Distinguishing epigenetic marks of developmental and imprinting regulation
Directory of Open Access Journals (Sweden)
McEwen Kirsten R
2010-01-01
Full Text Available Abstract Background The field of epigenetics is developing rapidly, however we are only beginning to comprehend the complexity of its influence on gene regulation. Using genomic imprinting as a model we examine epigenetic profiles associated with different forms of gene regulation. Imprinting refers to the expression of a gene from only one of the chromosome homologues in a parental-origin-specific manner. This is dependent on heritable germline epigenetic control at a cis-acting imprinting control region that influences local epigenetic states. Epigenetic modifications associated with imprinting regulation can be compared to those associated with the more canonical developmental regulation, important for processes such as differentiation and tissue specificity. Here we test the hypothesis that these two mechanisms are associated with different histone modification enrichment patterns. Results Using high-throughput data extraction with subsequent analysis, we have found that particular histone modifications are more likely to be associated with either imprinting repression or developmental repression of imprinted genes. H3K9me3 and H4K20me3 are together enriched at imprinted genes with differentially methylated promoters and do not show a correlation with developmental regulation. H3K27me3 and H3K4me3, however, are more often associated with developmental regulation. We find that imprinted genes are subject to developmental regulation through bivalency with H3K4me3 and H3K27me3 enrichment on the same allele. Furthermore, a specific tri-mark signature comprising H3K4me3, H3K9me3 and H4K20me3 has been identified at all imprinting control regions. Conclusion A large amount of data is produced from whole-genome expression and epigenetic profiling studies of cellular material. We have shown that such publicly available data can be mined and analysed in order to generate novel findings for categories of genes or regulatory elements. Comparing two
Directory of Open Access Journals (Sweden)
Fatma Kaplan
2011-03-01
Full Text Available The ascarosides form a family of small molecules that have been isolated from cultures of the nematode Caenorhabditis elegans. They are often referred to as "dauer pheromones" because most of them induce formation of long-lived and highly stress resistant dauer larvae. More recent studies have shown that ascarosides serve additional functions as social signals and mating pheromones. Thus, ascarosides have multiple functions. Until now, it has been generally assumed that ascarosides are constitutively expressed during nematode development.Cultures of C. elegans were developmentally synchronized on controlled diets. Ascarosides released into the media, as well as stored internally, were quantified by LC/MS. We found that ascaroside biosynthesis and release were strongly dependent on developmental stage and diet. The male attracting pheromone was verified to be a blend of at least four ascarosides, and peak production of the two most potent mating pheromone components, ascr#3 and asc#8 immediately preceded or coincided with the temporal window for mating. The concentration of ascr#2 increased under starvation conditions and peaked during dauer formation, strongly supporting ascr#2 as the main population density signal (dauer pheromone. After dauer formation, ascaroside production largely ceased and dauer larvae did not release any ascarosides. These findings show that both total ascaroside production and the relative proportions of individual ascarosides strongly correlate with these compounds' stage-specific biological functions.Ascaroside expression changes with development and environmental conditions. This is consistent with multiple functions of these signaling molecules. Knowledge of such differential regulation will make it possible to associate ascaroside production to gene expression profiles (transcript, protein or enzyme activity and help to determine genetic pathways that control ascaroside biosynthesis. In conjunction with findings
Kovacs, Maria; Lopez-Duran, Nestor L
2012-04-01
For this special issue about child and adolescent depression, the authors were asked to describe contextual emotion regulation therapy as an example of a developmentally informed psychosocial intervention. The article begins with the authors' definition of the elements that should comprise such an intervention. A succinct summary of this contextual emotion regulation therapy is then provided, including its explanatory paradigm of depression, followed by an exposition of how it addresses the various definitional criteria of a developmentally informed intervention. The article concludes with a brief overview of the challenges of implementing a developmentally sensitive psychotherapy for depressed children and adolescents.
Building strong bones: molecular regulation of the osteoblast lineage.
Long, Fanxin
2011-12-22
The past 15 years have witnessed tremendous progress in the molecular understanding of osteoblasts, the main bone-forming cells in the vertebrate skeleton. In particular, all of the major developmental signals (including WNT and Notch signalling), along with an increasing number of transcription factors (such as RUNX2 and osterix), have been shown to regulate the differentiation and/or function of osteoblasts. As evidence indicates that osteoblasts may also regulate the behaviour of other cell types, a clear understanding of the molecular identity and regulation of osteoblasts is important beyond the field of bone biology.
Developmental Regulation across the Life Span: Toward a New Synthesis
Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten
2013-01-01
How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…
Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas
2013-12-05
The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously
Mani, Muralidharan; Lee, Unn Hwa; Yoon, Nal Ae; Yoon, Eun Hye; Lee, Byung Ju; Cho, Wha Ja; Park, Jeong Woo
2017-11-04
Previously we have reported that developmentally regulated GTP-binding protein 2 (DRG2) localizes on Rab5 endosomes and plays an important role in transferrin (Tfn) recycling. We here identified DRG2 as a key regulator of membrane tubule stability. At 30 min after Tfn treatment, DRG2 localized to membrane tubules which were enriched with phosphatidylinositol 4-monophosphate [PI(4)P] and did not contain Rab5. DRG2 interacted with Rac1 more strongly with GTP-bound Rac1 and tubular localization of DRG2 depended on Rac1 activity. DRG2 depletion led to destabilization of membrane tubules, while ectopic expression of DRG2 rescued the stability of the membrane tubules in DRG2-depleted cells. Our results reveal a novel mechanism for regulation of membrane tubule stability mediated by DRG2. Copyright © 2017 Elsevier Inc. All rights reserved.
Zhu, Shaoyu; Eclarinal, Jesse; Baker, Maria S; Li, Ge; Waterland, Robert A
2016-02-01
Extensive human and animal model data show that environmental influences during critical periods of prenatal and early postnatal development can cause persistent alterations in energy balance regulation. Although a potentially important factor in the worldwide obesity epidemic, the fundamental mechanisms underlying such developmental programming of energy balance are poorly understood, limiting our ability to intervene. Most studies of developmental programming of energy balance have focused on persistent alterations in the regulation of energy intake; energy expenditure has been relatively underemphasised. In particular, very few studies have evaluated developmental programming of physical activity. The aim of this review is to summarise recent evidence that early environment may have a profound impact on establishment of individual propensity for physical activity. Recently, we characterised two different mouse models of developmental programming of obesity; one models fetal growth restriction followed by catch-up growth, and the other models early postnatal overnutrition. In both studies, we observed alterations in body-weight regulation that persisted to adulthood, but no group differences in food intake. Rather, in both cases, programming of energy balance appeared to be due to persistent alterations in energy expenditure and spontaneous physical activity (SPA). These effects were stronger in female offspring. We are currently exploring the hypothesis that developmental programming of SPA occurs via induced sex-specific alterations in epigenetic regulation in the hypothalamus and other regions of the central nervous system. We will summarise the current progress towards testing this hypothesis. Early environmental influences on establishment of physical activity are likely an important factor in developmental programming of energy balance. Understanding the fundamental underlying mechanisms in appropriate animal models will help determine whether early life
Directory of Open Access Journals (Sweden)
Jinyi Liu
Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.
Atrial natriuretic peptide regulates Ca channel in early developmental cardiomyocytes.
Directory of Open Access Journals (Sweden)
Lin Miao
Full Text Available BACKGROUND: Cardiomyocytes derived from murine embryonic stem (ES cells possess various membrane currents and signaling cascades link to that of embryonic hearts. The role of atrial natriuretic peptide (ANP in regulation of membrane potentials and Ca(2+ currents has not been investigated in developmental cardiomyocytes. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the role of ANP in regulating L-type Ca(2+ channel current (I(CaL in different developmental stages of cardiomyocytes derived from ES cells. ANP decreased the frequency of action potentials (APs in early developmental stage (EDS cardiomyocytes, embryonic bodies (EB as well as whole embryo hearts. ANP exerted an inhibitory effect on basal I(CaL in about 70% EDS cardiomyocytes tested but only in about 30% late developmental stage (LDS cells. However, after stimulation of I(CaL by isoproterenol (ISO in LDS cells, ANP inhibited the response in about 70% cells. The depression of I(CaL induced by ANP was not affected by either Nomega, Nitro-L-Arginine methyl ester (L-NAME, a nitric oxide synthetase (NOS inhibitor, or KT5823, a cGMP-dependent protein kinase (PKG selective inhibitor, in either EDS and LDS cells; whereas depression of I(CaL by ANP was entirely abolished by erythro-9-(2-Hydroxy-3-nonyl adenine (EHNA, a selective inhibitor of type 2 phosphodiesterase(PDE2 in most cells tested. CONCLUSION/SIGNIFICANCES: Taken together, these results indicate that ANP induced depression of action potentials and I(CaL is due to activation of particulate guanylyl cyclase (GC, cGMP production and cGMP-activation of PDE2 mediated depression of adenosine 3', 5'-cyclic monophophate (cAMP-cAMP-dependent protein kinase (PKA in early cardiomyogenesis.
Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis
Directory of Open Access Journals (Sweden)
Ishida Betty K
2003-08-01
Full Text Available Abstract Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion.
Directory of Open Access Journals (Sweden)
Perry Trinity L
2007-11-01
Full Text Available Abstract Background Heparan sulfate proteoglycans modulate signaling by a variety of growth factors. The mammalian proteoglycan Perlecan binds and regulates signaling by Sonic Hedgehog, Fibroblast Growth Factors (FGFs, Vascular Endothelial Growth Factor (VEGF and Platelet Derived Growth Factor (PDGF, among others, in contexts ranging from angiogenesis and cardiovascular development to cancer progression. The Drosophila Perlecan homolog trol has been shown to regulate the activity of Hedgehog and Branchless (an FGF homolog to control the onset of stem cell proliferation in the developing brain during first instar. Here we extend analysis of trol mutant phenotypes to show that trol is required for a variety of developmental events and modulates signaling by multiple growth factors in different situations. Results Different mutations in trol allow developmental progression to varying extents, suggesting that trol is involved in multiple cell-fate and patterning decisions. Analysis of the initiation of neuroblast proliferation at second instar demonstrated that trol regulates this event by modulating signaling by Hedgehog and Branchless, as it does during first instar. Trol protein is distributed over the surface of the larval brain, near the regulated neuroblasts that reside on the cortical surface. Mutations in trol also decrease the number of circulating plasmatocytes. This is likely to be due to decreased expression of pointed, the response gene for VEGF/PDGF signaling that is required for plasmatocyte proliferation. Trol is found on plasmatocytes, where it could regulate VEGF/PDGF signaling. Finally, we show that in second instar brains but not third instar brain lobes and eye discs, mutations in trol affect signaling by Decapentaplegic (a Transforming Growth Factor family member, Wingless (a Wnt growth factor and Hedgehog. Conclusion These studies extend the known functions of the Drosophila Perlecan homolog trol in both developmental and
de Oliveira, Rita F.; Wann, John P.
2011-01-01
In two experiments, we used an automatic car simulator to examine the steering control, speed regulation and response to hazards of young adults with developmental coordination disorder (DCD) and limited driving experience. In Experiment 1 participants either used the accelerator pedal to regulate their speed, or used the brake pedal when they…
DEFF Research Database (Denmark)
Thomas Danielsen, E.; E. Møller, Morten; Yamanaka, Naoki
2016-01-01
Steroid hormones control important developmental processes and are linked to many diseases. To systematically identify genes and pathways required for steroid production, we performed a Drosophila genome-wide in vivo RNAi screen and identified 1,906 genes with potential roles in steroidogenesis...... and developmental timing. Here, we use our screen as a resource to identify mechanisms regulating intracellular levels of cholesterol, a substrate for steroidogenesis. We identify a conserved fatty acid elongase that underlies a mechanism that adjusts cholesterol trafficking and steroidogenesis with nutrition...... and developmental programs. In addition, we demonstrate the existence of an autophagosomal cholesterol mobilization mechanism and show that activation of this system rescues Niemann-Pick type C1 deficiency that causes a disorder characterized by cholesterol accumulation. These cholesterol-trafficking mechanisms...
Let-7 microRNAs are developmentally regulated in circulating human erythroid cells
Directory of Open Access Journals (Sweden)
Reed Christopher
2009-11-01
Full Text Available Abstract Background MicroRNAs are ~22nt-long small non-coding RNAs that negatively regulate protein expression through mRNA degradation or translational repression in eukaryotic cells. Based upon their importance in regulating development and terminal differentiation in model systems, erythrocyte microRNA profiles were examined at birth and in adults to determine if changes in their abundance coincide with the developmental phenomenon of hemoglobin switching. Methods Expression profiling of microRNA was performed using total RNA from four adult peripheral blood samples compared to four cord blood samples after depletion of plasma, platelets, and nucleated cells. Labeled RNAs were hybridized to custom spotted arrays containing 474 human microRNA species (miRBase release 9.1. Total RNA from Epstein-Barr virus (EBV-transformed lymphoblastoid cell lines provided a hybridization reference for all samples to generate microRNA abundance profile for each sample. Results Among 206 detected miRNAs, 79% of the microRNAs were present at equivalent levels in both cord and adult cells. By comparison, 37 microRNAs were up-regulated and 4 microRNAs were down-regulated in adult erythroid cells (fold change > 2; p let-7 miRNA family consistently demonstrated increased abundance in the adult samples by array-based analyses that were confirmed by quantitative PCR (4.5 to 18.4 fold increases in 6 of 8 let-7 miRNA. Profiling studies of messenger RNA (mRNA in these cells additionally demonstrated down-regulation of ten let-7 target genes in the adult cells. Conclusion These data suggest that a consistent pattern of up-regulation among let-7 miRNA in circulating erythroid cells occurs in association with hemoglobin switching during the fetal-to-adult developmental transition in humans.
The ribonuclease Dis3 is an essential regulator of the developmental transcriptome
Directory of Open Access Journals (Sweden)
Hou Dezhi
2012-08-01
Full Text Available Abstract Background Dis3 is ribonuclease that acts directly in the processing, turnover, and surveillance of a large number of distinct RNA species. Evolutionarily conserved from eubacteria to eukaryotes and a crucial component of the RNA processing exosome, Dis3 has been shown to be essential in yeast and fly S2 cells. However, it is not known whether Dis3 has essential functions in a metazoan. This study inquires whether Dis3 is required for Drosophila development and viability and how Dis3 regulates the transcriptome in the developing fly. Results Using transgenic flies, we show that Dis3 knock down (Dis3KD retards growth, induces melanotic tumor formation, and ultimately results in 2nd instar larval lethality. In order to determine whether Dis3KD fly phenotypes were a consequence of disrupting developmentally regulated RNA turnover, we performed RNA deep sequencing analysis on total RNA isolated from developmentally staged animals. Bioinformatic analysis of transcripts from Dis3KD flies reveals substantial transcriptomic changes, most notably down-regulation in early expressed RNAs. Finally, gene ontology analysis of this early stage shows that Dis3 regulates transcripts related to extracellular structure and remodelling, neurogenesis, and nucleotide metabolism. Conclusions We conclude that Dis3 is essential for early Drosophila melanogaster development and has specific and important stage-specific roles in regulating RNA metabolism. In showing for the first time that Dis3 is required for the development of a multicellular organism, our work provides mechanistic insight into how Dis3—either independent of or associated with the RNA processing exosome—participates in cell type-specific RNA turnover in metazoan development.
Rankin, Scott A; McCracken, Kyle W; Luedeke, David M; Han, Lu; Wells, James M; Shannon, John M; Zorn, Aaron M
2018-02-01
A small number of signaling pathways are used repeatedly during organogenesis, and they can have drastically different effects on the same population of cells depending on the embryonic stage. How cellular competence changes over developmental time is not well understood. Here we used Xenopus, mouse, and human pluripotent stem cells to investigate how the temporal sequence of Wnt, BMP, and retinoic acid (RA) signals regulates endoderm developmental competence and organ induction, focusing on respiratory fate. While Nkx2-1+ lung fate is not induced until late somitogenesis stages, here we show that lung competence is restricted by the gastrula stage as a result of Wnt and BMP-dependent anterior-posterior (A-P) patterning. These early Wnt and BMP signals make posterior endoderm refractory to subsequent RA/Wnt/BMP-dependent lung induction. We further mapped how RA modulates the response to Wnt and BMP in a temporal specific manner. In the gastrula RA promotes posterior identity, however in early somite stages of development RA regulates respiratory versus pharyngeal potential in anterior endoderm and midgut versus hindgut potential in posterior endoderm. Together our data suggest a dynamic and conserved response of vertebrate endoderm during organogenesis, wherein early Wnt/BMP/RA impacts how cells respond to later Wnt/BMP/RA signals, illustrating how reiterative combinatorial signaling can regulate both developmental competence and subsequent fate specification. Copyright © 2017 Elsevier Inc. All rights reserved.
Sugliani, M.; Brambilla, V.; Clerkx, E.J.M.; Koornneef, M.; Soppe, W.J.J.
2010-01-01
ABSCISIC ACID INSENSITIVE3 (ABI3) is a major regulator of seed maturation in Arabidopsis thaliana. We detected two ABI3 transcripts, ABI3- and ABI3-ß, which encode full-length and truncated proteins, respectively. Alternative splicing of ABI3 is developmentally regulated, and the ABI3-ß transcript
A method for regulating strong nonlinear vibration energy of the flexible arm
Directory of Open Access Journals (Sweden)
Yushu Bian
2015-07-01
Full Text Available For an oscillating system, large amplitude indicates strong vibration energy. In this article, modal interaction is used as a useful means to regulate strong nonlinear vibration energy of the flexible arm undergoing rigid motion. A method is put forward to migrate and dissipate vibration energy based on modal interaction. By means of multiple-scale perturbation analysis, it is proven that internal resonance can be successfully established between modes of the flexible arm and the vibration absorber. Through examples and analyses, it is verified that this control method is effective in regulating strong vibration energy and can be used to suppress strong nonlinear vibration of the flexible arm undergoing rigid motion.
Schilling, Oliver K.; Wahl, Hans-Werner; Boerner, Kathrin; Horowitz, Amy; Reinhardt, Joann P.; Cimarolli, Verena R.; Brennan-Ing, Mark; Heckhausen, Jutta
2016-01-01
The present study addresses older adults' developmental regulation when faced with progressive and irreversible vision loss. We used the motivational theory of life span development as a conceptual framework and examined changes in older adults' striving for control over everyday goal achievement, and their association with affective well-being,…
Developmental instability: measures of resistance and resilience using pumpkin (Cucurbita pepo L.)
Freeman, D. Carl; Brown, Michelle L.; Dobson, Melissa; Jordan, Yolanda; Kizy, Anne; Micallef, Chris; Hancock, Leandria C.; Graham, John H.; Emlen, John M.
2003-01-01
Fluctuating asymmetry measures random deviations from bilateral symmetry, and thus estimates developmental instability, the loss of ability by an organism to regulate its development. There have been few rigorous tests of this proposition. Regulation of bilateral symmetry must involve either feedback between the sides or independent regulation toward a symmetric set point. Either kind of regulation should decrease asymmetry over time, but only right–left feedback produces compensatory growth across sides, seen as antipersistent growth following perturbation. Here, we describe the developmental trajectories of perturbed and unperturbed leaves of pumpkin, Cucurbita pepoL., grown at three densities. Covering one side of a leaf with aluminium foil for 24 h perturbed leaf growth. Reduced growth on the perturbed side caused leaves to become more asymmetrical than unperturbed controls. After the treatment the size-corrected asymmetry decreased over time. In addition, rescaled range analysis showed that asymmetry was antipersistent rather than random, i.e. fluctuation in one direction was likely to be followed by fluctuations in the opposite direction. Development involves right–left feedback. This feedback reduced size-corrected asymmetry over time most strongly in the lowest density treatment suggesting that developmental instability results from a lack of resilience rather than resistance.
Developmental Science: Past, Present, and Future
Lerner, Richard M.
2012-01-01
The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…
Keller, Heidi; Yovsi, Relindis; Borke, Joern; Kärtner, Joscha; Jensen, Henning; Papaligoura, Zaira
2004-01-01
This study relates parenting of 3-month-old children to children's self-recognition and self-regulation at 18 to 20 months. As hypothesized, observational data revealed differences in the sociocultural orientations of the 3 cultural samples' parenting styles and in toddlers' development of self-recognition and self-regulation. Children of Cameroonian Nso farmers who experience a proximal parenting style develop self-regulation earlier, children of Greek urban middle-class families who experience a distal parenting style develop self-recognition earlier, and children of Costa Rican middle-class families who experience aspects of both distal and proximal parenting styles fall between the other 2 groups on both self-regulation and self-recognition. Results are discussed with respect to their implications for culturally informed developmental pathways.
Directory of Open Access Journals (Sweden)
Mohammed Alsaweed
2015-10-01
Full Text Available Human milk (HM is the optimal source of nutrition, protection and developmental programming for infants. It is species-specific and consists of various bioactive components, including microRNAs, small non-coding RNAs regulating gene expression at the post-transcriptional level. microRNAs are both intra- and extra-cellular and are present in body fluids of humans and animals. Of these body fluids, HM appears to be one of the richest sources of microRNA, which are highly conserved in its different fractions, with milk cells containing more microRNAs than milk lipids, followed by skim milk. Potential effects of exogenous food-derived microRNAs on gene expression have been demonstrated, together with the stability of milk-derived microRNAs in the gastrointestinal tract. Taken together, these strongly support the notion that milk microRNAs enter the systemic circulation of the HM fed infant and exert tissue-specific immunoprotective and developmental functions. This has initiated intensive research on the origin, fate and functional significance of milk microRNAs. Importantly, recent studies have provided evidence of endogenous synthesis of HM microRNA within the human lactating mammary epithelium. These findings will now form the basis for investigations of the role of microRNA in the epigenetic control of normal and aberrant mammary development, and particularly lactation performance.
Jansen, Peter A.; Watter, Scott
2012-03-01
Connectionist language modelling typically has difficulty with syntactic systematicity, or the ability to generalise language learning to untrained sentences. This work develops an unsupervised connectionist model of infant grammar learning. Following the semantic boostrapping hypothesis, the network distils word category using a developmentally plausible infant-scale database of grounded sensorimotor conceptual representations, as well as a biologically plausible semantic co-occurrence activation function. The network then uses this knowledge to acquire an early benchmark clausal grammar using correlational learning, and further acquires separate conceptual and grammatical category representations. The network displays strongly systematic behaviour indicative of the general acquisition of the combinatorial systematicity present in the grounded infant-scale language stream, outperforms previous contemporary models that contain primarily noun and verb word categories, and successfully generalises broadly to novel untrained sensorimotor grounded sentences composed of unfamiliar nouns and verbs. Limitations as well as implications to later grammar learning are discussed.
A co-expression gene network associated with developmental regulation of apple fruit acidity.
Bai, Yang; Dougherty, Laura; Cheng, Lailiang; Xu, Kenong
2015-08-01
Apple fruit acidity, which affects the fruit's overall taste and flavor to a large extent, is primarily determined by the concentration of malic acid. Previous studies demonstrated that the major QTL malic acid (Ma) on chromosome 16 is largely responsible for fruit acidity variations in apple. Recent advances suggested that a natural mutation that gives rise to a premature stop codon in one of the two aluminum-activated malate transporter (ALMT)-like genes (called Ma1) is the genetic causal element underlying Ma. However, the natural mutation does not explain the developmental changes of fruit malate levels in a given genotype. Using RNA-seq data from the fruit of 'Golden Delicious' taken at 14 developmental stages from 1 week after full-bloom (WAF01) to harvest (WAF20), we characterized their transcriptomes in groups of high (12.2 ± 1.6 mg/g fw, WAF03-WAF08), mid (7.4 ± 0.5 mg/g fw, WAF01-WAF02 and WAF10-WAF14) and low (5.4 ± 0.4 mg/g fw, WAF16-WAF20) malate concentrations. Detailed analyses showed that a set of 3,066 genes (including Ma1) were expressed not only differentially (P FDR < 0.05) between the high and low malate groups (or between the early and late developmental stages) but also in significant (P < 0.05) correlation with malate concentrations. The 3,066 genes fell in 648 MapMan (sub-) bins or functional classes, and 19 of them were significantly (P FDR < 0.05) co-enriched or co-suppressed in a malate dependent manner. Network inferring using the 363 genes encompassed in the 19 (sub-) bins, identified a major co-expression network of 239 genes. Since the 239 genes were also differentially expressed between the early (WAF03-WAF08) and late (WAF16-WAF20) developmental stages, the major network was considered to be associated with developmental regulation of apple fruit acidity in 'Golden Delicious'.
Stiles, Kari A; Van Volkenburgh, Elizabeth
2002-07-01
Leaf growth responses to light have been compared in two species of Populus, P. deltoides and P. trichocarpa. These species differ markedly in morphology, anatomy, and dependence on light during leaf expansion. Light stimulates the growth rate and acidification of cell walls in P. trichocarpa but not in P. deltoides, whereas leaves of P. deltoides maintain growth in the dark. Light-induced growth is promoted in P. deltoides when cells are provided 50-100 mM KCl. In both species, light initially depolarizes, then hyperpolarizes mesophyll plasma membranes. However, in the dark, the resting E(m) of mesophyll cells in P. deltoides, but not in P. trichocarpa, is relatively insensitive to decade changes in external [K+]. Results suggest that light-stimulated leaf growth depends on developmentally regulated cellular mechanisms controlling ion fluxes across the plasma membrane. These developmental differences underlie species-level differences in growth and physiological responses to the photoenvironment.
Developmental delays in emotion regulation strategies in preschoolers with autism.
Nuske, Heather J; Hedley, Darren; Woollacott, Alexandra; Thomson, Phoebe; Macari, Suzanne; Dissanayake, Cheryl
2017-11-01
Children with autism spectrum disorder (ASD) commonly present with difficulty regulating negative emotions, which has been found to impact their behavioral and mental health. Little research has documented the strategies that children with ASD use to regulate their emotion to understand whether they use qualitatively different strategies to children without ASD, whether these are developmentally delayed, or both. Forty-four children with ASD and 29 typically-developing children (2-4 years) were given tasks designed to mimic everyday life experiences requiring children to manage low-level stress (e.g., waiting for a snack) and children's emotion regulation strategies were coded. Parents reported on their child's mental health, wellbeing, and self-development. The results suggest differences in using emotion regulation strategies in children with ASD, reflecting a delay, rather than a deviance when compared to those used by children without ASD. Only children with ASD relied on their family members for physical and communicative soothing; the typically developing children relied on people outside of their family for help regulating their emotion. More frequent approach/less frequent avoidance was related to a higher self-evaluation in both groups, but was only additionally related to higher self-recognition and autonomy in the ASD group. These findings help to identify important emotion regulation intervention targets for this population, including supporting communication with people outside of the family and independence. Autism Res 2017, 10: 1808-1822. © 2017 International Society for Autism Research, Wiley Periodicals, Inc. Results suggest that children with autism had more difficulty using communication strategies to manage stress only with people outside the family; they used these strategies with family members as often as children without autism. For all children, more task approach/less avoidance was related to children's higher self-evaluation. These
Directory of Open Access Journals (Sweden)
Jenkins Dafyd J
2008-01-01
Full Text Available Abstract Background Many prokaryotic transcription factors repress their own transcription. It is often asserted that such regulation enables a cell to homeostatically maintain protein abundance. We explore the role of negative self regulation of transcription in regulating the variability of protein abundance using a variety of stochastic modeling techniques. Results We undertake a novel analysis of a classic model for negative self regulation. We demonstrate that, with standard approximations, protein variance relative to its mean should be independent of repressor strength in a physiological range. Consequently, in that range, the coefficient of variation would increase with repressor strength. However, stochastic computer simulations demonstrate that there is a greater increase in noise associated with strong repressors than predicted by theory. The discrepancies between the mathematical analysis and computer simulations arise because with strong repressors the approximation that leads to Michaelis-Menten-like hyperbolic repression terms ceases to be valid. Because we observe that strong negative feedback increases variability and so is unlikely to be a mechanism for noise control, we suggest instead that negative feedback is evolutionarily favoured because it allows the cell to minimize mRNA usage. To test this, we used in silico evolution to demonstrate that while negative feedback can achieve only a modest improvement in protein noise reduction compared with the unregulated system, it can achieve good improvement in protein response times and very substantial improvement in reducing mRNA levels. Conclusion Strong negative self regulation of transcription may not always be a mechanism for homeostatic control of protein abundance, but instead might be evolutionarily favoured as a mechanism to limit the use of mRNA. The use of hyperbolic terms derived from quasi-steady-state approximation should also be avoided in the analysis of stochastic
A single cis element maintains repression of the key developmental regulator Gata2.
Directory of Open Access Journals (Sweden)
Jonathan W Snow
2010-09-01
Full Text Available In development, lineage-restricted transcription factors simultaneously promote differentiation while repressing alternative fates. Molecular dissection of this process has been challenging as transcription factor loci are regulated by many trans-acting factors functioning through dispersed cis elements. It is not understood whether these elements function collectively to confer transcriptional regulation, or individually to control specific aspects of activation or repression, such as initiation versus maintenance. Here, we have analyzed cis element regulation of the critical hematopoietic factor Gata2, which is expressed in early precursors and repressed as GATA-1 levels rise during terminal differentiation. We engineered mice lacking a single cis element -1.8 kb upstream of the Gata2 transcriptional start site. Although Gata2 is normally repressed in late-stage erythroblasts, the -1.8 kb mutation unexpectedly resulted in reactivated Gata2 transcription, blocked differentiation, and an aberrant lineage-specific gene expression pattern. Our findings demonstrate that the -1.8 kb site selectively maintains repression, confers a specific histone modification pattern and expels RNA Polymerase II from the locus. These studies reveal how an individual cis element establishes a normal developmental program via regulating specific steps in the mechanism by which a critical transcription factor is repressed.
2014-12-18
Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera: Culicidae): developmental regulation and environmental response...7205 Email lmzhao@ufl.edu Abstract: The cDNA of a NADH dehydrogenase-ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus...information useful for developing dsRNA pesticide for mosquito control. Keywords: Aedes taeniorhynchus, AetNDUFS8, mRNA expression, development
Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.
Directory of Open Access Journals (Sweden)
Anupama Khare
2010-02-01
Full Text Available The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC, a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.
Cheating by Exploitation of Developmental Prestalk Patterning in Dictyostelium discoideum
Khare, Anupama; Shaulsky, Gad
2010-01-01
The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters—strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510
Developmental regulation of voltage-sensitive sodium channels in rat skeletal muscle
International Nuclear Information System (INIS)
Sherman, S.J.
1985-01-01
The developmental regulation of the voltage-sensitive Na + channel in rat skeletal muscle was studied in vivo and in vitro. In triceps surae muscle developing in vivo the development of TTX-sensitive Na + channel occurred primarily during the first three postnatal weeks as determined by the specific binding of [ 3 H]saxitoxin. This development proceeded in two separate phases. The first phase occurs independently of continuing motor neuron innervation and accounts for 60% of the adult density of TTX-sensitive Na + channels. The second phase, which begins about day 11, requires innervation. Muscle cells in primary culture were found to have both TTX-sensitive and insensitive Na + channels. The development of the TTX-sensitive channel, in vitro, paralleled the initial innervation-independent phase of development observed in vivo. The density of TTX-sensitive Na + channels in cultured muscle cells was regulated by electrical activity and cytosolic Ca ++ levels. Pharmacological blockade of the spontaneous electrical activity present in these cells lead to a nearly 2-fold increase in the surface density of TTX-sensitive channels. The turnover time of the TTX-sensitive Na + channel was measured by blocking the incorporation of newly synthesized channels with tunicamycin, an inhibitor of N-linked protein glycosylation. The regulation of channel density by electrical activity, cytosolic Ca ++ levels, and agents affecting cyclic neucleotide levels had no effect on the turnover time of the TTX-sensitive Na + channel, indicating that these regulatory agents instead affect the synthesis of the channel
Krzyczmonik, Katarzyna; Wroblewska-Swiniarska, Agata; Swiezewski, Szymon
2017-07-03
Transcription terminators are DNA elements located at the 3' end of genes that ensure efficient cleavage of nascent RNA generating the 3' end of mRNA, as well as facilitating disengagement of elongating DNA-dependent RNA polymerase II. Surprisingly, terminators are also a potent source of antisense transcription. We have recently described an Arabidopsis antisense transcript originating from the 3' end of a master regulator of Arabidopsis thaliana seed dormancy DOG1. In this review, we discuss the broader implications of our discovery in light of recent developments in yeast and Arabidopsis. We show that, surprisingly, the key features of terminators that give rise to antisense transcription are preserved between Arabidopsis and yeast, suggesting a conserved mechanism. We also compare our discovery to known antisense-based regulatory mechanisms, highlighting the link between antisense-based gene expression regulation and major developmental transitions in plants.
Schaub, Michael; Jakober, Hans; Stauber, Wolfgang
2013-08-01
A mechanistic understanding of the dynamics of populations requires knowledge about the variation of the underlying demographic rates and about the reasons for their variability. In geographically open populations, immigration is often necessary to prevent declines, but little is known about whether immigration can contribute to its regulation. We studied the dynamics of a Red-backed Shrike population (Lanius collurio) over 36 years in Germany with a Bayesian integrated population model. We estimated mean and temporal variability of population sizes, productivity, apparent survival, and immigration. We assessed how strongly the demographic rates were correlated with population growth to understand the demographic reasons of population change and how strongly the demographic rates were correlated with population size to identify possible density-dependent mechanisms. The shrike population varied between 35 and 74 breeding pairs but did not show a significant trend in population size over time (growth rate 1.002 +/- 0.001 [mean +/- SD]). Apparent survival of females (juveniles 0.06 +/- 0.01; adults 0.37 +/- 0.03) was lower than that of males (juveniles 0.10 +/- 0.01; adults 0.44 +/- 0.02). Immigration rates were substantial and higher in females (0.56 +/- 0.02) than in males (0.43 +/- 0.02), and average productivity was 2.76 +/- 0.14. Without immigration, the Red-backed Shrike population would have declined strongly. Immigration was the strongest driver for the number of females while local recruitment was the most important driver for the number of males. Immigration of both sexes and productivity, but not local recruitment and survival, were subject to density dependence. Density-dependent productivity was not effectively regulating the local population but may have contributed to regulate shrike populations at larger spatial scales. These findings suggest that immigration is not only an important component to prevent a geographically open population from decline
Developmental changes in the metabolic network of snapdragon flowers.
Directory of Open Access Journals (Sweden)
Joëlle K Muhlemann
Full Text Available Evolutionary and reproductive success of angiosperms, the most diverse group of land plants, relies on visual and olfactory cues for pollinator attraction. Previous work has focused on elucidating the developmental regulation of pathways leading to the formation of pollinator-attracting secondary metabolites such as scent compounds and flower pigments. However, to date little is known about how flowers control their entire metabolic network to achieve the highly regulated production of metabolites attracting pollinators. Integrative analysis of transcripts and metabolites in snapdragon sepals and petals over flower development performed in this study revealed a profound developmental remodeling of gene expression and metabolite profiles in petals, but not in sepals. Genes up-regulated during petal development were enriched in functions related to secondary metabolism, fatty acid catabolism, and amino acid transport, whereas down-regulated genes were enriched in processes involved in cell growth, cell wall formation, and fatty acid biosynthesis. The levels of transcripts and metabolites in pathways leading to scent formation were coordinately up-regulated during petal development, implying transcriptional induction of metabolic pathways preceding scent formation. Developmental gene expression patterns in the pathways involved in scent production were different from those of glycolysis and the pentose phosphate pathway, highlighting distinct developmental regulation of secondary metabolism and primary metabolic pathways feeding into it.
Nolte, Tobias; Guiney, Jo; Fonagy, Peter; Mayes, Linda C.; Luyten, Patrick
2011-01-01
Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the etiology and maintenance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework. The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety, and activation of the attachment system. This interplay directly affects the development of social–cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualized as the key organizer of a complex interplay between genetic, environmental, and epigenetic contributions to the development of anxiety disorders – a multifactorial etiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterized by hyperactivation strategies in the face of anxiety. The cumulative allostatic load and subsequent “wear and tear” effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments are outlined. PMID
DAF-12 Regulates a Connected Network of Genes to Ensure Robust Developmental Decisions
Stuckenholz, Carsten; Labhart, Paul; Alexiadis, Vassili; Martin, René; Knölker, Hans-Joachim; Fisher, Alfred L.
2011-01-01
The nuclear receptor DAF-12 has roles in normal development, the decision to pursue dauer development in unfavorable conditions, and the modulation of adult aging. Despite the biologic importance of DAF-12, target genes for this receptor are largely unknown. To identify DAF-12 targets, we performed chromatin immunoprecipitation followed by hybridization to whole-genome tiling arrays. We identified 1,175 genomic regions to be bound in vivo by DAF-12, and these regions are enriched in known DAF-12 binding motifs and act as DAF-12 response elements in transfected cells and in transgenic worms. The DAF-12 target genes near these binding sites include an extensive network of interconnected heterochronic and microRNA genes. We also identify the genes encoding components of the miRISC, which is required for the control of target genes by microRNA, as a target of DAF-12 regulation. During reproductive development, many of these target genes are misregulated in daf-12(0) mutants, but this only infrequently results in developmental phenotypes. In contrast, we and others have found that null daf-12 mutations enhance the phenotypes of many miRISC and heterochronic target genes. We also find that environmental fluctuations significantly strengthen the weak heterochronic phenotypes of null daf-12 alleles. During diapause, DAF-12 represses the expression of many heterochronic and miRISC target genes, and prior work has demonstrated that dauer formation can suppress the heterochronic phenotypes of many of these target genes in post-dauer development. Together these data are consistent with daf-12 acting to ensure developmental robustness by committing the animal to adult or dauer developmental programs despite variable internal or external conditions. PMID:21814518
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Yoo, B C; Aoki, K; Xiang, Y; Campbell, L R; Hull, R J; Xoconostle-Cázares, B; Monzer, J; Lee, J Y; Ullman, D E; Lucas, W J
2000-11-10
We report on the molecular, biochemical, and functional characterization of Cucurbita maxima phloem serpin-1 (CmPS-1), a novel 42-kDa serine proteinase inhibitor that is developmentally regulated and has anti-elastase properties. CmPS-1 was purified to near homogeneity from C. maxima (pumpkin) phloem exudate and, based on microsequence analysis, the cDNA encoding CmPS-1 was cloned. The association rate constant (k(a)) of phloem-purified and recombinant His(6)-tagged CmPS-1 for elastase was 3.5 +/- 1.6 x 10(5) and 2.7 +/- 0.4 x 10(5) m(-)(1) s(-)(1), respectively. The fraction of complex-forming CmPS-1, X(inh), was estimated at 79%. CmPS-1 displayed no detectable inhibitory properties against chymotrypsin, trypsin, or thrombin. The elastase cleavage sites within the reactive center loop of CmPS-1 were determined to be Val(347)-Gly(348) and Val(350)-Ser(351) with a 3:2 molar ratio. In vivo feeding assays conducted with the piercing-sucking aphid, Myzus persicae, established a close correlation between the developmentally regulated increase in CmPS-1 within the phloem sap and the reduced ability of these insects to survive and reproduce on C. maxima. However, in vitro feeding experiments, using purified phloem CmPS-1, failed to demonstrate a direct effect on aphid survival. Likely roles of this novel phloem serpin in defense against insects/pathogens are discussed.
Mustn1: A Developmentally Regulated Pan-Musculoskeletal Cell Marker and Regulatory Gene
Directory of Open Access Journals (Sweden)
Michael Hadjiargyrou
2018-01-01
Full Text Available The Mustn1 gene encodes a small nuclear protein (~9.6 kDa that does not belong to any known family. Its genomic organization consists of three exons interspersed by two introns and it is highly homologous across vertebrate species. Promoter analyses revealed that its expression is regulated by the AP family of transcription factors, especially c-Fos, Fra-2 and JunD. Mustn1 is predominantly expressed in the major tissues of the musculoskeletal system: bone, cartilage, skeletal muscle and tendon. Its expression has been associated with normal embryonic development, postnatal growth, exercise, and regeneration of bone and skeletal muscle. Moreover, its expression has also been detected in various musculoskeletal pathologies, including arthritis, Duchenne muscular dystrophy, other skeletal muscle myopathies, clubfoot and diabetes associated muscle pathology. In vitro and in vivo functional perturbation revealed that Mustn1 is a key regulatory molecule in myogenic and chondrogenic lineages. This comprehensive review summarizes our current knowledge of Mustn1 and proposes that it is a new developmentally regulated pan-musculoskeletal marker as well as a key regulatory protein for cell differentiation and tissue growth.
CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes
Directory of Open Access Journals (Sweden)
Chao Yu
2017-08-01
Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.
Directory of Open Access Journals (Sweden)
Tobias eNolte
2011-09-01
Full Text Available Anxiety disorders represent a common but often debilitating form of psychopathology in both children and adults. While there is a growing understanding of the aetiology and maintainance of these disorders across various research domains, only recently have integrative accounts been proposed. While classical attachment history has been a traditional core construct in psychological models of anxiety, contemporary attachment theory has the potential to integrate neurobiological and behavioral findings within a multidisciplinary developmental framework.The current paper proposes a modern attachment theory-based developmental model grounded in relevant literature from multiple disciplines including social neuroscience, genetics, neuroendocrinology, and the study of family factors involved in the development of anxiety disorders. Recent accounts of stress regulation have highlighted the interplay between stress, anxiety and activation of the attachment system. This interplay directly affects the development of social cognitive and mentalizing capacities that are acquired in the interpersonal context of early attachment relationships. Early attachment experiences are conceptualised as the key organiser of a complex interplay between genetic, environmental and epigentic contributions to the development of anxiety disorders – a multifactorial aetiology resulting from dysfunctional co-regulation of fear and stress states. These risk-conferring processes are characterised by hyperactivation strategies in the face of anxiety.In the model, the cumulative allostatic load and subsequent wear and tear effects associated with hyperactivation strategies converge on the neural pathways of anxiety and stress. Attachment experiences further influence the development of anxiety as potential moderators of risk factors, differentially impacting on genetic vulnerability and relevant neurobiological pathways. Implications for further research and potential treatments
Manikkam, Mohan; Thompson, Robert C; Herkimer, Carol; Welch, Kathleen B; Flak, Jonathan; Karsch, Fred J; Padmanabhan, Vasantha
2008-04-01
The goal of this study was to explore mechanisms that mediate hypersecretion of LH and progressive loss of cyclicity in female sheep exposed during fetal life to excess testosterone. Our working hypothesis was that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH (but not FSH) secretion and, thus, hypersecretion of LH in adulthood, and that this results from altered developmental gene expression of GnRH and estradiol (E2) receptors, gonadotropin subunits, and paracrine factors that differentially regulate LH and FSH synthesis. We observed that, relative to controls, females exposed during fetal life to excess testosterone, as well as the nor-aromatizable androgen dihydrotestosterone, exhibited enhanced LH but not FSH responses to intermittent delivery of GnRH boluses under conditions in which endogenous LH (GnRH) pulses were suppressed. Luteinizing hormone hypersecretion was more evident in adults than in prepubertal females, and it was associated with development of acyclicity. Measurement of pituitary mRNA concentrations revealed that prenatal testosterone excess induced developmental changes in gene expression of pituitary GnRH and E2 receptors and paracrine modulators of LH and FSH synthesis in a manner consistent with subsequent amplification of LH release. Together, this series of studies suggests that prenatal testosterone excess, by its androgenic action, amplifies GnRH-induced LH response, leading to LH hypersecretion and acyclicity in adulthood, and that this programming involves developmental changes in expression of pituitary genes involved in LH and FSH release.
Developmentally regulated expression and complex processing of barley pri-microRNAs
Directory of Open Access Journals (Sweden)
Kruszka Katarzyna
2013-01-01
Full Text Available Abstract Background MicroRNAs (miRNAs regulate gene expression via mRNA cleavage or translation inhibition. In spite of barley being a cereal of great economic importance, very little data is available concerning its miRNA biogenesis. There are 69 barley miRNA and 67 pre-miRNA sequences available in the miRBase (release 19. However, no barley pri-miRNA and MIR gene structures have been shown experimentally. In the present paper, we examine the biogenesis of selected barley miRNAs and the developmental regulation of their pri-miRNA processing to learn more about miRNA maturation in barely. Results To investigate the organization of barley microRNA genes, nine microRNAs - 156g, 159b, 166n, 168a-5p/168a-3p, 171e, 397b-3p, 1120, and 1126 - were selected. Two of the studied miRNAs originate from one MIR168a-5p/168a-3p gene. The presence of all miRNAs was confirmed using a Northern blot approach. The miRNAs are encoded by genes with diverse organizations, representing mostly independent transcription units with or without introns. The intron-containing miRNA transcripts undergo complex splicing events to generate various spliced isoforms. We identified miRNAs that were encoded within introns of the noncoding genes MIR156g and MIR1126. Interestingly, the intron that encodes miR156g is spliced less efficiently than the intron encoding miR1126 from their specific precursors. miR397b-3p was detected in barley as a most probable functional miRNA, in contrast to rice where it has been identified as a complementary partner miRNA*. In the case of miR168a-5p/168a-3p, we found the generation of stable, mature molecules from both pre-miRNA arms, confirming evolutionary conservation of the stability of both species, as shown in rice and maize. We suggest that miR1120, located within the 3′ UTR of a protein-coding gene and described as a functional miRNA in wheat, may represent a siRNA generated from a mariner-like transposable element. Conclusions Seven of the
Directory of Open Access Journals (Sweden)
Taisuke Yoneda
Full Text Available The mammalian visual system exhibits significant experience-induced plasticity in the early postnatal period. While physiological studies have revealed the contribution of the CB1 cannabinoid receptor (CB1 to developmental plasticity in the primary visual cortex (V1, it remains unknown whether the expression and localization of CB1 is regulated during development or by visual experience. To explore a possible role of the endocannabinoid system in visual cortical plasticity, we examined the expression of CB1 in the visual cortex of mice. We found intense CB1 immunoreactivity in layers II/III and VI. CB1 mainly localized at vesicular GABA transporter-positive inhibitory nerve terminals. The amount of CB1 protein increased throughout development, and the specific laminar pattern of CB1 appeared at P20 and remained until adulthood. Dark rearing from birth to P30 decreased the amount of CB1 protein in V1 and altered the synaptic localization of CB1 in the deep layer. Dark rearing until P50, however, did not influence the expression of CB1. Brief monocular deprivation for 2 days upregulated the localization of CB1 at inhibitory nerve terminals in the deep layer. Taken together, the expression and the localization of CB1 are developmentally regulated, and both parameters are influenced by visual experience.
Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.
Huang, Tao; Ma, Liqun; Krimm, Robin F
2015-09-15
The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.
Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation
Huang, Tao; Ma, Liqun; Krimm, Robin F
2015-01-01
The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656
Itakura, Shoji
The ability to mentalize is essential for human socialization. Such ability is strongly related to communication. In this paper, I discuss the development of mentalizing and communication from the perspectives of a new idea, Developmental Cybernetics, and developmental cognitive neuroscience. Children only attributed intention to a robot when they saw it behaving as a human and displaying social signals such as eye gaze. The emergence of powerful new methods and tools, such as neuroimaging, now allows questions about mentalizing to resolved more directly than before.
On the developmental and environmental regulation of secondary metabolism in Vaccinium spp. berries
Directory of Open Access Journals (Sweden)
Katja eKarppinen
2016-05-01
Full Text Available Secondary metabolites have important defense and signaling roles, and they contribute to the overall quality of developing and ripening fruits. Blueberries, bilberries, cranberries and other Vaccinium berries are fleshy berry fruits recognized for the high levels of bioactive compounds, especially anthocyanin pigments. Besides anthocyanins and other products of the phenylpropanoid and flavonoid pathways, these berries also contain other metabolites of interest, such as carotenoid derivatives, vitamins and flavor compounds. Recently, new information has been achieved on the mechanisms related with developmental, environmental and genetic factors involved in the regulation of secondary metabolism in Vaccinium fruits. Especially light conditions and temperature are demonstrated to have a prominent role on the composition of phenolic compounds. The present review focuses on the studies on mechanisms associated with the regulation of key secondary metabolites, mainly phenolic compounds, in Vaccinium berries. The advances in the research concerning biosynthesis of phenolic compounds in Vaccinium species, including specific studies with mutant genotypes in addition to controlled and field experiments on the genotype x environment (GxE interaction, are discussed. The recently published Vaccinium transcriptome and genome databases provide new tools for the studies on the metabolic routes.
Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2005-04-01
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.
Ecdysone Control of Developmental Transitions
DEFF Research Database (Denmark)
Rewitz, Kim; Yamanaka, Naoki; O'Connor, Michael B.
2013-01-01
The steroid hormone ecdysone is the central regulator of insect developmental transitions. Recent new advances in our understanding of ecdysone action have relied heavily on the application of Drosophila melanogaster molecular genetic tools to study insect metamorphosis. In this review, we focus...... on three major aspects of Drosophila ecdysone biology: (a) factors that regulate the timing of ecdysone release, (b) molecular basis of stage- and tissue-specific responses to ecdysone, and (c) feedback regulation and coordination of ecdysone signaling....
Developmental model of static allometry in holometabolous insects.
Shingleton, Alexander W; Mirth, Christen K; Bates, Peter W
2008-08-22
The regulation of static allometry is a fundamental developmental process, yet little is understood of the mechanisms that ensure organs scale correctly across a range of body sizes. Recent studies have revealed the physiological and genetic mechanisms that control nutritional variation in the final body and organ size in holometabolous insects. The implications these mechanisms have for the regulation of static allometry is, however, unknown. Here, we formulate a mathematical description of the nutritional control of body and organ size in Drosophila melanogaster and use it to explore how the developmental regulators of size influence static allometry. The model suggests that the slope of nutritional static allometries, the 'allometric coefficient', is controlled by the relative sensitivity of an organ's growth rate to changes in nutrition, and the relative duration of development when nutrition affects an organ's final size. The model also predicts that, in order to maintain correct scaling, sensitivity to changes in nutrition varies among organs, and within organs through time. We present experimental data that support these predictions. By revealing how specific physiological and genetic regulators of size influence allometry, the model serves to identify developmental processes upon which evolution may act to alter scaling relationships.
Heppard, E P; Kinney, A J; Stecca, K L; Miao, G H
1996-01-01
The polyunsaturated fatty acid content is one of the major factors influencing the quality of vegetable oils. Edible oils rich in monounsaturated fatty acid provide improved oil stability, flavor, and nutrition for human and animal consumption. In plants, the microsomal omega-6 desaturase-catalyzed pathway is the primary route of production of polyunsaturated lipids. We report the isolation of two different cDNA sequences, FAD2-1 and FAD2-2, encoding microsomal omega-6 desaturase in soybeans and the characterization of their developmental and temperature regulation. The FAD2-1 gene is strongly expressed in developing seeds, whereas the FAD2-2 gene is constitutively expressed in both vegetative tissues and developing seeds. Thus, the FAD2-2 gene-encoded omega-6 desaturase appears to be responsible for production of polyunsaturated fatty acids within membrane lipids in both vegetative tissues and developing seeds. The seed-specifically expressed FAD2-1 gene is likely to play a major role in controlling conversion of oleic acid to linoleic acid within storage lipids during seed development. In both soybean seed and leaf tissues, linoleic acid and linolenic acid levels gradually increase as temperature decreases. However, the levels of transcripts for FAD2-1, FAD2-2, and the plastidial omega-6 desaturase gene (FAD 6) do not increase at low temperature. These results suggest that the elevated polyunsaturated fatty acid levels in developing soybean seeds grown at low temperature are not due to the enhanced expression of omega-6 desaturase genes. PMID:8587990
Directory of Open Access Journals (Sweden)
Pedro J. Rocha
2002-07-01
Full Text Available Catharanthus roseus (L. G Don is a medicinal plant that produces a variety of terpenoid indole alkaloids (TIAs, some of which display pharmacological activity. C. roseus plants and cell cultures have been used to elucidate the TIAs biosynthetic pathway. A considerable number or enzymes have also been characterised, and their respective genes cloned. TIAs production in C. roseus plant and cell cultures is highly regulated at transcriptional-, develop-mental-, and environmental-level. Studies into TIAs biosynthetic gene regulation have been carried out using cell cultures. However, regulation in plants is almost unknown. Here, biosynthetic genes idc, strl, d4h and dat expres-sion levels are qualitatively examined in a developmental series of C. roseus seedlings. The effect of water- and light-stress and methyl jasmonate (MeJa and acetyl salicylic acid (ASA elicitation is also examined. Comparison between seedlings and cell cultures strongly suggests that TIAs biosynthetic gene transcriptional regulation is different in C.roseus plants and cell cultures.
Barkla; Vera-Estrella; Maldonado-Gama; Pantoja
1999-07-01
Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways.
TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements.
Directory of Open Access Journals (Sweden)
Kamila Maliszewska-Olejniczak
2015-07-01
Full Text Available Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs. Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium
Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães
2015-01-01
Witches’ broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant–fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. PMID:25540440
Directory of Open Access Journals (Sweden)
Marc S Cortese
Full Text Available Aspergillus nidulans is a filamentous fungus widely used as a model for biotechnological and clinical research. It is also used as a platform for the study of basic eukaryotic developmental processes. Previous studies identified and partially characterized a set of proteins controlling cellular transformations in this ascomycete. Among these proteins, the bZip type transcription factor FlbB is a key regulator of reproduction, stress responses and cell-death. Our aim here was the prediction, through various bioinformatic methods, of key functional residues and motifs within FlbB in order to inform the design of future laboratory experiments and further the understanding of the molecular mechanisms that control fungal development. A dataset of FlbB orthologs and those of its key interaction partner FlbE was assembled from 40 members of the Pezizomycotina. Unique features were identified in each of the three structural domains of FlbB. The N-terminal region encoded a bZip transcription factor domain with a novel histidine-containing DNA binding motif while the dimerization determinants exhibited two distinct profiles that segregated by class. The C-terminal region of FlbB showed high similarity with the AP-1 family of stress response regulators but with variable patterns of conserved cysteines that segregated by class and order. Motif conservation analysis revealed that nine FlbB orthologs belonging to the Eurotiales order contained a motif in the central region that could mediate interaction with FlbE. The key residues and motifs identified here provide a basis for the design of follow-up experimental investigations. Additionally, the presence or absence of these residues and motifs among the FlbB orthologs could help explain the differences in the developmental programs among fungal species as well as define putative complementation groups that could serve to extend known functional characterizations to other species.
Gengoux, Grace W; Schapp, Salena; Burton, Sarah; Ardel, Christina M; Libove, Robin A; Baldi, Gina; Berquist, Kari L; Phillips, Jennifer M; Hardan, Antonio Y
2018-05-01
Developmental approaches to autism treatment aim to establish strong interpersonal relationships through joint play. These approaches have emerging empirical support; however, there is a need for further research documenting the procedures and demonstrating their effectiveness. This pilot study evaluated changes in parent behavior and child autism symptoms following a 12-week Developmental Reciprocity Treatment parent-training program. A total of 22 children with autism spectrum disorder between 2 and 6 years (mean age = 44.6 months, standard deviation = 12.7) and a primary caregiver participated in 12 weekly sessions of Developmental Reciprocity Treatment parent training, covering topics including introduction to developmental approaches, supporting attention and motivation, sensory regulation and sensory-social routines, imitation/building nonverbal communication, functional language development, and turn taking. Results indicated improvement in aspects of parent empowerment and social quality of life. Improvement in core autism symptoms was observed on the Social Responsiveness Scale total score (F(1,19): 5.550, p = 0.029), MacArthur-Bates Communicative Development Inventories number of words produced out of 680 (F(1,18): 18.104, p = 0.000), and two subscales of the Repetitive Behavior Scale, Revised (compulsive, p = 0.046 and restricted, p = 0.025). No differences in sensory sensitivity were observed on the Short Sensory Profile. Findings from this pilot study indicate that Developmental Reciprocity Treatment shows promise and suggest the need for future controlled trials of this developmentally based intervention.
Comparative genomic analysis of Drosophila melanogaster and vector mosquito developmental genes.
Directory of Open Access Journals (Sweden)
Susanta K Behura
Full Text Available Genome sequencing projects have presented the opportunity for analysis of developmental genes in three vector mosquito species: Aedes aegypti, Culex quinquefasciatus, and Anopheles gambiae. A comparative genomic analysis of developmental genes in Drosophila melanogaster and these three important vectors of human disease was performed in this investigation. While the study was comprehensive, special emphasis centered on genes that 1 are components of developmental signaling pathways, 2 regulate fundamental developmental processes, 3 are critical for the development of tissues of vector importance, 4 function in developmental processes known to have diverged within insects, and 5 encode microRNAs (miRNAs that regulate developmental transcripts in Drosophila. While most fruit fly developmental genes are conserved in the three vector mosquito species, several genes known to be critical for Drosophila development were not identified in one or more mosquito genomes. In other cases, mosquito lineage-specific gene gains with respect to D. melanogaster were noted. Sequence analyses also revealed that numerous repetitive sequences are a common structural feature of Drosophila and mosquito developmental genes. Finally, analysis of predicted miRNA binding sites in fruit fly and mosquito developmental genes suggests that the repertoire of developmental genes targeted by miRNAs is species-specific. The results of this study provide insight into the evolution of developmental genes and processes in dipterans and other arthropods, serve as a resource for those pursuing analysis of mosquito development, and will promote the design and refinement of functional analysis experiments.
Computer-based multisensory learning in children with developmental dyslexia.
Kast, Monika; Meyer, Martin; Vögeli, Christian; Gross, Markus; Jäncke, Lutz
2007-01-01
Several attempts have been made to remediate developmental dyslexia using various training environments. Based on the well-known retrieval structure model, the memory strength of phonemes and graphemes should be strengthened by visual and auditory associations between graphemes and phonemes. Using specifically designed training software, we examined whether establishing a multitude of visuo-auditory associations might help to mitigate writing errors in children with developmental dyslexia. Forty-three children with developmental dyslexia and 37 carefully matched normal reading children performed a computer-based writing training (15-20 minutes 4 days a week) for three months with the aim to recode a sequential textual input string into a multi-sensory representation comprising visual and auditory codes (including musical tones). The study included four matched groups: a group of children with developmental dyslexia (n=20) and a control group (n=18) practiced with the training software in the first period (3 months, 15-20 minutes 4 days a week), while a second group of children with developmental dyslexia (n=23) (waiting group) and a second control group (n=19) received no training during the first period. In the second period the children with developmental dyslexia and controls who did not receive training during the first period now took part in the training. Children with developmental dyslexia who did not perform computer-based training during the first period hardly improved their writing skills (post-pre improvement of 0-9%), the dyslexic children receiving training strongly improved their writing skills (post-pre improvement of 19-35%). The group who did the training during the second period also revealed improvement of writing skills (post-pre improvement of 27-35%). Interestingly, we noticed a strong transfer from trained to non-trained words in that the children who underwent the training were also better able to write words correctly that were not part
Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène
2013-01-01
Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy
Directory of Open Access Journals (Sweden)
David Cohen
Full Text Available Aquaporins (AQPs are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants. The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of
Blume, B; Grierson, D
1997-10-01
The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.
Directory of Open Access Journals (Sweden)
Xingguo Zhu
Full Text Available The human embryonic, fetal and adult β-like globin genes provide a paradigm for tissue- and developmental stage-specific gene regulation. The fetal γ-globin gene is expressed in fetal erythroid cells but is repressed in adult erythroid cells. The molecular mechanism underlying this transcriptional switch during erythroid development is not completely understood. Here, we used a combination of in vitro and in vivo assays to dissect the molecular assemblies of the active and the repressed proximal γ-globin promoter complexes in K562 human erythroleukemia cell line and primary human fetal and adult erythroid cells. We found that the proximal γ-globin promoter complex is assembled by a developmentally regulated, general transcription activator NF-Y bound strongly at the tandem CCAAT motifs near the TATA box. NF-Y recruits to neighboring DNA motifs the developmentally regulated, erythroid transcription activator GATA-2 and general repressor BCL11A, which in turn recruit erythroid repressor GATA-1 and general repressor COUP-TFII to form respectively the NF-Y/GATA-2 transcription activator hub and the BCL11A/COUP-TFII/GATA-1 transcription repressor hub. Both the activator and the repressor hubs are present in both the active and the repressed γ-globin promoter complexes in fetal and adult erythroid cells. Through changes in their levels and respective interactions with the co-activators and co-repressors during erythroid development, the activator and the repressor hubs modulate erythroid- and developmental stage-specific transcription of γ-globin gene.
Barau, Joan; Grandis, Adriana; Carvalho, Vinicius Miessler de Andrade; Teixeira, Gleidson Silva; Zaparoli, Gustavo Henrique Alcalá; do Rio, Maria Carolina Scatolin; Rincones, Johana; Buckeridge, Marcos Silveira; Pereira, Gonçalo Amarante Guimarães
2015-03-01
Witches' broom disease (WBD) of cacao differs from other typical hemibiotrophic plant diseases by its unusually long biotrophic phase. Plant carbon sources have been proposed to regulate WBD developmental transitions; however, nothing is known about their availability at the plant-fungus interface, the apoplastic fluid of cacao. Data are provided supporting a role for the dynamics of soluble carbon in the apoplastic fluid in prompting the end of the biotrophic phase of infection. Carbon depletion and the consequent fungal sensing of starvation were identified as key signalling factors at the apoplast. MpNEP2, a fungal effector of host necrosis, was found to be up-regulated in an autophagic-like response to carbon starvation in vitro. In addition, the in vivo artificial manipulation of carbon availability in the apoplastic fluid considerably modulated both its expression and plant necrosis rate. Strikingly, infected cacao tissues accumulated intracellular hexoses, and showed stunted photosynthesis and the up-regulation of senescence markers immediately prior to the transition to the necrotrophic phase. These opposite findings of carbon depletion and accumulation in different host cell compartments are discussed within the frame of WBD development. A model is suggested to explain phase transition as a synergic outcome of fungal-related factors released upon sensing of extracellular carbon starvation, and an early senescence of infected tissues probably triggered by intracellular sugar accumulation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Sundnes, Olav; Pietka, Wojciech; Loos, Tamara; Sponheim, Jon; Rankin, Andrew L; Pflanz, Stefan; Bertelsen, Vibeke; Sitek, Jan C; Hol, Johanna; Haraldsen, Guttorm; Khnykin, Denis
2015-07-01
IL-33 is a novel IL-1 family member with a putative role in inflammatory skin disorders and a complex biology. Therefore, recent conflicting data regarding its function in experimental models justify a close assessment of its tissue expression and regulation. Indeed, we report here that there are strong species differences in the expression and regulation of epidermal IL-33. In murine epidermis, IL-33 behaved similar to an alarmin, being constitutively expressed in keratinocyte nuclei and rapidly lost during acute inflammation. By contrast, human and porcine IL-33 were weakly expressed or absent in keratinocytes of noninflamed skin but induced during acute inflammation. To this end, we observed that expression of IL-33 in human keratinocytes but not murine keratinocytes was strongly induced by IFN-γ, and this upregulation completely depended on the presence of EGFR ligands. Accordingly, IFN-γ increased the expression of IL-33 in the basal layers of the epidermis in human ex vivo skin cultures only, despite good evidence of IFN-γ activity in cultures from both species. Together these findings demonstrate that a full understanding of IL-33 function in clinical settings must take species-specific differences into account.
Role of developmental factors in hypothalamic function
Directory of Open Access Journals (Sweden)
Jakob eBiran
2015-04-01
Full Text Available The hypothalamus is a brain region which regulates homeostasis by mediating endocrine, autonomic and behavioral functions. It is comprised of several nuclei containing distinct neuronal populations producing neuropeptides and neurotransmitters that regulate fundamental body functions including temperature and metabolic rate, thirst and hunger, sexual behavior and reproduction, circadian rhythm, and emotional responses. The identity, number and connectivity of these neuronal populations are established during the organism’s development and are of crucial importance for normal hypothalamic function. Studies have suggested that developmental abnormalities in specific hypothalamic circuits can lead to obesity, sleep disorders, anxiety, depression and autism. At the molecular level, the development of the hypothalamus is regulated by transcription factors, secreted growth factors, neuropeptides and their receptors. Recent studies in zebrafish and mouse have demonstrated that some of these molecules maintain their expression in the adult brain and subsequently play a role in the physiological functions that are regulated by hypothalamic neurons. Here, we summarize the involvement of some of the key developmental factors in hypothalamic development and function by focusing on the mouse and zebrafish genetic model organisms.
The Importance of Developmental Science for Studies in Bullying and Victimization
Smith, Peter K.; Jones, Alice P.
2012-01-01
Research on bullying and victimization, especially in school settings, has become an important area of developmental research, with strong practical implications. In this article we overview some considerations from neuropsychology, quantitative genetics, developmental neuroscience, we discuss CU traits and conduct problems, individual, group,…
Directory of Open Access Journals (Sweden)
Theresa L. B. Edelman
2016-12-01
Full Text Available The Caenorhabditis elegans heterochronic gene pathway regulates the relative timing of events during postembryonic development. lin-42, the worm homolog of the circadian clock gene, period, is a critical element of this pathway. lin-42 function has been defined by a set of hypomorphic alleles that cause precocious phenotypes, in which later developmental events, such as the terminal differentiation of hypodermal cells, occur too early. A subset of alleles also reveals a significant role for lin-42 in molting; larval stages are lengthened and ecdysis often fails in these mutant animals. lin-42 is a complex locus, encoding overlapping and nonoverlapping isoforms. Although existing alleles that affect subsets of isoforms have illuminated important and distinct roles for this gene in developmental timing, molting, and the decision to enter the alternative dauer state, it is essential to have a null allele to understand all of the roles of lin-42 and its individual isoforms. To remedy this problem and discover the null phenotype, we engineered an allele that deletes the entire lin-42 protein-coding region. lin-42 null mutants are homozygously viable, but have more severe phenotypes than observed in previously characterized hypomorphic alleles. We also provide additional evidence for this conclusion by using the null allele as a base for reintroducing different isoforms, showing that each isoform can provide heterochronic and molting pathway activities. Transcript levels of the nonoverlapping isoforms appear to be under coordinate temporal regulation, despite being driven by independent promoters. The lin-42 null allele will continue to be an important tool for dissecting the functions of lin-42 in molting and developmental timing.
Directory of Open Access Journals (Sweden)
Runko Suzan J
2005-10-01
Full Text Available Abstract Background Ginkgo biloba L. is the only surviving member of one of the oldest living seed plant groups with medicinal, spiritual and horticultural importance worldwide. As an evolutionary relic, it displays many characters found in the early, extinct seed plants and extant cycads. To establish a molecular base to understand the evolution of seeds and pollen, we created a cDNA library and EST dataset from the reproductive structures of male (microsporangiate, female (megasporangiate, and vegetative organs (leaves of Ginkgo biloba. Results RNA from newly emerged male and female reproductive organs and immature leaves was used to create three distinct cDNA libraries from which 6,434 ESTs were generated. These 6,434 ESTs from Ginkgo biloba were clustered into 3,830 unigenes. A comparison of our Ginkgo unigene set against the fully annotated genomes of rice and Arabidopsis, and all available ESTs in Genbank revealed that 256 Ginkgo unigenes match only genes among the gymnosperms and non-seed plants – many with multiple matches to genes in non-angiosperm plants. Conversely, another group of unigenes in Gingko had highly significant homology to transcription factors in angiosperms involved in development, including MADS box genes as well as post-transcriptional regulators. Several of the conserved developmental genes found in Ginkgo had top BLAST homology to cycad genes. We also note here the presence of ESTs in G. biloba similar to genes that to date have only been found in gymnosperms and an additional 22 Ginkgo genes common only to genes from cycads. Conclusion Our analysis of an EST dataset from G. biloba revealed genes potentially unique to gymnosperms. Many of these genes showed homology to fully sequenced clones from our cycad EST dataset found in common only with gymnosperms. Other Ginkgo ESTs are similar to developmental regulators in higher plants. This work sets the stage for future studies on Ginkgo to better understand seed and
Directory of Open Access Journals (Sweden)
Qun Zhang
2015-12-01
Full Text Available ABSTRACT Cell division and expansion require the ordered arrangement of microtubules, which are subject to spatial and temporal modifications by developmental and environmental factors. Understanding how signals translate to changes in cortical microtubule organization is of fundamental importance. A defining feature of the cortical microtubule array is its association with the plasma membrane; modules of the plasma membrane are thought to play important roles in the mediation of microtubule organization. In this review, we highlight advances in research on the regulation of cortical microtubule organization by membrane-associated and membrane-tethered proteins and lipids in response to phytohormones and stress. The transmembrane kinase receptor Rho-like guanosine triphosphatase, phospholipase D, phosphatidic acid, and phosphoinositides are discussed with a focus on their roles in microtubule organization.
Mural granulosa cell gene expression associated with oocyte developmental competence
Directory of Open Access Journals (Sweden)
Jiang Jin-Yi
2010-03-01
Full Text Available Abstract Background Ovarian follicle development is a complex process. Paracrine interactions between somatic and germ cells are critical for normal follicular development and oocyte maturation. Studies have suggested that the health and function of the granulosa and cumulus cells may be reflective of the health status of the enclosed oocyte. The objective of the present study is to assess, using an in vivo immature rat model, gene expression profile in granulosa cells, which may be linked to the developmental competence of the oocyte. We hypothesized that expression of specific genes in granulosa cells may be correlated with the developmental competence of the oocyte. Methods Immature rats were injected with eCG and 24 h thereafter with anti-eCG antibody to induce follicular atresia or with pre-immune serum to stimulate follicle development. A high percentage (30-50%, normal developmental competence, NDC of oocytes from eCG/pre-immune serum group developed to term after embryo transfer compared to those from eCG/anti-eCG (0%, poor developmental competence, PDC. Gene expression profiles of mural granulosa cells from the above oocyte-collected follicles were assessed by Affymetrix rat whole genome array. Results The result showed that twelve genes were up-regulated, while one gene was down-regulated more than 1.5 folds in the NDC group compared with those in the PDC group. Gene ontology classification showed that the up-regulated genes included lysyl oxidase (Lox and nerve growth factor receptor associated protein 1 (Ngfrap1, which are important in the regulation of protein-lysine 6-oxidase activity, and in apoptosis induction, respectively. The down-regulated genes included glycoprotein-4-beta galactosyltransferase 2 (Ggbt2, which is involved in the regulation of extracellular matrix organization and biogenesis. Conclusions The data in the present study demonstrate a close association between specific gene expression in mural granulosa cells and
DEFF Research Database (Denmark)
Danielsen, Erik Thomas
and duration required for juvenile-adult transition. This PhD project demonstrates the power of Drosophila genetics by taking an in vivo genome-wide RNAi screening approach to uncover genes required for the function of steroid producing tissue and developmental maturation. In total, 1909 genes were found...... to be required for the prothoracic gland function and affected the developmental timing for the juvenile-adult transition. Among the screen hits, we focused on an uncharacterized gene, sit (CG5278), which is highly expressed in the gland and is required for ecdysone production. Sit is a homolog of mammalian very...... flux of cholesterol uptake in the gland cells and affected the endosomal trafficking. Therefore this gene was suggested to be named stuck in traffic (sit). Sit’s role in cholesterol uptake was also supported by the observation that the developmental delayed phenotype from loss of sit expression...
Barkla, Bronwyn J.; Vera-Estrella, Rosario; Maldonado-Gama, Minerva; Pantoja, Omar
1999-01-01
Abscisic acid (ABA) has been implicated as a key component in water-deficit-induced responses, including those triggered by drought, NaCl, and low- temperature stress. In this study a role for ABA in mediating the NaCl-stress-induced increases in tonoplast H+-translocating ATPase (V-ATPase) and Na+/H+ antiport activity in Mesembryanthemum crystallinum, leading to vacuolar Na+ sequestration, were investigated. NaCl or ABA treatment of adult M. crystallinum plants induced V-ATPase H+ transport activity, and when applied in combination, an additive effect on V-ATPase stimulation was observed. In contrast, treatment of juvenile plants with ABA did not induce V-ATPase activity, whereas NaCl treatment resulted in a similar response to that observed in adult plants. Na+/H+ antiport activity was induced in both juvenile and adult plants by NaCl, but ABA had no effect at either developmental stage. Results indicate that ABA-induced changes in V-ATPase activity are dependent on the plant reaching its adult phase, whereas NaCl-induced increases in V-ATPase and Na+/H+ antiport activity are independent of plant age. This suggests that ABA-induced V-ATPase activity may be linked to the stress-induced, developmentally programmed switch from C3 metabolism to Crassulacean acid metabolism in adult plants, whereas, vacuolar Na+ sequestration, mediated by the V-ATPase and Na+/H+ antiport, is regulated through ABA-independent pathways. PMID:10398716
Directory of Open Access Journals (Sweden)
Mennatallah M Y Albarqi
2016-01-01
Full Text Available The complex life cycle of the parasitic nematode Strongyloides stercoralis leads to either developmental arrest of infectious third-stage larvae (iL3 or growth to reproductive adults. In the free-living nematode Caenorhabditis elegans, analogous determination between dauer arrest and reproductive growth is governed by dafachronic acids (DAs, a class of steroid hormones that are ligands for the nuclear hormone receptor DAF-12. Biosynthesis of DAs requires the cytochrome P450 (CYP DAF-9. We tested the hypothesis that DAs also regulate S. stercoralis development via DAF-12 signaling at three points. First, we found that 1 μM Δ7-DA stimulated 100% of post-parasitic first-stage larvae (L1s to develop to free-living adults instead of iL3 at 37°C, while 69.4±12.0% (SD of post-parasitic L1s developed to iL3 in controls. Second, we found that 1 μM Δ7-DA prevented post-free-living iL3 arrest and stimulated 85.2±16.9% of larvae to develop to free-living rhabditiform third- and fourth-stages, compared to 0% in the control. This induction required 24-48 hours of Δ7-DA exposure. Third, we found that the CYP inhibitor ketoconazole prevented iL3 feeding in host-like conditions, with only 5.6±2.9% of iL3 feeding in 40 μM ketoconazole, compared to 98.8±0.4% in the positive control. This inhibition was partially rescued by Δ7-DA, with 71.2±16.4% of iL3 feeding in 400 nM Δ7-DA and 35 μM ketoconazole, providing the first evidence of endogenous DA production in S. stercoralis. We then characterized the 26 CYP-encoding genes in S. stercoralis and identified a homolog with sequence and developmental regulation similar to DAF-9. Overall, these data demonstrate that DAF-12 signaling regulates S. stercoralis development, showing that in the post-parasitic generation, loss of DAF-12 signaling favors iL3 arrest, while increased DAF-12 signaling favors reproductive development; that in the post-free-living generation, absence of DAF-12 signaling is crucial for
Analysing growth and development of plants jointly using developmental growth stages.
Dambreville, Anaëlle; Lauri, Pierre-Éric; Normand, Frédéric; Guédon, Yann
2015-01-01
Plant growth, the increase of organ dimensions over time, and development, the change in plant structure, are often studied as two separate processes. However, there is structural and functional evidence that these two processes are strongly related. The aim of this study was to investigate the co-ordination between growth and development using mango trees, which have well-defined developmental stages. Developmental stages, determined in an expert way, and organ sizes, determined from objective measurements, were collected during the vegetative growth and flowering phases of two cultivars of mango, Mangifera indica. For a given cultivar and growth unit type (either vegetative or flowering), a multistage model based on absolute growth rate sequences deduced from the measurements was first built, and then growth stages deduced from the model were compared with developmental stages. Strong matches were obtained between growth stages and developmental stages, leading to a consistent definition of integrative developmental growth stages. The growth stages highlighted growth asynchronisms between two topologically connected organs, namely the vegetative axis and its leaves. Integrative developmental growth stages emphasize that developmental stages are closely related to organ growth rates. The results are discussed in terms of the possible physiological processes underlying these stages, including plant hydraulics, biomechanics and carbohydrate partitioning. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Boulle, Fabien; Pawluski, Jodi L; Homberg, Judith R; Machiels, Barbie; Kroeze, Yvet; Kumar, Neha; Steinbusch, Harry W M; Kenis, Gunter; van den Hove, Daniel L A
2016-04-01
A growing number of infants are exposed to selective serotonin reuptake inhibitor (SSRI) medications during the perinatal period. Perinatal exposure to SSRI medications alter neuroplasticity and increase depressive- and anxiety-related behaviors, particularly in male offspring as little work has been done in female offspring to date. The long-term effects of SSRI on development can also differ with previous exposure to prenatal stress, a model of maternal depression. Because of the limited work done on the role of developmental SSRI exposure on neurobehavioral outcomes in female offspring, the aim of the present study was to investigate how developmental fluoxetine exposure affects anxiety and depression-like behavior, as well as the regulation of hippocampal brain-derived neurotrophic factor (BDNF) signaling in the hippocampus of adult female offspring. To do this female Sprague-Dawley rat offspring were exposed to prenatal stress and fluoxetine via the dam, for a total of four groups of female offspring: 1) No Stress+Vehicle, 2) No Stress+Fluoxetine, 3) Prenatal Stress+Vehicle, and 4) Prenatal Stress+Fluoxetine. Primary results show that, in adult female offspring, developmental SSRI exposure significantly increases behavioral despair measures on the forced swim test, decreases hippocampal BDNF exon IV mRNA levels, and increases levels of the repressive histone 3 lysine 27 tri-methylated mark at the corresponding promoter. There was also a significant negative correlation between hippocampal BDNF exon IV mRNA levels and immobility in the forced swim test. No effects of prenatal stress or developmental fluoxetine exposure were seen on tests of anxiety-like behavior. This research provides important evidence for the long-term programming effects of early-life exposure to SSRIs on female offspring, particularily with regard to affect-related behaviors and their underlying molecular mechanisms. Copyright © 2016 Elsevier Inc. All rights reserved.
Developmental regulation of human truncated nerve growth factor receptor
Energy Technology Data Exchange (ETDEWEB)
DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R. (Abbott Laboratories, Abbott Park, IL (USA))
1991-01-01
Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system.
Developmental regulation of human truncated nerve growth factor receptor
International Nuclear Information System (INIS)
DiStefano, P.S.; Clagett-Dame, M.; Chelsea, D.M.; Loy, R.
1991-01-01
Monoclonal antibodies (designated XIF1 and IIIG5) recognizing distinct epitopes of the human truncated nerve growth factor receptor (NGF-Rt) were used in a two-site radiometric immunosorbent assay to monitor levels of NGF-Rt in human urine as a function of age. Urine samples were collected from 70 neurologically normal subjects ranging in age from 1 month to 68 years. By using this sensitive two-site radiometric immunosorbent assay, NGF-Rt levels were found to be highest in urine from 1-month old subjects. By 2.5 months, NGF-Rt values were half of those seen at 1 month and decreased more gradually between 0.5 and 15 years. Between 15 and 68 years, urine NGF-Rt levels were relatively constant at 5% of 1-month values. No evidence for diurnal variation of adult NGF-Rt was apparent. Pregnant women in their third trimester showed significantly elevated urine NGF-Rt values compared with age-matched normals. Affinity labeling of NGF-Rt with 125I-NGF followed by immunoprecipitation with ME20.4-IgG and gel autoradiography indicated that neonatal urine contained high amounts of truncated receptor (Mr = 50 kd); decreasingly lower amounts of NGF-Rt were observed on gel autoradiograms with development, indicating that the two-site radiometric immunosorbent assay correlated well with the affinity labeling technique for measuring NGF-Rt. NGF-Rt in urines from 1-month-old and 36-year-old subjects showed no differences in affinities for NGF or for the monoclonal antibody IIIG5. These data show that NGF-Rt is developmentally regulated in human urine, and are discussed in relation to the development and maturation of the peripheral nervous system
Virtual Embryo: Cell-Agent Based Modeling of Developmental Processes and Toxicities (CSS BOSC)
Spatial regulation of cellular dynamics is fundamental to morphological development. As such, chemical disruption of spatial dynamics is a determinant of developmental toxicity. Incorporating spatial dynamics into AOPs for developmental toxicity is desired but constrained by the ...
29 CFR 1952.221 - Developmental schedule.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.221 Section 1952.221 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... Management data system operational July 1, 1973. Automated Management data system operational January 1, 1974...
29 CFR 1952.341 - Developmental schedule.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.341 Section 1952.341 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... State Legislature January 1975 and to become effective by May 1, 1975. (d) Management Information System...
Childs, Andrew J; Kinnell, Hazel L; Collins, Craig S; Hogg, Kirsten; Bayne, Rosemary A L; Green, Samira J; McNeilly, Alan S; Anderson, Richard A
2010-08-01
Primordial germ cells (PGCs) are the embryonic precursors of gametes in the adult organism, and their development, differentiation, and survival are regulated by a combination of growth factors collectively known as the germ cell niche. Although many candidate niche components have been identified through studies on mouse PGCs, the growth factor composition of the human PGC niche has not been studied extensively. Here we report a detailed analysis of the expression of components of the bone morphogenetic protein (BMP) signaling apparatus in the human fetal ovary, from postmigratory PGC proliferation to the onset of primordial follicle formation. We find developmentally regulated and reciprocal patterns of expression of BMP2 and BMP4 and identify germ cells to be the exclusive targets of ovarian BMP signaling. By establishing long-term cultures of human fetal ovaries in which PGCs are retained within their physiological niche, we find that BMP4 negatively regulates postmigratory PGC numbers in the human fetal ovary by promoting PGC apoptosis. Finally, we report expression of both muscle segment homeobox (MSX)1 and MSX2 in the human fetal ovary and reveal a selective upregulation of MSX2 expression in human fetal ovary in response to BMP4, suggesting this gene may act as a downstream effector of BMP-induced apoptosis in the ovary, as in other systems. These data reveal for the first time growth factor regulation of human PGC development in a physiologically relevant context and have significant implications for the development of cultures systems for the in vitro maturation of germ cells, and their derivation from pluripotent stem cells.
Insulin and IGF receptors are developmentally regulated in the chick embry eye lens
International Nuclear Information System (INIS)
Bassas, L.; Zelenka, P.S.; Serrano, J.; de Pablo, F.
1987-01-01
The authors have previously reported that insulin-like growth factor (IGF) receptors appear to predominate over insulin receptors in early stages of embryogenesis in the chick (days 2-3 whole embryo membranes). Overall, [ 125 I]IGF and II binding to specific receptors was maximal when the rate of brain growth is highest. In the present study they used the embryonic chick lens, a well-defined tissue composed of a single type of cell, to analyze whether changes of insulin and IGFI binding are correlated with changes in growth rate and differentiation state of the cells. They show that both insulin receptors and IGF receptors are present in the lens epithelial cells, and that each type is distinctly regulated throughout development. While there is a direct correlation between IFG-binding capability and growth rate of the cells, there is less relation to differentiation status and embryo age. Insulin receptors, by contrast, appear to be mostly related to the differentiated state of cells, decreasing sharply in fibers, irrespective of their developmental age
Developmental checkpoints and feedback circuits time insect maturation
DEFF Research Database (Denmark)
Rewitz, Kim Furbo; Yamanaka, Naoki; O'Connor, Michael B.
2013-01-01
as external cues, to time production and release of ecdysone. Based on results discussed here, we suggest that developmental progression to adulthood is controlled by checkpoints that regulate the genetic timing program enabling it to adapt to different environmental conditions. These checkpoints utilize...... a number of signaling pathways to modulate ecdysone production in the prothoracic gland. Release of ecdysone activates an autonomous cascade of both feedforward and feedback signals that determine the duration of the ecdysone pulse at each developmental transitions. Conservation of the genetic mechanisms...... that coordinate the juvenile-adult transition suggests that insights from the fruit fly Drosophila will provide a framework for future investigation of developmental timing in metazoans....
Tian, Xue; Pang, Xiaolei; Wang, Liangyan; Li, Mengrong; Dong, Chuanju; Ma, Xiao; Wang, Lei; Song, Dongying; Feng, Jianxin; Xu, Peng; Li, Xuejun
2018-04-20
The Japanese ornamental carp (Cyprinus carpio var. Koi) is famous for multifarious colors and patterns, making it commonly culture and trade across the world. Although functional genes and inheritance of color traits have been commonly studied, seldom attentions were focused on the genetic regulation during the developmental process of pigmentation. To better understand the mechanism of skin color development, we observed the morphogenesis of pigment cells during the post-embryonic stages and analysed the temporal expression pattern of mRNAs/miRNAs profiles in four distinct developmental stages. 59 and 103 differentially expressed genes/miRNAs (DEGs/DEMs) associated with pigmentation and skin were identified, including pax7, mitf, tyr, tyrp1, etc., and the highest DEGs were detected at 11 days post hatching (dph). In addition, the functional characteristics of mRNAs/miRNAs associated with pteridine and carotenoid pathway were also examined. Furthermore, 65 miRNA-mRNA interaction pairs related to pigmentation, pteridines and carotenoids metabolism were detected between different stages. Interestingly, the largest pairs appeared in the transition from 11 dph to 48 dph, which had the similar trend with DEGs further manifesting the importance of 11 dph. This study produced a comprehensive programme of DEGs/DEMs during color development, which will provide resources to understand the regulation mechanism in color formation. The understanding of genetic basis in color formation might promote the production and breeding of the Koi carp. Copyright © 2017. Published by Elsevier B.V.
Li, Ning; Harris, T Brad; Boswell, Wendy R; Xie, Zhitao
2011-11-01
Drawing from an interactionist approach and feedback research, we examine the role of developmental feedback and proactive personality on newcomer task performance and helping behavior. Data were collected from 2 high-tech joint-ventures within the information technology and manufacturing industries located in Shanghai, China. Results based on 151 newcomer-manager dyads showed that supervisor developmental feedback (SDF) positively related to newcomer helping behavior and that SDF and coworker developmental feedback interactively predicted newcomer task performance. We also found differential moderating effects of proactive personality: SDF more strongly related to helping behavior when proactive personality was lower; conversely, coworker developmental feedback more strongly related to helping behavior when proactive personality was higher. (c) 2011 APA, all rights reserved.
The two forms of capitalism: developmentalism and economic liberalism
Directory of Open Access Journals (Sweden)
LUIZ CARLOS BRESSER-PEREIRA
Full Text Available ABSTRACT This paper argues that the state and the market are the main institutions regulating capitalism, and, correspondingly, that the form of the economic and political coordination of capitalism will be either developmental or liberal. It defines the developmental state, relates it to the formation of a developmental class coalition, and notes that capitalism was born developmental in its mercantilist phase, turned liberal in the nineteenth century, and, after 1929, became once again developmental, but, now, democratic and progressive. All industrial and capitalist revolutions took place within the framework of developmentalism, whereby the state coordinates the non-competitive sector of the economy and the five macroeconomic prices (which the market is unable to make “right”, while the market coordinates the competitive sector. In the 1970s, a crisis opened the way for a short-lived and reactionary form of capitalism, neoliberalism or rentier-financier capitalism. Since the 2008 Global Financial Crisis, the neoliberal hegemony has come to an end, and we are now experiencing a period of transition.
29 CFR 1952.151 - Developmental schedule.
2010-07-01
... Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... developmental plan for a “Management Information System” on the date of Plan approval. This program is to be... years after grant award. (p) A State “Safety and Health” poster will be prepared within ninety (90) days...
Label-free proteome profiling reveals developmental-dependent patterns in young barley grains.
Kaspar-Schoenefeld, Stephanie; Merx, Kathleen; Jozefowicz, Anna Maria; Hartmann, Anja; Seiffert, Udo; Weschke, Winfriede; Matros, Andrea; Mock, Hans-Peter
2016-06-30
Due to its importance as a cereal crop worldwide, high interest in the determination of factors influencing barley grain quality exists. This study focusses on the elucidation of protein networks affecting early grain developmental processes. NanoLC-based separation coupled to label-free MS detection was applied to gain insights into biochemical processes during five different grain developmental phases (pre-storage until storage phase, 3days to 16days after flowering). Multivariate statistics revealed two distinct developmental patterns during the analysed grain developmental phases: proteins showed either highest abundance in the middle phase of development - in the transition phase - or at later developmental stages - within the storage phase. Verification of developmental patterns observed by proteomic analysis was done by applying hypothesis-driven approaches, namely Western Blot analysis and enzyme assays. High general metabolic activity of the grain with regard to protein synthesis, cell cycle regulation, defence against oxidative stress, and energy production via photosynthesis was observed in the transition phase. Proteins upregulated in the storage phase are related towards storage protein accumulation, and interestingly to the defence of storage reserves against pathogens. A mixed regulatory pattern for most enzymes detected in our study points to regulatory mechanisms at the level of protein isoforms. In-depth understanding of early grain developmental processes of cereal caryopses is of high importance as they influence final grain weight and quality. Our knowledge about these processes is still limited, especially on proteome level. To identify key mechanisms in early barley grain development, a label-free data-independent proteomics acquisition approach has been applied. Our data clearly show, that proteins either exhibit highest expression during cellularization and the switch to the storage phase (transition phase, 5-7 DAF), or during storage
Developmental systems of plasticity and trans-generational epigenetic inheritance in nematodes.
Serobyan, Vahan; Sommer, Ralf J
2017-08-01
Several decades of research provided detailed insight into how genes control development and evolution, whereas recent studies have expanded this purely genetic perspective by presenting strong evidence for environmental and epigenetic influences. We summarize examples of phenotypic plasticity and trans-generational epigenetic inheritance in the nematode model organisms Pristionchus pacificus and Caenorhabditis elegans, which indicate that the response of developmental systems to environmental influences is hardwired into the organismś genome. We argue that genetic programs regulating these organismal-environmental interactions are themselves subject to natural selection. Indeed, macro-evolutionary studies of nematode feeding structures indicate evolutionary trajectories in which plasticity followed by genetic assimilation results in extreme diversity highlighting the role of plasticity as major facilitator of phenotypic diversification. Copyright © 2017 Elsevier Ltd. All rights reserved.
Developmental Social Cognitive Neuroscience: Insights from Deafness
Corina, David; Singleton, Jenny
2009-01-01
The condition of deafness presents a developmental context that provides insight into the biological, cultural, and linguistic factors underlying the development of neural systems that impact social cognition. Studies of visual attention, behavioral regulation, language development, and face and human action perception are discussed. Visually…
Directory of Open Access Journals (Sweden)
Vanessa C McFadden
2017-02-01
Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.
Volling, Brenda L; McElwain, Nancy L; Miller, Alison L
2002-01-01
Jealousy is a social emotion that has received little attention by developmental researchers. The current study examined sibling jealousy and its relations to child and family characteristics in 60 families with a 16-month-old toddler and an older preschool-age sibling. Sibling jealousy was elicited in social triads consisting of a parent (mother or father) and the two siblings. Positive marital relationship quality (i.e., love and relationship maintenance) was a particularly strong predictor of the older siblings' abilities to regulate jealousy reactions in the mother sessions. Younger siblings' jealous affect with mothers was linked to the child's temperament, whereas older siblings' jealous affect with mothers was related to the child's emotional understanding. Younger siblings displayed more behavioral dysregulation in the mother-sibling triads if there was greater sibling rivalry reported by mothers. Session order (i.e., which sibling was challenged first in the jealousy paradigm) had a strong effect on both the affect and behavioral dysregulation displayed by the older and younger siblings. Results are discussed with respect to the need for future research to consider social relationships as developmental contexts for young children's emotion regulation.
Zhao, Liming; Chen, Jian; Becnel, James J; Kline, Daniel L; Clark, Gary G; Linthicum, Kenneth J
2011-05-01
The cDNA of a trypsin gene from Aedes (Ochlerotatus) taeniorhynchus (Weidemann) was cloned and sequenced. The full-length mRNA sequence (890 bp) for trypsin from Ae. taeniorhynchus (AetTryp1) was obtained, which encodes an open reading frame of 765 bp (i.e., 255 amino acids). To detect whether AetTryp is developmentally regulated, a quantitative real-time polymerase chain reaction was used to examine AetTrypl mRNA expression levels in different developmental stages of Ae. taeniorhynchus. AetTryp1 was expressed at low levels in egg, larval, and pupal stages, but was differentially expressed in adult Ae. taeniorhynchus, with highest levels found in 5-d-old female adults when compared with teneral adults. In addition, AetTryp1 mRNA expression differed between sexes, with expression levels much lower in males. However, in both males and females, there was a significant increase in AetTryp1 transcription levels as age increased and peaked in 5-d-old adults. AetTrypl expressed in 5-d-old female Ae. taeniorhynchus significantly increased after 30 min postblood feeding compared with the control. The AetTryp1 mRNA expression in 5-d-old female Ae. taeniorhynchus was affected by different concentrations of permethrin.
Neuroendocrine Regulation of Maternal Behavior
Bridges, Robert S.
2015-01-01
The expression of maternal behavior in mammals is regulated by the developmental and experiential events over a female’s lifetime. In this review the relationships between the endocrine and neural systems that play key roles in these developmental and experiential that affect both the establishment and maintenance of maternal care are presented. The involvement of the hormones estrogen, progesterone, and lactogens are discussed in the context of ligand, receptor, and gene activity in rodents and to a lesser extent in higher mammals. The roles of neuroendocrine factors, including oxytocin, vasopressin, classical neurotransmitters, and other neural gene products that regulate aspects of maternal care are set forth, and the interactions of hormones with central nervous system mediators of maternal behavior are discussed. The impact of prior developmental factors, including epigenetic events, and maternal experience on subsequent maternal care are assessed over the course of the female’s lifespan. It is proposed that common neuroendocrine mechanisms underlie the regulation of maternal care in mammals. PMID:25500107
Peng, Hui; Cheng, Hui-Ying; Yu, Xin-Wang; Shi, Qing-Hua; Zhang, Hua; Li, Jian-Gui; Ma, Hao
2009-01-01
It has been documented that the plant-specific NAC (for NAM, ATAF1,2 and CUC2) transcription factors play an important role in plant development and stress responses. In this study, a chickpea NAC gene CarNAC5 (for Cicer arietinum L. NAC gene 5) was isolated from a cDNA library from chickpea leaves treated by polyethylene glycol (PEG). CarNAC5, as a single/low copy gene, contained three exons and two introns within genomic DNA sequence and encoded a polypeptide with 291 amino acids. CarNAC5 protein had a conserved NAC domain in the N-terminus and showed high similarity to other NACs, especially ATAF subgroup members. The CarNAC5:GFP fusion protein was localized in the nucleus of onion epidermal cells. Furthermore, CarNAC5 protein activated the reporter genes LacZ and HIS3 in yeast. The transactivation activity was mapped to the C-terminal region. The transcripts of CarNAC5 appeared in many chickpea tissues including seedling leaves, stems, roots, flowers, seeds and pods, but mostly accumulated in flowers. Meanwhile, CarNAC5 was strongly expressed during seed maturation and in embryos of the early germinating seeds. It was also significantly induced by drought, heat, wounding, salicylic acid (SA), and indole-3-acetic acid (IAA) treatments. Our results suggest that CarNAC5 encodes a novel NAC-domain protein and acts as a transcriptional activator involved in plant developmental regulation and various stress responses.
Epigenetics and the Developmental Origins of Health and ...
Epigenetic programming is likely to be an important mechanism underlying the lasting influence of the developmental environment on lifelong health, a concept known as the Developmental Origins of Health and Disease (DOHaD). DNA methylation, posttranslational histone protei n modifications, noncoding RNAs and recruited protein complexes are elements of the epigenetic regulation of gene transcription. These heritable but reversible changes in gene function are dynamic and labile during specific stages of the reproductive cycle and development. Epigenetic marks may be maintained throughout an individual's lifespan and can alter the life-long risk of disease; the nature of these epigenetic marks and their potential alteration by environmental factors is an area of active research. This chapter provides an overview of epigenetic regulation, particularly as it occurs as an essential component of embryo-fetal development. In this chapter we will present key features of DNA methylation and histone protein modifications, including the enzymes involved and the effects of these modifications on gene transcription. We will discuss the interplay of these dynamic modifications and the emerging role of noncoding RNAs in epigenetic gene regulation.
Directory of Open Access Journals (Sweden)
Hironao Takebayashi
Full Text Available Schizophrenia and similar psychoses induced by NMDA-type glutamate receptor antagonists, such as phencyclidine (PCP and ketamine, usually develop after adolescence. Moreover, adult-type behavioral disturbance following NMDA receptor antagonist application in rodents is observed after a critical period at around 3 postnatal weeks. These observations suggest that the schizophrenic symptoms caused by and psychotomimetic effects of NMDA antagonists require the maturation of certain brain neuron circuits and molecular networks, which differentially respond to NMDA receptor antagonists across adolescence and the critical period. From this viewpoint, we have identified a novel developmentally regulated phencyclidine-responsive transcript from the rat thalamus, designated as prt6, as a candidate molecule involved in the above schizophrenia-related systems using a DNA microarray technique. The transcript is a non-coding RNA that includes sequences of at least two microRNAs, miR132 and miR212, and is expressed strongly in the brain and testis, with trace or non-detectable levels in the spleen, heart, liver, kidney, lung and skeletal muscle, as revealed by Northern blot analysis. The systemic administration of PCP (7.5 mg/kg, subcutaneously (s.c. significantly elevated the expression of prt6 mRNA in the thalamus at postnatal days (PD 32 and 50, but not at PD 8, 13, 20, or 24 as compared to saline-treated controls. At PD 50, another NMDA receptor antagonist, dizocilpine (0.5 mg/kg, s.c., and a schizophrenomimetic dopamine agonist, methamphetamine (4.8 mg/kg, s.c., mimicked a significant increase in the levels of thalamic prt6 mRNAs, while a D2 dopmamine receptor antagonist, haloperidol, partly inhibited the increasing influence of PCP on thalamic prt6 expression without its own effects. These data indicate that prt6 may be involved in the pathophysiology of the onset of drug-induced schizophrenia-like symptoms and schizophrenia through the possible
Directory of Open Access Journals (Sweden)
Nelson S. Yee
2012-02-01
Histone deacetylases (HDACs and RNA polymerase III (POLR3 play vital roles in fundamental cellular processes, and deregulation of these enzymes has been implicated in malignant transformation. Hdacs and Polr3 are required for exocrine pancreatic epithelial proliferation during morphogenesis in zebrafish. We aim to test the hypothesis that Hdacs and Polr3 cooperatively control exocrine pancreatic growth, and combined inhibition of HDACs and POLR3 produces enhanced growth suppression in pancreatic cancer. In zebrafish larvae, combination of a Hdac inhibitor (Trichostatin A and an inhibitor of Polr3 (ML-60218 synergistically prohibited the expansion of exocrine pancreas. In human pancreatic adenocarcinoma cells, combination of the HDAC inhibitor suberoylanilide hydroxamic acid (SAHA and ML-60218 produced augmented suppression of colony formation and proliferation, and induction of cell cycle arrest and apoptotic cell death. The enhanced cytotoxicity was associated with supra-additive upregulation of the pro-apoptotic regulator BAX and the cyclin-dependent kinase inhibitor p21CDKN1A. tRNAs have been shown to have pro-proliferative and anti-apoptotic roles, and SAHA-stimulated expression of tRNAs was reversed by ML-60218. These findings demonstrate that chemically targeting developmental regulators of exocrine pancreas can be translated into an approach with potential impact on therapeutic response in pancreatic cancer, and suggest that counteracting the pro-malignant side effect of HDAC inhibitors can enhance their anti-tumor activity.
Mutations of PTPN23 in developmental and epileptic encephalopathy
Sowada, Nadine; Hashem, Mais Omar; Yilmaz, Rü stem; Hamad, Muddathir; Kakar, Naseebullah; Thiele, Holger; Arold, Stefan T.; Bode, Harald; Alkuraya, Fowzan S.; Borck, Guntram
2017-01-01
-resistant epilepsy, severe and global developmental delay, microcephaly, and sometimes premature death. PTPN23 encodes a tyrosine phosphatase with strong brain expression, and its knockout in mouse is embryonically lethal. Structural modeling supports a deleterious
Developmental effects of extremely low frequency electric and magnetic fields
International Nuclear Information System (INIS)
Juutilainen, J.
2003-01-01
Developmental effects of extremely low frequency (ELF) electric and magnetic fields are briefly reviewed in this paper. The results of animal studies on ELF electric fields are rather consistent, and do not suggest adverse effects on development. The results of studies on ELF magnetic fields suggest effects on bird embryo development, but not consistently in all studies. Results from experiments with other non-mammalian species have also suggested effects on developmental stability. In mammals, pre-natal exposure to ELF magnetic fields does not result in strong adverse effects on development. The only finding that shows some consistency is increase of minor skeleton alterations. Epidemiological studies do not establish an association between human adverse pregnancy outcomes and maternal exposure to ELF fields, although a few studies have reported increased risks associated with some characteristics of magnetic field exposure. Taken as a whole, the results do not show strong adverse effects on development. However, additional studies on the suggested subtle effects on developmental stability might increase our understanding of the sensitivity of organisms to weak ELF fields. (author)
Renaud, Sabrina; Pantalacci, Sophie; Quéré, Jean-Pierre; Laudet, Vincent; Auffray, Jean-Christophe
2009-01-01
Morphological integration corresponds to interdependency between characters that can arise from several causes. Proximal causes of integration include that different phenotypic features may share common genetic sets and/or interact during their development. Ultimate causes may be the prolonged effect of selection favoring integration of functionally interacting characters, achieved by the molding of these proximal causes. Strong and direct interactions among successive teeth of a molar row are predicted by genetic and developmental evidences. Functional constraints related to occlusion, however, should have selected more strongly for a morphological integration of occluding teeth and a corresponding evolution of the underlying developmental and genetic pathways. To investigate how these predictions match the patterns of phenotypic integration, we studied the co-variation among the six molars of the murine molar row, focusing on two populations of house mice (Mus musculus domesticus) and wood mice (Apodemus sylvaticus). The size and shape of the three upper and lower molars were quantified and compared. Our results evidenced similar patterns in both species, size being more integrated than shape among all the teeth, and both size and shape co-varying strongly between adjacent teeth, but also between occluding teeth. Strong co-variation within each molar row is in agreement with developmental models showing a cascade influence of the first molar on the subsequent molars. In contrast, the strong co-variation between molars of the occluding tooth rows confirms that functional constraints molded patterns of integration and probably the underlying developmental pathways despite the low level of direct developmental interactions occurring among molar rows. These patterns of co-variation are furthermore conserved between the house mouse and the wood mouse that diverged >10 Ma, suggesting that they may constitute long-running constraints to the diversification of the murine
Utz, Sandra; Huetteroth, Wolf; Vömel, Matthias; Schachtner, Joachim
2008-01-01
The paired antennal lobes (ALs) of the sphinx moth Manduca sexta serve as a well-established model for studying development of the primary integration centers for odor information in the brain. To further reveal the role of neuropeptides during AL development, we have analyzed cellular distribution, developmental time course, and regulation of the neuropeptide M. sexta allatotropin (Mas-AT). On the basis of morphology and appearance during AL formation, seven major types of Mas-AT-immunoreactive (ir) cells could be distinguished. Mas-AT-ir cells are identified as local, projection, and centrifugal neurons, which are either persisting larval or newly added adult-specific neurons. Complementary immunostaining with antisera against two other neuropeptide families (A-type allatostatins, RFamides) revealed colocalization within three of the Mas-AT-ir cell types. On the basis of this neurochemistry, the most prominent type of Mas-AT-ir neurons, the local AT neurons (LATn), could be divided in three subpopulations. The appearance of the Mas-AT-ir cell types occurring during metamorphosis parallels the rising titer of the developmental hormone 20-hydroxyecdysone (20E). Artificially shifting the 20E titer to an earlier developmental time point resulted in the precocious occurrence of Mas-AT immunostaining. This result supports the hypothesis that the pupal rise of 20E is causative for Mas-AT expression during AL development. Comparing localization and developmental time course of Mas-AT and other neuropeptides with the time course of AL formation suggests various functions for these neuropeptides during development, including an involvement in the formation of the olfactory glomeruli.
Xu, Chunxiang; Zhao, Lu; Pan, Xiao; Šamaj, Jozef
2011-01-01
Background The plant cell walls play an important role in somatic embryogenesis and plant development. Pectins are major chemical components of primary cell walls while homogalacturonan (HG) is the most abundant pectin polysaccharide. Developmental regulation of HG methyl-esterification degree is important for cell adhesion, division and expansion, and in general for proper organ and plant development. Methodology/Principal Findings Developmental localization of pectic homogalacturonan (HG) epitopes and the (1→4)-β-D-galactan epitope of rhamnogalacturonan I (RG-I) and degree of pectin methyl-esterification (DM) were studied during somatic embryogenesis of banana (Musa spp. AAA). Histological analysis documented all major developmental stages including embryogenic cells (ECs), pre-globular, globular, pear-shaped and cotyledonary somatic embryos. Histochemical staining of extracellularly secreted pectins with ruthenium red showed the most intense staining at the surface of pre-globular, globular and pear-shaped somatic embryos. Biochemical analysis revealed developmental regulation of galacturonic acid content and DM in diverse embryogenic stages. Immunodots and immunolabeling on tissue sections revealed developmental regulation of highly methyl-esterified HG epitopes recognized by JIM7 and LM20 antibodies during somatic embryogenesis. Cell walls of pre-globular/globular and late-stage embryos contained both low methyl-esterified HG epitopes as well as partially and highly methyl-esterified ones. Extracellular matrix which covered surface of early developing embryos contained pectin epitopes recognized by 2F4, LM18, JIM5, JIM7 and LM5 antibodies. De-esterification of cell wall pectins by NaOH caused a decrease or an elimination of immunolabeling in the case of highly methyl-esterified HG epitopes. However, immunolabeling of some low methyl-esterified epitopes appeared stronger after this base treatment. Conclusions/Significance These data suggest that both low
Developmental toxicology: adequacy of current methods.
Peters, P W
1998-01-01
Toxicology embraces several disciplines such as carcinogenicity, mutagenicity and reproductive toxicity. Reproductive toxicology is concerned with possible effects of substances on the reproductive process, i.e. on sexual organs and their functions, endocrine regulation, fertilization, transport of the fertilized ovum, implantation, and embryonic, fetal and postnatal development, until the end-differentiation of the organs is achieved. Reproductive toxicology is divided into areas related to male and female fertility, and developmental toxicology. Developmental toxicology can be further broken down into prenatal and postnatal toxicology. Today, much new information is available about the origins of developmental disorders resulting from chemical exposure. While these findings seem to promise important new developments in methodology and research, there is a danger of losing sight of the precepts and principles established in the light of existing knowledge. There is also a danger that we may fail to correct shortcomings in our existing procedures and practice. The aim of this presentation is to emphasize the importance of testing substances for their impact in advance of their use and to underline that we must use the best existing tools for carrying out risk assessments. Moreover, it needs to be stressed that there are many substances that are never assessed with respect to reproductive and developmental toxicity. Similarly, our programmes for post-marketing surveillance with respect to developmental toxicology are grossly inadequate. Our ability to identify risks to normal development and reproduction would be much improved, first if a number of straightforward precepts were always followed and second, if we had a clearer understanding of what we mean by risk and acceptable levels of risk in the context of development. Other aims of this paper are: to stress the complexity of the different stages of normal prenatal development; to note the principles that are
Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders
Fagan, Jeffrey; Piquero, Alex R.
2007-01-01
Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and dec...
Cirhin up-regulates a canonical NF-{kappa}B element through strong interaction with Cirip/HIVEP1
Energy Technology Data Exchange (ETDEWEB)
Yu, Bin; Mitchell, Grant A. [Genetique Medicale, Centre de Recherche CHU Sainte-Justine, Departement de Pediatrie, Universite de Montreal, Montreal, QC (Canada); Richter, Andrea, E-mail: andrea.richter@umontreal.ca [Genetique Medicale, Centre de Recherche CHU Sainte-Justine, Departement de Pediatrie, Universite de Montreal, Montreal, QC (Canada)
2009-11-01
North American Indian childhood cirrhosis (NAIC/CIRH1A) is a severe autosomal recessive intrahepatic cholestasis. All NAIC patients have a homozygous mutation in CIRH1A that changes conserved Arg565 to Trp (R565W) in Cirhin, a nucleolar protein of unknown function. Subcellular localization is unaffected by the mutation. Yeast two-hybrid screening identified Cirip (Cirhin interaction protein) and found that interaction between Cirip and R565W-Cirhin was weakened. Co-immunoprecipitation of the two proteins from nuclear extracts of HeLa cells strongly supports the yeast two hybrid results. Cirip has essentially the same sequence as the C-terminal of HIVEP1, a regulator of a canonical NF-{kappa}B sequence. Since Cirip has the zinc fingers required for this interaction, we developed an in vitro assay based on this element in mammalian cells to demonstrate functional Cirhin-Cirip interaction. The strong positive effect of Cirip on the NF-{kappa}B sequence was further increased by both Cirhin and R565W-Cirhin. Importantly, the effect of R565W-Cirhin was weaker than that of the wild type protein. We observed increased levels of Cirhin-Cirip complex in nuclear extracts in the presence of this NF-{kappa}B sequence. Our hypothesis is that Cirhin is a transcriptional regulatory factor of this NF-{kappa}B sequence and could be a participant in the regulation of other genes with NF-{kappa}B responsive elements. Since the activities of genes regulated through NF-{kappa}B responsive elements are especially important during development, this interaction may be a key to explain the perinatal appearance of NAIC.
Cirhin up-regulates a canonical NF-κB element through strong interaction with Cirip/HIVEP1
International Nuclear Information System (INIS)
Yu, Bin; Mitchell, Grant A.; Richter, Andrea
2009-01-01
North American Indian childhood cirrhosis (NAIC/CIRH1A) is a severe autosomal recessive intrahepatic cholestasis. All NAIC patients have a homozygous mutation in CIRH1A that changes conserved Arg565 to Trp (R565W) in Cirhin, a nucleolar protein of unknown function. Subcellular localization is unaffected by the mutation. Yeast two-hybrid screening identified Cirip (Cirhin interaction protein) and found that interaction between Cirip and R565W-Cirhin was weakened. Co-immunoprecipitation of the two proteins from nuclear extracts of HeLa cells strongly supports the yeast two hybrid results. Cirip has essentially the same sequence as the C-terminal of HIVEP1, a regulator of a canonical NF-κB sequence. Since Cirip has the zinc fingers required for this interaction, we developed an in vitro assay based on this element in mammalian cells to demonstrate functional Cirhin-Cirip interaction. The strong positive effect of Cirip on the NF-κB sequence was further increased by both Cirhin and R565W-Cirhin. Importantly, the effect of R565W-Cirhin was weaker than that of the wild type protein. We observed increased levels of Cirhin-Cirip complex in nuclear extracts in the presence of this NF-κB sequence. Our hypothesis is that Cirhin is a transcriptional regulatory factor of this NF-κB sequence and could be a participant in the regulation of other genes with NF-κB responsive elements. Since the activities of genes regulated through NF-κB responsive elements are especially important during development, this interaction may be a key to explain the perinatal appearance of NAIC.
Directory of Open Access Journals (Sweden)
Vincent eVan Waes
2012-03-01
Full Text Available Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains. We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25 and then progressively decreases towards adolescent (P40 and adult (P70 levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors receive inputs from cortical regions with higher expression (medial prefrontal cortex. In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important.
Holwerda, Anja; Brouwer, Sandra; de Boer, Michiel R.; Groothoff, Johan W.; van der Klink, Jac J. L.
2015-01-01
Purpose Expectations strongly influence future employment outcomes and social networks seem to mediate employment success of young adults with intellectual and developmental disabilities. The aim of this study is to examine the expectations of young adults with intellectual and developmental
Holwerda, A.; Brouwer, S.; de Boer, M.R.; Groothoff, J.W.; van der Klink, J.J.L.
2015-01-01
Purpose Expectations strongly influence future employment outcomes and social networks seem to mediate employment success of young adults with intellectual and developmental disabilities. The aim of this study is to examine the expectations of young adults with intellectual and developmental
Holwerda, Anja; Brouwer, Sandra; de Boer, Michiel R.; Groothoff, Johan W.; van der Klink, Jac J. L.
Purpose Expectations strongly influence future employment outcomes and social networks seem to mediate employment success of young adults with intellectual and developmental disabilities. The aim of this study is to examine the expectations of young adults with intellectual and developmental
Dang, Michelle T.
2010-01-01
A significant number of children in the United States have developmental disabilities. Historically, many children with developmental disabilities were institutionalized and rarely seen in public. Currently, children with developmental disabilities are entitled to education and health-related support services that permit them access to public…
Directory of Open Access Journals (Sweden)
Jonathan D Stoltzfus
2014-07-01
Full Text Available The infectious form of the parasitic nematode Strongyloides stercoralis is a developmentally arrested third-stage larva (L3i, which is morphologically similar to the developmentally arrested dauer larva in the free-living nematode Caenorhabditis elegans. We hypothesize that the molecular pathways regulating C. elegans dauer development also control L3i arrest and activation in S. stercoralis. This study aimed to determine the factors that regulate L3i activation, with a focus on G protein-coupled receptor-mediated regulation of cyclic guanosine monophosphate (cGMP pathway signaling, including its modulation of the insulin/IGF-1-like signaling (IIS pathway. We found that application of the membrane-permeable cGMP analog 8-bromo-cGMP potently activated development of S. stercoralis L3i, as measured by resumption of feeding, with 85.1 ± 2.2% of L3i feeding in 200 µM 8-bromo-cGMP in comparison to 0.6 ± 0.3% in the buffer diluent. Utilizing RNAseq, we examined L3i stimulated with DMEM, 8-bromo-cGMP, or the DAF-12 nuclear hormone receptor (NHR ligand Δ7-dafachronic acid (DA--a signaling pathway downstream of IIS in C. elegans. L3i stimulated with 8-bromo-cGMP up-regulated transcripts of the putative agonistic insulin-like peptide (ILP -encoding genes Ss-ilp-1 (20-fold and Ss-ilp-6 (11-fold in comparison to controls without stimulation. Surprisingly, we found that Δ7-DA similarly modulated transcript levels of ILP-encoding genes. Using the phosphatidylinositol-4,5-bisphosphate 3-kinase inhibitor LY294002, we demonstrated that 400 nM Δ7-DA-mediated activation (93.3 ± 1.1% L3i feeding can be blocked using this IIS inhibitor at 100 µM (7.6 ± 1.6% L3i feeding. To determine the tissues where promoters of ILP-encoding genes are active, we expressed promoter::egfp reporter constructs in transgenic S. stercoralis post-free-living larvae. Ss-ilp-1 and Ss-ilp-6 promoters are active in the hypodermis and neurons and the Ss-ilp-7 promoter is active in the
International Nuclear Information System (INIS)
Huang, Lixing; Wang, Chonggang; Zhang, Youyu; Wu, Meifang; Zuo, Zhenghong
2013-01-01
Highlights: • Phe exposure caused obvious morphological changes in the retina. • Phe exposure caused apoptosis and reduction of cell proliferation in the retina. • Phe causes ocular toxicity might be via the AhR/Zeb1/Mitf/Pax6 signaling pathway. • AhR is a repressor of Zeb1. -- Abstract: Recent studies show that polycyclic aromatic hydrocarbons (PAHs) may be a candidate cause of developmental defects of the retina, but the mechanism is still unclear. We evaluated the mechanism(s) underlying PAH-induced retinal development defects due to exposure to environmental concentrations of Phenanthrene (Phe) in zebrafish. We found that exposure to environmental concentrations of Phe caused obvious morphological changes, developmental retardation, apoptosis, and reduction of cell proliferation in the retina. Our results indicated that Phe could cause visual system developmental defects. Phe exposure up-regulated aryl hydrocarbon receptor (AhR) and microphthalmia-associated transcription factor (Mtif) expression, and down-regulated zinc finger E-box binding homeobox 1 (Zeb1) and paired box 6 (Pax6). Moreover, we demonstrated that AhR was a repressor of Zeb1. We propose that Phe's ocular toxicity is mediated by up-regulating AhR, which then down-regulates Zeb1, in turn inducing Mitf expression while inhibiting Pax6 expression
Hydroxylated PBDEs induce developmental arrest in zebrafish
Energy Technology Data Exchange (ETDEWEB)
Usenko, Crystal Y., E-mail: Crystal_usenko@baylor.edu; Hopkins, David C.; Trumble, Stephen J., E-mail: Stephen_trumble@baylor.edu; Bruce, Erica D., E-mail: Erica_bruce@baylor.edu
2012-07-01
The ubiquitous spread of polybrominated diphenyl ethers (PBDEs) has led to concerns regarding the metabolites of these congeners, in particular hydroxylated PBDEs. There are limited studies regarding the biological interactions of these chemicals, yet there is some concern they may be more toxic than their parent compounds. In this study three hydroxylated PBDEs were assessed for toxicity in embryonic zebrafish: 3-OH-BDE 47, 5-OH-BDE 47, and 6-OH-BDE 47. All three congeners induced developmental arrest in a concentration-dependent manner; however, 6-OH-BDE 47 induced adverse effects at lower concentrations than the other congeners. Furthermore, all three induced cell death; however apoptosis was not observed. In short-term exposures (24–28 hours post fertilization), all hydroxylated PBDEs generated oxidative stress in the region corresponding to the cell death at 5 and 10 ppm. To further investigate the short-term effects that may be responsible for the developmental arrest observed in this study, gene regulation was assessed for embryos exposed to 0.625 ppm 6-OH-BDE 47 from 24 to 28 hpf. Genes involved in stress response, thyroid hormone regulation, and neurodevelopment were significantly upregulated compared to controls; however, genes related to oxidative stress were either unaffected or downregulated. This study suggests that hydroxylated PBDEs disrupt development, and may induce oxidative stress and potentially disrupt the cholinergic system and thyroid hormone homeostasis. -- Highlights: ► OH-PBDEs induce developmental arrest in a concentration-dependent manner. ► Hydroxyl group location influences biological interaction. ► OH-PBDEs induce oxidative stress. ► Thyroid hormone gene regulation was disrupted following exposure. ► To our knowledge, this is the first whole organism study of OH-PBDE toxicity.
Impact of developmental lead exposure on splenic factors
International Nuclear Information System (INIS)
Kasten-Jolly, Jane; Heo, Yong; Lawrence, David A.
2010-01-01
Lead (Pb) is known to alter the functions of numerous organ systems, including the hematopoietic and immune systems. Pb can induce anemia and can lower host resistance to bacterial and viral infections. The anemia is due to Pb's inhibition of hemoglobin synthesis and Pb's induction of membrane changes, leading to early erythrocyte senescence. Pb also increases B-cell activation/proliferation and skews T-cell help (Th) toward Th2 subset generation. The specific mechanisms for many of the Pb effects are, as yet, not completely understood. Therefore, we performed gene expression analysis, via microarray, on RNA from the spleens of developmentally Pb-exposed mice, in order to gain further insight into these Pb effects. Splenic RNA microarray analysis indicated strong up-regulation of genes coding for proteolytic enzymes, lipases, amylase, and RNaseA. The data also showed that Pb affected the expression of many genes associated with innate immunity. Analysis of the microarray results via GeneSifter software indicated that Pb increased apoptosis, B-cell differentiation, and Th2 development. Direct up-regulation by Pb of expression of the gene encoding the heme-regulated inhibitor (HRI) suggested that Pb can decrease erythropoiesis by blocking globin mRNA translation. Pb's high elevation of digestive/catabolizing enzymes could generate immunogenic self peptides. With Pb's potential to induce new self-peptides and to enhance the expression of caspases, cytokines, and other immunomodulators, further evaluation of Pb's involvement in autoimmune phenomena, especially Th2-mediated autoantibody production, and alteration of organ system activities is warranted.
Developmental control of hypoxia during bud burst in grapevine.
Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J
2018-05-01
Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.
Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram
2003-12-01
Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.
Microcystin-LR exposure induces developmental neurotoxicity in zebrafish embryo
International Nuclear Information System (INIS)
Wu, Qin; Yan, Wei; Liu, Chunsheng; Li, Li; Yu, Liqin; Zhao, Sujuan; Li, Guangyu
2016-01-01
Microcystin-LR (MCLR) is a commonly acting potent hepatotoxin and has been pointed out of potentially causing developmental neurotoxicity, but the exact mechanism is little known. In this study, zebrafish embryos were exposed to 0, 0.8, 1.6 or 3.2 mg/L MCLR for 120 h. MCLR exposure through submersion caused serious hatching delay and body length decrease. The content of MCLR in zebrafish larvae was analyzed and the results demonstrated that MCLR can accumulate in zebrafish larvae. The locomotor speed of zebrafish larvae was decreased. Furthermore, the dopamine and acetylcholine (ACh) content were detected to be significantly decreased in MCLR exposure groups. And the acetylcholinesterase (AChE) activity was significantly increased after exposure to 1.6 and 3.2 mg/L MCLR. The transcription pattern of manf, chrnα7 and ache gene was consistent with the change of the dopamine content, ACh content and AChE activity. Gene expression involved in the development of neurons was also measured. α1-tubulin and shha gene expression were down-regulated, whereas mbp and gap43 gene expression were observed to be significantly up-regulated upon exposure to MCLR. The above results indicated that MCLR-induced developmental toxicity might attribute to the disorder of cholinergic system, dopaminergic signaling, and the development of neurons. - Highlights: • MCLR accumulation induces developmental neurotoxicity in zebrafish embryo. • The decrease of dopamine levels might be associated with the MCLR-induced developmental neurotoxicity in zebrafish larvae. • The alternation of cholinergic system might contribute to the change of neurobehavior in zebrafish larvae exposure with MCLR. - MCLR accumulation induces developmental neurotoxicity by affecting cholinergic system, dopaminergic signaling, and the development of neurons in zebrafish embryo.
Constructivist developmental theory is needed in developmental neuroscience
Arsalidou, Marie; Pascual-Leone, Juan
2016-12-01
Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.
Developmental neurotoxicity of different pesticides in PC-12 cells in vitro
Energy Technology Data Exchange (ETDEWEB)
Christen, Verena [University of Applied Sciences and Arts Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132, Muttenz (Switzerland); Rusconi, Manuel; Crettaz, Pierre [Federal Office of Public Health, Division Chemical Products, 3003 Bern (Switzerland); Fent, Karl, E-mail: karl.fent@bluewin.ch [University of Applied Sciences and Arts Northwestern Switzerland, School of Life Sciences, Gründenstrasse 40, CH-4132, Muttenz (Switzerland); Swiss Federal Institute of Technology Zürich (ETH Zürich), Department of Environmental Systems Sciences, Institute of Biogeochemistry and Pollution Dynamics, CH-8092 Zürich (Switzerland)
2017-06-15
The detection of developmental neurotoxicity (DNT) of chemicals has high relevance for protection of human health. However, DNT of many pesticides is only little known. Furthermore, validated in vitro systems for assessment of DNT are not well established. Here we employed the rat phaeochromocytoma cell line PC-12 to evaluate DNT of 18 frequently used pesticides of different classes, including neonicotinoids, pyrethroids, organophosphates, organochlorines, as well as quaternary ammonium compounds, the organic compound used in pesticides, piperonyl butoxide, as well as the insect repellent diethyltoluamide (DEET). We determined the outgrowth of neurites in PC-12 cells co-treated with nerve growth factor and different concentrations of biocides for 5 days. Furthermore, we determined transcriptional alterations of selected genes that may be associated with DNT, such as camk2α and camk2β, gap-43, neurofilament-h, tubulin-α and tubulin-β. Strong and dose- dependent inhibition of neurite outgrowth was induced by azamethiphos and chlorpyrifos, and dieldrin and heptachlor, which was correlated with up-regulation of gap-43. No or only weak effects on neurite outgrowth and transcriptional alterations occurred for neonicotinoids acetamiprid, clothianidin, imidacloprid and thiamethoxam, the pyrethroids λ-cyhalothrin, cyfluthrin, deltamethrin, and permethrin, the biocidal disinfectants C12-C14-alkyl(ethylbenzyl)dimethylammonium (BAC), benzalkonium chloride and barquat (dimethyl benzyl ammonium chloride), and piperonyl butoxide and DEET. Our study confirms potential developmental neurotoxicity of some pesticides and provides first evidence that azamethiphos has the potential to act as a developmental neurotoxic compound. We also demonstrate that inhibition of neurite outgrowth and transcriptional alterations of gap-43 expression correlate, which suggests the employment of gap-43 expression as a biomarker for detection and initial evaluation of potential DNT of chemicals
Developmental neurotoxicity of different pesticides in PC-12 cells in vitro
International Nuclear Information System (INIS)
Christen, Verena; Rusconi, Manuel; Crettaz, Pierre; Fent, Karl
2017-01-01
The detection of developmental neurotoxicity (DNT) of chemicals has high relevance for protection of human health. However, DNT of many pesticides is only little known. Furthermore, validated in vitro systems for assessment of DNT are not well established. Here we employed the rat phaeochromocytoma cell line PC-12 to evaluate DNT of 18 frequently used pesticides of different classes, including neonicotinoids, pyrethroids, organophosphates, organochlorines, as well as quaternary ammonium compounds, the organic compound used in pesticides, piperonyl butoxide, as well as the insect repellent diethyltoluamide (DEET). We determined the outgrowth of neurites in PC-12 cells co-treated with nerve growth factor and different concentrations of biocides for 5 days. Furthermore, we determined transcriptional alterations of selected genes that may be associated with DNT, such as camk2α and camk2β, gap-43, neurofilament-h, tubulin-α and tubulin-β. Strong and dose- dependent inhibition of neurite outgrowth was induced by azamethiphos and chlorpyrifos, and dieldrin and heptachlor, which was correlated with up-regulation of gap-43. No or only weak effects on neurite outgrowth and transcriptional alterations occurred for neonicotinoids acetamiprid, clothianidin, imidacloprid and thiamethoxam, the pyrethroids λ-cyhalothrin, cyfluthrin, deltamethrin, and permethrin, the biocidal disinfectants C12-C14-alkyl(ethylbenzyl)dimethylammonium (BAC), benzalkonium chloride and barquat (dimethyl benzyl ammonium chloride), and piperonyl butoxide and DEET. Our study confirms potential developmental neurotoxicity of some pesticides and provides first evidence that azamethiphos has the potential to act as a developmental neurotoxic compound. We also demonstrate that inhibition of neurite outgrowth and transcriptional alterations of gap-43 expression correlate, which suggests the employment of gap-43 expression as a biomarker for detection and initial evaluation of potential DNT of chemicals
Main tasks of studying strong regulation of excitation of complex electrical system generators
Energy Technology Data Exchange (ETDEWEB)
Gruzdev, I.A.; Yekimova, M.M.
1982-01-01
A survey is made of the current state of studies of the damping properties of complex electricity systems. The calculation programs of stability are based on frequency methods using the method of D-division. Now, when ARV of strong effect dominates at the SG, the task of coordinating their adjustments develops. Consequently, the following questions are discussed: study of the properties of quality functional with several points of regulation in the circuits of different structure; development of the efficient procedures for coordinating the ARV adjustment of the related energy systems; and creation of resources for solving these tasks. Results are presented of coordinating the ARV adjustments of the generators of the 3-machine electricity system. As an example, nonlinear relationships are shown between the obtained degree of stability and the coefficient of stabilization.
Johnson, Norman A; Porter, Adam H
2007-01-01
Developmental systems are regulated by a web of interacting loci. One common and useful approach in studying the evolution of development is to focus on classes of interacting elements within these systems. Here, we use individual-based simulations to study the evolution of traits controlled by branched developmental pathways involving three loci, where one locus regulates two different traits. We examined the system under a variety of selective regimes. In the case where one branch was under stabilizing selection and the other under directional selection, we observed "developmental system drift": the trait under stabilizing selection showed little phenotypic change even though the loci underlying that trait showed considerable evolutionary divergence. This occurs because the pleiotropic locus responds to directional selection and compensatory mutants are then favored in the pathway under stabilizing selection. Though developmental system drift may be caused by other mechanisms, it seems likely that it is accelerated by the same underlying genetic mechanism as that producing the Dobzhansky-Muller incompatibilities that lead to speciation in both linear and branched pathways. We also discuss predictions of our model for developmental system drift and how different selective regimes affect probabilities of speciation in the branched pathway system.
LeCuyer, Elizabeth A; Zhang, Yi
2015-04-01
To examine the evidence for cross-cultural variation in socialization and children's normative self-regulation, based on a contextual-developmental perspective. Nurses and healthcare workers in multi-cultural societies must understand diversity in socializing influences (including parenting) and in children's behaviour. A contextual-developmental perspective implies that normative cultural and ethnic values will influence socializing processes and behaviour, which in turn will influence children's self-regulation. Integrative review. Studies were located using five major search engines from 1990-2011. Domains of a contextual-developmental perspective and a comprehensive definition of self-regulation assisted the generation of search terms. Selected studies compared at least two ethnic or cultural groups and addressed contextual-developmental domains: (1) culturally specific social values, beliefs, or attitudes; (2) socializing behaviours; and (3) children's normative self-regulation. Eleven studies about children's self-regulation were found to have data consistent with a contextual-developmental perspective. Studies used descriptive correlational or comparative designs with primarily convenience sampling; eight confirmed stated hypotheses, three were exploratory. Findings across studies evidenced coherent patterns of sociocultural influence on children's attention, compliance, delay of gratification, effortful control and executive function. A contextual-developmental perspective provided a useful perspective to examine normative differences in values, socializing behaviours and children's self-regulation. This perspective and these findings are expected to guide future research, to assist nurses and healthcare providers to understand diversity in parenting and children's behaviour. © 2014 John Wiley & Sons Ltd.
Eco-Evo-Devo: developmental symbiosis and developmental plasticity as evolutionary agents.
Gilbert, Scott F; Bosch, Thomas C G; Ledón-Rettig, Cristina
2015-10-01
The integration of research from developmental biology and ecology into evolutionary theory has given rise to a relatively new field, ecological evolutionary developmental biology (Eco-Evo-Devo). This field integrates and organizes concepts such as developmental symbiosis, developmental plasticity, genetic accommodation, extragenic inheritance and niche construction. This Review highlights the roles that developmental symbiosis and developmental plasticity have in evolution. Developmental symbiosis can generate particular organs, can produce selectable genetic variation for the entire animal, can provide mechanisms for reproductive isolation, and may have facilitated evolutionary transitions. Developmental plasticity is crucial for generating novel phenotypes, facilitating evolutionary transitions and altered ecosystem dynamics, and promoting adaptive variation through genetic accommodation and niche construction. In emphasizing such non-genomic mechanisms of selectable and heritable variation, Eco-Evo-Devo presents a new layer of evolutionary synthesis.
Zhong, Hai-Jing; Wang, Wanhe; Kang, Tian-Shu; Yan, Hui; Yang, Yali; Xu, Lipeng; Wang, Yuqiang; Ma, Dik-Lung; Leung, Chung-Hang
2017-01-12
We report herein the identification of the rhodium(III) complex [Rh(phq) 2 (MOPIP)] + (1) as a potent and selective ATP-competitive neural precursor cell expressed, developmentally down-regulated 8 (NEDD8)-activating enzyme (NAE) inhibitor. Structure-activity relationship analysis indicated that the overall organometallic design of complex 1 was important for anti-inflammatory activity. Complex 1 showed promising anti-inflammatory activity in vivo for the potential treatment of inflammatory bowel disease.
Developmental programming of appetite/satiety.
Ross, Michael G; Desai, Mina
2014-01-01
Obesity is often attributed to a Western lifestyle, a high-fat diet and decreased activity. While these factors certainly contribute to adult obesity, compelling data from our laboratory and others indicate that this explanation is oversimplified. Recent studies strongly argue that maternal/fetal under- or overnutrition predisposes the offspring to become hyperphagic and increases the risk of later obesity. Both infants small for gestational age (SGA) or infants born to obese mothers who consume a high-fat diet are at a markedly increased risk of adult obesity. Specific alterations in the fetal metabolic/energy environment directly influence the development of appetite regulatory pathways. Specifically, SGA infants demonstrate (1) impaired satiety and anorexigenic cell signaling, (2) enhanced cellular orexigenic responses, (3) programmed dysfunction of neuroprogenitor cell proliferation/differentiation, and (4) increased expression of appetite (NPY) versus satiety (POMC) neurons. In both hypothalamic tissue and ex vivo culture, SGA newborns exhibit increased levels of the nutrient sensor SIRT1, signifying reduced energy, whereas maternal high-fat-exposed newborns exhibit reduced levels of pAMPK, signifying energy excess. Via downstream regulation of bHLH neuroproliferation (Hes1) and neurodifferentiation factors (Mash1, Ngn3), neurogenesis is biased toward orexigenic and away from anorexigenic neurons, resulting in excess appetite, reduced satiety and development of obesity. Despite the developmental programming of appetite neurogenesis, the potential for neuronal remodeling raises the opportunity for novel interventions.
Developmental neurotoxicity of different pesticides in PC-12 cells in vitro.
Christen, Verena; Rusconi, Manuel; Crettaz, Pierre; Fent, Karl
2017-06-15
The detection of developmental neurotoxicity (DNT) of chemicals has high relevance for protection of human health. However, DNT of many pesticides is only little known. Furthermore, validated in vitro systems for assessment of DNT are not well established. Here we employed the rat phaeochromocytoma cell line PC-12 to evaluate DNT of 18 frequently used pesticides of different classes, including neonicotinoids, pyrethroids, organophosphates, organochlorines, as well as quaternary ammonium compounds, the organic compound used in pesticides, piperonyl butoxide, as well as the insect repellent diethyltoluamide (DEET). We determined the outgrowth of neurites in PC-12 cells co-treated with nerve growth factor and different concentrations of biocides for 5days. Furthermore, we determined transcriptional alterations of selected genes that may be associated with DNT, such as camk2α and camk2β, gap-43, neurofilament-h, tubulin-α and tubulin-β. Strong and dose- dependent inhibition of neurite outgrowth was induced by azamethiphos and chlorpyrifos, and dieldrin and heptachlor, which was correlated with up-regulation of gap-43. No or only weak effects on neurite outgrowth and transcriptional alterations occurred for neonicotinoids acetamiprid, clothianidin, imidacloprid and thiamethoxam, the pyrethroids λ-cyhalothrin, cyfluthrin, deltamethrin, and permethrin, the biocidal disinfectants C12-C14-alkyl(ethylbenzyl)dimethylammonium (BAC), benzalkonium chloride and barquat (dimethyl benzyl ammonium chloride), and piperonyl butoxide and DEET. Our study confirms potential developmental neurotoxicity of some pesticides and provides first evidence that azamethiphos has the potential to act as a developmental neurotoxic compound. We also demonstrate that inhibition of neurite outgrowth and transcriptional alterations of gap-43 expression correlate, which suggests the employment of gap-43 expression as a biomarker for detection and initial evaluation of potential DNT of chemicals
Regulation of Expressive Behavior as Reflecting Affect Socialization.
Saarni, Carolyn
Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…
The phenotypic plasticity of developmental modules
Directory of Open Access Journals (Sweden)
Aabha I. Sharma
2016-08-01
Full Text Available Abstract Background Organisms develop and evolve in a modular fashion, but how individual modules interact with the environment remains poorly understood. Phenotypically plastic traits are often under selection, and studies are needed to address how traits respond to the environment in a modular fashion. In this study, tissue-specific plasticity of melanic spots was examined in the large milkweed bug, Oncopeltus fasciatus. Results Although the size of the abdominal melanic bands varied according to rearing temperatures, wing melanic bands were more robust. To explore the regulation of abdominal pigmentation plasticity, candidate genes involved in abdominal melanic spot patterning and biosynthesis of melanin were analyzed. While the knockdown of dopa decarboxylase (Ddc led to lighter pigmentation in both the wings and the abdomen, the shape of the melanic elements remained unaffected. Although the knockdown of Abdominal-B (Abd-B partially phenocopied the low-temperature phenotype, the abdominal bands were still sensitive to temperature shifts. These observations suggest that regulators downstream of Abd-B but upstream of DDC are responsible for the temperature response of the abdomen. Ablation of wings led to the regeneration of a smaller wing with reduced melanic bands that were shifted proximally. In addition, the knockdown of the Wnt signaling nuclear effector genes, armadillo 1 and armadillo 2, altered both the melanic bands and the wing shape. Thus, the pleiotropic effects of Wnt signaling may constrain the amount of plasticity in wing melanic bands. Conclusions We propose that when traits are regulated by distinct pre-patterning mechanisms, they can respond to the environment in a modular fashion, whereas when the environment impacts developmental regulators that are shared between different modules, phenotypic plasticity can manifest as a developmentally integrated system.
Regulation of signaling genes by TGFβ during entry into dauer diapause in C. elegans
Directory of Open Access Journals (Sweden)
Patterson Garth I
2004-09-01
Full Text Available Abstract Background When resources are scant, C. elegans larvae arrest as long-lived dauers under the control of insulin/IGF- and TGFβ-related signaling pathways. However, critical questions remain regarding the regulation of this developmental event. How do three dozen insulin-like proteins regulate one tyrosine kinase receptor to control complex events in dauer, metabolism and aging? How are signals from the TGFβ and insulin/IGF pathways integrated? What gene expression programs do these pathways regulate, and how do they control complex downstream events? Results We have identified genes that show different levels of expression in a comparison of wild-type L2 or L3 larvae (non-dauer to TGFβ mutants at similar developmental stages undergoing dauer formation. Many insulin/IGF pathway and other known dauer regulatory genes have changes in expression that suggest strong positive feedback by the TGFβ pathway. In addition, many insulin-like ligand and novel genes with similarity to the extracellular domain of insulin/IGF receptors have altered expression. We have identified a large group of regulated genes with putative binding sites for the FOXO transcription factor, DAF-16. Genes with DAF-16 sites upstream of the transcription start site tend to be upregulated, whereas genes with DAF-16 sites downstream of the coding region tend to be downregulated. Finally, we also see strong regulation of many novel hedgehog- and patched-related genes, hormone biosynthetic genes, cell cycle genes, and other regulatory genes. Conclusions The feedback regulation of insulin/IGF pathway and other dauer genes that we observe would be predicted to amplify signals from the TGFβ pathway; this amplification may serve to ensure a decisive choice between "dauer" and "non-dauer", even if environmental cues are ambiguous. Up and down regulation of insulin-like ligands and novel genes with similarity to the extracellular domain of insulin/IGF receptors suggests opposing
International Nuclear Information System (INIS)
Shao, Xue; Hu, Zhengtao; Hu, Chunyan; Bu, Qian; Yan, Guangyan; Deng, Pengchi; Lv, Lei; Wu, Dan; Deng, Yi; Zhao, Jinxuan; Zhu, Ruiming; Li, Yan; Li, Hongyu; Xu, Youzhi; Yang, Hanshuo; Zhao, Yinglan; Cen, Xiaobo
2012-01-01
Investigations have characterized addictive drug-induced developmental cardiovascular malformation in human, non-human primate and rodent. However, the underlying mechanism of malformation caused by drugs during pregnancy is still largely unknown, and preventive and therapeutic measures have been lacking. Using 1 H NMR spectroscopy, we profiled the metabolites from human embryo endothelial cells exposed to methamphetamine (METH) and quantified a total of 226 peaks. We identified 11 metabolites modified robustly and found that taurine markedly increased. We then validated the hypothesis that this dramatic increase in taurine could attribute to its effect in inhibiting METH-induced developmental angiogenesis defect. Taurine supplement showed a more significant potential than other metabolites in protecting against METH-induced injury in endothelial cells. Taurine strongly attenuated METH-induced inhibition of proliferation and migration in endothelial cells. Furthermore, death rate and vessel abnormality of zebrafish embryos treated with METH were greatly reversed by taurine. In addition, taurine supplement caused a rapid decrease in reactive oxygen species generation and strongly attenuated the excitable arise of antioxidase activities in the beginning of METH exposure prophase. Dysregulations of NF-κB, p-ERK as well as Bax, which reflect apoptosis, cell cycle arrest and oxidative stress in vascular endothelium, were blocked by taurine. Our results provide the first evidence that taurine prevents METH-caused developmental angiogenesis defect through antioxidant mechanism. Taurine could serve as a potential therapeutic or preventive intervention of developmental vascular malformation for the pregnant women with drug use. Highlights: ► Metabonomics findings. ► Abnormal development. ► Dysregulations of key proteins.
Energy Technology Data Exchange (ETDEWEB)
Shao, Xue; Hu, Zhengtao; Hu, Chunyan; Bu, Qian; Yan, Guangyan [National Chengdu Center for Safety Evaluation of Drugs, State Key Lab of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041 (China); Deng, Pengchi [Analytical and Testing Center, Sichuan University, Chengdu 610041 (China); Lv, Lei [National Chengdu Center for Safety Evaluation of Drugs, State Key Lab of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041 (China); Wu, Dan [College of Basic and Forensic Medicine, Sichuan University, Chengdu 610041 (China); Deng, Yi; Zhao, Jinxuan; Zhu, Ruiming; Li, Yan; Li, Hongyu; Xu, Youzhi; Yang, Hanshuo; Zhao, Yinglan [National Chengdu Center for Safety Evaluation of Drugs, State Key Lab of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041 (China); Cen, Xiaobo, E-mail: xbcenalan@vip.sina.com [National Chengdu Center for Safety Evaluation of Drugs, State Key Lab of Biotherapy, West China Hospital, Sichuan University, Chengdu 610041 (China)
2012-05-01
Investigations have characterized addictive drug-induced developmental cardiovascular malformation in human, non-human primate and rodent. However, the underlying mechanism of malformation caused by drugs during pregnancy is still largely unknown, and preventive and therapeutic measures have been lacking. Using {sup 1}H NMR spectroscopy, we profiled the metabolites from human embryo endothelial cells exposed to methamphetamine (METH) and quantified a total of 226 peaks. We identified 11 metabolites modified robustly and found that taurine markedly increased. We then validated the hypothesis that this dramatic increase in taurine could attribute to its effect in inhibiting METH-induced developmental angiogenesis defect. Taurine supplement showed a more significant potential than other metabolites in protecting against METH-induced injury in endothelial cells. Taurine strongly attenuated METH-induced inhibition of proliferation and migration in endothelial cells. Furthermore, death rate and vessel abnormality of zebrafish embryos treated with METH were greatly reversed by taurine. In addition, taurine supplement caused a rapid decrease in reactive oxygen species generation and strongly attenuated the excitable arise of antioxidase activities in the beginning of METH exposure prophase. Dysregulations of NF-κB, p-ERK as well as Bax, which reflect apoptosis, cell cycle arrest and oxidative stress in vascular endothelium, were blocked by taurine. Our results provide the first evidence that taurine prevents METH-caused developmental angiogenesis defect through antioxidant mechanism. Taurine could serve as a potential therapeutic or preventive intervention of developmental vascular malformation for the pregnant women with drug use. Highlights: ► Metabonomics findings. ► Abnormal development. ► Dysregulations of key proteins.
Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L
2005-05-13
Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.
Role of the pre- and post-natal environment in developmental programming of health and productivity.
Reynolds, Lawrence P; Caton, Joel S
2012-05-06
The concept that developmental insults (for example, poor pre- or postnatal nutrition) can have long-term consequences on health and well-being of the offspring has been termed developmental programming. In livestock, developmental programming affects production traits, including growth, body composition, and reproduction. Although low birth weight was used as a proxy for compromised fetal development in the initial epidemiological studies, based on controlled studies using livestock and other animal models in the last two decades we now know that developmental programming can occur independently of any effects on birth weight. Studies in humans, rodents, and livestock also have confirmed the critical role of the placenta in developmental programming. In addition, the central role of epigenetic regulation in developmental programming has been confirmed. Lastly, relatively simple therapeutic/management strategies designed to 'rescue' placental development and function are being developed to minimize the effects of developmental programming on health and productivity of humans, livestock, and other mammals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
A Developmental Neuroscience Perspective on Affect-Biased Attention
Morales, Santiago; Fu, Xiaoxue; Pérez-Edgar, Koraly E.
2016-01-01
There is growing interest regarding the impact of affect-biased attention on psychopathology. However, most of the research to date lacks a developmental approach. In the present review, we examine the role affect-biased attention plays in shaping socioemotional trajectories within a developmental neuroscience framework. We propose that affect-biased attention, particularly if stable and entrenched, acts as a developmental tether that helps sustain early socioemotional and behavioral profiles over time, placing some individuals on maladaptive developmental trajectories. Although most of the evidence is found in the anxiety literature, we suggest that these relations may operate across multiple domains of interest, including positive affect, externalizing behaviors, drug use, and eating behaviors. We also review the general mechanisms and neural correlates of affect-biased attention, as well as the current evidence for the co-development of attention and affect. Based on the reviewed literature, we propose a model that may help us better understand the nuances of affect-biased attention across development. The model may serve as a strong foundation for ongoing attempts to identify neurocognitive mechanisms and intervene with individuals at risk. Finally, we discuss open issues for future research that may help bridge existing gaps in the literature. PMID:27606972
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
Learning To Breathe: Developmental Phase Transitions in Oxygen Status.
Considine, Michael J; Diaz-Vivancos, Pedro; Kerchev, Pavel; Signorelli, Santiago; Agudelo-Romero, Patricia; Gibbs, Daniel J; Foyer, Christine H
2017-02-01
Plants are developmentally disposed to significant changes in oxygen availability, but our understanding of the importance of hypoxia is almost entirely limited to stress biology. Differential patterns of the abundance of oxygen, nitric oxide ( • NO), and reactive oxygen species (ROS), as well as of redox potential, occur in organs and meristems, and examples are emerging in the literature of mechanistic relationships of these to development. We describe here the convergence of these cues in meristematic and reproductive tissues, and discuss the evidence for regulated hypoxic niches within which oxygen-, ROS-, • NO-, and redox-dependent signalling curate developmental transitions in plants. Copyright © 2017 Elsevier Ltd. All rights reserved.
Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja
2015-12-22
Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.
Energy Technology Data Exchange (ETDEWEB)
Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.; Temple, Brenda R.S.; Nile, Aaron H.; Mousley, Carl J.; Duncan, Mara C.; Eckert, Debra M.; Leiker, Thomas J.; Ivanova, Pavlina T.; Myers, David S.; Murphy, Robert C.; Brown, H. Alex; Verdaasdonk, Jolien; Bloom, Kerry S.; Ortlund, Eric A.; Neiman, Aaron M.; Bankaitis, Vytas A. [Emory-MED; (SBU); (TAM); (UNC); (Vanderbilt-MED); (Utah); (UCHSC)
2014-07-11
Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumed during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.
Energy Technology Data Exchange (ETDEWEB)
Ren, Jihui; Lin, Coney Pei-Chen; Pathak, Manish C.; Temple, Brenda R.S.; Nile, Aaron H.; Mousley, Carl J.; Duncan, Mara C.; Eckert, Debra M.; Leiker, Thomas J.; Ivanova, Pavlina T.; Myers, David S.; Murphy, Robert C.; Brown, H. Alex; Verdaasdonk, Jolien; Bloom, Kerry S.; Ortlund, Eric A.; Neiman, Aaron M.; Bankaitis, Vytas A. (Emory-MED); (UNCSM); (UNC); (UCHSC); (TAM); (Vanderbilt-MED); (SBU); (Utah)
2016-07-06
Lipid droplet (LD) utilization is an important cellular activity that regulates energy balance and release of lipid second messengers. Because fatty acids exhibit both beneficial and toxic properties, their release from LDs must be controlled. Here we demonstrate that yeast Sfh3, an unusual Sec14-like phosphatidylinositol transfer protein, is an LD-associated protein that inhibits lipid mobilization from these particles. We further document a complex biochemical diversification of LDs during sporulation in which Sfh3 and select other LD proteins redistribute into discrete LD subpopulations. The data show that Sfh3 modulates the efficiency with which a neutral lipid hydrolase-rich LD subclass is consumed during biogenesis of specialized membrane envelopes that package replicated haploid meiotic genomes. These results present novel insights into the interface between phosphoinositide signaling and developmental regulation of LD metabolism and unveil meiosis-specific aspects of Sfh3 (and phosphoinositide) biology that are invisible to contemporary haploid-centric cell biological, proteomic, and functional genomics approaches.
Directory of Open Access Journals (Sweden)
Marcelo L Berthier
2016-08-01
Full Text Available Foreign accent syndrome (FAS is a speech disorder that is defined by the emergence of a peculiar manner of articulation and intonation which is perceived as foreign. In most cases of acquired FAS (AFAS the new accent is secondary to small focal lesions involving components of the bilaterally distributed neural network for speech production. In the past few years FAS has also been described in different psychiatric conditions (conversion disorder, bipolar disorder, schizophrenia as well as in developmental disorders (specific language impairment, apraxia of speech. In the present study, two adult males, one with atypical phonetic production and the other one with cluttering, reported having developmental FAS (DFAS since their adolescence. Perceptual analysis by naïve judges could not confirm the presence of foreign accent, possibly due to the mildness of the speech disorder. However, detailed linguistic analysis provided evidence of prosodic and segmental errors previously reported in AFAS cases. Cognitive testing showed reduced communication in activities of daily living and mild deficits related to psychiatric disorders. Psychiatric evaluation revealed long-lasting internalizing disorders (neuroticism, anxiety, obsessive-compulsive disorder, social phobia, depression, alexithymia, hopelessness, and apathy in both subjects. Diffusion tensor imaging (DTI data from each subject with DFAS were compared with data from a group of 21 age- and gender-matched healthy control subjects. Diffusion parameters (MD, AD, and RD in predefined regions of interest showed changes of white matter microstructure in regions previously related with AFAS and psychiatric disorders. In conclusion, the present findings militate against the possibility that these two subjects have FAS of psychogenic origin. Rather, our findings provide evidence that mild DFAS occurring in the context of subtle, yet persistent, developmental speech disorders may be associated with
let-7 miRNAs Can Act through Notch to Regulate Human Gliogenesis
Directory of Open Access Journals (Sweden)
M. Patterson
2014-11-01
Full Text Available It is clear that neural differentiation from human pluripotent stem cells generates cells that are developmentally immature. Here, we show that the let-7 plays a functional role in the developmental decision making of human neural progenitors, controlling whether these cells make neurons or glia. Through gain- and loss-of-function studies on both tissue and pluripotent derived cells, our data show that let-7 specifically regulates decision making in this context by regulation of a key chromatin-associated protein, HMGA2. Furthermore, we provide evidence that the let-7/HMGA2 circuit acts on HES5, a NOTCH effector and well-established node that regulates fate decisions in the nervous system. These data link the let-7 circuit to NOTCH signaling and suggest that this interaction serves to regulate human developmental progression.
Can evolution of sexual dimorphism be triggered by developmental temperatures?
DEFF Research Database (Denmark)
Ketola, Tarmo; Kristensen, Torsten Nygård; Kellermann, Vanessa M
2012-01-01
were split into four different developmental temperatures: two constant temperature treatments of 25 and 30oC and two cycling temperatures with means of 25 and 30oC, respectively. After emergence, we tested heat shock tolerance of adult flies. We found that sexual dimorphism was strongly affected...
Kayukawa, Takumi; Murata, Mika; Kobayashi, Isao; Muramatsu, Daisuke; Okada, Chieko; Uchino, Keiro; Sezutsu, Hideki; Kiuchi, Makoto; Tamura, Toshiki; Hiruma, Kiyoshi; Ishikawa, Yukio; Shinoda, Tetsuro
2014-04-01
Juvenile hormone (JH) has an ability to repress the precocious metamorphosis of insects during their larval development. Krüppel homolog 1 (Kr-h1) is an early JH-inducible gene that mediates this action of JH; however, the fine hormonal regulation of Kr-h1 and the molecular mechanism underlying its antimetamorphic effect are little understood. In this study, we attempted to elucidate the hormonal regulation and developmental role of Kr-h1. We found that the expression of Kr-h1 in the epidermis of penultimate-instar larvae of the silkworm Bombyx mori was induced by JH secreted by the corpora allata (CA), whereas the CA were not involved in the transient induction of Kr-h1 at the prepupal stage. Tissue culture experiments suggested that the transient peak of Kr-h1 at the prepupal stage is likely to be induced cooperatively by JH derived from gland(s) other than the CA and the prepupal surge of ecdysteroid, although involvement of unknown factor(s) could not be ruled out. To elucidate the developmental role of Kr-h1, we generated transgenic silkworms overexpressing Kr-h1. The transgenic silkworms grew normally until the spinning stage, but their development was arrested at the prepupal stage. The transgenic silkworms from which the CA were removed in the penultimate instar did not undergo precocious pupation or larval-larval molt but fell into prepupal arrest. This result demonstrated that Kr-h1 is indeed involved in the repression of metamorphosis but that Kr-h1 alone is incapable of implementing normal larval molt. Moreover, the expression profiles and hormonal responses of early ecdysone-inducible genes (E74, E75, and Broad) in transgenic silkworms suggested that Kr-h1 is not involved in the JH-dependent modulation of these genes, which is associated with the control of metamorphosis. Copyright © 2014 Elsevier Inc. All rights reserved.
Baumrind, N L; Parkinson, D; Wayne, D B; Heuser, J E; Pearlman, A L
1992-08-01
To identify cell-surface molecules that mediate interactions between neurons and their environment during neural development, we used monoclonal antibody techniques to define a developmentally regulated antigen in the central nervous system of the mouse. The antibody we produced (2A1) immunolabels cells throughout the central nervous system; we analyzed its distribution in the developing cerebral cortex, where it is expressed on cells very soon after they complete mitosis and leave the periventricular proliferative zone. Expression continues into adult life. The antibody also labels the epithelium of the choroid plexus and the renal proximal tubules, but does not label neurons of the peripheral nervous system in the dorsal root ganglia. In dissociated cell culture of embryonic cerebral cortex, 2A1 labels the surface of neurons but not glia. Immunolabeling of neurons in tissue culture is particularly prominent on the edge of growth cones, including filopodia and the leading edge of lamellipodia, when observed with either immunofluorescence or freeze-etch immunoelectron microscopy. Immunopurification with 2A1 of a CHAPS-extracted membrane preparation from brains of neonatal mice produces a broad (32-36 kD) electrophoretic band and a less prominent 70 kD band that are sensitive to N-glycosidase but not endoglycosidase H. Thus the 2A1 antibody recognizes a developmentally regulated, neuronal cell surface glycoprotein (or glycoproteins) with complex N-linked oligosaccharide side chains. We have termed the glycoprotein antigen EMA because of its prominence on the edge membrane of growth cones. EMA is similar to the M6 antigen (Lagenaur et al: J. Neurobiol. 23:71-88, 1992) in apparent molecular weight, distribution in tissue sections, and immunoreactivity on Western blots, suggesting that the two antigens are similar or identical. Expression of EMA is a very early manifestation of neuronal differentiation; its distribution on growth cones suggests a role in mediating the
Xu, Mingli; Hu, Tieqiang; Zhao, Jianfei; Park, Mee-Yeon; Earley, Keith W; Wu, Gang; Yang, Li; Poethig, R Scott
2016-08-01
Correct developmental timing is essential for plant fitness and reproductive success. Two important transitions in shoot development-the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition-are mediated by a group of genes targeted by miR156, SQUAMOSA PROMOTER BINDING PROTEIN (SBP) genes. To determine the developmental functions of these genes in Arabidopsis thaliana, we characterized their expression patterns, and their gain-of-function and loss-of-function phenotypes. Our results reveal that SBP-LIKE (SPL) genes in Arabidopsis can be divided into three functionally distinct groups: 1) SPL2, SPL9, SPL10, SPL11, SPL13 and SPL15 contribute to both the juvenile-to-adult vegetative transition and the vegetative-to-reproductive transition, with SPL9, SP13 and SPL15 being more important for these processes than SPL2, SPL10 and SPL11; 2) SPL3, SPL4 and SPL5 do not play a major role in vegetative phase change or floral induction, but promote the floral meristem identity transition; 3) SPL6 does not have a major function in shoot morphogenesis, but may be important for certain physiological processes. We also found that miR156-regulated SPL genes repress adventitious root development, providing an explanation for the observation that the capacity for adventitious root production declines as the shoot ages. miR156 is expressed at very high levels in young seedlings, and declines in abundance as the shoot develops. It completely blocks the expression of its SPL targets in the first two leaves of the rosette, and represses these genes to different degrees at later stages of development, primarily by promoting their translational repression. These results provide a framework for future studies of this multifunctional family of transcription factors, and offer new insights into the role of miR156 in Arabidopsis development.
Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.
2010-01-01
Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757
Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas
2009-01-01
Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607
Developmental Idealism: The Cultural Foundations of World Development Programs
Thornton, Arland; Dorius, Shawn F.; Swindle, Jeffrey
2015-01-01
This paper extends theory and research concerning cultural models of development beyond family and demographic matters to a broad range of additional factors, including government, education, human rights, daily social conventions, and religion. Developmental idealism is a cultural model—a set of beliefs and values—that identifies the appropriate goals of development and the ends for achieving these goals. It includes beliefs about positive cause and effect relationships among such factors as economic growth, educational achievement, health, and political governance, as well as strong values regarding many attributes, including economic growth, education, small families, gender equality, and democratic governance. This cultural model has spread from its origins among the elites of northwest Europe to elites and ordinary people throughout the world. Developmental idealism has become so entrenched in local, national, and global social institutions that it has now achieved a taken-for-granted status among many national elites, academics, development practitioners, and ordinary people around the world. We argue that developmental idealism culture has been a fundamental force behind many cultural clashes within and between societies, and continues to be an important cause of much global social change. We suggest that developmental idealism should be included as a causal factor in theories of human behavior and social change. PMID:26457325
I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.
Card, Noel A
2017-06-01
This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.
Atlas, Jeffrey A.; Lapidus, Leah Blumberg
1988-01-01
A total of 48 children (aged 4-14) with severe pervasive developmental disturbance, exhibiting mutism, echolalia, or nonecholalic speech, were observed in their communicative behaviors across modalities. Levels of symbolization in gesture, play, and drawing were significantly intercorrelated and were most strongly correlated with the criterion…
Lorber, Michael F.; Egeland, Byron
2009-01-01
Developmental models and previous findings suggest that early parenting is more strongly associated with externalizing problems in early childhood than it is in adolescence. In this article, the authors address whether the association of poor-quality infancy parenting and externalizing problems "rebounds" in adulthood. Poor-quality infancy…
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Directory of Open Access Journals (Sweden)
Anca Dana Dobrian
2012-08-01
Full Text Available The Twist proteins (Twist-1 and -2 are highly conserved developmental proteins with key roles for the transcriptional regulation in mesenchymal cell lineages. They belong to the super-family of bHLH proteins and exhibit bi-functional roles as both activators and repressors of gene transcription. The Twist proteins are expressed at low levels in adult tissues but may become abundantly re-expressed in cells undergoing malignant transformation. This observation prompted extensive research on the roles of Twist proteins in cancer progression and metastasis. Very recent studies indicate a novel role for Twist-1 as a potential regulator of adipose tissue remodeling and inflammation. Several studies suggested that developmental genes are important determinants of obesity, fat distribution and remodeling capacity of different adipose depots. Twist-1 is abundantly and selectively expressed in the adult adipose tissue and its constitutive expression is significantly higher in subcutaneous vs. visceral fat in both mice and humans. Moreover, Twist1 expression is strongly correlated with BMI and insulin resistance in humans. However, the functional roles and transcriptional downstream targets of Twist1 in adipose tissue are largely unexplored. The purpose of this review is to highlight the major findings related to Twist1 expression in different fat depots and cellular components of adipose tissue and to discuss the potential mechanisms suggesting a role for Twist1 in adipose tissue metabolism, inflammation and remodeling.
DEFF Research Database (Denmark)
Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S
2004-01-01
Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these......Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus...... for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise...... to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby...
Directory of Open Access Journals (Sweden)
Sangkyu Park
Full Text Available Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR and squalene synthase (SS genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS, belonging to a sesquiterpene cyclase (STC family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA, resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits.
Edossa, Ashenafi Kassahun; Schroeders, Ulrich; Weinert, Sabine; Artelt, Cordula
2018-01-01
Self-regulation is an essential ability of children to cope with various developmental challenges. This study examines the developmental interplay between emotional and behavioral self-regulation during childhood and the relationship with academic achievement using data from the longitudinal Millennium Cohort Study (UK). Using cross-lagged panel…
Boyer, Wanda
2013-01-01
Discourse on culture is vital to early childhood educators' understanding of the young child in various socio-cultural experiences in family and community settings. In this article, the author will present a contemporary definition of culture. This article will then discuss the developmental constructs of self-regulation and emotion regulation and…
Social geography of developmental health in the early years.
Hertzman, Clyde
2010-01-01
What happens to children in their earliest years is critical for their development throughout the life course. The years from zero to school age are foundational for brain and biological development. Attachment and face recognition; impulse control and regulation of physical aggression; executive function in the prefrontal cortex and focused attention; fine and gross motor functions and coordination; receptive and expressive language; and understandings of quantitative concepts are all established during this time and become embedded in the architecture and function of the brain (Doherty 1997; Kolb 2009; McCain and Mustard 1999). Brain and biological development are in turn expressed through three broad domains of development of the whole child: physical, social-emotional and language-cognitive, which together are the basis of "developmental health" (Keating and Hertzman 1999). Developmental health influences many aspects of well-being, including obesity and stunting, mental health, heart disease, competence in literacy and numeracy, criminality and economic participation throughout life (Irwin et al. 2007). Accordingly, developmental health is the central concern of this article.
2015-01-01
Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. PMID:26410301
Krekels, Elke H J; van Ham, Saskia; Allegaert, Karel; de Hoon, Jan; Tibboel, Dick; Danhof, Meindert; Knibbe, Catherijne A J
2015-09-01
Based on recovered metabolite ratios in urine, it has been concluded that paracetamol glucuronidation may be up-regulated upon multiple dosing. This study investigates paracetamol clearance in neonates and infants after single and multiple dosing using a population modelling approach. A population pharmacokinetic model was developed in NONMEM VI, based on paracetamol plasma concentrations from 54 preterm and term neonates and infants, and on paracetamol, paracetamol-glucuronide and paracetamol-sulphate amounts in urine from 22 of these patients. Patients received either a single intravenous propacetamol dose or up to 12 repeated doses. Paracetamol and metabolite disposition was best described with one-compartment models. The formation clearance of paracetamol-sulphate was 1.46 mL/min/kg(1.4), which was about 5.5 times higher than the formation clearance of the glucuronide of 0.266 mL/min/kg. The renal excretion rate constants of both metabolites was estimated to be 11.4 times higher than the excretion rate constant of unchanged paracetamol, yielding values of 0.580 mL/min/kg. Developmental changes were best described by bodyweight in linear relationships on the distribution volumes, the formation of paracetamol-glucuronide and the unchanged excretion of paracetamol, and in an exponential relationship on the formation of paracetamol-sulphate. There was no evidence for up-regulation or other time-varying changes in any of the model parameters. Simulations with this model illustrate how paracetamol-glucuronide recovery in urine increases over time due to the slower formation of this metabolite and in the absence of up-regulation. Developmental changes, described by bodyweight-based functions, rather than up-regulation, explain developmental changes in paracetamol disposition in neonates and infants.
Gorusupudi, Aruna; Shyam, Rajalekshmy; Li, Binxing; Vachali, Preejith; Subhani, Yumna K; Nelson, Kelly; Bernstein, Paul S
2016-04-01
meso-Zeaxanthin is a carotenoid that is rarely encountered in nature outside of the vertebrate eye. It is not a constituent of a normal human diet, yet this carotenoid comprises one-third of the primate macular pigment. In the current study, we undertook a systematic approach to biochemically characterize the production of meso-zeaxanthin in the vertebrate eye. Fertilized White Leghorn chicken eggs were analyzed for the presence of carotenoids during development. Yolk, liver, brain, serum, retina, and RPE/choroid were isolated, and carotenoids were extracted. The samples were analyzed on C-30 or chiral HPLC columns to determine the carotenoid composition. Lutein and zeaxanthin were found in all studied nonocular tissues, but no meso-zeaxanthin was ever detected. Among the ocular tissues, the presence of meso-zeaxanthin was consistently observed starting at embryonic day 17 (E17) in the RPE/choroid, several days before its consistent detection in the retina. If RPE/choroid of an embryo was devoid of meso-zeaxanthin, the corresponding retina was always negative as well. This is the first report of developmentally regulated synthesis of meso-zeaxanthin in a vertebrate system. Our observations suggest that the RPE/choroid is the primary site of meso-zeaxanthin synthesis. Identification of meso-zeaxanthin isomerase enzyme in the developing chicken embryo will facilitate our ability to determine the biochemical mechanisms responsible for production of this unique carotenoid in other higher vertebrates, such as humans.
Measuring Self-Regulated Learning in the Workplace
Fontana, Rosa Pia; Milligan, Colin; Littlejohn, Allison; Margaryan, Anoush
2015-01-01
In knowledge-intensive industries, the workplace has become a key locus of learning. To perform effectively, knowledge workers must be able to take responsibility for their own developmental needs, and in particular, to regulate their own learning. This paper describes the construction and validation of an instrument (the Self-Regulated Learning…
Directory of Open Access Journals (Sweden)
Leslie A. Frankel
2012-01-01
Full Text Available The following article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to children's behavior, assistance in helping children self-regulate, and motivating children through rewards and punishments. Additionally, sources of variation in parental influences on regulation are examined, including parenting style, child temperament, and child-parent attachment security. Parallels in the nature of parents' role in socializing children's regulation of emotions and energy intake are examined. Implications for future research are discussed.
Cumulative-Genetic Plasticity, Parenting and Adolescent Self-Regulation
Belsky, Jay; Beaver, Kevin M.
2011-01-01
Background: The capacity to control or regulate one's emotions, cognitions and behavior is central to competent functioning, with limitations in these abilities associated with developmental problems. Parenting appears to influence such self-regulation. Here the differential-susceptibility hypothesis is tested that the more putative "plasticity…
48 CFR 219.7104 - Developmental assistance costs eligible for reimbursement or credit.
2010-10-01
... costs eligible for reimbursement or credit. 219.7104 Section 219.7104 Federal Acquisition Regulations... reimbursement or credit. (a) Developmental assistance provided under an approved mentor-protege agreement is... eligible for reimbursement are set forth in appendix I. (b) Before incurring any costs under the Program...
Reporter-Based Isolation of Developmental Myogenic Progenitors
Directory of Open Access Journals (Sweden)
Eyemen Kheir
2018-04-01
Full Text Available The formation and activity of mammalian tissues entail finely regulated processes, involving the concerted organization and interaction of multiple cell types. In recent years the prospective isolation of distinct progenitor and stem cell populations has become a powerful tool in the hands of developmental biologists and has rendered the investigation of their intrinsic properties possible. In this protocol, we describe how to purify progenitors with different lineage history and degree of differentiation from embryonic and fetal skeletal muscle by fluorescence-activated cell sorting (FACS. The approach takes advantage of a panel of murine strains expressing fluorescent reporter genes specifically in the myogenic progenitors. We provide a detailed description of the dissection procedures and of the enzymatic dissociation required to maximize the yield of mononucleated cells for subsequent FACS-based purification. The procedure takes ~6–7 h to complete and allows for the isolation and the subsequent molecular and phenotypic characterization of developmental myogenic progenitors.
Prepatterning of developmental gene expression by modified histones before zygotic genome activation
DEFF Research Database (Denmark)
Lindeman, Leif C.; Andersen, Ingrid S.; Reiner, Andrew H.
2011-01-01
A hallmark of anamniote vertebrate development is a window of embryonic transcription-independent cell divisions before onset of zygotic genome activation (ZGA). Chromatin determinants of ZGA are unexplored; however, marking of developmental genes by modified histones in sperm suggests a predictive...... role of histone marks for ZGA. In zebrafish, pre-ZGA development for ten cell cycles provides an opportunity to examine whether genomic enrichment in modified histones is present before initiation of transcription. By profiling histone H3 trimethylation on all zebrafish promoters before and after ZGA......, we demonstrate here an epigenetic prepatterning of developmental gene expression. This involves pre-ZGA marking of transcriptionally inactive genes involved in homeostatic and developmental regulation by permissive H3K4me3 with or without repressive H3K9me3 or H3K27me3. Our data suggest that histone...
Hemodynamic forces regulate developmental patterning of atrial conduction.
Directory of Open Access Journals (Sweden)
Michael C Bressan
Full Text Available Anomalous action potential conduction through the atrial chambers of the heart can lead to severe cardiac arrhythmia. To date, however, little is known regarding the mechanisms that pattern proper atrial conduction during development. Here we demonstrate that atrial muscle functionally diversifies into at least two heterogeneous subtypes, thin-walled myocardium and rapidly conducting muscle bundles, during a developmental window just following cardiac looping. During this process, atrial muscle bundles become enriched for the fast conduction markers Cx40 and Nav1.5, similar to the precursors of the fast conduction Purkinje fiber network located within the trabeculae of the ventricles. In contrast to the ventricular trabeculae, however, atrial muscle bundles display an increased proliferation rate when compared to the surrounding myocardium. Interestingly, mechanical loading of the embryonic atrial muscle resulted in an induction of Cx40, Nav1.5 and the cell cycle marker Cyclin D1, while decreasing atrial pressure via in vivo ligation of the vitelline blood vessels results in decreased atrial conduction velocity. Taken together, these data establish a novel model for atrial conduction patterning, whereby hemodynamic stretch coordinately induces proliferation and fast conduction marker expression, which in turn promotes the formation of large diameter muscle bundles to serve as preferential routes of conduction.
[Regulation of terpene metabolism
Energy Technology Data Exchange (ETDEWEB)
Croteau, R.
1991-01-01
During the last grant period, we have completed studies on the key pathways of monoterpene biosynthesis and catabolism in sage and peppermint, and have, by several lines of evidence, deciphered the rate-limiting step of each pathway. We have at least partially purified and characterized the relevant enzymes of each pathway. We have made a strong case, based on analytical, in vivo, and in vitro studies, that terpene accumulation depends upon the balance between biosynthesis and catabolism, and provided supporting evidence that these processes are developmentally-regulated and very closely associated with senescence of the oil glands. Oil gland ontogeny has been characterized at the ultrastructural level. We have exploited foliar-applied bioregulators to delay gland senescence, and have developed tissue explant and cell culture systems to study several elusive aspects of catabolism. We have isolated pure gland cell clusters and localized monoterpene biosynthesis and catabolism within these structures, and have used these preparations as starting materials for the purification to homogeneity of target regulatory'' enzymes. We have thus developed the necessary background knowledge, based on a firm understanding of enzymology, as well as the necessary experimental tools for studying the regulation of monoterpene metabolism at the molecular level. Furthermore, we are now in a position to extend our systematic approach to other terpenoid classes (C[sub 15]-C[sub 30]) produced by oil glands.
Energy Technology Data Exchange (ETDEWEB)
Henrique Barreta, Marcos [Universidade Federal de Santa Catarina, Campus Universitario de Curitibanos, Curitibanos, SC (Brazil); Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Ferreira, Rogerio [Centro de Educacao Superior do Oeste-Universidade do Estado de Santa Catarina, Chapeco, SC (Brazil); Oliveira, Joao Francisco de; Goncalves, Paulo Bayard Dias [Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS (Brazil); Bordignon, Vilceu, E-mail: vilceu.bordignon@mcgill.ca [Department of Animal Science, McGill University, Ste-Anne-De-Bellevue, QC (Canada)
2012-10-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
International Nuclear Information System (INIS)
Henrique Barreta, Marcos; Garziera Gasperin, Bernardo; Braga Rissi, Vitor; Cesaro, Matheus Pedrotti de; Ferreira, Rogério; Oliveira, João Francisco de; Gonçalves, Paulo Bayard Dias; Bordignon, Vilceu
2012-01-01
This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes were expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.
Psychopathy: Developmental Perspectives and their Implications for Treatment
Anderson, Nathaniel E.; Kiehl, Kent A.
2015-01-01
Psychopathy is a neuropsychiatric disorder marked by deficient emotional responses, lack of empathy, and poor behavioral controls, commonly resulting in persistent antisocial deviance and criminal behavior. Accumulating research suggests that psychopathy follows a developmental trajectory with strong genetic influences, and which precipitates deleterious effects on widespread functional networks, particularly within paralimbic regions of the brain. While traditional therapeutic interventions commonly administered in prisons and forensic institutions have been notoriously ineffective at combating these outcomes, alternative strategies informed by an understanding of these specific neuropsychological obstacles to healthy development, and which target younger individuals with nascent symptoms of psychopathy are more promising. Here we review recent neuropsychiatric and neuroimaging literature that informs our understanding of the brain systems compromised in psychopathy, and apply these data to a broader understanding of its developmental course, ultimately promoting more proactive intervention strategies profiting from adaptive neuroplasticity in youth. PMID:23542910
Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders.
Fagan, Jeffrey; Piquero, Alex R
2007-12-01
Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and decisions. The interaction of these two developmental processes, and the identification of one domain of socialization and development as the primary source of motivation or restraint in adolescence, is the focus of this article. Accordingly, we combine rational choice and legal socialization frameworks into an integrated, developmental model of criminality. We test this framework in a large sample of adolescent felony offenders who have been interviewed at six-month intervals for two years. Using hierarchical and growth curve models, we show that both legal socialization and rational choice factors influence patterns of criminal offending over time. When punishment risks and costs are salient, crime rates are lower over time. We show that procedural justice is a significant antecedent of legal socialization, but not of rational choice. We also show that both mental health and developmental maturity moderate the effects of perceived crime risks and costs on criminal offending.
Rational Choice and Developmental Influences on Recidivism Among Adolescent Felony Offenders
Fagan, Jeffrey; Piquero, Alex R.
2009-01-01
Recent case law and social science both have claimed that the developmental limitations of adolescents affect their capacity for control and decision making with respect to crime, diminishing their culpability and reducing their exposure to punishment. Social science has focused on two concurrent adolescent developmental influences: the internalization of legal rules and norms that regulate social and antisocial behaviors, and the development of rationality to frame behavioral choices and decisions. The interaction of these two developmental processes, and the identification of one domain of socialization and development as the primary source of motivation or restraint in adolescence, is the focus of this article. Accordingly, we combine rational choice and legal socialization frameworks into an integrated, developmental model of criminality. We test this framework in a large sample of adolescent felony offenders who have been interviewed at six-month intervals for two years. Using hierarchical and growth curve models, we show that both legal socialization and rational choice factors influence patterns of criminal offending over time. When punishment risks and costs are salient, crime rates are lower over time. We show that procedural justice is a significant antecedent of legal socialization, but not of rational choice. We also show that both mental health and developmental maturity moderate the effects of perceived crime risks and costs on criminal offending. PMID:20148123
Traeger, Stefanie; Nowrousian, Minou
2015-04-14
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.
The Domain of Developmental Psychopathology.
Sroufe, L. Alan; Rutter, Michael
1984-01-01
Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)
Life Span Developmental Approach
Directory of Open Access Journals (Sweden)
Ali Eryilmaz
2011-03-01
Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.
Developmental Benefits of Extracurricular Sports Participation Among Brazilian Youth.
Reverdito, Riller S; Galatti, Larissa R; Carvalho, Humberto M; Scaglia, Alcides J; Côté, Jean; Gonçalves, Carlos E; Paes, Roberto R
2017-10-01
Youth sporting activities have been explored as a way to impact positive personal transformation and development, glaringly demonstrated by world-wide investments in public policies, programs, and projects. We studied positive effects of participation in sports on the developmental assets of 614 adolescents (13.1 ± 1.7 years) actively engaged in extracurricular sport programs targeted at socially disadvantaged youths, from five municipalities across five states of the southern, south-eastern and north-eastern regions of Brazil. Participants responded to a developmental assets questionnaire designed to capture sociodemographic and human development data. Multilevel logistic regression was used to explore associations between years of participation in sport and human development indicators, controlling for age and sex. Our results showed that the quality of the young people's support network and duration of program participation positively influenced sport participation, which, in turn, was associated with willingness to learn. A strong association was also observed between sport participation and developmental assets. Thus, we offer new evidence of a relationship between positive development and environmental factors in which individual and contextual forces can be aligned, and we provide new reference data for developing countries.
Directory of Open Access Journals (Sweden)
Matthias Keller
Full Text Available Prenatal inflammation is considered an important factor contributing to preterm birth and neonatal mortality and morbidity. The impact of prenatal inflammation on fetal bioenergetic status and the correlation of specific metabolites to inflammatory-induced developmental brain injury are unknown. We used a global metabolomics approach to examine plasma metabolites differentially regulated by intrauterine inflammation. Preterm-equivalent sheep fetuses were randomized to i.v. bolus infusion of either saline-vehicle or LPS. Blood samples were collected at baseline 2 h, 6 h and daily up to 10 days for metabolite quantification. Animals were killed at 10 days after LPS injection, and brain injury was assessed by histopathology. We detected both acute and delayed effects of LPS on fetal metabolism, with a long-term down-regulation of fetal energy metabolism. Within the first 3 days after LPS, 121 metabolites were up-regulated or down-regulated. A transient phase (4-6 days, in which metabolite levels recovered to baseline, was followed by a second phase marked by an opposing down-regulation of energy metabolites, increased pO(2 and increased markers of inflammation and ADMA. The characteristics of the metabolite response to LPS in these two phases, defined as 2 h to 2 days and at 6-9 days, respectively, were strongly correlated with white and grey matter volumes at 10 days recovery. Based on these results we propose a novel concept of inflammatory-induced hibernation of the fetus. Inflammatory priming of fetal metabolism correlated with measures of brain injury, suggesting potential for future biomarker research and the identification of therapeutic targets.
Developmental regulation of aromatase activity in the rat hypothalamus
International Nuclear Information System (INIS)
Lephart, E.D.
1989-01-01
The brain of all mammalian species studied thus far contain an enzymatic activity (aromatase) that catalyzes the conversion of androgens to estrogens. The activity is highest during prenatal development and contributes to the establishment of sex differences which determine adult gonadotropin secretion patterns and reproductive behavior. The studies presented in this dissertation represent a systematic effort to elucidate the mechanism(s) that control the initiation of and contribute to maintaining rat hypothalamic aromatase activity during pre- and postnatal development. Aromatase enzyme activity was measured by the 3 H 2 O release assay or by traditional estrogen product isolation. Brain aromatase mRNA was detected by hybridization to a cDNA encoding rat aromatase cytochrome P-450. In both males and females the time of puberty was associated with a decline in hypothalamic aromatase activity. This decline may represent a factor underlying the peri-pubertal decrease in the sensitivity to gonadal steroid feedback that accompanies completion of puberty. The results also indicate that androgens regulate brain aromatase levels during both the prepubertal and peri-pubertal stages of sexual development and that this regulation is transiently lost in young adults. Utilizing a hypothalamic organotypic culture system, aromatase activity in vitro was maintained for as long as two days. The results of studies of a variety of hormonal and metabolic regulators suggest that prenatal aromatase activity is regulated by factor(s) that function independently from the classical cyclic AMP and protein kinase C trans-membrane signaling pathways
Houwen, Suzanne; Visser, Linda; van der Putten, Annette; Vlaskamp, Carla
2016-01-01
It is generally agreed that cognitive and language development are dependent on the emergence of motor skills. As the literature on this issue concerning children with developmental disabilities is scarce, we examined the interrelationships between motor, cognitive, and language development in children with intellectual and developmental disabilities (IDD) and compared them to those in children without IDD. In addition, we investigated whether these relationships differ between children with different levels of cognitive delay. Seventy-seven children with IDD (calendar age between 1;0 and 9;10 years; mean developmental age: 1;8 years) and 130 typically developing children (calendar age between 0;3 and 3;6 years; mean developmental age: 1;10 years) were tested with the Dutch Bayley Scales of Infant and Toddler Development, Third Edition, which assesses development across three domains using five subscales: fine motor development, gross motor development (motor), cognition (cognitive), receptive communication, and expressive communication (language). Results showed that correlations between the motor, cognitive, and language domains were strong, namely .61 to .94 in children with IDD and weak to strong, namely .24 to .56 in children without IDD. Furthermore, the correlations showed a tendency to increase with the severity of IDD. It can be concluded that both fine and gross motor development are more strongly associated with cognition, and consequently language, in children with IDD than in children without IDD. The findings of this study emphasize the importance of early interventions that boost both motor and cognitive development, and suggest that such interventions will also enhance language development. Copyright © 2016 Elsevier Ltd. All rights reserved.
Epigenetics and Neural developmental disorders: Washington DC, September 18 and 19, 2006.
Zhao, Xinyu; Pak, ChangHui; Smrt, Richard D; Jin, Peng
2007-01-01
Neural developmental disorders, such as autism, Rett Syndrome, Fragile X syndrome, and Angelman syndrome manifest during early postnatal neural development. Although the genes responsible for some of these disorders have been identified, how the mutations of these genes affect neural development is currently unclear. Emerging evidence suggest that these disorders share common underlying defects in neuronal morphology, synaptic connectivity and brain plasticity. In particular, alterations in dendritic branching and spine morphology play a central role in the pathophysiology of most mental retardation disorders, suggesting that common pathways regulating neuronal function may be affected. Epigenetic modulations, mediated by DNA methylation, RNA-associated silencing, and histone modification, can serve as an intermediate process that imprints dynamic environmental experiences on the "fixed" genome, resulting in stable alterations in phenotypes. Disturbance in epigenetic regulations can lead to inappropriate expression or silencing of genes, causing an array of multi-system disorders and neoplasias. Rett syndrome, the most common form of mental retardation in young girls, is due to l mutation of MECP2, encoding a methylated DNA binding protein that translates DNA methylation into gene repression. Angelman syndrome is due to faulty genomic imprinting or maternal mutations in UBE3A. Fragile X Syndrome, in most cases, results from the hypermethylation of FMR1 promoter, hence the loss of expression of functional FMRP protein. Autism, with its complex etiology, may have strong epigenetic link. Together, these observations strongly suggest that epigenetic mechanisms may play a critical role in brain development and etiology of related disorders. This report summarizes the scientific discussions and major conclusions from a recent conference that aimed to gain insight into the common molecular pathways affected among these disorders and discover potential therapeutic targets
DEFF Research Database (Denmark)
Thomsen, Morten Skøtt; Cinar, Betül; Jensen, Majbrit Myrup
2014-01-01
regarding the distribution and developmental regulation of these proteins in the brain. We use protein cross-linking and synaptosomal fractions to demonstrate that the Ly-6 proteins Lynx1 and Ly6H are membrane-bound proteins in the brain, which are present on the cell surface and localize to synaptic...... demonstrate that Lynx1 and Ly6H are expressed in cultured neurons, but not cultured micro- or astroglial cultures. In addition, Lynx1, but not Ly6H was detected in the CSF. Finally, we show that the Ly-6 proteins Lynx1, Lynx2, Ly6H, and PSCA, display distinct expression patterns during postnatal development...
Strong and strategic conformity understanding by 3- and 5-year-old children.
Cordonier, Laurent; Nettles, Theresa; Rochat, Philippe
2017-12-18
'Strong conformity' corresponds to the public endorsement of majority opinions that are in blatant contradiction to one's own correct perceptual judgements of the situation. We tested strong conformity inference by 3- and 5-year-old children using a third-person perspective paradigm. Results show that at neither age, children spontaneously expect that an ostracized third-party individual who wants to affiliate with the majority group will show strong conformity. However, when questioned as to what the ostracized individual should do to befriend others, from 5 years of age children explicitly demonstrate that they construe strong conformity as a strategic means of social affiliation. Additional data suggest that strong and strategic conformity understanding from an observer's third-person perspective is linked to the passing of the language-mediated false belief theory of mind task, an index of children's emerging 'meta' ability to construe the mental state of others. Statement of contribution What is already known on this subject? 'Strong conformity' corresponds to the public endorsement of majority opinions that are in blatant contradiction to one's own correct perceptual judgements of the situation. Asch's (1956, Psychological Monographs: General and Applied, 70, 1) classic demonstration of strong conformity with adults has been replicated with preschool children: 3- to 4-year-olds manifest signs of strong conformity by reversing about thirty to forty per cent of the time their correct perceptual judgements to fit with contradictory statements held unanimously by other individuals (Corriveau & Harris, 2010, Developmental Psychology, 46, 437; Corriveau et al., 2013, Journal of Cognition and Culture, 13, 367; Haun & Tomasello, 2011, Child Development, 82, 1759). As for adults, strong conformity does not obliterate children's own private, accurate knowledge of the situation. It is in essence a public expression to fit the group and alleviate social dissonance
Kaieda, Yuya; Masuda, Ryota; Nishida, Ritsuo; Shimell, MaryJane; O'Connor, Michael B; Ono, Hajime
2017-10-01
Steroid hormones regulate life stage transitions, allowing animals to appropriately follow a developmental timeline. During insect development, the steroid hormone ecdysone is synthesized and released in a regulated manner by the prothoracic gland (PG) and then hydroxylated to the active molting hormone, 20-hydroxyecdysone (20E), in peripheral tissues. We manipulated ecdysteroid titers, through temporally controlled over-expression of the ecdysteroid-inactivating enzyme, CYP18A1, in the PG using the GeneSwitch-GAL4 system in the fruit fly Drosophila melanogaster. We monitored expression of a 20E-inducible glue protein gene, Salivary gland secretion 3 (Sgs3), using a Sgs3:GFP fusion transgene. In wild type larvae, Sgs3-GFP expression is activated at the midpoint of the third larval instar stage in response to the rising endogenous level of 20E. By first knocking down endogenous 20E levels during larval development and then feeding 20E to these larvae at various stages, we found that Sgs3-GFP expression could be triggered at an inappropriate developmental stage after a certain time lag. This stage-precocious activation of Sgs3 required expression of the Broad-complex, similar to normal Sgs3 developmental regulation, and a small level of nutritional input. We suggest that these studies provide evidence for a tissue-autonomic regulatory system for a metamorphic event independent from the primary 20E driven developmental progression. Copyright © 2017 Elsevier Inc. All rights reserved.
Mutations of PTPN23 in developmental and epileptic encephalopathy
Sowada, Nadine
2017-10-31
Developmental and epileptic encephalopathies (DEE) are a heterogeneous group of neurodevelopmental disorders with poor prognosis. Recent discoveries have greatly expanded the repertoire of genes that are mutated in epileptic encephalopathies and DEE, often in a de novo fashion, but in many patients, the disease remains molecularly uncharacterized. Here, we describe a new form of DEE in patients with likely deleterious biallelic variants in PTPN23. The phenotype is characterized by early onset drug-resistant epilepsy, severe and global developmental delay, microcephaly, and sometimes premature death. PTPN23 encodes a tyrosine phosphatase with strong brain expression, and its knockout in mouse is embryonically lethal. Structural modeling supports a deleterious effect of the identified alleles. Our data suggest that PTPN23 mutations cause a rare severe form of autosomal-recessive DEE in humans, a finding that requires confirmation.
CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING
Directory of Open Access Journals (Sweden)
Mario U Manto
2012-01-01
Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.
Jun, Ji Hyung; Liu, Chenggang; Xiao, Xirong; Dixon, Richard A
2015-10-01
Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. © 2015 American Society of Plant Biologists. All rights reserved.
Effect of Developmental Stimulation Program on the Developmental Measures of Toddlers
Directory of Open Access Journals (Sweden)
Elahe Ghayebie
2018-04-01
Full Text Available Background: The variability in the developmental skills is reduced after the first three years of life; therefore, it is necessary to identify and manage early developmental delays. Aim: The aim of this study was to investigate the effect of developmental stimulation program on the developmental measures of the toddlers. Method: The present randomized controlled clinical trial was conducted on 31 toddlers aged 1-3 years residing at Ali Asghar Foster Care Center within 2016-2017. Developmental interventions were carried out based on the modified guidelines of West Virginia Early Learning Standards Framework for eight weeks (three 2-hour sessions a week. The interventions included a range of age- and developmental-specific activities described in the given guidelines. Child development age was measured based on motor dimensions (i.e., gross and fine and language development (i.e., receptive and expressive before and after the intervention. The data were analyzed in SPSS software (version 11 using independent t-test and Chi-square test. Results: The mean ages of the participants in the control and intervention groups were 19.9±5.5 and 20±6.02, respectively (P=0.62. The mean ages of receptive language development (P=0.003, expressive language development (P
Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin
McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.
2015-01-01
Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202
Specific microRNAs Regulate Heat Stress Responses in Caenorhabditis elegans
DEFF Research Database (Denmark)
Nehammer, Camilla; Podolska, Agnieszka; Mackowiak, Sebastian D
2015-01-01
have identified additional functions for already known players (mir-71 and mir-239) as well as identifying mir-80 and the mir-229 mir-64-66 cluster as important regulators of the heat stress response in C. elegans. These findings uncover an additional layer of complexity to the regulation of stress...... to heat stress in Caenorhabditis elegans and show that a discrete subset of miRNAs is thermoregulated. Using in-depth phenotypic analyses of miRNA deletion mutant strains we reveal multiple developmental and post-developmental survival and behavioral functions for specific miRNAs during heat stress. We...
Lin, Yuan-Na; Izbicki, Jakob R; König, Alexandra; Habermann, Jens K; Blechner, Christine; Lange, Tobias; Schumacher, Udo; Windhorst, Sabine
2014-04-01
In most cases, metastatic colorectal cancer is not curable, thus new approaches are necessary to identify novel targets for colorectal cancer therapy. Actin-binding-proteins (ABPs) directly regulate motility of metastasising tumor cells, and for cortactin an association with colon cancer metastasis has been already shown. However, as its depletion only incompletely inhibits metastasis, additional, more suitable cellular targets have to be identified. Here we analyzed expression of the ABPs, DIAPH1, VASP, N-WASP, and fascin in comparison with cortactin and found that, besides cortactin, DIAPH1 was expressed with the highest frequency (63%) in colorectal cancer. As well as cortactin, DIAPH1 was not detectable in normal colon tissue and expression of both proteins was positively correlated with metastasis of colorectal cancer. To analyse the mechanistic role of DIAPH1 for metastasis of colon carcinoma cells in comparison with cortactin, expression of the proteins was stably down-regulated in the human colon carcinoma cell lines HT-29, HROC-24 and HCT-116. Analysis of metastasis of colon carcinoma cells in SCID mice revealed that depletion of DIAPH1 reduced metastasis 60-fold and depletion of cortactin 16-fold as compared with control cells. Most likely the stronger effect of DIAPH1 depletion on colon cancer metastasis is due to the fact that in vitro knock down of DIAPH1 impaired all steps of metastasis; adhesion, invasion and migration while down-regulation of cortactin only reduced adhesion and invasion. This very strong reducing effect of DIAPH1 depletion on colon carcinoma cell metastasis makes the protein a promising therapeutic target for individualized colorectal cancer therapy. © 2013 UICC.
The Developmental Stages of a Community–University Partnership
Allen, Michele L.; Svetaz, María Veronica; Hurtado, G. Ali; Linares, Roxana; Garcia-Huidobro, Diego; Hurtado, Monica
2013-01-01
Background: Strong and sustained community–university partnerships are necessary for community-based participatory translational research. Little attention has been paid to understanding the trajectory of research partnerships from a developmental perspective. Objective: To propose a framework describing partnership development and maturation based on Erikson’s eight stages of psychosocial development and describe how our collaboration is moving through those stages. Methods: Collaborators engaged in three rounds of iterative reflection regarding characteristics and contributors to the maturation of the Padres Informados/Jovenes Preparados (Informed Parents/Prepared Youth [PI/JP]) partnership. Lessons Learned: Each stage is characterized by broad developmental partnership tasks. Conflict or tension within the partnership is often a part of achieving the associated tasks. The strengths developed at each stage prepare the partnership for challenges associated with subsequent stages. Conclusions: This framework could provide a means for partnerships to reflect on their strengths and challenges at a given time point, and to help understand why some partnerships fail whereas others achieve maturity. PMID:24056509
Mother-Child Interaction and Resilience in Children with Early Developmental Risk
Fenning, Rachel M.; Baker, Jason K.
2014-01-01
Although prenatal and genetic factors make strong contributions to the emergence of intellectual disability (ID), children's early environment may have the potential to alter developmental trajectories and to foster resilience in children with early risk. The present study examined mother-child interaction and the promotion of competence in 50 children with early developmental delays. Three related but distinct aspects of mother-child interaction were considered: maternal technical scaffolding, maternal positive-sensitivity, and mother-child dyadic pleasure. Children were classified as exhibiting undifferentiated delays at age three based upon performance on developmental assessments and the absence of known genetic syndromes. Mother-child interaction was assessed at age four through observational ratings of structured laboratory tasks and through naturalistic home observations. ID was identified at age five using the dual criteria of clinically significant delays in cognitive functioning and adaptive behavior. Maternal technical scaffolding and dyadic pleasure each uniquely predicted reduced likelihood of later ID, beyond the contributions of children's early developmental level and behavioral functioning. Follow-up analyses suggested that mother-child interaction was primarily important to resilience in the area of adaptive behavior, with scaffolding and dyadic pleasure differentially associated with particular sub-domains. Implications for theories of intellectual disability and for family-based early intervention and prevention efforts are discussed. PMID:22662771
Mindfulness and emotion regulation in clinically depressed youth
Chambers, Richard
2017-01-01
Adolescence is a developmental period marked by a number of significant changes in psychological and social functioning. The demands placed upon adolescents and young adults by these changes place them at increased risk of depression, at least in part by the emergence of developmentally new stressors that can overwhelm the adolescent’s capacity for emotion regulation (ER). The adverse consequences of such early onset depression are dire, and include increased risk of suicide, increased impair...
Mueller, Michael M; Castells-Roca, Laia; Babu, Vipin; Ermolaeva, Maria A; Müller, Roman-Ulrich; Frommolt, Peter; Williams, Ashley B; Greiss, Sebastian; Schneider, Jennifer I; Benzing, Thomas; Schermer, Bernhard; Schumacher, Björn
2014-12-01
Genome maintenance defects cause complex disease phenotypes characterized by developmental failure, cancer susceptibility and premature ageing. It remains poorly understood how DNA damage responses function during organismal development and maintain tissue functionality when DNA damage accumulates with ageing. Here we show that the FOXO transcription factor DAF-16 is activated in response to DNA damage during development, whereas the DNA damage responsiveness of DAF-16 declines with ageing. We find that in contrast to its established role in mediating starvation arrest, DAF-16 alleviates DNA-damage-induced developmental arrest and even in the absence of DNA repair promotes developmental growth and enhances somatic tissue functionality. We demonstrate that the GATA transcription factor EGL-27 co-regulates DAF-16 target genes in response to DNA damage and together with DAF-16 promotes developmental growth. We propose that EGL-27/GATA activity specifies DAF-16-mediated DNA damage responses to enable developmental progression and to prolong tissue functioning when DNA damage persists.
Comparing three novel endpoints for developmental osteotoxicity in the embryonic stem cell test
International Nuclear Information System (INIS)
Nieden, Nicole I. zur; Davis, Lesley A.; Rancourt, Derrick E.
2010-01-01
Birth defects belong to the most serious side effects of pharmaceutical compounds or environmental chemicals. In vivo, teratogens most often affect the normal development of bones, causing growth retardation, limb defects or craniofacial malformations. The embryonic stem cell test (EST) is one of the most promising models that allow the in vitro prediction of embryotoxicity, with one of its endpoints being bone tissue development. The present study was designed to describe three novel inexpensive endpoints to assess developmental osteotoxicity using the model compounds penicillin G (non-teratogenic), 5-fluorouracil (strong teratogen) and all-trans retinoic acid (bone teratogen). These three endpoints were: quantification of matrix incorporated calcium by (1) morphometric analysis and (2) measurement of calcium levels as well as (3) activity of alkaline phosphatase, an enzyme involved in matrix calcification. To evaluate our data, we have compared the concentration curves and resulting ID 50 s of the new endpoints with mRNA expression for osteocalcin. Osteocalcin is an exclusive marker found only in mineralized tissues, is regulated upon compound treatment and reliably predicts the potential of a chemical entity acting as a bone teratogen. By comparing the new endpoints to quantitative expression of osteocalcin, which we previously identified as suitable to detect developmental osteotoxicity, we were ultimately able to illustrate IMAGE analysis and Ca 2+ deposition assays as two reliable novel endpoints for the EST. This is of particular importance for routine industrial assessment of novel compounds as these two new endpoints may substitute previously used molecular read-out methods, which are often costly and time-consuming.
Reproduction Symposium: developmental programming of reproductive and metabolic health.
Padmanabhan, V; Veiga-Lopez, A
2014-08-01
Inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (approximately 5 mo gestation and approximately 7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and/or reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of noninvasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting thereby keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level, all 3 feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive and metabolic diseases, insulin resistance, hypertension, and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of
Developmental programming of reproductive and metabolic health1,2
Padmanabhan, V.; Veiga-Lopez, A.
2014-01-01
The inappropriate programming of the reproductive system by developmental exposure to excess steroid hormones is of concern. Sheep are well suited for investigating developmental origin of reproductive and metabolic disorders. The developmental time line of female sheep (~5 mo gestation and ~7 mo to puberty) is ideal for conducting sequential studies of the progression of metabolic and (or) reproductive disruption from the developmental insult to manifestation of adult consequences. Major benefits of using sheep include knowledge of established critical periods to target adult defects, a rich understanding of reproductive neuroendocrine regulation, availability of non-invasive approaches to monitor follicular dynamics, established surgical approaches to obtain hypophyseal portal blood for measurement of hypothalamic hormones, and the ability to perform studies in natural setting keeping behavioral interactions intact. Of importance is the ability to chronically instrument fetus and mother for determining early endocrine perturbations. Prenatal exposure of the female to excess testosterone (T) leads to an array of adult reproductive disorders that include LH excess, functional hyperandrogenism, neuroendocrine defects, multifollicular ovarian morphology, and corpus luteum dysfunction culminating in early reproductive failure. At the neuroendocrine level all three feedback systems are compromised. At the pituitary level, gonadotrope (LH secretion) sensitivity to GnRH is increased. Multifollicular ovarian morphology stems from persistence of follicles, as well as enhanced follicular recruitment. These defects culminate in progressive loss of cyclicity and reduced fecundity. Prenatal T excess also leads to fetal growth retardation, an early marker of adult reproductive/metabolic diseases, insulin resistance, hypertension and behavioral deficits. Collectively, the reproductive and metabolic deficits of prenatal T-treated sheep provide proof of concept for the
Fong, Carlton J.; Zientek, Linda Reichwein; Yetkiner Ozel, Zeynep Ebrar; Phelps, Julie M.
2015-01-01
The present study investigated developmental mathematics students' efficacy beliefs for motivational, self-regulated learning, resource management, and cognitive strategies and which of these beliefs most differentiated European American, African American and Hispanic students in terms of their mathematics achievement. The diverse sample consisted…
Building a developmental toxicity ontology.
Baker, Nancy; Boobis, Alan; Burgoon, Lyle; Carney, Edward; Currie, Richard; Fritsche, Ellen; Knudsen, Thomas; Laffont, Madeleine; Piersma, Aldert H; Poole, Alan; Schneider, Steffen; Daston, George
2018-04-03
As more information is generated about modes of action for developmental toxicity and more data are generated using high-throughput and high-content technologies, it is becoming necessary to organize that information. This report discussed the need for a systematic representation of knowledge about developmental toxicity (i.e., an ontology) and proposes a method to build one based on knowledge of developmental biology and mode of action/ adverse outcome pathways in developmental toxicity. This report is the result of a consensus working group developing a plan to create an ontology for developmental toxicity that spans multiple levels of biological organization. This report provide a description of some of the challenges in building a developmental toxicity ontology and outlines a proposed methodology to meet those challenges. As the ontology is built on currently available web-based resources, a review of these resources is provided. Case studies on one of the most well-understood morphogens and developmental toxicants, retinoic acid, are presented as examples of how such an ontology might be developed. This report outlines an approach to construct a developmental toxicity ontology. Such an ontology will facilitate computer-based prediction of substances likely to induce human developmental toxicity. © 2018 Wiley Periodicals, Inc.
Role of epigenetics in developmental biology and transgenerational inheritance.
Skinner, Michael K
2011-03-01
The molecular mechanisms involved in developmental biology and cellular differentiation have traditionally been considered to be primarily genetic. Environmental factors that influence early life critical windows of development generally do not have the capacity to modify genome sequence, nor promote permanent genetic modifications. Epigenetics provides a molecular mechanism for environment to influence development, program cellular differentiation, and alter the genetic regulation of development. The current review discusses how epigenetics can cooperate with genetics to regulate development and allow for greater plasticity in response to environmental influences. This impacts area such as cellular differentiation, tissue development, environmental induced disease etiology, epigenetic transgenerational inheritance, and the general systems biology of organisms and evolution. Copyright © 2011 Wiley-Liss, Inc.
Transgenerational developmental programming.
Aiken, Catherine E; Ozanne, Susan E
2014-01-01
The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations
Evans, Kory M; Waltz, Brandon; Tagliacollo, Victor; Chakrabarty, Prosanta; Albert, James S
2017-03-01
Convergent evolution is widely viewed as strong evidence for the influence of natural selection on the origin of phenotypic design. However, the emerging evo-devo synthesis has highlighted other processes that may bias and direct phenotypic evolution in the presence of environmental and genetic variation. Developmental biases on the production of phenotypic variation may channel the evolution of convergent forms by limiting the range of phenotypes produced during ontogeny. Here, we study the evolution and convergence of brachycephalic and dolichocephalic skull shapes among 133 species of Neotropical electric fishes (Gymnotiformes: Teleostei) and identify potential developmental biases on phenotypic evolution. We plot the ontogenetic trajectories of neurocranial phenotypes in 17 species and document developmental modularity between the face and braincase regions of the skull. We recover a significant relationship between developmental covariation and relative skull length and a significant relationship between developmental covariation and ontogenetic disparity. We demonstrate that modularity and integration bias the production of phenotypes along the brachycephalic and dolichocephalic skull axis and contribute to multiple, independent evolutionary transformations to highly brachycephalic and dolichocephalic skull morphologies.
Energy Technology Data Exchange (ETDEWEB)
Sabala, I. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics
1998-12-31
Embryo development is a complex process involving a set of strictly regulated events. The regulation of these events is poorly understood especially during the early stages of embryo development. Somatic embryos go through the same developmental stages as zygotic embryos making them an ideal model system for studying the regulation of embryo development. We have used embryogenic cultures of Picea abies to study some aspects of the regulation of embryo development in gymnosperms. The bottle neck during somatic embryogenesis is the switch from the proliferation stage to the maturation stage. This switch is initiated by giving somatic embryos a maturation treatment i.e. the embryos are treated with abscisic acid (ABA). Somatic embryos which respond to ABA by forming mature somatic embryos were stimulated to secret a 70 kDa protein, AF70. The af70 gene was isolated and characterised. The expression of the af70 gene was constitutive in embryos but was highly ABA-induced in seedlings. Moreover, expression of this gene was stimulated during cold acclimation of Picea abies seedlings. A full length Picea abies cDNA clone Pa18, encoding a protein with the characteristics of plant lipid transfer proteins (LTPs), was isolated and characterised. The Pa18 gene is constitutively expressed in embryogenic cultures of Picea abies representing different stages of development as well as in nonembryogenic callus and seedlings. In situ hybridization showed that Pa18 gene is expressed in all embryonic cells of proliferating somatic embryos but the expression of the gene in mature somatic and zygotic embryos is restricted to the outer cell layer. Southern blot analysis at different stringencies was consistent with a single gene. An alteration in expression of Pa18 causes disturbance in the formation of the proper outer cell layer in the maturing somatic embryos. In addition to its influence on embryo development the Pa18 gene product also inhibits growth of Agrobacterium tumefaciens 195
Uljarević, Mirko; Hedley, Darren; Nevill, Rose; Evans, David W; Cai, Ru Ying; Butter, Eric; Mulick, James A
2018-04-06
The present study examined the link between poor self-regulation (measured by the child behavior checklist dysregulated profile [DP]) and core autism symptoms, as well as with developmental level, in a sample of 107 children with autism spectrum disorder (ASD) aged 19-46 months. We further examined the utility of DP in predicting individual differences in adaptive functioning, relative to the influence of ASD severity, chronological age (CA), and developmental level. Poor self-regulation was unrelated to CA, developmental level, and severity of ADOS-2 restricted and repetitive behaviors, but was associated with lower ADOS-2 social affect severity. Hierarchical regression identified poor self-regulation as a unique independent predictor of adaptive behavior, with more severe dysregulation predicting poorer adaptive functioning. Results highlight the importance of early identification of deficits in self-regulation, and more specifically, of the utility of DP, when designing individually tailored treatments for young children with ASD. Autism Res 2018. © 2018 International Society for Autism Research, Wiley Periodicals, Inc. This study explored the relationship between poor self-regulation and age, verbal and non-verbal developmental level, severity of autism symptoms and adaptive functioning in 107 children with autism under 4 years of age. Poor self-regulation was unrelated to age, developmental level, and severity of restricted and repetitive behaviors but was associated with lower social affect severity. Importantly, more severe self-regulation deficits predicted poorer adaptive functioning. © 2018 International Society for Autism Research, Wiley Periodicals, Inc.
Augustyniak, J; Lenart, J; Zychowicz, M; Lipka, G; Gaj, P; Kolanowska, M; Stepien, P P; Buzanska, L
2017-12-01
Pyrroloquinoline quinone (PQQ) is a factor influencing on the mitochondrial biogenesis. In this study the PQQ effect on viability, total cell number, antioxidant capacity, mitochondrial biogenesis and differentiation potential was investigated in human induced Pluripotent Stem Cells (iPSC) - derived: neural stem cells (NSC), early neural progenitors (eNP) and neural progenitors (NP). Here we demonstrated that sensitivity to PQQ is dependent upon its dose and neural stage of development. Induction of the mitochondrial biogenesis by PQQ at three stages of neural differentiation was evaluated at mtDNA, mRNA and protein level. Changes in NRF1, TFAM and PPARGC1A gene expression were observed at all developmental stages, but only at eNP were correlated with the statistically significant increase in the mtDNA copy numbers and enhancement of SDHA, COX-1 protein level. Thus, the "developmental window" of eNP for PQQ-evoked mitochondrial biogenesis is proposed. This effect was independent of high antioxidant capacity of PQQ, which was confirmed in all tested cell populations, regardless of the stage of hiPSC neural differentiation. Furthermore, a strong induction of GFAP, with down regulation of MAP2 gene expression upon PQQ treatment was observed. This indicates a possibility of shifting the balance of cell differentiation in the favor of astroglia, but more research is needed at this point. Copyright © 2017 Elsevier Ltd. All rights reserved.
Verboon, Jeffrey M.; Rahe, Travis K.; Rodriguez-Mesa, Evelyn; Parkhurst, Susan M.
2015-01-01
Drosophila immune cells, the hemocytes, undergo four stereotypical developmental migrations to populate the embryo, where they provide immune reconnoitering, as well as a number of non–immune-related functions necessary for proper embryogenesis. Here, we describe a role for Rho1 in one of these developmental migrations in which posteriorly located hemocytes migrate toward the head. This migration requires the interaction of Rho1 with its downstream effector Wash, a Wiskott–Aldrich syndrome family protein. Both Wash knockdown and a Rho1 transgene harboring a mutation that prevents Wash binding exhibit the same developmental migratory defect as Rho1 knockdown. Wash activates the Arp2/3 complex, whose activity is needed for this migration, whereas members of the WASH regulatory complex (SWIP, Strumpellin, and CCDC53) are not. Our results suggest a WASH complex–independent signaling pathway to regulate the cytoskeleton during a subset of hemocyte developmental migrations. PMID:25739458
This article examines the role of parents in the development of children's self-regulation of energy intake. Various paths of parental influence are offered based on the literature on parental influences on children's emotion self-regulation. The parental paths include modeling, responses to childre...
Developmental plasticity in vision and behavior may help guppies overcome increased turbidity.
Ehlman, Sean M; Sandkam, Benjamin A; Breden, Felix; Sih, Andrew
2015-12-01
Increasing turbidity in streams and rivers near human activity is cause for environmental concern, as the ability of aquatic organisms to use visual information declines. To investigate how some organisms might be able to developmentally compensate for increasing turbidity, we reared guppies (Poecilia reticulata) in either clear or turbid water. We assessed the effects of developmental treatments on adult behavior and aspects of the visual system by testing fish from both developmental treatments in turbid and clear water. We found a strong interactive effect of rearing and assay conditions: fish reared in clear water tended to decrease activity in turbid water, whereas fish reared in turbid water tended to increase activity in turbid water. Guppies from all treatments decreased activity when exposed to a predator. To measure plasticity in the visual system, we quantified treatment differences in opsin gene expression of individuals. We detected a shift from mid-wave-sensitive opsins to long wave-sensitive opsins for guppies reared in turbid water. Since long-wavelength sensitivity is important in motion detection, this shift likely allows guppies to salvage motion-detecting abilities when visual information is obscured in turbid water. Our results demonstrate the importance of developmental plasticity in responses of organisms to rapidly changing environments.
Hadland, Scott E.; Knight, John R.; Harris, Sion K.
2014-01-01
Marijuana policy is rapidly evolving in the United States and elsewhere, with cannabis sales fully legalized and regulated in some jurisdictions and use of the drug for medicinal purposes permitted in many others. Amidst this political change, patients and families are increasingly asking whether cannabis and its derivatives may have therapeutic utility for a number of conditions, including developmental and behavioral disorders in children and adolescents. This review examines the epidemiology of cannabis use among children and adolescents, including those with developmental and behavioral diagnoses. It then outlines the increasingly well-recognized neurocognitive changes shown to occur in adolescents who use cannabis regularly, highlighting the unique susceptibility of the developing adolescent brain and describing the role of the endocannabinoid system in normal neurodevelopment. The review then discusses some of the proposed uses of cannabis in developmental and behavioral conditions, including attention deficit hyperactivity disorder (ADHD) and autism spectrum disorder (ASD). Throughout, the review outlines gaps in current knowledge and highlights directions for future research, especially in light of a dearth of studies specifically examining neurocognitive and psychiatric outcomes among children and adolescents with developmental and behavioral concerns exposed to cannabis. PMID:25650954
Hadland, Scott E; Knight, John R; Harris, Sion K
2015-01-01
Marijuana policy is rapidly evolving in the United States and elsewhere, with cannabis sales fully legalized and regulated in some jurisdictions and use of the drug for medicinal purposes permitted in many others. Amidst this political change, patients and families are increasingly asking whether cannabis and its derivatives may have therapeutic utility for a number of conditions, including developmental and behavioral disorders in children and adolescents. This review examines the epidemiology of cannabis use among children and adolescents, including those with developmental and behavioral diagnoses. It then outlines the increasingly well-recognized neurocognitive changes shown to occur in adolescents who use cannabis regularly, highlighting the unique susceptibility of the developing adolescent brain and describing the role of the endocannabinoid system in normal neurodevelopment. The review then discusses some of the proposed uses of cannabis in developmental and behavioral conditions, including attention-deficit hyperactivity disorder and autism spectrum disorder. Throughout, the review outlines gaps in current knowledge and highlights directions for future research, especially in light of a dearth of studies specifically examining neurocognitive and psychiatric outcomes among children and adolescents with developmental and behavioral concerns exposed to cannabis.
Mateus, A.R.A.; Marques-Pita, M.; Oostra, V.; Lafuente, E.; Brakefield, P.M.; Zwaan, B.J.; Beldade, P.
2014-01-01
Background The environmental regulation of development can result in the production of distinct phenotypes from the same genotype and provide the means for organisms to cope with environmental heterogeneity. The effect of the environment on developmental outcomes is typically mediated by hormonal
Why developmental niche construction is not selective niche construction: and why it matters.
Stotz, Karola
2017-10-06
In the last decade, niche construction has been heralded as the neglected process in evolution. But niche construction is just one way in which the organism's interaction with and construction of the environment can have potential evolutionary significance. The constructed environment does not just select for , it also produces new variation. Nearly 3 decades ago, and in parallel with Odling-Smee's article 'Niche-constructing phenotypes', West and King introduced the 'ontogenetic niche' to give the phenomena of exo genetic inheritance a formal name. Since then, a range of fields in the life sciences and medicine has amassed evidence that parents influence their offspring by means other than DNA (parental effects), and proposed mechanisms for how heritable variation can be environmentally induced and developmentally regulated. The concept of 'developmental niche construction' (DNC) elucidates how a diverse range of mechanisms contributes to the transgenerational transfer of developmental resources. My most central of claims is that whereas the selective niche of niche construction theory is primarily used to explain the active role of the organism in its selective environment, DNC is meant to indicate the active role of the organism in its developmental environment. The paper highlights the differences between the construction of the selective and the developmental niche, and explores the overall significance of DNC for evolutionary theory.
South Korean Development Cooperation in Africa: The Legacy of a Developmental State
Directory of Open Access Journals (Sweden)
Thomas Kalinowski
2016-01-01
Full Text Available This paper investigates how the legacy of the South Korean developmental state influences the way the country conducts its development cooperation (DC policies. We argue that institutions of the developmental state remain instrumental in structuring South Korea’s cooperation with the developing world. Two country case studies of South Korean DC and investment projects in Mozambique and Rwanda show that state initiative and a strong state–business partnership are defining elements of South Korean DC. At the same time, both cases show substantial differences when it comes to type of project, type of state–business partnership in the South Korean approach, degree of project ownership by the recipient country, and quality of governance in the recipient countries.
Developmental rate and behavior of early life stages of bighead carp and silver carp
Chapman, Duane C.; George, Amy E.
2011-01-01
The early life stages of Asian carp are well described by Yi and others (1988), but since these descriptions are represented by line drawings based only on live individuals and lacked temperature controls, further information on developmental time and stages is of use to expand understanding of early life stages of these species. Bighead carp and silver carp were cultured under two different temperature treatments to the one-chamber gas bladder stage, and a photographic guide is provided for bighead carp and silver carp embryonic and larval development, including notes about egg morphology and larval swimming behavior. Preliminary information on developmental time and hourly thermal units for each stage is also provided. Both carp species developed faster under warmer conditions. Developmental stages and behaviors are generally consistent with earlier works with the exception that strong vertical swimming immediately after hatching was documented in this report.
Directory of Open Access Journals (Sweden)
Mitsutoshi Yamada
2017-03-01
Full Text Available Changes in oocyte quality can have great impact on the developmental potential of early embryos. Here we test whether nuclear genome transfer from a developmentally incompetent to a developmentally competent oocyte can restore developmental potential. Using in vitro oocyte aging as a model system we performed nuclear transfer in mouse oocytes at metaphase II or at the first interphase, and observed that development to the blastocyst stage and to term was as efficient as in control embryos. The increased developmental potential is explained primarily by correction of abnormal cytokinesis at anaphase of meiosis and mitosis, by a reduction in chromosome segregation errors, and by normalization of the localization of chromosome passenger complex components survivin and cyclin B1. These observations demonstrate that developmental decline is primarily due to abnormal function of cytoplasmic factors involved in cytokinesis, while the genome remains developmentally fully competent.
Streptomyces sporulation - Genes and regulators involved in bacterial cell differentiation
Larsson, Jessica
2010-01-01
Streptomycetes are Gram-positive bacteria with a complex developmental life cycle. They form spores on specialized cells called aerial hyphae, and this sporulation involves alterations in growth, morphogenesis and cell cycle processes like cell division and chromosome segregation. Understanding the developmental mechanisms that streptomycetes have evolved for regulating for example cell division is of general interest in bacterial cell biology. It can also be valuable in the design of new dru...
Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.
Aoyagi, N; Wassarman, D A
2001-10-01
In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.
2011-09-23
... of study results to assess concerns about human reproductive and developmental toxicities. It does... assist that office in processing your requests. See the SUPPLEMENTARY INFORMATION section for electronic access to the guidance document. Submit electronic comments on the guidance to http://www.regulations.gov...
Connective tissue fibroblasts and Tcf4 regulate myogenesis
Mathew, Sam J.; Hansen, Jody M.; Merrell, Allyson J.; Murphy, Malea M.; Lawson, Jennifer A.; Hutcheson, David A.; Hansen, Mark S.; Angus-Hill, Melinda; Kardon, Gabrielle
2011-01-01
Muscle and its connective tissue are intimately linked in the embryo and in the adult, suggesting that interactions between these tissues are crucial for their development. However, the study of muscle connective tissue has been hindered by the lack of molecular markers and genetic reagents to label connective tissue fibroblasts. Here, we show that the transcription factor Tcf4 (transcription factor 7-like 2; Tcf7l2) is strongly expressed in connective tissue fibroblasts and that Tcf4GFPCre mice allow genetic manipulation of these fibroblasts. Using this new reagent, we find that connective tissue fibroblasts critically regulate two aspects of myogenesis: muscle fiber type development and maturation. Fibroblasts promote (via Tcf4-dependent signals) slow myogenesis by stimulating the expression of slow myosin heavy chain. Also, fibroblasts promote the switch from fetal to adult muscle by repressing (via Tcf4-dependent signals) the expression of developmental embryonic myosin and promoting (via a Tcf4-independent mechanism) the formation of large multinucleate myofibers. In addition, our analysis of Tcf4 function unexpectedly reveals a novel mechanism of intrinsic regulation of muscle fiber type development. Unlike other intrinsic regulators of fiber type, low levels of Tcf4 in myogenic cells promote both slow and fast myogenesis, thereby promoting overall maturation of muscle fiber type. Thus, we have identified novel extrinsic and intrinsic mechanisms regulating myogenesis. Most significantly, our data demonstrate for the first time that connective tissue is important not only for adult muscle structure and function, but is a vital component of the niche within which muscle progenitors reside and is a critical regulator of myogenesis. PMID:21177349
Directory of Open Access Journals (Sweden)
Daniel P S Osborn
Full Text Available Common intronic variants in the Human fat mass and obesity-associated gene (FTO are found to be associated with an increased risk of obesity. Overexpression of FTO correlates with increased food intake and obesity, whilst loss-of-function results in lethality and severe developmental defects. Despite intense scientific discussions around the role of FTO in energy metabolism, the function of FTO during development remains undefined. Here, we show that loss of Fto leads to developmental defects such as growth retardation, craniofacial dysmorphism and aberrant neural crest cells migration in Zebrafish. We find that the important developmental pathway, Wnt, is compromised in the absence of FTO, both in vivo (zebrafish and in vitro (Fto(-/- MEFs and HEK293T. Canonical Wnt signalling is down regulated by abrogated β-Catenin translocation to the nucleus whilst non-canonical Wnt/Ca(2+ pathway is activated via its key signal mediators CaMKII and PKCδ. Moreover, we demonstrate that loss of Fto results in short, absent or disorganised cilia leading to situs inversus, renal cystogenesis, neural crest cell defects and microcephaly in Zebrafish. Congruently, Fto knockout mice display aberrant tissue specific cilia. These data identify FTO as a protein-regulator of the balanced activation between canonical and non-canonical branches of the Wnt pathway. Furthermore, we present the first evidence that FTO plays a role in development and cilia formation/function.
ODORANT1 Regulates Fragrance Biosynthesis in Petunia FlowersW⃞
Verdonk, Julian C.; Haring, Michel A.; van Tunen, Arjen J.; Schuurink, Robert C.
2005-01-01
Floral scent is important to plant reproduction because it attracts pollinators to the sexual organs. Therefore, volatile emission is usually tuned to the foraging activity of the pollinators. In Petunia hybrida, volatile benzenoids determine the floral aroma. Although the pathways for benzenoid biosynthesis have been characterized, the enzymes involved are less well understood. How production and emission are regulated is unknown. By targeted transcriptome analyses, we identified ODORANT1 (ODO1), a member of the R2R3-type MYB family, as a candidate for the regulation of volatile benzenoids in Petunia hybrida cv W115 (Mitchell) flowers. These flowers are only fragrant in the evening and at night. Transcript levels of ODO1 increased before the onset of volatile emission and decreased when volatile emission declined. Downregulation of ODO1 in transgenic P. hybrida Mitchell plants strongly reduced volatile benzenoid levels through decreased synthesis of precursors from the shikimate pathway. The transcript levels of several genes in this pathway were reduced by suppression of ODO1 expression. Moreover, ODO1 could activate the promoter of the 5-enol-pyruvylshikimate-3-phosphate synthase gene. Flower pigmentation, which is furnished from the same shikimate precursors, was not influenced because color and scent biosynthesis occur at different developmental stages. Our studies identify ODO1 as a key regulator of floral scent biosynthesis. PMID:15805488
Molenaar, Peter C. M.
2015-01-01
The main theme of this paper concerns the persistent critique of Gilbert Gottlieb on developmental behavior genetics and my reactions to this critique, the latter changing from rejection to complete acceptation. Concise characterizations of developmental behavior genetics, developmental systems theory (to which Gottlieb made essential…
Directory of Open Access Journals (Sweden)
Vyacheslav Gurevich
Full Text Available Tight regulation of developmental pathways is of critical importance to all organisms, and is achieved by a transcriptional cascade ensuring the coordinated expression of sets of genes. We aimed to explore whether a strong signal is required to enter and complete a developmental pathway, by using meiosis in budding yeast as a model. We demonstrate that meiosis in budding yeast is insensitive to drastic changes in the levels of its consecutive positive regulators (Ime1, Ime2, and Ndt80. Entry into DNA replication is not correlated with the time of transcription of the early genes that regulate this event. Entry into nuclear division is directly regulated by the time of transcription of the middle genes, as premature transcription of their activator NDT80, leads to a premature entry into the first meiotic division, and loss of coordination between DNA replication and nuclear division. We demonstrate that Cdk1/Cln3 functions as a negative regulator of Ime2, and that ectopic expression of Cln3 delays entry into nuclear division as well as NDT80 transcription. Because Ime2 functions as a positive regulator for premeiotic DNA replication and NDT80 transcription, as well as a negative regulator of Cdk/Cln, we suggest that a double negative feedback loop between Ime2 and Cdk1/Cln3 promotes a bistable switch from the cell cycle to meiosis. Moreover, our results suggest a regulatory mode switch that ensures robust meiosis as the transcription of the early meiosis-specific genes responds in a graded mode to Ime1 levels, whereas that of the middle and late genes as well as initiation of DNA replication, are regulated in a threshold mode.
Developmental Transcriptomic Features of the Carcinogenic Liver Fluke, Clonorchis sinensis
Cho, Pyo Yun; Kim, Tae Im; Cho, Shin-Hyeong; Choi, Sang-Haeng; Park, Hong-Seog; Kim, Tong-Soo; Hong, Sung-Jong
2011-01-01
Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs). Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development, bile chemotaxis, and
Developmental transcriptomic features of the carcinogenic liver fluke, Clonorchis sinensis.
Directory of Open Access Journals (Sweden)
Won Gi Yoo
2011-06-01
Full Text Available Clonorchis sinensis is the causative agent of the life-threatening disease endemic to China, Korea, and Vietnam. It is estimated that about 15 million people are infected with this fluke. C. sinensis provokes inflammation, epithelial hyperplasia, and periductal fibrosis in bile ducts, and may cause cholangiocarcinoma in chronically infected individuals. Accumulation of a large amount of biological information about the adult stage of this liver fluke in recent years has advanced our understanding of the pathological interplay between this parasite and its hosts. However, no developmental gene expression profiles of C. sinensis have been published. In this study, we generated gene expression profiles of three developmental stages of C. sinensis by analyzing expressed sequence tags (ESTs. Complementary DNA libraries were constructed from the adult, metacercaria, and egg developmental stages of C. sinensis. A total of 52,745 ESTs were generated and assembled into 12,830 C. sinensis assembled EST sequences, and then these assemblies were further categorized into groups according to biological functions and developmental stages. Most of the genes that were differentially expressed in the different stages were consistent with the biological and physical features of the particular developmental stage; high energy metabolism, motility and reproduction genes were differentially expressed in adults, minimal metabolism and final host adaptation genes were differentially expressed in metacercariae, and embryonic genes were differentially expressed in eggs. The higher expression of glucose transporters, proteases, and antioxidant enzymes in the adults accounts for active uptake of nutrients and defense against host immune attacks. The types of ion channels present in C. sinensis are consistent with its parasitic nature and phylogenetic placement in the tree of life. We anticipate that the transcriptomic information on essential regulators of development
Developmental regulation of nucleolus size during Drosophila eye differentiation.
Directory of Open Access Journals (Sweden)
Nicholas E Baker
Full Text Available When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.
Developmental regulation of nucleolus size during Drosophila eye differentiation.
Baker, Nicholas E
2013-01-01
When cell cycle withdrawal accompanies terminal differentiation, biosynthesis and cellular growth are likely to change also. In this study, nucleolus size was monitored during cell fate specification in the Drosophila eye imaginal disc using fibrillarin antibody labeling. Nucleolus size is an indicator of ribosome biogenesis and can correlate with cellular growth rate. Nucleolar size was reduced significantly during cell fate specification and differentiation, predominantly as eye disc cells entered a cell cycle arrest that preceded cell fate specification. This reduction in nucleolus size required Dpp and Hh signaling. A transient enlargement of the nucleolus accompanied cell division in the Second Mitotic Wave. Nucleoli continued to diminish in postmitotic cells following fate specification. These results suggest that cellular growth is regulated early in the transition from proliferating progenitor cells to terminal cell fate specification, contemporary with regulation of the cell cycle, and requiring the same extracellular signals.
Michalko, Jaroslav; Glanc, Matouš; Perrot-Rechenmann, Catherine; Friml, Jiří
2016-01-01
The Auxin Binding Protein 1 (ABP1) is one of the most studied proteins in plants. Since decades ago, it has been the prime receptor candidate for the plant hormone auxin with a plethora of described functions in auxin signaling and development. The developmental importance of ABP1 has recently been questioned by identification of Arabidopsis thaliana abp1 knock-out alleles that show no obvious phenotypes under normal growth conditions. In this study, we examined the contradiction between the normal growth and development of the abp1 knock-outs and the strong morphological defects observed in three different ethanol-inducible abp1 knock-down mutants ( abp1-AS, SS12K, SS12S). By analyzing segregating populations of abp1 knock-out vs. abp1 knock-down crosses we show that the strong morphological defects that were believed to be the result of conditional down-regulation of ABP1 can be reproduced also in the absence of the functional ABP1 protein. This data suggests that the phenotypes in abp1 knock-down lines are due to the off-target effects and asks for further reflections on the biological function of ABP1 or alternative explanations for the missing phenotypic defects in the abp1 loss-of-function alleles.
Kishi, Shuji
2011-09-01
regulation. We wish to ascertain whether we can identify such genes promptly in a comprehensive manner. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. Copyright © 2011 Wiley-Liss, Inc.
Eastmond, Peter J; Jones, Russell L
2005-11-01
Storage oil is a major constituent in the cereal aleurone layer. The aim of this study was to investigate how gibberellin (GA) and abscisic acid (ABA) regulate conversion of oil to sugar in barley aleurone. The activity of the glyoxylate cycle enzyme isocitrate lyase (ICL) was surveyed in eight barley cultivars. Surprisingly, some cultivars do not require GA for the induction of ICL (e.g. Himalaya), whereas some do (e.g. Golden Promise). Furthermore, in Golden Promise, GA also stimulates triacylglycerol breakdown and enhances the net flux of carbon from acetate to sugar. In contrast, ABA strongly represses ICL activity and the flux of carbon from oil to sugar in both Golden Promise and Himalaya. Biolistics using a promoter reporter showed that GA and ABA regulate ICL at the level of transcription. Studies using barley and rice mutants and pharmacological agents show that GA-dependent induction of ICL activity is mediated by SLENDER1 and requires cGMP, but does not involve the transcription factor GAMYB. Gibberellin and ABA therefore act antagonistically to regulate gluconeogenesis in the aleurone layer as well as controlling the production and secretion of hydrolases into the starchy endosperm. We suggest that the variation between different barley cultivars might be a result of selective breeding to alter seed dormancy.
Qualitative methodology in developmental psychology
DEFF Research Database (Denmark)
Demuth, Carolin; Mey, Günter
2015-01-01
Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing rec...... in qualitative research offers a promising avenue to advance the field in this direction.......Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing...
Attentional networks in developmental dyscalculia
Directory of Open Access Journals (Sweden)
Henik Avishai
2010-01-01
Full Text Available Abstract Background Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Methods Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test - interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. Results The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. Conclusions These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.
Attentional networks in developmental dyscalculia.
Askenazi, Sarit; Henik, Avishai
2010-01-07
Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test-interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.
Copf, Tijana
2014-09-15
Dendrites develop morphologies characterized by multiple levels of complexity that involve neuron type specific dendritic length and particular spatial distribution. How this is developmentally regulated and in particular which signaling molecules are crucial in the process is still not understood. Using Drosophila class IV dendritic arborization (da) neurons we test in vivo the effects of cell-autonomous dose-dependent changes in the activity levels of the cAMP-dependent Protein Kinase A (PKA) on the formation of complex dendritic arbors. We find that genetic manipulations of the PKA activity levels affect profoundly the arbor complexity with strongest impact on distal branches. Both decreasing and increasing PKA activity result in a reduced complexity of the arbors, as reflected in decreased dendritic length and number of branching points, suggesting an inverted U-shape response to PKA. The phenotypes are accompanied by changes in organelle distribution: Golgi outposts and early endosomes in distal dendritic branches are reduced in PKA mutants. By using Rab5 dominant negative we find that PKA interacts genetically with the early endosomal pathway. We test if the possible relationship between PKA and organelles may be the result of phosphorylation of the microtubule motor dynein components or Rab5. We find that Drosophila cytoplasmic dynein components are direct PKA phosphorylation targets in vitro, but not in vivo, thus pointing to a different putative in vivo target. Our data argue that tightly controlled dose-dependent intra-neuronal PKA activity levels are critical in determining the dendritic arbor complexity, one of the possible ways being through the regulation of organelle distribution. Copyright © 2014 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Giorgi, Franco; Bruni, Luis Emilio
2015-01-01
. Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...
Psychotherapy with people with developmental disabilities
Directory of Open Access Journals (Sweden)
Barbara Zafošnik
2011-08-01
Full Text Available People with developmental disabilities can experience any psychological abnormalitiy and psychiatric illness as do people without developmental disabilities. Due to different diagnostic criteria, assessment procedures and instruments, we lack definite prevalence rates for people with developmental disabilities, also suffering from mental health problems, eventhough most studies place the rate at 20 to 40%. One of the possible treatment alternatives for augmenting psychological well-being is psychotherapy, but is extremely rarely used for people with severe and profound disabilities, where speech cannot be the main therapeutic medium. So, those that are included in the psychotherapuetic process are predominantly clients with mild developmental disabilities, and they are mostly in cognitive-behavioral therapy. Recently, two models of (psychotherapy for persons with severe and profound developmental disabilities were developed: developmental-dynamic relationship therapy and attachment-based behaviour therapy for children. Conceptually, they both originate form developmental psychoanalytic theories.
Affect regulation, brain development, and behavioral/emotional health in adolescence.
Dahl, R E
2001-01-01
This paper addresses the importance of affect regulation (AR) in relation to a broad range of behavioral and emotional health problems that emerge during adolescence. AR is defined as the adaptive modulation of emotional experience to serve a goal or purpose. This conceptualization of AR emphasizes the use of cognitive skills to guide, inhibit, or modify emotion and behavior, including the expression of emotional responses, in learned, strategic ways-skills that ultimately underpin adult levels of social maturity and the ability to show "responsible" behavior across a range of emotional situations. Neurobehavioral systems that subserve these AR skills include areas of the inferior and orbital prefrontal cortex (PFC), with rich interconnections to several limbic structures and other cortical areas, including the dorsolateral PFC. Adolescence represents an important developmental period in the functional maturation of adult AR skills; it is also a critical time in the development of clinical disorders of AR (eg, rates of depression increase dramatically and gender differences in depression emerge). Maturational changes in AR that occur during adolescence-particularly with respect to the role of emotions influencing responsible decision making-are also relevant to understanding key aspects of the developmental pathways of some behavioral health problems, such as alcohol use and nicotine dependence. A strong case is made for developmental research in affective neuroscience aimed at this important maturational period, particularly the kind of transdisciplinary research leading toward mechanistic understanding of the development of adolescent-onset disorders. Improving understanding in these areas could ultimately lead to the development of early interventions in targeted high-risk populations, and has enormous clinical and social policy relevance.
Directory of Open Access Journals (Sweden)
Peter eRobertson
2014-12-01
Full Text Available Legionella pneumophila is a natural intracellular bacterial parasite of free-living freshwater protozoa and an accidental human pathogen that causes Legionnaires’ disease. L. pneumophila differentiates, and does it in style. Recent experimental data on L. pneumophila’s differentiation point at the existence of a complex network that involves many developmental forms. We intend readers to: (i understand the biological relevance of L. pneumophila’s forms found in freshwater and their potential to transmit Legionnaires’ disease, and (ii learn that the common depiction of L. pneumophila’s differentiation as a biphasic developmental cycle that alternates between a replicative and a transmissive form is but an oversimplification of the actual process. Our specific objectives are to provide updates on the molecular factors that regulate L. pneumophila’s differentiation (section 2, and describe the developmental network of L. pneumophila (section 3, which for clarity’s sake we have dissected into five separate developmental cycles. Finally, since each developmental form seems to contribute differently to the human pathogenic process and the transmission of Legionnaires’ disease, readers are presented with a challenge to develop novel methods to detect the various L. pneumophila forms present in water (section 4, as a means to improve our assessment of risk and more effectively prevent legionellosis outbreaks.
Evidence for a developmental role for TLR4 in learning and memory.
Directory of Open Access Journals (Sweden)
Eitan Okun
Full Text Available Toll-like receptors (TLRs play essential roles in innate immunity and increasing evidence indicates that these receptors are expressed in neurons, astrocytes and microglia in the brain where they mediate responses to infection, stress and injury. Very little is known about the roles of TLRs in cognition. To test the hypothesis that TLR4 has a role in hippocampus-dependent spatial learning and memory, we used mice deficient for TLR4 and mice receiving chronic TLR4 antagonist infusion to the lateral ventricles in the brain. We found that developmental TLR4 deficiency enhances spatial reference memory acquisition and memory retention, impairs contextual fear-learning and enhances motor functions, traits that were correlated with CREB up-regulation in the hippocampus. TLR4 antagonist infusion into the cerebral ventricles of adult mice did not affect cognitive behavior, but instead affected anxiety responses. Our findings indicate a developmental role for TLR4 in shaping spatial reference memory, and fear learning and memory. Moreover, we show that central TLR4 inhibition using a TLR4 antagonist has no discernible physiological role in regulating spatial and contextual hippocampus-dependent cognitive behavior.
Qiu, Zhengkun; Wang, Xiaoxuan; Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen
2016-01-01
Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.
Directory of Open Access Journals (Sweden)
Zhengkun Qiu
Full Text Available Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF gene, which corresponds to the ah (Hoffman's anthocyaninless locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses.
Progranulin regulates neurogenesis in the developing vertebrate retina.
Walsh, Caroline E; Hitchcock, Peter F
2017-09-01
We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.
Korver, Anna M. H.; Konings, Saskia; Dekker, Friedo W.; Beers, Mieke; Wever, Capi C.; Frijns, Johan H. M.; Oudesluys-Murphy, Anne M.; de Vries, Jutte; Vossen, Ann; Kant, Sarina; van den Akker-van Marle, Elske; le Cessie, Saskia; Rieffe, Carolien; Ens-Dokkum, Martina; van Straaten, Irma; Uilenburg, Noelle; Elvers, Bert; Loeber, Gerard; Meuwese-Jongejeugd, Anneke; Maré, Marcel; van Zanten, Bert; Goedegebure, André; Coster, Francien; van Dijk, Pim; Goverts, Theo; Admiraal, Ronald; Cremers, Cor; Kunst, Dirk; de Leeuw, Marina; Dijkhuizen, Janette; Scharloo, Marleen; Hoeben, Dirk; Rijpma, Gerti; Graef, Wim; Linschoten, Dik; Kuijper, Jessica; Hof, Nanda; Koldewijn, Reinoud; Pans, Donné; Jorritsma, Frank; van Beurden, Maarten; ter Huurne, Christien; Brienesse, Patrick; Seekles, Lisanne; de Jong, Jantine; Thijssen, Andrea; Lievense, Andrea; van Egdom-van der Wind, Marina; Theunissen, Stephanie; Mooij, Sophie
2010-01-01
Newborn hearing screening programs have been implemented in many countries because it was thought that the earlier permanent childhood hearing impairment is detected, the less developmentally disadvantaged children would become. To date, however, no strong evidence exists for universal introduction
Desouza, Lynette A.; Sathanoori, Malini; Kapoor, Richa; Rajadhyaksha, Neha; Gonzalez, Luis E.; Kottmann, Andreas H.; Tole, Shubha; Vaidya, Vidita A.
2011-01-01
Thyroid hormone is important for development and plasticity in the immature and adult mammalian brain. Several thyroid hormone-responsive genes are regulated during specific developmental time windows, with relatively few influenced across the lifespan. We provide novel evidence that thyroid hormone regulates expression of the key developmental morphogen sonic hedgehog (Shh), and its coreceptors patched (Ptc) and smoothened (Smo), in the early embryonic and adult forebrain. Maternal hypo- and...
Growth Conditions Regulate the Requirements for Caulobacter Chromosome Segregation
DEFF Research Database (Denmark)
Shebelut, Conrad W.; Jensen, Rasmus Bugge; Gitai, Zemer
2009-01-01
Growth environments are important metabolic and developmental regulators. Here we demonstrate a growth environment-dependent effect on Caulobacter chromosome segregation of a small-molecule inhibitor of the MreB bacterial actin cytoskeleton. Our results also implicate ParAB as important segregation...... determinants, suggesting that multiple distinct mechanisms can mediate Caulobacter chromosome segregation and that their relative contributions can be environmentally regulated....
DEFF Research Database (Denmark)
Mravec, Jozef; Kračun, Stjepan K.; Rydahl, Maja G.
2014-01-01
Polysaccharides are major components of extracellular matrices and are often extensively modified post-synthetically to suit local requirements and developmental programmes. However, our current understanding of the spatiotemporal dynamics and functional significance of these modifications is lim...... and animal systems. We demonstrated their potential for providing new biological insights by using them to study homogalacturonan processing during Arabidopsis thaliana root cap development and by analyzing sites of chitosan deposition in fungal cell walls and arthropod exoskeletons....
Lorber, Michael F.; Egeland, Byron
2009-01-01
Developmental models and previous findings suggest that early parenting is more strongly associated with externalizing problems in early childhood than in adolescence. In this brief report, we addressed the question of whether the association of poor quality infancy parenting and externalizing problems “rebounds” in adulthood. Poor quality infancy parenting was associated with externalizing problems at kindergarten and first grade (mother report), as well as at 23 and 26 years (self-report). ...
A developmental, biopsychosocial model for the treatment of children with gender identity disorder.
Zucker, Kenneth J; Wood, Hayley; Singh, Devita; Bradley, Susan J
2012-01-01
This article provides a summary of the therapeutic model and approach used in the Gender Identity Service at the Centre for Addiction and Mental Health in Toronto. The authors describe their assessment protocol, describe their current multifactorial case formulation model, including a strong emphasis on developmental factors, and provide clinical examples of how the model is used in the treatment.
Kralj, S. (Sara)
2016-01-01
Abstract Cognitive and emotional developmental trajectories account for individual differences in children. Individual variations of emotional intelligence may be a result of various factors. For the purpose of this work children’s development of emotional intelligence is examined through individual developmental aspect related to development of cognition and emotion. The ability to be aware of own emotions and emotions of ...
Toward an understanding of late life suicidal behavior: the role of lifespan developmental theory.
Fiske, Amy; O'Riley, Alisa A
2016-01-01
Suicidal behavior in late life differs in important ways from suicidal behavior that occurs earlier in the lifespan, suggesting the possibility of developmental differences in the etiology of suicidal behavior. This paper examines late life suicidal behavior within the context of lifespan developmental theory. This paper presents a conceptual framework for using lifespan developmental theory to better understand late life suicidal behavior. We argue that the motivational theory of lifespan development, which focuses on control, is particularly relevant to late life suicide. This theory posits that opportunities to exert control over important aspects of one's life diminish in late life as a result of declines in physical functioning and other factors, and that successful aging is associated with adaptive regulation of this developmental change. Although continued striving to meet goals is normative throughout the lifespan, most individuals also increase the use of compensatory strategies in old age or when faced with a decline in functioning. We propose that individuals who do not adapt to developmental changes by altering their strategies for exerting control will be at risk for suicidal behavior in late life. This paper reviews evidence that supports the importance of control with respect to suicidal outcomes in older adults, as well as findings regarding specific types of control strategies that may be related to suicide risk in older adults with health-related limitations. Although suicidal behavior is not a normal part of aging, the application of lifespan developmental theory may be useful in understanding and potentially preventing suicide among older adults.
Low, Felicia M; Gluckman, Peter D; Hanson, Mark A
2011-06-01
The importance of developmental factors in influencing the risk of later-life disease has a strong evidence base derived from multiple epidemiological, clinical and experimental studies in animals and humans. During early life, an organism is able to adjust its phenotypic development in response to environmental cues. Such developmentally plastic responses evolved as a fitness-maximizing strategy to cope with variable environments. There are now increasing data that these responses are, at least partially, underpinned by epigenetic mechanisms. A mismatch between the early and later-life environments may lead to inappropriate early life-course epigenomic changes that manifest in later life as increased vulnerability to disease. There is also growing evidence for the transgenerational transmission of epigenetic marks. This article reviews the evidence that susceptibility to metabolic and cardiovascular disease in humans is linked to changes in epigenetic marks induced by early-life environmental cues, and discusses the clinical, public health and therapeutic implications that arise.
DeVeney, Shari L.; Hoffman, Lesa; Cress, Cynthia J.
2012-01-01
Purpose: In this study, the authors compared a multiple-domain strategy for assessing developmental age of young children with developmental disabilities who were at risk for long-term reliance on augmentative and alternative communication (AAC) with a communication-based strategy composed of receptive language and communication indices that may…
Developmental plasticity: Friend or foe?
Michels, Karin B
2017-01-01
Developmental plasticity - the concept that adaptation to changing and unfavorable environmental conditions are possible but may come at the price of compromised health potentials - has evolutionary grounding as it facilitates survival but dissents with fundamental evolutionary principles in that it may advance the lesser fit. It is an important cornerstone of the Developmental Origins of Health and Disease (DOHaD). Unlike evolutionary adaptation developmental plasticity may be short-lived and restricted to one or few generations and inheritance is uncertain. Potential mechanisms include epigenetic modifications adopted in utero which may not transmit to the next generation; future insights may allow adjustments of the outcomes of developmental plasticity.
Energy Technology Data Exchange (ETDEWEB)
Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands); Pronk, Tessa E. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht (Netherlands); Brandhof, Evert-Jan van den [Centre for Environmental Quality, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Ven, Leo T.M. van der [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Piersma, Aldert H. [Centre for Health Protection, National Institute for Public Health and the Environment (RIVM), P.O. Box 1, 3720 BA Bilthoven (Netherlands); Institute for Risk Assessment Sciences (IRAS), Utrecht University, P.O. Box 80.178, 3508 TD, Utrecht (Netherlands)
2013-10-01
The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol and saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.
Katanin: A Sword Cutting Microtubules for Cellular, Developmental, and Physiological Purposes
Directory of Open Access Journals (Sweden)
Ivan Luptovčiak
2017-11-01
Full Text Available KATANIN is a well-studied microtubule severing protein affecting microtubule organization and dynamic properties in higher plants. By regulating mitotic and cytokinetic and cortical microtubule arrays it is involved in the progression of cell division and cell division plane orientation. KATANIN is also involved in cell elongation and morphogenesis during plant growth. In this way KATANIN plays critical roles in diverse plant developmental processes including the development of pollen, embryo, seed, meristem, root, hypocotyl, cotyledon, leaf, shoot, and silique. KATANIN-dependent microtubule regulation seems to be under the control of plant hormones. This minireview provides an overview on available KATANIN mutants and discusses advances in our understanding of KATANIN biological roles in plants.
Protein expression in the nucleus accumbens of rats exposed to developmental vitamin D deficiency.
Directory of Open Access Journals (Sweden)
John McGrath
Full Text Available INTRODUCTION: Developmental vitamin D (DVD deficiency is a candidate risk factor for schizophrenia. Animal models have confirmed that DVD deficiency is associated with a range of altered genomic, proteomic, structural and behavioural outcomes in the rat. Because the nucleus accumbens has been implicated in neuropsychiatric disorders, in the current study we examined protein expression in this region in adult rats exposed to DVD deficiency METHODS: Female Sprague Dawley rats were maintained on a vitamin D deficient diet for 6 weeks, mated and allowed to give birth, after which a diet containing vitamin D was reintroduced. Male adult offspring (n = 8 were compared to control male (n = 8. 2-D gel electrophoresis-based proteomics and mass spectroscopy were used to investigate differential protein expression. RESULTS: There were 35 spots, mapped to 33 unique proteins, which were significantly different between the two groups. Of these, 22 were down-regulated and 13 up-regulated. The fold changes were uniformly small, with the largest FC being -1.67. Within the significantly different spots, three calcium binding proteins (calbindin1, calbindin2 and hippocalcin were altered. Other proteins associated with DVD deficiency related to mitochondrial function, and the dynamin-like proteins. CONCLUSIONS: Developmental vitamin D deficiency was associated with subtle changes in protein expression in the nucleus accumbens. Disruptions in pathways related to calcium-binding proteins and mitochondrial function may underlie some of the behavioural features associated with animal models of developmental vitamin D deficiency.
Directory of Open Access Journals (Sweden)
Guoxia Liu
Full Text Available Chemosensory proteins (CSPs are believed to play a key role in the chemosensory process in insects. Sequencing genomic DNA and RNA encoding CSP1, CSP2 and CSP3 in the sweet potato whitefly Bemisia tabaci showed strong variation between B and Q biotypes. Analyzing CSP-RNA levels showed not only biotype, but also age and developmental stage-specific expression. Interestingly, applying neonicotinoid thiamethoxam insecticide using twenty-five different dose/time treatments in B and Q young adults showed that Bemisia CSP1, CSP2 and CSP3 were also differentially regulated over insecticide exposure. In our study one of the adult-specific gene (CSP1 was shown to be significantly up-regulated by the insecticide in Q, the most highly resistant form of B. tabaci. Correlatively, competitive binding assays using tryptophan fluorescence spectroscopy and molecular docking demonstrated that CSP1 protein preferentially bound to linoleic acid, while CSP2 and CSP3 proteins rather associated to another completely different type of chemical, i.e. α-pentyl-cinnamaldehyde (jasminaldehyde. This might indicate that some CSPs in whiteflies are crucial to facilitate the transport of fatty acids thus regulating some metabolic pathways of the insect immune response, while some others are tuned to much more volatile chemicals known not only for their pleasant odor scent, but also for their potent toxic insecticide activity.
Developmental Trends in Self-Regulation among Low-Income Toddlers
Raikes, H. Abigail; Robinson, JoAnn L.; Bradley, Robert H.; Raikes, Helen H.; Ayoub, Catherine C.
2007-01-01
The attainment of self-regulatory skills during the toddler years is an understudied issue, especially among low-income children. The present study used growth modeling to examine the change over time and the final status in children's abilities to self-regulate, in a sample of 2,441 low-income children aged 14 to 36 months. Positive growth in…
Directory of Open Access Journals (Sweden)
Conforto Tara L
2012-04-01
Full Text Available Abstract Background Early liver development and the transcriptional transitions during hepatogenesis are well characterized. However, gene expression changes during the late postnatal/pre-pubertal to young adulthood period are less well understood, especially with regards to sex-specific gene expression. Methods Microarray analysis of male and female mouse liver was carried out at 3, 4, and 8 wk of age to elucidate developmental changes in gene expression from the late postnatal/pre-pubertal period to young adulthood. Results A large number of sex-biased and sex-independent genes showed significant changes during this developmental period. Notably, sex-independent genes involved in cell cycle, chromosome condensation, and DNA replication were down regulated from 3 wk to 8 wk, while genes associated with metal ion binding, ion transport and kinase activity were up regulated. A majority of genes showing sex differential expression in adult liver did not display sex differences prior to puberty, at which time extensive changes in sex-specific gene expression were seen, primarily in males. Thus, in male liver, 76% of male-specific genes were up regulated and 47% of female-specific genes were down regulated from 3 to 8 wk of age, whereas in female liver 67% of sex-specific genes showed no significant change in expression. In both sexes, genes up regulated from 3 to 8 wk were significantly enriched (p p Ihh; female-specific Cdx4, Cux2, Tox, and Trim24 and may contribute to the developmental changes that lead to global acquisition of liver sex-specificity by 8 wk of age. Conclusions Overall, the observed changes in gene expression during postnatal liver development reflect the deceleration of liver growth and the induction of specialized liver functions, with widespread changes in sex-specific gene expression primarily occurring in male liver.
van Bergen, Erik; Osbaldeston, Dave; Kodandaramaiah, Ullasa; Brattström, Oskar; Aduse-Poku, Kwaku; Brakefield, Paul M
2017-02-27
Developmental plasticity is thought to have profound macro-evolutionary effects, for example, by increasing the probability of establishment in new environments and subsequent divergence into independently evolving lineages. In contrast to plasticity optimized for individual traits, phenotypic integration, which enables a concerted response of plastic traits to environmental variability, may affect the rate of local adaptation by constraining independent responses of traits to selection. Using a comparative framework, this study explores the evolution of reaction norms for a variety of life history and morphological traits across five related species of mycalesine butterflies from the Old World tropics. Our data indicate that an integrated response of a suite of key traits is shared amongst these species. Interestingly, the traits that make up the functional suite are all known to be regulated by ecdysteroid signalling in Bicyclus anynana, one of the species included in this study, suggesting the same underlying hormonal regulator may be conserved within this group of polyphenic butterflies. We also detect developmental thresholds for the expression of alternative morphs. The phenotypic plasticity of a broad suite of morphological and life history traits is integrated and shared among species from three geographically independent lineages of mycalesine butterflies, despite considerable periods of independent evolution and exposure to disparate environments. At the same time, we have detected examples of evolutionary change where independent traits show different patterns of reaction norms. We argue that the expression of more robust phenotypes may occur by shifting developmental thresholds beyond the boundaries of the typical environmental variation.
Hosey, Alison M; Chaturvedi, Chandra-Prakash; Brand, Marjorie
2010-05-16
Genome wide studies have provided a wealth of information related to histone modifications. Particular modifications, which can encompass both broad and discrete regions, are associated with certain genomic elements and gene expression status. Here we focus on how studies on the beta-globin gene cluster can complement the genome wide effort through the thorough dissection of histone modifying protein crosstalk. The beta-globin locus serves as a model system to study both regulation of gene expression driven at a distance by enhancers and mechanisms of developmental switching of clustered genes. We investigate recent studies, which uncover that histone methyltransferases, recruited at the beta-globin enhancer, control gene expression by long range propagation on chromatin. Specifically, we focus on how seemingly antagonistic complexes, such as those including MLL2, G9a and UTX, can cooperate to functionally regulate developmentally controlled gene expression. Finally, we speculate on the mechanisms of chromatin modifying complex propagation on genomic domains.
Self-Regulation Processes and Thriving in Childhood and Adolescence: A View of the Issues
Lerner, Richard M.; Lerner, Jacqueline V.; Bowers, Edmond P.; Lewin-Bizan, Selva; Gestsdottir, Steinunn; Urban, Jennifer Brown
2011-01-01
Both organismic and intentional self-regulation processes must be integrated across childhood and adolescence for adaptive developmental regulations to exist and for the developing person to thrive, both during the first two decades of life and through the adult years. To date, such an integrated, life-span approach to self-regulation during…
Cole, David A; Martin, Nina C; Sterba, Sonya K; Sinclair-McBride, Keneisha; Roeder, Kathryn M; Zelkowitz, Rachel; Bilsky, Sarah A
2014-05-01
Prior research has shown cognitive reactivity to be a diathesis for depression. Seeking evidence for the developmental origins of such diatheses, the current study examined peer victimization and harsh parenting as developmental correlates of cognitive reactivity in 571 children and adolescents (ages 8-13 years). Four major findings emerged. First, a new method for assessing cognitive reactivity in children and adolescents showed significant reliability and demonstrated construct validity vis-à-vis its relation to depression. Second, history of more severe peer victimization was significantly related to cognitive reactivity, with verbal victimization being more strongly tied to cognitive reactivity than other subtypes of peer victimization. Third, harsh parenting was also significantly related to cognitive reactivity. Fourth, both peer victimization and harsh parenting made unique statistical contributions to cognitive reactivity, after controlling for the effects of the other. Taken together, these findings provide preliminary support for a developmental model pertaining to origins of cognitive reactivity in children and adolescents.
Directory of Open Access Journals (Sweden)
Kim Man-Sun
2012-05-01
Full Text Available Abstract Background Network motifs provided a “conceptual tool” for understanding the functional principles of biological networks, but such motifs have primarily been used to consider static network structures. Static networks, however, cannot be used to reveal time- and region-specific traits of biological systems. To overcome this limitation, we proposed the concept of a “spatiotemporal network motif,” a spatiotemporal sequence of network motifs of sub-networks which are active only at specific time points and body parts. Results On the basis of this concept, we analyzed the developmental gene regulatory network of the Drosophila melanogaster embryo. We identified spatiotemporal network motifs and investigated their distribution pattern in time and space. As a result, we found how key developmental processes are temporally and spatially regulated by the gene network. In particular, we found that nested feedback loops appeared frequently throughout the entire developmental process. From mathematical simulations, we found that mutual inhibition in the nested feedback loops contributes to the formation of spatial expression patterns. Conclusions Taken together, the proposed concept and the simulations can be used to unravel the design principle of developmental gene regulatory networks.
Translational co-regulation of a ligand and inhibitor by a conserved RNA element
DEFF Research Database (Denmark)
Zaucker, Andreas; Nagorska, Agnieszka; Kumari, Pooja
2018-01-01
In many organisms, transcriptional and post-transcriptional regulation of components of pathways or processes has been reported. However, to date, there are few reports of translational co-regulation of multiple components of a developmental signaling pathway. Here, we show that an RNA element wh...
Gao, Jianchang; Guo, Yanmei; Huang, Zejun; Du, Yongchen
2016-01-01
Anthocyanin pigments play many roles in plants, including providing protection against biotic and abiotic stresses. Many of the genes that mediate anthocyanin accumulation have been identified through studies of flowers and fruits; however, the mechanisms of genes involved in anthocyanin regulation in seedlings under low-temperature stimulus are less well understood. Genetic characterization of a tomato inbred line, FMTT271, which showed no anthocyanin pigmentation, revealed a mutation in a bHLH transcription factor (TF) gene, which corresponds to the ah (Hoffman's anthocyaninless) locus, and so the gene in FMTT271 at that locus was named ah. Overexpression of the wild type allele of AH in FMTT271 resulted in greater anthocyanin accumulation and increased expression of several genes in the anthocyanin biosynthetic pathway. The expression of AH and anthocyanin accumulation in seedlings was shown to be developmentally regulated and induced by low-temperature stress. Additionally, transcriptome analyses of hypocotyls and leaves from the near-isogenic lines seedlings revealed that AH not only influences the expression of anthocyanin biosynthetic genes, but also genes associated with responses to abiotic stress. Furthermore, the ah mutation was shown to cause accumulation of reactive oxidative species and the constitutive activation of defense responses under cold conditions. These results suggest that AH regulates anthocyanin biosynthesis, thereby playing a protective role, and that this function is particularly important in young seedlings that are particularly vulnerable to abiotic stresses. PMID:26943362
International Nuclear Information System (INIS)
Rimoldi, M.T.; Sher, A.; Heiny, A.; Lituchy, A.; Hammer, C.H.; Joiner, K.
1988-01-01
The authors recently showed that culture-derived metacyclic trypomastigotes (CMT), but not epimastigotes (Epi), of the Miranda 99 strain of Trypanosoma cruzi evade lysis by the human alternative complement pathway because of inefficient binding of factor B to complement component C3b on the parasite surface. These results suggested that CMT and tissue-culture-derived trypomastigotes (TCT), which also activate the alternative pathway poorly, might produce a molecule capable of interfering with factor B binding to C3b. They now demonstrate that CMT and TCT lysates, as well as molecules spontaneously shed from CMT and TCT but not Epi, accelerate decay of 125 I-labeled factor Bb from the alternative-pathway C3 convertase (C3bBb) assembled on zymosan or Epi and also accelerate decay of the classical-pathway C3 convertase (C4b2a) on sheep erythrocytes. Parasites metabolically labeled with [ 35 S]methionine spontaneously shed a limited number of radioactive components, ranging in molecular mass from 86 to 155 kDa for trypomastigotes and 25 to 80 kDa for Epi. Decay-accelerating activity within supernatants is inactivated by papain and is coeluted with 35 S-containing polypeptides on FPLC anion-exchange chromatography, suggesting that the active constituents are protein molecules. Molecules with decay-accelerating activity may explain the developmentally regulated resistance to complement-mediated lysis in infective and vertebrate stages for T. cruzi life cycle
Suryawan, Agus; Orellana, Renan A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Fleming, Jillian R; Davis, Teresa A
2007-12-01
Insulin and amino acids act independently to stimulate protein synthesis in skeletal muscle of neonatal pigs, and the responses decrease with development. The purpose of this study was to compare the separate effects of fed levels of INS and AA on the activation of signaling components leading to translation initiation and how these responses change with development. Overnight-fasted 6- (n = 4/group) and 26-day-old (n = 6/ group) pigs were studied during 1) euinsulinemic-euglycemiceuaminoacidemic conditions (controls), 2) euinsulinemic-euglycemichyperaminoacidemic clamps (AA), and 3) hyperinsulinemic-euglycemic-euaminoacidemic clamps (INS). INS, but not AA, increased the phosphorylation of protein kinase B (PKB) and tuberous sclerosis 2 (TSC2). Both INS and AA increased protein synthesis and the phosphorylation of mammalian target of rapamycin (mTOR), ribosomal protein S6 kinase-1, and eukaryotic initiation factor (eIF)4E-binding protein 1 (4E-BP1), and these responses were higher in 6-day-old compared with 26-day-old pigs. Both INS and AA decreased the binding of 4E-BP1 to eIF4E and increased eIF4E binding to eIF4G; these effects were greater in 6-day-old than in 26-day-old pigs. Neither INS nor AA altered the composition of mTORC1 (raptor, mTOR, and GbetaL) or mTORC2 (rictor, mTOR, and GbetaL) complexes. Furthermore, neither INS, AA, nor age had any effect on the abundance of Rheb and the phosphorylation of AMP-activated protein kinase and eukaryotic elongation factor 2. Our results suggest that the activation by insulin and amino acids of signaling components leading to translation initiation is developmentally regulated and parallels the developmental decline in protein synthesis in skeletal muscle of neonatal pigs.
DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER
Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković
2015-01-01
Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...
Li, Shu-Chen
2013-01-01
Instead of viewing organisms and individuals as passive recipients of their biological, ecological, and cultural inheritances, the developmental niche construction theory and the biocultural co-construction framework both emphasize that the individual's agency plays a key role in regulating how environmental and sociocontextual influences may…
Assessing self-regulated learning in early childhood education: Difficulties, needs, and prospects.
de la Fuente Arias, Jesús; Lozano Díaz, Antonia
2010-05-01
Self-regulated learning is one of the main processes being investigated today within developmental and educational psychology; however, the research has come up against a number of challenges for which no satisfactory response has been found, and which are impeding progress in the field. These challenges are two-fold: one part is methodological, as the process of self-regulation must be evaluated at the very moment in which it occurs, and the other part is developmental, as these processes have not been fully assessed in children under the age of 6 years. This article gives a broad overview of these challenges, as well as prospects for future solutions which are beginning to take shape.
Topographic processing in developmental prosopagnosia
DEFF Research Database (Denmark)
Klargaard, Solja K.; Starrfelt, Randi; Petersen, Anders
2016-01-01
deficit in visual processing or visual short-term memory. Interestingly, a classical dissociation could be demonstrated between impaired face memory and preserved topographic memory in two developmental prosopagnosics. We conclude that impairments in topographic memory tend to co-occur with developmental......Anecdotal evidence suggests a relation between impaired spatial (navigational) processing and developmental prosopagnosia. To address this formally, we tested two aspects of topographic processing – that is, perception and memory of mountain landscapes shown from different viewpoints. Participants...
Signal Transduction Pathways that Regulate CAB Gene Expression
Energy Technology Data Exchange (ETDEWEB)
Chory, Joanne
2004-12-31
The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.
Signal Transduction Pathways that Regulate CAB Gene Expression
Energy Technology Data Exchange (ETDEWEB)
Chory, Joanne
2006-01-16
The process of chloroplast differentiation, involves the coordinate regulation of many nuclear and chloroplast genes. The cues for the initiation of this developmental program are both extrinsic (e.g., light) and intrinsic (cell-type and plastid signals). During this project period, we utilized a molecular genetic approach to select for Arabidopsis mutants that did not respond properly to environmental light conditions, as well as mutants that were unable to perceive plastid damage. These latter mutants, called gun mutants, define two retrograde signaling pathways that regulate nuclear gene expression in response to chloroplasts. A major finding was to identify a signal from chloroplasts that regulates nuclear gene transcription. This signal is the build-up of Mg-Protoporphyrin IX, a key intermediate of the chlorophyll biosynthetic pathway. The signaling pathways downstream of this signal are currently being studied. Completion of this project has provided an increased understanding of the input signals and retrograde signaling pathways that control nuclear gene expression in response to the functional state of chloroplasts. These studies should ultimately influence our abilities to manipulate plant growth and development, and will aid in the understanding of the developmental control of photosynthesis.
Developmental stages of developmental screening: steps to implementation of a successful program.
Pinto-Martin, Jennifer A; Dunkle, Margaret; Earls, Marian; Fliedner, Dane; Landes, Cynthia
2005-11-01
Through the use of 2-stage screening strategies, research studies have shown that autism spectrum disorders and other developmental disabilities can now be detected reliably and with greater validity and in children as young as 18 months of age. Screening and diagnostic practices in the medical and educational arena lag far behind clinical research, however, with the average patient age at time of diagnosis being 3 to 6 years.We discuss the challenges of instituting universal developmental screening as part of pediatric care and present 2 models of existing or planned programs of early screening for autism spectrum disorder and developmental disability (1 in a community-based setting and 1 in a pediatric setting), and discuss the pros and cons of the different strategies.
Drosophila melanogaster as a model system for assessing development under conditions of microgravity
Abbott, M. K.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)
1992-01-01
More is known about the regulation of early developmental events in Drosophila than any other animal. In addition, its size and short life cycle make it a facile experimental system. Since developmental perturbations have been demonstrated when both oogenesis and embryogenesis occur in the space environment, there is a strong rationale for using this organism for the elucidation of specific gravity-sensitive developmental events.
Maternal abuse history and self-regulation difficulties in preadolescence.
Delker, Brianna C; Noll, Laura K; Kim, Hyoun K; Fisher, Philip A
2014-12-01
Although poor parenting is known to be closely linked to self-regulation difficulties in early childhood, comparatively little is understood about the role of other risk factors in the early caregiving environment (such as a parent's own experiences of childhood abuse) in developmental pathways of self-regulation into adolescence. Using a longitudinal design, this study aimed to examine how a mother's history of abuse in childhood relates to her offspring's self-regulation difficulties in preadolescence. Maternal controlling parenting and exposure to intimate partner aggression in the child's first 24-36 months were examined as important early social and environmental influences that may explain the proposed connection between maternal abuse history and preadolescent self-regulation. An ethnically diverse sample of mothers (N=488) who were identified as at-risk for child maltreatment was recruited at the time of their children's birth. Mothers and their children were assessed annually from the child's birth through 36 months, and at age 9-11 years. Structural equation modeling and bootstrap tests of indirect effects were conducted to address the study aims. Findings indicated that maternal abuse history indirectly predicted their children's self-regulation difficulties in preadolescence mainly through maternal controlling parenting in early childhood, but not through maternal exposure to aggression by an intimate partner. Maternal history of childhood abuse and maternal controlling parenting in her child's early life may have long-term developmental implications for child self-regulation. Copyright © 2014 Elsevier Ltd. All rights reserved.
Regulation of TORC2 complex in Dictyostelium discoideum
Khanna, Ankita
2016-01-01
Dictyostelium is an amoeba that lives in the soil where it feeds on bacteria. During scarcity of food, Dictyostelium cells undergo a highly regulated developmental process in which the cells aggregate by chemotaxing towards pulsatile emission of extracellular cAMP from a signaling center; the cells
Jason L. He; Ian Fuelscher; Peter G. Enticott; Wei-peng Teo; Pamela Barhoun; Christian Hyde
2018-01-01
IntroductionWhile the etiology of developmental coordination disorder (DCD) is yet to be established, brain-behavior modeling provides a cogent argument that neuropathology may subserve the motor difficulties typical of DCD. We argue that a number of the core behavioral features of the DCD profile (such as poor surround inhibition, compromised motor inhibition, and the presence of mirror movements) are consistent with difficulties regulating inhibition within the primary motor cortex (M1). Th...
Self-regulation underlies temperament and personality : An integrative developmental framework
Denissen, J.J.A.; van Aken, M.A.G.; Penke, L.; Wood, D.
2013-01-01
In this article, we present an integrative perspective on temperament and personality development. Personality and temperament are conceptualized as regulatory systems that start as physiological reactivity to environmental features early in life, but are increasingly supplemented by regulation
Geldhof, G John; Weiner, Michelle; Agans, Jennifer P; Mueller, Megan K; Lerner, Richard M
2014-01-01
Entrepreneurship represents a form of adaptive developmental regulation through which both entrepreneurs and their ecologies benefit. We describe entrepreneurship from the perspective of relational developmental systems theory, and examine the joint role of personal attributes, contextual attributes, and characteristics of person-context relationships in predicting entrepreneurial intent in a sample 3,461 college students enrolled in colleges and universities in the United States (60 % female; 61 % European American). Specifically, we tested whether personal characteristics (i.e., gender, intentional self-regulation skills, innovation orientation) and contextual factors (i.e., entrepreneurial parents) predicted college students' intentions to pursue an entrepreneurial career. Our findings suggest that self-regulation, innovation orientation, and having entrepreneurial role models (i.e., parents) predict entrepreneurial intent. Limitations and future directions for the study of youth entrepreneurship are discussed.
CONDOR: a database resource of developmentally associated conserved non-coding elements
Directory of Open Access Journals (Sweden)
Smith Sarah
2007-08-01
Full Text Available Abstract Background Comparative genomics is currently one of the most popular approaches to study the regulatory architecture of vertebrate genomes. Fish-mammal genomic comparisons have proved powerful in identifying conserved non-coding elements likely to be distal cis-regulatory modules such as enhancers, silencers or insulators that control the expression of genes involved in the regulation of early development. The scientific community is showing increasing interest in characterizing the function, evolution and language of these sequences. Despite this, there remains little in the way of user-friendly access to a large dataset of such elements in conjunction with the analysis and the visualization tools needed to study them. Description Here we present CONDOR (COnserved Non-coDing Orthologous Regions available at: http://condor.fugu.biology.qmul.ac.uk. In an interactive and intuitive way the website displays data on > 6800 non-coding elements associated with over 120 early developmental genes and conserved across vertebrates. The database regularly incorporates results of ongoing in vivo zebrafish enhancer assays of the CNEs carried out in-house, which currently number ~100. Included and highlighted within this set are elements derived from duplication events both at the origin of vertebrates and more recently in the teleost lineage, thus providing valuable data for studying the divergence of regulatory roles between paralogs. CONDOR therefore provides a number of tools and facilities to allow scientists to progress in their own studies on the function and evolution of developmental cis-regulation. Conclusion By providing access to data with an approachable graphics interface, the CONDOR database presents a rich resource for further studies into the regulation and evolution of genes involved in early development.
Spessot, Alexandra L; Plessen, Kerstin J; Peterson, Bradley S
2004-06-01
Normal brain maturational and developmental processes, together with plastic reorganization of the brain in response to experiential demands, contribute to the acquisition of improved capacities for self-regulation and impulse control during adolescence. The frontal lobe is a main focus for these developmental and plastic processes during the transition from adolescence into adulthood. Tourette syndrome (TS), defined as the chronic presence of motor and vocal tics, has been increasingly conceptualized as a disorder of impaired self-regulatory control. This disordered control is thought to give rise to semicompulsory urges to perform the movements that constitute simple tics, complex tics, or compulsions. Neuroimaging studies suggest that the expression of the genetic diathesis to TS is influenced by genetic and nongenetic factors affecting activity-dependent reorganization of neuroregulatory systems, thereby influencing the phenotype, illness severity, and adult outcome of tic disorders. Similar developmental processes during adolescence likely determine the phenotype and natural history of a broad range of other complex neuropsychiatric disorders of childhood onset, and they likely contribute to the acquisition of improved self-regulatory capacities that characterize normal adolescent development.
Developmental dental defects in children exposed to PCBs
Energy Technology Data Exchange (ETDEWEB)
Jan, J. [Ljubljana Univ. (Slovenia). Fac. of Medicine; Sovcikova, E.; Kovrizhnykh, I.; Wimmerova, S.; Trnovec, T. [Slovak Medical Univ., Bratislava (Slovakia). Inst. of Preventive and Clinical Medicine; Kocan, A. [Institute of Preventive and Clinical Medicine, Bratislava (Slovakia). Dept. of Toxic Organic Pollutants
2004-09-15
Developing enamel is sensitive to a wide range of local and systemic disturbances. Because of the absolute metabolic stability of its structure, changes in enamel during its development are permanent in nature. Polychlorinated biphenyls (PCB) have been shown to disturb tooth development in experimental animals, but only limited amounts of data exist on their adverse effects in humans. Dental changes such as mottled, chipped, carious, and neonatal teeth have been reported in accidentally exposed humans. Nevertheless, co-contamination with polychlorinated dibenzo-furans (PCDFs) was largely responsible for the overall toxicity4. Alaluusua et al. found that developmental dental defects were correlated with the total exposure to polychlorinated aromatic hydrocarbons via mother's milk. The correlation was strong with exposure to prevailing levels of polychlorinated dibenzo-p-dioxins (PCDD) and furans (PCDF) but weak with exposure to PCBs alone. In our previous study we have shown developmental dental defects in children exposed to PCBs alone6, suggesting that the developing human teeth are vulnerable to PCBs. In the Michalovce region of eastern Slovakia, PCBs from a chemical plant manufacturing Delors contaminated the surrounding district7. The total serum PCB levels in samples from the general population there exceeded by several times the background levels in subjects living in a comparable unexposed Svidnik district. PCB levels in breast milk samples in the Michalovce region were the highest in Slovakia. Levels of toxic polychlorinated aromatics (PCDFs, PCNs, and planar PCBs) in technical Delors were high. The aim of this study was to evaluate the effects of long-term exposure to PCBs, measured at the individual level, on developmental dental defects in children in eastern Slovakia.
Directory of Open Access Journals (Sweden)
Youngjoo Oh
Full Text Available Jasmonic acid is an important regulator of plant growth, development and defense. The jasmonate-ZIM domain (JAZ proteins are key regulators in jasmonate signaling ubiquitously present in flowering plants but their functional annotation remains largely incomplete. Recently, we identified 12 putative JAZ proteins in native tobacco, Nicotiana attenuata, and initiated systematic functional characterization of these proteins by reverse genetic approaches. In this report, Nicotiana attenuata plants silenced in the expression of NaJAZd (irJAZd by RNA interference were used to characterize NaJAZd function. Although NaJAZd transcripts were strongly and transiently up-regulated in the rosette leaves by simulated herbivory treatment, we did not observe strong defense-related phenotypes, such as altered herbivore performance or the constitutive accumulation of defense-related secondary metabolites in irJAZd plants compared to wild type plants, both in the glasshouse and the native habitat of Nicotiana attenuata in the Great Basin Desert, Utah, USA. Interestingly, irJAZd plants produced fewer seed capsules than did wild type plants as a result of increased flower abscission in later stages of flower development. The early- and mid-developmental stages of irJAZd flowers had reduced levels of jasmonic acid and jasmonoyl-L-isoleucine, while fully open flowers had normal levels, but these were impaired in NaMYB305 transcript accumulations. Previously, NaMYB305-silenced plants were shown to have strong flower abscission phenotypes and contained lower NECTARIN 1 transcript levels, phenotypes which are copied in irJAZd plants. We propose that the NaJAZd protein is required to counteract flower abscission, possibly by regulating jasmonic acid and jasmonoyl-L-isoleucine levels and/or expression of NaMYB305 gene in Nicotiana attenuata flowers. This novel insight into the function of JAZ proteins in flower and seed development highlights the diversity of functions
The Levels of Emotional Awareness Scale: a cognitive-developmental measure of emotion.
Lane, R D; Quinlan, D M; Schwartz, G E; Walker, P A; Zeitlin, S B
1990-01-01
The Levels of Emotional Awareness Scale (LEAS) is based on a new cognitive-developmental model of emotional experience. The scale poses evocative interpersonal situations and elicits descriptions of the emotional responses of self and others which are scored using specific structural criteria. Forty undergraduates (20 of each sex) were tested. Interrater reliability and intratest homogeneity of the LEAS were strong. The LEAS was significantly correlated with two measures of maturity: the Washington University Sentence Completion Test (SCT) of Ego Development, and the Parental Descriptions Scale-a cognitive-developmental measure of object representation. In addition, the LEAS correlated positively with openness to experience and emotional range but not with measures of specific emotions, repression or the number of words used in the LEAS responses. These findings suggest that it is the level of emotion, not the specific quality of emotion, that is tapped by the LEAS.
Validity and reliability of developmental coordination disorder questionnaire-spanish version
Directory of Open Access Journals (Sweden)
Luisa Matilde Salamanca Duque
2013-09-01
Full Text Available The Developmental Coordination Disorder is characterized by difficulties that produce consequences on the psychomotor performance in daily and school activities, and requires early diagnosis. The Developmental Coordination Disorder Questionnaire CTDC is used for its diagnosis.The objective of the study was to determinate the psychometric properties of CTDC. Methodology. Descriptive study and instrument validation, with a sample of 41 children aged between 6 to 12 years old, at school, with the application of the CTDC and the Da Fonseca Psychomotor Battery. The study analyzed internal consistency reliability, and intra-rater and concurrent validity through the two instruments. Results. Positive results were obtained: the reliability for the full internal consistency using Cronbach’s alpha coefficient was 0.92, and the intra-rater reliability using Kappa index was 0.82 with ap<0.001, independent items showed values above 0.5; concurrent validity through the Spearman correlation coefficient Rho was 0.6, with ap<0.01. Conclusions. The CTDC has appropriate and strong psychometric properties for its application and clinical use.
Directory of Open Access Journals (Sweden)
Tathyana Rachel Palo Mello
2014-12-01
Full Text Available Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH, control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1. EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g. miR-133 and miR-375, as well honeybee-specific ones (e.g. miR-3745 and miR-3761. Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect.
Jaspers, P.; Blomster, T.; Brosché, M.; Salojärvi, J.; Ahlfors, R.; Vainonen, J.P.; Reddy, R.A.; Immink, G.H.; Angenent, G.C.; Turck, F.; Overmyer, K.; Kangasjärvi, J.
2009-01-01
RADICAL-INDUCED CELL DEATH1 (RCD1) is an important regulator of stress and hormonal and developmental responses in Arabidopsis thaliana. Together with its closest homolog, SIMILAR TO RCD-ONE1 (SRO1), it is the only Arabidopsis protein containing the WWE domain, which is known to mediate
Arenas-Mena, Cesar; Coffman, James A.
2016-01-01
Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445
Hui, Min; Cui, Zhaoxia; Liu, Yuan; Song, Chengwen
2017-07-01
In crab, embryogenesis is a complicated developmental program marked by a series of critical events. RNA-Sequencing technology offers developmental biologists a way to identify many more developmental genes than ever before. Here, we present a comprehensive analysis of the transcriptomes of Eriocheir sinensis oosperms (Os) and embryos at the 2-4 cell stage (Cs), which are separated by a cleavage event. A total of 18 923 unigenes were identified, and 403 genes matched with gene ontology (GO) terms related to developmental processes. In total, 432 differentially expressed genes (DEGs) were detected between the two stages. Nine DEGs were specifically expressed at only one stage. These DEGs may be relevant to stage-specific molecular events during development. A number of DEGs related to `hedgehog signaling pathway', `Wnt signaling pathway' `germplasm', `nervous system', `sensory perception' and `segment polarity' were identified as being up-regulated at the Cs stage. The results suggest that these embryonic developmental events begin before the early cleavage event in crabs, and that many of the genes expressed in the two transcriptomes might be maternal genes. Our study provides ample information for further research on the molecular mechanisms underlying crab development.
Gene expression regulation in photomorphogenesis from the perspective of the central dogma.
Wu, Shu-Hsing
2014-01-01
Depending on the environment a young seedling encounters, the developmental program following seed germination could be skotomorphogenesis in the dark or photomorphogenesis in the light. Light signals are interpreted by a repertoire of photoreceptors followed by sophisticated gene expression networks, eventually resulting in developmental changes. The expression and functions of photoreceptors and key signaling molecules are highly coordinated and regulated at multiple levels of the central dogma in molecular biology. Light activates gene expression through the actions of positive transcriptional regulators and the relaxation of chromatin by histone acetylation. Small regulatory RNAs help attenuate the expression of light-responsive genes. Alternative splicing, protein phosphorylation/dephosphorylation, the formation of diverse transcriptional complexes, and selective protein degradation all contribute to proteome diversity and change the functions of individual proteins.
Reading in developmental prosopagnosia
DEFF Research Database (Denmark)
Starrfelt, Randi; Klargaard, Solja K; Petersen, Anders
2018-01-01
exposure durations (targeting the word superiority effect), and d) text reading. RESULTS: Participants with developmental prosopagnosia performed strikingly similar to controls across the four reading tasks. Formal analysis revealed a significant dissociation between word and face recognition......, that is, impaired reading in developmental prosopagnosia. METHOD: We tested 10 adults with developmental prosopagnosia and 20 matched controls. All participants completed the Cambridge Face Memory Test, the Cambridge Face Perception test and a Face recognition questionnaire used to quantify everyday face...... recognition experience. Reading was measured in four experimental tasks, testing different levels of letter, word, and text reading: (a) single word reading with words of varying length,(b) vocal response times in single letter and short word naming, (c) recognition of single letters and short words at brief...
Developmental biology of Streptomyces from the perspective of 100 actinobacterial genome sequences
Chandra, Govind; Chater, Keith F
2014-01-01
To illuminate the evolution and mechanisms of actinobacterial complexity, we evaluate the distribution and origins of known Streptomyces developmental genes and the developmental significance of actinobacteria-specific genes. As an aid, we developed the Actinoblast database of reciprocal blastp best hits between the Streptomyces coelicolor genome and more than 100 other actinobacterial genomes (http://streptomyces.org.uk/actinoblast/). We suggest that the emergence of morphological complexity was underpinned by special features of early actinobacteria, such as polar growth and the coupled participation of regulatory Wbl proteins and the redox-protecting thiol mycothiol in transducing a transient nitric oxide signal generated during physiologically stressful growth transitions. It seems that some cell growth and division proteins of early actinobacteria have acquired greater importance for sporulation of complex actinobacteria than for mycelial growth, in which septa are infrequent and not associated with complete cell separation. The acquisition of extracellular proteins with structural roles, a highly regulated extracellular protease cascade, and additional regulatory genes allowed early actinobacterial stationary phase processes to be redeployed in the emergence of aerial hyphae from mycelial mats and in the formation of spore chains. These extracellular proteins may have contributed to speciation. Simpler members of morphologically diverse clades have lost some developmental genes. PMID:24164321
Pingault, Jean-Baptiste; Viding, Essi; Galéra, Cédric; Greven, Corina U; Zheng, Yao; Plomin, Robert; Rijsdijk, Frühling
2015-07-01
Attention-deficit/hyperactivity disorder (ADHD) is conceptualized as a neurodevelopmental disorder that is strongly heritable. However, to our knowledge, no study to date has examined the genetic and environmental influences explaining interindividual differences in the developmental course of ADHD symptoms from childhood to adolescence (ie, systematic decreases or increases with age). The reason ADHD symptoms persist in some children but decline in others is an important concern, with implications for prognosis and interventions. To assess the proportional impact of genes and the environment on interindividual differences in the developmental course of ADHD symptom domains of hyperactivity/impulsivity and inattention between ages 8 and 16 years. A prospective sample of 8395 twin pairs from the Twins Early Development Study, recruited from population records of births in England and Wales between January 1, 1994, and December 31, 1996. Data collection at age 8 years took place between November 2002 and November 2004; data collection at age 16 years took place between February 2011 and January 2013. Both DSM-IV ADHD symptom subscales were rated 4 times by participants' mothers. Estimates from latent growth curve models indicated that the developmental course of hyperactivity/impulsivity symptoms followed a sharp linear decrease (mean score of 6.0 at age 8 years to 2.9 at age 16 years). Interindividual differences in the linear change in hyperactivity/impulsivity were under strong additive genetic influences (81%; 95% CI, 73%-88%). More than half of the genetic variation was specific to the developmental course and not shared with the baseline level of hyperactivity/impulsivity. The linear decrease in inattention symptoms was less pronounced (mean score of 5.8 at age 8 years to 4.9 at age 16 years). Nonadditive genetic influences accounted for a substantial amount of variation in the developmental course of inattention symptoms (54%; 95% CI, 8%-76%), with more than
[Developmental trauma disorder: towards a rational diagnosis for chronically traumatized children].
van der Kolk, Bessel A
2009-01-01
Less than eight years after the establishment of the National Child Traumatic Stress Network in 2001 it has become evident that the current diagnostic classification system is inadequate for tens of thousands of traumatized children. While the inclusion of PTSD in the psychiatric classification system in 1980 led to extensive scientific studies of that diagnosis, over the past 25 years there has been a parallel emergence of the field of Developmental Psychopathology, which has documented the effects of interpersonal trauma and disruption of caregiving systems on the development of affect regulation, attention, cognition, perception, and interpersonal relationships. Another significant development has been the increasing documentation of the effects of adverse early life experiences on brain development. The goal of introducing the diagnosis of Developmental Trauma Disorder is to capture the reality of the clinical presentations of children and adolescents exposed to chronic interpersonal trauma. Whether or not they exhibit some symptoms of PTSD, children who have developed in the context of ongoing danger, maltreatment, and inadequate caregiving systems are ill-served by the current diagnostic system, as it frequently leads to multiple unrelated diagnoses, an emphasis on behavioral control without recognition of interpersonal trauma and lack of safety in the etiology of symptoms, and a lack of attention to ameliorating the developmental disruptions that underlie the symptoms.
Developmental toxicity of engineered nanomaterials in rodents
Energy Technology Data Exchange (ETDEWEB)
Ema, Makoto, E-mail: ema-makoto@aist.go.jp; Gamo, Masashi; Honda, Kazumasa
2016-05-15
We summarized significant effects reported in the literature on the developmental toxicity of engineered nanomaterials (ENMs) in rodents. The developmental toxicity of ENMs included not only structural abnormalities, but also death, growth retardation, and behavioral and functional abnormalities. Most studies were performed on mice using an injection route of exposure. Teratogenic effects were indicated when multi-walled carbon nanotubes (MWCNTs), single-walled carbon nanotubes (SWCNTs), and TiO{sub 2}-nanoparticles were administered to mice during early gestation. Reactive oxygen species levels were increased in placentas and malformed fetuses and their placentas after prenatal exposure to MWCNTs and SWCNTs, respectively. The pre- and postnatal mortalities and growth retardation in offspring increased after prenatal exposure to ENMs. Histopathological and functional abnormalities were also induced in placentas after prenatal exposure to ENMs. Maternal exposure to ENMs induced behavioral alterations, histopathological and biochemical changes in the central nervous system, increased susceptibility to allergy, transplacental genotoxicity, and vascular, immunological, and reproductive effects in offspring. The size- and developmental stage-dependent placental transfer of ENMs was noted after maternal exposure. Silver accumulated in the visceral yolk sac after being injected with Ag-NPs during early gestation. Although currently available data has provided initial information on the potential developmental toxicity of ENMs, that on the developmental toxicity of ENMs is still very limited. Further studies using well-characterized ENMs, state-of the-art study protocols, and appropriate routes of exposure are required in order to clarify these developmental effects and provide information suitable for risk assessments of ENMs. - Highlights: • We review the developmental toxicity studies of engineered nanomaterials (ENMs). • Various developmental endpoints have been
Human developmental enhancers conserved between deuterostomes and protostomes.
Directory of Open Access Journals (Sweden)
Shoa L Clarke
Full Text Available The identification of homologies, whether morphological, molecular, or genetic, is fundamental to our understanding of common biological principles. Homologies bridging the great divide between deuterostomes and protostomes have served as the basis for current models of animal evolution and development. It is now appreciated that these two clades share a common developmental toolkit consisting of conserved transcription factors and signaling pathways. These patterning genes sometimes show common expression patterns and genetic interactions, suggesting the existence of similar or even conserved regulatory apparatus. However, previous studies have found no regulatory sequence conserved between deuterostomes and protostomes. Here we describe the first such enhancers, which we call bilaterian conserved regulatory elements (Bicores. Bicores show conservation of sequence and gene synteny. Sequence conservation of Bicores reflects conserved patterns of transcription factor binding sites. We predict that Bicores act as response elements to signaling pathways, and we show that Bicores are developmental enhancers that drive expression of transcriptional repressors in the vertebrate central nervous system. Although the small number of identified Bicores suggests extensive rewiring of cis-regulation between the protostome and deuterostome clades, additional Bicores may be revealed as our understanding of cis-regulatory logic and sample of bilaterian genomes continue to grow.
Directory of Open Access Journals (Sweden)
Jonathan D Stoltzfus
Full Text Available The infectious form of many parasitic nematodes, which afflict over one billion people globally, is a developmentally arrested third-stage larva (L3i. The parasitic nematode Strongyloides stercoralis differs from other nematode species that infect humans, in that its life cycle includes both parasitic and free-living forms, which can be leveraged to investigate the mechanisms of L3i arrest and activation. The free-living nematode Caenorhabditis elegans has a similar developmentally arrested larval form, the dauer, whose formation is controlled by four pathways: cyclic GMP (cGMP signaling, insulin/IGF-1-like signaling (IIS, transforming growth factor β (TGFβ signaling, and biosynthesis of dafachronic acid (DA ligands that regulate a nuclear hormone receptor. We hypothesized that homologous pathways are present in S. stercoralis, have similar developmental regulation, and are involved in L3i arrest and activation. To test this, we undertook a deep-sequencing study of the polyadenylated transcriptome, generating over 2.3 billion paired-end reads from seven developmental stages. We constructed developmental expression profiles for S. stercoralis homologs of C. elegans dauer genes identified by BLAST searches of the S. stercoralis genome as well as de novo assembled transcripts. Intriguingly, genes encoding cGMP pathway components were coordinately up-regulated in L3i. In comparison to C. elegans, S. stercoralis has a paucity of genes encoding IIS ligands, several of which have abundance profiles suggesting involvement in L3i development. We also identified seven S. stercoralis genes encoding homologs of the single C. elegans dauer regulatory TGFβ ligand, three of which are only expressed in L3i. Putative DA biosynthetic genes did not appear to be coordinately regulated in L3i development. Our data suggest that while dauer pathway genes are present in S. stercoralis and may play a role in L3i development, there are significant differences between
Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki
2015-11-01
The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.
Early Intervention in Children with Developmental Disabilities
Directory of Open Access Journals (Sweden)
Beena Johnson
2016-01-01
Full Text Available Developmental disabilities consist of conditions that delay or impair the physical, cognitive, and/or psychological development of children. If not intervened at the earliest, these disabilities will cause significant negative impact on multiple domains of functioning such as learning, language, self-care and capacity for independent living. Common developmental disabilities include autism spectrum disorders, intellectual disabilities, developmental delay and cerebral palsy. About one fourth of young children in developing countries are at risk for or have developmental delay or disabilities. Inadequate stimulation has significant negative impact on physical, socioemotional and cognitive development of children. Hence early scientific intervention programs are necessary in the management of children at risk for developmental delay.
Ryan, R M; Kuhl, J; Deci, E L
1997-01-01
The concepts of self-regulation and autonomy are examined within an organizational framework. We begin by retracing the historical origins of the organizational viewpoint in early debates within the field of biology between vitalists and reductionists, from which the construct of self-regulation emerged. We then consider human autonomy as an evolved behavioral, developmental, and experiential phenomenon that operates at both neurobiological and psychological levels and requires very specific supports within higher order social organizations. We contrast autonomy or true self-regulation with controlling regulation (a nonautonomous form of intentional behavior) in phenomenological and functional terms, and we relate the forms of regulation to the developmental processes of intrinsic motivation and internalization. Subsequently, we describe how self-regulation versus control may be characterized by distinct neurobiological underpinnings, and we speculate about some of the adaptive advantages that may underlie the evolution of autonomy. Throughout, we argue that disturbances of autonomy, which have both biological and psychological etiologies, are central to many forms of psychopathology and social alienation.
Directory of Open Access Journals (Sweden)
Christian Grønhøj Larsen
2015-01-01
Full Text Available Introduction. Sharp, retained foreign bodies in the oesophagus are associated with severe complications. Developmentally delayed patients are especially subject to foreign objects. We describe a 37-year-old, developmentally delayed male with a mincer blade obstructing the oesophagus. Six months prior to surgical intervention, the patient was hospitalized in a condition of sepsis and pneumonia where the thoracic X-ray reveals a foreign body in the proximal oesophagus. When rehospitalized 6 months later, a mincer blade of the type used in immersion blenders was surgically removed. During these 6 months the patient’s main symptoms were dysphagia, weight loss, and diarrhoea. When developmentally delayed patients present with dysphagia, we strongly encourage the awareness of the possible presence of foreign bodies. To our knowledge this is the first reported case of a mincer blade in the oesophagus.
Chanderbali, André S; Albert, Victor A; Leebens-Mack, Jim; Altman, Naomi S; Soltis, Douglas E; Soltis, Pamela S
2009-06-02
The debate on the origin and evolution of flowers has recently entered the field of developmental genetics, with focus on the design of the ancestral floral regulatory program. Flowers can differ dramatically among angiosperm lineages, but in general, male and female reproductive organs surrounded by a sterile perianth of sepals and petals constitute the basic floral structure. However, the basal angiosperm lineages exhibit spectacular diversity in the number, arrangement, and structure of floral organs, whereas the evolutionarily derived monocot and eudicot lineages share a far more uniform floral ground plan. Here we show that broadly overlapping transcriptional programs characterize the floral transcriptome of the basal angiosperm Persea americana (avocado), whereas floral gene expression domains are considerably more organ specific in the model eudicot Arabidopsis thaliana. Our findings therefore support the "fading borders" model for organ identity determination in basal angiosperm flowers and extend it from the action of regulatory genes to downstream transcriptional programs. Furthermore, the declining expression of components of the staminal transcriptome in central and peripheral regions of Persea flowers concurs with elements of a previous hypothesis for developmental regulation in a gymnosperm "floral progenitor." Accordingly, in contrast to the canalized organ-specific regulatory apparatus of Arabidopsis, floral development may have been originally regulated by overlapping transcriptional cascades with fading gradients of influence from focal to bordering organs.
Developmental Vitamin D Availability Impacts Hematopoietic Stem Cell Production
Directory of Open Access Journals (Sweden)
Mauricio Cortes
2016-10-01
Full Text Available Vitamin D insufficiency is a worldwide epidemic affecting billions of individuals, including pregnant women and children. Despite its high incidence, the impact of active vitamin D3 (1,25(OHD3 on embryonic development beyond osteo-regulation remains largely undefined. Here, we demonstrate that 1,25(OHD3 availability modulates zebrafish hematopoietic stem and progenitor cell (HSPC production. Loss of Cyp27b1-mediated biosynthesis or vitamin D receptor (VDR function by gene knockdown resulted in significantly reduced runx1 expression and Flk1+cMyb+ HSPC numbers. Selective modulation in vivo and in vitro in zebrafish indicated that vitamin D3 acts directly on HSPCs, independent of calcium regulation, to increase proliferation. Notably, ex vivo treatment of human HSPCs with 1,25(OHD3 also enhanced hematopoietic colony numbers, illustrating conservation across species. Finally, gene expression and epistasis analysis indicated that CXCL8 (IL-8 was a functional target of vitamin D3-mediated HSPC regulation. Together, these findings highlight the relevance of developmental 1,25(OHD3 availability for definitive hematopoiesis and suggest potential therapeutic utility in HSPC expansion.
de Vega-Bartol, José J; Simões, Marta; Lorenz, W Walter; Rodrigues, Andreia S; Alba, Rob; Dean, Jeffrey F D; Miguel, Célia M
2013-08-30
It is during embryogenesis that the plant body plan is established and the meristems responsible for all post-embryonic growth are specified. The molecular mechanisms governing conifer embryogenesis are still largely unknown. Their elucidation may contribute valuable information to clarify if the distinct features of embryo development in angiosperms and gymnosperms result from differential gene regulation. To address this issue, we have performed the first transcriptomic analysis of zygotic embryo development in a conifer species (Pinus pinaster) focusing our study in particular on regulatory genes playing important roles during plant embryo development, namely epigenetic regulators and transcription factors. Microarray analysis of P. pinaster zygotic embryogenesis was performed at five periods of embryo development from early developing to mature embryos. Our results show that most changes in transcript levels occurred in the first and the last embryo stage-to-stage transitions, namely early to pre-cotyledonary embryo and cotyledonary to mature embryo. An analysis of functional categories for genes that were differentially expressed through embryogenesis highlighted several epigenetic regulation mechanisms. While putative orthologs of transcripts associated with mechanisms that target transposable elements and repetitive sequences were strongly expressed in early embryogenesis, PRC2-mediated repression of genes seemed more relevant during late embryogenesis. On the other hand, functions related to sRNA pathways appeared differentially regulated across all stages of embryo development with a prevalence of miRNA functions in mid to late embryogenesis. Identification of putative transcription factor genes differentially regulated between consecutive embryo stages was strongly suggestive of the relevance of auxin responses and regulation of auxin carriers during early embryogenesis. Such responses could be involved in establishing embryo patterning. Later in
Energy Technology Data Exchange (ETDEWEB)
Zhuang, Shulin, E-mail: shulin@zju.edu.cn [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Zhang, Zhisheng [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhang, Wenjing; Bao, Lingling [Institute of Environmental Science, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058 (China); Zhejiang Provincial Key Laboratory of Organic Pollution Process and Control, Hangzhou 310058 (China); Xu, Chao, E-mail: chaoxu@zjut.edu.cn [Research Center of Environmental Science, College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032 (China); Zhang, Hu [Institute of Quality and Standard for Agro-products, Zhejiang Academy of Agricultural Sciences, Hangzhou 210021 (China)
2015-02-15
Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially
International Nuclear Information System (INIS)
Zhuang, Shulin; Zhang, Zhisheng; Zhang, Wenjing; Bao, Lingling; Xu, Chao; Zhang, Hu
2015-01-01
Highlights: • Pyraclofos has significant enantioselective aquatic toxicities to zebrafish. • Pyraclofos induces time- and concentration-dependent developmental toxicity and immunotoxicity. • The mRNA level of IL-1β gene was significantly up-regulated by pyraclofos. • Pyraclofos binds potently to IL-1β, potentially affecting IL-1β-dependent proinflammatory signal transduction. • Our in vitro and in silico studies help to understand the molecular basis for aquatic toxicity of pyraclofos. - Abstract: Pyraclofos, a relatively new organophosphorus pesticide, has shown potential ecotoxicities, however, its aquatic toxicity, especially enantioselective aquatic toxicity, remains largely unknown. Using zebrafish (Danio rerio) as a preeminent vertebrate aquatic model, the enantioselective differences in the developmental toxicity and immunotoxicity of pyraclofos were evaluated. Following 96-h exposure, pyraclofos enantiomers exhibited acute toxicity and showed lethal concentration 50 of 2.23 and 3.99 mg/L for (R)-Pyraclofos and (S)-Pyraclofos, respectively. Exposure to pyraclofos caused time- and concentration-dependent malformations such as pericardial edema, yolk sac edema, crooked bodies and hatching during the embryonic development, with markedly higher percentages of malformation at higher concentrations. The concentration-dependent immunotoxicity to zebrafish embryo exposed to low level pyraclofos was induced with significant up-regulation of mRNA levels of immune-related interleukin-1β (IL-1β) gene. (R)-Pyraclofos was consistently more toxic than (S)-Pyraclofos for the acute toxicity, developmental toxicity and immunotoxicity to zebrafish. Molecular dynamics simulations revealed that at the atomic level, (R)-Pyraclofos binds more potently to IL-1β protein than (S)-Pyraclofos. This enantioselective binding is mainly contributed by the distinct binding mode of pyraclofos enantiomers and their electrostatic interactions with IL-1β, which potentially
[Contemporary cognitive theories about developmental dyscalculia].
Castro-Cañizares, D; Estévez-Pérez, N; Reigosa-Crespo, V
To analyze the current theories describing the cognitive mechanisms underlying developmental dyscalculia. The four most researched hypotheses concerning the cognitive deficits related to developmental dyscalculia, as well as experimental evidences supporting or refusing them are presented. The first hypothesis states that developmental dyscalculia is consequence of domain general cognitive deficits. The second hypothesis suggests that it is due to a failure in the development of specialized brain systems dedicated to numerosity processing. The third hypothesis asserts the disorder is caused by a deficit in accessing quantity representation through numerical symbols. The last hypothesis states developmental dyscalculia appears as a consequence of impairments in a generalized magnitude system dedicated to the processing of continuous and discrete magnitudes. None of the hypotheses has been proven more plausible than the rest. Relevant issues rose by them need to be revisited and answered in the light of new experimental designs. In the last years the understanding of cognitive disorders involved in developmental dyscalculia has remarkably increased, but it is nonetheless insufficient. Additional research is required in order to achieve a comprehensive cognitive model of numerical processing development and its disorders. This will improve the diagnostic precision and the effectiveness of developmental dyscalculia intervention strategies.
Mercadante, M.T.; Gaag, R.J. van der; Schwartzman, J.S.
2006-01-01
The category "Pervasive Developmental Disorders" includes autistic disorder, Asperger's syndrome, Rett's syndrome, childhood disintegrative disorder, and a residual category, named pervasive developmental disorder not otherwise specified. In this review, Rett's syndrome and childhood disintegrative
Life Span Developmental Approach
Ali Eryilmaz
2011-01-01
The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of...
What Is a Developmental-Behavioral Pediatrician?
... social worker. Developmental-behavioral pediatricians work closely with parents, families, and schools. Developmental-behavioral pediatricians understand that children’s development and behavior happen first and foremost in the ...
Metzger, Aaron; Alvis, Lauren M; Oosterhoff, Benjamin; Babskie, Elizabeth; Syvertsen, Amy; Wray-Lake, Laura
2018-03-23
Civic developmental theory anticipates connections between normative developmental competencies and civic engagement, but little previous research has directly studied such links. The current study sought to contribute to civic development theory by examining associations between emotional and sociocognitive competencies (empathy, emotion regulation, prosocial moral reasoning, future-orientation) and civic engagement (volunteering, informal helping, political behaviors and beliefs, environmental behaviors, social responsibility values, civic skills). Data came from a geographically and racially diverse sample of 2467 youth (M age = 13.4, Range: 8-20 years, 56% female). The results indicated that empathy and future-orientation significantly predicted nearly all forms of civic engagement, whereas emotion regulation and prosocial moral reasoning were uniquely associated with specific forms of civic engagement. Exploratory multi-group models indicated that empathy and emotion regulation were more strongly associated with civic engagement among younger youth and prosocial moral reasoning and future-orientation were more strongly related to civic engagement among older youth. The findings help to advance developmental theory of youth civic engagement.
Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.
Directory of Open Access Journals (Sweden)
Sumedha S Gunewardena
Full Text Available During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth to maturity (60-days after birth. Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2 RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.
Kohsokabe, Takahiro; Kaneko, Kunihiko
2016-01-01
Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.
Trisomy 21 and facial developmental instability.
Starbuck, John M; Cole, Theodore M; Reeves, Roger H; Richtsmeier, Joan T
2013-05-01
The most common live-born human aneuploidy is trisomy 21, which causes Down syndrome (DS). Dosage imbalance of genes on chromosome 21 (Hsa21) affects complex gene-regulatory interactions and alters development to produce a wide range of phenotypes, including characteristic facial dysmorphology. Little is known about how trisomy 21 alters craniofacial morphogenesis to create this characteristic appearance. Proponents of the "amplified developmental instability" hypothesis argue that trisomy 21 causes a generalized genetic imbalance that disrupts evolutionarily conserved developmental pathways by decreasing developmental homeostasis and precision throughout development. Based on this model, we test the hypothesis that DS faces exhibit increased developmental instability relative to euploid individuals. Developmental instability was assessed by a statistical analysis of fluctuating asymmetry. We compared the magnitude and patterns of fluctuating asymmetry among siblings using three-dimensional coordinate locations of 20 anatomic landmarks collected from facial surface reconstructions in four age-matched samples ranging from 4 to 12 years: (1) DS individuals (n = 55); (2) biological siblings of DS individuals (n = 55); 3) and 4) two samples of typically developing individuals (n = 55 for each sample), who are euploid siblings and age-matched to the DS individuals and their euploid siblings (samples 1 and 2). Identification in the DS sample of facial prominences exhibiting increased fluctuating asymmetry during facial morphogenesis provides evidence for increased developmental instability in DS faces. We found the highest developmental instability in facial structures derived from the mandibular prominence and lowest in facial regions derived from the frontal prominence. Copyright © 2013 Wiley Periodicals, Inc.
Developmental Kindergarten Program Evaluation Report.
Blois, George T.; Cushing, Katherine S.
The evaluation of the Developmental Kindergarten (DK) Program at the Harrison School District #2, Colorado Springs, Colorado, involved pre- and post-testing of student academic gains and interviewing of principals and teachers. The program aimed to provide developmentally appropriate activities for students believed to be "at risk" of…
Developmentally Appropriate Peace Education Curricula
Lewsader, Joellen; Myers-Walls, Judith A.
2017-01-01
Peace education has been offered to children for decades, but those curricula have been only minimally guided by children's developmental stages and needs. In this article, the authors apply their research on children's developmental understanding of peace along with peace education principles and Vygotsky's sociocultural theory to present…
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
Regulation of planar growth by the Arabidopsis AGC protein kinase UNICORN.
Enugutti, Balaji; Kirchhelle, Charlotte; Oelschner, Maxi; Torres Ruiz, Ramón Angel; Schliebner, Ivo; Leister, Dario; Schneitz, Kay
2012-09-11
The spatial coordination of growth is of central importance for the regulation of plant tissue architecture. Individual layers, such as the epidermis, are clonally propagated and structurally maintained by symmetric cell divisions that are oriented along the plane of the layer. The developmental control of this process is poorly understood. The simple cellular basis and sheet-like structure of Arabidopsis integuments make them an attractive model system to address planar growth. Here we report on the characterization of the Arabidopsis UNICORN (UCN) gene. Analysis of ucn integuments reveals localized distortion of planar growth, eventually resulting in an ectopic multicellular protrusion. In addition, ucn mutants exhibit ectopic growth in filaments and petals, as well as aberrant embryogenesis. We further show that UCN encodes an active AGC VIII kinase. Genetic, biochemical, and cell biological data suggest that UCN suppresses ectopic growth in integuments by directly repressing the KANADI transcription factor ABERRANT TESTA SHAPE. Our findings indicate that UCN represents a unique plant growth regulator that maintains planar growth of integuments by repressing a developmental regulator involved in the control of early integument growth and polarity.
The silkworm (Bombyx mori microRNAs and their expressions in multiple developmental stages.
Directory of Open Access Journals (Sweden)
Xiaomin Yu
Full Text Available BACKGROUND: MicroRNAs (miRNAs play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. METHODOLOGY/PRINCIPAL FINDINGS: We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs and 14 novel miRNAs (including 11 predicted novel miRNAs. Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5' and/or 3' ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. CONCLUSIONS/SIGNIFICANCE: Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over
College Student Binge Eating: Insecure Attachment and Emotion Regulation
Han, Suejung; Pistole, M. Carole
2014-01-01
Because college students who have accomplished developmental tasks less effectively may be at risk for detrimental behavior such as binge eating, we examined emotion regulation as a mediator of attachment insecurity and binge eating. Based on undergraduate and graduate student responses to a Web-based survey ("N" = 381), structural…
Distinct developmental defense activations in barley embryos identified by transcriptome profiling
DEFF Research Database (Denmark)
Nielsen, ME; Lok, F; Nielsen, Henrik Bjørn
2006-01-01
analyses of > 22,000 genes, which together with measurements of jasmonic acid and salicylic acid during embryo development provide new information on the initiation in the developing barley embryo of at least two distinct types of developmental defense activation (DDA). Early DDA is characterized by the up......-regulation of several PR genes is notable. Throughout barley embryo development, there are no indications of an increased biosynthesis of either jasmonic acid or salicylic acid. Collectively, the results help explain how the proposed DDA enables protection of the developing barley embryo and grain for purposes...
Kirk, Hannah
2017-01-01
Attention skills are strongly associated with academic attainment, social inclusion, peer relationships and mental health. Attention difficulties are commonly reported in children with intellectual and developmental disabilities (IDD), consequently increasing the already heightened risk of cognitive difficulties, behavioural problems and learning impairments. Despite acknowledgement of the core deficits in attention that characterise children with IDD, limited research has attempted to stre...
Developmental biology, the stem cell of biological disciplines.
Gilbert, Scott F
2017-12-01
Developmental biology (including embryology) is proposed as "the stem cell of biological disciplines." Genetics, cell biology, oncology, immunology, evolutionary mechanisms, neurobiology, and systems biology each has its ancestry in developmental biology. Moreover, developmental biology continues to roll on, budding off more disciplines, while retaining its own identity. While its descendant disciplines differentiate into sciences with a restricted set of paradigms, examples, and techniques, developmental biology remains vigorous, pluripotent, and relatively undifferentiated. In many disciplines, especially in evolutionary biology and oncology, the developmental perspective is being reasserted as an important research program.
Tarantini, Stefano; Giles, Cory B; Wren, Jonathan D; Ashpole, Nicole M; Valcarcel-Ares, M Noa; Wei, Jeanne Y; Sonntag, William E; Ungvari, Zoltan; Csiszar, Anna
2016-08-01
Epidemiological findings support the concept of Developmental Origins of Health and Disease, suggesting that early-life hormonal influences during a sensitive period of development have a fundamental impact on vascular health later in life. The endocrine changes that occur during development are highly conserved across mammalian species and include dramatic increases in circulating IGF-1 levels during adolescence. The present study was designed to characterize the effect of developmental IGF-1 deficiency on the vascular aging phenotype. To achieve that goal, early-onset endocrine IGF-1 deficiency was induced in mice by knockdown of IGF-1 in the liver using Cre-lox technology (Igf1 f/f mice crossed with mice expressing albumin-driven Cre recombinase). This model exhibits low-circulating IGF-1 levels during the peripubertal phase of development, which is critical for the biology of aging. Due to the emergence of miRNAs as important regulators of the vascular aging phenotype, the effect of early-life IGF-1 deficiency on miRNA expression profile in the aorta was examined in animals at 27 months of age. We found that developmental IGF-1 deficiency elicits persisting late-life changes in miRNA expression in the vasculature, which significantly differed from those in mice with adult-onset IGF-1 deficiency (TBG-Cre-AAV8-mediated knockdown of IGF-1 at 5 month of age in Igf1 f/f mice). Using a novel computational approach, we identified miRNA target genes that are co-expressed with IGF-1 and associate with aging and vascular pathophysiology. We found that among the predicted targets, the expression of multiple extracellular matrix-related genes, including collagen-encoding genes, were downregulated in mice with developmental IGF-1 deficiency. Collectively, IGF-1 deficiency during a critical period during early in life results in persistent changes in post-transcriptional miRNA-mediated control of genes critical targets for vascular health, which likely contribute to the
Developmentalism: An Obscure but Pervasive Restriction
Directory of Open Access Journals (Sweden)
J. E. Stone
1996-04-01
Full Text Available Despite continuing criticism of public education, experimentally demonstrated and field tested teaching methods have been ignored, rejected, and abandoned. Instead of a stable consensus regarding best teaching practices, there seems only an unending succession of innovations. A longstanding educational doctrine appears to underlie this anomalous state of affairs. Termed developmentalism, it presumes "natural" ontogenesis to be optimal and it requires experimentally demonstrated teaching practices to overcome a presumption that they interfere with an optimal developmental trajectory. It also discourages teachers and parents from asserting themselves with children. Instead of effective interventions, it seeks the preservation of a postulated natural perfection. Developmentalism's rich history is expressed in a literature extending over 400 years. Its notable exponents include Jean Jacques Rousseau, John Dewey, and Jean Piaget; and its most recent expressions include "developmentally appropriate practice" and "constructivism." In the years during which it gained ascendance, developmentalism served as a basis for rejecting harsh and inhumane teaching methods. Today it impedes efforts to hold schools accountable for student academic achievement.
DEFF Research Database (Denmark)
Benninger, Yves; Thurnherr, Tina; Pereira, Jorge A
2007-01-01
During peripheral nervous system (PNS) myelination, Schwann cells must interpret extracellular cues to sense their environment and regulate their intrinsic developmental program accordingly. The pathways and mechanisms involved in this process are only partially understood. We use tissue-specific......During peripheral nervous system (PNS) myelination, Schwann cells must interpret extracellular cues to sense their environment and regulate their intrinsic developmental program accordingly. The pathways and mechanisms involved in this process are only partially understood. We use tissue...
miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma
International Nuclear Information System (INIS)
Põlajeva, Jelena; Swartling, Fredrik J; Jiang, Yiwen; Singh, Umashankar; Pietras, Kristian; Uhrbom, Lene; Westermark, Bengt; Roswall, Pernilla
2012-01-01
MicroRNAs (miRNAs) and their role during tumor development have been studied in great detail during the last decade, albeit their expression pattern and regulation during normal development are however not so well established. Previous studies have shown that miRNAs are differentially expressed in solid human tumors. Platelet-derived growth factor (PDGF) signaling is known to be involved in normal development of the brain as well as in malignant primary brain tumors, gliomas, but the complete mechanism is still lacking. We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. We generated mouse glioma using the RCAS/tv-a system for driving PDGF-BB expression in a cell-specific manner. Expression of miR-21 in mouse cell cultures and mouse brain were assessed using Northern blot analysis and in situ hybridization. Immunohistochemistry and Western blot analysis were used to investigate SOX2 expression. LNA-modified siRNA was used for irreversible depletion of miR-21. For inhibition of PDGF signaling Gleevec (imatinib mesylate), Rapamycin and U0126, as well as siRNA were used. Statistical significance was calculated using double-sided unpaired Student´s t-test. We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that mi
Farlora, Rodolfo; Valenzuela-Muñoz, Valentina; Chávez-Mardones, Jacqueline; Gallardo-Escárate, Cristian
2016-07-01
Aquaporins are small integral membrane proteins that function as pore channels for the transport of water and other small solutes across the cell membrane. Considering the important roles of these proteins in several biological processes, including host-parasite interactions, there has been increased research on aquaporin proteins recently. The present study expands on the knowledge of aquaporin family genes in parasitic copepods, examining diversity and expression during the ontogeny of the sea louse Caligus rogercresseyi. Furthermore, aquaporin expression was evaluated during the early infestation of Atlantic (Salmo salar) and Coho salmon (Oncorhynchus kisutch). Deep transcriptome sequencing data revealed eight full length and two partial open reading frames belonging to the aquaporin protein family. Clustering analyses with identified Caligidae sequences revealed three major clades of aquaglyceroporins (Cr-Glp), classical aquaporin channels (Cr-Bib and Cr-PripL), and unorthodox aquaporins (Cr-Aqp12-like). In silico analysis revealed differential expression of aquaporin genes between developmental stages and between sexes. Male-biased expression of Cr-Glp1_v1 and female-biased expression of Cr-Bib were further confirmed in adults by RT-qPCR. Additionally, gene expressions were measured for seven aquaporins during the early infestation stage. The majority of aquaporin genes showed significant differential transcription expressions between sea lice parasitizing different hosts, with Atlantic salmon sea lice exhibiting overall reduced expression as compared to Coho salmon. The observed differences in the regulation of aquaporin genes may reveal osmoregulatory adaptations associated with nutrient ingestion and metabolite waste export, exposing complex host-parasite relationships in C. rogercresseyi. Copyright © 2016 Elsevier B.V. All rights reserved.
Bergman, Lars R.
2015-01-01
Molenaar's (2015) article concerns Developmental Systems Theory (DST) in relation to behavior genetics and he presents implications of DST for empirical research, especially the need for subject-specific studies. In this commentary, the article is discussed from a broader developmental science perspective, particularly regarded through the lens of…
Developmental plasticity: re-conceiving the genotype.
Sultan, Sonia E
2017-10-06
In recent decades, the phenotype of an organism (i.e. its traits and behaviour) has been studied as the outcome of a developmental 'programme' coded in its genotype. This deterministic view is implicit in the Modern Synthesis approach to adaptive evolution as a sorting process among genetic variants. Studies of developmental pathways have revealed that genotypes are in fact differently expressed depending on environmental conditions. Accordingly, the genotype can be understood as a repertoire of potential developmental outcomes or norm of reaction. Reconceiving the genotype as an environmental response repertoire rather than a fixed developmental programme leads to three critical evolutionary insights. First, plastic responses to specific conditions often comprise functionally appropriate trait adjustments, resulting in an individual-level, developmental mode of adaptive variation. Second, because genotypes are differently expressed depending on the environment, the genetic diversity available to natural selection is itself environmentally contingent. Finally, environmental influences on development can extend across multiple generations via cytoplasmic and epigenetic factors transmitted to progeny individuals, altering their responses to their own, immediate environmental conditions and, in some cases, leading to inherited but non-genetic adaptations. Together, these insights suggest a more nuanced understanding of the genotype and its evolutionary role, as well as a shift in research focus to investigating the complex developmental interactions among genotypes, environments and previous environments.
Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.
Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee
2016-02-01
Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.
Directory of Open Access Journals (Sweden)
Takashi Onikubo
2015-03-01
Full Text Available Nucleoplasmin (Npm is an abundant histone chaperone in vertebrate oocytes and embryos. During embryogenesis, regulation of Npm histone binding is critical for its function in storing and releasing maternal histones to establish and maintain the zygotic epigenome. Here, we demonstrate that Xenopus laevis Npm post-translational modifications (PTMs specific to the oocyte and egg promote either histone deposition or sequestration, respectively. Mass spectrometry and Npm phosphomimetic mutations used in chromatin assembly assays identified hyperphosphorylation on the N-terminal tail as a critical regulator for sequestration. C-terminal tail phosphorylation and PRMT5-catalyzed arginine methylation enhance nucleosome assembly by promoting histone interaction with the second acidic tract of Npm. Electron microscopy reconstructions of Npm and TTLL4 activity toward the C-terminal tail demonstrate that oocyte- and egg-specific PTMs cause Npm conformational changes. Our results reveal that PTMs regulate Npm chaperoning activity by modulating Npm conformation and Npm-histone interaction, leading to histone sequestration in the egg.
Family Life and Developmental Idealism in Yazd, Iran
Directory of Open Access Journals (Sweden)
Mohammad Jalal Abbasi-Shavazi
2012-03-01
Full Text Available BACKGROUND This paper is motivated by the theory that developmental idealism has been disseminated globally and has become an international force for family and demographic change. Developmental idealism is a set of cultural beliefs and values about development and how development relates to family and demographic behavior. It holds that modern societies are causal forces producing modern families, that modern families help to produce modern societies, and that modern family change is to be expected. OBJECTIVE We examine the extent to which developmental idealism has been disseminated in Iran. We also investigate predictors of the dissemination of developmental idealism. METHODS We use survey data collected in 2007 from a sample of women in Yazd, a city in Iran. We examine the distribution of developmental idealism in the sample and the multivariate predictors of developmental idealism. RESULTS We find considerable support for the expectation that many elements of developmental idealism have been widely disseminated. Statistically significant majorities associate development with particular family attributes, believe that development causes change in families, believe that fertility reductions and age-at-marriage increases help foster development, and perceive family trends in Iran headed toward modernity. As predicted, parental education, respondent education, and income affect adherence to developmental idealism. CONCLUSIONS Developmental idealism has been widely disseminated in Yazd, Iran and is related to social and demographic factors in predicted ways. COMMENTS Although our data come from only one city, we expect that developmental idealism has been widely distributed in Iran, with important implications for family and demographic behavior.
29 CFR 1902.33 - Developmental period.
2010-07-01
... consideration of developmental changes by OSHA. Generally, whenever a State completes a developmental step, it must submit the resulting plan change as a supplement to its plan to OSHA for approval. OSHA's approval...
Yanik, Fatma; Aytürk, Özlem; Çetinbaş-Genç, Aslihan; Vardar, Filiz
2018-01-01
Salicylic acid (SA) is one of the endogenous plant growth regulators that modulate various metabolic and physiological events. To evaluate the exogenous SA-induced germination, biochemical and developmental alterations, different concentrations (10, 100, 500 and 1000 μM) of SA were applied to rye (Secale cereale L.) seeds in hydroponic culture conditions for 15 days. The observations revealed that seed germination and root elongation were stimulated in 10 μM SA treatment, however they were in...
Functional mapping imprinted quantitative trait loci underlying developmental characteristics
Directory of Open Access Journals (Sweden)
Li Gengxin
2008-03-01
Full Text Available Abstract Background Genomic imprinting, a phenomenon referring to nonequivalent expression of alleles depending on their parental origins, has been widely observed in nature. It has been shown recently that the epigenetic modification of an imprinted gene can be detected through a genetic mapping approach. Such an approach is developed based on traditional quantitative trait loci (QTL mapping focusing on single trait analysis. Recent studies have shown that most imprinted genes in mammals play an important role in controlling embryonic growth and post-natal development. For a developmental character such as growth, current approach is less efficient in dissecting the dynamic genetic effect of imprinted genes during individual ontology. Results Functional mapping has been emerging as a powerful framework for mapping quantitative trait loci underlying complex traits showing developmental characteristics. To understand the genetic architecture of dynamic imprinted traits, we propose a mapping strategy by integrating the functional mapping approach with genomic imprinting. We demonstrate the approach through mapping imprinted QTL controlling growth trajectories in an inbred F2 population. The statistical behavior of the approach is shown through simulation studies, in which the parameters can be estimated with reasonable precision under different simulation scenarios. The utility of the approach is illustrated through real data analysis in an F2 family derived from LG/J and SM/J mouse stains. Three maternally imprinted QTLs are identified as regulating the growth trajectory of mouse body weight. Conclusion The functional iQTL mapping approach developed here provides a quantitative and testable framework for assessing the interplay between imprinted genes and a developmental process, and will have important implications for elucidating the genetic architecture of imprinted traits.
Wallace, Rodrick
2018-06-01
Cognition in living entities-and their social groupings or institutional artifacts-is necessarily as complicated as their embedding environments, which, for humans, includes a particularly rich cultural milieu. The asymptotic limit theorems of information and control theories permit construction of a new class of empirical 'regression-like' statistical models for cognitive developmental processes, their dynamics, and modes of dysfunction. Such models may, as have their simpler analogs, prove useful in the study and re-mediation of cognitive failure at and across the scales and levels of organization that constitute and drive the phenomena of life. These new models particularly focus on the roles of sociocultural environment and stress, in a large sense, as both trigger for the failure of the regulation of bio-cognition and as 'riverbanks' determining the channels of pathology, with implications across life-course developmental trajectories. We examine the effects of an embedding cultural milieu and its socioeconomic implementations using the 'lenses' of metabolic optimization, control system theory, and an extension of symmetry-breaking appropriate to information systems. A central implication is that most, if not all, human developmental disorders are fundamentally culture-bound syndromes. This has deep implications for both individual treatment and public health policy.
Targeted genome regulation via synthetic programmable transcriptional regulators
Piatek, Agnieszka Anna
2016-04-19
Regulation of gene transcription controls cellular functions and coordinates responses to developmental, physiological and environmental cues. Precise and efficient molecular tools are needed to characterize the functions of single and multiple genes in linear and interacting pathways in a native context. Modular DNA-binding domains from zinc fingers (ZFs) and transcriptional activator-like proteins (TALE) are amenable to bioengineering to bind DNA target sequences of interest. As a result, ZF and TALE proteins were used to develop synthetic programmable transcription factors. However, these systems are limited by the requirement to re-engineer proteins for each new target sequence. The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR associated 9 (Cas9) genome editing tool was recently repurposed for targeted transcriptional regulation by inactivation of the nuclease activity of Cas9. Due to the facile engineering, simplicity, precision and amenability to library construction, the CRISPR/Cas9 system is poised to revolutionize the functional genomics field across diverse eukaryotic species. In this review, we discuss the development of synthetic customizable transcriptional regulators and provide insights into their current and potential applications, with special emphasis on plant systems, in characterization of gene functions, elucidation of molecular mechanisms and their biotechnological applications. © 2016 Informa UK Limited, trading as Taylor & Francis Group
Measuring children's regulation of emotion-expressive behavior.
Bar-Haim, Yair; Bar-Av, Gali; Sadeh, Avi
2011-04-01
Emotion regulation has become a pivotal concept in developmental and clinical research. However, the measurement of regulatory processes has proved extremely difficult, particularly in the context of within-subject designs. Here, we describe a formal conceptualization and a new experimental procedure, the Balloons Game, to measure a regulatory component of emotion-expressive behavior. We present the internal consistency and stability of the indices derived from the Balloons Game in a sample of 121 kindergarten children. External validation against measures that have been associated with emotion regulation processes is also provided. The findings suggest that the Balloons Game provides a reliable tool for the study of regulation of emotion expression in young children. PsycINFO Database Record (c) 2011 APA, all rights reserved.
Developmental principles: fact or fiction.
Durston, A J
2012-01-01
While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, "whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm". We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level?) adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.
DEFF Research Database (Denmark)
Møller, Niels; Hvid, Helge
2001-01-01
AbstractIn the nineties, the concept of the developmental work (DW) has become a significant point of orientation for the actors on Danish labour market. The DW has moved the focus of the labour market from wages and working time towards work and production. For employees, the DW promises...... developmental possibilities, influence and responsibility, but also greater social responsibility for the firm. For firms, the DW promises increased competitiveness and better products. In this paper we present the concept of the DW as one which encourages the development of work, production and organisation...... of the firm and show that the DW is different from mainstream management concepts, as the DW...
Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander
2018-01-01
Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.
Future Directions in Sleep and Developmental Psychopathology.
Meltzer, Lisa J
2017-01-01
It is critical for psychologists to gain a better understanding about the intersection between sleep and developmental psychopathology. However, while many strive to answer the question of whether sleep causes developmental psychopathology, or vice versa, ultimately the relationship between sleep and developmental psychopathology is complex and dynamic. This article considers future directions in the field of clinical child and adolescent psychology that go beyond this mechanistic question, highlighting areas important to address for clinicians and researchers who strive to better understand how best to serve children and adolescents with developmental psychopathology. Questions are presented about what is normal in terms of sleep across development, the role of individual variability in terms of sleep needs and vulnerability to sleep loss, and how sleep may serve as a risk or resilience factor for developmental psychopathology, concluding with considerations for interventions.
Molenaar, Peter C. M.
2015-01-01
In this article, Peter Molenaar responds to three commentaries (this issue) on his article, "An Interpretation of Part of Gilbert Gottlieb's Legacy: Developmental Systems Theory Contra Developmental Behavior Genetics." He addresses aspects of relational developmental systems (RDS) mentioned and questions raised in each of the…
DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER
Directory of Open Access Journals (Sweden)
Jelena Kostić
2015-12-01
Full Text Available Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to conduct disorder which have different causes and serve as the basis for the current typology of conduct disorders in the classification systems. Such a typology of conduct disorders in the diagnostic classification allows better understanding, prognosis and choice of treatment.
Global Prevalence of Autism and Other Pervasive Developmental Disorders
Elsabbagh, Mayada; Divan, Gauri; Koh, Yun-Joo; Kim, Young Shin; Kauchali, Shuaib; Marcín, Carlos; Montiel-Nava, Cecilia; Patel, Vikram; Paula, Cristiane S; Wang, Chongying; Yasamy, Mohammad Taghi; Fombonne, Eric
2012-01-01
We provide a systematic review of epidemiological surveys of autistic disorder and pervasive developmental disorders (PDDs) worldwide. A secondary aim was to consider the possible impact of geographic, cultural/ethnic, and socioeconomic factors on prevalence estimates and on clinical presentation of PDD. Based on the evidence reviewed, the median of prevalence estimates of autism spectrum disorders was 62/10 000. While existing estimates are variable, the evidence reviewed does not support differences in PDD prevalence by geographic region nor of a strong impact of ethnic/cultural or socioeconomic factors. However, power to detect such effects is seriously limited in existing data sets, particularly in low-income countries. While it is clear that prevalence estimates have increased over time and these vary in different neighboring and distant regions, these findings most likely represent broadening of the diagnostic concets, diagnostic switching from other developmental disabilities to PDD, service availability, and awareness of autistic spectrum disorders in both the lay and professional public. The lack of evidence from the majority of the world's population suggests a critical need for further research and capacity building in low- and middle-income countries. Autism Res 2012, 5: 160–179. © 2012 International Society for Autism Research, Wiley Periodicals, Inc. PMID:22495912
Language used in interaction during developmental science instruction
Avenia-Tapper, Brianna
The coordination of theory and evidence is an important part of scientific practice. Developmental approaches to instruction, which make the relationship between the abstract and the concrete a central focus of students' learning activity, provide educators with a unique opportunity to strengthen students' coordination of theory and evidence. Therefore, developmental approaches may be a useful instructional response to documented science achievement gaps for linguistically diverse students. However, if we are to leverage the potential of developmental instruction to improve the science achievement of linguistically diverse students, we need more information on the intersection of developmental science instruction and linguistically diverse learning contexts. This manuscript style dissertation uses discourse analysis to investigate the language used in interaction during developmental teaching-learning in three linguistically diverse third grade classrooms. The first manuscript asks how language was used to construct ascension from the abstract to the concrete. The second manuscript asks how students' non-English home languages were useful (or not) for meeting the learning goals of the developmental instructional program. The third manuscript asks how students' interlocutors may influence student choice to use an important discourse practice--justification--during the developmental teaching-learning activity. All three manuscripts report findings relevant to the instructional decisions that teachers need to make when implementing developmental instruction in linguistically diverse contexts.
Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...
DEFF Research Database (Denmark)
Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard
2003-01-01
Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...
Tissue expression and developmental regulation of chicken cathelicidin antimicrobial peptides
Directory of Open Access Journals (Sweden)
Achanta Mallika
2012-05-01
Full Text Available Abstract Cathelicidins are a major family of antimicrobial peptides present in vertebrate animals with potent microbicidal and immunomodulatory activities. Four cathelicidins, namely fowlicidins 1 to 3 and cathelicidin B1, have been identified in chickens. As a first step to understand their role in early innate host defense of chickens, we examined the tissue and developmental expression patterns of all four cathelicidins. Real-time PCR revealed an abundant expression of four cathelicidins throughout the gastrointestinal, respiratory, and urogenital tracts as well as in all primary and secondary immune organs of chickens. Fowlicidins 1 to 3 exhibited a similar tissue expression pattern with the highest expression in the bone marrow and lung, while cathelicidin B1 was synthesized most abundantly in the bursa of Fabricius. Additionally, a tissue-specific regulatory pattern was evident for all four cathelicidins during the first 28 days after hatching. The expression of fowlicidins 1 to 3 showed an age-dependent increase both in the cecal tonsil and lung, whereas all four cathelicidins were peaked in the bursa on day 4 after hatching, with a gradual decline by day 28. An abrupt augmentation in the expression of fowlicidins 1 to 3 was also observed in the cecum on day 28, while the highest expression of cathelicidin B1 was seen in both the lung and cecal tonsil on day 14. Collectively, the presence of cathelicidins in a broad range of tissues and their largely enhanced expression during development are suggestive of their potential important role in early host defense and disease resistance of chickens.
Energy Technology Data Exchange (ETDEWEB)
Keranen, Soile V.E.
2003-04-02
The developmental increase in structural complexity in multicellular life forms depends on local, often non-periodic differences in gene expression. These depend on a network of gene-gene interactions coded within the organismal genome. To better understand how genomic information generates complex expression patterns, I have modeled the pattern forming behavior of small artificial genomes in virtual blastoderm embryos. I varied several basic properties of these genomic signaling networks, such as the number of genes, the distributions of positive (inductive) and negative (repressive) interactions, and the strengths of gene-gene interactions, and analyzed their effects on developmental pattern formation. The results show how even simple genomes can generate complex non-periodic patterns under suitable conditions. They also show how the frequency of complex patterns depended on the numbers and relative arrangements of positive and negative interactions. For example, negative co-regulation of signaling pathway components increased the likelihood of (complex) patterns relative to differential negative regulation of the pathway components. Interestingly, neither quantitative differences either in strengths of signaling interactions nor multiple response thresholds to signal concentration (as in morphogen gradients) were essential for formation of multiple, spatially unique cell types. Thus, with combinatorial code of gene regulation and hierarchical signaling interactions, it is theoretically possible to organize metazoan embryogenesis with just a small fraction of the metazoan genome. Because even small networks can generate complex patterns when they contain a suitable set of connections, evolution of metazoan complexity may have depended more on selection for favourable configurations of signaling interactions than on the increase in numbers of regulatory genes.
Kohsokabe, Takahiro
2016-01-01
ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution
Assessing the Developmental Neurotoxicity of 27 ...
Assessing the Developmental Neurotoxicity of 27 Organophosphorus Pesticides Using a Zebrafish Behavioral Assay, Waalkes, M., Hunter, D.L., Jarema, K., Mundy, W., and S. Padilla. The U.S. Environmental Protection Agency is evaluating methods to screen and prioritize organophosphorus pesticides for developmental neurotoxicity. As such, we are exploring a behavioral testing paradigm that can assess the effects of sublethal and subteratogenic concentrations of developmental neurotoxicants on zebrafish (Danio rerio). This in vivo assay quantifies the locomotor response to light stimuli under tandem light and dark conditions in a 96-well plate using a video tracking system on 6 day post fertilization zebrafish larvae. Each of twenty-seven organophosphorus pesticides was tested for their developmental neurotoxic potential by exposing zebrafish embryos/larvae to the pesticide at several concentrations (≤ 100 μM nominal concentration) during the first five days of development, followed by 24 hours of depuration and then behavioral testing. Approximately 22% of the chemicals (Acephate, Dichlorvos, Diazoxon, Bensulide,Tribufos, Tebupirimfos) did not produce any behavioral changes after developmental exposure, while many (Malaoxon Fosthiazate, Dimethoate, Dicrotophos, Ethoprop, Malathion, Naled, Diazinon, Methamidophos, Terbufos, Trichlorfon, Phorate, Pirimiphos-methyl, Profenofos, Z-Tetrachlorvinphos, Chlorpyrifos, Coumaphos, Phosmet, Omethoate) produced changes in swi
Epigenetic Regulation of the Neural Transcriptome and Alcohol Interference During Development
Directory of Open Access Journals (Sweden)
Marisol eResendiz
2014-08-01
Full Text Available Alcohol intoxicated cells broadly alter their metabolites–– among them methyl and acetic acid can alter the DNA and histone epigenetic codes. Together with the promiscuous effect of alcohol on enzyme activities (including DNA methyltransferases and the downstream effect on microRNA and transposable elements, alcohol is well placed to affect intrinsic transcriptional programs of developing cells. Considering that the developmental consequences of early alcohol exposure so profoundly affect neural systems, it is not unfounded to reason that alcohol exploits transcriptional regulators to challenge canonical gene expression and in effect, intrinsic developmental pathways to achieve widespread damage in the developing nervous system. To fully evaluate the role of epigenetic regulation in alcohol-related developmental disease, it is important to first gather the targets of epigenetic players in neurodevelopmental models. Here, we attempt to review the cellular and genomic windows of opportunity for alcohol to act on intrinsic neurodevelopmental programs. We also discuss some established targets of fetal alcohol exposure and propose pathways for future study. Overall, this review hopes to illustrate the known epigenetic program and its alterations in normal neural stem cell development and further, aims to depict how alcohol, through neuroepigenetics, may lead to neurodevelopmental deficits observed in fetal alcohol spectrum disorders.
Epigenetic regulation of the neural transcriptome and alcohol interference during development.
Resendiz, Marisol; Mason, Stephen; Lo, Chiao-Ling; Zhou, Feng C
2014-01-01
Alcohol intoxicated cells broadly alter their metabolites - among them methyl and acetic acid can alter the DNA and histone epigenetic codes. Together with the promiscuous effect of alcohol on enzyme activities (including DNA methyltransferases) and the downstream effect on microRNA and transposable elements, alcohol is well placed to affect intrinsic transcriptional programs of developing cells. Considering that the developmental consequences of early alcohol exposure so profoundly affect neural systems, it is not unfounded to reason that alcohol exploits transcriptional regulators to challenge canonical gene expression and in effect, intrinsic developmental pathways to achieve widespread damage in the developing nervous system. To fully evaluate the role of epigenetic regulation in alcohol-related developmental disease, it is important to first gather the targets of epigenetic players in neurodevelopmental models. Here, we attempt to review the cellular and genomic windows of opportunity for alcohol to act on intrinsic neurodevelopmental programs. We also discuss some established targets of fetal alcohol exposure and propose pathways for future study. Overall, this review hopes to illustrate the known epigenetic program and its alterations in normal neural stem cell development and further, aims to depict how alcohol, through neuroepigenetics, may lead to neurodevelopmental deficits observed in fetal alcohol spectrum disorders.
2017-04-06
guidance to the PM regarding development and sustainment of software . The need for a strong application of software engineering principles is...on the battlefield by a government- developed network manager application . The configuration of this confluence of software will be jointly managed...How Well Can Existing Software -Support Processes Accomplish Sustainment of a Non- Developmental Item-Based Acquisition Strategy? Graciano
Personality and self-regulation: trait and information-processing perspectives.
Hoyle, Rick H
2006-12-01
This article introduces the special issue of Journal of Personality on personality and self-regulation. The goal of the issue is to illustrate and inspire research that integrates personality and process-oriented accounts of self-regulation. The article begins by discussing the trait perspective on self-regulation--distinguishing between temperament and personality accounts--and the information-processing perspective. Three approaches to integrating these perspectives are then presented. These range from methodological approaches, in which constructs representing the two perspectives are examined in integrated statistical models, to conceptual approaches, in which the two perspectives are unified in a holistic theoretical model of self-regulation. The article concludes with an overview of the special issue contributions, which are organized in four sections: broad, integrative models of personality and self-regulation; models that examine the developmental origins of self-regulation and self-regulatory styles; focused programs of research that concern specific aspects or applications of self-regulation; and strategies for increasing the efficiency and effectiveness of self-regulation.
Evolutionary and developmental modules.
Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka
2013-01-01
The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.
Sexual dysfunction within an adult developmental perspective.
Fagan, P J; Meyer, J K; Schmidt, C W
1986-01-01
The focus of this paper is on the adult who has adequately mastered the oedipal stage of psychosexual development and who presents with a sexual dysfunction. Drawing on the developmental sequence of Erik Erikson, the authors suggest that failure to address adequately an adult psychosocial crisis may result in sexual dysfunction. There may be both adult developmental deficits and regression to adolescent and adult stages previously negotiated. Both may be symptomatically represented by sexual dysfunction. The authors urge that the sexual and marital problems be evaluated within an adult developmental framework and that the therapy address the psychosocial issues which are appropriate to the developmental stage of the patient.
Molecular and Chemical Genetic Approaches to Developmental Origins of Aging and Disease in Zebrafish
Sasaki, Tomoyuki; Kishi, Shuji
2013-01-01
The incidence of diseases increases rapidly with age, accompanied by progressive deteriorations of physiological functions in organisms. Aging-associated diseases are sporadic but mostly inevitable complications arising from senescence. Senescence is often considered the antithesis of early development, but yet there may be factors and mechanisms in common between these two phenomena over the dynamic process of aging. The association between early development and late-onset disease with advancing age is thought to come from a consequence of developmental plasticity, the phenomenon by which one genotype can give rise to a range of physiologically and/or morphologically adaptive states in response to different environmental or genetic perturbations. On the one hand, we hypothesized that the future aging process can be predictive based on adaptivity during the early developmental period. Modulating the thresholds of adaptive plasticity by chemical genetic approaches, we have been investigating whether any relationship exists between the regulatory mechanisms that function in early development and in senescence using the zebrafish (Danio rerio), a small freshwater fish and a useful model animal for genetic studies. We have successfully conducted experiments to isolate zebrafish mutants expressing apparently altered senescence phenotypes during embryogenesis (“embryonic senescence”), subsequently showing shortened lifespan in adulthoods. We anticipate that previously uncharacterized developmental genes may mediate the aging process and play a pivotal role in senescence. On the other hand, unexpected senescence-related genes might also be involved in the early developmental process and regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes and small molecular compounds that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins
Oscillatory Dynamics of the Extracellular Signal-regulated Kinase Pathway
Energy Technology Data Exchange (ETDEWEB)
Shankaran, Harish; Wiley, H. S.
2010-12-01
The extracellular signal-regulated kinase (ERK) pathway is a central signaling pathway in development and disease and is regulated by multiple negative and positive feedback loops. Recent studies have shown negative feedback from ERK to upstream regulators can give rise to biochemical oscillations with a periodicity of between 15-30 minutes. Feedback due to the stimulated transcription of negative regulators of the ERK pathway can also give rise to transcriptional oscillations with a periodicity of 1-2h. The biological significance of these oscillations is not clear, but recent evidence suggests that transcriptional oscillations participate in developmental processes, such as somite formation. Biochemical oscillations are more enigmatic, but could provide a mechanism for encoding different types of inputs into a common signaling pathway.
Stefanatou, Athena
2008-12-01
The level and nature of emotional upheaval and relationship to developmental stage was studied in children with pervasive developmental disorder (PDD) hospitalized for head injury. The sample consisted of 25 hospitalized children aged 5-12 years. Children were asked to make the drawing of a ;person in hospital'. The drawings were evaluated by Koppitz's emotional indicators. Punishment and persecution were the main cognitive constructs of children in order to explain hospitalization.
Neurobehavioural effects of developmental toxicity
DEFF Research Database (Denmark)
Grandjean, Philippe; Landrigan, Philip J
2014-01-01
Neurodevelopmental disabilities, including autism, attention-deficit hyperactivity disorder, dyslexia, and other cognitive impairments, affect millions of children worldwide, and some diagnoses seem to be increasing in frequency. Industrial chemicals that injure the developing brain are among...... the known causes for this rise in prevalence. In 2006, we did a systematic review and identified five industrial chemicals as developmental neurotoxicants: lead, methylmercury, polychlorinated biphenyls, arsenic, and toluene. Since 2006, epidemiological studies have documented six additional developmental...... chemicals should not be presumed to be safe to brain development, and chemicals in existing use and all new chemicals must therefore be tested for developmental neurotoxicity. To coordinate these efforts and to accelerate translation of science into prevention, we propose the urgent formation of a new...
The Two Edged Sword; Illinois' Risk Reduction Success Through Managed Retreat And Strong Regulations
Osman, P.
2017-12-01
Illinois has the nation's largest inland system of rivers, lakes, and streams. Two thirds of the continental US and two Canadian provinces drain thru Illinois. Although a blessing, these waterways also result in frequent flooding. Historically, Illinois ranked among the top five states in the nation for flood losses. However, using a combination of strong floodplain regulations and proactive flood mitigation programs, Illinois now ranks near the bottom of flood loss states. Following the 1993 flood, the State of Illinois began an aggressive program to remove flood prone structures from the floodplain. Using a combination of state, federal, and local funds, towns like Valmeyer and Grafton have largely been relocated outside of the floodplain. Likewise, in dozens of communities across the state, thousands of structures have been have purchased to create open space in the floodplain. In addition, new structures in the floodplain must meet strict state and local floodplain construction standards. Major floods now routinely pass Illinois unnoticed. Many communities once ravaged by flooding now pass large floods unscathed. Due largely to climate change, flood losses in many areas are evolving. The majority of flood losses in Illinois now occur outside of the mapped floodplain. The State of Illinois has recently completed a detailed analysis of the state's urban flood exposure. Flood risk is changing and methods to address that risk must evolve accordingly. Accurate climate change data on major inland waterways and urban areas remain elusive. This presentation will highlight simple steps any state or community can take to reduce existing flood losses and be better prepared to address changing impacts due to climate change.
Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C
2016-11-01
Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Epigenetic regulation during fetal femur development: DNA methylation matters.
Directory of Open Access Journals (Sweden)
María C de Andrés
Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development
Yuan, Chloe J; Marikawa, Yusuke
2017-11-01
Various chemical compounds can inflict developmental toxicity when sufficiently high concentrations are exposed to embryos at the critical stages of development. Excipients, such as coloring agents and preservatives, are pharmacologically inactive ingredients that are included in various medications, foods, and cosmetics. However, concentrations that may adversely affect embryo development are largely unknown for most excipients. Here, the lowest observed adverse effect level (LOAEL) to inflict developmental toxicity was assessed for three coloring agents (allura red, brilliant blue, and tartrazine) and three preservatives (butylated hydroxyanisole, metabisulfite, and methylparaben). Adverse impact of a compound exposure was determined using the stem cell-based in vitro morphogenesis model, in which three-dimensional cell aggregates, or embryoid bodies (EBs), recapitulate embryonic processes of body axis elongation and patterning. LOAEL to impair EB morphogenesis was 200 μM for methylparaben, 400 μM for butylated hydroxyanisole, 600 μM for allura red and brilliant blue, and 1000 μM for metabisulfite. Gene expression analyses of excipient-treated EBs revealed that butylated hydroxyanisole and methylparaben significantly altered profiles of developmental regulators involved in axial elongation and patterning of the body. The present study may provide a novel in vitro approach to investigate potential developmental toxicity of common excipients with mechanistic insights. Copyright © 2017 Elsevier Ltd. All rights reserved.
Regulation of Stem Cell Differentiation by Histone Methyltransferases and Demethylases
DEFF Research Database (Denmark)
Pasini, D; Bracken, A P; Agger, K
2008-01-01
The generation of different cell types from stem cells containing identical genetic information and their organization into tissues and organs during development is a highly complex process that requires defined transcriptional programs. Maintenance of such programs is epigenetically regulated...... and the factors involved in these processes are often essential for development. The activities required for cell-fate decisions are frequently deregulated in human tumors, and the elucidation of the molecular mechanisms that regulate these processes is therefore important for understanding both developmental...
Ku, Hui-Yu; Sun, Y Henry
2017-07-01
Compartment boundary formation plays an important role in development by separating adjacent developmental fields. Drosophila imaginal discs have proven valuable for studying the mechanisms of boundary formation. We studied the boundary separating the proximal A1 segment and the distal segments, defined respectively by Lim1 and Dll expression in the eye-antenna disc. Sharp segregation of the Lim1 and Dll expression domains precedes activation of Notch at the Dll/Lim1 interface. By repressing bantam miRNA and elevating the actin regulator Enable, Notch signaling then induces actomyosin-dependent apical constriction and epithelial fold. Disruption of Notch signaling or the actomyosin network reduces apical constriction and epithelial fold, so that Dll and Lim1 cells become intermingled. Our results demonstrate a new mechanism of boundary formation by actomyosin-dependent tissue folding, which provides a physical barrier to prevent mixing of cells from adjacent developmental fields.
Developmental Principles: Fact or Fiction
Directory of Open Access Journals (Sweden)
A. J. Durston
2012-01-01
Full Text Available While still at school, most of us are deeply impressed by the underlying principles that so beautifully explain why the chemical elements are ordered as they are in the periodic table, and may wonder, with the theoretician Brian Goodwin, “whether there might be equally powerful principles that account for the awe-inspiring diversity of body forms in the living realm”. We have considered the arguments for developmental principles, conclude that they do exist and have specifically identified features that may generate principles associated with Hox patterning of the main body axis in bilaterian metazoa in general and in the vertebrates in particular. We wonder whether this exercise serves any purpose. The features we discuss were already known to us as parts of developmental mechanisms and defining developmental principles (how, and at which level? adds no insight. We also see little profit in the proposal by Goodwin that there are principles outside the emerging genetic mechanisms that need to be taken into account. The emerging developmental genetic hierarchies already reveal a wealth of interesting phenomena, whatever we choose to call them.
DEFF Research Database (Denmark)
Rewitz, Kim; Rybczynski, Robert; Warren, James T.
2006-01-01
this work to the tobacco hornworm Manduca sexta, an established model for endocrinological and developmental studies. cDNA clones were obtained for three Manduca orthologs of CYP306A1 (phantom; phm, the 25-hydroxylase), CYP302A1 (disembodied; dib, the 22-hydroxylase) and CYP315A1 (shadow; sad, the 2...... in the developmentally varying steroidogenic capacities of the prothoracic glands during the fifth instar. The consistent expression of the Halloween genes confirms the importance of the prothoracic glands in pupal-adult development. These studies establish Manduca as an excellent model for examining the regulation...
Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...
Arguments from Developmental Order.
Stöckle-Schobel, Richard
2016-01-01
In this article, I investigate a special type of argument regarding the role of development in theorizing about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind - getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories. Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasizing the importance of the early cognitive processes and arguments emphasizing the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive) development, and I will present some topics that also pertain to a full-fledged 'philosophy of development.'
Desiccation stress induces developmental heterochrony in ...
Indian Academy of Sciences (India)
Stressful environments are known to perturb developmental patterns in insects. In the purview of desiccation as astressor, relatively little is known about the developmental consequences linked with desiccation tolerance. In thisstudy, we have particularly focused on the exploration of the temporal profile of postembryonic ...
Developmental wiring of specific neurons is regulated by RET-1/Nogo-A in Caenorhabditis elegans
DEFF Research Database (Denmark)
Torpe, Nanna; Nørgaard, Steffen; Høye, Anette M.
2017-01-01
Nogo-A is a membrane-bound protein that functions to inhibit neuronal migration, adhesion, and neurite outgrowth during development. In the mature nervous system, Nogo-A stabilizes neuronal wiring to inhibit neuronal plasticity and regeneration after injury. Here, we show that RET-1, the sole Nog...... present a previously unidentified function for RET-1 in the nervous system of C. elegans.......-A homolog in Caenorhabditis elegans, is required to control developmental wiring of a specific subset of neurons. In ret-1 deletion mutant animals, specific ventral nerve cord axons are misguided where they fail to respect the ventral midline boundary. We found that ret-1 is expressed in multiple neurons...
Replication and robustness in developmental research.
Duncan, Greg J; Engel, Mimi; Claessens, Amy; Dowsett, Chantelle J
2014-11-01
Replications and robustness checks are key elements of the scientific method and a staple in many disciplines. However, leading journals in developmental psychology rarely include explicit replications of prior research conducted by different investigators, and few require authors to establish in their articles or online appendices that their key results are robust across estimation methods, data sets, and demographic subgroups. This article makes the case for prioritizing both explicit replications and, especially, within-study robustness checks in developmental psychology. It provides evidence on variation in effect sizes in developmental studies and documents strikingly different replication and robustness-checking practices in a sample of journals in developmental psychology and a sister behavioral science-applied economics. Our goal is not to show that any one behavioral science has a monopoly on best practices, but rather to show how journals from a related discipline address vital concerns of replication and generalizability shared by all social and behavioral sciences. We provide recommendations for promoting graduate training in replication and robustness-checking methods and for editorial policies that encourage these practices. Although some of our recommendations may shift the form and substance of developmental research articles, we argue that they would generate considerable scientific benefits for the field. (PsycINFO Database Record (c) 2014 APA, all rights reserved).
The Comet Cometh: Evolving Developmental Systems.
Jaeger, Johannes; Laubichler, Manfred; Callebaut, Werner
In a recent opinion piece, Denis Duboule has claimed that the increasing shift towards systems biology is driving evolutionary and developmental biology apart, and that a true reunification of these two disciplines within the framework of evolutionary developmental biology (EvoDevo) may easily take another 100 years. He identifies methodological, epistemological, and social differences as causes for this supposed separation. Our article provides a contrasting view. We argue that Duboule's prediction is based on a one-sided understanding of systems biology as a science that is only interested in functional, not evolutionary, aspects of biological processes. Instead, we propose a research program for an evolutionary systems biology, which is based on local exploration of the configuration space in evolving developmental systems. We call this approach-which is based on reverse engineering, simulation, and mathematical analysis-the natural history of configuration space. We discuss a number of illustrative examples that demonstrate the past success of local exploration, as opposed to global mapping, in different biological contexts. We argue that this pragmatic mode of inquiry can be extended and applied to the mathematical analysis of the developmental repertoire and evolutionary potential of evolving developmental mechanisms and that evolutionary systems biology so conceived provides a pragmatic epistemological framework for the EvoDevo synthesis.
Strongly interacting Higgs sector without technicolor
International Nuclear Information System (INIS)
Liu Chuan; Kuti, J.
1994-12-01
Simulation results are presented on Higgs mass calculations in the spontaneously broken phase of the Higgs sector in the minimal Standard Model with a higher derviative regulator. A heavy Higgs particle is found in the TeV mass range in the presence of a complex conjugate ghost pair at higher energies. The ghost pair evades easy experimental detection. As a finite and unitary theory in the continuum, this model serves as an explicit and simple example of a strong interacting Higgs sector without technicolor. (orig.)
Directory of Open Access Journals (Sweden)
Kimchi Strasser
Full Text Available The retinoblastoma tumour suppressor, Rb, has two major functions. First, it represses genes whose products are required for S-phase entry and progression thus stabilizing cells in G1. Second, Rb interacts with factors that induce cell-cycle exit and terminal differentiation. Dictyostelium lacks a G1 phase in its cell cycle but it has a retinoblastoma orthologue, rblA.Using microarray analysis and mRNA-Seq transcriptional profiling, we show that RblA strongly represses genes whose products are involved in S phase and mitosis. Both S-phase and mitotic genes are upregulated at a single point in late G2 and again in mid-development, near the time when cell cycling is reactivated. RblA also activates a set of genes unique to slime moulds that function in terminal differentiation.Like its mammalian counterpart Dictyostelium, RblA plays a dual role, regulating cell-cycle progression and transcriptional events leading to terminal differentiation. In the absence of a G1 phase, however, RblA functions in late G2 controlling the expression of both S-phase and mitotic genes.
Hérouart, D; Van Montagu, M; Inzé, D
1994-03-01
Superoxide dismutases (SODs) play a key role in the cellular defense against reactive oxygen species. To study the transcriptional regulation at the cellular level, the promoter of the Nicotiana plumbaginifolia cytosolic gene encoding Cu/ZnSOD (SODCc) was fused to the beta-glucuronidase (GUS) reporter gene (gusA) and analyzed in transgenic tobacco plants. The promoter was highly active in vascular bundles of leaves and stems, where it is confined to phloem cells. In flowers, GUS activity was detected in ovules and pollen grains, in pigmented tissues of petals, and in vascular tissue of ovaries and anthers. In response to treatment with the superoxide-generating herbicide paraquat, very strong GUS staining was observed in photosynthetically active cells of leaves and in some epidermal root cells of seedlings. The expression of the SODCc-gusA was also induced in seedlings after heat shock and chilling and after treatment with sulfhydryl antioxidants such as reduced glutathione and cysteine. It is postulated that SODCc expression is directly linked to a cell-specific production of excess superoxide radicals in the cytosol.
Prevalence and sociodemographic determinants of developmental ...
African Journals Online (AJOL)
Birth order and household size also had significant association with delay in various domains. There was no significant association between socioeconomic class and developmental delay in any of the domains. Conclusion: The study showed that developmental delay was relatively common among under-five children in ...
Introducing Newspapers in Developmental Reading Classes
Karstadt, Roberta; Rey, Victoria M.
2009-01-01
Newspapers are an effective educational and motivational tool in developmental reading classes. However, many students are unfamiliar with newspapers and read them infrequently. In order to foster newspaper reading and familiarize the college freshmen enrolled in their developmental reading classes with newspapers, the writers of this article…
Njelesani, Janet; Leckie, Karen; Drummond, Jennifer; Cameron, Deb
2015-01-01
Parents have a strong influence on their child's engagement in physical activities, especially for children with developmental disabilities, as these children are less likely to initiate physical activity. Knowledge is limited regarding parents' perceptions of this phenomenon in low- and middle-income countries (LMICs); yet many rehabilitation providers work with children with developmental disabilities and their parents in these contexts. The aim of this study was to explore the barriers perceived by parents of children with developmental disabilities to their children's engagement in physical activity. An occupational perspective was used to explore how parents speak about barriers to their child's engagement in physical activity. Interviews were conducted with nine parents in Port-of-Spain, Trinidad and Tobago. Parent's perceived barriers were categorized into four themes: family priorities, not an option in our environment, need to match the activity to the child's ability, and need for specialized supports. FINDINGS provide opportunities for future rehabilitation and community programming in LMICs. Implications for Rehabilitation Children living with a developmental disability may engage more in solitary and sedentary pursuits as a result of parents choosing activities that do not present extensive social and physical demands for their child. Therapists can play an important role in providing knowledge to parents of appropriate physical activity and the benefits of physical activity for children with developmental disabilities in order to promote children's participation. In environments where there is limited social support for families, therapists need to consider and be particularly supportive of parental priorities and schedules.
MicroRNA-276 promotes egg-hatching synchrony by up-regulating brm in locusts
He, Jing; Chen, Qianquan; Wei, Yuanyuan; Jiang, Feng; Yang, Meiling; Hao, Shuguang; Guo, Xiaojiao; Chen, Dahua; Kang, Le
2016-01-01
Developmental synchrony, the basis of uniform swarming, migration, and sexual maturation, is an important strategy for social animals to adapt to variable environments. However, the molecular mechanisms underlying developmental synchrony are largely unexplored. The migratory locust exhibits polyphenism between gregarious and solitarious individuals, with the former displaying more synchronous sexual maturation and migration than the latter. Here, we found that the egg-hatching time of gregarious locusts was more uniform compared with solitarious locusts and that microRNA-276 (miR-276) was expressed significantly higher in both ovaries and eggs of gregarious locusts than in solitarious locusts. Interestingly, inhibiting miR-276 in gregarious females and overexpressing it in solitarious females, respectively, caused more heterochronic and synchronous hatching of progeny eggs. Moreover, miR-276 directly targeted a transcription coactivator gene, brahma (brm), resulting in its up-regulation. Knockdown of brm not only resulted in asynchronous egg hatching in gregarious locusts but also impaired the miR-276–induced synchronous egg hatching in solitarious locusts. Mechanistically, miR-276 mediated brm activation in a manner that depended on the secondary structure of brm, namely, a stem-loop around the binding site of miR-276. Collectively, our results unravel a mechanism by which miR-276 enhances brm expression to promote developmental synchrony and provide insight into regulation of developmental homeostasis and population sustaining that are closely related to biological synchrony. PMID:26729868
Developmental changes of l-arginine transport at the blood-brain barrier in rats.
Tachikawa, Masanori; Hirose, Shirou; Akanuma, Shin-Ichi; Matsuyama, Ryo; Hosoya, Ken-Ichi
2018-05-01
l-Arginine is required for regulating synapse formation/patterning and angiogenesis in the developing brain. We hypothesized that this requirement would be met by increased transporter-mediated supply across the blood-brain barrier (BBB). Thus, the purpose of this work was to test the idea that elevation of blood-to-brain l-arginine transport across the BBB in the postnatal period coincides with up-regulation of cationic acid transporter 1 (CAT1) expression in developing brain capillaries. We found that the apparent brain-to-plasma concentration ratio (Kp, app) of l-arginine after intravenous administration during the first and second postnatal weeks was 2-fold greater than that at the adult stage. Kp, app of l-serine was also increased at the first postnatal week. In contrast, Kp, app of d-mannitol, a passively BBB-permeable molecule, did not change, indicating that increased transport of l-arginine and l-serine is not due to BBB immaturity. Double immunohistochemical staining of CAT1 and a marker protein, glucose transporter 1, revealed that CAT1 was localized on both luminal and abluminal membranes of brain capillary endothelial cells during the developmental and adult stages. A dramatic increase in CAT1 expression in the brain was seen at postnatal day 7 (P7) and day 14 (P14) and the expression subsequently decreased as the brain matured. In accordance with this, intense immunostaining of CAT1 was observed in brain capillaries at P7 and P14. These findings strongly support our hypothesis and suggest that the supply of blood-born l-arginine to the brain via CAT1 at the BBB plays a key role in meeting the elevated demand for l-arginine in postnatal brain. Copyright © 2017 Elsevier Inc. All rights reserved.
Tissue-specific regulation of BMP signaling by Drosophila N-glycanase 1.
Galeone, Antonio; Han, Seung Yeop; Huang, Chengcheng; Hosomi, Akira; Suzuki, Tadashi; Jafar-Nejad, Hamed
2017-08-04
Mutations in the human N- glycanase 1 ( NGLY1 ) cause a rare, multisystem congenital disorder with global developmental delay. However, the mechanisms by which NGLY1 and its homologs regulate embryonic development are not known. Here we show that Drosophila Pngl encodes an N -glycanase and exhibits a high degree of functional conservation with human NGLY1. Loss of Pngl results in developmental midgut defects reminiscent of midgut-specific loss of BMP signaling. Pngl mutant larvae also exhibit a severe midgut clearance defect, which cannot be fully explained by impaired BMP signaling. Genetic experiments indicate that Pngl is primarily required in the mesoderm during Drosophila development. Loss of Pngl results in a severe decrease in the level of Dpp homodimers and abolishes BMP autoregulation in the visceral mesoderm mediated by Dpp and Tkv homodimers. Thus, our studies uncover a novel mechanism for the tissue-specific regulation of an evolutionarily conserved signaling pathway by an N -glycanase enzyme.
A Developmental Shift from Positive to Negative Connectivity in Human Amygdala-Prefrontal Circuitry
Gee, Dylan G.; Humphreys, Kathryn L.; Flannery, Jessica; Goff, Bonnie; Telzer, Eva H.; Shapiro, Mor; Hare, Todd A.; Bookheimer, Susan Y.; Tottenham, Nim
2013-01-01
Recent human imaging and animal studies highlight the importance of frontoamygdala circuitry in the regulation of emotional behavior and its disruption in anxiety-related disorders. While tracing studies have suggested changes in amygdala-cortical connectivity through the adolescent period in rodents, less is known about the reciprocal connections within this circuitry across human development, when these circuits are being fine-tuned and substantial changes in emotional control are observed. The present study examined developmental changes in amygdala-prefrontal circuitry across the ages of 4 to 22 years using task-based functional magnetic resonance imaging (fMRI). Results suggest positive amygdala-prefrontal connectivity in early childhood that switches to negative functional connectivity during the transition to adolescence. Amygdala-mPFC functional connectivity was significantly positive (greater than zero) among participants younger than ten, whereas functional connectivity was significantly negative (less than zero) among participants ten years and older, over and above the effect of amygdala reactivity. The developmental switch in functional connectivity was paralleled by a steady decline in amygdala reactivity. Moreover, the valence switch might explain age-related improvement in task performance and a developmentally normative decline in anxiety. Initial positive connectivity followed by a valence shift to negative connectivity provides a neurobiological basis for regulatory development and may present novel insight into a more general process of developing regulatory connections. PMID:23467374
Holwerda, Anja; Brouwer, Sandra; de Boer, Michiel R; Groothoff, Johan W; van der Klink, Jac J L
2015-03-01
Expectations strongly influence future employment outcomes and social networks seem to mediate employment success of young adults with intellectual and developmental disabilities. The aim of this study is to examine the expectations of young adults with intellectual and developmental disabilities from special needs education, their parents and their school teachers regarding future work and the extent to which these expectations predict work outcome. Data on 341 young adults with intellectual or developmental disabilities, coming from special needs education, aged 17-20 years, and with an ability to work according to the Social Security Institute were examined. The school teacher's expectation was the only perspective that significantly predicted entering competitive employment, with a complementary effect of the expectation of parents and a small additional effect of the expectation of the young adult. Expectations of school teachers and parents are valuable in predicting work outcome. Therefore, it is important for professionals working with the young adult in the transition from school to work to incorporate the knowledge of school teachers and parents regarding the abilities of the young adult to enter competitive employment as a valuable source of information.
Avesson, Lotta; Reimegård, Johan; Wagner, E Gerhart H; Söderbom, Fredrik
2012-10-01
The RNA interference machinery has served as a guardian of eukaryotic genomes since the divergence from prokaryotes. Although the basic components have a shared origin, silencing pathways directed by small RNAs have evolved in diverse directions in different eukaryotic lineages. Micro (mi)RNAs regulate protein-coding genes and play vital roles in plants and animals, but less is known about their functions in other organisms. Here, we report, for the first time, deep sequencing of small RNAs from the social amoeba Dictyostelium discoideum. RNA from growing single-cell amoebae as well as from two multicellular developmental stages was sequenced. Computational analyses combined with experimental data reveal the expression of miRNAs, several of them exhibiting distinct expression patterns during development. To our knowledge, this is the first report of miRNAs in the Amoebozoa supergroup. We also show that overexpressed miRNA precursors generate miRNAs and, in most cases, miRNA* sequences, whose biogenesis is dependent on the Dicer-like protein DrnB, further supporting the presence of miRNAs in D. discoideum. In addition, we find miRNAs processed from hairpin structures originating from an intron as well as from a class of repetitive elements. We believe that these repetitive elements are sources for newly evolved miRNAs.
Where Do Epigenetics and Developmental Origins Take the Field of Developmental Psychopathology?
Nigg, Joel T
2016-04-01
The time is ripe for upgrading or rethinking the assumed paradigms for how we study developmental psychopathology. The classic transactional models appear robust but need specification in terms of biological and psychosocial processes. That specification is increasingly tractable due to developments in genetics, epigenetics, the measurement of psychosocial processes, and theory and data on developmental origins of health and disease. This essay offers a high-level view of where the field has been and where it may be going in regard to nosology and conceptions of etiology. Remarks seek to consider rapidly evolving contexts not only for children, but also for the science itself due to progress in our field and in neighboring fields. Illustrations are provided as to how syndromal nosology can be enriched and advanced by careful integration with biologically relevant behavioral dimensions and application of quantitative methods. It is concluded that a revised, forward-looking, transactional model of abnormal child psychology will incorporate prenatal and postnatal developmental programming, epigenetic mechanisms and their associated genotype x environment interactions, and inflammatory processes as a potential common mediator influencing numerous health and mental health conditions.
Regulation of terpene metabolism. Final technical report, March 15, 1988--March 14, 1996
Energy Technology Data Exchange (ETDEWEB)
Croteau, R.
1996-12-31
This research focuses on the following topics: the biosynthesis and catabolism of monoterpenes; the organization of monoterpene metabolism; the developmental regulation of monoterpene metabolism; the flux control of precursor supply; and the integration of monoterpene and higher terpenoid metabolism.
Energy Technology Data Exchange (ETDEWEB)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of); Hwang, Un-Ki [Marine Ecological Risk Assessment Center, West Sea Fisheries Research Institute, National Fisheries Research & Development Institute, Incheon 46083 (Korea, Republic of); Zhou, Bingsheng [State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072 (China); Choe, Joonho [Department of Biological Sciences, Korea Advanced Institute of Science and Technology, Daejeon 34141 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@skku.edu [Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419 (Korea, Republic of)
2016-08-15
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
International Nuclear Information System (INIS)
Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong
2016-01-01
Highlights: • The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47. • Expression profiles of nearly all NR genes were the highest at naupliar stages 5–6. • USP, HR96, and FTZ-F1 genes showed significant sex differences (P < 0.05) over different developmental stages. • NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47. • BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. - Abstract: 2,2′,4,4′-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P < 0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P < 0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5–6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P < 0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P < 0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47
Ethiopia: A Democratic Developmental State?
Directory of Open Access Journals (Sweden)
Fesseha Mulu Gebremariam
2017-12-01
Full Text Available The ruling Ethiopia People’s Revolutionary Democratic Front (EPRDF in its notable second reform appraisal held in the aftermath of the 2005 national election concluded that the utmost priority of the government should be realizing fastest and sustainable economic growth that fairly benefits its citizens’ unless the very existence of the country wouldn’t be guaranteed. Given the history of poverty reduction in developing countries, particularly in Africa, EPRDF realized that it is unthinkable to eradicate poverty from Ethiopia adopting neo-liberalism. Above all, the miraculous economic transformation of the South East Asian countries like South Korea, Taiwan, Singapore and Hong Kong has proved that there is another way to development, not just neo-liberalism. Accordingly, EPRDF, after examining South Korea’s and Taiwan’s history of economic development in particular where both countries have had a large section of rural population unlike Hong Kong and Singapore where both are urban, found ‘developmental state’ relevant to Ethiopia. However, unlike these countries which were originally under non-democratic regimes where their leaders fear the rural peasant and external aggression from their communist rivals, EPRDF has had a great support of rural and urban population with no imminent foreign threat(s, and decided to execute the ideology rather under the umbrella of democracy. Therefore, employing secondary sources, this desk study aims to analyze whether Ethiopia is a ‘democratic developmental state?’ And, concludes that given the practices of the government vis-a-vis the principles of democracy and developmental state, Ethiopia couldn’t be taken as best model for democratic developmental state, rather emerging developmental state.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Arguments from Developmental Order
Directory of Open Access Journals (Sweden)
Richard eStöckle-Schobel
2016-05-01
Full Text Available In this article, I investigate a special type of argument regarding the role of development in theorising about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind – getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories.Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasising the importance of the early cognitive processes and arguments emphasising the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive development, and I will present some topics that also pertain to a full-fledged ‘philosophy of development’.
Developmental dyscalculia: a dysconnection syndrome?
Kucian, Karin; Ashkenazi, Simone Schwizer; Hänggi, Jürgen; Rotzer, Stephanie; Jäncke, Lutz; Martin, Ernst; von Aster, Michael
2014-09-01
Numerical understanding is important for everyday life. For children with developmental dyscalculia (DD), numbers and magnitudes present profound problems which are thought to be based upon neuronal impairments of key regions for numerical understanding. The aim of the present study was to investigate possible differences in white matter fibre integrity between children with DD and controls using diffusion tensor imaging. White matter integrity and behavioural measures were evaluated in 15 children with developmental dyscalculia aged around 10 years and 15 matched controls. The main finding, obtained by a whole brain group comparison, revealed reduced fractional anisotropy in the superior longitudinal fasciculus in children with developmental dyscalculia. In addition, a region of interest analysis exhibited prominent deficits in fibres of the superior longitudinal fasciculus adjacent to the intraparietal sulcus, which is thought to be the core region for number processing. To conclude, our results outline deficient fibre projection between parietal, temporal and frontal regions in children with developmental dyscalculia, and therefore raise the question of whether dyscalculia can be seen as a dysconnection syndrome. Since the superior longitudinal fasciculus is involved in the integration and control of distributed brain processes, the present results highlight the importance of considering broader domain-general mechanisms in the diagnosis and therapy of dyscalculia.
Developmental trends in adaptive memory.
Otgaar, Henry; Howe, Mark L; Smeets, Tom; Garner, Sarah R
2014-01-01
Recent studies have revealed that memory is enhanced when information is processed for fitness-related purposes. The main objective of the current experiments was to test developmental trends in the evolutionary foundation of memory using different types of stimuli and paradigms. In Experiment 1, 11-year-olds and adults were presented with neutral, negative, and survival-related DRM word lists. We found a memory benefit for the survival-related words and showed that false memories were more likely to be elicited for the survival-related word lists than for the other lists. Experiment 2 examined developmental trends in the survival processing paradigm using neutral, negative, and survival-related pictures. A survival processing advantage was found for survival-related pictures in adults, for negative pictures in 11/12-year-olds, and for neutral pictures in 7/8-year-olds. In Experiment 3, 11/12-year-olds and adults had to imagine the standard survival scenario or an adapted survival condition (or pleasantness condition) that was designed to reduce the possibilities for elaborative processing. We found superior memory retention for both survival scenarios in children and adults. Collectively, our results evidently show that the survival processing advantage is developmentally invariant and that certain proximate mechanisms (elaboration and distinctiveness) underlie these developmental trends.
Developmental immunotoxicity testing of 4-methyl anisole.
Tonk, Elisa C M; Verhoef, Aart; Gremmer, Eric R; van Loveren, Henk; Piersma, Aldert H
2015-07-01
The developmental immunotoxicity of 4-methyl anisole (4MA) was investigated in the rat. Four study designs were used, with either premating or post-weaning onset of exposure, continued to postnatal day 50, and with or without additional oral gavage of pups from postnatal day 10 onward. Reduced litter size (benchmark dose lower confidence limit (BMDL) 80mg/kg bw/day) was the most sensitive developmental parameter, with pup relative organ weight effects observed at similar BMDLs, in the absence of maternal toxicity. Eosinophil numbers were reduced at lower doses (BMDL 16mg/kg bw/day). KLH challenge resulted in increased IL-13 and TNF-α responses, and variably reduced IgG production (BMDL 27mg/kg bw/day). T4 levels were reduced by 11% at maximum with a BMDL of 73mg/kg bw/day. Differences between exposure cohorts were limited and were considered to be without biological significance. This study shows that 4MA induces developmental immunotoxicity at doses below those inducing developmental and general toxicity. These observations being independent of the study designs applied suggest that the post-weaning period, included in all designs, is the most relevant sensitive period for inducing 4MA mediated developmental immunotoxicity. Moreover, this study stresses the importance of including developmental immunotoxicity testing by default in regulatory toxicology. Copyright © 2015 Elsevier Inc. All rights reserved.
Unilateral implicit motor learning deficit in developmental dyslexia.
Yang, Yang; Hong-Yan, Bi
2011-02-01
It has been suggested that developmental dyslexia involves various literacy, sensory, motor skill, and processing speed deficits. Some recent studies have shown that individuals with developmental dyslexia exhibit implicit motor learning deficits, which may be related to cerebellar functioning. However, previous studies on implicit motor learning in developmental dyslexics have produced conflicting results. Findings from cerebellar lesion patients have shown that patients' implicit motor learning performance varied when different hands were used to complete tasks. This suggests that dyslexia may have different effects on implicit motor learning between the two hands if cerebellar dysfunction is involved. To specify this question, we used a one-handed version of a serial reaction time task to compare the performance of 27 Chinese children with developmental dyslexics with another 27 age-matched children without reading difficulties. All the subjects were students from two primary schools, Grades 4 to 6. The results showed that children with developmental dyslexic responded more slowly than nondyslexic children, and exhibited no implicit motor learning in the condition of left-hand response. In contrast, there was no significant difference in reaction time between two groups of children when they used the right hand to respond. This finding indicates that children with developmental dyslexia exhibited normal motor skill and implicit motor learning ability provided the right hand was used. Taken together, these results suggested that Chinese children with developmental dyslexia exhibit unilateral deficits in motor skill and implicit motor learning in the left hand. Our findings lend partial support to the cerebellar deficit theory of developmental dyslexia.
Developmental analytic view on narcissism
Directory of Open Access Journals (Sweden)
Polona Matjan Štuhec
2009-07-01
Full Text Available Narcissistic pathology is connected to the pathology of the self. This article makes an overview of definitions of developmental analytic theories and stops with Kohut, Kernberg, Masterson, Auerbach and Mollon. The self is understood as a separate personality structure and has its own developmental line. Narcissism is a personality disorder that has its roots in preodipal developmental phases, mostly in the practicing and rapprochement subphase and in the oedipal phase as well. Recent research shows that the oedipal phase and the relation between the mother, the child's father (or her partner in general and the child is crucial for the maintenance of the pathological narcissism. Mothers who do not believe in a satisfying relationship with a man in general, keep the child in the dyadic position and do not support the development of the child's own identity.
Arnold, Hayley S.; Conture, Edward G.; Key, Alexandra P. F.; Walden, Tedra
2011-01-01
The purpose of this preliminary study was to assess whether behavioral and psychophysiological correlates of emotional reactivity and regulation are associated with developmental stuttering, as well as determine the feasibility of these methods in preschool-age children. Nine preschool-age children who stutter (CWS) and nine preschool-age children…
Directory of Open Access Journals (Sweden)
Jin Soo Choi
Full Text Available Zinc oxide nanoparticles (ZnO NPs are being utilized in an increasing number of fields and commercial applications. While their general toxicity and associated oxidative stress have been extensively studied, the toxicological pathways that they induce in developmental stages are still largely unknown. In this study, the developmental toxicity of ZnO NPs to embryonic/larval zebrafish was investigated. The transcriptional expression profiles induced by ZnO NPs were also investigated to ascertain novel genomic responses related to their specific toxicity pathway. Zebrafish embryos were exposed to 0.01, 0.1, 1, and 10 mg/L ZnO NPs for 96 h post-fertilization. The toxicity of ZnO NPs, based on their Zn concentration, was quite similar to that in embryonic/larval zebrafish exposed to corresponding ZnSO4 concentrations. Pericardial edema and yolk-sac edema were the principal malformations induced by ZnO NPs. Gene-expression profiling using microarrays demonstrated 689 genes that were differentially regulated (fold change >1.5 following exposure to ZnO NPs (498 upregulated, 191 downregulated. Several genes that were differentially regulated following ZnO NP exposure shared similar biological pathways with those observed with ZnSO4 exposure, but six genes (aicda, cyb5d1, edar, intl2, ogfrl2 and tnfsf13b associated with inflammation and the immune system responded specifically to ZnO NPs (either in the opposite direction or were unchanged in ZnSO4 exposure. Real-time reverse-transcription quantitative polymerase chain reaction confirmed that the responses of these genes to ZnO NPs were significantly different from their response to ZnSO4 exposure. ZnO NPs may affect genes related to inflammation and the immune system, resulting in yolk-sac edema and pericardia edema in embryonic/larval developmental stages. These results will assist in elucidating the mechanisms of toxicity of ZnO NPs during development of zebrafish.
Self-Regulation and School Achievement in Contexts : Aspects of Gender, Parenting, and Culture
Weis, Mirjam
2015-01-01
Scholars from multiple disciplines claim that self-regulation is an essential skill and motivation for positive developmental outcomes (e.g., Mischel, 2014; Moffitt et al., 2011; Tangney, Baumeister, & Boone, 2004). More specifically, self-regulation might play a central role for children’s school achievement (e.g., Blair, Ursache, Greenberg, Vernon-Feagans, & Investigators, 2015; McClelland et al., 2007; McClelland & Cameron, 2011; Suchodoletz, Trommsdorff, Heikamp, Wieber, & Gollwitzer, 200...
Developmental coordination disorder
Developmental coordination disorder can lead to: Learning problems Low self-esteem resulting from poor ability at sports and teasing by other children Repeated injuries Weight gain as a result of not wanting to participate ...
Regulated 15-V, 7500-A, neutral-beam filament supply
International Nuclear Information System (INIS)
Reass, W.
1977-01-01
Lawrence Livermore Laboratory (LLL) designed a cost-effective, regulated 15-V, 7500-A filament supply for use with the High-Voltage Test Stand , a major ERDA developmental neutral-beam test facility. The filament supply can float to 200 kV and can provide pulse widths up to 30 s. Powered by a 24-V, 0.5-TJ battery bank, it avoids the use of expensive isolation transformers and induction voltage regulators (IVR's). Battery output is regulated by a water-cooled resistor-contactor combination in which contactors are closed in sequential format to create a staircase current waveform. A fine-tuning network tunes in-between the ''steps'' for regulation to less than 0.5 percent. The regulator is digitally controlled except for the sense amplifiers, which are optically coupled to the digital controller. All ground telemetry uses optical links to minimize effects of rfi and emi noise in the data channels
Maternal effects and the evolution of brain size in birds: overlooked developmental constraints.
Garamszegi, L Z; Biard, C; Eens, M; Møller, A P; Saino, N; Surai, P
2007-01-01
A central dogma for the evolution of brain size posits that the maintenance of large brains incurs developmental costs, because they need prolonged periods to grow during the early ontogeny. Such constraints are supported by the interspecific relationship between ontological differences and relative brain size in birds and mammals. Given that mothers can strongly influence the development of the offspring via maternal effects that potentially involve substances essential for growing brains, we argue that such effects may represent an important but overlooked component of developmental constraints on brain size. To demonstrate the importance of maternal effect on the evolution of brains, we investigated the interspecific relationship between relative brain size and maternal effects, as reflected by yolk testosterone, carotenoids, and vitamins A and E in a phylogenetic study of birds. Females of species with relatively large brains invested more in eggs in terms of testosterone and vitamin E than females of species with small brains. The effects of carotenoid and vitamin A levels on the evolution of relative brain size were weaker and non-significant. The association between relative brain size and yolk testosterone was curvilinear, suggesting that very high testosterone levels can be suppressive. However, at least in moderate physiological ranges, the positive relationship between components of maternal effects and relative brain size may imply one aspect of developmental costs of large brains. The relationship between vitamin E and relative brain size was weakened when we controlled for developmental mode, and thus the effect of this antioxidant may be indirect. Testosterone-enhanced neurogenesis and vitamin E-mediated defence against oxidative stress may have key functions when the brain of the embryo develops, with evolutionary consequences for relative brain size.
Care of preterm infants: programs of research and their relationship to developmental science.
Holditch-Davis, Diane; Black, Beth Perry
2003-01-01
The purpose of this review was to examine the topics covered in current programs of nursing research on the care of the preterm infant and to determine the extent to which this research is informed by developmental science. A researcher was considered to have a current program of research if he or she had at least five publications published since 1990 and was the first author on at least three of them. The infants in a study could be any age from birth throughout childhood; studies focusing on parenting, nursing, or other populations of infants were not included. Seventeen nurse researchers had current programs of research in this area. These programs had four themes. Those of Becker, Evans, Pridham, Shiao, and Zahr focused on infant responses to the neonatal intensive care unit (NICU) environment and treatments. Franck, Johnston, and Stevens focused on pain management. Harrison, Ludington-Hoe, and White-Traut's research focused on infant stimulation. Holditch-Davis, McCain, McGrath, Medoff-Cooper, Schraeder, and Youngblut studied infant behavior and development. These research programs had many strengths, including strong interdisciplinary focus and clinical relevance. However, additional emphasis is needed on the care of the critically ill infant. Also, despite the fact that the preterm infant's neurological system develops rapidly over the first year, only three of these researchers used a developmental science perspective. Only research on infant behavior and development focused on the developmental changes that the infants were experiencing. Most of the studies were longitudinal, but many did not use statistics appropriate for identifying stability and change over time. The response of individual infants and the broader ecological context as evidenced by factors such as gender, ethnic group, culture, and intergenerational effects were rarely examined. Thus research on the care of preterm infants could be expanded if the developmental science perspective
Infant developmental milestones and adult intelligence
DEFF Research Database (Denmark)
Flensborg-Madsen, Trine; Mortensen, Erik Lykke
2015-01-01
Intelligence Scale (WAIS). Associations between motor developmental milestones and IQwere analysed bymultiple linear regression adjusting for potential confounding factors. Results: Later acquisition of infant developmental milestones was associated with lower subsequent IQ, and the majority of significant......Background: A number of studies suggest a positive association between faster infant motor development and intellectual function in childhood and adolescence. However, studies investigating the relationship between infant motor development and intelligence in adulthood are lacking. Aims......: To investigate whether age at achievement of 12 motor developmental milestones was associated with adult intelligence and to evaluate the influence of sex, parental social status, parity,mother's cigarette consumption in the last trimester, gestational age, birthweight, and birth length on this association...
East Asian Developmental Path and Land-Use Rights in China
Directory of Open Access Journals (Sweden)
Ganesh K. Trichur
2015-08-01
Full Text Available This paper highlights contemporary Chinas long-term continuities with the historical EastAsian developmental path in relation to its post-1978 revival of market-economy traditions. Therevival of market economy traditions does not exemplify the unfolding of processes associatedwith the one-size-fits-all Washington Consensus. Rural land reforms were driven from belowand strongly influenced policy changes from above. Neither rural nor urban land use relationssuggest a more general unfolding of neoliberal processes of capitalist accumulation bydispossession. Contemporary Chinese land relations reflect the effects of continuities withhistorical East Asian regional traditions more strongly than do some discontinuities andruptures that emerged in the conjuncture of the mid-1980s. These continuities remain moreimportant in understanding the future of the China-led East Asian region. Like the Ming andQing dynasties, Chinas Party-State is sharply focused on problems of governance. Retaininglegitimacy and recreating a welfare state to promote harmonious development rather thangrowth fetishism appears to characterize Chinas current trajectory.
Silvers, Jennifer A.; McRae, Kateri; Gross, James J.; Remy, Katherine A.; Ochsner, Kevin N.; Gabrieli, John D. E.
2012-01-01
Although adolescents’ emotional lives are thought to be more turbulent than those of adults, it is unknown whether this difference is attributable to developmental changes in emotional reactivity or emotion regulation. Study 1 addressed this question by presenting healthy individuals aged 10–23 with negative and neutral pictures and asking them to respond naturally or use cognitive reappraisal to down-regulate their responses on a trial-by-trial basis. Results indicated that age exerted both ...
Insecure Attachment and Eating Pathology in Early Adolescence: Role of Emotion Regulation
van Durme, Kim; Braet, Caroline; Goossens, Lien
2015-01-01
The present study investigated whether associations exist between attachment dimensions toward mother and different forms of eating pathology (EP) in a group of early adolescent boys and girls, and whether these associations were mediated by maladaptive emotion regulation (ER) strategies. Developmentally appropriate self-report questionnaires were…
Developmental environment mediates male seminal protein investment in Drosophila melanogaster.
Wigby, Stuart; Perry, Jennifer C; Kim, Yon-Hee; Sirot, Laura K
2016-03-01
Males of many species fine-tune their ejaculates in response to sperm competition risk. Resource availability and the number of competitors during development can also strongly influence sperm production. However, despite the key role of seminal proteins in mediating reproductive processes, it is unclear whether seminal protein investment is dependent on the developmental environment.We manipulated the developmental environment of Drosophila melanogaster by rearing flies at low and high density. As expected, this resulted in large and small (i.e. high and low condition) adult phenotypes, respectively.As predicted, large males produced more of two key seminal proteins, sex peptide (SP) and ovulin, and were more successful at obtaining matings with both virgin and previously mated females. However, there was only a weak and non-significant trend for large males to transfer more absolute quantities of SP at mating, and thus, small males ejaculated proportionally more of their stored accessory gland SP resources.Males transferred more receptivity-inhibiting SP to large females. Despite this, large females remated more quickly than small females and thus responded to their developmental environment over and above the quantity of SP they received.The results are consistent with two non-mutually exclusive hypotheses. First, flies might respond to condition-dependent reproductive opportunities, with (i) small males investing heavily in ejaculates when mating opportunities arise and large males strategically partitioning SP resources and (ii) small females remating at reduced rates because they have higher mating costs or need to replenish sperm less often.Second, flies may be primed by their larval environment to deal with similar adult population densities, with (i) males perceiving high density as signalling increased competition, leading small males to invest proportionally more SP resources at mating and (ii) females perceiving high density as signalling abundant
Current status of developmental neurotoxicity: regulatory view
DEFF Research Database (Denmark)
Hass, Ulla
2003-01-01
in the testing strategy for new and existing substances, and biocides. Hopefully, this will lead to an improved database for risk assessment of potential developmental neurotoxicants. However, the regulatory authorities and toxicologists will also be faced with the challenge that decisions have to be made......The need for developmental neurotoxicity testing has been recognized for decades and guidelines are available, as the USEPA guideline and the OECD draft TG 426. Regulatory testing of industrial chemicals for developmental neurotoxicity is required to some extent, especially for pesticides in the US....... Until recently, however, developmental neurotoxicity testing of industrial chemicals has not been a clear regulatory requirement in EU, probably due to the lack of an accepted OECD TG. The revised EU Technical Guidance Document for Risk Assessment (EU-TGD) has now included the OECD draft TG 426...
Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling
2008-10-03
In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.
Developmental biology, the stem cell of biological disciplines
Gilbert, Scott F.
2017-01-01
Developmental biology (including embryology) is proposed as "the stem cell of biological disciplines.” Genetics, cell biology, oncology, immunology, evolutionary mechanisms, neurobiology, and systems biology each has its ancestry in developmental biology. Moreover, developmental biology continues to roll on, budding off more disciplines, while retaining its own identity. While its descendant disciplines differentiate into sciences with a restricted set of paradigms, examples, and techniques, ...
Developmental surface and phonological dyslexia in both Greek and English.
Sotiropoulos, Andreas; Hanley, J Richard
2017-11-01
The hallmark of developmental surface dyslexia in English and French is inaccurate reading of words with atypical spelling-sound correspondences. According to Douklias, Masterson and Hanley (2009), surface dyslexia can also be observed in Greek (a transparent orthography for reading that does not contain words of this kind). Their findings suggested that surface dyslexia in Greek can be characterized by slow reading of familiar words, and by inaccurate spelling of words with atypical sound-spelling correspondences (Greek is less transparent for spelling than for reading). In this study, we report seven adult cases whose slow reading and impaired spelling accuracy satisfied these criteria for Greek surface dyslexia. When asked to read words with atypical grapheme-phoneme correspondences in English (their second language), their accuracy was severely impaired. A co-occurrence was also observed between impaired spelling of words with atypical phoneme-grapheme correspondences in English and Greek. These co-occurrences provide strong evidence that surface dyslexia genuinely exists in Greek and that slow reading of real words in Greek reflects the same underlying impairment as that which produces inaccurate reading of atypical words in English. Two further individuals were observed with impaired reading and spelling of nonwords in both languages, consistent with developmental phonological dyslexia. Neither of the phonological dyslexics read words slowly. In terms of computational models of reading aloud, these findings suggest that slow reading by dyslexics in transparent orthographies is the consequence of a developmental impairment of the lexical (Coltheart, Rastle, Perry, Langdon, & Zeigler, 2001; Perry, Ziegler, & Zorzi, 2010) or semantic reading route (Plaut, McClelland, Seidenberg, & Patterson, 1996). This outcome provides evidence that the neurophysiological substrate(s) that support the lexical/semantic and the phonological pathways that are involved in reading
The diversification of developmental biology.
Crowe, Nathan; Dietrich, Michael R; Alomepe, Beverly S; Antrim, Amelia F; ByrneSim, Bay Lauris; He, Yi
2015-10-01
In the 1960s, "developmental biology" became the dominant term to describe some of the research that had previously been included under the rubrics of embryology, growth, morphology, and physiology. As scientific societies formed under this new label, a new discipline took shape. Historians, however, have a number of different perspectives on what changes led to this new field of developmental biology and how the field itself was constituted during this period. Using the General Embryological Information Service, a global index of post-World War II development-related research, we have documented and visualized significant changes in the kinds of research that occurred as this new field formed. In particular, our analysis supports the claim that the transition toward developmental biology was marked by a growth in new topics and forms of research. Although many historians privilege the role of molecular biology and/or the molecularization of biology in general during this formative period, we have found that the influence of molecular biology is not sufficient to account for the wide range of new research that constituted developmental biology at the time. Overall, our work creates a robust characterization of the changes that occurred with regard to research on growth and development in the decades following World War II and provides a context for future work on the specific drivers of those changes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Berzenski, Sara R
2018-03-22
Efforts to differentiate between the developmental sequelae of childhood emotional abuse and childhood emotional neglect are critical to both research and practice efforts. As an oft-identified mechanism of the effects of child maltreatment on later adjustment, emotion dysregulation represents a key potential pathway. The present study explored a higher order factor model of specific emotion regulation skills, and the extent to which these skill sets would indicate distinct developmental pathways from unique emotional maltreatment experiences to multidomain adjustment. A sample of 500 ethnoracially diverse college students reported on their experiences. A two-factor model of emotion regulation skills based on subscales of the Difficulties in Emotion Regulation Scale was revealed. Significant indirect effects of childhood emotional abuse on psychopathology and problems in social relationships were found through response-focused difficulties in emotion regulation, whereas a significant indirect effect of childhood emotional neglect on problems in social relationships was found through antecedent-focused difficulties in emotion regulation. These results are consistent with theoretical models and empirical evidence suggesting differential effects of childhood emotional abuse and emotional neglect, and provide an important indication for developing targeted interventions focusing on specific higher order emotion dysregulation skill clusters.
Gogol, Katarzyna; Brunner, Martin; Preckel, Franzis; Goetz, Thomas; Martin, Romain
2016-01-01
The present study investigated the developmental dynamics of general and subject-specific (i.e., mathematics, French, and German) components of students' academic self-concept, anxiety, and interest. To this end, the authors integrated three lines of research: (a) hierarchical and multidimensional approaches to the conceptualization of each construct, (b) longitudinal analyses of bottom-up and top-down developmental processes across hierarchical levels, and (c) developmental processes across subjects. The data stemmed from two longitudinal large-scale samples (N = 3498 and N = 3863) of students attending Grades 7 and 9 in Luxembourgish schools. Nested-factor models were applied to represent each construct at each grade level. The analyses demonstrated that several characteristics were shared across constructs. All constructs were multidimensional in nature with respect to the different subjects, showed a hierarchical organization with a general component at the apex of the hierarchy, and had a strong separation between the subject-specific components at both grade levels. Further, all constructs showed moderate differential stabilities at both the general (0.42 < r < 0.55) and subject-specific levels (0.45 < r < 0.73). Further, little evidence was found for top-down or bottom-up developmental processes. Rather, general and subject-specific components in Grade 9 proved to be primarily a function of the corresponding components in Grade 7. Finally, change in several subject-specific components could be explained by negative effects across subjects.
Unpacking developmental local government using Soft Systems Methodology and MCDA tools
Directory of Open Access Journals (Sweden)
L Scott
2005-12-01
Full Text Available This paper presents two different analytical approaches that may be useful in developing an understanding of developmental local government (DLG. DLG implies a significant commitment with respect to poverty relief at the local administrative level as well as strong emphasis on participation and accountability to communities1. This paper attempts to apply Soft Systems Methodology (SSM to clarify the activities that DLG implies for local authorities and focuses specifically on their ability to be developmental and to effectively impact upon poverty. An expected product of this approach will be the identification of specific indicators of (inter alia poverty that may be used to monitor the effectiveness of local government from a constitutional and developmental perspective. Indicators may also be generated from the perspective of community needs and this paper reports on a case study which identifies the needs of a small community, Pniel, in the South African Western Cape, using a Multi-Criteria Decision Analysis approach. This approach allows for both the identification and prioritisation of issues from the perspective of the community. Further, it is suggested that the SSM approach can be used to provide a context within which community needs may be considered. This framework clarifies what it is that local government have the aims, powers and functions to perform. Viewing the community needs within this framework provides a mechanism for realistically linking the community needs to the local authority’s budget. A process of ongoing monitoring and evaluation of DLG, using the two sets of indicators, can assist to focus the functioning of local government on effective poverty relief.
Developmental toxicity of engineered nanomaterials
DEFF Research Database (Denmark)
Hougaard, Karin S.; Hansen, Jitka S.; Jackson, Petra
2016-01-01
Study of air pollution indicates that minute particles may adversely interfere with pregnancy and fetal development. As engineering of nanoparticles have emerged, so has concern that these might interfere with reproductive and developmental functions. This is because nanotechnology may potentially...... increase the overall particle burden in air and introduce particles with novel characteristics and surface reactivity. To evaluate safety for pregnant women, we have studied developmental toxicity of engineered nanoparticles (ENPs), following exposure of pregnant mice by inhalation (ENPs of titanium...
Allen, Michele L; Svetaz, A Veronica; Hurtado, G Ali; Linares, Roxana; Garcia-Huidobro, Diego; Hurtado, Monica
2013-01-01
Strong and sustained community-university partnerships are necessary for community-based participatory translational research. Little attention has been paid to understanding the trajectory of research partnerships from a developmental perspective. To propose a framework describing partnership development and maturation based on Erikson's eight stages of psychosocial development and describe how our collaboration is moving through those stages. Collaborators engaged in three rounds of iterative reflection regarding characteristics and contributors to the maturation of the Padres Informados/Jovenes Preparados (Informed Parents/Prepared Youth [PI/JP]) partnership. Each stage is characterized by broad developmental partnership tasks. Conflict or tension within the partnership is often a part of achieving the associated tasks. The strengths developed at each stage prepare the partnership for challenges associated with subsequent stages. This framework could provide a means for partnerships to reflect on their strengths and challenges at a given time point, and to help understand why some partnerships fail whereas others achieve maturity.
Developmental neurotoxicity of Propylthiouracil in rats
DEFF Research Database (Denmark)
Petersen, Marta Axelstad; Hansen, P.; Christiansen, S.
2007-01-01
early in pregnancy may cause adverse effects on the offspring. This has led to increased concern about thyroid hormone disrupting chemicals (TDCs) in our environment. We have studied how developmental exposure to the known antithyroid agent propylthiouracil (PTU) affects the development of rat pups...... behaviour and hearing function. This supports that exposure to TDC's in general may cause long-lasting developmental neurotoxicity....
Unpacking developmental local government using Soft Systems ...
African Journals Online (AJOL)
Unpacking developmental local government using Soft Systems Methodology and MCDA tools. L Scott. Abstract. This paper presents two different analytical approaches that may be useful in developing an understanding of developmental local government (DLG). DLG implies a significant commitment with respect to ...
Rethinking developmental toxicity testing: Evolution or revolution?
Scialli, Anthony R; Daston, George; Chen, Connie; Coder, Prägati S; Euling, Susan Y; Foreman, Jennifer; Hoberman, Alan M; Hui, Julia; Knudsen, Thomas; Makris, Susan L; Morford, LaRonda; Piersma, Aldert H; Stanislaus, Dinesh; Thompson, Kary E
2018-01-01
Current developmental toxicity testing adheres largely to protocols suggested in 1966 involving the administration of test compound to pregnant laboratory animals. After more than 50 years of embryo-fetal development testing, are we ready to consider a different approach to human developmental
Are Students with Developmental Dyslexia Neurologically Different?
Goldsmith-Phillips, Josephine
1994-01-01
Reviews the controversy over a biological basis for developmental dyslexia and illustrates it with two case studies of junior high school students. Reviews neurological evidence for developmental dyslexia, and proposes seven signs characteristic of reading disability that may qualify as dyslexia. (SR)
Kinet, Maxime J; Malin, Jennifer A; Abraham, Mary C; Blum, Elyse S; Silverman, Melanie R; Lu, Yun; Shaham, Shai
2016-03-08
Apoptosis is a prominent metazoan cell death form. Yet, mutations in apoptosis regulators cause only minor defects in vertebrate development, suggesting that another developmental cell death mechanism exists. While some non-apoptotic programs have been molecularly characterized, none appear to control developmental cell culling. Linker-cell-type death (LCD) is a morphologically conserved non-apoptotic cell death process operating in Caenorhabditis elegans and vertebrate development, and is therefore a compelling candidate process complementing apoptosis. However, the details of LCD execution are not known. Here we delineate a molecular-genetic pathway governing LCD in C. elegans. Redundant activities of antagonistic Wnt signals, a temporal control pathway, and mitogen-activated protein kinase kinase signaling control heat shock factor 1 (HSF-1), a conserved stress-activated transcription factor. Rather than protecting cells, HSF-1 promotes their demise by activating components of the ubiquitin proteasome system, including the E2 ligase LET-70/UBE2D2 functioning with E3 components CUL-3, RBX-1, BTBD-2, and SIAH-1. Our studies uncover design similarities between LCD and developmental apoptosis, and provide testable predictions for analyzing LCD in vertebrates.
Risk factors of ophthalmic disorders in children with developmental delay
DEFF Research Database (Denmark)
Sandfeld, L.N.; Jensen, H.; Skov, L.
2008-01-01
PURPOSE: To identify diagnoses that increase the risk of ophthalmic disorders in developmentally delayed children. METHODS: A cross-sectional study of 1126 Danish children with developmental delay (IQ Udgivelsesdato: 2008/12......PURPOSE: To identify diagnoses that increase the risk of ophthalmic disorders in developmentally delayed children. METHODS: A cross-sectional study of 1126 Danish children with developmental delay (IQ Udgivelsesdato: 2008/12...
Developmental basis for filamin-A-associated myxomatous mitral valve disease
Sauls, Kimberly; de Vlaming, Annemarieke; Harris, Brett S.; Williams, Katherine; Wessels, Andy; Levine, Robert A.; Slaugenhaupt, Susan A.; Goodwin, Richard L.; Pavone, Luigi Michele; Merot, Jean; Schott, Jean-Jacques; Le Tourneau, Thierry; Dix, Thomas; Jesinkey, Sean; Feng, Yuanyi; Walsh, Christopher; Zhou, Bin; Baldwin, Scott; Markwald, Roger R.; Norris, Russell A.
2012-01-01
Aims We hypothesized that the structure and function of the mature valves is largely dependent upon how these tissues are built during development, and defects in how the valves are built can lead to the pathological progression of a disease phenotype. Thus, we sought to uncover potential developmental origins and mechanistic underpinnings causal to myxomatous mitral valve disease. We focus on how filamin-A, a cytoskeletal binding protein with strong links to human myxomatous valve disease, can function as a regulatory interface to control proper mitral valve development. Methods and results Filamin-A-deficient mice exhibit abnormally enlarged mitral valves during foetal life, which progresses to a myxomatous phenotype by 2 months of age. Through expression studies, in silico modelling, 3D morphometry, biochemical studies, and 3D matrix assays, we demonstrate that the inception of the valve disease occurs during foetal life and can be attributed, in part, to a deficiency of interstitial cells to efficiently organize the extracellular matrix (ECM). This ECM organization during foetal valve gestation is due, in part, to molecular interactions between filamin-A, serotonin, and the cross-linking enzyme, transglutaminase-2 (TG2). Pharmacological and genetic perturbations that inhibit serotonin-TG2-filamin-A interactions lead to impaired ECM remodelling and engender progression to a myxomatous valve phenotype. Conclusions These findings illustrate a molecular mechanism by which valve interstitial cells, through a serotonin, TG, and filamin-A pathway, regulate matrix organization during foetal valve development. Additionally, these data indicate that disrupting key regulatory interactions during valve development can set the stage for the generation of postnatal myxomatous valve disease. PMID:22843703
Young Children’s Developmental Ecologies and Kindergarten Readiness
Mollborn, Stefanie
2016-01-01
Children enter the crucial transition to school with sociodemographic disparities firmly established. Domain-specific research (e.g., on poverty and family structure) has shed light on these disparities, but we need broader operationalizations of children’s environments to explain them. Building on existing theory, this study articulates the concept of developmental ecology—those interrelated features of a child’s proximal environment that shape development and health. Developmental ecology links structural and demographic factors with interactional, psychological, and genetic factors. Using the Early Childhood Longitudinal Study, Birth Cohort (ECLS-B), this study conducts latent class analyses to identify how 41 factors from three domains—namely, household resources, health risks, and ecological changes—cluster within children as four overarching developmental ecologies. Because it documents how numerous factors co-occur within children, this method allows an approximation of their lived environments. Findings illuminate powerful relationships between race/ethnicity, parental age, socioeconomic background, and nativity and a child’s developmental ecology, as well as associations between developmental ecology and kindergarten cognition, behavior, and health. Developmental ecology represents a major pathway through which demographic characteristics shape school readiness. Because specific factors have different implications depending on the ecologies in which they are embedded, findings support the usefulness of a broad ecological approach. PMID:27873222
Co-Occurrence of Developmental Disorders: The Case of Developmental Dyscalculia
Rubinsten, Orly
2009-01-01
Five to seven percent of children experience severe difficulties in learning mathematics and/or reading. Current trials that are focused on identifying biological markers suggest that these learning disabilities, known as Developmental Dyscalculia (DD) and Dyslexia (for reading), are due to underlying brain dysfunctions. One ongoing controversy…
Conservation and co-option in developmental programmes: the importance of homology relationships
Directory of Open Access Journals (Sweden)
Becker May-Britt
2005-10-01
Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.
Flowering time regulation in crops—what did we learn from Arabidopsis?
Blümel, Martina; Dally, Nadine; Jung, Christian
2015-04-01
The change from vegetative to reproductive growth is a key developmental switch in flowering plants. In agriculture, flowering is a prerequisite for crop production whenever seeds or fruits are harvested. An intricate network with various (epi-) genetic regulators responding to environmental and endogenous triggers controls the timely onset of flowering. Changes in the expression of a single flowering time (FTi) regulator can suffice to drastically alter FTi. FTi regulation is of utmost importance for genetic improvement of crops. We summarize recent discoveries on FTi regulators in crop species emphasizing crop-specific genes lacking homologs in Arabidopsis thaliana. We highlight pleiotropic effects on agronomically important characters, impact on adaptation to new geographical/climate conditions and future perspectives for crop improvement. Copyright © 2014 Elsevier Ltd. All rights reserved.
Thomsen, Tamara
2016-01-01
One way to avert negative influences on well-being when confronted with blocked goals is the flexible adjustment of one's goals to the given situation. This study examines developmental differences in flexible goal adjustment (FGA) regarding age and gender in a sample of N = 815 participants (10 to 20 years; M = 13.63, SD = 2.60, 48.5% male).…
Biomarkers of adult and developmental neurotoxicity
International Nuclear Information System (INIS)
Slikker, William; Bowyer, John F.
2005-01-01
Neurotoxicity may be defined as any adverse effect on the structure or function of the central and/or peripheral nervous system by a biological, chemical, or physical agent. A multidisciplinary approach is necessary to assess adult and developmental neurotoxicity due to the complex and diverse functions of the nervous system. The overall strategy for understanding developmental neurotoxicity is based on two assumptions: (1) significant differences in the adult versus the developing nervous system susceptibility to neurotoxicity exist and they are often developmental stage dependent; (2) a multidisciplinary approach using neurobiological, including gene expression assays, neurophysiological, neuropathological, and behavioral function is necessary for a precise assessment of neurotoxicity. Application of genomic approaches to developmental studies must use the same criteria for evaluating microarray studies as those in adults including consideration of reproducibility, statistical analysis, homogenous cell populations, and confirmation with non-array methods. A study using amphetamine to induce neurotoxicity supports the following: (1) gene expression data can help define neurotoxic mechanism(s) (2) gene expression changes can be useful biomarkers of effect, and (3) the site-selective nature of gene expression in the nervous system may mandate assessment of selective cell populations
Hashida, Shin-Nosuke; Itami, Taketo; Takahara, Kentaro; Hirabayashi, Takayuki; Uchimiya, Hirofumi; Kawai-Yamada, Maki
2016-11-01
NAD is a well-known co-enzyme that mediates hundreds of redox reactions and is the basis of various processes regulating cell responses to different environmental and developmental cues. The regulatory mechanism that determines the amount of cellular NAD and the rate of NAD metabolism remains unclear. We created Arabidopsis thaliana plants overexpressing the NAD synthase (NADS) gene that participates in the final step of NAD biosynthesis. NADS overexpression enhanced the activity of NAD biosynthesis but not the amounts of NAD + , NADH, NADP + or NADPH. However, the amounts of some intermediates were elevated, suggesting that NAD metabolism increased. The NAD redox state was greatly facilitated by an imbalance between NAD generation and degradation in response to bolting. Metabolite profiling and transcriptional analysis revealed that the drastic modulation of NAD redox homeostasis increased tricarboxylic acid flux, causing the ectopic generation of reactive oxygen species. Vascular bundles suffered from oxidative stress, leading to a malfunction in amino acid and organic acid transportation that caused early wilting of the flower stalk and shortened plant longevity, probably due to malnutrition. We concluded that the mechanism regulating the balance between NAD synthesis and degradation is important in the systemic plant response to developmental cues during the growth-phase transition. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Dominique Haumont
2014-06-01
Full Text Available Perinatal mortality in very low birth weight infants has dramatically decreased during the last decades. However, 15-25% of these infants will show neurodevelopmental impairment later on. The aim of implementing early developmental care (EDC, emerged as a new field in neonatology, is to create an intervention program designed to provide support for optimal neurobehavioral development during this highly vulnerable period of brain growth. The theoretical framework, which underlies the approach, is supported by research in different scientific fields, including neuroscience, psychology, medicine and nursing. EDC utilizes a range of medical and nursing interventions that aim to decrease the stress of preterm neonates in neonatal intensive care units (NICUs. The Neonatal Individualized Developmental Care Assessment Program (NIDCAP is an integrated and holistic form of family-centered developmental care. Changing the traditional NICU towards an EDC-NICU includes training nursing and medical staff, investing in their quality and most importantly keeping parents in proximity to the infants. The new challenge of modern neonatology is to restore the mother-infant dyad applying “couplet care” starting at birth until discharge. Most of the European NICUs apply some elements of EDC, but it is more consistent in northern Europe. The development of NIDCAP training centers in Europe demonstrates the evolution of care. It is likely that future research and intervention programs will optimize our practices. Developmental care could prove to be an important recent step in improving outcome in extremely preterm neonates. Proceedings of the 10th International Workshop on Neonatology · Cagliari (Italy · October 22nd-25th, 2014 · The last ten years, the next ten years in Neonatology Guest Editors: Vassilios Fanos, Michele Mussap, Gavino Faa, Apostolos Papageorgiou
Reproductive and developmental toxicology
National Research Council Canada - National Science Library
Gupta, Ramesh C
2011-01-01
.... Reproductive and Developmental Toxicology is a comprehensive and authoritative resource providing the latest literature enriched with relevant references describing every aspect of this area of science...
Mitochondrial dysfunction in alveolar and white matter developmental failure in premature infants.
Ten, Vadim S
2017-02-01
At birth, some organs in premature infants are not developed enough to meet challenges of the extra-uterine life. Although growth and maturation continues after premature birth, postnatal organ development may become sluggish or even arrested, leading to organ dysfunction. There is no clear mechanistic concept of this postnatal organ developmental failure in premature neonates. This review introduces a concept-forming hypothesis: Mitochondrial bioenergetic dysfunction is a fundamental mechanism of organs maturation failure in premature infants. Data collected in support of this hypothesis are relevant to two major diseases of prematurity: white matter injury and broncho-pulmonary dysplasia. In these diseases, totally different clinical manifestations are defined by the same biological process, developmental failure of the main functional units-alveoli in the lungs and axonal myelination in the brain. Although molecular pathways regulating alveolar and white matter maturation differ, proper bioenergetic support of growth and maturation remains critical biological requirement for any actively developing organ. Literature analysis suggests that successful postnatal pulmonary and white matter development highly depends on mitochondrial function which can be inhibited by sublethal postnatal stress. In premature infants, sublethal stress results mostly in organ maturation failure without excessive cellular demise.
Psychological Resources of Adults with Developmental Dyslexia
Lockiewicz, Marta; Bogdanowicz, Katarzyna M.; Bogdanowicz, Marta
2014-01-01
The aim of our study was to describe specific psychological resources of adults with developmental dyslexia and compare them with psychological resources of adults without developmental dyslexia. Potential differences were analyzed in visual-spatial, creative, and motivational abilities. No evidence was found for either creative, or visuospatial…
Developmental patterns of adolescent spiritual health in six countries
Directory of Open Access Journals (Sweden)
Valerie Michaelson
2016-12-01
Full Text Available The spiritual health of adolescents is a topic of emerging contemporary importance. Limited numbers of international studies provide evidence about developmental patterns of this aspect of health during the adolescent years. Using multidimensional indicators of spiritual health that have been adapted for use within younger adolescent populations, we therefore: (1 describe aspects of the perceptions of the importance of spiritual health of adolescents by developmental stage and within genders; (2 conduct similar analyses across measures related to specific domains of adolescent spiritual health; (3 relate perceptions of spiritual health to self-perceived personal health status. Cross-sectional surveys were administered to adolescent populations in school settings during 2013–2014. Participants (n=45,967 included eligible and consenting students aged 11–15 years in sampled schools from six European and North American countries. Our primary measures of spiritual health consisted of eight questions in four domains (perceived importance of connections to: self, others, nature, and the transcendent. Socio-demographic factors included age, gender, and country of origin. Self-perceived personal health status was assessed using a simple composite measure. Self-rated importance of spiritual health, both overall and within most questions and domains, declined as young people aged. This declining pattern persisted for both genders and in all countries, and was most notable for the domains of “connections with nature” and “connections with the transcendent”. Girls consistently rated their perceptions of the importance of spiritual health higher than boys. Spiritual health and its domains related strongly and consistently with self-perceived personal health status. While limited by the 8-item measure of perceived spiritual health employed, study findings confirm developmental theories proposed from qualitative observation, provide foundational
Mirzaa, Ghayda M; Millen, Kathleen J; Barkovich, A James; Dobyns, William B; Paciorkowski, Alex R
2014-06-01
The number of single genes associated with neurodevelopmental disorders has increased dramatically over the past decade. The identification of causative genes for these disorders is important to clinical outcome as it allows for accurate assessment of prognosis, genetic counseling, delineation of natural history, inclusion in clinical trials, and in some cases determines therapy. Clinicians face the challenge of correctly identifying neurodevelopmental phenotypes, recognizing syndromes, and prioritizing the best candidate genes for testing. However, there is no central repository of definitions for many phenotypes, leading to errors of diagnosis. Additionally, there is no system of levels of evidence linking genes to phenotypes, making it difficult for clinicians to know which genes are most strongly associated with a given condition. We have developed the Developmental Brain Disorders Database (DBDB: https://www.dbdb.urmc.rochester.edu/home), a publicly available, online-curated repository of genes, phenotypes, and syndromes associated with neurodevelopmental disorders. DBDB contains the first referenced ontology of developmental brain phenotypes, and uses a novel system of levels of evidence for gene-phenotype associations. It is intended to assist clinicians in arriving at the correct diagnosis, select the most appropriate genetic test for that phenotype, and improve the care of patients with developmental brain disorders. For researchers interested in the discovery of novel genes for developmental brain disorders, DBDB provides a well-curated source of important genes against which research sequencing results can be compared. Finally, DBDB allows novel observations about the landscape of the neurogenetics knowledge base. © 2014 Wiley Periodicals, Inc.
Regulating Pornography: A Public Dilemma.
Thompson, Margaret E.; And Others
1990-01-01
Examines attitudes toward sex and pornography by means of a telephone survey of Dane County, Wisconsin, adults. Describes survey questions about sexual attitudes, perceived effects of pornography, and pornography regulation. Concludes that adults who feel more strongly that pornography has negative effects are more opposed to its regulation. (SG)
Choosing to regulate: does choice enhance craving regulation?
Mobasser, Arian; Zeithamova, Dagmar; Pfeifer, Jennifer H
2018-01-01
Abstract Goal-directed behavior and lifelong well-being often depend on the ability to control appetitive motivations, such as cravings. Cognitive reappraisal is an effective way to modulate emotional states, including cravings, but is often studied under explicit instruction to regulate. Despite the strong prediction from Self-Determination Theory that choice should enhance task engagement and regulation success, little is known empirically about whether and how regulation is different when participants choose (vs are told) to exert control. To investigate how choice affects neural activity and regulation success, participants reappraised their responses to images of personally-craved foods while undergoing functional neuroimaging. Participants were either instructed to view or reappraise (‘no-choice’) or chose freely to view or reappraise (‘yes-choice’). Choice increased activity in the frontoparietal control network. We expected this activity would be associated with increased task engagement, resulting in better regulation success. However, contrary to this prediction, choice slightly reduced regulation success. Follow-up multivariate functional neuroimaging analyses indicated that choice likely disrupted allocation of limited cognitive resources during reappraisal. While unexpected, these results highlight the importance of studying upstream processes such as regulation choice, as they may affect the ability to regulate cravings and other emotional states. PMID:29462475
Transferin concentration and location during formation of chick retina: developmental correlates
International Nuclear Information System (INIS)
Zeevalk, G.D.; Hyndman, A.G.
1988-01-01
The amount of transferrin in chick retina was measured during development and compared to transferrin location seen immunocytochemically. Between embryonic day 6 (E6), and 5 days post hatching, two periods occur in which transferrin concentrations rise sharply and decline. During the first, transferrin concentration rises 5-fold between E6 and 10, then rapidly declines by E14. A second increase begins on E17 and peaks by E19-20. Immunocytochemical findings demonstrate that during the first rise in concentration, transferrin is located primarily in neuritic layers. Later in development, when levels again increase, newly forming photoreceptor outer segments are strongly transferrin positive. These findings are discussed in light of developmental events occurring during retinal maturation (author)
Wen, Luan; Shibata, Yuki; Su, Dan; Fu, Liezhen; Luu, Nga; Shi, Yun-Bo
2017-06-01
Thyroid hormone (T3) receptors (TRs) mediate the effects of T3 on organ metabolism and animal development. There are two TR genes, TRα and TRβ, in all vertebrates. During animal development, TRα expression is activated earlier than zygotic T3 synthesis and secretion into the plasma, implicating a developmental role of TRα both in the presence and absence of T3. Using T3-dependent amphibian metamorphosis as a model, we previously proposed a dual-function model for TRs, in particular TRα, during development. That is, unliganded TR represses the expression of T3-inducible genes during premetamorphosis to ensure proper animal growth and prevent premature metamorphosis, whereas during metamorphosis, liganded TR activates target gene transcription to promote the transformation of the tadpole into a frog. To determine if TRα has such a dual function, we generated homozygous TRα-knockout animal lines. We show that, indeed, TRα knockout affects both premetamorphic animal development and metamorphosis. Surprisingly, we observed that TRα is not essential for amphibian metamorphosis, given that homozygous knockout animals complete metamorphosis within a similar time period after fertilization as their wild-type siblings. On the other hand, the timing of metamorphosis for different organs is altered by the knockout; limb metamorphosis occurs earlier, whereas intestinal metamorphosis is completed later than in wild-type siblings. Thus, our studies have demonstrated a critical role of endogenous TRα, not only in regulating both the timing and rate of metamorphosis, but also in coordinating temporal metamorphosis of different organs.
Early Childhood Profiles of Sleep Problems and Self-Regulation Predict Later School Adjustment
Williams, Kate E.; Nicholson, Jan M.; Walker, Sue; Berthelsen, Donna
2016-01-01
Background: Children's sleep problems and self-regulation problems have been independently associated with poorer adjustment to school, but there has been limited exploration of longitudinal early childhood profiles that include both indicators. Aims: This study explores the normative developmental pathway for sleep problems and self-regulation…
Developmental orthopaedic diseases in foals
International Nuclear Information System (INIS)
Şİrİn, Özlem; Alkan, Zeki
2010-01-01
Developmental Orthopaedic Diseases (DOD) is seen frequently in horses which completed their maturity. Osteochondrosis, physitis, angular limb deformities, flexural deformities, juvenil arthritis, cervical vertebral anomalies, cuboidal bone abnormalities are problems investigated under Developmental Orthopaedic Diseases title. This diseases can develop single or some together in fast growing, heavy animals (especially Arabian and English Thoroughbreds). Multifactorial causes of this diseases etiopathogenesis can be listed as genetic predisposition, trauma, nutrition, vitamins/minerals and endocrine disorders. But the exact causes of these diseases are not known. In this review detailed information are given about the diseases mentioned above
Delaying Developmental Mathematics: The Characteristics and Costs
Johnson, Marianne; Kuennen, Eric
2004-01-01
This paper investigates which students delay taking a required developmental mathematics course and the impact of delay on student performance in introductory microeconomics. Analysis of a sample of 1462 students at a large Midwestern university revealed that, although developmental-level mathematics students did not reach the same level of…
Essential Role of Culture in Developmental Psychology
Miller, Joan G.
2005-01-01
This chapter argues for the essential role of culture in forming the basic constructs and theories of developmental psychology. The case is made for the need to overcome the cultural insularity of core developmental concepts and methods in order to create a psychology that is more truly universal.
Ariel, Federico D.; Jé gu, Teddy; Latrasse, David; Romero-Barrios, Natali; Christ, Auré lie; Benhamed, Moussa; Crespi, Martí n D.
2014-01-01
The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.
Ariel, Federico D.
2014-08-01
The eukaryotic epigenome is shaped by the genome topology in three-dimensional space. Dynamic reversible variations in this epigenome structure directly influence the transcriptional responses to developmental cues. Here, we show that the Arabidopsis long intergenic noncoding RNA (lincRNA) APOLO is transcribed by RNA polymerases II and V in response to auxin, a phytohormone controlling numerous facets of plant development. This dual APOLO transcription regulates the formation of a chromatin loop encompassing the promoter of its neighboring gene PID, a key regulator of polar auxin transport. Altering APOLO expression affects chromatin loop formation, whereas RNA-dependent DNA methylation, active DNA demethylation, and Polycomb complexes control loop dynamics. This dynamic chromatin topology determines PID expression patterns. Hence, the dual transcription of a lincRNA influences local chromatin topology and directs dynamic auxin-controlled developmental outputs on neighboring genes. This mechanism likely underscores the adaptive success of plants in diverse environments and may be widespread in eukaryotes. © 2014 Elsevier Inc.
A developmental timing switch promotes axon outgrowth independent of known guidance receptors.
Directory of Open Access Journals (Sweden)
Katherine Olsson-Carter
2010-08-01
Full Text Available To form functional neuronal connections, axon outgrowth and guidance must be tightly regulated across space as well as time. While a number of genes and pathways have been shown to control spatial features of axon development, very little is known about the in vivo mechanisms that direct the timing of axon initiation and elongation. The Caenorhabditis elegans hermaphrodite specific motor neurons (HSNs extend a single axon ventrally and then anteriorly during the L4 larval stage. Here we show the lin-4 microRNA promotes HSN axon initiation after cell cycle withdrawal. Axons fail to form in lin-4 mutants, while they grow prematurely in lin-4-overexpressing animals. lin-4 is required to down-regulate two inhibitors of HSN differentiation--the transcriptional regulator LIN-14 and the "stemness" factor LIN-28--and it likely does so through a cell-autonomous mechanism. This developmental switch depends neither on the UNC-40/DCC and SAX-3/Robo receptors nor on the direction of axon growth, demonstrating that it acts independently of ventral guidance signals to control the timing of HSN axon elongation.
Jakobsson, Lars; van Meeteren, Laurens A
2013-05-15
Blood vessels are composed of endothelial cells, mural cells (smooth muscle cells and pericytes) and their shared basement membrane. During embryonic development a multitude of signaling components orchestrate the formation of new vessels. The process is highly dependent on correct dosage, spacing and timing of these signaling molecules. As vessels mature some cascades remain active, albeit at very low levels, and may be reactivated upon demand. Members of the Transforming growth factor β (TGF-β) protein family are strongly engaged in developmental angiogenesis but are also regulators of vascular integrity in the adult. In humans various genetic alterations within this protein family cause vascular disorders, involving disintegration of vascular integrity. Here we summarize and discuss recent data gathered from conditional and endothelial cell specific genetic loss-of-function of members of the TGF-β family in the mouse. Copyright © 2013 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Shuhua Zhan
Full Text Available microRNAs (miRNAs are small, endogenous RNAs of 20 approximately 25 nucleotides, processed from stem-loop regions of longer RNA precursors. Plant miRNAs act as negative regulators of target mRNAs predominately by slicing target transcripts, and a number of miRNAs play important roles in development. We analyzed a number of published datasets from Arabidopsis thaliana to characterize novel miRNAs, novel miRNA targets, and miRNA-regulated developmental changes in gene expression. These data include microarray profiling data and small RNA (sRNA deep sequencing data derived from miRNA biogenesis/transport mutants, microarray profiling data of mRNAs in a developmental series, and computational predictions of conserved genomic stem-loop structures. Our conservative analyses identified five novel mature miRNAs and seven miRNA targets, including one novel target gene. Two complementary miRNAs that target distinct mRNAs were encoded by one gene. We found that genes targeted by known miRNAs, and genes up-regulated or down-regulated in miRNA mutant inflorescences, are highly expressed in the wild type inflorescence. In addition, transcripts upregulated within the mutant inflorescences were abundant in wild type leaves and shoot meristems and low in pollen and seed. Downregulated transcripts were abundant in wild type pollen and seed and low in shoot meristems, roots and leaves. Thus, disrupting miRNA function causes the inflorescence transcriptome to resemble the leaf and meristem and to differ from pollen and seed. Applications of our computational approach to other species and the use of more liberal criteria than reported here will further expand the number of identified miRNAs and miRNA targets. Our findings suggest that miRNAs have a global role in promoting vegetative to reproductive transitions in A. thaliana.
International Nuclear Information System (INIS)
Dartel, Dorien A.M. van; Pennings, Jeroen L.A.; Schooten, Frederik J. van; Piersma, Aldert H.
2010-01-01
The embryonic stem cell test (EST) predicts developmental toxicity based on the inhibition of cardiomyocyte differentiation of embryonic stem cells (ESC). The subjective endpoint, the long culture duration together with the undefined applicability domain and related predictivity need further improvement to facilitate implementation of the EST into regulatory strategies. These aspects may be improved by studying gene expression changes in the ESC differentiation cultures and their modulation by compound exposure using transcriptomics. Here, we tested the developmental toxicants monobutyl phthalate and 6-aminonicotinamide. ESC were allowed to differentiated, and cardiomyocyte differentiation was assessed after 10 days of culture. RNA of solvent controls was collected after 0, 24, 48, 72 and 96 h of exposure, and RNA of developmental-toxicant-exposed cultures was collected after 24 and 96 h. Samples were hybridized to DNA microarrays, and 1355 genes were found differentially expressed among the unexposed experimental groups. These regulated genes were involved in differentiation-related processes, and Principal Component Analysis (PCA) based on these genes showed that the unexposed experimental groups appeared in chronological order in the PCA, which can therefore be regarded as a continuous representation of the differentiation track. The developmental-toxicant-exposed cultures appeared to deviate significantly from this differentiation track, which confirms the compound-modulating effects on the differentiation process. The incorporation of transcriptomics in the EST is expected to provide a more informative and improved endpoint in the EST as compared with morphology, allowing early detection of differentiation modulation. Furthermore, this approach may improve the definition of the applicability domain and predictivity of the EST.
Puskarjov, Martin; Fiumelli, Hubert; Briner, Adrian; Bodogan, Timea; Demeter, Kornel; Lacoh, Claudia-Marvine; Mavrovic, Martina; Blaesse, Peter; Kaila, Kai; Vutskits, Laszlo
2017-05-01
General anesthetics potentiating γ-aminobutyric acid (GABA)-mediated signaling are known to induce a persistent decrement in excitatory synapse number in the cerebral cortex when applied during early postnatal development, while an opposite action is produced at later stages. Here, the authors test the hypothesis that the effect of general anesthetics on synaptogenesis depends upon the efficacy of GABA receptor type A (GABAA)-mediated inhibition controlled by the developmental up-regulation of the potassium-chloride (K-Cl) cotransporter 2 (KCC2). In utero electroporation of KCC2 was used to prematurely increase the efficacy of (GABAA)-mediated inhibition in layer 2/3 pyramidal neurons in the immature rat somatosensory cortex. Parallel experiments with expression of the inward-rectifier potassium channel Kir2.1 were done to reduce intrinsic neuronal excitability. The effects of these genetic manipulations (n = 3 to 4 animals per experimental group) were evaluated using iontophoretic injection of Lucifer Yellow (n = 8 to 12 cells per animal). The total number of spines analyzed per group ranged between 907 and 3,371. The authors found a robust effect of the developmental up-regulation of KCC2-mediated Cl transport on the age-dependent action of propofol on dendritic spines. Premature expression of KCC2, unlike expression of a transport-inactive KCC2 variant, prevented a propofol-induced decrease in spine density. In line with a reduction in neuronal excitability, the above result was qualitatively replicated by overexpression of Kir2.1. The KCC2-dependent developmental increase in the efficacy of GABAA-mediated inhibition is a major determinant of the age-dependent actions of propofol on dendritic spinogenesis.
International Nuclear Information System (INIS)
Hill, E.J.; Woehrling, E.K.; Prince, M.; Coleman, M.D.
2008-01-01
Developmental neurotoxicity is a major issue in human health and may have lasting neurological implications. In this preliminary study we exposed differentiating Ntera2/clone D1 (NT2/D1) cell neurospheres to known human teratogens classed as non-embryotoxic (acrylamide), weakly embryotoxic (lithium, valproic acid) and strongly embryotoxic (hydroxyurea) as listed by European Centre for the Validation of Alternative Methods (ECVAM) and examined endpoints of cell viability and neuronal protein marker expression specific to the central nervous system, to identify developmental neurotoxins. Following induction of neuronal differentiation, valproic acid had the most significant effect on neurogenesis, in terms of reduced viability and decreased neuronal markers. Lithium had least effect on viability and did not significantly alter the expression of neuronal markers. Hydroxyurea significantly reduced cell viability but did not affect neuronal protein marker expression. Acrylamide reduced neurosphere viability but did not affect neuronal protein marker expression. Overall, this NT2/D1-based neurosphere model of neurogenesis, may provide the basis for a model of developmental neurotoxicity in vitro
[Regulation of terpene metabolism]. Annual progress report, March 15, 1990--March 14, 1991
Energy Technology Data Exchange (ETDEWEB)
Croteau, R.
1991-12-31
During the last grant period, we have completed studies on the key pathways of monoterpene biosynthesis and catabolism in sage and peppermint, and have, by several lines of evidence, deciphered the rate-limiting step of each pathway. We have at least partially purified and characterized the relevant enzymes of each pathway. We have made a strong case, based on analytical, in vivo, and in vitro studies, that terpene accumulation depends upon the balance between biosynthesis and catabolism, and provided supporting evidence that these processes are developmentally-regulated and very closely associated with senescence of the oil glands. Oil gland ontogeny has been characterized at the ultrastructural level. We have exploited foliar-applied bioregulators to delay gland senescence, and have developed tissue explant and cell culture systems to study several elusive aspects of catabolism. We have isolated pure gland cell clusters and localized monoterpene biosynthesis and catabolism within these structures, and have used these preparations as starting materials for the purification to homogeneity of target ``regulatory`` enzymes. We have thus developed the necessary background knowledge, based on a firm understanding of enzymology, as well as the necessary experimental tools for studying the regulation of monoterpene metabolism at the molecular level. Furthermore, we are now in a position to extend our systematic approach to other terpenoid classes (C{sub 15}-C{sub 30}) produced by oil glands.
A developmental perspective on early-life exposure to neurotoxicants.
Bellinger, David C; Matthews-Bellinger, Julia A; Kordas, Katarzyna
2016-09-01
Studies of early-life neurotoxicant exposure have not been designed, analyzed, or interpreted in the context of a fully developmental perspective. The goal of this paper is to describe the key principles of a developmental perspective and to use examples from the literature to illustrate the relevance of these principles to early-life neurotoxicant exposures. Four principles are discussed: 1) the effects of early-life neurotoxicant exposure depend on a child's developmental context; 2) deficits caused by early-life exposure initiate developmental cascades that can lead to pathologies that differ from those observed initially; 3) early-life neurotoxicant exposure has intra-familial and intergenerational impacts; 4) the impacts of early-life neurotoxicant exposure influence a child's ability to respond to future insults. The first principle is supported by considerable evidence, but the other three have received much less attention. Incorporating a developmental perspective in studies of early-life neurotoxicant exposures requires prospective collection of data on a larger array of covariates than usually considered, using analytical approaches that acknowledge the transactional processes between a child and the environment and the phenomenon of developmental cascades. Consideration of early-life neurotoxicant exposure within a developmental perspective reveals that many issues remain to be explicated if we are to achieve a deep understanding of the societal health burden associated with early-life neurotoxicant exposures. Copyright © 2016 Elsevier Ltd. All rights reserved.
Regulation of plant cells, cell walls and development by mechanical signals
Energy Technology Data Exchange (ETDEWEB)
Meyerowitz, Elliot M. [California Inst. of Technology (CalTech), Pasadena, CA (United States)
2016-06-14
The overall goal of the revised scope of work for the final year of funding was to characterize cell wall biosynthesis in developing cotyledons and in the shoot apical meristem of Arabidopsis thaliana, as a way of learning about developmental control of cell wall biosynthesis in plants, and interactions between cell wall biosynthesis and the microtubule cytoskeleton. The proposed work had two parts – to look at the effect of mutation in the SPIRAL2 gene on microtubule organization and reorganization, and to thoroughly characterize the glycosyltransferase genes expressed in shoot apical meristems by RNA-seq experiments, by in situ hybridization of the RNAs expressed in the meristem, and by antibody staining of the products of the glycosyltransferases in meristems. Both parts were completed; the spiral2 mutant was found to speed microtubule reorientation after ablation of adjacent cells, supporting our hypothesis that reorganization correlates with microtubule severing, the rate of which is increased by the mutation. The glycosyltransferase characterization was completed and published as Yang et al. (2016). Among the new things learned was that primary cell wall biosynthesis is strongly controlled both by cell type, and by stage of cell cycle, implying not only that different, even adjacent, cells can have different sugar linkages in their (nonshared) walls, but also that a surprisingly large proportion of glycosyltransferases is regulated in the cell cycle, and therefore that the cell cycle regulates wall maturation to a degree previously unrecognized.
Regulation of Floral Stem Cell Termination in Arabidopsis
Directory of Open Access Journals (Sweden)
Toshiro eIto
2015-02-01
Full Text Available In Arabidopsis, floral stem cells are maintained only at the initial stages of flower development, and they are terminated at a specific time to ensure proper development of the reproductive organs. Floral stem cell termination is a dynamic and multi-step process involving many transcription factors, chromatin remodeling factors and signaling pathways. In this review, we discuss the mechanisms involved in floral stem cell maintenance and termination, highlighting the interplay between transcriptional regulation and epigenetic machinery in the control of specific floral developmental genes. In addition, we discuss additional factors involved in floral stem cell regulation, with the goal of untangling the complexity of the floral stem cell regulatory network.
Directory of Open Access Journals (Sweden)
Elvis Genbo Xu
Full Text Available Mahi-mahi (Coryphaena hippurus is a commercially and ecologically important species of fish occurring in tropical and temperate waters worldwide. Understanding early life events is crucial for predicting effects of environmental stress, which is largely restricted by a lack of genetic resources regarding expression of early developmental genes and regulation of pathways. The need for anchoring developmental stages to transcriptional activities is highlighted by increasing evidence on the impacts of recurrent worldwide oil spills in this sensitive species during early development. By means of high throughput sequencing, we characterized the developmental transcriptome of mahi-mahi at three critical developmental stages, from pharyngula embryonic stage (24 hpf to 48 hpf yolk-sac larva (transition 1, and to 96 hpf free-swimming larva (transition 2. With comparative analysis by multiple bioinformatic tools, a larger number of significantly altered genes and more diverse gene ontology terms were observed during transition 2 than transition 1. Cellular and tissue development terms were more significantly enriched in transition 1, while metabolism related terms were more enriched in transition 2, indicating a switch progressing from general embryonic development to metabolism during the two transitions. Special focus was given on the most significant common canonical pathways (e.g. calcium signaling, glutamate receptor signaling, cAMP response element-binding protein signaling, cardiac β-adrenergic signaling, etc. and expression of developmental genes (e.g. collagens, myosin, notch, glutamate metabotropic receptor etc., which were associated with morphological changes of nervous, muscular, and cardiovascular system. These data will provide an important basis for understanding embryonic development and identifying molecular mechanisms of abnormal development in fish species.
Giron, D.; Frago, E.; Glevarec, G.; Pieterse, C.M.J.; Dicke, M.
2013-01-01
1. Plant hormones play important roles in regulating plant growth and defence by mediating developmental processes and signalling networks involved in plant responses to a wide range of parasitic and mutualistic biotic interactions. 2. Plants are known to rapidly respond to pathogen and herbivore
Transcription regulation by the Mediator complex.
Soutourina, Julie
2018-04-01
Alterations in the regulation of gene expression are frequently associated with developmental diseases or cancer. Transcription activation is a key phenomenon in the regulation of gene expression. In all eukaryotes, mediator of RNA polymerase II transcription (Mediator), a large complex with modular organization, is generally required for transcription by RNA polymerase II, and it regulates various steps of this process. The main function of Mediator is to transduce signals from the transcription activators bound to enhancer regions to the transcription machinery, which is assembled at promoters as the preinitiation complex (PIC) to control transcription initiation. Recent functional studies of Mediator with the use of structural biology approaches and functional genomics have revealed new insights into Mediator activity and its regulation during transcription initiation, including how Mediator is recruited to transcription regulatory regions and how it interacts and cooperates with PIC components to assist in PIC assembly. Novel roles of Mediator in the control of gene expression have also been revealed by showing its connection to the nuclear pore and linking Mediator to the regulation of gene positioning in the nuclear space. Clear links between Mediator subunits and disease have also encouraged studies to explore targeting of this complex as a potential therapeutic approach in cancer and fungal infections.
Lyons, Kristen E; Zelazo, Philip David
2011-01-01
While an abundance of research has investigated the development of the automatic and controlled processes through which individuals control their thoughts, emotions, and actions, less research has emphasized the role of the self in self-regulation. This chapter synthesizes four literatures that have examined the mechanisms through which the individual acts in a managerial role, evaluating the current status of the system and initiating regulatory actions as necessary. Taken together, these literatures (on executive function, error monitoring, metacognition, and uncertainty monitoring) suggest that self-reflection plays a critical role in self-regulation, and that developmental improvements in self-reflection (via increasing levels of conscious awareness and enhanced calibration of monitoring systems) may serve as driving forces underlying developmental improvement (and temperamental individual differences) in children's ability to control their thoughts and actions.
International Nuclear Information System (INIS)
Meza, Mercedes; Gandolfi, A. Jay; Klimecki, Walter T.
2007-01-01
The complexity of arsenic toxicology has confounded the identification of specific pathways of disease causation. One focal point of arsenic research is aimed at fully characterizing arsenic biotransformation in humans, a process that appears to be quite variable, producing a mixture of several arsenic species with greatly differing toxic potencies. In an effort to characterize genetic determinants of variability in arsenic biotransformation, a genetic association study of 135 subjects in western Sonora, Mexico was performed by testing 23 polymorphic sites in three arsenic biotransformation candidate genes. One gene, arsenic 3 methyltransferase (AS3MT), was strongly associated with the ratio of urinary dimethylarsinic acid to monomethylarsonic acid (D/M) in children (7-11 years) but not in adults (18-79 years). Subsequent analyses revealed that the high D/M values associated with variant AS3MT alleles were primarily due to lower levels of monomethylarsonic acid as percent of total urinary arsenic (%MMA5). In light of several reports of arsenic-induced disease being associated with relatively high %MMA5 levels, these findings raise the possibility that variant AS3MT individuals may suffer less risk from arsenic exposure than non-variant individuals. These analyses also provide evidence that, in this population, regardless of AS3MT variant status, children tend to have lower %MMA5 values than adults, suggesting that the global developmental regulation of arsenic biotransformation may interact with genetic variants in metabolic genes to result in novel genetic effects such as those in this report
45 CFR 1385.4 - Rights of individuals with developmental disabilities.
2010-10-01
... university affiliated programs or for projects of national significance grants must also contain an assurance... DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM REQUIREMENTS APPLICABLE TO THE DEVELOPMENTAL DISABILITIES PROGRAM § 1385.4 Rights of individuals with developmental disabilities. (a) Section 110 of the Act, Rights...
Identifying support functions in developmental relationships: A self-determination perspective
Janssen, Suzanne; van Vuuren, Hubrecht A.; de Jong, Menno D.T.
2013-01-01
This study examines the content of developmental networks from the perspective of self-determination theory. We qualitatively examine 18 protégés' constellations of developmental relationships to identify specific types of developmental support functions. Our study shows that the adoption of
Directory of Open Access Journals (Sweden)
Mengmeng Xu
Full Text Available Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins and molecular functions (enzyme regulator activity. We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be
Xu, Mengmeng; Che, Long; Wang, Dingyue; Yang, Zhenguo; Zhang, Pan; Lin, Yan; Fang, Zhengfeng; Che, Lianqiang; Li, Jian; Chen, Daiwen; Wu, De; Xu, Shengyu
2015-01-01
Time-dependent expression of functional proteins in fetal ovaries is important to understand the developmental process of the ovary. This study was carried out to enhance our understanding of the developmental process of porcine fetal ovaries and to better address the differences in fetal ovary development of local and foreign pigs. The objective of the present study is to test the expression of key proteins that regulate the growth and development of fetal ovaries in Meishan and Yorkshire porcine breeds by using proteomics technology. Six Meishan and 6 Yorkshire pregnant gilts were used in this experiment. Fetal ovaries were obtained from Yorkshire and Meishan gilts on days 55 and 90 of the gestation period. Using 2D-DIGE (two dimensional-difference in gel electrophoresis) analysis, the results showed that there are about 1551 and 1400 proteins in gilt fetal ovaries on days 55 and 90, respectively of the gestation. Using MALDI TOF-TOF MS analysis, 27 differentially expressed proteins were identified in the fetal ovaries of the 2 breeds on day 55 of gestation, and a total of 18 proteins were identified on day 90 of gestation. These differentially expressed proteins were involved in the regulation of biological processes (cell death, stress response, cytoskeletal proteins) and molecular functions (enzyme regulator activity). We also found that alpha-1-antitrypsin, actin, vimentin, and PP2A proteins promote the formation of primordial follicles in the ovaries of Yorkshire pigs on day 55 of gestation while low expression heat shock proteins and high expression alpha-fetoproteins (AFP) may promote Meishan fetal ovarian follicular development on day 90 of gestation. These findings provide a deeper understanding of how reduced expression of heat shock proteins and increased expression of AFP can significantly reduce the risk of reproductive disease in obese Meishan sows. Our study also shows how these proteins can increase the ovulation rate and may be responsible for
International Nuclear Information System (INIS)
Aluru, Neelakanteswar; Kuo, Elaine; Helfrich, Lily W.; Karchner, Sibel I.; Linney, Elwood A.; Pais, June E.; Franks, Diana G.
2015-01-01
DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt
Energy Technology Data Exchange (ETDEWEB)
Aluru, Neelakanteswar, E-mail: naluru@whoi.edu [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Kuo, Elaine [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Stanford University, 450 Serra Mall, Stanford, CA 94305 (United States); Helfrich, Lily W. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Northwestern University, 633 Clark St, Evanston, IL 60208 (United States); Karchner, Sibel I. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States); Linney, Elwood A. [Department of Molecular Genetics and Microbiology, Duke University Medical Center, Box 3020, Durham, NC 27710 (United States); Pais, June E. [New England Biolabs, 240 County Road, Ipswich, MA 01938 (United States); Franks, Diana G. [Biology Department and Woods Hole Center for Oceans and Human Health, Woods Hole Oceanographic Institution, Woods Hole, MA 02543 (United States)
2015-04-15
DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNA methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt
Toddler Developmental Delays After Extensive Hospitalization: Primary Care Practitioner Guidelines.
Lehner, Dana C; Sadler, Lois S
2015-01-01
This review investigated developmental delays toddlers may encounter after a lengthy pediatric hospitalization (30 days or greater). Physical, motor, cognitive, and psychosocial development of children aged 1 to 3 years was reviewed to raise awareness of factors associated with developmental delay after extensive hospitalization. Findings from the literature suggest that neonatal and pediatric intensive care unit (NICU/PICU) graduates are most at risk for developmental delays, but even non-critical hospital stays interrupt development to some extent. Primary care practitioners (PCPs) may be able to minimize risk for delays through the use of formal developmental screening tests and parent report surveys. References and resources are described for developmental assessment to help clinicians recognize delays and to educate families about optimal toddler development interventions. Pediatric PCPs play a leading role in coordinating health and developmental services for the young child following an extensive hospital stay.
Kishi, Shuji
2014-01-01
hand, unexpected senescence-related genes might also be involved in the early developmental process and its regulation. The ease of manipulation using the zebrafish system allows us to conduct an exhaustive exploration of novel genes/genotypes and epigenotype that can be linked to the senescence phenotype, and thereby facilitates searching for the evolutionary and developmental origins of aging in vertebrates. PMID:24239812
Convergent occurrence of the developmental hourglass in plant and animal embryogenesis?
Cridge, Andrew G; Dearden, Peter K; Brownfield, Lynette R
2016-04-01
The remarkable similarity of animal embryos at particular stages of development led to the proposal of a developmental hourglass. In this model, early events in development are less conserved across species but lead to a highly conserved 'phylotypic period'. Beyond this stage, the model suggests that development once again becomes less conserved, leading to the diversity of forms. Recent comparative studies of gene expression in animal groups have provided strong support for the hourglass model. How and why might such an hourglass pattern be generated? More importantly, how might early acting events in development evolve while still maintaining a later conserved stage? The discovery that an hourglass pattern may also exist in the embryogenesis of plants provides comparative data that may help us explain this phenomenon. Whether the developmental hourglass occurs in plants, and what this means for our understanding of embryogenesis in plants and animals is discussed. Models by which conserved early-acting genes might change their functional role in the evolution of gene networks, how networks buffer these changes, and how that might constrain, or confer diversity, of the body plan are also discused. Evidence of a morphological and molecular hourglass in plant and animal embryogenesis suggests convergent evolution. This convergence is likely due to developmental constraints imposed upon embryogenesis by the need to produce a viable embryo with an established body plan, controlled by the architecture of the underlying gene regulatory networks. As the body plan is largely laid down during the middle phases of embryo development in plants and animals, then it is perhaps not surprising this stage represents the narrow waist of the hourglass where the gene regulatory networks are the oldest and most robust and integrated, limiting species diversity and constraining morphological space. © The Author 2016. Published by Oxford University Press on behalf of the Annals of
Energy Technology Data Exchange (ETDEWEB)
Huang, Hegui; He, Zheng; Zhu, Chunyan; Liu, Lian; Kou, Hao; Shen, Lang [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Wang, Hui, E-mail: wanghui19@whu.edu.cn [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Disorder, Wuhan 430071 (China)
2015-10-01
Fetal adrenal developmental status is the major determinant of fetal tissue maturation and offspring growth. We have previously proposed that prenatal ethanol exposure (PEE) suppresses fetal adrenal corticosterone (CORT) synthesis. Here, we focused on PEE-induced adrenal developmental abnormalities of male offspring rats before and after birth, and aimed to explore its intrauterine programming mechanisms. A rat model of intrauterine growth retardation (IUGR) was established by PEE (4 g/kg·d). In PEE fetus, increased serum CORT concentration and decreased insulin-like growth factor 1 (IGF1) concentration, with lower bodyweight and structural abnormalities as well as a decreased Ki67 expression (proliferative marker), were observed in the male fetal adrenal cortex. Adrenal glucocorticoid (GC)-metabolic activation system was enhanced while gene expression of IGF1 signaling pathway with steroidogenic acute regulatory protein (StAR), 3β-hydroxysteroid dehydrogenase (3β-HSD) was decreased. Furthermore, in the male adult offspring of PEE, serum CORT level was decreased but IGF1 was increased with partial catch-up growth, and Ki67 expression demonstrated no obvious change. Adrenal GC-metabolic activation system was inhibited, while IGF1 signaling pathway and 3β-HSD was enhanced with the steroidogenic factor 1 (SF1), and StAR was down-regulated in the adult adrenal. Based on these findings, we propose a “two-programming” mechanism for PEE-induced adrenal developmental toxicity: “the first programming” is a lower functional programming of adrenal steroidogenesis, and “the second programming” is GC-metabolic activation system-related GC-IGF1 axis programming. - Highlights: • Prenatal ethanol exposure induces adrenal developmental abnormality in offspring rats. • Prenatal ethanol exposure induces intrauterine programming of adrenal steroidogenesis. • Intrauterine GC-IGF1 axis programming might mediate adrenal developmental abnormality.
International Nuclear Information System (INIS)
Huang, Hegui; He, Zheng; Zhu, Chunyan; Liu, Lian; Kou, Hao; Shen, Lang; Wang, Hui
2015-01-01
Fetal adrenal developmental status is the major determinant of fetal tissue maturation and offspring growth. We have previously proposed that prenatal ethanol exposure (PEE) suppresses fetal adrenal corticosterone (CORT) synthesis. Here, we focused on PEE-induced adrenal developmental abnormalities of male offspring rats before and after birth, and aimed to explore its intrauterine programming mechanisms. A rat model of intrauterine growth retardation (IUGR) was established by PEE (4 g/kg·d). In PEE fetus, increased serum CORT concentration and decreased insulin-like growth factor 1 (IGF1) concentration, with lower bodyweight and structural abnormalities as well as a decreased Ki67 expression (proliferative marker), were observed in the male fetal adrenal cortex. Adrenal glucocorticoid (GC)-metabolic activation system was enhanced while gene expression of IGF1 signaling pathway with steroidogenic acute regulatory protein (StAR), 3β-hydroxysteroid dehydrogenase (3β-HSD) was decreased. Furthermore, in the male adult offspring of PEE, serum CORT level was decreased but IGF1 was increased with partial catch-up growth, and Ki67 expression demonstrated no obvious change. Adrenal GC-metabolic activation system was inhibited, while IGF1 signaling pathway and 3β-HSD was enhanced with the steroidogenic factor 1 (SF1), and StAR was down-regulated in the adult adrenal. Based on these findings, we propose a “two-programming” mechanism for PEE-induced adrenal developmental toxicity: “the first programming” is a lower functional programming of adrenal steroidogenesis, and “the second programming” is GC-metabolic activation system-related GC-IGF1 axis programming. - Highlights: • Prenatal ethanol exposure induces adrenal developmental abnormality in offspring rats. • Prenatal ethanol exposure induces intrauterine programming of adrenal steroidogenesis. • Intrauterine GC-IGF1 axis programming might mediate adrenal developmental abnormality.
Bulimia: A Self-Psychological and Ego-Developmental View.
Brenner-Liss, Deborah
1986-01-01
Discusses key clinical issues in the treatment of bulimia with clinical examples from a self-psychological and ego-developmental point of view. Identifies three developmental issues for bulimia: self-regulatory, differentiation, and self-esteem. (Author/ABB)
Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)
Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping
2014-05-01
Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.
Directory of Open Access Journals (Sweden)
Katarzyna eGogol
2016-03-01
Full Text Available The present study investigated the developmental dynamics of general and subject-specific (i.e., mathematics, French, and German components of students’ academic self-concept, anxiety, and interest. To this end, the authors integrated three lines of research: (a hierarchical and multidimensional approaches to the conceptualization of each construct, (b longitudinal analyses of bottom-up and top-down developmental processes across hierarchical levels, and (c ipsative developmental processes across subjects. The data stemmed from two longitudinal large-scale samples (N = 3,498 and N = 3,863 of students attending Grades 7 and 9 in Luxembourgish schools. Nested-factor models were applied to represent each construct at each grade level. The analyses demonstrated that several characteristics were shared across constructs. All constructs were multidimensional in nature with respect to the different subjects, showed a hierarchical organization with a general component at the apex of the hierarchy, and had a strong separation between the subject-specific components at both grade levels. Further, all constructs showed moderate differential stabilities at both the general (.42 < r < .55 and subject-specific levels (.45 < r < .73. Further, little evidence was found for top-down or bottom-up developmental processes. Rather, general and subject-specific components in Grade 9 proved to be primarily a function of the corresponding components in Grade 7. Finally, change in several subject-specific components could be explained by negative, ipsative effects across subjects.
Gogol, Katarzyna; Brunner, Martin; Preckel, Franzis; Goetz, Thomas; Martin, Romain
2016-01-01
The present study investigated the developmental dynamics of general and subject-specific (i.e., mathematics, French, and German) components of students' academic self-concept, anxiety, and interest. To this end, the authors integrated three lines of research: (a) hierarchical and multidimensional approaches to the conceptualization of each construct, (b) longitudinal analyses of bottom-up and top-down developmental processes across hierarchical levels, and (c) developmental processes across subjects. The data stemmed from two longitudinal large-scale samples (N = 3498 and N = 3863) of students attending Grades 7 and 9 in Luxembourgish schools. Nested-factor models were applied to represent each construct at each grade level. The analyses demonstrated that several characteristics were shared across constructs. All constructs were multidimensional in nature with respect to the different subjects, showed a hierarchical organization with a general component at the apex of the hierarchy, and had a strong separation between the subject-specific components at both grade levels. Further, all constructs showed moderate differential stabilities at both the general (0.42 < r < 0.55) and subject-specific levels (0.45 < r < 0.73). Further, little evidence was found for top-down or bottom-up developmental processes. Rather, general and subject-specific components in Grade 9 proved to be primarily a function of the corresponding components in Grade 7. Finally, change in several subject-specific components could be explained by negative effects across subjects. PMID:27014162
Developmental disorders: what can be learned from cognitive neuropsychology?
Castles, Anne; Kohnen, Saskia; Nickels, Lyndsey; Brock, Jon
2014-01-01
The discipline of cognitive neuropsychology has been important for informing theories of cognition and describing the nature of acquired cognitive disorders, but its applicability in a developmental context has been questioned. Here, we revisit this issue, asking whether the cognitive neuropsychological approach can be helpful for exploring the nature and causes of developmental disorders and, if so, how. We outline the key features of the cognitive neuropsychological approach, and then consider how some of the major challenges to this approach from a developmental perspective might be met. In doing so, we distinguish between challenges to the methods of cognitive neuropsychology and those facing its deeper conceptual underpinnings. We conclude that the detailed investigation of patterns of both associations and dissociations, and across both developmental and acquired cases, can assist in describing the cognitive deficits within developmental disorders and in delineating possible causal pathways to their acquisition.
Physiological correlates of emotional reactivity and regulation in early adolescents.
Latham, Melissa D; Cook, Nina; Simmons, Julian G; Byrne, Michelle L; Kettle, Jonathan W L; Schwartz, Orli; Vijayakumar, Nandita; Whittle, Sarah; Allen, Nicholas B
2017-07-01
Few studies have examined physiological correlates of emotional reactivity and regulation in adolescents, despite the occurrence in this group of significant developmental changes in emotional functioning. The current study employed multiple physiological measures (i.e., startle-elicited eyeblink and ERP, skin conductance, facial EMG) to assess the emotional reactivity and regulation of 113 early adolescents in response to valenced images. Reactivity was measured while participants viewed images, and regulation was measured when they were asked to discontinue or maintain their emotional reactions to the images. Adolescent participants did not exhibit fear-potentiated startle blink. However, they did display affect-consistent zygomatic and corrugator activity during reactivity, as well as inhibition of some of these facial patterns during regulation. Skin conductance demonstrated arousal dependent activity during reactivity, and overall decreases during regulation. These findings suggest that early adolescents display reactivity to valenced pictures, but not to startle probes. Psychophysiological patterns during emotion regulation indicate additional effort and/or attention during the regulation process. Copyright © 2017 Elsevier B.V. All rights reserved.
Giletta, M.; Hastings, Paul D.; Rudolph, Karen D.; Bauer, Daniel J.; Nock, Matthew K.; Prinstein, Mitchell J.
2017-01-01
Poor physiological self-regulation has been proposed as a potential biological vulnerability for adolescent suicidality. This study tested this hypothesis by examining the effect of parasympathetic stress responses on future suicide ideation. In addition, drawing from multilevel developmental
Normal composite face effects in developmental prosopagnosia.
Biotti, Federica; Wu, Esther; Yang, Hua; Jiahui, Guo; Duchaine, Bradley; Cook, Richard
2017-10-01
Upright face perception is thought to involve holistic processing, whereby local features are integrated into a unified whole. Consistent with this view, the top half of one face appears to fuse perceptually with the bottom half of another, when aligned spatially and presented upright. This 'composite face effect' reveals a tendency to integrate information from disparate regions when faces are presented canonically. In recent years, the relationship between susceptibility to the composite effect and face recognition ability has received extensive attention both in participants with normal face recognition and participants with developmental prosopagnosia. Previous results suggest that individuals with developmental prosopagnosia may show reduced susceptibility to the effect suggestive of diminished holistic face processing. Here we describe two studies that examine whether developmental prosopagnosia is associated with reduced composite face effects. Despite using independent samples of developmental prosopagnosics and different composite procedures, we find no evidence for reduced composite face effects. The experiments yielded similar results; highly significant composite effects in both prosopagnosic groups that were similar in magnitude to the effects found in participants with normal face processing. The composite face effects exhibited by both samples and the controls were greatly diminished when stimulus arrangements were inverted. Our finding that the whole-face binding process indexed by the composite effect is intact in developmental prosopagnosia indicates that other factors are responsible for developmental prosopagnosia. These results are also inconsistent with suggestions that susceptibility to the composite face effect and face recognition ability are tightly linked. While the holistic process revealed by the composite face effect may be necessary for typical face perception, it is not sufficient; individual differences in face recognition ability
Developmental programming and transgenerational transmission of obesity.
Vickers, M H
2014-01-01
The global obesity pandemic is often causally linked to marked changes in diet and lifestyle, namely marked increases in dietary intakes of high-energy diets and concomitant reductions in physical activity levels. However, far less attention has been paid to the role of developmental plasticity and alterations in phenotypic outcomes resulting from environmental perturbations during the early-life period. Human and animal studies have highlighted the link between alterations in the early-life environment and increased susceptibility to obesity and related metabolic disorders in later life. In particular, altered maternal nutrition, including both undernutrition and maternal obesity, has been shown to lead to transgenerational transmission of metabolic disorders. This association has been conceptualised as the developmental programming hypothesis whereby the impact of environmental influences during critical periods of developmental plasticity can elicit lifelong effects on the physiology of the offspring. Further, evidence to date suggests that this developmental programming is a transgenerational phenomenon, with a number of studies showing transmission of programming effects to subsequent generations, even in the absence of continued environmental stressors, thus perpetuating a cycle of obesity and metabolic disorders. The mechanisms responsible for these transgenerational effects remain poorly understood; evidence to date suggests a number of potential mechanisms underpinning the transgenerational transmission of the developmentally programmed phenotype through both the maternal and paternal lineage. Transgenerational phenotype transmission is often seen as a form of epigenetic inheritance with evidence showing both germline and somatic inheritance of epigenetic modifications leading to phenotype changes across generations. However, there is also evidence for non-genomic components as well as an interaction between the developing fetus with the in utero