WorldWideScience

Sample records for stronger tata boxes

  1. The TATA box regulates TATA-binding protein (TBP) dynamics in vivo.

    Science.gov (United States)

    Tora, Laszlo; Timmers, H Th Marc

    2010-06-01

    Early work established the TATA box as the predominant DNA element of core promoters which directed accurate transcription initiation by RNA polymerase II. This element is recognized by TATA-binding protein (TBP), the central DNA-binding subunit of TFIID. In vitro binding and structural experiments indicate that TBP has a strong preference for TATA and induces severe DNA bending. Recent in vivo studies in Saccharomyces cerevisiae indicate that TBP turnover is higher at TATA-containing than at TATA-less promoters; this turnover seems to be regulated by NC2 and Mot1p. We propose that bending of TATA by TBP acts in synergy with NC2 and Mot1p to release TBP more rapidly from TATA promoters in vivo, thus providing a rationale for the predominance of TATA boxes in highly regulated promoters versus constitutively active TATA-less promoters. Copyright 2010 Elsevier Ltd. All rights reserved.

  2. RNAa Induced by TATA Box-Targeting MicroRNAs.

    Science.gov (United States)

    Zhang, Yijun; Zhang, Hui

    2017-01-01

    Recent studies reveal that some nuclear microRNAs (miRNA) and synthesized siRNAs target gene promoters to activate gene transcription (RNAa). Interestingly, our group identified a novel HIV-1-encoded miRNA, miR-H3, which targets specifically the core promoter TATA box of HIV-1 and activates viral gene expression. Depletion of miR-H3 significantly impaired the replication of HIV-1. miR-H3 mimics could activate viruses from CD4 + T cells isolated from patients receiving suppressive highly active antiretroviral therapy, which is very intriguing for reducing HIV-1 latent reservoir. Further study revealed that many cellular miRNAs also function like miR-H3. For instance, let-7i targets the TATA box of the interleukin-2 (IL-2) promoter and upregulates IL-2 expression in T-lymphocytes. In RNAa induced by TATA box-targeting miRNAs, Argonaute (AGO) proteins are needed, but there is no evidence for the involvement of promoter-associated transcripts or epigenetic modifications. We propose that the binding of small RNA-AGO complex to TATA box could facilitate the assembly of RNA Polymerase II transcription preinitiation complex. In addition, synthesized small RNAs targeting TATA box can also efficiently activate transcription of interested genes, such as insulin, IL-2, and c-Myc. The discovery of RNAa induced by TATA box-targeting miRNA provides an easy-to-use tool for activating gene expression.

  3. An experimental verification of the predicted effects of promoter TATA-box polymorphisms associated with human diseases on interactions between the TATA boxes and TATA-binding protein.

    Science.gov (United States)

    Savinkova, Ludmila; Drachkova, Irina; Arshinova, Tatyana; Ponomarenko, Petr; Ponomarenko, Mikhail; Kolchanov, Nikolay

    2013-01-01

    Human genome sequencing has resulted in a great body of data, including a stunningly large number of single nucleotide polymorphisms (SNPs) with unknown phenotypic manifestations. Identification and comprehensive analysis of regulatory SNPs in human gene promoters will help quantify the effects of these SNPs on human health. Based on our experimental and computer-aided study of SNPs in TATA boxes and the use of literature data, we have derived an equation for TBP/TATA equilibrium binding in three successive steps: TATA-binding protein (TBP) sliding along DNA due to their nonspecific affinity for each other ↔ recognition of the TATA box ↔ stabilization of the TBP/TATA complex. Using this equation, we have analyzed TATA boxes containing SNPs associated with human diseases and made in silico predictions of changes in TBP/TATA affinity. An electrophoretic mobility shift assay (EMSA)-based experimental study performed under the most standardized conditions demonstrates that the experimentally measured values are highly correlated with the predicted values: the coefficient of linear correlation, r, was 0.822 at a significance level of αTATA boxes (δ= -ln[K(D,TATAMut)]-(-ln[K(D,TATAMut)])). It has been demonstrated that the SNPs associated with increased risk of human diseases such as α-, β- and δ-thalassemia, myocardial infarction and thrombophlebitis, changes in immune response, amyotrophic lateral sclerosis, lung cancer and hemophilia B Leyden cause 2-4-fold changes in TBP/TATA affinity in most cases. The results obtained strongly suggest that the TBP/TATA equilibrium binding equation derived can be used for analysis of TATA-box sequences and identification of SNPs with a potential of being functionally important.

  4. Functional analysis of the molecular interactions of TATA box-containing genes and essential genes.

    Science.gov (United States)

    Bae, Sang-Hun; Han, Hyun Wook; Moon, Jisook

    2015-01-01

    Genes can be divided into TATA-containing genes and TATA-less genes according to the presence of TATA box elements at promoter regions. TATA-containing genes tend to be stress-responsive, whereas many TATA-less genes are known to be related to cell growth or "housekeeping" functions. In a previous study, we demonstrated that there are striking differences among four gene sets defined by the presence of TATA box (TATA-containing) and essentiality (TATA-less) with respect to number of associated transcription factors, amino acid usage, and functional annotation. Extending this research in yeast, we identified KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways that are statistically enriched in TATA-containing or TATA-less genes and evaluated the possibility that the enriched pathways are related to stress or growth as reflected by the individual functions of the genes involved. According to their enrichment for either of these two gene sets, we sorted KEGG pathways into TATA-containing-gene-enriched pathways (TEPs) and essential-gene-enriched pathways (EEPs). As expected, genes in TEPs and EEPs exhibited opposite results in terms of functional category, transcriptional regulation, codon adaptation index, and network properties, suggesting the possibility that the bipolar patterns in these pathways also contribute to the regulation of the stress response and to cell survival. Our findings provide the novel insight that significant enrichment of TATA-binding or TATA-less genes defines pathways as stress-responsive or growth-related.

  5. Dynamics of TBP binding to the TATA box

    Science.gov (United States)

    Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

    2008-02-01

    Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

  6. Predominant gain of promoter TATA box after gene duplication associated with stress responses.

    Science.gov (United States)

    Zou, Yangyun; Huang, Wei; Gu, Zhenglong; Gu, Xun

    2011-10-01

    TATA box, the core promoter element, exists in a broad range of eukaryotes, and the expression of TATA-containing genes usually responds to various environmental stresses. Hence, the evolution of TATA-box in duplicate genes may provide some clues for the interrelationship among environmental stress, expression differentiation, and duplicate gene preservation. In the present study, we observed that the TATA box is significantly overrepresented in duplicate genes compared with singletons in human, worm, Arabidopsis, and yeast genomes. We then conducted an extensive functional genomic analysis to investigate the evolution of TATA box along over 700 yeast gene family phylogenies. After reconstructing the ancestral TATA-box states (presence or absence), we found that significantly higher numbers of TATA box gain events than loss events had occurred after yeast gene duplications-the overall gain-loss ratio is about 3-4 to 1. Interestingly, these TATA-gain duplicate genes on average have experienced greater expression divergence from the ancestral expression states than their most closely related TATA-less duplicate partners, but only under environmental stress conditions (asymmetric evolution); indeed, under normal physiological conditions, they have similar expression divergence (symmetric evolution). Moreover, we showed that TATA-gain duplicates are enriched in stress-associated functional categories but that is not the case for TATA-ancestral duplicates (those inherited from their ancestors prior to duplication). Together, we conclude that after the gene duplication, gain of the TATA box in duplicate promoters may have played an important role in yeast duplicate preservation by accelerating expression divergence that may facilitate the adaptive evolution of the organism in response to environmental changes.

  7. Stepwise bending of DNA by a single TATA box binding protein

    DEFF Research Database (Denmark)

    Tolic-Nørrelykke, Simon F; Rasmussen, Mette B; Pavone, Francesco S

    2006-01-01

    The TATA-box binding protein (TBP) is required by all three eucaryotic RNA polymerases for the initiation of transcription from most promoters. TBP recognizes, binds to, and bends promoter sequences called "TATA-boxes" in the DNA. We present results from the study of individual Saccharomyces...... cerevisiae TBPs interacting with single DNA molecules containing a TATA-box. Using video microscopy, we observed the Brownian motion of the beads tethered by short surface-bound DNA. When TBP binds to and bends the DNA, the conformation of the DNA changes and the amplitude of Brownian motion of the tehtered...

  8. SNPs in the HIV-1 TATA box and the AIDS pandemic.

    Science.gov (United States)

    Suslov, Valentin V; Ponomarenko, Petr M; Efimov, Vadim M; Savinkova, Ludmila K; Ponomarenko, Mikhail P; Kolchanov, Nikolay A

    2010-06-01

    Evolutionary trends have been examined in 146 HIV-1 forms (2662 copies, 2311 isolates) polymorphic for the TATA box using the "DNA sequence-->affinity for TBP" regression (TBP is the TATA binding protein). As a result, a statistically significant excess of low-affinity TATA box HIV-1 variants corresponding to a low level of both basal and TAT-dependent expression and, consequently, slow replication of HIV-1 have been detected. A detailed analysis revealed that the excess of slowly replicating HIV-1 is associated with the subtype E-associated TATA box core sequence "CATAAAA". Principal Component Analysis performed on 2662 HIV-1 TATA box copies in 70 countries revealed the presence of two principal components, PC1 (75.7% of the variance) and PC2 (23.3% of the variance). They indicate that each of these countries is specifically associated with one of the following trends in HIV-1 evolution: neutral drift around the normal TATA box; neutral drift around the slowly replicating TATA box core sequence (phylogenetic inertia); an adaptive increase in the frequency of the slowly replicating form.

  9. Role of indirect readout mechanism in TATA box binding protein-DNA interaction

    Science.gov (United States)

    Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

    2015-03-01

    Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

  10. Cellular microRNAs up-regulate transcription via interaction with promoter TATA-box motifs.

    Science.gov (United States)

    Zhang, Yijun; Fan, Miaomiao; Zhang, Xue; Huang, Feng; Wu, Kang; Zhang, Junsong; Liu, Jun; Huang, Zhuoqiong; Luo, Haihua; Tao, Liang; Zhang, Hui

    2014-12-01

    The TATA box represents one of the most prevalent core promoters where the pre-initiation complexes (PICs) for gene transcription are assembled. This assembly is crucial for transcription initiation and well regulated. Here we show that some cellular microRNAs (miRNAs) are associated with RNA polymerase II (Pol II) and TATA box-binding protein (TBP) in human peripheral blood mononuclear cells (PBMCs). Among them, let-7i sequence specifically binds to the TATA-box motif of interleukin-2 (IL-2) gene and elevates IL-2 mRNA and protein production in CD4(+) T-lymphocytes in vitro and in vivo. Through direct interaction with the TATA-box motif, let-7i facilitates the PIC assembly and transcription initiation of IL-2 promoter. Several other cellular miRNAs, such as mir-138, mir-92a or mir-181d, also enhance the promoter activities via binding to the TATA-box motifs of insulin, calcitonin or c-myc, respectively. In agreement with the finding that an HIV-1-encoded miRNA could enhance viral replication through targeting the viral promoter TATA-box motif, our data demonstrate that the interaction with core transcription machinery is a novel mechanism for miRNAs to regulate gene expression. © 2014 Zhang et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  11. Crystal structure of Methanococcus jannaschii TATA box-binding protein.

    Science.gov (United States)

    Adachi, Naruhiko; Senda, Miki; Natsume, Ryo; Senda, Toshiya; Horikoshi, Masami

    2008-11-01

    As the archaeal transcription system consists of a eukaryotic-type transcription apparatus and bacterial-type regulatory transcription factors, analyses of the molecular interface between the transcription apparatus and regulatory transcription factors are critical to reveal the evolutionary change of the transcription system. TATA box-binding protein (TBP), the central components of the transcription apparatus are classified into three groups: eukaryotic, archaeal-I and archaeal-II TBPs. Thus, comparative functional analysis of these three groups of TBP is important for the study of the evolution of the transcription system. Here, we present the first crystal structure of an archaeal-II TBP from Methanococcus jannaschii. The highly conserved and group-specific conserved surfaces of TBP bind to DNA and TFIIB/TFB, respectively. The phylogenetic trees of TBP and TFIIB/TFB revealed that they evolved in a coupled manner. The diversified surface of TBP is negatively charged in the archaeal-II TBP, which is completely different from the case of eukaryotic and archaeal-I TBPs, which are positively charged and biphasic, respectively. This difference is responsible for the diversification of the regulatory functions of TBP during evolution.

  12. Comprehensive study in the inhibitory effect of berberine on gene transcription, including TATA box.

    Science.gov (United States)

    Wang, Yugang; Kheir, Michael M; Chai, Yushuang; Hu, Jun; Xing, Dongming; Lei, Fan; Du, Lijun

    2011-01-01

    Berberine (BBR) is an established natural DNA intercalator with numerous pharmacological functions. However, currently there are neither detailed reports concerning the distribution of this alkaloid in living cells nor reports concerning the relationship between BBR's association with DNA and the function of DNA. Here we report that the distribution of BBR within the nucleus can be observed 30 minutes after drug administration, and that the content of berberine in the nucleus peaks at around 4 µmol, which is twelve hours after drug administration. The spatial conformation of DNA and chromatin was altered immediately after their association with BBR. Moreover, this association can effectively suppress the transcription of DNA in living cell systems and cell-free systems. Electrophoretic mobility shift assays (EMSA) demonstrated further that BBR can inhibit the association between the TATA binding protein (TBP) and the TATA box in the promoter, and this finding was also attained in living cells by chromatin immunoprecipitation (ChIP). Based on results from this study, we hypothesize that berberine can suppress the transcription of DNA in living cell systems, especially suppressing the association between TBP and the TATA box by binding with DNA and, thus, inhibiting TATA box-dependent gene expression in a non-specific way. This novel study has significantly expanded the sphere of knowledge concerning berberine's pharmacological effects, beginning at its paramount initial interaction with the TATA box.

  13. The conformational state of the nucleosome entry–exit site modulates TATA box-specific TBP binding

    Science.gov (United States)

    Hieb, Aaron R.; Gansen, Alexander; Böhm, Vera; Langowski, Jörg

    2014-01-01

    The TATA binding protein (TBP) is a critical transcription factor used for nucleating assembly of the RNA polymerase II machinery. TBP binds TATA box elements with high affinity and kinetic stability and in vivo is correlated with high levels of transcription activation. However, since most promoters use less stable TATA-less or TATA-like elements, while also competing with nucleosome occupancy, further mechanistic insight into TBP's DNA binding properties and ability to access chromatin is needed. Using bulk and single-molecule FRET, we find that TBP binds a minimal consensus TATA box as a two-state equilibrium process, showing no evidence for intermediate states. However, upon addition of flanking DNA sequence, we observe non-specific cooperative binding to multiple DNA sites that compete for TATA-box specificity. Thus, we conclude that TBP binding is defined by a branched pathway, wherein TBP initially binds with little sequence specificity and is thermodynamically positioned by its kinetic stability to the TATA box. Furthermore, we observed the real-time access of TBP binding to TATA box DNA located within the DNA entry–exit site of the nucleosome. From these data, we determined salt-dependent changes in the nucleosome conformation regulate TBP's access to the TATA box, where access is highly constrained under physiological conditions, but is alleviated by histone acetylation and TFIIA. PMID:24829456

  14. The conformational state of the nucleosome entry-exit site modulates TATA box-specific TBP binding.

    Science.gov (United States)

    Hieb, Aaron R; Gansen, Alexander; Böhm, Vera; Langowski, Jörg

    2014-07-01

    The TATA binding protein (TBP) is a critical transcription factor used for nucleating assembly of the RNA polymerase II machinery. TBP binds TATA box elements with high affinity and kinetic stability and in vivo is correlated with high levels of transcription activation. However, since most promoters use less stable TATA-less or TATA-like elements, while also competing with nucleosome occupancy, further mechanistic insight into TBP's DNA binding properties and ability to access chromatin is needed. Using bulk and single-molecule FRET, we find that TBP binds a minimal consensus TATA box as a two-state equilibrium process, showing no evidence for intermediate states. However, upon addition of flanking DNA sequence, we observe non-specific cooperative binding to multiple DNA sites that compete for TATA-box specificity. Thus, we conclude that TBP binding is defined by a branched pathway, wherein TBP initially binds with little sequence specificity and is thermodynamically positioned by its kinetic stability to the TATA box. Furthermore, we observed the real-time access of TBP binding to TATA box DNA located within the DNA entry-exit site of the nucleosome. From these data, we determined salt-dependent changes in the nucleosome conformation regulate TBP's access to the TATA box, where access is highly constrained under physiological conditions, but is alleviated by histone acetylation and TFIIA. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. The archaeal TFIIE homologue facilitates transcription initiation by enhancing TATA-box recognition

    NARCIS (Netherlands)

    Bell, S.D.; Brinkman, A.B.; Oost, van der J.; Jackson, S.P.

    2001-01-01

    Transcription from many archaeal promoters can be reconstituted in vitro using recombinant TATA-box binding protein (TBP) and transcription factor B (TFB)—homologues of eukaryal TBP and TFIIB—together with purified RNA polymerase (RNAP). However, all archaeal genomes sequenced to date reveal the

  16. TATA Box Insertion Provides a Selection Mechanism Underpinning Adaptations to Fe Deficiency.

    Science.gov (United States)

    Zhang, Meiling; Lv, Yuanda; Wang, Yi; Rose, Jocelyn K C; Shen, Fei; Han, Zhenyun; Zhang, Xinzhong; Xu, Xuefeng; Wu, Ting; Han, Zhenhai

    2017-01-01

    Intraspecific genetic variation is essential for the responses and adaption of plants to evolutionary challenges, such as changing environmental conditions. The development of the Earth's aerobic atmosphere has increased the demand for iron (Fe) in organisms, and Fe deficiency has become a limiting environmental factor for plant growth. Here, we demonstrate that genus Malus adapt to Fe deficiency through modification of the Iron-Regulated Transporter1 (IRT1) promoter. Specifically, an IRT1 mutant allele with a TATA-box insertion in the promoter region upstream of the coding region exhibited increased IRT1 expression. The altered IRT1 promoter is responsible for enhancing Fe uptake. Increasing the number of synthetic repeat TATA-boxes correlates with increased promoter activity. Furthermore, we demonstrate that the insertion of the TATA-box correlates with an increase in transcriptional activation via specific binding of the transcription factor IID (MDP0000939369). Taken together, these results indicate that an allelic insertion of a TATA-box in a gene promoter has allowed apple to adapt to the selective pressure posed by Fe deficiency. More broadly, this study reveals a new mechanism for enhancing gene expression to help plants adapt to different environments, providing new insights into molecular genetic divergence in plants. © 2017 American Society of Plant Biologists. All Rights Reserved.

  17. The Association between Prolonged Jaundice and TATA Box Dinucleotide Repeats in Gilbert's Syndrome.

    Science.gov (United States)

    Pasha, Yadollah Zahed; Kacho, Mousa Ahmadpor; Niaki, Haleh Akhavan; Tarighati, Mehdi; Alaee, Ehsan

    2017-09-01

    Jaundice is a common condition during the neonatal period. Prolonged jaundice occurs in a large number of breastfed infants, considering the impact of genetic factors on the incidence of jaundice. To determine the association between prolonged jaundice and TATA box dinucleotide repeats in Gilbert's Syndrome (GS). In this case-control study, the case group consisted of 51 neonates with jaundice, aged more than two weeks with indirect bilirubin level higher than 10 mg/dl. Acute diseases, mother's use of phenobarbital and other medications were the exclusion criteria. The control group consisted of 54 newborns without jaundice. The two groups were matched in terms of age and sex. TATA box polymorphisms in the promoter region of UGT1A1 gene were evaluated using Polymerase Chain Reaction (PCR) in order to determine TATA box dinucleotide repeats. Overall, 64.7% and 50% of subjects in the case and control groups were male, respectively (p=0.168). The mean age of neonates in the case and control groups was 20.1±7.1days and 18.8±4.1 days, respectively. The distribution of Gilbert genome was not significantly different between the two groups. In the case group, 13.7% of the subjects were homozygous, 37.3% were heterozygous and 49% were normal. In the control group, 7.4% of the participants were homozygous, 35.2% were heterozygous and 57.4% were normal. The results of this study showed an association between TATA box polymorphism and prolonged jaundice in neonates which revealed that TATA box polymorphism is an important risk to increase and extend icterus.

  18. TBP-like protein (TLP) interferes with Taspase1-mediated processing of TFIIA and represses TATA box gene expression.

    Science.gov (United States)

    Suzuki, Hidefumi; Isogai, Momoko; Maeda, Ryo; Ura, Kiyoe; Tamura, Taka-Aki

    2015-07-27

    TBP-TFIIA interaction is involved in the potentiation of TATA box-driven promoters. TFIIA activates transcription through stabilization of TATA box-bound TBP. The precursor of TFIIA is subjected to Taspase1-directed processing to generate α and β subunits. Although this processing has been assumed to be required for the promoter activation function of TFIIA, little is known about how the processing is regulated. In this study, we found that TBP-like protein (TLP), which has the highest affinity to TFIIA among known proteins, affects Taspase1-driven processing of TFIIA. TLP interfered with TFIIA processing in vivo and in vitro, and direct binding of TLP to TFIIA was essential for inhibition of the processing. We also showed that TATA box promoters are specifically potentiated by processed TFIIA. Processed TFIIA, but not unprocessed TFIIA, associated with the TATA box. In a TLP-knocked-down condition, not only the amounts of TATA box-bound TFIIA but also those of chromatin-bound TBP were significantly increased, resulting in the stimulation of TATA box-mediated gene expression. Consequently, we suggest that TLP works as a negative regulator of the TFIIA processing and represses TFIIA-governed and TATA-dependent gene expression through preventing TFIIA maturation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Conserved features of complexes of TATA-box binding proteins with DNA.

    Science.gov (United States)

    Zanegina, Olga; Aksianov, Evgeniy; Alexeevski, Andrei V; Karyagina, Anna; Spirin, Sergei

    2016-04-01

    A comparative analysis of all available structures of complexes of TATA-box binding proteins (TBPs) with DNA is performed. Conserved features of DNA-protein interaction are described, including nine amino acid residues that form conserved hydrogen bonds, 13 residues participating in formation of two conserved hydrophobic clusters at DNA-protein interface, and four conserved water-mediated contacts. Partial symmetry of conserved contacts reflects quasi-symmetry of TBP structure.

  20. Real-Time Interaction between TBP and the TATA Box of the Human Triosephosphate Isomerase Gene Promoter in the Norm and Pathology.

    Science.gov (United States)

    Arkova, O V; Kuznetsov, N A; Fedorova, O S; Kolchanov, N A; Savinkova, L K

    2014-04-01

    The TATA-binding protein (TBP) is a key part of the transcription complex of RNA polymerase II. Alone or as a part of the basal transcription factor TFIID, TBP binds the TATA box located in the core region of the TATA-containing promoters of class II genes. Previously, we studied the effects of single nucleotide polymorphisms (SNPs) on TBP/TATA-box interactions using gel retardation assay. It was demonstrated that most SNPs in the TATA boxes of some human gene promoters cause a 2- to 4-fold decrease in TBP/TATA affinity, which is associated with an increased risk of hereditary diseases, such as β thalassemias of diverse severity, hemophilia B Leyden, myocardial infarction, thrombophlebitis, lung cancer, etc. In this work, the process of TBP/TATA complex formation has been studied in real time by a stopped-flow technique using recombinant human TBP and duplexes, which were identical to the TATA box of the wild-type and a SNP-containing triosephosphate isomerase gene promoter and were fluorescently labeled by the Cy3/Cy5 FRET pair. It has been demonstrated for the first time that real-time binding of TBP to the TATA box of the TPI gene promoter is complete within 10 s and is described by a single-stage kinetic model. The complex formation of TBP with the wild-type TATA box occurs 5.5 times faster and the complex dissociation occurs 31 times slower compared with the SNPcontaining TATA box. Within the first seconds of the interaction, TBP binds to and simultaneously bends the TATA box. Importantly, the TATA box of the wild-type TPI gene promoter requires lower TBP concentrations compared to the TATA box containing the -24T → G SNP, which is associated with neurological and muscular disorders, cardiomyopathy, and other diseases.

  1. [TATA box polymorphisms in genes of commercial and laboratory animals and plants associated with selectively valuable traits].

    Science.gov (United States)

    Suslov, V V; Ponomarenko, P M; Ponomarenko, M P; Drachkova, I A; Arshinova, T V; Savinkova, L K; Kolchanov, N A

    2010-04-01

    Most of more than 11 million experimentally established polymorphisms, accumulated in dbSNP, were identified in the intergenic spacers or coding DNA regions. This fact enables interpretation of the former polymorphisms as neutral, while the latter make clear the biological sense of the associated mutant phenotypes, "the defect of certain proteins". The association of polymorphisms in regulatory DNA regions with mutant phenotypes is poorly studied. Specifically, the defects in certain DNA/protein binding sites were identified in less than 500 cases. In TATA-containing genes of eukaryotes the TATA box, the TBP (TATA-binding protein) binding site, is located about 30 bp upstream from the transcription start site. Interaction between DNA and TBP triggers assemblage of the preinitiation complex. For 37 TATA box polymorphisms in the genes of commercial and laboratory animals and plants, the effect on TBP-binding activity was evaluated using the equilibrium equation for the four subsequent steps of TBP/TATA box binding (nonspecific binding sliding recognition stabilization). According to the GenBank data, these 37 polymorphisms were associated with the changes in a number of selectively valuable traits. Statistically significant congruence of in silico analysis performed with mutant phenotypes (a TATA box mutations in specified genes on selectively valuable traits of the species, varieties, and breeds.

  2. Core promoter-specific gene regulation: TATA box selectivity and Initiator-dependent bi-directionality of serum response factor-activated transcription.

    Science.gov (United States)

    Xu, Muyu; Gonzalez-Hurtado, Elsie; Martinez, Ernest

    2016-04-01

    Gene-specific activation by enhancers involves their communication with the basal RNA polymerase II transcription machinery at the core promoter. Core promoters are diverse and may contain a variety of sequence elements such as the TATA box, the Initiator (INR), and the downstream promoter element (DPE) recognized, respectively, by the TATA-binding protein (TBP) and TBP-associated factors of the TFIID complex. Core promoter elements contribute to the gene selectivity of enhancers, and INR/DPE-specific enhancers and activators have been identified. Here, we identify a TATA box-selective activating sequence upstream of the human β-actin (ACTB) gene that mediates serum response factor (SRF)-induced transcription from TATA-dependent but not INR-dependent promoters and requires the TATA-binding/bending activity of TBP, which is otherwise dispensable for transcription from a TATA-less promoter. The SRF-dependent ACTB sequence is stereospecific on TATA promoters but activates in an orientation-independent manner a composite TATA/INR-containing promoter. More generally, we show that SRF-regulated genes of the actin/cytoskeleton/contractile family tend to have a TATA box. These results suggest distinct TATA-dependent and INR-dependent mechanisms of TFIID-mediated transcription in mammalian cells that are compatible with only certain stereospecific combinations of activators, and that a TBP-TATA binding mechanism is important for SRF activation of the actin/cytoskeleton-related gene family. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Science.gov (United States)

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  4. The human immunodeficiency virus type 1 promoter contains a CATA box instead of a TATA box for optimal transcription and replication

    NARCIS (Netherlands)

    van Opijnen, Tim; Kamoschinski, Joost; Jeeninga, Rienk E.; Berkhout, Ben

    2004-01-01

    The human immunodeficiency virus type 1 (HIV-1) transcriptional promoter contains a single polymorphism in the TATA box. Most subtypes contain the sequence TATAAGC, but subtype E and some recombinant AG strains have the sequence TA (A) under bar AAGC. Based on mutagenesis studies of cellular RNA

  5. TC-motifs at the TATA-box expected position in plant genes: a novel class of motifs involved in the transcription regulation.

    Science.gov (United States)

    Bernard, Virginie; Brunaud, Véronique; Lecharny, Alain

    2010-03-12

    The TATA-box and TATA-variants are regulatory elements involved in the formation of a transcription initiation complex. Both have been conserved throughout evolution in a restricted region close to the Transcription Start Site (TSS). However, less than half of the genes in model organisms studied so far have been found to contain either one of these elements. Indeed different core-promoter elements are involved in the recruitment of the TATA-box-binding protein. Here we assessed the possibility of identifying novel functional motifs in plant genes, sharing the TATA-box topological constraints. We developed an ab-initio approach considering the preferential location of motifs relative to the TSS. We identified motifs observed at the TATA-box expected location and conserved in both Arabidopsis thaliana and Oryza sativa promoters. We identified TC-elements within non-TA-rich promoters 30 bases upstream of the TSS. As with the TATA-box and TATA-variant sequences, it was possible to construct a unique distance graph with the TC-element sequences. The structural and functional features of TC-element-containing genes were distinct from those of TATA-box- or TATA-variant-containing genes. Arabidopsis thaliana transcriptome analysis revealed that TATA-box-containing genes were generally those showing relatively high levels of expression and that TC-element-containing genes were generally those expressed in specific conditions. Our observations suggest that the TC-elements might constitute a class of novel regulatory elements participating towards the complex modulation of gene expression in plants.

  6. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    Science.gov (United States)

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  7. The mechanism by which TATA-box polymorphisms associated with human hereditary diseases influence interactions with the TATA-binding protein.

    Science.gov (United States)

    Drachkova, Irina; Savinkova, Ludmila; Arshinova, Tatyana; Ponomarenko, Mikhail; Peltek, Sergey; Kolchanov, Nikolay

    2014-05-01

    SNPs in ТАТА boxes are the cause of monogenic diseases, contribute to a large number of complex diseases, and have implications for human sensitivity to external and internal environmental signals. The aim of this work was to explore the kinetic characteristics of the formation of human ТВР complexes with ТАТА boxes, in which the SNPs are associated with β-thalassemias of diverse severity, immunosuppression, neurological disorders, and so on. It has for the first time been demonstrated, using an electrophoretic mobility shift assay, that TBP interacts with SNP-containing ТАТА boxes with a significant (8-36-fold) decrease in TBP/ТАТА association rate constant (ka ) as compared with that in healthy people, a smaller decrease in dissociation rate constant (kd ) and changes in the half-lives of TBP/ТАТА complexes. Carriers of the -24G allele (rs 1800202T>G) in the TATA box of the triosephosphate isomerase gene promoter, associated with neurological and muscular disorders, were observed to have a 36-fold decrease in TBP/TATA association rate constant that are consistent with TPI deficiency shown for patients who carry this defective allele. The kinetic characteristics of TBP/ТАТА complexes obtained suggest that, at a molecular level, hereditary diseases are largely caused by changes in TBP/ТАТА association rates and these changes have a bearing on disease severity. © 2014 WILEY PERIODICALS, INC.

  8. [A precise equilibrium equation for four steps of binding between TBP and TATA-box allows for the prediction of phenotypical expression upon mutation].

    Science.gov (United States)

    Ponomarenko, P M; Suslov, V V; Savinkova, L K; Ponomarenko, M P; Kolchanov, N A

    2010-01-01

    Among the main events of transcription initiation of TATA-containing genes in eukayotes are the recognition and binding of the TATA-box by the TATA-binding protein (TBP) to start the preinitiation complex formation on the nucleosomal DNA. Using the equilibrium equation for step-by-step TBP/TATA-binding, we have analyzed 69 experimental datasets on the characteristics of biologicacally important features altered by TATA-box mutations. Among these features, the TBP/TATA-complex parameters, the transcription level, the activity of gene products, yeast colony growth at a dose of growth inhibitor (phenotype), and the heterogenity of the response of a population to unspecific environmental stress have been described. Significant correlations were found between in silico prediction for TBP/TATA affinity and experimental data for in vivo and in vitro test-systems based on 15 cell types of 19 species, RNA polymerases II and III, and natural, recombinant or mutant TBP. Such an invariant impact of the step-by-step TBP/TATA-binding on the biological activity of complex systems, from a molecule to a population, might be due to the fact that TBP/TATA-complex formation precedes specific steps of transcription machinery assembly, which provide the multivariant jigsaw puzzle according to the expression pattern of each eukaryotic gene.

  9. Differential stability of TATA box binding proteins from archaea with different optimal growth temperatures

    Science.gov (United States)

    Kopitz, Annette; Soppa, Jörg; Krejtschi, Carsten; Hauser, Karin

    2009-09-01

    The TATA box binding protein (TBP) is involved in promoter recognition, the first step of transcription initiation. TBP is universally conserved and essential in archaea and eukaryotes. In archaea, TBPs have to be stable and to function in species that cover an extremely wide range of optimal growth temperatures (OGTs), from below 0 °C to more than 100 °C. Thus, the archaeal TBP family is ideally suited to study the evolutionary adaptation of proteins to an extremely wide range of temperatures. We characterized the thermostability of one mesophilic and one thermophilic TBP by infrared spectroscopy. Transition temperatures ( Tms) of thermal unfolding have been determined using TBPs from Methanosarcina mazei (OGT 37 °C) and from Methanothermobacter thermautotrophicus (OGT 65 °C). Furthermore, the influence of protein and salt concentration on thermostability has been characterized. Together with previous studies, our results reveal that the Tms of archaeal TBPs are closely correlated with the OGTs of the respective species. Noteworthy, this is also true for the TBP from M. mazei representing the first characterized TBP from a mesophilic archaeon. In contrast, the only characterized eukaryotic TBP of the mesophilic plant Arabidopsis thaliana has a Tm more than 40 °C above the OGT.

  10. A T9G mutation in the prototype TATA-box TCACTATATATAG determines nucleosome formation and synergy with upstream activator sequences in plant promoters.

    Science.gov (United States)

    Ranjan, Amol; Ansari, Suraiya A; Srivastava, Rakesh; Mantri, Shrikant; Asif, Mehar H; Sawant, Samir V; Tuli, Rakesh

    2009-12-01

    We had earlier reported that mutations to G and C at the seventh and eighth positions in the prototype TATA-box TCACTATATATAG inhibited light-dependent activation of transcription from the promoter. In this study, we characterized mutations at the ninth position of the prototype TATA-box. Substitution of T at the ninth position with G or C enhanced transcription from the promoter in transgenic tobacco (Nicotiana tabacum) plants. The effect of T9G/C mutations was not light dependent, although the 9G/C TATA-box showed synergy with the light-responsive element (lre). However, the 9G/C mutants in the presence of lre failed to respond to phytochromes, sugar, and calcium signaling, in contrast to the prototype TATA-box with lre. The 9G/C mutation shifted the point of initiation of transcription, and transcription activation was dependent upon the type of activating element present upstream. The synergy in activation was noticed with lre and legumin activators but not with rbcS, Pcec, and PR-1a activators. The 9G mutation resulted in a micrococcal nuclease-sensitive region over the TATA-box, suggesting a nucleosome-free region, in contrast to the prototype promoter, which had a distinct nucleosome on the TATA-box. Thus, the transcriptional augmentation with mutation at the ninth position might be because of the loss of a repressive nucleosomal structure on the TATA-box. In agreement with our findings, the promoters containing TATAGATA as identified by genome-wide analysis of Arabidopsis (Arabidopsis thaliana) are not tightly repressed.

  11. Direct observation of preferential processing of clustered abasic DNA damages with APE1 in TATA box and CpG island by reaction kinetics and fluorescence dynamics.

    Science.gov (United States)

    Singh, Vandana; Kumari, Bhavini; Maity, Banibrata; Seth, Debabrata; Das, Prolay

    2014-01-01

    Sequences like the core element of TATA box and CpG island are frequently encountered in the genome and related to transcription. The fate of repair of clustered abasic sites in such sequences of genomic importance is largely unknown. This prompted us to investigate the sequence dependence of cleavage efficiency of APE1 enzyme at abasic sites within the core sequences of TATA box and CpG island using fluorescence dynamics and reaction kinetics. Simultaneous molecular dynamics study through steady state and time resolved fluorescence spectroscopy using unique ethidium bromide dye release assay confirmed an elevated amount of abasic site cleavage of the TATA box sequence as compared to the core CpG island. Reaction kinetics showed that catalytic efficiency of APE1 for abasic site cleavage of core CpG island sequence was ∼4 times lower as compared to that of the TATA box. Higher value of Km was obtained from the core CpG island sequence than the TATA box sequence. This suggests a greater binding effect of APE1 enzyme on TATA sequence that signifies a prominent role of the sequence context of the DNA substrate. Evidently, a faster response from APE1 was obtained for clustered abasic damage repair of TATA box core sequences than CpG island consensus sequences. The neighboring bases of the abasic sites in the complementary DNA strand were found to have significant contribution in addition to the flanking bases in modulating APE1 activity. The repair refractivity of the bistranded clustered abasic sites arise from the slow processing of the second abasic site, consequently resulting in decreased overall production of potentially lethal double strand breaks. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Optimizations of siRNA design for the activation of gene transcription by targeting the TATA-box motif.

    Directory of Open Access Journals (Sweden)

    Miaomiao Fan

    Full Text Available Small interfering RNAs (siRNAs are widely used to repress gene expression by targeting mRNAs. Some reports reveal that siRNAs can also activate or inhibit gene expression through targeting the gene promoters. Our group has found that microRNAs (miRNAs could activate gene transcription via interaction with the TATA-box motif in gene promoters. To investigate whether siRNA targeting the same region could upregulate the promoter activity, we test the activating efficiency of siRNAs targeting the TATA-box motif of 16 genes and perform a systematic analysis to identify the common features of the functional siRNAs for effective activation of gene promoters. Further, we try various modifications to improve the activating efficiency of siRNAs and find that it is quite useful to design the promoter-targeting activating siRNA by following several rules such as (a complementary to the TATA-box-centered region; (b UA usage at the first two bases of the antisense strand; (c twenty-three nucleotides (nts in length; (d 2'-O-Methyl (2'-OMe modification at the 3' terminus of the antisense strand; (e avoiding mismatches at the 3' end of the antisense strand. The optimized activating siRNAs potently enhance the expression of interleukin-2 (IL-2 gene in human and mouse primary CD4+ T cells with a long-time effect. Taken together, our study provides a guideline for rational design the promoter-targeting siRNA to sequence-specifically enhance gene expression.

  13. Optimizations of siRNA design for the activation of gene transcription by targeting the TATA-box motif.

    Science.gov (United States)

    Fan, Miaomiao; Zhang, Yijun; Huang, Zhuoqiong; Liu, Jun; Guo, Xuemin; Zhang, Hui; Luo, Haihua

    2014-01-01

    Small interfering RNAs (siRNAs) are widely used to repress gene expression by targeting mRNAs. Some reports reveal that siRNAs can also activate or inhibit gene expression through targeting the gene promoters. Our group has found that microRNAs (miRNAs) could activate gene transcription via interaction with the TATA-box motif in gene promoters. To investigate whether siRNA targeting the same region could upregulate the promoter activity, we test the activating efficiency of siRNAs targeting the TATA-box motif of 16 genes and perform a systematic analysis to identify the common features of the functional siRNAs for effective activation of gene promoters. Further, we try various modifications to improve the activating efficiency of siRNAs and find that it is quite useful to design the promoter-targeting activating siRNA by following several rules such as (a) complementary to the TATA-box-centered region; (b) UA usage at the first two bases of the antisense strand; (c) twenty-three nucleotides (nts) in length; (d) 2'-O-Methyl (2'-OMe) modification at the 3' terminus of the antisense strand; (e) avoiding mismatches at the 3' end of the antisense strand. The optimized activating siRNAs potently enhance the expression of interleukin-2 (IL-2) gene in human and mouse primary CD4+ T cells with a long-time effect. Taken together, our study provides a guideline for rational design the promoter-targeting siRNA to sequence-specifically enhance gene expression.

  14. Optimizations of SiRNA Design for the Activation of Gene Transcription by Targeting the TATA-Box Motif

    Science.gov (United States)

    Huang, Zhuoqiong; Liu, Jun; Guo, Xuemin; Zhang, Hui; Luo, Haihua

    2014-01-01

    Small interfering RNAs (siRNAs) are widely used to repress gene expression by targeting mRNAs. Some reports reveal that siRNAs can also activate or inhibit gene expression through targeting the gene promoters. Our group has found that microRNAs (miRNAs) could activate gene transcription via interaction with the TATA-box motif in gene promoters. To investigate whether siRNA targeting the same region could upregulate the promoter activity, we test the activating efficiency of siRNAs targeting the TATA-box motif of 16 genes and perform a systematic analysis to identify the common features of the functional siRNAs for effective activation of gene promoters. Further, we try various modifications to improve the activating efficiency of siRNAs and find that it is quite useful to design the promoter-targeting activating siRNA by following several rules such as (a) complementary to the TATA-box-centered region; (b) UA usage at the first two bases of the antisense strand; (c) twenty-three nucleotides (nts) in length; (d) 2′-O-Methyl (2′-OMe) modification at the 3′ terminus of the antisense strand; (e) avoiding mismatches at the 3′ end of the antisense strand. The optimized activating siRNAs potently enhance the expression of interleukin-2 (IL-2) gene in human and mouse primary CD4+ T cells with a long-time effect. Taken together, our study provides a guideline for rational design the promoter-targeting siRNA to sequence-specifically enhance gene expression. PMID:25250958

  15. TATA boxes in gene transcription and poly (A) tails in mRNA stability: New perspective on the effects of berberine.

    Science.gov (United States)

    Yuan, Zhi-Yi; Lu, Xi; Lei, Fan; Chai, Yu-Shuang; Wang, Yu-Gang; Jiang, Jing-Fei; Feng, Tian-Shi; Wang, Xin-Pei; Yu, Xuan; Yan, Xiao-Jin; Xing, Dong-Ming; Du, Li-Jun

    2015-12-16

    Berberine (BBR) is a natural compound with variable pharmacological effects and a broad panel of target genes. We investigated berberine's pharmacological activities from the perspective of its nucleotide-binding ability and discovered that BBR directly regulates gene expression by targeting TATA boxes in transcriptional regulatory regions as well as the poly adenine (poly (A)) tail at the mRNA terminus. BBR inhibits gene transcription by binding the TATA boxes in the transcriptional regulatory region, but it promotes higher levels of expression by targeting the poly (A) tails of mRNAs. The present study demonstrates that TATA boxes and poly (A) tails are the first and second primary targets by which BBR regulates gene expression. The final outcome of gene regulation by BBR depends on the structure of the individual gene. This is the first study to reveal that TATA boxes and poly (A) tails are direct targets for BBR in its regulation of gene expression. Our findings provide a novel explanation for the complex activities of a small molecule compound in a biological system and a novel horizon for small molecule-compound pharmacological studies.

  16. TATA is a modular component of synthetic promoters.

    Science.gov (United States)

    Mogno, Ilaria; Vallania, Francesco; Mitra, Robi D; Cohen, Barak A

    2010-10-01

    The expression of most genes is regulated by multiple transcription factors. The interactions between transcription factors produce complex patterns of gene expression that are not always obvious from the arrangement of cis-regulatory elements in a promoter. One critical element of promoters is the TATA box, the docking site for the RNA polymerase holoenzyme. Using a synthetic promoter system coupled to a thermodynamic model of combinatorial regulation, we analyze the effects of different strength TATA boxes on various aspects of combinatorial cis-regulation. The thermodynamic model explains 75% of the variance in gene expression in synthetic promoter libraries with different strength TATA boxes, suggesting that many of the salient aspects of cis-regulation are captured by the model. Our results demonstrate that the effect of changing the TATA box on gene expression is the same for all synthetic promoters regardless of the arrangement of cis-regulatory sites we studied. Our analysis also showed that in our synthetic system the strength of the RNA polymerase-TATA interaction does not alter the combinatorial interactions between transcription factors, or between transcription factors and RNA polymerase. Finally, we show that although stronger TATA boxes increase expression in a predictable fashion, stronger TATA boxes have very little effect on noise in our synthetic promoters, regardless of the arrangement of cis-regulatory sites. Our results support a modular model of promoter function, where cis-regulatory elements can be mixed and matched (programmed) with outcomes on expression that are predictable based on the rules of simple protein-protein and protein-DNA interactions.

  17. Activin A induces ovine follicle stimulating hormone beta using -169/-58 bp of its promoter and a simple TATA box

    Directory of Open Access Journals (Sweden)

    Miller William L

    2009-06-01

    Full Text Available Abstract Background Activin A increases production of follicle stimulating hormone (FSH by inducing transcription of its beta subunit (FSHB. This induction has been studied here in LbetaT2 gonadotropes using transient expression of ovine FSHBLuc (-4741 bp of ovine FSHB promoter plus exon/intron 1 linked to Luc. Several sequences between -169/-58 bp of the ovine FSHB proximal promoter are necessary for induction by activin A in LbetaT2 cells, but deletions between -4741/-752 bp decrease induction > 70% suggesting the existence of other important 5' sequences. Induction disappears if a minimal T81 thymidine kinase promoter replaces the ovine FSHB TATA box and 3' exon/intron. The study reported here was designed to determine if sequences outside -169/-58 bp are important for induction of ovine FSHB by activin A. Methods Progressively longer deletions of ovine FSHBLuc were created between -4741/-195 bp. Deletions internal to this region were created also, but replaced with substitute DNA. The ovine FSHB TATA box region (-40/+3 bp was replaced by thymidine kinase and rat prolactin minimal promoters, and substitutions were made in 3' intron/exon sequences. All constructs were tested for basal and activin A-induced expression in LbetaT2 cells. Results Successive 5' deletions progressively lowered fold-induction by activin A from 9.5 to zero, but progressively increased basal expression. Replacing deletions with substitute DNA showed no changes in basal expression or fold-induction. Induction by activin A was supported by the minimal rat prolactin promoter (TATA box but not the thymidine kinase promoter (no TATA box. Replacement mutations in the 3' region did not decrease induction by activin A. Conclusion The data show that specific ovine FSHB sequences 5' to -175 bp or 3' of the transcription start site are not required for induction by activin A. A minimal TATA box promoter supports induction by activin A, but the sequence between the TATA box and

  18. MiRNAs regulate oxidative stress related genes via binding to the 3' UTR and TATA-box regions: a new hypothesis for cataract pathogenesis.

    Science.gov (United States)

    Wu, Changrui; Liu, Zhao; Ma, Le; Pei, Cheng; Qin, Li; Gao, Ning; Li, Jun; Yin, Yue

    2017-08-14

    Age-related cataracts are related to oxidative stress. However, the genome-wide screening of cataract related oxidative stress related genes are not thoroughly investigated. Our study aims to identify cataract regulated miRNA target genes that are related to oxidative stress and to propose a new possible mechanism for cataract formation. Microarrays were used to determine the mRNA expression profiles of both transparent and cataractous lenses. The results were analyzed by significance analyses performed by the microarray software, and bioinformatics analysis was further conducted using Molecular Annotation System. The Eukaryotic Promoter Database (EPD) was used to retrieve promoter sequences and identify TATA-box motifs. Online resource miRWalk was exploited to screen for validated miRNAs targeting mRNAs related to oxidative stress. RNAhybrid online tool was applied to predict the binding between significantly regulated miRNAs in cataract lenses and target mRNAs. Oxidative stress pathway was significantly regulated in cataractous lens samples. Pro-oxidative genes were half up-regulated (11/20), with a small number of genes down-regulated (4/20) and the rest of them with no significant change (5/20). Anti-oxidative genes were partly up-regulated (17/69) and partly down-regulated (17/69). Four down-regulated miRNAs (has-miR-1207-5p, has-miR-124-3p, has-miR-204-3p, has-miR-204-5p) were found to target 3' UTR of pro-oxidative genes and could also bind to the TATA-box regions of anti-oxidative genes (with the exception of has-miR-204-3p), whilst two up-regulated miRNAs (has-miR-222-3p, has-miR-378a-3p) were found to target 3' UTR of anti-oxidative genes and could simultaneously bind to the TATA-box regions of pro-oxidative genes. We propose for the first time a hypothesis that cataract regulated miRNAs could contribute to cataract formation not only by targeting 3' UTR but also by targeting TATA-box region of oxidative stress related genes. This results in the

  19. A Cellular MicroRNA Facilitates Regulatory T Lymphocyte Development by Targeting the FOXP3 Promoter TATA-Box Motif.

    Science.gov (United States)

    Zhang, Yiwen; Liu, Weiwei; Chen, Yingshi; Liu, Jun; Wu, Kang; Su, Lishi; Zhang, Wanying; Jiang, Yawen; Zhang, Xu; Zhang, Yijun; Liu, Chao; Tao, Liang; Liu, Bingfeng; Zhang, Hui

    2018-02-01

    The CD4 + CD25 + FOXP3 + regulatory T cells (Tregs) mediate immunological self-tolerance and suppress various immune responses. FOXP3 is a key transcriptional factor for the generation and development of Tregs. Its expression is regulated by various cytokines including TGF-β, IL-2, and IL-10. It is important to further identify the regulatory factors for Tregs. Given that many microRNAs (miRNAs) could specifically interact with the core promoter region and specifically enhance the transcription of many target genes, we searched for any possible miRNA(s) targeting the core promoter region of the FOXP3 gene. We found that miR-4281, an miRNA specifically expressed in hominids, can potently and specifically upregulate FOXP3 expression by directly interacting with the TATA-box motif in the human FOXP3 promoter. Consequently, miR-4281 significantly accelerated the differentiation of human naive cells to induced Tregs (iTregs) that possess immune suppressor functions and weaken the development of graft-versus-host disease in a humanized mouse model. Interestingly, iTregs induced by the combination of TGF-β, IL-2, and chemically synthesized miR-4281 were more stable and functional than those induced by TGF-β and IL-2 alone. Moreover, we found that the IL-2/STAT5 signal transduction upregulates FOXP3 expression not only through the classical pathway, but also by enhancing the expression of the miR-4281 precursor gene ( SNCB ) and, correspondingly, miR-4281. This study reveals a novel mechanism regulating FOXP3 expression and human iTreg development and, therefore, offers a new therapeutic target to manipulate immunosuppressive system. Copyright © 2018 by The American Association of Immunologists, Inc.

  20. Neuronal expression of TATA box-binding protein containing expanded polyglutamine in knock-in mice reduces chaperone protein response by impairing the function of nuclear factor-Y transcription factor.

    Science.gov (United States)

    Huang, Shanshan; Ling, Joseph J; Yang, Su; Li, Xiao-Jiang; Li, Shihua

    2011-07-01

    The polyglutamine diseases consist of nine neurodegenerative disorders including spinocerebellar ataxia type 17 that is caused by a polyglutamine tract expansion in the TATA box-binding protein. In all polyglutamine diseases, polyglutamine-expanded proteins are ubiquitously expressed throughout the body but cause selective neurodegeneration. Understanding the specific effects of polyglutamine-expanded proteins, when expressed at the endogenous levels, in neurons is important for unravelling the pathogenesis of polyglutamine diseases. However, addressing this important issue using mouse models that either overly or ubiquitously express mutant polyglutamine proteins in the brain and body has proved difficult. To investigate the pathogenesis of spinocerebellar ataxia 17, we generated a conditional knock-in mouse model that expresses one copy of the mutant TATA box-binding protein gene, which encodes a 105-glutamine repeat, selectively in neuronal cells at the endogenous level. Neuronal expression of mutant TATA box-binding protein causes age-dependent neurological symptoms in mice and the degeneration of cerebellar Purkinje cells. Mutant TATA box-binding protein binds more tightly to the transcription factor nuclear factor-Y, inhibits its association with the chaperone protein promoter, as well as the promoter activity and reduces the expression of the chaperones Hsp70, Hsp25 and HspA5, and their response to stress. These findings demonstrate how mutant TATA box-binding protein at the endogenous level affects neuronal function, with important implications for the pathogenesis and treatment of polyglutamine diseases.

  1. Development of a system for the study of protein-protein interactions in planta: characterization of a TATA-box binding protein complex in Oryza sativa.

    Science.gov (United States)

    Zhong, Jingping; Haynes, Paul A; Zhang, Shiping; Yang, Xinping; Andon, Nancy L; Eckert, Donna; Yates, John R; Wang, Xun; Budworth, Paul

    2003-01-01

    We describe a simple, rapid method for protein complex purification in planta. Using a biotin peptide as an affinity tag with TATA-box binding protein (TBP), 86 unique proteins present in the purified complex were identified by tandem mass spectrometry. We identified proteins known to be associated with TBP, and many other proteins involved in pre-mRNA processing and chromatin remodeling. The identification of these novel protein-protein associations will upon further investigations provide new insights into the mechanisms of mRNA transcription and pre-mRNA processing.

  2. Contribution of phenylalanine side chain intercalation to the TATA-box binding protein-DNA interaction: molecular dynamics and dispersion-corrected density functional theory studies.

    Science.gov (United States)

    Mondal, Manas; Mukherjee, Sanchita; Bhattacharyya, Dhananjay

    2014-11-01

    Deformation of DNA takes place quite often due to binding of small molecules or proteins with DNA. Such deformation is significant due to minor groove binding and, besides electrostatic interactions, other non-covalent interactions may also play an important role in generating such deformation. TATA-box binding protein (TBP) binds to the minor groove of DNA at the TATA box sequence, producing a large-scale deformation in DNA and initiating transcription. In order to observe the interactions of protein residues with DNA in the minor groove that produce the deformation in the DNA structure, we carried out molecular dynamics simulations of the TBP-DNA system. The results reveal consistent partial intercalation of two Phe residues, distorting stacking interactions at two dinucleotide step sites. We carried out calculations based on dispersion-corrected density functional theory to understand the source of such stabilization. We observed favorable interaction energies between the Phe residues and the base pairs with which they interact. We suggest that salt-bridge interactions between the phosphate groups and Lys or Arg residues, along with the intercalation of Phe residues between two base pair stacks, stabilize the kinked and opened-up DNA conformation.

  3. A real-time study of the interaction of TBP with a TATA box-containing duplex identical to an ancestral or minor allele of human gene LEP or TPI.

    Science.gov (United States)

    Arkova, Olga; Kuznetsov, Nikita; Fedorova, Olga; Savinkova, Ludmila

    2017-11-01

    It is known that only a single-nucleotide substitution (SNP: a single nucleotide polymorphism) in the sequence of a TATA box can influence the affinity of the interaction of TBP with the TATA box and contribute to the pathogenesis of complex hereditary human diseases and sometimes may be a cause of monogenic diseases (for instance, β-thalassemia). In the present work, we studied the interaction of human TBP with a double-stranded oligodeoxyribonucleotide (ODN) 15 or 26 bp long identical to a TATA box of promoters of a real-life human gene, TPI or LEP, and labeled with fluorophores TAMRA and FAM. To analyze the interaction of TBP with a TATA box of an ancestral or minor allele (SNP in the TATA box) in real time, we used the stopped-flow method with detection of a Förster resonance energy transfer (FRET) signal. The nature of the resulting kinetic curves reflecting changes in the FRET signal (and therefore of DNA conformation during the interaction with TBP) pointed to a multistage mechanism of the formation of the TBP complex with the TATA-containing ODN. The results showed that with the increasing concentration and length of the ODN, heterogeneity of conformational changes (taking place during the first second of the interaction with TBP) in DNA also increases. In contrast to the initial nonspecific interaction, the subsequent phases strictly depend on TBP concentration: at the TBP:ODN ratio of 10:1, the velocity of change of the FRET signal increases approximately 100-fold.

  4. Differential utilization of TATA box-binding protein (TBP) and TBP-related factor 1 (TRF1) at different classes of RNA polymerase III promoters.

    Science.gov (United States)

    Verma, Neha; Hung, Ko-Hsuan; Kang, Jin Joo; Barakat, Nermeen H; Stumph, William E

    2013-09-20

    In the fruit fly Drosophila melanogaster, RNA polymerase III transcription was found to be dependent not upon the canonical TATA box-binding protein (TBP) but instead upon the TBP-related factor 1 (TRF1) (Takada, S., Lis, J. T., Zhou, S., and Tjian, R. (2000) Cell 101, 459-469). Here we confirm that transcription of fly tRNA genes requires TRF1. However, we unexpectedly find that U6 snRNA gene promoters are occupied primarily by TBP in cells and that knockdown of TBP, but not TRF1, inhibits U6 transcription in cells. Moreover, U6 transcription in vitro effectively utilizes TBP, whereas TBP cannot substitute for TRF1 to promote tRNA transcription in vitro. Thus, in fruit flies, different classes of RNA polymerase III promoters differentially utilize TBP and TRF1 for the initiation of transcription.

  5. The interaction of hyperthermophilic TATA-box binding protein with single-stranded DNA is entropically favorable and exhibits a large negative heat capacity change at high salt concentration.

    Science.gov (United States)

    Nagatoishi, Satoru; Tanaka, Yoshikazu; Kudou, Motonori; Tsumoto, Kouhei

    2009-09-01

    We have investigated the thermodynamics of the interaction between the TATA-box-binding protein from Pyrococcus horikoshii (PhoTBP) and its target DNA (TATA-1). The interaction between PhoTBP and double-stranded DNA (dsDNA) is entropically favorable and enthalpically unfavorable. The thermodynamic parameters for TATA-1 duplex formation in the presence of PhoTBP, that is, ternary PhoTBP-dsDNA complexation, are similar to those for TATA-1 duplex formation, which is enthalpically favorable. Surface plasmon resonance analysis indicates that the interaction between PhoTBP and single-stranded DNA (ssDNA) of TATA-1 is entropy driven and has a large negative heat capacity change (-1.19 kcal mol(-1) K(-1)) at high salt concentration (800 mM NaCl). These results suggest that the favorable entropic effect corresponding to the interaction between PhoTBP and dsDNA is due not to ternary complexation but to the interaction between PhoTBP and ssDNA. This report is the first to describe the thermodynamics of the interaction between TBP and ssDNA.

  6. molecular interactions of the TATA-binding protein

    Indian Academy of Sciences (India)

    Unknown

    variants and lacking a UASGAL, showed that TATA-binding protein (TBP)-TATA complex gets stabilized in the presence of the acidic activator GAL4-VP16. Activator also greatly suppressed the non-specific TBP-DNA complex formation. The effects were more pronounced over weaker TATA boxes. Activator also reduced the.

  7. Characterization of TATA-containing genes and TATA-less genes in S. cerevisiae by network topologies and biological properties.

    Science.gov (United States)

    Yang, Lei; Wang, Jizhe; Lv, Yingli; Hao, Dapeng; Zuo, Yongchun; Li, Xiang; Jiang, Wei

    2014-12-01

    The TATA box is the core sequence of the promoter and the binding site of many transcription factors. Based on the presence or absence of TATA box, genes can be defined as TATA-containing or TATA-less genes. Many important stress-response functions and highly variable expression patterns are found to be correlated with the TATA box. However, until now, the relationships and differences between TATA-containing and TATA-less genes remain unclear. In this study, based on the transcriptional profiling of the Saccharomyces cerevisiae genome, the perturbation sensitivity (PS) network is constructed. The topological and biological properties are used to investigate differences between TATA-containing and TATA-less genes. Significant differences are found in all topological properties and most of the biological properties. Notably, the TF number, determined mathematically by the number of transcription factors regulating a gene, demonstrates the highest discrimination between TATA-containing and TATA-less genes when all properties are estimated by the F-score. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

    Science.gov (United States)

    Kugel, Jennifer F.

    2008-01-01

    An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…

  9. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    International Nuclear Information System (INIS)

    Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

    2011-01-01

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

  10. Nucleosomal TATA-switch: competing orientations of TATA on the nucleosome.

    Science.gov (United States)

    Hapala, Jan; Trifonov, Edward N

    2013-09-15

    Transcription is known to be affected by the rotational setting of the transcription response elements within nucleosomes. We studied the rotational positioning of the TATA box, the most universal promoter motif. We applied a bioinformatic high-resolution nucleosome mapping technique to eukaryotic promoters. Our results show that the nucleosome DNA sequence harboring the TATA box encodes alternative rotational positions for the same piece of DNA. This may serve for switching the gene activity on and off. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. A conserved GA element in TATA-less RNA polymerase II promoters.

    Science.gov (United States)

    Seizl, Martin; Hartmann, Holger; Hoeg, Friederike; Kurth, Fabian; Martin, Dietmar E; Söding, Johannes; Cramer, Patrick

    2011-01-01

    Initiation of RNA polymerase (Pol) II transcription requires assembly of the pre-initiation complex (PIC) at the promoter. In the classical view, PIC assembly starts with binding of the TATA box-binding protein (TBP) to the TATA box. However, a TATA box occurs in only 15% of promoters in the yeast Saccharomyces cerevisiae, posing the question how most yeast promoters nucleate PIC assembly. Here we show that one third of all yeast promoters contain a novel conserved DNA element, the GA element (GAE), that generally does not co-occur with the TATA box. The distance of the GAE to the transcription start site (TSS) resembles the distance of the TATA box to the TSS. The TATA-less TMT1 core promoter contains a GAE, recruits TBP, and supports formation of a TBP-TFIIB-DNA-complex. Mutation of the promoter region surrounding the GAE abolishes transcription in vivo and in vitro. A 32-nucleotide promoter region containing the GAE can functionally substitute for the TATA box in a TATA-containing promoter. This identifies the GAE as a conserved promoter element in TATA-less promoters.

  12. Investigation of reference gene expression during human herpesvirus 6B infection indicates peptidylprolyl isomerase A as a stable reference gene and TATA box binding protein as a gene up-regulated by this virus.

    Science.gov (United States)

    Engdahl, Elin; Dunn, Nicky; Fogdell-Hahn, Anna

    2016-01-01

    When using relative gene expression for quantification of RNA it is crucial that the reference genes used for normalization do not change with the experimental condition. We aimed at investigating the expressional stability of commonly used reference genes during Human herpesvirus 6B (HHV-6B) infection. Expression of eight commonly used reference genes were investigated with quantitative PCR in a T-cell line infected with HHV-6B. The stability of genes was investigated using the 2(-ΔΔCT) method and the algorithms BestKeeper, GeNorm and NormFinder. Our results indicate that peptidylprolyl isomerase A (PPIA) is the most stably expressed gene while TATA box binding protein (TBP) is the least stably expressed gene during HHV-6B infection. In a confirmatory experiment, TBP was demonstrated to be dose and time dependently upregulated by HHV-6B. The stability of PPIA is in line with other studies investigating different herpesvirus infections whereas the finding that HHV-6B significantly upregulates TBP is novel and most likely specific to HHV-6B. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. DNA structural features of eukaryotic TATA-containing and TATA-less promoters.

    Science.gov (United States)

    Yella, Venkata Rajesh; Bansal, Manju

    2017-03-01

    Eukaryotic genes can be broadly classified as TATA-containing and TATA-less based on the presence of TATA box in their promoters. Experiments on both classes of genes have revealed a disparity in the regulation of gene expression and cellular functions between the two classes. In this study, we report characteristic differences in promoter sequences and associated structural properties of the two categories of genes in six different eukaryotes. We have analyzed three structural features, DNA duplex stability, bendability, and curvature along with the distribution of A-tracts, G-quadruplex motifs, and CpG islands. The structural feature analyses reveal that while the two classes of gene promoters are distinctly different from each other, the properties are also distinguishable across the six organisms.

  14. Stronger synergies

    CERN Document Server

    Antonella Del Rosso

    2012-01-01

    CERN was founded 58 years ago under the auspices of UNESCO. Since then, both organisations have grown to become world leaders in their respective fields. The links between the two have always existed but today they are even stronger, with new projects under way to develop a more efficient way of exchanging information and devise a common strategy on topics of mutual interest.   CERN and UNESCO are a perfect example of natural partners: their common field is science and education is one of the pillars on which both are built. Historically, they share a common heritage. Both UNESCO and CERN were born of the desire to use scientific cooperation to rebuild peace and security in the aftermath of the Second World War. "Recently, building on our common roots and in close collaboration with UNESCO, we have been developing more structured links to ensure the continuity of the actions taken over the years," says Maurizio Bona, who is in charge of CERN relations with international orga...

  15. B V R Tata

    Indian Academy of Sciences (India)

    2015-11-27

    Nov 27, 2015 ... Home; Journals; Pramana – Journal of Physics. B V R Tata. Articles written in Pramana – Journal of Physics. Volume 75 Issue 6 December 2010 pp 1209-1214 Conributed Papers. Quasi-elastic laser light scattering study of polyacrylamide hydrogel immersed in water and salt solutions · M Sivanantham ...

  16. Mot1 redistributes TBP from TATA-containing to TATA-less promoters.

    Science.gov (United States)

    Zentner, Gabriel E; Henikoff, Steven

    2013-12-01

    The Swi2/Snf2 family ATPase Mot1 displaces TATA-binding protein (TBP) from DNA in vitro, but the global relationship between Mot1 and TBP in vivo is unclear. In particular, how Mot1 activates transcription is poorly understood. To address these issues, we mapped the distribution of Mot1 and TBP on native chromatin at base pair resolution. Mot1 and TBP binding sites coincide throughout the genome, and depletion of TBP results in a global decrease in Mot1 binding. We find evidence that Mot1 approaches TBP from the upstream direction, consistent with its in vitro mode of action. Strikingly, inactivation of Mot1 leads to both increases and decreases in TBP-genome association. Sites of TBP gain tend to contain robust TATA boxes, while sites of TBP loss contain poly(dA-dT) tracts that may contribute to nucleosome exclusion. Sites of TBP gain are associated with increased gene expression, while decreased TBP binding is associated with reduced gene expression. We propose that the action of Mot1 is required to clear TBP from intrinsically preferred (TATA-containing) binding sites, ensuring sufficient soluble TBP to bind intrinsically disfavored (TATA-less) sites.

  17. Kajian Paduserasi Tata Ruang Daerah (Trd) dengan Tata Guna Hutan (Tgh)

    OpenAIRE

    Syahadat, Epi; Dwiprabowo, Hariyatno

    2013-01-01

    Kajian paduserasi tata ruang daerah dengan tata guna hutan adalah suatu kajian terhadap aturan main dalam pelaksanaan paduserasi rencana tata ruang daerah dengan tata guna hutan, dasar hukum, serta upaya yang dilakukan oleh pemerintah untuk mengoptimalkan struktur ruang daerah sesuai dengan rencana pembangunan/pengembangan daerah. Kajian paduserasi tata ruang daerah dengan tata guna hutan berorientasi terhadap aspek-aspek utama dan pendukung yang menyebabkan keberhasilan maupun kegagalan dari...

  18. Transcription factors operate TATA switches via rotational remodeling of local columnar chromatin structure.

    Science.gov (United States)

    Trifonov, Edward N

    2016-12-01

    Our earlier study on the nucleosomes containing TBP binding sites (TATA boxes) indicated that generally the same sequence, which harbors the TATA box, encodes simultaneously an alternative rotational setting of the box, so that the TATA element is either exposed (position "minor groove out") or hidden in position "minor groove in". The sequence elements (dinucleotides) residing on the inner surface of DNA in contact with histone octamers are identified by calculating YR tracks in the promoter regions of the genes - periodically reappearing YR elements, at distances of 10-11 bases from one another. Non-YR elements of the YR tracks are also verified by nucleosome mapping procedure based on alternation of runs of purines with runs of pyrimidines. The tracks observed in yeast promoter regions are found to split into two, passing further downstream either through the TATA element or 4-6 bases toward the tail of the box. The points of splitting which play the role of TATA switches are located in close vicinity or within the transcription factor binding sites. This suggests the regulatory function of transcription factors changing the YR tracks by over- or under-twisting DNA induced by their binding.

  19. SAGA mediates transcription from the TATA-like element independently of Taf1p/TFIID but dependent on core promoter structures in Saccharomyces cerevisiae.

    Science.gov (United States)

    Watanabe, Kiyoshi; Kokubo, Tetsuro

    2017-01-01

    In Saccharomyces cerevisiae, core promoters of class II genes contain a TATA element, either a TATA box (TATA[A/T]A[A/T][A/G]) or TATA-like element (1 or 2 bp mismatched version of the TATA box). The TATA element directs the assembly of the preinitiation complex (PIC) to ensure accurate transcriptional initiation. It has been proposed the PIC is assembled by two distinct pathways in which TBP is delivered by TFIID or SAGA, leading to the widely accepted model that these complexes mediate transcription mainly from TATA-like element- or TATA box-containing promoters, respectively. Although both complexes are involved in transcription of nearly all class II genes, it remains unclear how efficiently SAGA mediates transcription from TATA-like element-containing promoters independently of TFIID. We found that transcription from the TATA box-containing AGP1 promoter was greatly stimulated in a Spt3p-dependent manner after inactivation of Taf1p/TFIID. Thus, this promoter provides a novel experimental system in which to evaluate SAGA-mediated transcription from TATA-like element(s). We quantitatively measured transcription from various TATA-like elements in the Taf1p-dependent CYC1 promoter and Taf1p-independent AGP1 promoter. The results revealed that SAGA could mediate transcription from at least some TATA-like elements independently of Taf1p/TFIID, and that Taf1p-dependence or -independence is highly robust with respect to variation of the TATA sequence. Furthermore, chimeric promoter mapping revealed that Taf1p-dependence or independence was conferred by the upstream activating sequence (UAS), whereas Spt3p-dependent transcriptional stimulation after inactivation of Taf1p/TFIID was specific to the AGP1 promoter and dependent on core promoter regions other than the TATA box. These results suggest that TFIID and/or SAGA are regulated in two steps: the UAS first specifies TFIID or SAGA as the predominant factor on a given promoter, and then the core promoter structure

  20. Single-molecule fluorescence resonance energy transfer shows uniformity in TATA binding protein-induced DNA bending and heterogeneity in bending kinetics.

    Science.gov (United States)

    Blair, Rebecca H; Goodrich, James A; Kugel, Jennifer F

    2012-09-25

    TATA binding protein (TBP) is a key component of the eukaryotic RNA polymerase II transcription machinery that binds to TATA boxes located in the core promoter regions of many genes. Structural and biochemical studies have shown that when TBP binds DNA, it sharply bends the DNA. We used single-molecule fluorescence resonance energy transfer (smFRET) to study DNA bending by human TBP on consensus and mutant TATA boxes in the absence and presence of TFIIA. We found that the state of the bent DNA within populations of TBP-DNA complexes is homogeneous; partially bent intermediates were not observed. In contrast to the results of previous ensemble studies, TBP was found to bend a mutant TATA box to the same extent as the consensus TATA box. Moreover, in the presence of TFIIA, the extent of DNA bending was not significantly changed, although TFIIA did increase the fraction of DNA molecules bound by TBP. Analysis of the kinetics of DNA bending and unbending revealed that on the consensus TATA box two kinetically distinct populations of TBP-DNA complexes exist; however, the bent state of the DNA is the same in the two populations. Our smFRET studies reveal that human TBP bends DNA in a largely uniform manner under a variety of different conditions, which was unexpected given previous ensemble biochemical studies. Our new observations led to us to revise the model for the mechanism of DNA binding by TBP and for how DNA bending is affected by TATA sequence and TFIIA.

  1. Trust Ownership of the Tata Group

    DEFF Research Database (Denmark)

    Thomsen, Steen

    : the main holding company Tata Sons Limited is majority-owned by charitable trusts. We examine the governance of this remarkable entity. The Trusts own 66% of Tata Sons, the main holding company of the Group, while members of the founding Tata family are very small minority shareholders. The governance...... structure is characterized by managerial distance between trusts and Group companies. The Trusts are almost exclusively concerned with philanthropy, and according to the Articles of Association of Tata Sons Limited, their governance role is limited to nominating two members to the Selection Committee which...

  2. PERANCANGAN TATA LETAK FLEKSIBEL DENGAN TEORI GRAPH

    Directory of Open Access Journals (Sweden)

    Agus Ristono

    2006-01-01

    Full Text Available In this paper, plant layouts is designed by considering the influence of the environment, i.e., the variability of demand. It also considers the new Total of Material Handling Cost (TMHC, which captures the inventory carrying costs. Moreover, the comparison between the distributed and the modular layout performance is presented. Those two types of layout are called as the next generation layout. It shows that the modular layout, which is done by using graph theory, i.e., modified Hamiltonian chain, gives flexibility as good as the distributed layout. Abstract in Bahasa Indonesia : Dalam makalah akan dipaparkan suatu rancangan tata letak yang memperhatikan pengaruh dari lingkungan berupa permintaan yang selalu berubah dari waktu ke waktu. Selain itu digunakan juga ukuran Ongkos Material Handling (OMH yang baru dengan mengakomodasi ongkos simpan selama penanganan bahan. Selanjutnya diberikan juga perbandingan performansi antar tata letak generasi baru, yaitu tata letak terdistribusi dan tata letak modular. Hasil penelitian menunjukkan bahwa tata letak modular dengan menggunakan teori graph, yaitu rantai Hamilton yang dimodifikasi, dapat dikatakan sama fleksibelnya dengan tata letak terdistribusi. Kata kunci: tata letak terdistribusi, tata letak modular, Total Ongkos Material Handling (TOMH, tata letak generasi masa depan

  3. Multimerization of the mouse TATA-binding protein (TBP) driven by its C-terminal conserved domain.

    Science.gov (United States)

    Kato, K; Makino, Y; Kishimoto, T; Yamauchi, J; Kato, S; Muramatsu, M; Tamura, T

    1994-04-11

    The conformational states of the mouse TATA-binding protein (TBP) in solution were studied. A histidine tag and a factor Xa recognition site-carrying mouse TBP was expressed in E. coli, highly purified, and its fundamental functions as a TBP were demonstrated. We analyzed the molecular states of mouse TBP by gel filtration and glycerol gradient sedimentation, and found that TBP forms heterogeneous multimers in solution. Direct binding of TBP molecules to each other was proven by the far-Western procedure. Analyses using TBPs truncated at the N- and C-termini demonstrated that the functionally important C-terminal domain was responsible for homomultimer formation, and the N-terminal domain enhances multimerization. Furthermore, it was found that the TATA sequence dissociates homomultimers, and only monomeric TBP binds to the TATA-box. We suggest that TBP shares structural motifs in the C-terminal conserved domain for intermolecular interaction and TATA-binding.

  4. Effective Governance in the Era of Disruptive Changes in Business Illustrated by the Tata Capital Framework

    DEFF Research Database (Denmark)

    Rose, Caspar; Sherman, David; Haraszuk, Anni

    2015-01-01

    Identifying, assessing, managing, and containing risks is a fundamental responsibility of business and ‘business as usual’ in 2015. The question is: How can businesses be effectively governed in an era of disruptive changes while managing risks of business? This article explores – through the case...... example of Tata Capital, part of the Indian, global conglomerate Tata Group – how to effectively govern in an environment of disruptive forces impacting business while managing risk seen from an audit committee and internal audit perspective. Effective governance through regular evaluation of internal...... financial controls and risk management ensures that the systems of risk management are robust and defensible. This agenda should be integrated into the audit committee oversight and cannot merely reflect a check the box exercise. Instead, as illustrated by the Tata Capital Framework, it must reflect...

  5. Recombinant expression and purification of human TATA binding protein using a chimeric fusion.

    Science.gov (United States)

    Silvers, Robert; Saxena, Krishna; Kudlinzki, Denis; Schwalbe, Harald

    2012-09-01

    The TATA binding protein (TBP) is the central core protein of the transcription factor II D that binds directly to the TATA box and therefore plays an integral part in eukaryotic transcription. This pivotal position of TBP is underlined by the vast number of interaction partners involved. Expression and purification of human TATA binding protein (hTBP) has remained a challenge due to protein instability and the protein loss during expression and purification involved. Here, we present a novel approach for high yield expression and purification of human TBP core (hTBPc) protein. Protein fold and activity are verified by nuclear magnetic resonance (NMR) spectroscopy and microscale thermophoresis (MST). Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Mechanistic Differences in Transcription Initiation at TATA-Less and TATA-Containing Promoters.

    Science.gov (United States)

    Donczew, Rafal; Hahn, Steven

    2018-01-01

    A yeast in vitro system was developed that is active for transcription at both TATA-containing and TATA-less promoters. Transcription with extracts made from cells depleted of TFIID subunit Taf1 demonstrated that promoters of both classes are TFIID dependent, in agreement with recent in vivo findings. TFIID depletion can be complemented in vitro by additional recombinant TATA binding protein (TBP) at only the TATA-containing promoters. In contrast, high levels of TBP did not complement Taf1 depletion in vivo and instead repressed transcription from both promoter types. We also demonstrate the importance of the TATA-like sequence found at many TATA-less promoters and describe how the presence or absence of the TATA element is likely not the only feature that distinguishes these two types of promoters. Copyright © 2017 American Society for Microbiology.

  7. Trust Ownership of the Tata Group

    DEFF Research Database (Denmark)

    Thomsen, Steen

    : the main holding company Tata Sons Limited is majority-owned by charitable trusts. We examine the governance of this remarkable entity. The Trusts own 66% of Tata Sons, the main holding company of the Group, while members of the founding Tata family are very small minority shareholders. The governance...... structure is characterized by managerial distance between trusts and Group companies. The Trusts are almost exclusively concerned with philanthropy, and according to the Articles of Association of Tata Sons Limited, their governance role is limited to nominating two members to the Selection Committee which...... recommends the Chairman of the company’s Board of Directors. Group companies are independently managed, but there are significant cross shareholdings and a member of the founding family, Mr Ratan Tata, chairs the Trusts, holding companies and major subsidiaries. Mr. Cyrus P Mistry, Managing Director...

  8. How to achieve Tat transport with alien TatA

    OpenAIRE

    Hauer, René Steffen; Freudl, Roland; Dittmar, Julia; Jakob, Mario; Klösgen, Ralf Bernd

    2017-01-01

    TatA is an essential and structurally conserved component of all known Twin-arginine transport (Tat) machineries which are able to catalyse membrane transport of fully folded proteins. Here we have investigated if bacterial TatA, or chimeric pea/E. coli TatA derivatives, are capable of replacing thylakoidal TatA in function. While authentic E. coli TatA does not show any transport activity in thylakoid transport experiments, TatA chimeras comprising the transmembrane helix (TMH) of pea TatA a...

  9. A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene

    DEFF Research Database (Denmark)

    Soravia, E; Grebe, A; De Luca, P

    1995-01-01

    have cloned an uPAR DNA segment containing upstream regulatory sequences from both the human and murine genomes. We report that a proximal promoter, contained within 180 bp from the major transcription start sites of the human uPAR gene, drives basal transcription. This region lacks TATA and CAAT boxes...

  10. TATA RUANG RUMAH BANGSAWAN YOGYAKARTA

    Directory of Open Access Journals (Sweden)

    Siti Widayatsari

    2002-01-01

    Full Text Available To Study old buildings, it is necessary to study cultural aspects, hintory, place, environment, spatial arrangement, plan, shape, structure and construction, building materials, dcoration, and other architectural aspects. This article is a part of the result of the whole study about Architecture of the Noble Residence in Yogyakarta, studying especially the soatial arragement. The conslusion of this part of study is architecture of the noble residence in Yogyakarta having some abstract concept as a part of the tradition that couln't explain rationally. Criterias to select noble residences to study are: the owner's relationship to Sri Sultan Hamengku Buwono, locations near kraton inside and outside fortifications, and recent condition. Four selected noble residences are: Yudaningratan, Notoprajan and Mangkubumen. This study aims to discover the traditional norms including regulations and beliefs that gave shape to noble residence's architecture, to give reference for noble residence's conservation and applied proportional design concept to modern vernakular construction. Abstract in Bahasa Indonesia : Kajian mengenai bangunan masa lalu, mencakup aspek budaya, sejarah, tempat, lingkungan, tata letak, denah, bentuk, struktur dan konstruksi, bahan bangunan, dekorasi, dll aspek arsitektural. Artikel ini adalah bagian dari penelitian tentang Arsitektur Rumah Bangsawan di Yogyakarta mengkaji aspek-aspek tersebut, khusus mengemukakan tata-ruang. Kesimpulan kajian dari segi ini, rumah bangsawan Yogyakarta cukup banyak mempunyai konsep-konsep abstrak, sebagai bagian dari tardisi yang tidak dapat diterangkan secara rasional. Dalem di Yogyakarta cukup banyak sehingga tidak mungkin diteliti secara mendetail semuanya, maka dipilih dengan kriteria : perkerabatan pemilik pertama dengan Sri Sultan Hamengku Buwana, lokasi sekitar kraton dan kondisinya saat ini. Berdasarkan kriteria tersebut dipilih empat yaitu: Yudaningratan, Pakuningratan, Notoprajan dan

  11. DTIE, a novel core promoter element that directs start site selection in TATA-less genes.

    Science.gov (United States)

    Marbach-Bar, Nadav; Bahat, Anat; Ashkenazi, Shaked; Golan-Mashiach, Michal; Haimov, Ora; Wu, Shwu-Yuan; Chiang, Cheng-Ming; Puzio-Kuter, Anna; Hirshfield, Kim M; Levine, Arnold J; Dikstein, Rivka

    2016-02-18

    The transcription start site (TSS) determines the length and composition of the 5' UTR and therefore can have a profound effect on translation. Yet, little is known about the mechanism underlying start site selection, particularly from promoters lacking conventional core elements such as TATA-box and Initiator. Here we report a novel mechanism of start site selection in the TATA- and Initiator-less promoter of miR-22, through a strictly localized downstream element termed DTIE and an upstream distal element. Changing the distance between them reduced promoter strength, altered TSS selection and diminished Pol II recruitment. Biochemical assays suggest that DTIE does not serve as a docking site for TFIID, the major core promoter-binding factor. TFIID is recruited to the promoter through DTIE but is dispensable for TSS selection. We determined DTIE consensus and found it to be remarkably prevalent, present at the same TSS downstream location in ≈20.8% of human promoters, the vast majority of which are TATA-less. Analysis of DTIE in the tumor suppressor p53 confirmed a similar function. Our findings reveal a novel mechanism of transcription initiation from TATA-less promoters. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    Science.gov (United States)

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. 75 FR 24747 - TATA Technologies Incorporated, a Subsidiary of TATA Technologies Limited, Formally Known as...

    Science.gov (United States)

    2010-05-05

    ... wages reported under two separate unemployment insurance (UI) tax accounts under the names Tata... acquiring engineering design and product lifecycle management in India. The amended notice applicable to TA...

  14. 75 FR 21352 - Tata Technologies Incorporated; A Subsidiary of Tata Technologies Limited: Formally Known As...

    Science.gov (United States)

    2010-04-23

    ... wages reported under two separate unemployment insurance (UI) tax accounts under the names Tata... acquiring engineering design and product lifecycle management in India. The amended notice applicable to TA...

  15. TATA-binding protein and the retinoblastoma gene product bind to overlapping epitopes on c-Myc and adenovirus E1A protein

    NARCIS (Netherlands)

    Hateboer, G.; Timmers, H.T.M.; Rustgi, A.K.; Billaud, Marc; Veer, L.J. Van 't; Bernards, R.A.

    1993-01-01

    Using a protein binding assay, we show that the amino-teminal 204 amino acids of the c-Myc protein interact di y with a key component of the basal p tdon factor TFID, the TATA box-binding protein (TBP). Essentialy the same region of the c-Myc protein alo binds the product of the retinoblatoma

  16. How to achieve Tat transport with alien TatA.

    Science.gov (United States)

    Hauer, René Steffen; Freudl, Roland; Dittmar, Julia; Jakob, Mario; Klösgen, Ralf Bernd

    2017-08-18

    TatA is an essential and structurally conserved component of all known Twin-arginine transport (Tat) machineries which are able to catalyse membrane transport of fully folded proteins. Here we have investigated if bacterial TatA, or chimeric pea/E. coli TatA derivatives, are capable of replacing thylakoidal TatA in function. While authentic E. coli TatA does not show any transport activity in thylakoid transport experiments, TatA chimeras comprising the transmembrane helix (TMH) of pea TatA are fully active. For minimal catalytic activity it is even sufficient to replace three residues within TMH of E. coli TatA by the corresponding pea residues. Almost any further substitution within TMH gradually raises transport activity in the thylakoid system, while functional characterization of the same set of TatA derivatives in E. coli yields essentially inverse catalytic activities. Closer inspection of the substituted residues suggests that the two transport systems have deviating demands with regard to the hydrophobicity of the transmembrane helix.

  17. Menanamkan Konsep Tata Krama pada Anak melalui Perancangan Game Edukasi

    Directory of Open Access Journals (Sweden)

    Dea Faustina Shaula

    2017-09-01

    Full Text Available Tata krama sangat berperan penting untuk mepermudah manusia untuk diterima di lingkungan masyarakat sekitar. Peran orang tua sangatlah penting dalam pembentukan karakter anak terutama dalam menerapkan sikap tata krama atau sopan santun anak. . Saat ini perilaku anak lebih cenderung kehilangan etika dan sopan santun. Berdasarkan obeservasi yang dilakukan di beberapa sekolah dasar di Semarang ditemui beberapa sikap yang mencerminkan kurangnya tata krama siswa di sekolah. Perlu adanya media yang kreatif untuk menanmkan tata krama kepada anak dengan melibatkan perkembangan teknologi, salah satunya melalui perancanan game edukasi berbasis mobile. Pada penelitian ini,metode yang digunakan adalah metode pengembangan multimedia yang meliputi membuat konsep (concept, merancang desain (design, mengumpulkan bahan (material collecting, pembuatan (assembly, melakukan pengujian (testing, dan evaluasi produk (evaluating. Desain game dibuat desain vektor dengan style karakter chibi yang memiliki ciri kepala besar dan badan mungil atau kecil untuk membuat karakter lebih terlihat lucu. Hasil perancangan ini adalah sebuah game edukasi untuk menanamkan tata krama pada anak.

  18. Virtual Box

    DEFF Research Database (Denmark)

    Davis, Hilary; Skov, Mikael B.; Stougaard, Malthe

    2007-01-01

    . This paper reports on the design, implementation and initial evaluation of Virtual Box. Virtual Box attempts to create a physical and engaging context in order to support reciprocal interactions with expressive content. An implemented version of Virtual Box is evaluated in a location-aware environment...

  19. Prospects for stronger calandria tubes

    International Nuclear Information System (INIS)

    Ells, C.E.; Coleman, C.E.; Hosbons, R.R.; Ibrahim, E.F.; Doubt, G.L.

    1990-12-01

    The CANDU calandria tubes, made of seam welded and annealed Zircaloy-2, have given exemplary service in-reactor. Although not designed as a system pressure containment, calandria tubes may remain intact even in the face of pressure tube rupture. One such incident at Pickering Unit 2 demonstrated the economic advantage of such an outcome, and a case can be made for increasing the probability that other calandria tubes would perform in a similar fashion. Various methods of obtaining stronger calandria tubes are available, and reviewed here. When the tubes are internally pressurized, the weld is the weak section of the tube. Increasing the oxygen concentration in the starting sheet, and thickening the weld, are promising routes to a stronger tube

  20. Homi Bhabha Centre for Science Education, Tata Institute of ...

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 2. Homi Bhabha Centre for Science Education, Tata Institute of Fundamental Research (A Deemed University). Information and Announcements Volume 22 Issue 2 February 2017 pp 189-189 ...

  1. Bento Boxes

    Science.gov (United States)

    Hasio, Cindy

    2010-01-01

    Bento boxes are common objects in Japanese culture, designed to hold enough lunch for one person. They have individual compartments and sometimes multiple tiers for rice, vegetables, and other side dishes. They are made of materials ranging from wood, cloth, aluminum, or plastic. In general, the greater the number of foods, the better the box is…

  2. A conserved TATA-less proximal promoter drives basal transcription from the urokinase-type plasminogen activator receptor gene

    DEFF Research Database (Denmark)

    Soravia, E; Grebe, A; De Luca, P

    1995-01-01

    have cloned an uPAR DNA segment containing upstream regulatory sequences from both the human and murine genomes. We report that a proximal promoter, contained within 180 bp from the major transcription start sites of the human uPAR gene, drives basal transcription. This region lacks TATA and CAAT boxes...... and contains relatively GC-rich proximal sequences. A subregion of this sequence, highly conserved between human and murine genes, contains most of the promoter activity and is specifically bound by HeLa nuclear proteins, one of which belongs to the SP1 class....

  3. Structural basis for TatA oligomerization: an NMR study of Escherichia coli TatA dimeric structure.

    Science.gov (United States)

    Zhang, Yi; Hu, Yunfei; Li, Hongwei; Jin, Changwen

    2014-01-01

    Many proteins are transported across lipid membranes by protein translocation systems in living cells. The twin-arginine transport (Tat) system identified in bacteria and plant chloroplasts is a unique system that transports proteins across membranes in their fully-folded states. Up to date, the detailed molecular mechanism of this process remains largely unclear. The Escherichia coli Tat system consists of three essential transmembrane proteins: TatA, TatB and TatC. Among them, TatB and TatC form a tight complex and function in substrate recognition. The major component TatA contains a single transmembrane helix followed by an amphipathic helix, and is suggested to form the translocation pore via self-oligomerization. Since the TatA oligomer has to accommodate substrate proteins of various sizes and shapes, the process of its assembly stands essential for understanding the translocation mechanism. A structure model of TatA oligomer was recently proposed based on NMR and EPR observations, revealing contacts between the transmembrane helices from adjacent subunits. Herein we report the construction and stabilization of a dimeric TatA, as well as the structure determination by solution NMR spectroscopy. In addition to more extensive inter-subunit contacts between the transmembrane helices, we were also able to observe interactions between neighbouring amphipathic helices. The side-by-side packing of the amphipathic helices extends the solvent-exposed hydrophilic surface of the protein, which might be favourable for interactions with substrate proteins. The dimeric TatA structure offers more detailed information of TatA oligomeric interface and provides new insights on Tat translocation mechanism.

  4. Tata võidujooks Jaguarile ja Roverile / Gail Edmondson, David Welch

    Index Scriptorium Estoniae

    Edmondson, Gail

    2007-01-01

    India autotöösturile Ratan N. Tata kuuluv Tata Motors soovib osta kahjumis olevad Jaguar Carsi ja Land Roveri, mille Ford Motor on enampakkumisele pannud. Kaasautor Nandini Lakshman. Diagramm: Briti brändidest kaugel ees

  5. Genome-wide characterization of the relationship between essential and TATA-containing genes.

    Science.gov (United States)

    Han, Hyun Wook; Bae, Sang Hun; Jung, Yun Hwa; Kim, Ju Han; Moon, Jisook

    2013-03-01

    Essential genes are involved in most survival-related housekeeping functions. TATA-containing genes encode proteins involved in various stress-response functions. However, because essential and TATA-containing genes have been researched independently, their relationship remains unclear. The present study classified Saccharomyces cerevisiae genes into four groups: non-essential non-TATA, non-essential TATA, essential non-TATA, and essential TATA genes. The results showed that essential TATA genes have the most significant codon bias, the highest level of expression, and unique characteristics, including a large number of transcription factor binding sites, a higher degree in protein interaction networks, and significantly different amino acid usage patterns compared with the other gene groups. Notably, essential TATA genes were uniquely involved in functions such as unfolded protein binding, glycolysis, and alcohol and steroid-related processes. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. Glove box

    International Nuclear Information System (INIS)

    Morita, Atsushi

    1990-01-01

    Wire rope earthquake proof supports having sufficient vibration transmitting and attenuating property are disposed between a fixed floor and the bottom of a glove box in order to improve earthquake proofness of the glove box. The vertical weight of the glove box is supported by support legs slidable on the surface of the fixed floor. The wire rope earthquake-proof supports when undergoing a load, cause stretching and rolling against the external force such as earthquakes, and provide flexible spring support and cause a great damping due to friction with strands. Further, the vertical weight is always supported by the support legs and, when a horizontal weight is applied, the glove box slides on the fixed floor freely with slidable members. In this way, stress concentration generated at joint portions of columns and beams can be moderated greatly and earthquake proofness can be improved. Further, quality control and maintenance for the device is almost unnecessary owing to excellent fatigue-resistant characteristics of the wire rope earthquake proof supports. (N.H.)

  7. Aspek Budaya Dalam Keistimewaan Tata Ruang Kota Yogyakarta

    Directory of Open Access Journals (Sweden)

    Suryanto .

    2015-09-01

    Full Text Available Dengan ditetapkannya budaya dan tata ruang kota sebagai penanda keistimewaan Yogyakarta dalam UU No. 13 tahun 2012 tentang Keistimewaan Yogyakarta, maka Yogyakarta merupakan kasus spesifik dalam Penataan Ruang, karena aspek Tata Ruang menjadi salah satu penanda Keistimewaannya. Apa yang istimewa. Apanya yang istimewa dang mengapa istimewa; apakah penanda (tata ruang kota, petanda (konsep budaya atau makna/pesan dari hubungan antara petanda dengan penandanya yang tersirat dalam wujud tata ruang kota Yogya. Penelitian ini berupaya untuk mengenali dan memahami hubungan antara kebudayaan, tata kota dan keistimewaan Yogyakarta. Dari bukti-bukti empiris, kajian tentang kebudayan dan tata ruang kota memerlukan rentang waktu panjang, karena akan menyangkut data longitudinal (diakronik dan lateral (sinkronik. Oleh karena itu studi ini perlu didudukkan dalam bingkai sejarah dan budaya, untuk membaca peristiwa sepanjang perkembangan kota Yogyakarta, dari HB I sampai HB IX. Kemudian untuk memahami makna kaitan antar penanda dan petanda sepanjang perjalanan perkembangan kota, maka digunakan metoda hermeneutika, khususnya Hermeneutik Paul Ricoeur. Dari hasil kajian terhadap obyek tata ruang kota yang dianggap istimewa, maka budaya yang mewujud dalam keistimewaan tata ruang kota Yogyakarta bisa dilihat dari komponen ruang kotanya maupun konfigurasi fungsi ruang kotanya. Kesimpulan penting dari penelitian ini adalah konsep budaya yang mewujud dalam tata ruang kota, yaitu monumental dan pertahanan, yang tidak ditemui di kota manapun di Indonesia. Kemudian dari sisi makna, terjadi perbedaan makna simbol-simbol tata ruang kota di era HB I dan HB IX.Kata kunci. Kebudayaan, tata ruang kota, budaya, Yogyakarta. Since Yogyakarta’s culture and spatiality were proclaimed as special features of Yogyakarta as stated in Law No. 13, 2012 on the Special Region of Yogyakarta, Yogyakarta is recognized as a specific case in spatial planning, because its spatiality is one of

  8. Homi Bhabha Centre for Science Education Tata Institute of ...

    Indian Academy of Sciences (India)

    INF. & ANN. Homi Bhabha Centre for Science Education. Tata Institute of Fundamental Research (A Deemed University. Admission to PhD Programme in Science Education – 2018). We are looking for young people with. • Interest in science education • Flair for teaching and writing • Curiosity about how students learn.

  9. Genome-wide regulation of TATA-binding protein activity

    NARCIS (Netherlands)

    van Werven, F.J.

    2009-01-01

    Transcription, the synthesis of RNA from a DNA template, is a well-controlled process. TATA binding protein (TBP) recruitment to promoters is essential for transcription by all three RNA polymerases, and often is the rate-limiting step of transcription initiation. TBP is incorporated into different

  10. Controlling transcription fidelity via TATA-binding protein dynamics

    NARCIS (Netherlands)

    Koster, M.J.E.

    2015-01-01

    Transcription underlies all cellular processes and responses to internal and external cues. Deregulation of transcription has implications for the fitness of the cell or organism. During my PhD I have investigated the importance of proper TATA-binding protein (TBP) regulation as a mechanism to

  11. Homi Bhabha Centre for Science Education Tata Institute of ...

    Indian Academy of Sciences (India)

    Tata Institute of Fundamental Research (A Deemed University). Admission to PhD Programme in Science Education – 2017 We are looking for young people with. • Interest in science ... mathematical thinking in students at school and college level • Design and technology in the curriculum •. Visual and spatial modes in ...

  12. Glove boxes

    International Nuclear Information System (INIS)

    Eisert, G.A.

    1979-01-01

    An arrangement for effecting access for performing work within a glove box comprises an elongate arm-length impermeable flexible sleeve, a fitting having an aperture therethrough, adapted to be secured in sealing relation in a port, in a wall of the glove box, the fitting including an outwardly extending lip having at least one continuous groove extending around its outer periphery, one end of the sleeve extending through the aperture in fitting and being folded back against the outer periphery of the lip, a resilient fastening ring securing the sleeve in sealing engagement in the groove, clamping means securing the sleeves to the lip and a glove secured in sealing relation via a bushing to the other end of the sleeve. (author)

  13. PENGATURAN KEBIJAKAN PEMERINTAH INDONESIA MENGENAI TATA NIAGA IMPOR PANGAN

    Directory of Open Access Journals (Sweden)

    Sihabudin Sihabudin

    2016-03-01

    This paper is about to do a reformulation of the government's policy regarding the adjustment of the trade system for food imports, in order to find effective policy formulation and efficient in solving the problems that arise regarding the marketing of food imports that has been happening. By using descriptive normative legal analysis, the study found that the common thread of chaos cross trade system for food import regulations which are due to unfitted between national regulations and regional regulations (AFTA, CAFTA, APEC as well as global regulations (GATT-WTO. Thus, administrative reform of domestic and foreign trade are necessary, particularly regarding to the procedure of rice imports. All forms of deviations in import licensing process, document manipulation, and the pattern of non-governmental practices must obtain decisive action, both administratively and legally, as a valuable shock-therapy. Key words: government policy, trade , regulation, import Abstrak Kebijakan adalah keputusan pemerintah yang bersifat umum dan berlaku untuk seluruh anggota masyarakat. Konsekuensi hukum dari menjadi anggota organisasi perdagangan dunia adalah bahwasanya pemerintah Indonesia harus ikut tunduk dan patuh pada kaidah-kaidah yang disepakati dalam persetujuan perdagangan internasional terkait ekspor-impor, termasuk melakukan perubahan terhadap instrumen hukum dan kebijaksanaan pembangunan di sektor perdagangan. Tata niaga beras dan beberapa komoditas pangan lain yang melibatkan impor memiliki dimensi permasalahan yang tidak sederhana, bahkan multi-dimensi, mulai dari ekonomi, politik, bahkan sosio kultural. Kebijakan pemerintah Indonesia mengenai pengaturan tata niaga impor pangan merupakan upaya melindungi produsen dalam negeri dari kegiatan dumping atau karena meningkatnya produk impor, juga untuk melindungi konsumen Indonesia dari produk impor yang tidak memenuhi standar kualitas keamanan dan kesehatan konsumen. Tulisan ini hendak melakukan reformulasi kebijakan

  14. Identification, cloning, and functional analysis of the TATA-less mouse FNDC5 promoter during neural differentiation.

    Science.gov (United States)

    Seifi, Tahere; Ghaedi, Kamran; Tanhaei, Sommayeh; Karamali, Fereshteh; Kiani-Esfahani, Abbas; Peymani, Maryam; Baharvand, Hossein; Nasr-Esfahani, Mohammad-Hossein

    2014-07-01

    FNDC5 (also termed PEP) gene encodes a type I membrane protein which is cleaved and secreted as Irisin hormone. We have identified mouse putative core promoter of FNDC5 and characterized its activity. FNDC5 is located within mouse chromosome 4, spans about 7,534 bp, and consists of 6 exons. The mouse FNDC5 promoter is TATA-less and lacks a consensus initiator sequence. In silico analyses revealed that the core promoter (-561/+101 with respect to translation start site) is located in a GC-rich domain (approximately 70.01 %) with one CpG island as a promoter index and several GC box factors including GC/SP1 which is necessary for transcription of TATA-less promoters. The core promoter showed a lower activity than CMV promoter in CHO and P19 cell lines when located upstream of EGFP CDS in an appropriate expression vector. Data implicated that both exon 1 and intron 1 of the gene are included in the core promoter. Upon treating with retinoic acid, FNDC5 expression was upregulated during embryoid body formation and decreased slowly at final stage of neural differentiation when neurospheres emerged. However, Noggin induction induced up regulation of FNDC5 expression at final stage of neural differentiation. In conclusion, stage dependent expression of FNDC5 is affected by neural induction method used for neural differentiation.

  15. Pengaruh Tata Ruang Perpustakaan STMIK Potensi Utama Terhadap Kepuasan Pengguna

    OpenAIRE

    Sari, Lela Maya

    2010-01-01

    Penelitian ini dilakukan di perpustakaan STMIK Potensi Utama yang berlokasi di Jl. K.L Yos Sudarso Km 6,5 No. 3A, Tj. Mulia Medan. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh tata ruang perpustakaan terhadap kepuasan penggunadi STMIK Potensi Utama. Penelitian ini diharapkan dapat bermanfaat bagi pihak perpustakaan STMIK Potensi Utama, bagi peneliti lain, serta bagi penulis. Penelitian ini adalah termasuk jenis penelitian deskriptif asosiatif yang menggunakan angket sebagai...

  16. Medical applications of accelerators at Tata Memorial Centre

    International Nuclear Information System (INIS)

    Dinshaw, K.A.

    2003-01-01

    The Tata Memorial Centre constitutes the national comprehensive cancer centre for the prevention, diagnosis, treatment and research on cancer. It is well equipped with sophisticated state-of-the-art equipment capable of delivering External Beam Radiotherapy (Ebert) and Brachytherapy. Nearly 400 patients receive Ebert daily at the institute from a team of highly skilled and dedicated radiation oncologists, medical physicists and technologists, making it one of the busiest centres in the country

  17. Rituximab: Apakah Efektif dalam Tata Laksana Sindrom Nefrotik?

    Directory of Open Access Journals (Sweden)

    Sudung O. Pardede

    2016-11-01

    LPB diberikan dua dosis selang waktu dua minggu. Rituximab dapat mengurangi aktivitas penyakit dan memperbaiki sensitivitas terhadap obat imunsupresan. Efek samping yang sering terjadi berupa reaksi akut seperti demam, nyeri abdomen, diare, muntah, ruam kulit, bronkospasme, takikadia, dan hipertensi. Rituximab memberikan hasil yang baik dalam tata laksana sindrom nefrotik refrakter, namun diperlukan uji klinik dengan jumlah sampel yang cukup untuk menilai efikasi dan keamanan obat

  18. Subunit Organization in the TatA Complex of the Twin Arginine Protein Translocase

    OpenAIRE

    White, Gaye F.; Schermann, Sonya M.; Bradley, Justin; Roberts, Andrew; Greene, Nicholas P.; Berks, Ben C.; Thomson, Andrew J.

    2009-01-01

    The Tat system is used to transport folded proteins across the cytoplasmic membrane in bacteria and archaea and across the thylakoid membrane of plant chloroplasts. Multimers of the integral membrane TatA protein are thought to form the protein-conducting element of the Tat pathway. Nitroxide radicals were introduced at selected positions within the transmembrane helix of Escherichia coli TatA and used to probe the structure of detergent-solubilized TatA complexes by EPR spectroscopy. A compa...

  19. ANALISIS KUALITAS PELAYANAN PADA BAGIAN TATA USAHA BERDASARKAN TINGKAT KEPUASAN MAHASISWA

    Directory of Open Access Journals (Sweden)

    Muzakiyah Muzakiyah

    2011-12-01

    Full Text Available Kepuasan pelanggan merupakan hasil (outcome yang dirasakan atas penggunanya produk atau jasa, sama atau melebihi harapan yang diinginkan. Pelayanan di bagian Tata Usaha idealnya lebih bersahabat, cepat dan akurat. Ini berarti orientasi layanan di bagian Tata Usaha harus didasarkan pada kebutuhan mahasiswa. Dalam penelitian ini metode yang digunakan dengan menggunakan Pendekatan Lean ServPerf (Lean Service dan Service Performance. Service Performance digunakan untuk menganalisis tingkat instrumen kinerja pelayanan bagian Tata Usaha. Lean Service digunakan untuk menghilangkan waste aktivitas yang tidak bernilai tambah. Hasil dari penelitian ini, terdapat 14 atribut pelayanan yang perlu dilakukan perbaikan untuk meningkatkan kualitas pelayanan di bagian Tata Usaha Fakultas.

  20. Efektifitas Dukungan Sosial Dokter kepada Orangtua dalam Tata Laksana Anak Asma

    Directory of Open Access Journals (Sweden)

    Fx. Wikan Indrarto

    2016-11-01

    Kesimpulan. Pemberian dukungan sosial dokter tidak berhubungan dengan keberhasilan tata laksana anak asma. Kepuasan orangtua akan pemberian dukungan sosial dokter, terutama diperoleh dari jenis dukungan penghargaan.

  1. Anomalous DNA binding by E2 regulatory protein driven by spacer sequence TATA.

    Science.gov (United States)

    Xi, Zhiqun; Zhang, Yongli; Hegde, Rashmi S; Shakked, Zippora; Crothers, Donald M

    2010-06-01

    We have investigated the anomalously weak binding of human papillomavirus (HPV) regulatory protein E2 to a DNA target containing the spacer sequence TATA. Experiments in magnesium (Mg(2+)) and calcium (Ca(2+)) ion buffers revealed a marked reduction in cutting by DNase I at the CpG sequence in the protein-binding site 3' to the TATA spacer sequence, Studies of the cation dependence of DNA-E2 affinities showed that upon E2 binding the TATA sequence releases approximately twice as many Mg(2+) ions as the average of the other spacer sequences. Binding experiments for TATA spacer relative to ATAT showed that in potassium ion (K(+)) the E2 affinity of the two sequences is nearly equal, but the relative dissociation constant (K(d)) for TATA increases in the order K(+ )TATA relative to ATAT is independent of ion concentration, whereas for Mg(2+) the affinity for TATA drops sharply as ion concentration increases. Thus, ions of increasing positive charge density increasingly distort the E2 binding site, weakening the affinity for protein. In the case of Mg(2+), additional ions are bound to TATA that require displacement for protein binding. We suggest that the TATA sequence may bias the DNA structure towards a conformation that binds the protein relatively weakly.

  2. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    The origin of a chemical reaction between two reactant atoms is associated with the activation energy, on the assumption that, high-energy collisions between these atoms, are the ones that overcome the activation energy. Here, we show that a stronger attractive van der Waals (vdW) and electron-ion Coulomb interactions ...

  3. Model Manajemen Laba Stubben, Tata Kelola dan Nilai Perusahaan Industri Dasar dan Kimia di Indonesia

    OpenAIRE

    Gultom, Riris Rollyna; Ahmar, Nurmala

    2016-01-01

    Implementasi IFRS secarra mandatory berdampak pada semakin bergesernya manajemen laba secara akrual. Model Manajemen Laba Stubben merupakan solusi untuk mengukur manajemen laba. Tata kelola yang baik akan meningkatkan nilai Perusahaan. Riset ini menguji 43 data tahun Perusahaan inndustri dasar dan kimia. Pengujian dilakukan dengan uji analisis regresi berganda. Hasil pengujian menunjukkan bahwa pengukuran tata kelola dengan pendekatan kepemilikan manajerial (KM), komite audit (KA), dewan ...

  4. Tata Kelola Publik Dan Kinerja Keuangan Pemerintah Daerah Di Indonesia

    Directory of Open Access Journals (Sweden)

    Handoko A Hasthoro

    2016-08-01

      Tujuan penelitian ini adalah untuk menguji pengaruh penerapan tata kelola publik terhadap kinerja keuangan pemerintah daerah di Indonesia. Pelaksanaan pemerintahan umum diukur dengan menggunakan transparansi pemerintah daerah, akuntabilitas pemerintah daerah, budaya hukum, dan partisipasi masyarakat. Sejumlah lima puluh pemerintah daerah yang disurvei oleh Tansparency International Indonesia pada tahun 2010 digunakan sebagai sampel. Hasil dari analisis regresi berganda menunjukkan bahwa budaya hukum yang ditunjukkan oleh indeks persepsi korupsi, dan partisipasi masyarakat yang diwakili oleh jumlah pemilih pemilu memiliki pengaruh signifikan positif pada kinerja keuangan pemerintah daerah di Indonesia. Hasil penelitian menunjukkan bahwa penegakan hukum dan pemilu yang adil mendorong kepercayaan masyarakat untuk membayar pajak yang meningkatkan pendapatan asli.

  5. Transcription factor binding site positioning in yeast: proximal promoter motifs characterize TATA-less promoters.

    Science.gov (United States)

    Erb, Ionas; van Nimwegen, Erik

    2011-01-01

    The availability of sequence specificities for a substantial fraction of yeast's transcription factors and comparative genomic algorithms for binding site prediction has made it possible to comprehensively annotate transcription factor binding sites genome-wide. Here we use such a genome-wide annotation for comprehensively studying promoter architecture in yeast, focusing on the distribution of transcription factor binding sites relative to transcription start sites, and the architecture of TATA and TATA-less promoters. For most transcription factors, binding sites are positioned further upstream and vary over a wider range in TATA promoters than in TATA-less promoters. In contrast, a group of 6 'proximal promoter motifs' (GAT1/GLN3/DAL80, FKH1/2, PBF1/2, RPN4, NDT80, and ROX1) occur preferentially in TATA-less promoters and show a strong preference for binding close to the transcription start site in these promoters. We provide evidence that suggests that pre-initiation complexes are recruited at TATA sites in TATA promoters and at the sites of the other proximal promoter motifs in TATA-less promoters. TATA-less promoters can generally be classified by the proximal promoter motif they contain, with different classes of TATA-less promoters showing different patterns of transcription factor binding site positioning and nucleosome coverage. These observations suggest that different modes of regulation of transcription initiation may be operating in the different promoter classes. In addition we show that, across all promoter classes, there is a close match between nucleosome free regions and regions of highest transcription factor binding site density. This close agreement between transcription factor binding site density and nucleosome depletion suggests a direct and general competition between transcription factors and nucleosomes for binding to promoters.

  6. VISUALISASI SISTEM TATA SURYA MENGGUNAKAN ANIMASI 3D

    Directory of Open Access Journals (Sweden)

    Achmad Nur Hamid

    2008-02-01

    Full Text Available Multimedia berkembang pesat seiring dengan perkembangan teknologi. Salah satu aspek yang dipengaruhi adalah dunia pendidikan. Dalam dunia pendidikan multimedia digunakan sebagai media pembelajaran. Dengan aplikasi pembelajaran berbasis multimedia, materi yang disajikan diharapkan lebih menarik dan mudah dipahami. Tujuan dari penulisan skripsi ini adalah untuk membuat aplikasi system tatasurya menggunakan animasi 3 dimensi untuk menunjang sarana belajar yang sudah ada seperti buku. Pengumpulan data dalam pembuatan aplikasi ini dilakukan dengan cara mendayagunakan sumber informasi yang terdapat pada perpustakaan dan sumber informasi lain seperti internet. Aplikasi ini dikembangkan dengan metode pengembangan multimedia menurut Luther yaitu concept, design, material collecting, assembly, testing dan distribution. Dalam pembuatan aplikasi ini menggunakan 3DS Max 2009 sebagai software untuk membuat objek-objek yang terdapat pada system tata surya dengan bentuk 3 dimensi, Adobe Premiere Pro sebagai software untuk menggabungkan suara (audio dan video hasil renderan dari 3DS Max, Adobe Flash CS4 Professional di gunakan sebagai penggabungan semua objek multimedia yang telah dibuat oleh perangkat lunak lainnya. Dengan aplikasi ini siswa dapat memahami materi tentang sistem tata surya dan membuat suasana belajar lebih menyenangkan.

  7. A Random Screen Using a Novel Reporter Assay System Reveals a Set of Sequences That Are Preferred as the TATA or TATA-Like Elements in the CYC1 Promoter of Saccharomyces cerevisiae.

    Science.gov (United States)

    Watanabe, Kiyoshi; Yabe, Makoto; Kasahara, Koji; Kokubo, Tetsuro

    2015-01-01

    In Saccharomyces cerevisiae, the core promoters of class II genes contain either TATA or TATA-like elements to direct accurate transcriptional initiation. Genome-wide analyses show that the consensus sequence of the TATA element is TATAWAWR (8 bp), whereas TATA-like elements carry one or two mismatches to this consensus. The fact that several functionally distinct TATA sequences have been identified indicates that these elements may function, at least to some extent, in a gene-specific manner. The purpose of the present study was to identify functional TATA sequences enriched in one particular core promoter and compare them with the TATA or TATA-like elements that serve as the pre-initiation complex (PIC) assembly sites on the yeast genome. For this purpose, we conducted a randomized screen of the TATA element in the CYC1 promoter by using a novel reporter assay system and identified several hundreds of unique sequences that were tentatively classified into nine groups. The results indicated that the 7 bp TATA element (i.e., TATAWAD) and several sets of TATA-like sequences are preferred specifically by this promoter. Furthermore, we find that the most frequently isolated TATA-like sequence, i.e., TATTTAAA, is actually utilized as a functional core promoter element for the endogenous genes, e.g., ADE5,7 and ADE6. Collectively, these results indicate that the sequence requirements for the functional TATA or TATA-like elements in one particular core promoter are not as stringent. However, the variation of these sequences differs significantly from that of the PIC assembly sites on the genome, presumably depending on promoter structures and reflecting the gene-specific function of these sequences.

  8. Enough is enough: TatA demand during Tat-dependent protein transport.

    Science.gov (United States)

    Hauer, René Steffen; Schlesier, René; Heilmann, Kathleen; Dittmar, Julia; Jakob, Mario; Klösgen, Ralf Bernd

    2013-05-01

    The twin-arginine translocation (Tat(1)) pathway is unique with respect to its property to translocate proteins in a fully folded conformation across ion-tight membranes. In chloroplasts and Gram-negative bacteria, Tat translocase consists of the integral subunits TatB and TatC, which are assumed to constitute the membrane receptor, and TatA, a bitopic membrane protein being responsible in a yet unknown manner for the membrane translocation step. Antibody inhibition of intrinsic thylakoidal TatA activity and recovery of transport by heterologously expressed, purified TatA allowed to exactly quantify the amount of TatA required to catalyse membrane transport of the model Tat substrate 16/23. We can show that TatA concentrations in the 100nM range are sufficient to efficiently catalyse membrane transport of the protein, which corresponds well to the amount of TatA identified in thylakoids. Furthermore, TatA shows cooperativity in its catalytic activity suggesting that Tat translocase operates as an allosteric enzyme complex. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Laryngeal (Voice Box) Cancer

    Science.gov (United States)

    ... ENTCareers Marketplace Find an ENT Doctor Near You Voice Box (Laryngeal) Cancer Voice Box (Laryngeal) Cancer Patient Health Information News media ... laryngeal cancer can be severe with respect to voice, breathing, or swallowing. It is fundamentally a preventable ...

  10. Use of waste plastics in cokemaking at Tata Steel

    Energy Technology Data Exchange (ETDEWEB)

    Krishnan, S.H.; Sharma, R.; Dash, P.S.; Haldar, S.K.; Biswas, B. [Tata Steel, Jamshedpur (India)

    2006-08-15

    Disposal of waste plastics is a serious global issue, and hence it is imperative to explore methods to recycle them for efficient utilisation. The coke making process is considered to be a promising area to which the thermal decomposition of waste plastics is applicable, because the process involves coal carbonisation at a high temperature under a reducing atmosphere. As an outcome of the research work carried out on a laboratory scale followed by plant trials at Tata Steel, it was found that waste plastics recycling process using stamp charged coke ovens is feasible to recover coke, tar, light oil and gas from general waste plastics mixed in coal by carbonisation in coke ovens. It has also been established in the laboratory that waste plastics up to 1% can be used in coke making without any deterioration in coke strength. Plant trials have also indicated that co-carbonisation of waste plastics with coal is a possible solution for its disposal.

  11. LHC Season 2: A stronger machine

    CERN Multimedia

    Dominguez, Daniel

    2015-01-01

    1) New magnets / De nouveaux aimants 2) Stronger connections / Des jonctions électriques renforcées 3) Safer magnets / Des aimants plus sûrs 4) Higher energy beams / Des faisceaux d’énergie plus élevée 5) Narrower beams / Des faisceaux plus serrés 6) Smaller but closer proton packets / Des groupes de protons plus petits mais plus rapprochés 7) Higher voltage / Une tension plus haute 8) Superior cryogenics / Un système cryogénique amélioré 9) Radiation-resistant electronics / Une électronique qui résiste aux radiations 10) More secure vacuum / Un vide plus sûr

  12. A novel method to design S-box based on chaotic map and genetic algorithm

    International Nuclear Information System (INIS)

    Wang, Yong; Wong, Kwok-Wo; Li, Changbing; Li, Yang

    2012-01-01

    The substitution box (S-box) is an important component in block encryption algorithms. In this Letter, the problem of constructing S-box is transformed to a Traveling Salesman Problem and a method for designing S-box based on chaos and genetic algorithm is proposed. Since the proposed method makes full use of the traits of chaotic map and evolution process, stronger S-box is obtained. The results of performance test show that the presented S-box has good cryptographic properties, which justify that the proposed algorithm is effective in generating strong S-boxes. -- Highlights: ► The problem of constructing S-box is transformed to a Traveling Salesman Problem. ► We present a new method for designing S-box based on chaos and genetic algorithm. ► The proposed algorithm is effective in generating strong S-boxes.

  13. A novel method to design S-box based on chaotic map and genetic algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yong, E-mail: wangyong_cqupt@163.com [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Key Laboratory of Electronic Commerce and Logistics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Wong, Kwok-Wo [Department of Electronic Engineering, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon Tong (Hong Kong); Li, Changbing [Key Laboratory of Electronic Commerce and Logistics, Chongqing University of Posts and Telecommunications, Chongqing 400065 (China); Li, Yang [Department of Automatic Control and Systems Engineering, The University of Sheffield, Mapping Street, S1 3DJ (United Kingdom)

    2012-01-30

    The substitution box (S-box) is an important component in block encryption algorithms. In this Letter, the problem of constructing S-box is transformed to a Traveling Salesman Problem and a method for designing S-box based on chaos and genetic algorithm is proposed. Since the proposed method makes full use of the traits of chaotic map and evolution process, stronger S-box is obtained. The results of performance test show that the presented S-box has good cryptographic properties, which justify that the proposed algorithm is effective in generating strong S-boxes. -- Highlights: ► The problem of constructing S-box is transformed to a Traveling Salesman Problem. ► We present a new method for designing S-box based on chaos and genetic algorithm. ► The proposed algorithm is effective in generating strong S-boxes.

  14. Interpreting SCAMPI for a People CMM Appraisal at Tata Consultancy Services

    National Research Council Canada - National Science Library

    Radice, Ron; Hefley, William E; Curtis, Bill; Ferguson, Jack; Hayes, Will

    2005-01-01

    Tata Consultancy Services (TCS) is a large information technology consulting, services, and business process outsourcing organization interested in reducing the costs of conducting process improvement appraisals at its multiple locations...

  15. Shaping 3-D boxes

    DEFF Research Database (Denmark)

    Stenholt, Rasmus; Madsen, Claus B.

    2011-01-01

    Enabling users to shape 3-D boxes in immersive virtual environments is a non-trivial problem. In this paper, a new family of techniques for creating rectangular boxes of arbitrary position, orientation, and size is presented and evaluated. These new techniques are based solely on position data......F) docking experiment against an existing technique, which requires the user to perform the rotation and scaling of the box explicitly. The precision of the users' box construction is evaluated by a novel error metric measuring the difference between two boxes. The results of the experiment strongly indicate...

  16. Penerapan Framework COBIT untuk Identifikasi Tingkat Kematangan Tata Kelola Teknologi Informasi: Studi Kasus di Fasilkom Unwidha

    Directory of Open Access Journals (Sweden)

    Agustinus Suradi

    2017-07-01

    Full Text Available Perkembangan IT sebagai media komunikasi data hingga saat ini berkembang sangat pesat. Peranan teknologi informasi dalam suatu lembaga sangat krusial, namun  masalah  yang sering terjadi di lembaga/ instansi adalah penggunaan teknologi informasi yang ternyata tidak sesuai dengan harapan, oleh karena itu diperlukan tata kelola terhadap penggunaan teknologi informasi. Permasalahan yang dihadapi di Fasilkom Unwidha adalah adanya ketidak puasan layanan IT yang diberikan, terdapatnya gangguan layanan yang tidak segera diatasi, adanya koordinasi maintenance infrastruktur IT yang kurang optimal. Sehingga perlu adanya evaluasi terhadap tata kelola teknologi informasi yang diberikan untuk penyelarasan dengan tujuan organisasi agar visi yang diharapkan dapat tercapai. Penelitian ini membahas tentang kondisi tata kelola teknologi informasi di Fasilkom Unwidha, dan sejauh mana telah menerapkan tata kelola teknologi informasi yang baik. Metode analisis yang digunakan dalam penelitian ini adalah dengan menggunakan  framework Control Objectives for Information and Related Technology (COBIT. Hasil dari analisis ini berupa tingkat kematangan tata kelola  teknologi informasi  yang  mencerminkan  kondisi  tata  kelola  teknologi informasi  di  Fakultas Ilmu Komputer Unwidha. Tingkat kematangan dengan mengacu pada maturity level yang disediakan kerangka kerja COBIT, diperoleh nilai  kematangan 2,84 yaitu pada level Defined Process. Sistem memiliki ruang lingkup Business Goals sebanyak 13, IT Goals sebanyak 18, IT Process sebanyak 30 proses dan 4 Domain.

  17. Early Contacts between Substrate Proteins and TatA Translocase Component in Twin-arginine Translocation*

    Science.gov (United States)

    Fröbel, Julia; Rose, Patrick; Müller, Matthias

    2011-01-01

    Twin-arginine translocation (Tat) is a unique protein transport pathway in bacteria, archaea, and plastids. It mediates the transmembrane transport of fully folded proteins, which harbor a consensus twin-arginine motif in their signal sequences. In Gram-negative bacteria and plant chloroplasts, three membrane proteins, named TatA, TatB, and TatC, are required to enable Tat translocation. Available data suggest that TatA assembles into oligomeric pore-like structures that might function as the protein conduit across the lipid bilayer. Using site-specific photo-cross-linking, we have investigated the molecular environment of TatA under resting and translocating conditions. We find that monomeric TatA is an early interacting partner of functionally targeted Tat substrates. This interaction with TatA likely precedes translocation of Tat substrates and is influenced by the proton-motive force. It strictly depends on the presence of TatB and TatC, the latter of which is shown to make contacts with the transmembrane helix of TatA. PMID:22041896

  18. Early contacts between substrate proteins and TatA translocase component in twin-arginine translocation.

    Science.gov (United States)

    Fröbel, Julia; Rose, Patrick; Müller, Matthias

    2011-12-23

    Twin-arginine translocation (Tat) is a unique protein transport pathway in bacteria, archaea, and plastids. It mediates the transmembrane transport of fully folded proteins, which harbor a consensus twin-arginine motif in their signal sequences. In Gram-negative bacteria and plant chloroplasts, three membrane proteins, named TatA, TatB, and TatC, are required to enable Tat translocation. Available data suggest that TatA assembles into oligomeric pore-like structures that might function as the protein conduit across the lipid bilayer. Using site-specific photo-cross-linking, we have investigated the molecular environment of TatA under resting and translocating conditions. We find that monomeric TatA is an early interacting partner of functionally targeted Tat substrates. This interaction with TatA likely precedes translocation of Tat substrates and is influenced by the proton-motive force. It strictly depends on the presence of TatB and TatC, the latter of which is shown to make contacts with the transmembrane helix of TatA.

  19. Gas Marbles: Much Stronger than Liquid Marbles

    Science.gov (United States)

    Timounay, Yousra; Pitois, Olivier; Rouyer, Florence

    2017-06-01

    Enwrapping liquid droplets with hydrophobic particles allows the manufacture of so-called "liquid marbles" [Aussillous and Quéré Nature (London) 411, 924 (2001); , 10.1038/35082026Mahadevan Nature (London)411, 895 (2001), 10.1038/35082164]. The recent intensive research devoted to liquid marbles is justified by their very unusual physical and chemical properties and by their potential for various applications, from microreactors to water storage, including water pollution sensors [Bormashenko Curr. Opin. Colloid Interface Sci. 16, 266 (2011), 10.1016/j.cocis.2010.12.002]. Here we demonstrate that this concept can be successfully applied for encapsulating and protecting small gas pockets within an air environment. Similarly to their liquid counterparts, those new soft-matter objects, that we call "gas marbles," can sustain external forces. We show that gas marbles are surprisingly tenfold stronger than liquid marbles and, more importantly, they can sustain both positive and negative pressure differences. This magnified strength is shown to originate from the strong cohesive nature of the shell. Those interesting properties could be exploited for imprisoning valuable or polluted gases or for designing new aerated materials.

  20. SISTEM Tata niaga KEDELAI DI DESA CIPEUYEUM, KECAMATAN HAURWANGI, KABUPATEN CIANJUR

    Directory of Open Access Journals (Sweden)

    Aldha Hermianty Alang

    2014-09-01

    Full Text Available ABSTRACTThe objectives of this research were 1 identify the channel, institution, and trade system function of soy in Cipeuyeum Village, Haurwangi District, Cianjur, 2 Analyze the structure and the behavior of soy market in Cipeuyeum Village, Haurwangi District, Cianjur, also 3 Analyze the efficiency of soy trade system at each channel with trade channel margin approach, farmers’ share and profit-cost ratio (π/c. Qualitative and quantitative analysis were used to analyze the data. Qualitative analysis includes: channel and institution of the trade system, analysis of farmers and institutions functions involved in the trade system, analysis of market structure and behavior, trade system margin analysis, farmers’ share analysis, and analysis of π/c ratio.  There are four channels of marketing system in this village with five institutions that identified with the snowball method. The institutions within the trade systems perform their own function and face diverse market structures. Quantitative analysis showed that the most efficient channel is the one with Rp917 for the trade margin, 85,89% for the farmer’s share value, and 7,06 for profit-cost ratio. Therefore, Soybean Farmers should not sell the entire stock system directly to large traders without going through the small traders as it will increase the share of the farmers.Keywords: soy agribusiness, Cipeuyeum village, demand for soy, trade system of soy, soyABSTRAKTujuan dari penelitian ini adalah 1 mengidentifikasi saluran, lembaga, dan fungsi tata niaga kedelai di Desa Cipeuyeum, Kecamatan Haurwangi, Kabupaten Cianjur, 2 menganalisis struktur dan perilaku pasar kedelai di Desa Cipeuyeum, Kecamatan Haurwangi, Kabupaten Cianjur, dan 3 menganlisis efisiensi tata niaga kedelai pada setiap saluran yang ada dengan pendekatan margin tata niaga, farmer’s share, serta rasio keuntungan terhadap biaya (π/c. Analisis data dilakukan secara kualitatif dan kuantitatif. Analisis kualitatif

  1. States agree on stronger physical protection regime

    International Nuclear Information System (INIS)

    2005-01-01

    Full text: Delegates from 89 countries agreed on 8 July to fundamental changes that will substantially strengthen the Convention on the Physical Protection of Nuclear Material (CPPNM). IAEA Director General Mohamed ElBaradei welcomed the agreement in saying 'This new and stronger treaty is an important step towards greater nuclear security by combating, preventing, and ultimately punishing those who would engage in nuclear theft, sabotage or even terrorism. It demonstrates that there is indeed a global commitment to remedy weaknesses in our nuclear security regime.' The amended CPPNM makes it legally binding for States Parties to protect nuclear facilities and material in peaceful domestic use, storage as well as transport. It will also provide for expanded cooperation between and among States regarding rapid measures to locate and recover stolen or smuggled nuclear material, mitigate any radiological consequences of sabotage, and prevent and combat related offences. The original CPPNM applied only to nuclear material in international transport. Conference President Dr. Alec Baer said 'All 89 delegations demonstrated real unity of purpose. They put aside some very genuine national concerns in favour of the global interest and the result is a much improved convention that is better suited to addressing the nuclear security challenges we currently face.' The new rules will come into effect once they have been ratified by two-thirds of the 112 States Parties of the Convention, expected to take several years. 'But concrete actions are already taking place around the world. For more than 3 years, the IAEA has been implementing a systematic Nuclear Security plan, including physical protection activities designed to prevent, detect and respond to malicious acts,' said Anita Nillson, Director of the IAEA's Office of Nuclear Security. The Agency's Nuclear Security Fund, set up after the events of 9/11, has delivered $19.5 million in practical assistance to 121 countries

  2. A minimal tat system from a gram-positive organism - A bifunctional TatA subunit participates in discrete TatAC and TatA complexes

    NARCIS (Netherlands)

    Barnett, James P.; Eijlander, Robyn T.; Kuipers, Oscar P.; Robinson, Colin

    2008-01-01

    The Tat system transports folded proteins across bacterial and thylakoid membranes. In Gram-negative organisms, a TatABC substrate-binding complex and separate TatA complex are believed to coalesce to form an active translocon, with all three subunits essential for translocation. Most Gram-positive

  3. Tata Institute of Fundamental Research School of Physics

    International Nuclear Information System (INIS)

    Daniel, R.R.

    1975-01-01

    The diverse activities currently in progress in the School of Physics at Tata Institute of Fundamental Research, Bombay are reported in detail. The activities involving theoretical and experimental research are grouped under the following areas: (1) pure physics (2) astronomy and space science (3) chemical and biological studies and (4) applied research. In pure physics, studies are in progress in nuclear physics, high energy physics and solid state physics. In astronomy and space science, the fields of investigation comprise: cosmic ray physics, theoretical astrophysics and radio-astronomy. In chemical physics, structure of a variety of systems have been investigated using NMR and Moessbauer techniques. In molecular biology, basic biological processes have been studied in terms of structure and properties of biomolecules. In addition to these areas of pure research, considerable advances have been made in computer science and technology, solid state electronics, microwave engineering and hydrogy. The work done in each one of these areas is briefly summarized. A number of supporting research facilities are mentioned. A brief mention has also been made on the existing education and training programmes. (A.K.)

  4. Annual report 1988-89: Tata Institute of Fundamental Research

    International Nuclear Information System (INIS)

    Isloor, J.D.

    1989-01-01

    The annual report surveys the work of the Tata Institute of Fundamental Research (TIFR), Bombay, during the fiscal year 1988-89. Most of the research activities are organised and carried out in two schools of the Institute, namely, the School of Mathematics and the School of Physics. In the School of Mathematics, active research is carried out in almost every branch of pure mathematics. The School of Physics is engaged in research activities of both theoretical and experimental nature in high energy physics, astrophysics, cosmic rays, space physics, astronomy, nuclear and atomic physics, condensed matter physics, molecular biology, computer science and communication and microwave engineering. TIFR has a Basic Dental Research Unit which carries out intervention studies on oral cancer and precancerous lesions. Its Homi Bhabha Centre for Science Education (HBCSE) carries out programmes for improvement of science education at all levels in the country. TIFR outstation units are: (1) TIFR Centre at Bangalore which in collaboration with the Indian Institute of Science, Bangalore has a programme in Applications of Mathematics (2) Radio Astronomy Centre, Ooty, (3) Baloon Facility, Hyderabad and (4) National Image Processing Facility, Ooty. The academic and research activities of the schools, new technique and instruments and experimental facilities developed and fabricated by various units of TIFR are briefly described. Faculty and section wise list of staff members is given. Lists of publications by the members and other activities such as colloquia, seminars, conferences etc. are also given. (M.G.B.)

  5. RpoD promoters in Campylobacter jejuni exhibit a strong periodic signal instead of a-35 box

    DEFF Research Database (Denmark)

    Petersen, Lise; Larsen, Thomas Schou; Ussery, David

    2003-01-01

    We have used a hidden Markov model (HMM) to identify the consensus sequence of the RpoD promoters in the genome of Campylobacter jejuni. The identified promoter consensus sequence is unusual compared to other bacteria, in that the region upstream of the TATA-box does not contain a conserved -35...... region, but shows a very strong periodic variation in the AT-content and semi-conserved T-stretches, with a period of 10-11 nucleotides. The TATA-box is in some, but not all cases, preceded by a TGx, similar to an extended -10 promoter. We predicted a total of 764 presumed RpoD promoters in the C...... with a training set of 175 genes. This leads to the conclusion that the remaining genes (354) are more rarely preceded by a (RpoD) promoter, and consequently that operon structure may be more widespread in C.jejuni than has been assumed by others. Structural predictions of the regions upstream of the TATA...

  6. Analisis Tata Kelola Teknologi Informasi Menggunakan Kerangka Kerja COBIT 4.1 pada Fakultas Teknik Undip

    Directory of Open Access Journals (Sweden)

    Arini Arumana

    2014-06-01

    Full Text Available Peran teknologi informasi dalam suatu instansi sudah tidak dapat dielakkan lagi, mengingat perkembangannya yang begitu pesat seiring berjalannya waktu. Namun masalah yang sering terjadi di instansi adalah penggunaan teknologi informasi yang kadang tidak sesuai dengan harapan. Oleh karena itu diperlukan tata kelola terhadap penggunaan teknologi informasi yang biasa disebut dengan IT Governance. Fakultas teknik UNDIP adalah salah satu fakultas yang dalam operasionalnya sangat mengandalkan teknologi informasi, baik dalam aktifitas belajar mengajar maupun dalam menjalankan operasional bisnis. Kondisi sekarang di Fakultas Teknik sendiri tidak terdapat suatu indikator yang dapat menyatakan bahwa kinerja TI yang berjalan telah sesuai dengan visi dan misi Fakultas Teknik, oleh karena itu perlu dilakukan analisis tata kelola teknologi informasi, guna mengetahui performa TI sekarang sesuai dengan yang diharapkan oleh managemen atau tidak. Hasil dari analisis ini berupa tingkat kematangan tata kelola TI yang mecerminkan kondisi tata kelola TI di Fakultas Teknik dengan mengacu pada maturity level yang disediakan kerangka kerja COBIT 4.1, yakni dari level 0 (non-existent sampai 5 (optimized. Berdasarkan analisis yang dilakukan, secara garis besar kondisi kematangan tata kelola TI Fakultas Teknik berada pada level 2 yakni repeatable but intuitive. Kondisi ini mengacu pada beberapa kelemahan dalam proses-proses TI yang berjalan, diantaranya penetapan dan dokumentasi tindakan, kebijakan dan prosedur yang minim, serta tidak tersedianya service level yang disetujui bersama.

  7. Thinking outside the Box

    Science.gov (United States)

    Fanshawe, Simon; Sriskandarajah, Dhananjayan

    2010-01-01

    Britain is not only more diverse than ever before, but that diversity itself is growing more diverse. Britain's simplistic "tick-box" approach to identity is in danger of inhibiting the very equality it seeks to promote. To question the tick-box is not to accuse local authorities of "political correctness gone mad". The notion…

  8. ALUMINUM BOX BUNDLING PRESS

    Directory of Open Access Journals (Sweden)

    Iosif DUMITRESCU

    2015-05-01

    Full Text Available In municipal solid waste, aluminum is the main nonferrous metal, approximately 80- 85% of the total nonferrous metals. The income per ton gained from aluminum recuperation is 20 times higher than from glass, steel boxes or paper recuperation. The object of this paper is the design of a 300 kN press for aluminum box bundling.

  9. Implikasi Persyaratan dan Tata Cara Pemberian Izin Penyelenggaraan Pos

    Directory of Open Access Journals (Sweden)

    Sri Wahyuningsih

    2016-03-01

    Full Text Available Abstrak Industri pos sebagai sarana komunikasi dan informasi yang mendukung distribusi diatur dalam UU 38 tahun 2009 tentang Pos Ketentuan Izin Penyelenggaraan Pos selanjutnya diatur dalam Peraturan Pemerintah No.15 tahun 2013, dan Peraturan Menteri Kominfo no.32/2014 tentang Persyaratan dan Tata Cara Pemberian Izin Penyelenggaraan Pos. yaitu Izin Penyelenggaraan Pos Nasional, Izin Penyelenggaraan Pos Provinsi dan Izin Penyelenggaraan Pos Kabupaten/Kota. Kajian membahas implikasi persyaratan izin penyelenggaraan pos dari aspek bisnis dan operasional.Hasil kajian literatur dan data sekunder dengan analisis menggunakan konsep Mattew B.Miles dan A.Michael Huberman,didapatkan kejelasan implikasi terhadap bisnis, penyelenggara pos memiliki peluang menentukan wilayah potensial sedangkan implikasi terhadap aspek operasional penyelenggara pos wajib melakukan kegiatan jaringanya sesuai jenis izin yang diajukan. Penyelenggara pos dapat melakukan interkoneksi untuk pengembangan bisnis dan operasionalnya, sehingga pola bisnis dapat direncanakan lebih efektif dan efisien. Abstract Postal industry as a means of communication and information that support the distribution stipulated in Law 38 of 2009 on the Post Operation License further provisions stipulated in Government Regulation 15 of 2013, and the Regulation of the Minister of Communications and Information Technology no.32 / 2014 on Conditions and Procedures for Granting Licenses Implementation Pos. namely the National Post Operation Permits, Licenses and Permits Province of Post of Post Regency / City. Studies discuss the implications of the requirements of the operating license of the postal business aspects and operasional.Hasil literature review and secondary data analysis using the concept Mattew B.Miles and A.MichaelHuberman, obtained clarity on the business implications, the organizer of the post has a chance determine potential areas while the implications of the operational aspects the

  10. KESESUAIAN LABORATORIUM SEBAGAI SUMBER BELAJAR DI PRODI TATA BOGA

    Directory of Open Access Journals (Sweden)

    Tri Sadha Bakti

    2017-11-01

    Full Text Available Tujuan penelitian ini untuk: (1 Menganalisis kondisi sarana dan prasarana la­­boratorium; (2 ke­sesuaian sarana dan prasarana laboratorium Tata Boga Jurusan TI-FT UM dengan standar minimal laboratorium maupun yang te­lah di­per­sya­rat­kan Permendiknas No.40 tahun 2008. Metode penelitian dan analisis di­gunakan   ranc­ang­an dan statistik deskriftif.  Hasilpenelitian   kondisi peralatan di La­boratorium Pastry (luas ruang 136m2,intensitas cahaya dan kuat arus pencahayaan   710 lux 82,57% se­suai standar minimal. Prasarana   (lantai,warna dinding,sirkulasi uda­ra, tempat cuci peralatan dan bahantersedia dan  memadai. Kondisi laboratorium Pro­duksi(jumlah peralatan, lantai keramik, sirkulasi udara  56,00% sesuai dan me­madai,    di­dukung jendela sepanjang 12m dan exhouse fan dan kipas angin dibe­be­ra­pa titik, re­rataintensitas cahaya 990 lux dengan luas ruangan 80m2, kuat arus pen­ca­hayaan da­lam laboratorium sangat memenuhi. Laboratorium Industri kondisi per­alatan 50,00% me­­menuhi standar,luas ruang 96m2 untuk 30 mahasiswa kurang me­me­nuhi. In­ten­si­tas cahaya 710 lux, kuat arus pencahayaan  laboratorium sudah me­me­nuh­i, namun kon­disi lantai belum memenuhi dari segi kemiringan dan material.

  11. Implementasi Kebijakan Tata Kelola Pemerintahan Daerah Dengan Semangat Euforia Demokrasi Lokal

    Directory of Open Access Journals (Sweden)

    Jaelan Usman

    2011-04-01

    Full Text Available Perjalan reformasi kurang lebih 13 tahun pasca pemerintahan rezim Orde Baru 32 tahun; menimbulkan beberapa pertanyaan kritis yang harus dijawab dalam konteks “Tata Kelola Pemerintahan Daerah, dengan semangat Efouria Demokrasi Lokal”. Beberapa pertanyaan kritis dimaksud, timbul dari praktek desentralisasi dan otonomi daerah, antara lain: Sejauh mana desentralisasi dan otonomi daerah mendorong tumbuhnya demokrasi lokal yang kokoh dan beradab? Bagaimana nasib perkembangan demokrasi lokal pasca Pemilihan Umum Legislatif dan Pemilihan Presiden 2009? Desentralisasi, secara teoretis, merupakan upaya untuk membawa negara lebih dekat dengan masyarakat lokal serta mendorong tumbuhnya tata pemerintahan lokal yang lebih demokratis. Dengan kata lain, tanpa diikuti dengan demokrasi lokal, desentralisasi dan otonomi daerah tidak lebih hanya memindahkan sentralisasi dan korupsi dari pusat ke daerah. Tata pemerintahan lokal yang demokratis, mengedepankan prinsip pemerintahan “dari” masyarakat, dikelola secara akuntabel dan transparan “oleh” masyarakat dan dimanfaatkan secara responsive “untuk” kepentingan masyarakat luas.

  12. Glove box shield

    Science.gov (United States)

    Brackenbush, L.W.; Hoenes, G.R.

    A shield for a glove box housing radioactive material is comprised of spaced apart clamping members which maintain three overlapping flaps in place therebetween. There is a central flap and two side flaps, the side flaps overlapping at the interior edges thereof and the central flap extending past the intersection of the side flaps in order to insure that the shield is always closed when the user wthdraws his hand from the glove box. Lead loaded neoprene rubber is the preferred material for the three flaps, the extent of lead loading depending upon the radiation levels within the glove box.

  13. Voice box (image)

    Science.gov (United States)

    The larynx, or voice box, is located in the neck and performs several important functions in the body. The larynx is involved in swallowing, breathing, and voice production. Sound is produced when the air which ...

  14. The POWHEG-BOX

    OpenAIRE

    Oleari, Carlo

    2010-01-01

    We review the key features of POWHEG, a method for interfacing parton-shower Monte Carlo generators to fixed next-to-leading order QCD computations. We describe a recently introduced framework, the POWHEG-BOX, that allows the automatic POWHEG implementation of any given NLO calculation. We present a few results for Higgs boson production via vector boson fusion and Z + 1 jet production, both processes available in the POWHEG-BOX.

  15. Boxes and Shelves

    OpenAIRE

    Hughes, Dean

    2008-01-01

    The Boxes and Shelves series from 2008 are are all made from the backing card from discarded writing pads. Boxes and Shelves extended my investigation of quotidian materials and their relationship to the origins of creative toil. Since 1996 my research has sought to identify and locate instances where the 'unmeasurable' meets the measurable. I have consistently employed a range of utilitarian materials such as bus seats, bus tickets, puddles, A4 writing paper, to present a series of 'problem ...

  16. Regulation of activity of the yeast TATA-binding protein through intra ...

    Indian Academy of Sciences (India)

    Unknown

    413. Keywords. Chemical cross-linking; dimerization; gene regulation; TBP; transcription; yeast ... [Vanathi P, Mishra A K and Bhargava P 2003 Regulation of activity of the yeast TATA-binding protein through intra-molecular interactions; J. Biosci. ..... Data given was obtained from more than three independent estimations in ...

  17. Regulation of activity of the yeast TATA-binding protein through intra ...

    Indian Academy of Sciences (India)

    ... TATA-binding protein (TBP) activity both in vitro and in vivo. The reversible dimer-monomer transition of TBP is influenced by the buffer conditions in vitro. Using in vitro chemical cross-linking, we found yeast TBP (yTBP) to be largely monomeric in the presence of the divalent cation Mg2+, even at high salt concentrations.

  18. Pretata: predicting TATA binding proteins with novel features and dimensionality reduction strategy.

    Science.gov (United States)

    Zou, Quan; Wan, Shixiang; Ju, Ying; Tang, Jijun; Zeng, Xiangxiang

    2016-12-23

    It is necessary and essential to discovery protein function from the novel primary sequences. Wet lab experimental procedures are not only time-consuming, but also costly, so predicting protein structure and function reliably based only on amino acid sequence has significant value. TATA-binding protein (TBP) is a kind of DNA binding protein, which plays a key role in the transcription regulation. Our study proposed an automatic approach for identifying TATA-binding proteins efficiently, accurately, and conveniently. This method would guide for the special protein identification with computational intelligence strategies. Firstly, we proposed novel fingerprint features for TBP based on pseudo amino acid composition, physicochemical properties, and secondary structure. Secondly, hierarchical features dimensionality reduction strategies were employed to improve the performance furthermore. Currently, Pretata achieves 92.92% TATA-binding protein prediction accuracy, which is better than all other existing methods. The experiments demonstrate that our method could greatly improve the prediction accuracy and speed, thus allowing large-scale NGS data prediction to be practical. A web server is developed to facilitate the other researchers, which can be accessed at http://server.malab.cn/preTata/ .

  19. CRTC1 mediates preferential transcription at neuronal activity-regulated CRE/TATA promoters.

    Science.gov (United States)

    Parra-Damas, Arnaldo; Rubió-Ferrarons, Laura; Shen, Jie; Saura, Carlos A

    2017-12-21

    Gene expression mediated by the transcription factor cAMP-responsive element-binding protein (CREB) is essential for a wide range of brain processes. The transcriptional coactivartor CREB-regulated transcription coactivator-1 (CRTC1) is required for efficient induction of CREB target genes during neuronal activity. However, the mechanisms regulating induction of specific CREB/CRTC1-dependent genes during neuronal activity remain largely unclear. Here, we investigated the molecular mechanisms regulating activity-dependent gene transcription upon activation of the CREB/CRTC1 signaling pathway in neurons. Depolarization and cAMP signals induce preferential transcription of activity-dependent genes containing promoters with proximal CRE/TATA sequences, such as c-fos, Dusp1, Nr4a1, Nr4a2 and Ptgs2, but not genes with proximal CRE/TATA-less promoters (e.g. Nr4a3, Presenilin-1 and Presenilin-2). Notably, biochemical and chromatin immunoprecipitation analyses reveal constitutive binding of CREB to target gene promoters in the absence of neuronal activity, whereas recruitment of CRTC1 to proximal CRE/TATA promoters depends on neuronal activity. Neuronal activity induces rapid CRTC1 dephosphorylation, nuclear translocation and binding to endogenous CREB. These results indicate that neuronal activity induces a preferential binding of CRTC1 to the transcriptional complex in CRE/TATA-containing promoters to engage activity-dependent transcription in neurons.

  20. Live cell imaging shows reversible assembly of the TatA component of the twin-arginine protein transport system.

    Science.gov (United States)

    Alcock, Felicity; Baker, Matthew A B; Greene, Nicholas P; Palmer, Tracy; Wallace, Mark I; Berks, Ben C

    2013-09-17

    The twin-arginine translocation (Tat) machinery transports folded proteins across the cytoplasmic membrane of bacteria and the thylakoid membrane of chloroplasts. It has been inferred that the Tat translocation site is assembled on demand by substrate-induced association of the protein TatA. We tested this model by imaging YFP-tagged TatA expressed at native levels in living Escherichia coli cells in the presence of low levels of the TatA paralogue TatE. Under these conditions the TatA-YFP fusion supports full physiological Tat transport activity. In agreement with the TatA association model, raising the number of transport-competent substrate proteins within the cell leads to an increase in the number of large TatA complexes present. Formation of these complexes requires both a functional TatBC substrate receptor and the transmembrane proton motive force (PMF). Removing the PMF causes TatA complexes to dissociate, except in strains with impaired Tat transport activity. Based on these observations we propose that TatA assembly reaches a critical point at which oligomerization can be reversed only by substrate transport. In contrast to TatA-YFP, the oligomeric states of TatB-YFP and TatC-YFP fusions are not affected by substrate or the PMF, although TatB-YFP oligomerization does require TatC.

  1. TatA complexes exhibit a marked change in organisation in response to expression of the TatBC complex.

    Science.gov (United States)

    Smith, Sarah M; Yarwood, Andrew; Fleck, Roland A; Robinson, Colin; Smith, Corinne J

    2017-04-19

    The twin-arginine translocation (Tat) system is an integral membrane protein complex that accomplishes the remarkable feat of transporting large, fully folded polypeptides across the inner membrane of bacteria, into the periplasm. In Escherichia coli , Tat comprises three membrane proteins: TatA, TatB and TatC. How these proteins arrange themselves in the inner membrane to permit passage of Tat substrates, whilst maintaining membrane integrity, is still poorly understood. TatA is the most abundant component of this complex and facilitates assembly of the transport mechanism. We have utilised immunogold labelling in combination with array tomography to gain insight into the localisation and distribution of the TatA protein in E. coli cells. We show that TatA exhibits a uniform distribution throughout the inner membrane of E. coli and that altering the expression of TatBC shows a previously uncharacterised distribution of TatA in the inner membrane. Array tomography was used to provide our first insight into this altered distribution of TatA in three-dimensional space, revealing that this protein forms linear clusters in the inner membrane of E. coli upon increased expression of TatBC. This is the first indication that TatA organisation in the inner membrane alters in response to changes in Tat subunit stoichiometry. © 2017 The Author(s).

  2. Candidate SNP markers of reproductive potential are predicted by a significant change in the affinity of TATA-binding protein for human gene promoters.

    Science.gov (United States)

    Chadaeva, Irina V; Ponomarenko, Petr M; Rasskazov, Dmitry A; Sharypova, Ekaterina B; Kashina, Elena V; Zhechev, Dmitry A; Drachkova, Irina A; Arkova, Olga V; Savinkova, Ludmila K; Ponomarenko, Mikhail P; Kolchanov, Nikolay A; Osadchuk, Ludmila V; Osadchuk, Alexandr V

    2018-02-09

    The progress of medicine, science, technology, education, and culture improves, year by year, quality of life and life expectancy of the populace. The modern human has a chance to further improve the quality and duration of his/her life and the lives of his/her loved ones by bringing their lifestyle in line with their sequenced individual genomes. With this in mind, one of genome-based developments at the junction of personalized medicine and bioinformatics will be considered in this work, where we used two Web services: (i) SNP_TATA_Comparator to search for alleles with a single nucleotide polymorphism (SNP) that alters the affinity of TATA-binding protein (TBP) for the TATA boxes of human gene promoters and (ii) PubMed to look for retrospective clinical reviews on changes in physiological indicators of reproductive potential in carriers of these alleles. A total of 126 SNP markers of female reproductive potential, capable of altering the affinity of TBP for gene promoters, were found using the two above-mentioned Web services. For example, 10 candidate SNP markers of thrombosis (e.g., rs563763767) can cause overproduction of coagulation inducers. In pregnant women, Hughes syndrome provokes thrombosis with a fatal outcome although this syndrome can be diagnosed and eliminated even at the earliest stages of its development. Thus, in women carrying any of the above SNPs, preventive treatment of this syndrome before a planned pregnancy can reduce the risk of death. Similarly, seven SNP markers predicted here (e.g., rs774688955) can elevate the risk of myocardial infarction. In line with Bowles' lifespan theory, women carrying any of these SNPs may modify their lifestyle to improve their longevity if they can take under advisement that risks of myocardial infarction increase with age of the mother, total number of pregnancies, in multiple pregnancies, pregnancies under the age of 20, hypertension, preeclampsia, menstrual cycle irregularity, and in women smokers

  3. RNA polymerase II components and Rrn7 form a preinitiation complex on the HomolD box to promote ribosomal protein gene expression in Schizosaccharomyces pombe.

    Science.gov (United States)

    Montes, Matías; Moreira-Ramos, Sandra; Rojas, Diego A; Urbina, Fabiola; Käufer, Norbert F; Maldonado, Edio

    2017-02-01

    In Schizosaccharomyces pombe, ribosomal protein gene (RPG) promoters contain a TATA box analog, the HomolD box, which is bound by the Rrn7 protein. Despite the importance of ribosome biogenesis for cell survival, the mechanisms underlying RPG transcription remain unknown. In this study, we found that components of the RNA polymerase II (RNAPII) system, consisting of the initiation or general transcription factors (GTFs) TFIIA, IIB, IIE, TATA-binding protein (TBP) and the RNAPII holoenzyme, interacted directly with Rrn7 in vitro, and were able to form a preinitiation complex (PIC) on the HomolD box. PIC complex formation follows an ordered pathway on these promoters. The GTFs and RNAPII can also be cross-linked to HomolD-containing promoters in vivo. In an in vitro reconstituted transcription system, RNAPII components and Rrn7 were necessary for HomolD-directed transcription. The Mediator complex was required for basal transcription from those promoters in whole cell extract (WCE). The Med17 subunit of Mediator also can be cross-linked to the promoter region of HomolD-containing promoters in vivo, suggesting the presence of the Mediator complex on HomolD box-containing promoters. Together, these data show that components of the RNAPII machinery and Rrn7 participate in the PIC assembly on the HomolD box, thereby directing RPG transcription. © 2017 Federation of European Biochemical Societies.

  4. Stronger Schrödinger-like uncertainty relations

    International Nuclear Information System (INIS)

    Song, Qiu-Cheng; Qiao, Cong-Feng

    2016-01-01

    Highlights: • A stronger Schrödinger-like uncertainty relation in the sum of variances of two observables is obtained. • An improved Schrödinger-like uncertainty relation in the product of variances of two observables is obtained. • A stronger uncertainty relation in the sum of variances of three observables is proposed. - Abstract: Uncertainty relation is one of the fundamental building blocks of quantum theory. Nevertheless, the traditional uncertainty relations do not fully capture the concept of incompatible observables. Here we present a stronger Schrödinger-like uncertainty relation, which is stronger than the relation recently derived by Maccone and Pati (2014) [11]. Furthermore, we give an additive uncertainty relation which holds for three incompatible observables, which is stronger than the relation newly obtained by Kechrimparis and Weigert (2014) [12] and the simple extension of the Schrödinger uncertainty relation.

  5. Channel box compression device

    International Nuclear Information System (INIS)

    Nakamizo, Hiroshi; Tanaka, Yuki.

    1996-01-01

    The device of the present invention reduces the volume of spent fuel channel boxes of power plant facilities to eliminate secondary wastes, suppress generation of radiation sources and improve storage space efficiency. The device has a box-like shape. A support frame is disposed on the lateral side of the box for supporting spent channel boxes. A horizontal transferring unit and a vertical transferring compression unit driven by a driving mechanism are disposed in the support frame. Further, the compression unit may have a rotational compression roller so as to move freely in the transferring unit. In addition, the transferring unit and the driving mechanism may be disposed outside of pool water. With such a constitution, since spent channel boxes are compressed and bent by horizontal movement of the transferring unit and the vertical movement of the compression unit, no cut pieces or cut powders are generated. Further, if the transferring unit and the driving mechanism are disposed outside of the pool water, it is not necessary to make them waterproof, which facilitates the maintenance. (I.S.)

  6. The BOXES Methodology Black Box Dynamic Control

    CERN Document Server

    Russell, David W

    2012-01-01

    Robust control mechanisms customarily require knowledge of the system’s describing equations which may be of the high order differential type.  In order to produce these equations, mathematical models can often be derived and correlated with measured dynamic behavior.  There are two flaws in this approach one is the level of inexactness introduced by linearizations and the other when no model is apparent.  Several years ago a new genre of control systems came to light that are much less dependent on differential models such as fuzzy logic and genetic algorithms. Both of these soft computing solutions require quite considerable a priori system knowledge to create a control scheme and sometimes complicated training program before they can be implemented in a real world dynamic system. Michie and Chambers’ BOXES methodology created a black box system that was designed to control a mechanically unstable system with very little a priori system knowledge, linearization or approximation.  All the method need...

  7. Tata Kelola Sistem Informasi pada Perusahaan Pelayaran Lepas Pantai

    Directory of Open Access Journals (Sweden)

    Bimo Andono

    2017-05-01

    peningkatan tingkat kematangan Sistem Informasi (SI PT BRL menggunakan kerangka kerja COBIT. Dari hasil penelitian ini dapat diketahui arah yang diinginkan manajemen PT BRL serta dapat disusun beberapa rekomendasi untuk dapat mewujudkannya. Tata kelola TI adalah konsep penting yang berkembang di perusahaan TI dan bertindak sebagai patokan untuk mengukur kematangan organisasi TI (Ayat et al. 2011. Secara keseluruhan proses perencanaan dan implementasi Sistem Informasi (SI di PT BRL sudah mengikuti kaidah-kaidah sesuai dengan kerangka kerja COBIT dan Maturity Level-nya berada pada level: 3 – Defined dimana prosedur kerja telah distandarisasi dan didokumentasikan serta dikomunikasikan melalui proses pelatihan. Telah dimandatkan pula bahwa prosedur ini wajib dipatuhi, namun bagaimanapun juga masih ada deviasi prosedur dalam pelaksanaannya yang belum diakomodasi. Sudah ada prosedur yang memiliki standar dan didokumentasikan dengan baik, sudah ada pelatihan formal untuk mengkomunikasikan prosedur dan kebijakan yang dibuat. Namun pada tahap implementasinya masih tergantung pada individu apakah mau melakukan prosedur yang ditetapkan atau tidak. Prosedur yang dibuat masih terbatas pada bentuk formalisasi dari praktik yang ada.Kata kunci: Audit, COBIT, CSF, KPI, KGI

  8. Opto-Box

    CERN Document Server

    Bertsche, David; The ATLAS collaboration; Welch, Steven; Smith, Dale Shane; Che, Siinn; Gan, K.K.; Boyd, George Russell Jr

    2015-01-01

    The opto-box is a custom mini-crate for housing optical modules, which process and transfer optoelectronic data. The system tightly integrates electrical, mechanical, and thermal functionality into a small package of size 35x10x8 cm^3. Special attention was given to ensure proper shielding, grounding, cooling, high reliability, and environmental tolerance. The custom modules, which incorporate Application Specific Integrated Circuits (ASICs), were developed through a cycle of rigorous testing and redesign. In total, fourteen opto-boxes have been installed and loaded with modules on the ATLAS detector. They are currently in operation as part of the LHC run 2 data read-out chain.

  9. The Entamoeba histolytica TBP and TRF1 transcription factors are GAAC-box binding proteins, which display differential gene expression under different stress stimuli and during the interaction with mammalian cells.

    Science.gov (United States)

    Narayanasamy, Ravi Kumar; Castañón-Sanchez, Carlos Alberto; Luna-Arias, Juan Pedro; García-Rivera, Guillermina; Avendaño-Borromeo, Bartolo; Labra-Barrios, María Luisa; Valdés, Jesús; Herrera-Aguirre, María Esther; Orozco, Esther

    2018-03-07

    Entamoeba histolytica is the protozoan parasite responsible for human amebiasis. It causes up to 100,000 deaths worldwide each year. This parasite has two closely related basal transcription factors, the TATA-box binding protein (EhTBP) and the TBP-related factor 1 (EhTRF1). TBP binds to the canonical TATTTAAA-box, as well as to different TATA variants. TRF1 also binds to the TATTTAAA-box. However, their binding capacity to diverse core promoter elements, including the GAAC-element, and their role in gene regulation in this parasite remains unknown. EMSA experiments were performed to determine the binding capacity of recombinant TBP and TRF1 to TATA variants, GAAC and GAAC-like boxes. For the functional analysis under different stress stimuli (e.g. growth curve, serum depletion, heat-shock, and UV-irradiation) and during the interaction with mammalian cells (erythrocytes, MDCK cell monolayers, and hepatocytes of hamsters), RT-qPCR, and gene knockdown were performed. Both transcription factors bound to the different TATA variants tested, as well as to the GAAC-boxes, suggesting that they are GAAC-box-binding proteins. The K D values determined for TBP and TRF1 for the different TATA variants and GAAC-box were in the range of 10 -12  M to 10 -11  M. During the death phase of growth or in serum depletion, Ehtbp mRNA levels significantly increased, whereas the mRNA level of Ehtrf1 did not change under these conditions. Ehtrf1 gene expression was negatively regulated by UV-irradiation and heat-shock stress, with no changes in Ehtbp gene expression. Moreover, Ehtrf1 gene also showed a negative regulation during erythrophagocytosis, liver abscess formation, and a transient expression level increase at the initial phase of MDCK cell destruction. Finally, the Ehtbp gene knockdown displayed a drastic decrease in the efficiency of erythrophagocytosis in G3 trophozoites. To our knowledge, this study reveals that these basal transcription factors are able to bind multiple

  10. Processing by rhomboid protease is required for Providencia stuartii TatA to interact with TatC and to form functional homo-oligomeric complexes.

    Science.gov (United States)

    Fritsch, Maximilian J; Krehenbrink, Martin; Tarry, Michael J; Berks, Ben C; Palmer, Tracy

    2012-06-01

    The twin arginine transport (Tat) system transports folded proteins across the prokaryotic cytoplasmic membrane and the plant thylakoid membrane. In Escherichia coli three membrane proteins, TatA, TatB and TatC, are essential components of the machinery. TatA from Providencia stuartii is homologous to E. coli TatA but is synthesized as an inactive pre-protein with an N-terminal extension of eight amino acids. Removal of this extension by the rhomboid protease AarA is required to activate P. stuartii TatA. Here we show that P. stuartii TatA can functionally substitute for E. coli TatA provided that the E. coli homologue of AarA, GlpG, is present. The oligomerization state of the P. stuartii TatA pro-protein was compared with that of the proteolytically activated protein and with E. coli TatA. The pro-protein still formed small homo-oligomers but cannot form large TatBC-dependent assemblies. In the absence of TatB, E. coli TatA or the processed form of P. stuartii TatA form a complex with TatC. However, this complex is not observed with the pro-form of P. stuartii TatA. Taken together our results suggest that the P. stuartii TatA pro-protein is inactive because it is unable to interact with TatC and cannot form the large TatA complexes required for transport. © 2012 Blackwell Publishing Ltd.

  11. Teaching with Box Tops.

    Science.gov (United States)

    Raiser, Lynne; D'Zamko, Mary Elizabeth

    1984-01-01

    Using environmental materials (such as the phone book and placemats from fast food restaurants) can be a motivating way to teach learning disabled students skills and concepts, as shown in an approach to reading, math, science and nutrition, and social studies instruction using a JELL-O brand gelatin box. (CL)

  12. Glove box posting system

    International Nuclear Information System (INIS)

    McIntosh, A.E.

    1981-01-01

    A system for posting objects into closed containers, such as glove boxes, is described in which the bag used, preferably made of plastic, does not have to be fitted and sealed by the operator during each posting operation. (U.K.)

  13. Many-box locality

    Science.gov (United States)

    Zhou, Yuqian; Cai, Yu; Bancal, Jean-Daniel; Gao, Fei; Scarani, Valerio

    2017-11-01

    There is an ongoing search for a physical or operational definition for quantum mechanics. Several informational principles have been proposed which are satisfied by a theory less restrictive than quantum mechanics. Here, we introduce the principle of "many-box locality," which is a refined version of the previously proposed "macroscopic locality." These principles are based on coarse graining the statistics of several copies of a given box. The set of behaviors satisfying many-box locality for N boxes is denoted LNM B. We study these sets in the bipartite scenario with two binary measurements, in relation with the sets Q and Q1 +A B of quantum and "almost quantum" correlations, respectively. We find that the LNM B sets are, in general, not convex. For unbiased marginals, by working in the Fourier space we can prove analytically that LNM B⊈Q for any finite N , while L∞M B=Q . Then, with suitably developed numerical tools, we find an example of a point that belongs to L16M B but not to Q1 +A B. Among the problems that remain open is whether Q ⊂L∞M B .

  14. Mystery Box Marvels

    Science.gov (United States)

    Santos, Joel; Centurio, Tina

    2012-01-01

    What happens in the first week of school could very well set the stage for the rest of the school year. Setting high standards for science activities based in inquiry can start on the first day of science class and develop as the year unfolds. With the use of simple, readily available, inexpensive materials, an efficient mystery box lesson can be…

  15. IN-A-BOX

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 7; Issue 2. Claude Elwood Shannon. Priti Shankar. Article-in-a-Box Volume 7 Issue 2 February 2002 pp 2-3 ... Author Affiliations. Priti Shankar1. Department of Computer Science & Automation, Indian Institute of Science, Bangalore 560 012, India.

  16. IN-A-BOX

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 12. Vikram A Sarabhai. Mrinalini Sarabhai. Article-in-a-Box Volume 6 Issue 12 December 2001 pp 5-7. Fulltext. Click here to view fulltext PDF. Permanent link: http://www.ias.ac.in/article/fulltext/reso/006/12/0005-0007. Author Affiliations. Mrinalini ...

  17. PERENCANAAN TATA GUNA LAHAN DAS WAY SEPUTIH HULU LAMPUNG TENGAH MENGGUNAKAN MODEL TATA AIR (Landuse Planning for Way Seputih Watershed at Central Lampung by Water Management Model

    Directory of Open Access Journals (Sweden)

    Mohammad Amin

    2008-11-01

    Full Text Available ABSTRAK Das Way Seputih Hulu merupakan sungai yang terletak di Kabupaten Larnpung Tengah, merniliki luas 175,28 km2. Kejadian banjir di Desa Segalarninder hilir Way Seputih Hulu terjadi setiap datang musim penghujan. Hasil penelitian bempa software program tata-air.exe, konsep dasar rnodel menggunakan neraca air (waterbalance yang dibuat dengart program delphi versi 7. Hasil uji t-tes antara tebal aliran model simulasi dengan pengukuran lapangan menunjukkan nilai t-hitung (0,14 lebih besar dari t-tabel (2,51, sehingga dikatakan model dapat digunakan untuk melakukan simulasi berbagai alternatif penggunaan lahan. Hasil simulasi program tata-air.exe menunjukkan bahwa keseluruhan alternatif untuk eksperimentasi model menghasilkan nilai rasio tebal aliran di bawah angka 30. Kondisi rasio tebal aliran air Way Seputih Hulu memiliki nilai berkisar antara 2,84 sanrpai 3,40, sehingga dapat dikatakan dalam kondisi masih wajar bahkan dapat dikatakan mempunvai nilai yang cukup bagus. Alternatif penggunaan lahan yang mengarah kepada bentuk lahan kebun campuran akan memberikan nilai rasio paling kecil dan menghasilkan produksi air yang kecil pula.   ABSTRACT  Watersheed of Way Seputih Upstream represent river which located in Kabupaten Lampung Tengah, oing wide of 175,28 km2. Occurence of floods in Countryside of Segalaminder go downstream Way Seputih Upstream happened in every coming rain season. Result of the research namely tata-air.exe, base concept of modeling uses water balance was made by using Delphi 7th version. Result of t-test value between modeled discharge flow and field measurement result shows t-counting value (0.14 higher than t-table (2.51, hence the model is can be used for simulating various landuse alternative. The simulation result using tata-air.exe shows that entire alternatives for model experimentation resulted discharge ratio value was under 30. Condition of Way Seputih Hulu River discharge was in the range between 2.84 until 3

  18. PERAN DINAS TATA RUANG DAN CIPTA KARYA DALAM PENGELOLAAN SAMPAH DI KABUPATEN BULUKUMBA

    Directory of Open Access Journals (Sweden)

    Akhmad Affandi

    2015-10-01

        Penelitian ini bertujuan untuk menjelaskan peran dan upaya Dinas Tata Ruang dan Cipta Karya dalam mengelola sampah di Kabupaten Bulukumba. Jenis penelitian ini adalah Kualitatif dengan teknik pengumpulan data menggunakan instrumen wawancara dan observasi. Data tersebut dianalisis secara deskriktif dan interpretasi kepada informan dengan melakukan wawancara. Hasil penelitian menunjukkan bahwa: dalam melaksanakan peran sebagai implementor dan pengawas terhadap pengelolaan sampah di Kabupaten Bulukumba, Dinas Tata Ruang dan Cipta Karya Kabupaten Bulukumba belum dapat memberikan hasil yang maksimal. Belum maksimalnya hasil tersebut dipengaruhi oleh kurangnya sumber daya manusia serta masih minimnya sarana dan prasarana yang tersedia memiliki pengaruh lebih besar dalam pengelolaan sampah. Adapun faktor pendukung yakni: partisipasi masyarakat dan ketersediaan lahan (TPA.

  19. Bibliometric dimension of innovation communication productivity of Tata Institute of Social Sciences

    OpenAIRE

    Koganuramath, M. M.; Angadi, Mallikarjun; Kademani, B. S.

    2002-01-01

    Bibliometric analysis of 663 papers published by the social scientists of Tata Institute of Social Sciences during 1990-2000 in diverse domains: Criminology and Correctional Administration, Extra Mural Studies, Family and Child Welfare, Health Service Studies, Medical and Psychiatric Social work, Personnel Management and Industrial Relations, Research Methodology, Social Welfare Administration, and Urban and Rural Community Development, and Research Units: Social Work Education and Practice ...

  20. Opto-Box

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00377159; The ATLAS collaboration

    2015-01-01

    The opto-box is a custom mini-crate for housing optical modules, which process and transfer optoelectronic data. Many novel solutions were developed for the custom design and manufacturing. The system tightly integrates electrical, mechanical, and thermal functionality into a small package of size 35x10x8 cm$^{3}$. Special attention was given to ensure proper shielding, grounding, cooling, high reliability, and environmental tolerance. The custom modules, which incorporate Application Specific Integrated Circuits (ASICs), were developed through a cycle of rigorous testing and redesign. In total, fourteen opto-boxes have been installed and loaded with modules on the ATLAS detector. They are currently in operation as part of the LHC run 2 data read-out chain.

  1. Boxed Permutation Pattern Matching

    DEFF Research Database (Denmark)

    Amit, Mika; Bille, Philip; Cording, Patrick Hagge

    2016-01-01

    the goal is to only find the boxed subsequences of T that are order-isomorphic to P. This problem was introduced by Bruner and Lackner who showed that it can be solved in O(n3) time. Cho et al. [CPM 2015] gave an O(n2m) time algorithm and improved it to O(n2 logm). In this paper we present a solution...

  2. The Box Method

    DEFF Research Database (Denmark)

    Nielsen, Peter Vilhelm

    The velocity level in a room ventilated by jet ventilation is strongly influenced by the supply conditions. The momentum flow in the supply jets controls the air movement in the room and, therefore, it is very important that the inlet conditions and the numerical method can generate a satisfactor...... description of this momentum flow. The Box Method is a practical method for the description of an Air Terminal Device which will save grid points and ensure the right level of the momentum flow....

  3. Subunit organization in the TatA complex of the twin arginine protein translocase: a site-directed EPR spin labeling study.

    Science.gov (United States)

    White, Gaye F; Schermann, Sonya M; Bradley, Justin; Roberts, Andrew; Greene, Nicholas P; Berks, Ben C; Thomson, Andrew J

    2010-01-22

    The Tat system is used to transport folded proteins across the cytoplasmic membrane in bacteria and archaea and across the thylakoid membrane of plant chloroplasts. Multimers of the integral membrane TatA protein are thought to form the protein-conducting element of the Tat pathway. Nitroxide radicals were introduced at selected positions within the transmembrane helix of Escherichia coli TatA and used to probe the structure of detergent-solubilized TatA complexes by EPR spectroscopy. A comparison of spin label mobilities allowed classification of individual residues as buried within the TatA complex or exposed at the surface and suggested that residues Ile(12) and Val(14) are involved in interactions between helices. Analysis of inter-spin distances suggested that the transmembrane helices of TatA subunits are arranged as a single-walled ring containing a contact interface between Ile(12) on one subunit and Val(14) on an adjacent subunit. Experiments in which labeled and unlabeled TatA samples were mixed demonstrate that TatA subunits are exchanged between TatA complexes. This observation is consistent with the TatA dynamic polymerization model for the mechanism of Tat transport.

  4. PENERAPAN METODE TUTOR SEBAYA UNTUK MENINGKATKAN KETERAMPILANPREPARE DANTABLE SET UP DALAM MATA KULIAH TATA HIDANG

    Directory of Open Access Journals (Sweden)

    Wahyuningsih Wahyuningsih

    2011-02-01

    Full Text Available This learning teching research was intended to improve the learning outcomes of the students practicing in the subject of prepare and table set up, the main subject of Tata Hidang I (Servicing Arragements I. The subject for this research consisted of 18 S1 students of the learning group number 02 for the study Program for PKK, concentrating on Tata Boga, Departement of Service & Production Technology, the Technical Faculty of Semarang State University for the academic period of 2009-2010. This research was conducted in the gasal semester of the academic year of 2009-2010. The needed data were collected by means of tests and obsevation on the learning outcomes of the students practicing in the sub-subject of Prepare and Table Set up. The data collection used grading sheets for practices in Tata Hidang as its instrument. The data were then analized using the method of descriptive presentation. This was a classroom-action research planned in three cycles. The second and third cycles were implemented based on reflections on the first cycle and on improvements that should be reached. Every cycle consisted of two face to face encounters and of 4 activities: (1planning, (2 implementations, (3 observations, (4 reflections. The results of this research showed that the use of peeer tutorials for the learning-teching pocesses had positive effects both on the students and the lecturers that it might improve the quality of lecturing for the Tata Hidang I. The grades obtained by the students from practicing in the sub-subject of prepare and table set up increased from the lowest grade C (46.7% BC and B (60% and AB (26.6 %, and AB (26.6%.. Trough the three cycles, the number of BC grade decreased from 66% to only 20%. Based on the results of this research, it is recommended that peer tutorial for the subject of Tata Hidang I and Servicing in Food & Beverage should be continued in order that the educational serveices provided to the practicing students might be

  5. Women's political participation leads to stronger local economies ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Edgard Rodriguez - IDRC. Women attend a self-help group meeting near Hyderabad, India. Keenara Khanderia. Under changes to India's constitution, Indian women are gaining a stronger political voice. Legal reforms are encouraging women to contribute to economic growth and investments in community growth.

  6. A Stronger Reason for the Right to Sign Languages

    Science.gov (United States)

    Trovato, Sara

    2013-01-01

    Is the right to sign language only the right to a minority language? Holding a capability (not a disability) approach, and building on the psycholinguistic literature on sign language acquisition, I make the point that this right is of a stronger nature, since only sign languages can guarantee that each deaf child will properly develop the…

  7. Outside the box

    International Nuclear Information System (INIS)

    Pichon, Max

    2011-01-01

    Full text: Queensland-based Hydrasyst wants to take its motto of 'Do more with less' into the greywater sector with a new water recycling and energy recovery technology launched in November, called The Grey Box. The company is initially targeting large industrial laundries as they are major generators of greywater and heavy energy users, but it has ambitions well beyond that. The average commercial laundry consumes 1-5ML of water a week, using about 16 litres for every 1kg of clothing washed. Hydrasyst director Stephen Balemi said The Grey Box can slash the volume by 80 per cent. While he was reluctant to disclose too much technical detail, he claimed it is the only technology serving the $1 billion a year laundry sector that combines microfiltration / ultrafiltration membrane technology and energy reduction components. The heart of the system is a ceramic hollow fibre membrane. Balemi said it produces higher filtrate quality than competitors, meaning the recycled water can be reused more often, and can process feed water of up to 70°C compared to typical ultrafiltration membranes that cap out at about 38°C. This means the recycled water can be reused at higher temperatures, with the heat in it recovered by a precise steam heater built into The Grey Box. “As an overall measure, it saves 80 per cent of the water that is processed and saves 20 per cent of the energy,” Balemi said. Four systems have already been installed, with one going into a large commercial laundry in south Queensland and another to AMP's state-of-the-art 6 Green Star building in Brisbane. “We can modify them slightly to suit the industry, depending on the quality of raw water they are trying to recycle and also depending on the size of the project,,” said Balemi. Where many organisations build systems to specification, The Grey Box is offered in three standard sizes: the HY20 (20kL per day, based on a 10 hour day), HY80 (80kL per day) and HY130 (130kL per day). They can

  8. Two-step mechanism for modifier of transcription 1 (Mot1) enzyme-catalyzed displacement of TATA-binding protein (TBP) from DNA.

    Science.gov (United States)

    Moyle-Heyrman, Georgette; Viswanathan, Ramya; Widom, Jonathan; Auble, David T

    2012-03-16

    The TATA box binding protein (TBP) is a central component of the transcription preinitiation complex, and its occupancy at a promoter is correlated with transcription levels. The TBP-promoter DNA complex contains sharply bent DNA and its interaction lifetime is limited by the ATP-dependent TBP displacement activity of the Snf2/Swi2 ATPase Mot1. Several mechanisms for Mot1 action have been proposed, but how it catalyzes TBP removal from DNA is unknown. To better understand the Mot1 mechanism, native gel electrophoresis and FRET were used to determine how Mot1 affects the trajectory of DNA in the TBP-DNA complex. Strikingly, in the absence of ATP, Mot1 acts to unbend DNA, whereas TBP remains closely associated with the DNA in a stable Mot1-TBP-DNA ternary complex. Interestingly, and in contrast to full-length Mot1, the isolated Mot1 ATPase domain binds DNA, and its affinity for DNA is nucleotide-dependent, suggesting parallels between the Mot1 mechanism and DNA translocation-based mechanisms of chromatin remodeling enzymes. Based on these findings, a model is presented for Mot1 that links a DNA conformational change with ATP-induced DNA translocation.

  9. Substrate-triggered position switching of TatA and TatB during Tat transport in Escherichia coli.

    Science.gov (United States)

    Habersetzer, Johann; Moore, Kristoffer; Cherry, Jon; Buchanan, Grant; Stansfeld, Phillip J; Palmer, Tracy

    2017-08-01

    The twin-arginine protein transport (Tat) machinery mediates the translocation of folded proteins across the cytoplasmic membrane of prokaryotes and the thylakoid membrane of plant chloroplasts. The Escherichia coli Tat system comprises TatC and two additional sequence-related proteins, TatA and TatB. The active translocase is assembled on demand, with substrate-binding at a TatABC receptor complex triggering recruitment and assembly of multiple additional copies of TatA; however, the molecular interactions mediating translocase assembly are poorly understood. A 'polar cluster' site on TatC transmembrane (TM) helix 5 was previously identified as binding to TatB. Here, we use disulfide cross-linking and molecular modelling to identify a new binding site on TatC TM helix 6, adjacent to the polar cluster site. We demonstrate that TatA and TatB each have the capacity to bind at both TatC sites, however in vivo this is regulated according to the activation state of the complex. In the resting-state system, TatB binds the polar cluster site, with TatA occupying the TM helix 6 site. However when the system is activated by overproduction of a substrate, TatA and TatB switch binding sites. We propose that this substrate-triggered positional exchange is a key step in the assembly of an active Tat translocase. © 2017 The Authors.

  10. 46 CFR 111.81-1 - Outlet boxes and junction boxes; general.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Outlet boxes and junction boxes; general. 111.81-1... ELECTRIC SYSTEMS-GENERAL REQUIREMENTS Outlet Boxes and Junction Boxes § 111.81-1 Outlet boxes and junction boxes; general. (a) The requirements of this subpart apply to each outlet box used with a lighting...

  11. The Classroom Animal: Box Turtles.

    Science.gov (United States)

    Kramer, David C.

    1986-01-01

    Provides basic information on the anatomy, physiology, behaviors, and distribution patterns of the box turtle. Offers suggestions for the turtle's care and maintenance in a classroom environment. (ML)

  12. Characterize the relationship between essential and TATA-containing genes for S. cerevisiae by network topologies in the perturbation sensitivity network.

    Science.gov (United States)

    Yang, Lei; Wang, Shiyuan; Zhou, Meng; Chen, Xiaowen; Zuo, Yongchun; Lv, Yingli

    2016-10-01

    Essential genes are those that are indispensable for the survival and propagation of an organism. TATA-containing genes are associated with responses to various stresses and are highly regulated. Although both essential genes and TATA genes are very important in the function of biological systems, their relationship remains unclear because they have typically been researched independently. In this study, to investigate the relationship between essential genes and TATA genes, S. cerevisiae genes were classified as: essential TATA-containing, non-essential TATA-containing, essential non-TATA, and non-essential non-TATA genes. Network-based methods were applied to analyze these four gene categories in the S. cerevisiae perturbation sensitivity (PS) network, which was created from the transcriptional profiling of hundreds of different gene disruptions. All of the topological properties were found to be statistically discriminative among the four gene categories, and the non-essential TATA-containing genes had the most important roles in the yeast PS network. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Escherichia coli TatA and TatB Proteins Have N-out, C-in Topology in Intact Cells*

    Science.gov (United States)

    Koch, Sabrina; Fritsch, Maximilian J.; Buchanan, Grant; Palmer, Tracy

    2012-01-01

    The twin arginine protein transport (Tat) system translocates folded proteins across the cytoplasmic membrane of prokaryotes and the thylakoid membrane of chloroplasts. In Escherichia coli, TatA, TatB, and TatC are essential components of the machinery. A complex of TatB and TatC acts as the substrate receptor, whereas TatA is proposed to form the Tat transport channel. TatA and TatB are related proteins that comprise an N-terminal transmembrane helix and an adjacent amphipathic helix. Previous studies addressing the topological organization of TatA have given conflicting results. In this study, we have addressed the topological arrangement of TatA and TatB in intact cells by labeling of engineered cysteine residues with the membrane-impermeable thiol reagent methoxypolyethylene glycol maleimide. Our results show that TatA and TatB share an N-out, C-in topology, with no evidence that the amphipathic helices of either protein are exposed at the periplasmic side of the membrane. We further show that the N-out, C-in topology of TatA is fixed and is not affected by the absence of other Tat components or by the overproduction of a Tat substrate. These data indicate that topological reorganization of TatA is unlikely to accompany Tat-dependent protein transport. PMID:22399293

  14. Escherichia coli TatA and TatB proteins have N-out, C-in topology in intact cells.

    Science.gov (United States)

    Koch, Sabrina; Fritsch, Maximilian J; Buchanan, Grant; Palmer, Tracy

    2012-04-27

    The twin arginine protein transport (Tat) system translocates folded proteins across the cytoplasmic membrane of prokaryotes and the thylakoid membrane of chloroplasts. In Escherichia coli, TatA, TatB, and TatC are essential components of the machinery. A complex of TatB and TatC acts as the substrate receptor, whereas TatA is proposed to form the Tat transport channel. TatA and TatB are related proteins that comprise an N-terminal transmembrane helix and an adjacent amphipathic helix. Previous studies addressing the topological organization of TatA have given conflicting results. In this study, we have addressed the topological arrangement of TatA and TatB in intact cells by labeling of engineered cysteine residues with the membrane-impermeable thiol reagent methoxypolyethylene glycol maleimide. Our results show that TatA and TatB share an N-out, C-in topology, with no evidence that the amphipathic helices of either protein are exposed at the periplasmic side of the membrane. We further show that the N-out, C-in topology of TatA is fixed and is not affected by the absence of other Tat components or by the overproduction of a Tat substrate. These data indicate that topological reorganization of TatA is unlikely to accompany Tat-dependent protein transport.

  15. Molecular Mechanism of Mot1, a TATA-binding Protein (TBP)-DNA Dissociating Enzyme.

    Science.gov (United States)

    Viswanathan, Ramya; True, Jason D; Auble, David T

    2016-07-22

    The essential Saccharomyces cerevisiae ATPase Mot1 globally regulates transcription by impacting the genomic distribution and activity of the TATA-binding protein (TBP). In vitro, Mot1 forms a ternary complex with TBP and DNA and can use ATP hydrolysis to dissociate the TBP-DNA complex. Prior work suggested an interaction between the ATPase domain and a functionally important segment of DNA flanking the TATA sequence. However, how ATP hydrolysis facilitates removal of TBP from DNA is not well understood, and several models have been proposed. To gain insight into the Mot1 mechanism, we dissected the role of the flanking DNA segment by biochemical analysis of complexes formed using DNAs with short single-stranded gaps. In parallel, we used a DNA tethered cleavage approach to map regions of Mot1 in proximity to the DNA under different conditions. Our results define non-equivalent roles for bases within a broad segment of flanking DNA required for Mot1 action. Moreover, we present biochemical evidence for two distinct conformations of the Mot1 ATPase, the detection of which can be modulated by ATP analogs as well as DNA sequence flanking the TATA sequence. We also show using purified complexes that Mot1 dissociation of a stable, high affinity TBP-DNA interaction is surprisingly inefficient, suggesting how other transcription factors that bind to TBP may compete with Mot1. Taken together, these results suggest that TBP-DNA affinity as well as other aspects of promoter sequence influence Mot1 function in vivo. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Acsys in a box

    International Nuclear Information System (INIS)

    Briegel, C.; Finstrom, D.; Hendricks, B.; King, C.; Lackey, S.; Neswold, R.; Nicklaus, D.; Patrick, J.; Petrov, A.; Rechenmacher, R.; Schumann, C.; Smedinghoff, J.

    2012-01-01

    The Accelerator Control System (ACSYS) at Fermilab has evolved to enable this relatively large control system to be encapsulated into a 'box' such as a laptop. The goal was to provide a platform isolated from the 'online' control system. This platform can be used internally for making major upgrades and modifications without impacting operations. It also provides a stand-alone environment for research and development including a turnkey control system for collaborators. Over time, the code base running on Scientific Linux has enabled all the salient features of the Fermilab's control system to be captured in an off-the-shelf laptop. The anticipated additional benefits of packaging the system include improved maintenance, reliability, documentation, and future enhancements. (authors)

  17. ACYSYS in a box

    Energy Technology Data Exchange (ETDEWEB)

    Briegel, C.; Finstrom, D.; Hendricks, B.; King, C.; Lackey, S.; Neswold, R.; Nicklaus, D.; Patrick, J.; Petrov, A.; Rechenmacher, R.; Schumann, C.; /Fermilab

    2011-11-01

    The Accelerator Control System at Fermilab has evolved to enable this relatively large control system to be encapsulated into a 'box' such as a laptop. The goal was to provide a platform isolated from the 'online' control system. This platform can be used internally for making major upgrades and modifications without impacting operations. It also provides a standalone environment for research and development including a turnkey control system for collaborators. Over time, the code base running on Scientific Linux has enabled all the salient features of the Fermilab's control system to be captured in an off-the-shelf laptop. The anticipated additional benefits of packaging the system include improved maintenance, reliability, documentation, and future enhancements.

  18. PENERAPAN STANDAR PELAYANAN MINIMAL PEGAWAI TATA USAHA DI SMP NEGERI SE-KOTA SALATIGA

    Directory of Open Access Journals (Sweden)

    Aan Ikhsananto

    2016-06-01

    Full Text Available Pegawai tata usaha memiliki tugas-tugas pelayanan yang berhubungan dengan banyak orang di lingkungan sekolah. Observasi awal yang dilakukan peneliti menunjukkan bahwa penerapan Standar Pelayanan Minimal (SPM masih kurang. Melalui peningkatan kompetensi pegawai diharapkan dapat memenuhi standar pelayanan minimal pegawai tata usaha di sekolah. Pemanfaatan fasilitas kantor juga diharapkan dapat menunjang standar pelayanan minimal. Selain itu ketersediaan teknologi informasi diharapkan penerapan standar pelayanan minimal dapat semakin meningkat. Tujuan dari penelitian ini adalah untuk mengetahui apakah kompetensi pegawai, fasilitas kantor, dan teknologi infomasi berpengaruh terhadap penerapan SPM pegawai tata usaha.Variabel dalam penelitian ini adalah kompetensi pegawai (X1, fasilitas kantor (X2 dan teknologi informasi (X3 sebagai variabel bebas serta standar pelayanan minimal (Y sebagai variabel terikatnya. Sampel dalam penelitian ini adalah seluruh pegawai tata usaha (TU di SMP Negeri Se-Kota Salatiga, berjumlah 54 pegawai. Metode pengumpulan data yang digunakan adalah metode dokumentasi, wawancara, dan kuesioner. Teknik analisis data dapat menggunakan regresi berganda bantuan SPSS, asumsi klasik, dan analisis deskriptif persentase. Hasil penelitian ini dapat disimpulkan bahwa kompetensi pegawai, fasilitas kantor, dan teknologi informasi berpengaruh positif dan signifikan terhadap penerapan standar pelayanan minimal pegawai. Clerical employee has service tasks associated with many people in the school environment. Preliminary observations conducted by researchers showed that the application of the Minimum Service Standards (SPM is still lacking. By improving the competence of employees is expected to meet minimum service standards in school administration employees. The usefullness of office facilities are also expected to support the minimum service standards. Besides the availability of information technology is expected implementation of

  19. Proses Penanganan Tata Kearsipan Daerah pada Kantor Perpustakaan Arsip dan Dokumentasi Deli Serdang

    Directory of Open Access Journals (Sweden)

    Lisnawati Lisnawati

    2014-06-01

    Full Text Available Kebutuhan manusia akan informasi begitu penting, beragamnya jenis media saluran informasi turut menambah kemudahan bagi siapa saja untuk mencari informasi tidak terkecuali bagi pemerintahan daerah sebagai penyelenggara pemerintahan memiliki peran penting untuk menyediakan sistem pengarsipan dalam mendukung kinerja. Tujuan penelitian ini untuk melihat bagaimanakah proses penanganan tata kearsipan daerah pada kantor perpustakaan arsip dan dokumentasi Kabupaten Deli Serdang. Metode penelitian yang digunakan adalah berjenis kualitatif dengan pendekatan deskriptif dimana pencarian data menggunakan data primer dan data skunder. Hasil penelitian memperlihatkan peralatan penyimpanan arsip masih mengunakan peralatan sederhana dan belum berbasis teknologi.

  20. Stronger declines in youth alcohol consumption thanks to stronger integrated alcohol policies? A qualitative comparison of ten Dutch municipalities.

    Science.gov (United States)

    de Goeij, Moniek C M; Harting, Janneke; Kunst, Anton E

    2017-03-02

    Little detailed evidence is available on how integrated policies could impact population health and under what conditions such policies could be realized. The aim of this study was to assess how youth alcohol consumption trends in the province of Noord-Brabant, The Netherlands, were related to the development and implementation of integrated policies. In a retrospective multiple case study, alcohol policies of six municipalities with stronger declines in youth alcohol consumption between 2007 and 2011 (cases) were compared to four municipalities with weaker declines (controls). Information on the policy process in the same period was obtained through semi-structured in-depth interviews with policy advisors. Information on implemented interventions was extracted from policy documents and checked by the interviewees. Interviews were analyzed for thematic content. Only municipalities with stronger declines in alcohol consumption involved sectors other than public health and had started to implement interventions that use regulatory or enforcement strategies. Their involvement was facilitated by framing youth alcohol consumption as a safety rather than a health problem, whereby local media played a substantial role. Implementation of integrated policies was further facilitated by dedicated leadership and sufficient resources. Reductions in youth alcohol consumption in Noord-Brabant were stronger when municipalities started to develop integrated policies. Results suggest that integrated policies framing a health problem as a broader societal problem could positively influence population health.

  1. What Makes a Better Box?

    Science.gov (United States)

    Moyer, Richard; Everett, Susan

    2010-01-01

    Every morning, many Americans start their day with a bowl of cereal. Some spend time while they eat breakfast reading the back of the cereal box, but few consider its size, shape, and construction, or realize that it was designed by an engineer. This article describes a lesson in which students design, build, and critique cereal boxes. The lesson…

  2. Spirit Boxes: Expressions of Culture.

    Science.gov (United States)

    DeMuro, Ted

    1984-01-01

    After studying the culture and art of the ancient civilizations of South America, Mesopotamia, Greece, and Egypt, secondary level art students made spirit boxes as expressions of the various cultures. How to make the boxes and how to prepare the face molds are described. (RM)

  3. The right of the stronger: The play Sisyphus and critias

    Directory of Open Access Journals (Sweden)

    Jordović Ivan

    2004-01-01

    Full Text Available The Focus of this study is the standpoint of the play Sisyphus and critias the leader of the thirty towards the right of the stronger. this is a question of constant interest in scientific circles, since its answer can serve as the indicator of the influence this famous theory has had. this interest has been encouraged by the fact that critias’ authorship of the play is questionable. however, the question of the author is not of primary importance for this article, because there are some arguments, among some well known ones, which were not considered and which Show that in this satire, regardless of the author and the purpose of this fragment, the right of the stronger is actually non-existant. the first argument to support this theory is that nomosphysis antithesis is nowhere explicitly mentioned although it is the crucial element of the right of the stronger. in addition there is no claim in the play that the exploitation of the strong by the week or by law accrued. the second argument is that despite the incapability of laws to prevent the secret injustice, they and their importance for the human society are depicted in a positive light. it should also be noted that, unlike callicles and glaucon, laws are created to stop the bad and not the good. the third argument is that the invention of religion is accepted as a positive achievement, which finally enables the overcoming of primeval times and lawlessness. the reflection of this argument is a positive characterization of the individual who invented the fear of gods. the fourth argument, which has not been taken into consideration so far is the way the supporters and opponents of lawlessness are described and marked as κακοί and έσξλοί in the satire only physically strong are considered as strong as opposed to callicles, where they are also spiritually superior. intelectually superior in Sisyphus is the inventor of the fear of gods who is also in favor of law and order. the fact

  4. Stronger misdirection in curved than in straight motion

    Directory of Open Access Journals (Sweden)

    Jorge eOtero-Millan

    2011-11-01

    Full Text Available Illusions developed by magicians are a rich and largely untapped source of insight into perception and cognition. Here we show that curved motion, as employed by the magician in a classic sleight of hand trick, generates stronger misdirection than rectilinear motion, and that this difference can be explained by the differential engagement of the smooth pursuit and the saccadic oculomotor systems. This research moreover exemplifies how the magician’s intuitive understanding of the spectator’s mindset can surpass that of the cognitive scientist in specific instances, and that observation-based behavioral insights developed by magicians are worthy of quantitative investigation in the neuroscience laboratory.

  5. Determining the Molecular and Genetic Basis for Diabetes in Navy Bottlenose Dolphins (Tursiops truncatus)

    Science.gov (United States)

    2015-01-12

    compared to those from humans, mice, and rats. Targeted binding sites, including TATA boxes, included those for the transcription factors, forkhead box 01...CCTACTGATGATGCACCTTTGATCAATAGATTTTAGACAAAAGTGTTTTTTTGAGTCCAA ******* ******************** ************ * * ***** ******** TATA Box AGATCAGGGCTGGGTTGACCTGAATACTGGATACAGGGCA

  6. El tratamiento de la metáfora en la traducción de Historias de Tata Mundo (The Treatment of the Metaphor in the Translation of Historias de Tata Mundo

    Directory of Open Access Journals (Sweden)

    Jacqueline Araya Ríos

    2016-09-01

    Full Text Available Fabián Dobles plantea mediante hechos característicos y regionalismos una imagen del campesino nacional de mediados de siglo xx en su obra Historias de Tata Mundo. Joan Henry lo traduce al inglés en 1998 y lo titula The Stories of Tata Mundo, transportando al campesino costarricense a la escena de habla inglesa. Se analizan las decisiones de la traductora sobre el tratamiento de las metáforas, teniendo en cuenta el lenguaje figurado como una herramienta empleada por el autor para caracterizar la vida rural del campesinado costarricense. Using traditional activities and regionalisms, Fabián Dobles reconstructed the image of the Costa Rican country folk of the mid-twentieth century in his literary work Historias de Tata Mundo. Joan Henry translated it in 1998, with the title The Stories of Tata Mundo, transporting the local peasant to the English-speaking scenario. The translator’s decisions are analyzed here regarding the translation of metaphors, taking into account figurative speech as a tool used by the author to characterize and depict the rural life of Costa Rican country folk.

  7. Thinking Inside the Box

    International Nuclear Information System (INIS)

    Boeheim, Charles T.

    2007-01-01

    In early 2007, SLAC was faced with a shortage of both electrical power and cooling in the main computer building, at the same time that the BaBar collaboration needed a new cluster of 250 batch machines installed. A number of different options were explored for the expansion. Provision of additional electrical power to the building was estimated to take one to two years, and cost several million dollars; additional cooling was even worse. Space in a Silicon Valley co-location facilities was reasonable on a one-year timescale, but broke even in costs by the end of three years, and were more expensive after that. There were also unresolved questions about the affects of additional latency from an offsite compute cluster to the onsite disk servers. The option of converting existing experimental hall space into computer space was estimated at one year, with uncertain availability. An option to aggressively replace several existing clusters with more power-efficient equipment was studied closely, but was disruptive to continued operations, expensive, and didn't provide any additional headroom. Finally, the installation of a Sun Project Blackbox (PBB) unit was selected as providing the capacity on a timescale of six months for a reasonable cost with minimal disruption to service. SLAC obtained and installed a beta unit and have been running it in production since September 2007. The experiences described are with the Early Access version of the PBB. The production version of the box has engineering changes based in part on our experiences

  8. Learning Intelligent Dialogs for Bounding Box Annotation

    OpenAIRE

    Konyushkova, Ksenia; Uijlings, Jasper; Lampert, Christoph; Ferrari, Vittorio

    2017-01-01

    We introduce Intelligent Annotation Dialogs for bounding box annotation. We train an agent to automatically choose a sequence of actions for a human annotator to produce a bounding box in a minimal amount of time. Specifically, we consider two actions: box verification [37], where the annotator verifies a box generated by an object detector, and manual box drawing. We explore two kinds of agents, one based on predicting the probability that a box will be positively verified, and the other bas...

  9. Microclimate boxes for panel paintings

    DEFF Research Database (Denmark)

    Wadum, Jørgen

    1998-01-01

    The use of microclimate boxes to protect vulnerable panel paintings is, therefore, not a new phenomenon of the past two or three decades. Rather, it has been a concern for conservators and curators to protect these objects of art at home and in transit since the end of the nineteenth century....... The increased number of travelling exhibitions in recent years has heightened the need to protect paintings during circulation (Thomson 1961; Mecklenburg 1991). The use and design of microclimate boxes have been evolving since 1892. These boxes may be divided into three broad groups: those using an active...

  10. Ultrastructural characterisation of Bacillus subtilis TatA complexes suggests they are too small to form homooligomeric translocation pores.

    Science.gov (United States)

    Beck, Daniel; Vasisht, Nishi; Baglieri, Jacopo; Monteferrante, Carmine G; van Dijl, Jan Maarten; Robinson, Colin; Smith, Corinne J

    2013-08-01

    Tat-dependent protein transport permits the traffic of fully folded proteins across membranes in bacteria and chloroplasts. The mechanism by which this occurs is not understood. Current theories propose that a key step requires the coalescence of a substrate-binding TatC-containing complex with a TatA complex, which forms pores of varying sizes that could accommodate different substrates. We have studied the structure of the TatAd complex from Bacillus subtilis using electron microscopy to generate the first 3D model of a TatA complex from a Gram-positive bacterium. We observe that TatAd does not exhibit the remarkable heterogeneity of Escherichia coli TatA complexes but instead forms ring-shaped complexes of 7.5-9nm diameter with potential pores of 2.5-3nm diameter that are occluded at one end. Such structures are consistent with those seen for E. coli TatE complexes. Furthermore, the small diameter of the TatAd pore, and the homogeneous nature of the complexes, suggest that TatAd cannot form the translocation channel by itself. Biochemical data indicate that another B. subtilis TatA complex, TatAc, has similar properties, suggesting a common theme for TatA-type complexes from Bacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Prinsip Kehati-Hatian di Bidang Pengelolaan Lingkungan Hidup dalam Peraturan Daerah Rencana Tata Ruang Wilayah Provinsi Maluku

    Directory of Open Access Journals (Sweden)

    La Ode Angga

    2017-06-01

    Full Text Available Prinsip Kehati-Hatian di Bidang Pengelolaan Lingkungan Hidup dalamPeraturan Daerah Rencana Tata Ruang Wilayah Provinsi Maluku bertujuan untuk mengetahui hakekat prinsip kehati-hatian dalam Rencana Tata Ruang Wilayah di Provinsi Maluku.Penelitian ini merupakan penelitian yuridis normatif, yaitu penelitian yang dilakukan terhadap azas-azas hukum, kaedah-kaedah hukum dalam arti nilai (norma peraturan hukum konkrit dan sistem hukum.Pendekatan yang digunakan dalam penelitian adalah pendekaan filosofis (philosophicalapproach, pendekatan konseptual (conseptual approach, pendekatan perundang-undangan (statute approach. Hasil yang diperoleh bahwa prinsip kehati-hatian dalam Perda RTRW Provinsi Maluku No. 16 Tahun 2013 dilakukan pencegahan secara dini, pencegahan antisipatif, kehati-hatian (Prudential Principles terhadap perlindungan dan pengelolaan sumber daya alam dan lingkungan hidup serta penataan ruang. Filosofis pengaturan prinsip kehati-hatian dalam Perda RTRW Provinsi Maluku bahwa mengingat fungsi ruang sebagai tempat manusia dan makhluk hidup lain, melakukan kegiatan, dan memelihara kelangsungan hidupnya, pada dasarnya ketersediaannya tidak tak terbatas. Berkaitan itu untuk mewujudkan rencana tata ruang wilayah Provinsi Maluku yang aman, nyaman, produktif, dan berkelanjutan perlu dilakukan rencana tata ruang wilayah yang dapat mengharmonisasi lingkungan alam dan lingkungan buatan  mampu mewujudkan keterpaduan penggunaan sumber daya alam dan sumber daya buatan, serta dapat memberikan perlindungan terhadap fungsi ruang dan pencegahan dampak negatif terhadap lingkungan hidup akibat pemanfaatan ruang. 

  12. DIRECT KICKS IN BOXING

    Directory of Open Access Journals (Sweden)

    Izet Kahrović

    2009-11-01

    Full Text Available Hit directly, giving any impact maximum muscle strength is skill, and it is neces- sary to the exercise and learning to make it perfect. Training begins with oral statement, so that students get to know with the techni- que that works. After oral exposure, it is necessary to create a good notion on technology that is adopted. The best way for the creation of good notion is a good demonstration. In direct training kicks in the box, you need patience and gradualness and there- fore uses a large number of additional exercises. In their work with beginners, in the first class, individual elements of technology, and also direct blow, it is necessary to separate the parts and run them on multiple commands, to later come to the confluence in one command. Direct wounds, with left and right hand, can be run from the towns, on the head and body, from the movement, to step forward, step back and step aside, the remedy to the left and right side. Left direct is taking out from a running protrusion hands, but kick, which is a pro- duct of the system, ankle-knee-pelvis and shoulder forward horizontaly. Set at the time of stripes, body weight over the left leg. Right direct from the place, starting ekscentrical reflecsive impuls of a extensor muscle in ankle, knee and joint of a hip.This kind of a sud- den movement is running simultaneously with the rotation of the body around vertical (longitudinal axis, with the transfer body weight on the left leg. Further movement to the hand which serves as a lever, which is transmitted through the power stroke

  13. The TatA component of the twin-arginine translocation system locally weakens the cytoplasmic membrane ofEscherichia coliupon protein substrate binding.

    Science.gov (United States)

    Hou, Bo; Heidrich, Eyleen S; Mehner-Breitfeld, Denise; Brüser, Thomas

    2018-03-13

    The twin-arginine translocation (Tat) system that comprises the TatA, TatB, and TatC components transports folded proteins across energized membranes of prokaryotes and plant plastids. It is not known, however, how the transport of this protein cargo is achieved. Favored models suggest that the TatA component supports transport by weakening the membrane upon full translocon assembly. Using Escherichia coli as model organism, we now demonstrate in vivo that the N-terminus of TatA can indeed destabilize the membrane, resulting in a lowered membrane energization in growing cells. We found that in full-length TatA, this effect is counterbalanced by its amphipathic helix. Consistent with these observations, the TatA N-terminus induced proton leakage in vitro , indicating membrane destabilization. Fluorescence quenching data revealed that substrate binding causes the TatA hinge region and the N-terminal part of the TatA amphipathic helix to move toward the membrane surface. In the presence of TatBC, substrate binding also reduced the exposure of a specific region in the amphipathic helix, indicating a participation of TatBC. Of note, the substrate-induced reorientation of the TatA amphipathic helix correlated with detectable membrane weakening. We therefore propose a two-state model in which membrane-destabilizing effects of the short TatA membrane anchor are compensated by the membrane-immersed N-terminal part of the amphipathic helix in a resting state. We conclude that substrate binding to TatABC complexes switches the position of the amphipathic helix, which locally weakens the membrane on demand to allow substrate translocation across the membrane. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Article-in-a-Box

    Indian Academy of Sciences (India)

    Volume 1 Issue 5 May 1996 pp 2-2 Article-in-a-Box. Chief Editor's column / The First Electronic Computer · V Rajaraman · More Details Fulltext PDF. Volume 1 Issue 6 June 1996 pp 2-4 Article-in-a-Box. Konrad Lorenz · Raghavendra Gadagkar · More Details Fulltext PDF. Volume 1 Issue 8 August 1996 pp 3-4 Article-in-a- ...

  15. Fuel element box inspection device

    International Nuclear Information System (INIS)

    Ortmayer, R.M.; Pick, W.

    1985-01-01

    The invention concerns a device for inspecting the outer geometry of a long fuel element box by measuring the surface contours over its longitudinal crossection and along its length by sensors. These are kept in a sledge which can be moved along the fuel element guide in a slot guide. The measurement signals reach an evaluation device outside the longitudinal box. (orig./HP) [de

  16. Processing by rhomboid protease is required for Providencia stuartii TatA to interact with TatC and to form functional homo-oligomeric complexes

    OpenAIRE

    Fritsch, Maximilian J; Krehenbrink, Martin; Tarry, Michael J; Berks, Ben C; Palmer, Tracy

    2012-01-01

    The twin arginine transport (Tat) system transports folded proteins across the prokaryotic cytoplasmic membrane and the plant thylakoid membrane. In Escherichia coli three membrane proteins, TatA, TatB and TatC, are essential components of the machinery. TatA from Providencia stuartii is homologous to E. coli TatA but is synthesized as an inactive pre-protein with an N-terminal extension of eight amino acids. Removal of this extension by the rhomboid protease AarA is required to activate P. s...

  17. Variable stoichiometry of the TatA component of the twin-arginine protein transport system observed by in vivo single-molecule imaging

    OpenAIRE

    Leake, Mark C.; Greene, Nicholas P.; Godun, Rachel M.; Granjon, Thierry; Buchanan, Grant; Chen, Shuyun; Berry, Richard M.; Palmer, Tracy; Berks, Ben C.

    2008-01-01

    The twin-arginine translocation (Tat) system transports folded proteins across the bacterial cytoplasmic membrane and the thylakoid membrane of plant chloroplasts. The essential components of the Tat pathway are the membrane proteins TatA, TatB, and TatC. TatA is thought to form the protein translocating element of the Tat system. Current models for Tat transport make predictions about the oligomeric state of TatA and whether, and how, this state changes during the transport cycle. We determi...

  18. Chromatin interaction of TATA-binding protein is dynamically regulated in human cells.

    Science.gov (United States)

    de Graaf, Petra; Mousson, Florence; Geverts, Bart; Scheer, Elisabeth; Tora, Laszlo; Houtsmuller, Adriaan B; Timmers, H Th Marc

    2010-08-01

    Gene transcription in mammalian cells is a dynamic process involving regulated assembly of transcription complexes on chromatin in which the TATA-binding protein (TBP) plays a central role. Here, we investigate the dynamic behaviour of TBP by a combination of fluorescence recovery after photobleaching (FRAP) and biochemical assays using human cell lines of different origin. The majority of nucleoplasmic TBP and other TFIID subunits associate with chromatin in a highly dynamic manner. TBP dynamics are regulated by the joint action of the SNF2-related BTAF1 protein and the NC2 complex. Strikingly, both BTAF1 and NC2 predominantly affect TBP dissociation rates, leaving the association rate unchanged. Chromatin immunoprecipitation shows that BTAF1 negatively regulates TBP and NC2 binding to active promoters. Our results support a model for a BTAF1-mediated release of TBP-NC2 complexes from chromatin.

  19. Conservatives Anticipate and Experience Stronger Emotional Reactions to Negative Outcomes.

    Science.gov (United States)

    Joel, Samantha; Burton, Caitlin M; Plaks, Jason E

    2014-02-01

    The present work examined whether conservatives and liberals differ in their anticipation of their own emotional reactions to negative events. In two studies, participants imagined experiencing positive or negative outcomes in domains that do not directly concern politics. In Study 1, 190 American participants recruited online (64 male, Mage  = 32 years) anticipated their emotional responses to romantic relationship outcomes. In Study 2, 97 Canadian undergraduate students (26 male, Mage  = 21 years) reported on their anticipated and experienced emotional responses to academic outcomes. In both studies, more conservative participants predicted they would feel stronger negative emotions following negative outcomes than did more liberal participants. Furthermore, a longitudinal follow-up of Study 2 participants revealed that more conservative participants actually felt worse than more liberal participants after receiving a lower-than-desired exam grade. These effects remained even when controlling for the Big Five traits, prevention focus, and attachment style (Study 1), and optimism (Study 2). We discuss how the relationship between political orientation and anticipated affect likely contributes to differences between conservatives and liberals in styles of decision and policy choices. © 2013 Wiley Periodicals, Inc.

  20. Stronger inducible defences enhance persistence of intraguild prey.

    Science.gov (United States)

    Kratina, Pavel; Hammill, Edd; Anholt, Bradley R

    2010-09-01

    1. Intraguild predation is widespread in nature despite its potentially destabilizing effect on food web dynamics. 2. Anti-predator inducible defences affect both birth and death rates of populations and have the potential to substantially modify food web dynamics and possibly increase persistence of intraguild prey. 3. In a chemostat experiment, we investigated the long-term effects of inducible defences on the dynamics of aquatic microbial food webs consisting of an intraguild predator, intraguild prey, and a basal resource. We controlled environmental conditions and selected strains of intraguild prey that varied in the strength of expressed inducible defences. 4. We found that intraguild prey with a stronger tendency to induce an anti-predator morphology persist for significantly longer periods of time. In addition, model selection analysis implied that flexibility in defensive phenotype (inducibility itself) is most likely the factor responsible for the enhanced persistence. 5. As patterns at the community level often emerge as a result of the life-history traits of individuals, we propose that inducible defences increase the persistence of populations and may contribute to the widespread occurrence of theoretically unstable intraguild predation systems in nature.

  1. EFEKTIVITAS MODEL PEMBELAJARAN BERBASIS KOMPETENSI DENGAN PENDEKATAN DUNIA KERJA PADA PROGRAM D3 TATA BOGA

    Directory of Open Access Journals (Sweden)

    Rina Febriana

    2017-02-01

    Full Text Available Abstrak: Penelitian bertujuan untuk menghasilkan model pembelajaran berbasis kompetensi dengan pendekatan dunia kerja (model PKBK, rumusan kompetensi mahasiswa D3 Tata Boga, rancangan pembelajaran berbasis kompetensi, dan rubrik penilaian. Penelitian ini merupakan penelitian dan pengembangan yang mengadopsi model prosedural Borg & Gall.Subjek penelitian adalah praktisi industri perhotelan, mahasiswa proram D3 Tata Boga dan dosen matakuliah praktik. Teknik pengumpulan data lewat FGD dan pemberian angket, sedang teknik analisis data dilakukan secara deskriptif kualitatitif dan statistik deskriptif. Hasil penelitian ini adalah (1 model PKBK memiliki komponen: profil lulusan, learning outcomes, rumusan kompetensi, pengalaman pembelajaran, rancangan pembelajaran, dan evaluasi kompetensi, (2 rumusan kompetensi untuk lulusan terbagi menjadi 2 kelompok yaitu technical skills dan employability skills, (3 rancangan pembelajaran pada model PKBK terdiri dari: struktur kurikulum, materi dan bahan pembelajaran, diagram pencapaian kompetensi dan dokumen kurikulum, (4 rubrik penilaian berisi penilaian terhadap employability dan technical skills. THE EFFECTIVENESS OF A COMPETENCY-BASED LEARNING MODEL USING WORLD OF WORK APPROACH AT D3 FOOD AND NUTRITION PROGRAMME Abstract: This research aims to produce a model of competence-based learning using the world of work approach (model PKBK, to formulate students’ competence, to design competence-based learning, and to develop evaluation rubric. This research adopted Research and Development model developed by Borg and Gall. The research subjects were hotel practitioners, students of D3 Food and Nutrition, and lechturers of practice courses. Data were collected through FGDs and questionnaires and analysed using descriptive qualitative and descriptive stastitics tecniques. The findings show that (1 the PKBK model comprises graduates’ profile, learning outcomes, competence formulation, learning design, and competence

  2. Construction of Hunveyor-9 and Experiments with its Magnetic Carpet Observing Dust Mixtures at Eötvös High School, Tata, Hungary

    Science.gov (United States)

    Magyar, I.; Varga, T.; Bérczi, Sz.; Hegyi, S.; Hudoba, Gy.; Almády, B.; Badics, A.; Bakonyi, I.; Franko, M.; Gyürky, A.; Héricz, M.; Ikonga, R.; Németh, A.; Pardy, T.; Varga, T.; Végh, Gy.

    2008-03-01

    We report about the construction of the ninth Hungarian University Surveyor (Hunveyor-9) and its experiment with magnetic dust observation by carpet containing small discs of magnets at Tata, Eötvös József High School, Hungary.

  3. First-aid boxes - Reminder

    CERN Multimedia

    GS Department

    2010-01-01

    With a view to ensuring optimum use of the first-aid boxes on the CERN site, we should like to remind you of various changes introduced in March 2009: The TSO of the buildings concerned is responsible for the first-aid boxes, including checking their contents.   First-aid boxes may be restocked ONLY at the CERN stores (SCEM No. 54.99.80). This is no longer possible at the Infirmary. The associated cost is charged to the Departments.   First-aid boxes should be used only for mild injuries. All other cases should be referred to the Medical Service Infirmary (Bldg. 57 – ground-floor, tel. 73802) between 8.00 a.m. and 5.30 p.m. or to the Fire and Rescue Service (tel. 74444). N.B.: This information does not apply to the red emergency first-aid boxes in the underground areas or to the emergency kits for use in the event of being splashed with hydrofluoric acid.

  4. Box graphs and resolutions I

    Directory of Open Access Journals (Sweden)

    Andreas P. Braun

    2016-04-01

    Full Text Available Box graphs succinctly and comprehensively characterize singular fibers of elliptic fibrations in codimension two and three, as well as flop transitions connecting these, in terms of representation theoretic data. We develop a framework that provides a systematic map between a box graph and a crepant algebraic resolution of the singular elliptic fibration, thus allowing an explicit construction of the fibers from a singular Weierstrass or Tate model. The key tool is what we call a fiber face diagram, which shows the relevant information of a (partial toric triangulation and allows the inclusion of more general algebraic blowups. We shown that each such diagram defines a sequence of weighted algebraic blowups, thus providing a realization of the fiber defined by the box graph in terms of an explicit resolution. We show this correspondence explicitly for the case of SU(5 by providing a map between box graphs and fiber faces, and thereby a sequence of algebraic resolutions of the Tate model, which realizes each of the box graphs.

  5. Decontamination of TRU glove boxes

    International Nuclear Information System (INIS)

    Crawford, J.H.

    1978-03-01

    Two glove boxes that had been used for work with transuranic nuclides (TRU) for about 12 years were decontaminated in a test program to collect data for developing a decontamination facility for large equipment highly contaminated with alpha emitters. A simple chemical technique consisting of a cycle of water flushes and alkaline permanganate and oxalic acid washes was used for both boxes. The test showed that glove boxes and similar equipment that are grossly contaminated with transuranic nuclides can be decontaminated to the current DIE nonretrievable disposal guide of <10 nCi TRU/g with a moderate amount of decontamination solution and manpower. Decontamination of the first box from an estimated 1.3 Ci to about 5 mCi (6 nCi/g) required 1.3 gallons of decontamination solution and 0.03 man-hour of work for each square foot of surface area. The second box was decontaminated from an estimated 3.4 Ci to about 2.8 mCi (4.2 nCi/g) using 0.9 gallon of decontamination solution and 0.02 man-hour for each square foot of surface area. Further reductions in contamination were achieved by repetitive decontamination cycles, but the effectiveness of the technique decreased sharply after the initial cycle

  6. Identifying competencies of boxing coaches

    Directory of Open Access Journals (Sweden)

    Ioannis Tasiopoulos

    2014-10-01

    Full Text Available The purpose of this study was to find out the management skills required by boxing coaches to administrate their clubs. For the purposes of this study a scale was constructed which was answered by 98 boxing coaches. Explanatory factor analysis revealed seven factors: Communication-public relations (5 items, event management (4 items, management techniques (4 items, new technologies (4 items, prevention-safety (2 items, sport (5 items and sports facilities (2 items. The Cronbach of the scale was 0.85. The five competencies that rated by the coaches were: Supervisors of the area of training, maintaining excellent communication with athletes, using new technologies (e-mail, internet, handling disciplinary matters, accidents, complaints and reports on some sporting games and promoted harmony among athletes. We concluded that boxing coaches understand that the competencies required for meeting their obligations, were related to sports, prevention, safety and communications-public relations.

  7. Highly redundant function of multiple AT-rich sequences as core promoter elements in the TATA-less RPS5 promoter of Saccharomyces cerevisiae.

    Science.gov (United States)

    Sugihara, Fuminori; Kasahara, Koji; Kokubo, Tetsuro

    2011-01-01

    In eukaryotes, protein-coding genes are transcribed by RNA polymerase II (pol II) together with general transcription factors (GTFs). TFIID, the largest GTF composed of TATA element-binding protein (TBP) and 14 TBP-associated factors (TAFs), plays a critical role in transcription from TATA-less promoters. In metazoans, several core promoter elements other than the TATA element are thought to be recognition sites for TFIID. However, it is unclear whether functionally homologous elements also exist in TATA-less promoters in Saccharomyces cerevisiae. Here, we identify the cis-elements required to support normal levels of transcription and accurate initiation from sites within the TATA-less and TFIID-dependent RPS5 core promoter. Systematic mutational analyses show that multiple AT-rich sequences are required for these activities and appear to function as recognition sites for TFIID. A single copy of these sequences can support accurate initiation from the endogenous promoter, indicating that they carry highly redundant functions. These results show a novel architecture of yeast TATA-less promoters and support a model in which pol II scans DNA downstream from a recruited site, while searching for appropriate initiation site(s).

  8. Is Polar Amplification Deeper and Stronger than Dynamicists Assume?

    Science.gov (United States)

    Scheff, J.; Maroon, E.

    2017-12-01

    In the CMIP multi-model mean under strong future warming, Arctic amplification is confined to the lower troposphere, so that the meridional gradient of warming reverses around 500 mb and the upper troposphere is characterized by strong "tropical amplification" in which warming weakens with increasing latitude. This model-derived pattern of warming maxima in the upper-level tropics and lower-level Arctic has become a canonical assumption driving theories of the large-scale circulation response to climate change. Yet, several lines of evidence and reasoning suggest that Arctic amplification may in fact extend through the entire depth of the troposphere, and/or may be stronger than commonly modeled. These include satellite Microwave Sounding Unit (MSU) temperature trends as a function of latitude and vertical level, the recent discovery that the extratropical negative cloud phase feedback in models is largely spurious, and the very strong polar amplification observed in past warm and lukewarm climates. Such a warming pattern, with deep, dominant Arctic amplification, would have very different implications for the circulation than a canonical CMIP-like warming: instead of slightly shifting poleward and strengthening, eddies, jets and cells might shift equatorward and considerably weaken. Indeed, surface winds have been mysteriously weakening ("stilling") at almost all stations over the last half-century or so, there has been no poleward shift in northern hemisphere circulation metrics, and past warm climates' subtropics were apparently quite wet (and their global ocean circulations were weak.) To explore these possibilities more deeply, we examine the y-z structure of warming and circulation changes across a much broader range of models, scenarios and time periods than the CMIP future mean, and use an MSU simulator to compare them to the satellite warming record. Specifically, we examine whether the use of historical (rather than future) forcing, AMIP (rather than CMIP

  9. Increasing Arctic sea ice export driven by stronger winds

    Science.gov (United States)

    Sorteberg, A.; Smedsrud, L. H.; Sirevaag, A.; Kloster, K.

    2010-12-01

    Arctic sea ice area has decreased steadily over the last three decades. A thinner and more seasonal Arctic ice cover, related to increased long wave radiation, has become evident. Changes in circulation, including drift patterns of the Arctic pack ice, have been less obvious. Arctic sea ice export estimates have been hampered by low resolution spatial and temporal satellite imagery, especially during summer, making accurate detection difficult. Here we present a new ice area export dataset calculated from sea ice motion and concentration profiles along 79N. Ice drift vectors are calculated from ice feature displacement using Envisat ASAR WideSwath images every 3 days from 2004 while ice concentration is based on DMSP F13 SSMI and AQUA AMSR-E brightness temperature data. The two data sets are combined to give the ice-area flux in consecutive 3-day periods, uninterrupted year-round coverage along 79N. It is shown that sea ice export variability is closely linked to the geostrophic wind in the Fram Strait (correlation of 0.84). Using geostrophic winds from reanalysis back to the 1950s as a proxy for ice export indicates that the Arctic sea ice has annually lost an increasing area since the 1950's driven by stronger winds. Ice concentration has decreased slightly, but does not contribute significantly. The ice export has overall increased by ~25% over the period. Using cyclone tracking the changes in winds seems directly related to a higher low pressure activity in the Nordic Seas. Our results demonstrate that the changes in atmospheric circulation over the Arctic and sub-Arctic have contributed to a trend in the Fram Strait ice export. The Fram Strait between Greenland and Svalbard with average sea ice concentration for summer (red, June through August) and winter (black, January through March). Solid lines are 50%, dashed lines are 15%. Above mean southward ice drift across 79N from August 2004 to July 2010 in 1 degree bins based on SAR imagery, and mean ice

  10. Pembuatan Tata Kelola Keamanan Informasi Kontrol Akses Berbasis ISO/IEC 27001:2005 Pada Kantor Pelayanan Perbendaharaan Surabaya I

    Directory of Open Access Journals (Sweden)

    Margo Utomo

    2012-09-01

    Full Text Available Perkembangan teknologi informasi yang pesat saat ini turut berimbas kepada penggunaan teknologi informasi di lingkungan pemerintahan. KPPN Surabaya I sebagai instansi vertikal dari Direktorat Jenderal Perbendaharaan juga menerapkan teknologi informasi dalam untuk mendukung kegiatan pelayanan terhadap satuan kerja yang berada di lingkup bayarnya. Sayangnya masalah keamanan informasi yang merupakan bagian penting dari teknologi informasi sering kali kurang mendapatkan perhatian. Tidak dapat dipungkiri bahwa munculnya ancaman ataupun kelemahan dalam teknologi informasi dapat menggangu jalannya kegiatan pelayanan yang menggunakan teknologi informasi. Oleh karena itu diperlukan pengelolaan teknologi informasi berbasis risiko yang dituangkan dalam tata kelola untuk mengelola ancaman ataupun kelemahan yang muncul. ISO/IEC 27001:2005 merupakan framework sistem manajemen keamanan informasi yang dapat dijadikan dasar dalam pengelolaan keamanan informasi. Tata kelola keamanan informasi yang dibuat ini menitikberatkan pada kontrol akses yang merupakan salah satu kotrol keamanan dari ISO/IEC 27001:2005

  11. Multimerization of the mouse TATA-binding protein (TBP) driven by its C-terminal conserved domain.

    OpenAIRE

    Kato, K; Makino, Y; Kishimoto, T; Yamauchi, J; Kato, S; Muramatsu, M; Tamura, T

    1994-01-01

    The conformational states of the mouse TATA-binding protein (TBP) in solution were studied. A histidine tag and a factor Xa recognition site-carrying mouse TBP was expressed in E. coli, highly purified, and its fundamental functions as a TBP were demonstrated. We analyzed the molecular states of mouse TBP by gel filtration and glycerol gradient sedimentation, and found that TBP forms heterogeneous multimers in solution. Direct binding of TBP molecules to each other was proven by the far-Weste...

  12. CMS delegation for MTB55 held at Tata Institute in Mumbai (Bombay) during CMS week 14 December 2000.

    CERN Multimedia

    A. Payn

    2000-01-01

    CMS delegation at MTB55 in Tata Institue Mumbai on 14 December 2000. From left to right Bertrand Blau/ETHZ, Stefania Farinon/INFN-Genova, Alain Hervé/CERN, Lucien Veillet/CERN, Jean-Paul Grillet/CERN, Yves Pabot/Saclay, Bruno Levesy/Saclay, Alain Payn/Saclay, François Kircher/Saclay, Benoît Curé/CERN.

  13. One Year After Fukushima, Nuclear Safety Is Stronger

    International Nuclear Information System (INIS)

    2012-01-01

    Full text: Nuclear power is safer than it was a year ago as the nuclear industry, regulators and governments act on the lessons of Fukushima, but that safety must never be taken for granted, said Yukiya Amano, Director General of the International Atomic Energy Agency (IAEA). Speaking ahead of the first anniversary of the Fukushima Daiichi nuclear accident on 11 March, Amano said a culture of constant vigilance and improvement was vital to ensure that the benefits of nuclear power could be harnessed as safely as humanly possible. 'Nuclear safety is stronger than it was a year ago', he said. 'Fukushima Daiichi was a very serious accident, but we know what went wrong and we have a clear course of action to tackle those causes - not only in Japan, but anywhere in the world. 'Now we have to keep up the momentum. Complacency can kill'. On 11 March 2011 a huge earthquake and tsunami left more than 20 000 people dead or missing in eastern Japan. Amidst widespread destruction, the tsunami slammed into the Fukushima Daiichi Nuclear Power Station, disabling cooling systems and leading to fuel meltdowns in three of the six Units. The accident was a jolt to the nuclear industry, regulators and governments. It was triggered by a massive force of nature, but it was existing weaknesses of design regarding defence against natural hazards, regulatory oversight, accident management and emergency response that allowed it to unfold as it did. For example: The nuclear regulator was not sufficiently independent, allowing weak oversight of the operator, TEPCO, and regulatory requirements fell short of international best practice; Not enough attention was paid to guarding against possible extreme events at the Fukushima Daiichi site, leaving critical safety functions such as cooling systems vulnerable to the tsunami; Training to respond to serious accidents was inadequate, as were mitigation measures to prevent hydrogen explosions and protect the venting system; and Accident command lines

  14. Glove boxes and similar containments

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    According to the present invention a glove box or similar containment is provided with an exhaust system including a vortex amplifier venting into the system, the vortex amplifier also having its main inlet in fluid flow connection with the containment and a control inlet in fluid flow connection with the atmosphere outside the containment. (U.S.)

  15. The Bird Box Survey Project

    Science.gov (United States)

    Willis, Patrick

    2014-01-01

    When high school students are asked what's the best part of science class, many will say it's the field trips. Students enjoy engaging in authentic, community-based science outside the classroom. To capitalize on this, Patrick Willis created the Bird Box Survey Project for his introductory field biology class. The project takes students…

  16. On the Dirichlet's Box Principle

    Science.gov (United States)

    Poon, Kin-Keung; Shiu, Wai-Chee

    2008-01-01

    In this note, we will focus on several applications on the Dirichlet's box principle in Discrete Mathematics lesson and number theory lesson. In addition, the main result is an innovative game on a triangular board developed by the authors. The game has been used in teaching and learning mathematics in Discrete Mathematics and some high schools in…

  17. PERANCANGAN CASING DAN TATA LETAK KOMPONEN OZONIZER PENGAWET MAKANAN MENGGUNAKAN METODE QUALITY FUNCTION DEPLOYMENT (QFD

    Directory of Open Access Journals (Sweden)

    Zainal Fanani

    2012-02-01

    Full Text Available Penelitian ini berisi tentang perancangan casing dan tata letak komponen ozonizer pengawet makanan. Proses perancangan produk dilakukan dengan menggunakan metode Quality Function Deployment (QFD pada fase perencanaan produk (Product Planning dan fase perencanaan disain (Design Planning. Pada fase perencanaan produk, dilakukan identifikasi kebutuhan konsumen terhadap ozonizer pengawet makanan. Pengumpulan data mengenai kebutuhan konsumen diperoleh dari penyebaran angket (kuisioner kepada pengguna produk, yaitu rumah makan dan industri makanan. Setelah diperoleh daftar kebutuhan konsumen, kebutuhan-kebutuhan tersebut kemudian diolah menggunakan metode QFD pada fase perencanaan produk hingga diperoleh spestifikasi teknis produk dan House of Quality (HOQ. Spesifikasi teknis produk ini akan digunakan sebagai acuan dalam menyusun fase kedua proses QFD, yaitu fase perencanaan disain. Pada fase perencanaan disain, dihasilkan beberapa sketsa alternatif solusi. Alternatif solusi disain tersebut kemudian dievaluasi dan dilakukan penilaian untuk memilih solusi disain produk ozonizer pengawet makanan. Setelah solusi disain produk ozonizer dipilih, alternatif solusi tersebut kemudian dirancang secara detail, dan kemudian dibuat prototype produk. Prototype produk  yang dibuat adalah prototype visual, yakni gambar disain yang dianimasi untuk melihat proses perakitan, penyusunan tata letak komponen penyusun produk dan penyusunan display dan panel operasi produk. Kata Kunci   :   Kebutuhan konsumen, Quality Function Deployment, Spesifikasi Teknis Produk, Solusi Disain, Prototype Disain Produk     This research contains about casing project and ozonizer component layout of food preservative. The project is practiced using Quality Function Deployment (QFD method on product planning and design planning phase. In product planning phase, there is identification about consumer needs in ozonizer food preservative. Collecting data about consumer needs are received

  18. Evaluation of bike boxes at signalized intersections.

    Science.gov (United States)

    Dill, Jennifer; Monsere, Christopher M; McNeil, Nathan

    2012-01-01

    This paper presents a before-after study of bike boxes at 10 signalized intersections in Portland, Oregon. The bike boxes, also known as advanced stop lines or advanced stop boxes, were installed to increase visibility of cyclists and reduce conflicts between motor vehicles and cyclists, particularly in potential "right-hook" situations. Before and after video were analyzed for seven intersections with green bike boxes, three intersections with uncolored bike boxes, and two control intersections. User perceptions were measured through surveys of cyclists passing through five of the bike box intersections and of motorists working downtown, where the boxes were concentrated. Both the observations and survey of motorists found a high rate of compliance and understanding of the markings. Overall, 73% of the stopping motor vehicles did not encroach at all into the bike box. Both motor vehicle and bicycle encroachment in the pedestrian crosswalk fell significantly at the bike box locations compared to the control intersections. The bike boxes had mixed effects on the motorists' encroachment in the bicycle lane. The number of observed conflicts at the bike box locations decreased, while the total number of cyclists and motor vehicles turning right increased. Negative-binomial models based upon the data predict fewer conflicts with the boxes, particularly as right-turning motor vehicle volumes increase. Observations of yielding behavior at two bike box and one control intersection found an improvement in motorists yielding to cyclists at the bike box locations. Differences in the traffic volumes and location contexts make firm conclusions about the effects of green coloring of the boxes difficult. Higher shares of surveyed motorists felt that the bike boxes made driving safer rather than more dangerous, even when the sample was narrowed to respondents who were not also cyclists. Over three-quarters of the surveyed cyclists thought that the boxes made the intersection safer

  19. Towards understanding the Tat translocation mechanism through structural and biophysical studies of the amphipathic region of TatA from Escherichia coli.

    Science.gov (United States)

    Chan, Catherine S; Haney, Evan F; Vogel, Hans J; Turner, Raymond J

    2011-09-01

    The twin-arginine translocase (Tat) system is used by many bacteria and plants to move folded proteins across the cytoplasmic or thylakoid membrane. In most bacteria, the TatA protein is believed to form a defined pore in the membrane through homo-oligomerization with other TatA protomers. The predicted secondary structure of TatA includes a transmembrane helix, an amphipathic helix, and an unstructured C-terminal region. Here biophysical and structural investigations were performed on a synthetic peptide representing the amphipathic region of TatA (residues 22 to 44, abbreviated TatAH2). The C-terminal region of TatA (residues 44-89) was previously shown to be accessible from both the cytoplasmic and periplasmic sides of the membrane only when the membrane potential was intact, suggesting dependence of its topology on an energized membrane (Chan et al. 2007 Biochemistry 46: 7396-404). Such observation suggests that the TatAH2 region would have unique lipid interactions that may be related to the function of TatA during translocation and thus warranted further investigations. NMR and CD spectroscopy of TatAH2 show that it adopts a predominantly helical structure in a membrane environment while remaining unstructured in aqueous solution. Differential scanning calorimetry studies also reveal that TatAH2 interacts with DPPG lipids but not with DPPC, suggesting that negatively charged phospholipid head groups contribute to the membrane interactions with TatA. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. PENGEMBANGAN BUKU AJAR MATA PELAJARAN TATA HIDANG PAKET KEAHLIAN JASA BOGA SEKOLAH MENENGAH KEJURUAN

    Directory of Open Access Journals (Sweden)

    Yuli Astuti

    2016-01-01

    Full Text Available Textbooks are the ingredients or the subject matter is arranged systematically used by students in the learning process. The purpose of this study was to develop teaching materials such as textbooks on the subjects of governance hidang class X SMK in Magetan consisting of 3 KD, namely, (1 The scope of food and beverage service, (2 Operating equipment food and beverage service, and (3 providing food and beverage service at the restaurant. The results show that the development of an overall assessment of the completeness of the presentation of the textbook of the development of criteria that are in "good", which means it does not need to be revised textbooks. Buku ajar adalah bahan-bahan atau materi pelajaran yang disusun secara sistematis yang digunakan oleh siswa dalam proses belajar mengajar. Tujuan dari penelitian ini adalah untuk mengembangkan bahan ajar berupa buku ajar pada mata pelajaran tata hidang kelas X SMK di Kabupaten Magetan yang terdiri dari 3 KD yaitu, (1 Ruang lingkup pelayanan makanan dan minuman, (2 Mengoperasikan peralatan layanan makanan dan minuman, dan (3 menyediakan layanan makanan dan minuman di restoran. Hasil pengembangan menunjukkan bahwa secara keseluruhan penilaian tentang kelengkapan penyajian terhadap buku ajar hasil pengembangan berada pada kriteria “baik”, yang berarti buku ajar tidak perlu direvisi.

  1. PENGUNGKAPAN RISIKO FINANSIAL DAN TATA KELOLA PERUSAHAAN: STUDI EMPIRIS PERBANKAN INDONESIA

    Directory of Open Access Journals (Sweden)

    Djoko Suhardjanto

    2017-03-01

    Full Text Available The purpose of this study was to examine the effect of corporate governance to financial risk disclosures ofIndonesian banks. Corporate governance was identified as the board size, the number of board meetings, theproportion of independent commissioners, the proportion of independent audit committee members and numberof audit committee meetings. This study also used leverage and profitability as control variable. The levelof financial risk disclosure was measured based on identified items of a circular enclosure of Bank IndonesiaNo.5/21/DPNP/2003. Under purposive sampling, secondary data of 60 annual reports year 2007-2009 ofbanks in Indonesian Stock Exchange were selected. The average level of financial risk disclosures was at46.50%. It indicated that Indonesian’s banks were not fully compliance to regulations since financial riskdisclosures were as mandatory matters. The result of multiple regression showed that corporate governanceaffected the level of financial risk disclosure through the variable board size and the number of board meetings.The important role in implementing tata kelola perusahaan(company management was at the board of commissionerswho served as supervisors of activities and performance of banks as well as advisory directors inensuring that companies implemented good corporate governance, including financial risk disclosures (KomiteNasional Kebijakan Governance, 2006.

  2. Operation of Cryogenic Facility in e-way at Tata Institute of Fundamental Research, Mumbai, India

    International Nuclear Information System (INIS)

    Srinivasan, K V

    2012-01-01

    In an attempt towards the development of modern, model and paperless cryogenic facility, the Low Temperature Facility of Tata Institute of Fundamental Research, at Mumbai, India; carried out many automation works using programmable logic controller (PLC) and other modern electronic tools, with the objective of bringing the entire plant operation to your palm whenever and wherever you are. Efficiency in the plant operation by keeping a watch on the plant healthiness, advance indication about the possible plant problem by means of pre-warning alarms, so that the remedial action can be taken well prior to the actual failure affects the plant operation, reduction in plant down time were achieved by the automation works. Large size in our cryogen production, controlling the complicated helium liquefier, meeting the uninterrupted supply of cryogen to the users on “any time availability basis,” safety in handling cryogens and high pressure gas, effective usage of limited skilled manpower etc., all these requirements call for the definite need of modern electronic gears and gadgets. This paper will describe in details about the automation works carried out at our cryogenic facility at TIFR.

  3. Karakteristik Perubahan Penggunaan Lahan yang Tidak Sesuai Rencana Tata Ruang Di Koridor Lingkar Timur Sidoarjo

    Directory of Open Access Journals (Sweden)

    Kathon Wira Ajimas

    2017-03-01

    Full Text Available Untuk mempermudah akses, memecah kemacetan, serta pembangunan wilayah, Pemerintah Daerah Kabupaten Sidoarjo membangun Jalan Lingkar Timur Sidoarjo pada tahun 2006. Pembangunan jalan Lingkar Timur Sidoarjo dapat meningkatkan nilai lokasi dari lahan di sekitar koridor jalan tersebut karena adanya peningkatan aksesibilitas yang ada. Peningkatan nilai lokasi ini kemudian menyebabkan perubahan penggunaan lahan yang tidak sesuai rencana. Karakteristik perubahan penggunaan lahan di perlukan untuk menangani perubahan lahan di koridor Lingkar Timur Sidoarjo . Penelitian ini bertujuan untuk mengidentifikasi karakteristik perubahan penggunaan lahan yang tidak sesuai rencana tata ruang di koridor Lingkar Timur Sidoarjo. Untuk mencapai tujuan tersebut dilakukan dengan cara mengidentifikasi karakteristik perubahan penggunaan lahan berdasarkan jenis-jenis perubahan lahan, luas lahan, dan kecepatan perubahan lahan dengan menggunakan analisis deskriptif yaitu segmentasi wilayah. Berdasarkan hasil yang ditemukan pada segmen satu, perubahan lahan pertanian menjadi permuikiman adalah 1,3ha/th (lambat, Permukiman menjadi pergudangan adalah 0,7 ha/th (lambat, dan pertanian menjadi pergudangan adalah 5,9 ha/th (cepat. Perubahan . Perubahan lahan yang terjadi pada segmen 2, perubahan lahan pertanian menjadi permukiman adalah 4,4 ha/th sedang dan pertanian menjadi fasilitas umum 6,3 ha/th (cepat.

  4. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    Science.gov (United States)

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Elevated TATA-binding protein expression drives vascular endothelial growth factor expression in colon cancer.

    Science.gov (United States)

    Johnson, Sandra A S; Lin, Justin J; Walkey, Christopher J; Leathers, Michael P; Coarfa, Cristian; Johnson, Deborah L

    2017-07-25

    The TATA-binding protein (TBP) plays a central role in eukaryotic gene transcription. Given its key function in transcription initiation, TBP was initially thought to be an invariant protein. However, studies showed that TBP expression is upregulated by oncogenic signaling pathways. Furthermore, depending on the cell type, small increases in cellular TBP amounts can induce changes in cellular growth properties towards a transformed phenotype. Here we sought to identify the specific TBP-regulated gene targets that drive its ability to induce tumorigenesis. Using microarray analysis, our results reveal that increases in cellular TBP concentrations produce selective alterations in gene expression that include an enrichment for genes involved in angiogenesis. Accordingly, we find that TBP levels modulate VEGFA expression, the master regulator of angiogenesis. Increases in cellular TBP amounts induce VEGFA expression and secretion to enhance cell migration and tumor vascularization. TBP mediates changes in VEGFA transcription requiring its recruitment at a hypoxia-insensitive proximal TSS, revealing a mechanism for VEGF regulation under non-stress conditions. The results are clinically relevant as TBP expression is significantly increased in both colon adenocarcinomas as well as adenomas relative to normal tissue. Furthermore, TBP expression is positively correlated with VEGFA expression. Collectively, these studies support the idea that increases in TBP expression contribute to enhanced VEGFA transcription early in colorectal cancer development to drive tumorigenesis.

  6. Interconversion between active and inactive TATA-binding protein transcription complexes in the mouse genome.

    Science.gov (United States)

    Choukrallah, Mohamed-Amin; Kobi, Dominique; Martianov, Igor; Pijnappel, W W M Pim; Mischerikow, Nikolai; Ye, Tao; Heck, Albert J R; Timmers, H Th Marc; Davidson, Irwin

    2012-02-01

    The TATA binding protein (TBP) plays a pivotal role in RNA polymerase II (Pol II) transcription through incorporation into the TFIID and B-TFIID complexes. The role of mammalian B-TFIID composed of TBP and B-TAF1 is poorly understood. Using a complementation system in genetically modified mouse cells where endogenous TBP can be conditionally inactivated and replaced by exogenous mutant TBP coupled to tandem affinity purification and mass spectrometry, we identify two TBP mutations, R188E and K243E, that disrupt the TBP-BTAF1 interaction and B-TFIID complex formation. Transcriptome and ChIP-seq analyses show that loss of B-TFIID does not generally alter gene expression or genomic distribution of TBP, but positively or negatively affects TBP and/or Pol II recruitment to a subset of promoters. We identify promoters where wild-type TBP assembles a partial inactive preinitiation complex comprising B-TFIID, TFIIB and Mediator complex, but lacking TFIID, TFIIE and Pol II. Exchange of B-TFIID in wild-type cells for TFIID in R188E and K243E mutant cells at these primed promoters completes preinitiation complex formation and recruits Pol II to activate their expression. We propose a novel regulatory mechanism involving formation of a partial preinitiation complex comprising B-TFIID that primes the promoter for productive preinitiation complex formation in mammalian cells.

  7. Operation of Cryogenic Facility in e-way at Tata Institute of Fundamental Research, Mumbai, India.

    Science.gov (United States)

    Srinivasan, K. V.

    2012-12-01

    In an attempt towards the development of modern, model and paperless cryogenic facility, the Low Temperature Facility of Tata Institute of Fundamental Research, at Mumbai, India; carried out many automation works using programmable logic controller (PLC) and other modern electronic tools, with the objective of bringing the entire plant operation to your palm whenever and wherever you are. Efficiency in the plant operation by keeping a watch on the plant healthiness, advance indication about the possible plant problem by means of pre-warning alarms, so that the remedial action can be taken well prior to the actual failure affects the plant operation, reduction in plant down time were achieved by the automation works. Large size in our cryogen production, controlling the complicated helium liquefier, meeting the uninterrupted supply of cryogen to the users on “any time availability basis,” safety in handling cryogens and high pressure gas, effective usage of limited skilled manpower etc., all these requirements call for the definite need of modern electronic gears and gadgets. This paper will describe in details about the automation works carried out at our cryogenic facility at TIFR.

  8. The Heuristic Interpretation of Box Plots

    Science.gov (United States)

    Lem, Stephanie; Onghena, Patrick; Verschaffel, Lieven; Van Dooren, Wim

    2013-01-01

    Box plots are frequently used, but are often misinterpreted by students. Especially the area of the box in box plots is often misinterpreted as representing number or proportion of observations, while it actually represents their density. In a first study, reaction time evidence was used to test whether heuristic reasoning underlies this…

  9. Water box for steam generator

    International Nuclear Information System (INIS)

    Lecomte, Robert; Viaud, Michel.

    1975-01-01

    This invention relates to a water box for connecting an assembly composed of a vertical steam generator and a vertical pump to the vessel of the nuclear reactor, the assembly forming the primary cooling system of a pressurised water reactor. This invention makes it easy to dismantle the pump on the water box without significant loss of water in the primary cooling system of the reactor and particularly without it being necessary to drain the water contained in the steam generator beforehand. It makes it possible to shorten the time required for dismantling the primary pump in order to service or repair it and makes dismantling safer in that the dismantling does not involve draining the steam generator and therefore the critical storage of a large amount of cooling water that has been in contact with the fuel assemblies of the nuclear reactor core [fr

  10. Autoantibodies to box A of high mobility group box 1 in systemic lupus erythematosus

    NARCIS (Netherlands)

    Schaper, F.; de Leeuw, K.; Horst, G.; Maas, F.; Bootsma, H.; Heeringa, P.; Limburg, P. C.; Westra, J.

    Autoantibodies to nuclear structures are a hallmark of systemic lupus erythematosus (SLE), including autoantibodies to nuclear protein high mobility group box 1 (HMGB1). HMGB1 consists of three separate domains: box A, box B and an acidic tail. Recombinant box A acts as a competitive antagonist for

  11. Autoantibodies to box A of high mobility group box 1 in systemic lupus erythematosus

    NARCIS (Netherlands)

    Schaper, F.; Leeuw, K. de; Horst, G. ter; Maas, F.; Bootsma, H.; Heeringa, P.; Limburg, P.C.; Westra, J.

    2017-01-01

    Autoantibodies to nuclear structures are a hallmark of systemic lupus erythematosus (SLE), including autoantibodies to nuclear protein high mobility group box 1 (HMGB1). HMGB1 consists of three separate domains: box A, box B and an acidic tail. Recombinant box A acts as a competitive antagonist for

  12. Box-shaped halophilic bacteria.

    OpenAIRE

    Javor, B; Requadt, C; Stoeckenius, W

    1982-01-01

    Three morphologically similar strains of halophilic, box-shaped procaryotes have been isolated from brines collected in the Sinai, Baja California (Mexico), and southern California (United States). Although the isolates in their morphology resemble Walsby's square bacteria, which are a dominant morphological type in the Red Sea and Baja California brines, they are probably not identical to them. The cells show the general characteristics of extreme halophiles and archaebacteria. They contain ...

  13. The novel isotopically coded short-range photo-reactive crosslinker 2,4,6-triazido-1,3,5-triazine (TATA) for studying protein structures.

    Science.gov (United States)

    Brodie, Nicholas I; Petrotchenko, Evgeniy V; Borchers, Christoph H

    2016-10-21

    Short-distance molecular-modeling constraints are advantageous for elucidating the structures of individual proteins and protein conformational changes. Commonly used amine-reactive crosslinks are relatively long (14Å), partly due to the length of the lysine side-chain, and are sparsely distributed throughout a protein. Short-distance non-specific crosslinkers can provide a larger number of tighter molecular-modeling constraints. Here we describe the use of a short-range homo-trifunctional isotopically-coded non-specific photo-reactive crosslinking reagent, 2,4,6-triazido-1,3,5-triazine (TATA)- 12 C 3 / 13 C 3 , for MS-based protein crosslinking studies. Upon activation by 254nm UV light, TATA- 12 C 3 / 13 C 3 generates up to three nitrene radicals capable of non-selective crosslinking at ~5Å. This reagent was validated using cyclohexane, several test peptides, and myoglobin, and was found to react with a large number of amino acids, forming multiple crosslinked products. The myoglobin crosslinks detected by MS agreed with the known structure of myoglobin; arranging the protein's secondary-structure motifs into their correct fold was possible based solely on the constraints imposed by the crosslinks. Finally, TATA was used to crosslink the α-synuclein monomer. The 10 short-distance constraints provided by TATA crosslinking led to an initial model of the molten-globule form of the native α-synuclein monomer; this provides a suggested structure for the precursor of the misfolded α-synuclein proteoforms involved in synucleopathies. The isotopically labeled short-range non-specific crosslinker TATA- 12 C 3 / 13 C 3 was characterized for use in crosslinking-based protein structural studies. The crosslinking products of TATA can provide a distance constraint of merely 5Ǻ between crosslinked residues. TATA- 12 C 3 / 13 C 3 had broad reactivity, crosslinking a wide variety of amino acids, including lysine, glutamic and aspartic acid, asparagine, glutamine, glycine

  14. Penilaian Tingkat Kemapanan Tata Kelola Teknologi Informasi Berbasis COBIT 4.1 Pada Layanan Portal Akademik Online (Studi Kasus : UIN Maulana Malik Ibrahim Malang

    Directory of Open Access Journals (Sweden)

    Fachrul Kurniawan

    2014-09-01

    Full Text Available Pemanfaatan TI dalam dunia pendidikan merupakan hal yang sangat penting untuk menunjang kegiatan akademiknya. Termasuk juga di Universitas Islam Negeri Maulana Malik Ibrahim Malang yang terkenal dengan sistem administrasi akademik online atau biasa disebut siakad. Namun dalam pemanfatan tersebut belum bisa diketahui sejauh mana TI yang digunakan bisa mendukung proses bisnis yang ada di universitas, khususnya yang terkait dengan layanan akademik online. Oleh karena itu perlu adanya penilaian resmi dan prosedural terkait kualitas tata kelola TI pada layanan portal akademik online. Proses penilaian tata kelola TI ini menggunakan framework COBIT 4.1. Penelitian ini dilakukan di Lembaga Pengembangan Sistem Informasi (LPSI. Dalam proses penilaian tata kelola TI tersebut COBIT 4.1 menggunakan sistem pemetaan proses bisnis sehingga terpilih proses TI terkait COBIT atau dengan diagram value chain. Hasil dari pemetaan proses bisnis berdasarkan COBIT 4.1 terpilih proses TI DS1 Define and manage service levels dan DS4 Ensure continuous service sebagai acuan penilaian dengan hasil perhitungan tingkat kemapanan kedua proses TI pada level 3 (Defined. Namun LPSI memiliki keinginan dan harapan besar dalam meningkatkan tingkat kemapanan TI yang semakin baik, yaitu tata kelola yang optimal. Hal ini ditunjukkan dari hasil perhitungan tingkat kemapanan yang diharapkan (to-be , yaitu berada pada level 5 (Optimised. Kata kunci : tingkat kemapanan, tata kelola ti, COBIT, portal akademik online.

  15. EVALUASI PENERAPAN ICT DALAM MENDUKUNG KETERAMPILAN SAINTIFIK PADA PEMBELAJARAN TATA SURYA

    Directory of Open Access Journals (Sweden)

    Septiana Indri Hapsari

    2017-02-01

    Full Text Available Abstrak ___________________________________________________________________ Tujuan penelitian ini untuk mengetahui persentase penerapan ICT dalam mendukung keterampilan saintifik pada pembelajaran IPA tema tata surya. Pemilihan sampel dengan cara purpossive sampling, diperoleh guru IPA dan peserta didik kelas VIII di SMPN 5, 8, 15 Yogyakarta dan SMP Pangudi Luhur 1 Yogyakarta. Penelitian ini merupakan penelitian Evaluasi dengan model yang digunakan adalah Countenance Stake. Instrumen yang digunakan adalah angket peserta didik, angket guru, serta observasi. Data diolah dengan menggunakan deskriptif.  Hasil penelitian ini adalah 77,54% peserta didik mengaku ICT membantu kegiatan mengamati, 57,97% ICT membantu kegiatan menanya, 75,36% ICT membantu kegiatan mengumpulkan informasi, 57,00% ICT membantu kegiatan mengasosiasi, dan 42,75% ICT membantu kegiatan mengkomunikasikan. Dengan demikian penerapan ICT cukup mendukung keterampilan saintifik, namun harus tetap perlu ditingkatkan. Abstract ___________________________________________________________________ The purpose of this study to determine the percentage of the application of ICT in supporting scientific skills in learning science theme of the solar system. Election sample by purposive sampling, obtained a science teacher and students in class VIII SMPN 5, 8, 15 and SMP Pangudi Luhur Yogyakarta 1 Yogyakarta. This study is evaluation of the model used is the Countenance Stake. The instrument used was a questionnaire the learner, teacher questionnaire, and observation. The data was processed using descriptive. The results of this study are 77,54% of students admitted to ICT helps the activity observed, 57,97% ICT help activities ask, 75,36% ICT help in gathering information, 57,00% ICT assist the associates, and 42,75% ICT help communicate the activities. Thus the application of ICT support enough scientific skills, but must still be improved.

  16. POTENSI PERKEMBANGAN WILAYAH DAN KAITANNYA DENGAN TATA RUANG DI KAWASAN LERENG MERAPI PROPINSI DAERAH ISTIMEWA YOGYAKARTA

    Directory of Open Access Journals (Sweden)

    Luthfi Muta'ali

    2016-10-01

    Full Text Available ABSTRAK Penelitian ini bertujuan untuk mengkaji potensi dan perkembangan wilayah kawasan lereng Merapi yang dikalikan dengan peruntukan fungsi tata ruang. Lingkup wilayah dan unit analisis adalah seluruh desa di kawasan pengembangan Lereng Merapi, yaitu sejumlah 206 desa yang tersebar di Kabupaten Sleman, Kota Yogyakarta, dan Kabupaten Banta Penelitian menggunakan pendekatan deskriptif analitis, dengan menggunakan data sekunder. Potensi perkembangan wilayah diidentifikasi dengan indikator demografis, karakteristik social ekonomi, penggunaan lahan dan infrastruktur, dan aksesibilitas. Sedangkan data peruntukan ruang dikelompokkan dalam peruntukan fungsi kawasan lindung dan kawasan budidaya. Teknik analisis yang digunakan antara lain stalistik deskriptip, penentuan tipologi wilayah, analisis deskriminan, shift analysis, dan pemetaan. Hasil penelitian menunjukkan, pola perkembangan wilayah di kawasan lereng Merapi terkonsentrasi di bagian tengah (kota Yogyakarta dan pinggirannya dan menuju kearah lereng atas (Kabupaten Sleman. Pada fungsi budidaya, sebagian besar wilayah bertipe 1: (besar tumbuh berada di daerah perkotaan dan perluasannya, sedangkan wilayah ripe 1l (kecil tumbuh urnumnya berfungsi sebagai daerah pertanian lahan basah. Pada peruntukan fungsi lindung, khususnya lindung bawahan (resapan air, terdapat 36,7% (18 desa yang berpotensi berkembang pesat. Analisis basis ekonomi juga menunjukkan bahwa potensi perkembangan wilayah tinggi, akan diiringi oleh pergeseran menguatnya peran sektor non pertanian. Tipologi wilayah menurut fungsi kawasan dapat digunakan sebagai dasar dalam determinasi perkembangan wilayah, karena memiliki tingkat perbedaan yang signifikan antara fungsi lindung dan budidaya. Gejala potensi perkembangan wilayah yang tinggi di lereng bagian tengah dan atas yang berfungsi sebagai kawasan lindung dan resapan tidak menguntungkan dart sisi ekologis, dapat mengakibatkan kerusakan lingkungan. Oleh karena itu penelitian ini

  17. Voronoi Diagrams Without Bounding Boxes

    Science.gov (United States)

    Sang, E. T. K.

    2015-10-01

    We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010) and Nerbonne et al (2011).

  18. Hot cells and glove boxes

    International Nuclear Information System (INIS)

    1992-05-01

    Hot cells and glove boxes have been designed and developed to conduct operations involving radioactive materials which require some degree of manipulation. Glove boxes were developed to manipulate alpha emitters. As their name indicates, these are airtight boxes usually constructed with transparent, see-through walls. Operations are conducted inside by means of gloves or mechanic manipulators. These boxes are also used for biological-protection purposes, e.g., manipulation of viruses or similar applications. Basically, hot cells are used for: - radioisotope fractionning and purification; - post-irradiation studies, and - tests or sundry operations involving radiological or biological protection. These shielded cells are constructed on a supporting structure made out of steel and antimonious Pb bricks with airtight inner enclosures and lead-glass windows. Operations are conducted by means of remote telemanipulators. Airtight enclosures are made out of a stainless steel structure forming an Omega-shaped profile on the openings which are fitted with acrylic panels. Tight-proof insulation is achieved by means of appropriate joints placed between the structure and acrylic plates. Electric passage ducts for fluids or electrical conductors also preserve absolute hermeticity. The partition enclosures are placed on supporting tables made out of normalized sections and steel plates. If needed, enclosures, may be removed and replaced by others. For materials-transference purposes, these cells are provided with shielded doors, air-tight doors and a connecting duct between the tight-proof enclosures with a guillotine-type gate and a pneumatic remote-control coupling/uncoupling system. Each work post is provided with an operations console and a control cabinet with depression indicating manometers, input inlet valves and electrical interconnecting boards. A desk-type console centralizes operation commands which will take place inside the enclosures. Appropriate lighting has been

  19. International Conference on Analytic and Algebraic Geometry held at the Tata Institute of Fundamental Research and the University of Hyderabad

    CERN Document Server

    Biswas, Indranil; Morye, Archana; Parameswaran, A

    2017-01-01

    This volume is an outcome of the International conference held in Tata Institute of Fundamental Research and the University of Hyderabad. There are fifteen articles in this volume. The main purpose of the articles is to introduce recent and advanced techniques in the area of analytic and algebraic geometry. This volume attempts to give recent developments in the area to target mainly young researchers who are new to this area. Also, some research articles have been added to give examples of how to use these techniques to prove new results.

  20. Structure of TatA paralog, TatE, suggests a structurally homogeneous form of Tat protein translocase that transports folded proteins of differing diameter.

    Science.gov (United States)

    Baglieri, Jacopo; Beck, Daniel; Vasisht, Nishi; Smith, Corinne J; Robinson, Colin

    2012-03-02

    The twin-arginine translocation (Tat) system transports folded proteins across bacterial and plant thylakoid membranes. Most current models for the translocation mechanism propose the coalescence of a substrate-binding TatABC complex with a separate TatA complex. In Escherichia coli, TatA complexes are widely believed to form the translocation pore, and the size variation of TatA has been linked to the transport of differently sized substrates. Here, we show that the TatA paralog TatE can substitute for TatA and support translocation of Tat substrates including AmiA, AmiC, and TorA. However, TatE is found as much smaller, discrete complexes. Gel filtration and blue native electrophoresis suggest sizes between ∼50 and 110 kDa, and single-particle processing of electron micrographs gives size estimates of 70-90 kDa. Three-dimensional models of the two principal TatE complexes show estimated diameters of 6-8 nm and potential clefts or channels of up to 2.5 nm diameter. The ability of TatE to support translocation of the 90-kDa TorA protein suggests alternative translocation models in which single TatA/E complexes do not contribute the bulk of the translocation channel. The homogeneity of both the TatABC and the TatE complexes further suggests that a discrete Tat translocase can translocate a variety of substrates, presumably through the use of a flexible channel. The presence and possible significance of double- or triple-ring TatE forms is discussed.

  1. Efficient expression of cyclodextrin glycosyltransferase from Geobacillus stearothermophilus in Escherichia coli by promoter engineering and downstream box evolution.

    Science.gov (United States)

    Deng, Chen; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

    2018-01-20

    Cyclodextrin glycosyltransferase (CGTase) catalyzes hydrolysis, cyclization, coupling, and disproportionation reactions and is widely used in the starch processing industry. In this work, the expression of CGTase from Geobacillus stearothermophilus in Escherichia coli BL21 (DE3) was significantly improved by promoter engineering and downstream box evolution. Firstly, the effects of the promoter type (P T7 , P trp , P lacUV5 , and the hybrid promoters P tacI and P tacII ) and spacer sequence on the expression of CGTase were examined. P tacI demonstrated the highest rate of transcriptional activity, which was 4.4-, 7.1-, 3.3-, and 1.5-fold greater than that of P T7 , P trp , P lacUV5 , and P tacII , respectively. The spacer sequence of the promoter was optimized using a degenerate base library, and the GC content of the spacer was found to be inversely proportional to CGTase expression. In addition, CGTase expression was higher when TG:CA and TA:TA dimers were present in the spacer sequence. Under the control of the P tacI promoter with an optimized spacer sequence, extracellular CGTase activity reached 170.6 U/mL, which was seven times higher than that of the original strain (25.2 U/mL). Directed evolution of the downstream box sequence was then performed by randomization of the sequence using degenerate codons, similarly as for the optimization of the spacer sequence. After optimizing the downstream box sequence, CGTase activity increased from 170.6 to 214 U/mL. The results obtained here indicate that in addition to promoter type, the spacer sequence of the promoter and the downstream box are important target elements for improved gene expression. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Stronger learning recruits additional cell-signaling cascades: c-Jun-N-terminal kinase 1 (JNK1) is necessary for expression of stronger contextual fear conditioning.

    Science.gov (United States)

    Leach, Prescott T; Kenney, Justin W; Gould, Thomas J

    2015-02-01

    Increased training often results in stronger memories but the neural changes responsible for these stronger memories are poorly understood. It is proposed here that higher levels of training that result in stronger memories recruit additional cell signaling cascades. This study specifically examined if c-Jun N-terminal kinase 1 (JNK1) is involved in the formation of stronger fear conditioning memories. Wildtype (WT), JNK1 heterozygous (Het), and JNK1 knockout (KO) mice were fear conditioned with 1 trial, 2 trials, or 4 trials. All mice learned both contextual (hippocampus-dependent) and cued (hippocampus-independent) fear conditioning but for contextual fear conditioning only, the JNK1 KO mice did not show higher levels of learning with increased trials. That is, WT mice showed a significant linear increase in contextual fear conditioning as training trials increased from 1 to 2 to 4 trials whereas KO mice showed the same level of contextual fear conditioning as WT mice for 1 trial training but did not have increased levels of contextual fear conditioning with additional trials. These data suggest that JNK1 may not be critical for learning but when higher levels of hippocampus-dependent learning occur, JNK1 signaling is recruited and is necessary for stronger hippocampus-dependent memory formation. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Box graphs and singular fibers

    International Nuclear Information System (INIS)

    Hayashi, Hirotaka; Lawrie, Craig; Morrison, David R.; Schäfer-Nameki, Sakura

    2014-01-01

    We determine the higher codimension fibers of elliptically fibered Calabi-Yau fourfolds with section by studying the three-dimensional N=2 supersymmetric gauge theory with matter which describes the low energy effective theory of M-theory compactified on the associated Weierstrass model, a singular model of the fourfold. Each phase of the Coulomb branch of this theory corresponds to a particular resolution of the Weierstrass model, and we show that these have a concise description in terms of decorated box graphs based on the representation graph of the matter multiplets, or alternatively by a class of convex paths on said graph. Transitions between phases have a simple interpretation as “flopping' of the path, and in the geometry correspond to actual flop transitions. This description of the phases enables us to enumerate and determine the entire network between them, with various matter representations for all reductive Lie groups. Furthermore, we observe that each network of phases carries the structure of a (quasi-)minuscule representation of a specific Lie algebra. Interpreted from a geometric point of view, this analysis determines the generators of the cone of effective curves as well as the network of flop transitions between crepant resolutions of singular elliptic Calabi-Yau fourfolds. From the box graphs we determine all fiber types in codimensions two and three, and we find new, non-Kodaira, fiber types for E 6 , E 7 and E 8

  4. Lessons from the light-cone box

    CERN Document Server

    Leibbrandt, G

    2000-01-01

    Working in the noncovariant light-cone gauge, we discuss the explicit computation of the 1PI four-point function ("box diagram") in Yang- Mills theory. The complete box diagram which consists of 16 box subdiagrams, 8 lynx subdiagrams and 4 fish subdiagrams, yields both local and nonlocal UV divergent terms. The nonlocal terms are consistent with gauge symmetry and correspond to a nonlocal renormalization of the wave function. (14 refs).

  5. Repackaging SRS Black Box TRU Waste

    International Nuclear Information System (INIS)

    Swale, D. J.; Stone, K.A.; Milner, T. N.

    2006-01-01

    Historically, large items of TRU Waste, which were too large to be packaged in drums for disposal have been packaged in various sizes of custom made plywood boxes at the Savannah River Site (SRS), for many years. These boxes were subsequently packaged into large steel ''Black Boxes'' for storage at SRS, pending availability of Characterization and Certification capability, to facilitate disposal of larger items of TRU Waste. There are approximately 107 Black Boxes in inventory at SRS, each measuring some 18' x 12' x 7', and weighing up to 45,000 lbs. These Black Boxes have been stored since the early 1980s. The project to repackage this waste into Standard Large Boxes (SLBs), Standard Waste Boxes (SWB) and Ten Drum Overpacks (TDOP), for subsequent characterization and WIPP disposal, commenced in FY04. To date, 10 Black Boxes have been repackaged, resulting in 40 SLB-2's, and 37 B25 overpack boxes, these B25's will be overpacked in SLB-2's prior to shipping to WIPP. This paper will describe experience to date from this project

  6. The three-box paradox revisited

    International Nuclear Information System (INIS)

    Ravon, Tamar; Vaidman, Lev

    2007-01-01

    The classical three-box paradox of Kirkpatrick (2003 J. Phys. A: Math. Gen. 36 4891) is compared to the original quantum three-box paradox of Aharonov and Vaidman (1991 J. Phys. A: Math. Gen. 24 2315). It is argued that the quantum three-box experiment is a 'quantum paradox' in the sense that it is an example of a classical task which cannot be accomplished using classical means, but can be accomplished using quantum devices. It is shown that Kirkpatrick's card game is analogous to a different game with a particle in three boxes which does not contain paradoxical features

  7. Makna dan Kriteria Diskresi Keputusan Dan/Atau Tindakan Pejabat Publik dalam Mewujudkan Tata Pemerintahan yang Baik

    Directory of Open Access Journals (Sweden)

    Agus Budi Susilo

    2015-03-01

    Full Text Available Dalam rangka melakukan tindakan hukum, pejabat publik sering melakukan tindakan di luar ketentuan hukum tertulis. Keadaan ini sebagai suatu konsekuensi logis, bahwa Undang-Undang dan peraturan tertulis lainnya seringkali tertinggal dalam mengantisipasi perkembangan zaman, perubahan nilai, dan meningkatnya kebutuhan hidup manusia seiring dengan kemajuan yang dicapainya di bidang ilmu pengetahuan dan teknologi. Oleh karena itu, agar prinsip legalitas pada tahap operasionalnya dapat dilaksanakan dengan sebaik-baiknya, maka diperlukan “diskresi” sebagai sarana pengembangannya. Ironisnya, tidak jarang penggunaan diskresi oleh pejabat publik dengan dalih untuk kepentingan umum dan kepastian hukum, justru mengorbankan hak-hak masyarakat baik secara individu pribadi, kelompok maupun badan hukum perdata. Untuk mengantisipasinya, perlu ada konsep lain yang mengendalikan diskresi keputusan dan/atau tindakan pejabat publik, dan konsep tersebut adalah good governance, yang sering diartikan tata pemerintahan yang baik. Dengan memahami prinsip-prinsip utama dari tata pemerintahan yang baik itu sendiri, diharapkan diskresi keputusan dan/atau tindakan pejabat publik dapat diterapkan sesuai rel hukum (rechtmatigheid van regering.

  8. IMPROVED, FAVORABLE FOR ENVIRONMENT POLYURETHANE COLD-BOX-PROCESS (COLD BOX «HUTTENES-ALBERTUS» .

    Directory of Open Access Journals (Sweden)

    A. Sergini

    2005-01-01

    Full Text Available The results of the laboratory and industrial investigations, the purpose of which is improvement of the classical Cold-box-process, i.e. the process of the slugs hardening in cold boxes, are presented.

  9. PENGEMBANGAN BAHAN AJAR POLA DASAR BUSANA WANITA PADA PROGRAM STUDI D3 TATA BUSANA

    Directory of Open Access Journals (Sweden)

    Idah Hadijah

    2014-05-01

    Full Text Available Teaching Materials Development of the Basic Pattern of Women's Clothing on Clothing Design Program. The purpose of this development is to pro­­duce teaching materials of archetypal body of woman fashion, whichis equipped with a Power Po­int in order to assist faculty and students on conducting learning ac­ti­vi­ty. The research development me­thod used was adapted from the instructional de­sign model of Dick and Carey. The results of the study in the form of assess­ment/feedback showed that the mean score reached 86.00%, which meant that the teaching materials categorized as well qualify­ed/ decent, the media has a very good Power Point as it re­ached 91.00%, the lecturers gui­de reached 92.00% and catehorized as ex­cell­ent/ve­ry decent, and the students guide achieved 83.00% and categorized as good/de­cent. Thus, the teaching material is feasible to be used as the instructional materials for learning on Clothing Design Program.   Tujuan pengembangan ini un­­­tuk menghasilkan produk bahan ajar po­­la dasar ba­dan busana wanita dilengkapi de­ngan Power Point, sehingga dapat membantu dosen dan mahasiswa dalam me­lak­sa­na­kan pembelajaran. Metode penelitian pengembangan yang digunakan diadaptasi dari ran­­­cangan pembelajaran model Dick dan Carey. Hasil pe­nelitian berupa penilaian/tanggapan menunjukan rerata skor bah­­wa bahan ajar mencapai 86,00% termasuk ke da­lam kualifikasi baik/layak, media Po­­wer Point termasuk sangat baik karena men­capai 91,00%, pan­­duan dosen mencapai 92,00% termasuk ke dalam kualifikasi sangat ba­ik/sa­­­­ngat layak, dan panduan ma­ha­siswa mencapai 83,00% termasuk kua­lifikasi ba­ik/la­yak, dengan demikian bahan ajar ter­­sebut layak digunakan untuk pem­­b­e­lajaran pada Program Studi D3Tata Busana.

  10. Dinamika Tata Kelola Kebijakan Industri Penyiaran dan Telekomunikasi Indonesia Menuju Konvergensi

    Directory of Open Access Journals (Sweden)

    Vience Mutiara Rumata

    2016-03-01

    Full Text Available Abstrak Konvergensi antara penyiaran dan telekomunikasi di Indonesia tidak terhindarkan seiring dengan perkembangan teknologi informasi dan komunikasi (TIK serta ketatnya persaingan dalam industri keduanya. Kedua industri telah mengintegrasi TIK sebagai nilai tambah dari layanan ataupun produk yang ditawarkannya. Meski demikian, tata kelola kedua industri ini masih terpisah yakni melalui UU Penyiaran tahun 2002 dan UU Telekomunikasi tahun 1999. Di saat RUU konvergensi telematika belum menemukan titik terang, regulator berupaya merevisi kedua UU tersebut. Studi ini bertujuan untuk memahami relasi kekuasaan serta pandangan para pemangku kebijakan dalam mengatur industri penyiaran dan telekomunikasi di era konvergensi. Teknik pengumpulan data dilakukan dengan cara wawancara mendalam kepada narasumber yang dipilih secara purposif yakni Kemkominfo, KPI, BRTI, dan DPR, selama Januari-Februari 2015. Setiap institusi memiliki path dependence yang berbeda antar satu dengan yang lain, sehingga membentuk pola distribusi kekuasan berbeda dalam prosedur pembuatan kebijakan. Proposal revisi UU baik dari Kemkominfo dan KPI tidak mengatur hal-hal yang berkaitan dengan konvergensi. Akan tetapi, perebutan otoritas antar kedua institusi tersebut justru menjadi fokus dalam proposal tersebut. Kemkominfo, sebagai inisiator UU Telekomunikasi, berencana untuk mengubah revisi UU tersebut menjadi UU konvergensi.     Abstract The convergence between broadcasting and telecommunication in Indonesia is inevitable as the growing information and communication technology and competition within both industries. Nevertheless, the policy governance of these industries remains distinctively separated under the 2002 Broadcasting Law and the 1999 Telecommunication Law. Whilst the regulators failed to enact the convergence bill, the only way is to synergize the revision of both laws.. This study aims to understand the point of views as well as power relation among regulators in

  11. An extended method for obtaining S-boxes based on three-dimensional chaotic Baker maps

    International Nuclear Information System (INIS)

    Chen Guo; Chen Yong; Liao Xiaofeng

    2007-01-01

    Tang et al. proposed a novel method for obtaining S-boxes based on the well-known two-dimensional chaotic Baker map. Unfortunately, some mistakes exist in their paper. The faults are corrected first in this paper and then an extended method is put forward for acquiring cryptographically strong S-boxes. The new scheme employs a three-dimensional chaotic Baker map, which has more intensive chaotic characters than the two-dimensional one. In addition, the cryptographic properties such as the bijective property, the nonlinearity, the strict avalanche criterion, the output bits independence criterion and the equiprobable input/output XOR distribution are analyzed in detail for our S-box and revised Tang et al.'s one, respectively. The results of numerical analysis show that both of the two boxes can resist several attacks effectively and the three-dimensional chaotic map, a stronger sense in chaotic characters, can perform more smartly and more efficiently in designing S-boxes

  12. VORONOI DIAGRAMS WITHOUT BOUNDING BOXES

    Directory of Open Access Journals (Sweden)

    E. T. K. Sang

    2015-10-01

    Full Text Available We present a technique for presenting geographic data in Voronoi diagrams without having to specify a bounding box. The method restricts Voronoi cells to points within a user-defined distance of the data points. The mathematical foundation of the approach is presented as well. The cell clipping method is particularly useful for presenting geographic data that is spread in an irregular way over a map, as for example the Dutch dialect data displayed in Figure 2. The automatic generation of reasonable cell boundaries also makes redundant a frequently used solution to this problem that requires data owners to specify region boundaries, as in Goebl (2010 and Nerbonne et al (2011.

  13. Asian-American Mental Health and Help-Seeking Behavior: Comment on Solberg et al. (1994), Tata and Leong (1994), and Lin (1994).

    Science.gov (United States)

    Sue, Derald Wing

    1994-01-01

    Comments on previous articles (this issue) by Solberg et al., Tata and Leong, and Lin on help-seeking behaviors of Asian Americans. Sees articles as dispelling false images and stereotypes about mental health needs of Asian Americans. Suggests that future research focus on diversity of Asian American population and development of theories and…

  14. Perturbation of discrete sites on a single protein domain with RNA aptamers: targeting of different sides of the TATA-binding protein (TBP).

    Science.gov (United States)

    Hohmura, Ken I; Shi, Hua; Hirayoshi, Kazunori

    2013-01-01

    Control of interactions among proteins is critical in the treatment of diseases, but the specificity required is not easily incorporated into small molecules. Macromolecules could be more suitable as antagonists in this situation, and RNA aptamers have become particularly promising. Here we describe a novel selection procedure for RNA aptamers against a protein that constitutes a single structural domain, the Drosophila TATA-binding protein (TBP). In addition to the conventional filter partitioning method with free TBP as target, we performed another experiment, in which the TATA-bound form of TBP was targeted. Aptamers generated by both selections were able to bind specifically to TBP, but the two groups showed characteristics which were clearly different in terms of their capability to compete with TATA-DNA, their effects on the TATA-bound form of TBP, and their effects on in vitro transcription. The method used to generate these two groups of aptamers can be used with other targets to direct aptamer specificity to discrete sites on the surface of a protein.

  15. Electrical requirements for unshielded glove boxes

    International Nuclear Information System (INIS)

    1978-02-01

    The specification relates to the general design and installation of electrical services required in unshielded glove boxes in which atmospheres of air, argon or nitrogen etc. may exist either temporarily or permanently. The specification does not apply to electrical services for glove boxes with flammable explosive atmospheres. (author)

  16. A boxing procedure for corrected cast impressions.

    Science.gov (United States)

    Ansari, I H

    1994-01-01

    This new method for boxing a corrected cast impression for a distal extension removable partial denture improves the procedure. The framework with its impression is seated on the remainder of the cast after anatomic ridges have been removed and luted with sticky wax, and the assembly is inserted into a previously formed thermoplastic box and poured to make a new corrected cast.

  17. Characterization and functional analysis of a novel double-guide C/D box snoRNA in the fission yeast

    International Nuclear Information System (INIS)

    Bi Yanzhen; Qu Lianghu; Zhou Hui

    2007-01-01

    Ribose methylation of eukaryotic rRNA is directed by box C/D small nucleolar RNAs (snoRNAs), which pinpoint the nucleotide to be methylated in specific position within the rRNA sequence. Here, we report the identification of a novel double-guide C/D box snoRNA termed snR88 that directs methylation of two previously undetermined sites in 25S rRNA from the fission yeast. Knockout of the predicted TATA box of the snR88 gene resulted in the complete blocking of its expression, showing that snR88 is an independently transcribed gene and dispensable for yeast viability. The depletion of snR88 abolished 25S rRNA methylation at U2304 and U2497 simultaneously. Interestingly, an unusual pause of reverse transcription at U2495 was observed, which implies an unknown structure of 25S rRNA related to ribose methylation at U2497 in the fission yeast

  18. 49 CFR 178.515 - Standards for reconstituted wood boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for reconstituted wood boxes. 178.515... wood boxes. (a) The identification code for a reconstituted wood box is 4F. (b) Construction requirements for reconstituted wood boxes are as follows: (1) The walls of boxes must be made of water...

  19. North American box turtles: A natural history

    Science.gov (United States)

    Dodd, C. Kenneth

    2002-01-01

    Once a familiar backyard visitor in many parts of the United States and Mexico, the box turtle is losing the battle against extinction. In North American Box Turtles, C. Kenneth Dodd, Jr., has written the first book-length natural history of the twelve species and subspecies of this endangered animal. This volume includes comprehensive information on the species’ evolution, behavior, courtship and reproduction, habitat use, diet, population structure, systematics, and disease. Special features include color photos of all species, subspecies, and their habitats; a simple identification guide to both living and fossil species; and a summary of information on fossil Terrapene and Native uses of box turtles. End-of-chapter sections highlight future research directions, including the need for long-term monitoring and observation of box turtles within their natural habitat and conservation applications. A glossary and a bibliography of literature on box turtles accompany the text.

  20. MANAJEMEN PERPUSTAKAAN SEKOLAH BERBASIS SISTEM INFORMASI GUNA MENINGKATKAN KEMANDIRIAN DAN OPTIMALISASI TATA KELOLA PERPUSTAKAAN SEKOLAH DASAR SE-KECAMATAN JATINANGOR

    Directory of Open Access Journals (Sweden)

    Tine Silvana

    2014-11-01

    ABSTRAK Kegiatan Pengabdian Masyarakat ini dilaksanakan di Kecamatan Jatinangor dengan mengambil tempat pelaksanaan di Aula Kantor UPTD TK, SD dan PNF Kecamatan Jatinangor dan di Ruang Pertemuan GERKOPIN Kecamatan Jatinangor. Sebagai Masyarakat Mitra dalam PKM ini yakni Unit Pengelola Teknis Dinas TK, SD dan PNF Kecamatan Jatinangor. Pencapaian Sasaran PKM ini adalah para Pengelola Perpustakaan Sekolah Dasar Se-Kecamatan Jatinangor. Kegiatan PKM yang telah dilaksanakan yakni dimulai dari kegiatan FGD untuk mengetahui kebutuhan pencapaian sasaran, kemudian Seminar dan Workshop yang diikuti oleh para Kepala Sekolah Dasar serta para Pengelola Perpustakaan dari 29 SD Negeri maupun Swasta. Berikutnya kegiatan Monitoring dan Evaluasi Akhir. Tujuan dari Program PKM ini adalah agar pencapaian sasaran dapat memiliki pengetahuan dan keterampilan teknis dalam mengelola dan mengolah koleksi bahan pustaka maupun layanan perpustakaan sekolah dengan menggunakan sistem informasi perpustakaan yang lebih mudah digunakan. Dalam kegiatan FGD diketahui bahwa hampir semua pengelola perpustakaan sekolah belum dapat menangani pengolahan koleksi secara sistematis. Meskipun sebagian diantara mereka sudah mengetahui adanya sistem informasi yang dapat digunakan untuk mengolah dan mengelola koleksi, mereka belum mengetahui dan belum dapat memanfaatkan dan menggunakannya. Dalam sesi Seminar, para Kepala Sekolah mendapatkan pemahaman lebih lanjut tentang pentingnya mengelola perpustakaan sekolah secara lebih profesional. Terlebih lagi bahwa mereka saat ini mulai dituntut untuk selalu siap menyediakan data dan informasi tentang tata kelola perpustakaan baik untuk pelaporan dan evaluasi maupun untuk kepentingan akreditasi sekolah. Dalam sesi Workshop, para peserta yang umumnya para pelaksana pengelola perpustakaan mendapatkan pengetahuan dan keterampilan teknis tentang tata cara pengolahan koleksi yang terdiri dari inventarisasi, klasifikasi, katalogisasi, pelayanan serta administrasi perpustakaan

  1. PENGARUH DISIPLIN KERJA, MOTIVASI KERJA, DAN TATA RUANG KANTOR TERHADAP KINERJA PEGAWAI KELURAHAN KECAMATAN PURBALINGGA KABUPATEN PURBALINGGA

    Directory of Open Access Journals (Sweden)

    Masasti Suci

    2015-11-01

    Full Text Available Kinerja adalah suatu hasil kerja baik secara kualitas maupun kuantitas yang dicapai oleh seseorang untuk mencapai tujuan tertentu. Kinerja yang baik tentunya dipengaruhi oleh beberapa faktor, seperti disiplin kerja, motivasi kerja, dan tata ruang kantor yang ada di kantor Kelurahan Kecamatan Purbalingga Kabupaten Purbalingga. Permasalahan dalam penelitian ini yaitu kedisiplinan pegawai dalam jam kerja yang kurang baik, rendahnya semangat pegawai untuk memberikan pelayanan kepada masyarakat dengan maksimal, masih terdapat ketidakteraturan dalam hal penataan ruang kantor dan lingkungan fisik. Metode pengumpulan data yang digunakan adalah metode angket dan dokumentasi. Uji keberartian persamaan regresi dilihat dari uji Fhitung = 49,993 dengan probabilitas sebesar 0,000 < 0,05 sehingga diperoleh hasil analisis regresi linear berganda dengan persamaan Y = 0,281 + 0,357X1 + 0,252X2 + 0,222X3. Besarnya pengaruh secara simultan antara disiplin kerja, motivasi kerja, dan tata ruang kantor terhadap kinerja pegawai yaitu 59,2%. Variabel yang memberikan pengaruh paling besar terhadap kinerja pegawai secara parsial adalah disiplin kerja yaitu sebesar 21,34%, sedangkan untuk motivasi kerja, dan tata ruang kantor berpengaruh lebih kecil yaitu masing-masing sebesar 19,53%, dan 9,18%. A performance is the work result either qualitatively or quantitatively achieved by a person to reach the certain goal. The good performance is influenced by some factors such as work discipline, work motivation, and office room arrangement in the village office. The problems of this reserach were the low disipline of civil servants’ in the work time, the low motivation of the civil servants to give the service for the guests, and the bad ordered office room arrangement and the physical environment. The data were colleted by questionnaire and documentation. The significance test of regression was found out from F test = 49.993 with probability was 0.000 < 0.05, therefore the

  2. Dinamika Tata Kelola Kebijakan Industri Penyiaran dan Telekomunikasi Indonesia Menuju Konvergensi: Sebuah Studi Paradigma Interpretatif

    Directory of Open Access Journals (Sweden)

    Vience Mutiara Rumata

    2017-03-01

    Konvergensi antara penyiaran dan telekomunikasi di Indonesia tidak terhindarkan seiring dengan perkembangan teknologi informasi dan komunikasi (TIK serta ketatnya persaingan dalam industri keduanya. Kedua industri telah mengintegrasi TIK sebagai nilai tambah dari layanan ataupun produk yang ditawarkannya. Meski demikian, tata kelola kedua industri ini masih terpisah yakni melalui UU Penyiaran tahun 2002 dan UU Telekomunikasi tahun 1999. Di saat RUU konvergensi telematika belum menemukan titik terang, regulator berupaya merevisi kedua UU tersebut. Studi ini merupakan penelitian deskriptif kualitatif dengan kerangka paradigma interpretatif dengan berlandaskan teori neo-institusionalisme, yakni historical institutionalism. Studi ini bertujuan untuk memahami relasi kekuasaan serta pandangan para pemangku kebijakan dalam mengatur industri penyiaran dan telekomunikasi di era konvergensi. Teknik pengumpulan data dilakukan dengan cara wawancara mendalam kepada narasumber yang dipilih secara purposif yakni Kemkominfo, KPI, BRTI, dan DPR, selama Januari-Februari 2015. Setiap institusi memiliki path dependence yang berbeda antar satu dengan yang lain, sehingga membentuk pola distribusi kekuasan berbeda dalam prosedur pembuatan kebijakan. Proposal revisi UU baik dari Kemkominfo dan KPI tidak mengatur hal-hal yang berkaitan dengan konvergensi. Akan tetapi, perebutan otoritas antar kedua institusi tersebut justru menjadi fokus dalam proposal tersebut. Kemkominfo, sebagai inisiator UU Telekomunikasi, berencana untuk mengubah revisi UU tersebut menjadi UU konvergensi. Fokus utama revisi tersebut adalah upaya untuk memfasilitasi interkoneksi dan internetworking dalam infrastruktur digital sebagai fondasi ekosistem konvergensi.     Abstract The convergence between broadcasting and telecommunication in Indonesia is envitable as the growing information and communication technology and the growing competition in both industries. These industries have integrated ICT as part of their

  3. PEMAHAMAN, SIKAP, DAN UNJUK KERJA HIGIENE-SANITASI SISWA DALAM PENGOLAHAN DAN PENYAJIAN MAKANAN DI SMK BIDANG KEAHLIAN TATA BOGA

    Directory of Open Access Journals (Sweden)

    Luh Masdarini

    2012-08-01

    Full Text Available The gastronomy students’ hygiene-sanitation under standing, attitude and performance in SMK. This study aims at describing the gastronomy students’ hygiene-sanitation understanding, attitude and performance. This research is a des­crip­tive quantitative one with research subjects are the gastronomy students of SMKs in Bali with the total number of 198 students. The instruments used are skill test, questionnaire and observation sheet. Then, the data are analyzed descriptively by using percentage formula. The data analysis shows that: (1 the gastronomy students’ understanding over the hygiene-sanitation 82,89% is very good, (2 the gas­tronomy stu­dents’ attitude over the hygiene-sanitation 84,36% is very good, (3 the gastronomy students’ performance over the hygiene-sanitation 90,20% is very good. Pemahaman, Sikap, dan Unjuk Kerja Higiene-sanitasi Siswa dalam Peng­olahan dan Penyajian Makanan di SMK Bidang Keahlian Tata Boga. Tujuan penelitian ini untuk mendeskripsikan pemahaman, sikap, dan unjuk kerja higiene-sani­tasi siswa dalam pengolahan dan penyajian makanan. Penelitian ini menggunakan rancangan penelitian deskriptif kuantitatif dengan subjek penelitian siswa di SMK Bidang Keahlian Tata Boga di Bali yang berjumlah 198 orang. Instrumen penelitian yang digunakan adalah tes pengetahuan, angket, dan lembar observasi. Selanjutnya data dianalisis dengan teknik deskriptif dengan menggunakan formula persentase. Hasil penelitian ini menunjukkan bahwa: (1 pemahaman higiene-sanitasi siswa dalam pengolahan dan penyajian makanan 82,89% adalah sangat baik, (2 Sikap higiene-sanitasi siswa dalam pengolahan dan penyajian makanan 84,36% adalah sangat baik, (3 Unjuk kerja higiene-sanitasi siswa dalam pengolahan dan penyajian makanan 90,20% adalah sangat baik.

  4. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin

    2002-01-01

    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  5. Illusion-related brain activations: a new virtual reality mirror box system for use during functional magnetic resonance imaging.

    Science.gov (United States)

    Diers, Martin; Kamping, Sandra; Kirsch, Pinar; Rance, Mariela; Bekrater-Bodmann, Robin; Foell, Jens; Trojan, Joerg; Fuchs, Xaver; Bach, Felix; Maaß, Heiko; Cakmak, Hüseyin; Flor, Herta

    2015-01-12

    Extended viewing of movements of one's intact limb in a mirror as well as motor imagery have been shown to decrease pain in persons with phantom limb pain or complex regional pain syndrome and to increase the movement ability in hemiparesis following stroke. In addition, mirrored movements differentially activate sensorimotor cortex in amputees with and without phantom limb pain. However, using a so-called mirror box has technical limitations, some of which can be overcome by virtual reality applications. We developed a virtual reality mirror box application and evaluated its comparability to a classical mirror box setup. We applied both paradigms to 20 healthy controls and analyzed vividness and authenticity of the illusion as well as brain activation patterns. In both conditions, subjects reported similar intensities for the sensation that movements of the virtual left hand felt as if they were executed by their own left hand. We found activation in the primary sensorimotor cortex contralateral to the actual movement, with stronger activation for the virtual reality 'mirror box' compared to the classical mirror box condition, as well as activation in the primary sensorimotor cortex contralateral to the mirrored/virtual movement. We conclude that a virtual reality application of the mirror box is viable and that it might be useful for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Packing a cake into a box

    KAUST Repository

    Skopenkov, Mikhail

    2011-05-01

    Given a triangular cake and a box in the shape of its mirror image, how can the cake be cut into a minimal number of pieces so that it can be put into the box? The cake has icing, so we are not allowed to put it into the box upside down. V. G. Boltyansky asked this question in 1977 and showed that three pieces always suffice. In this paper we provide examples of cakes that cannot be cut into two pieces to be put into the box. This shows that three is the answer to Boltyansky\\'s question. We also give examples of cakes which can be cut into two pieces. © THE MATHEMATICAL ASSOCIATION OF AMERICA.

  7. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    Wild, E.

    1979-01-01

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  8. Glove boxes. Dimensions and requirements. Draft

    International Nuclear Information System (INIS)

    1985-07-01

    The standard is to be applied to work done in glove-boxes, whereby either the personnel need to be protected from the damaging effects of the materials being handled, or the materials from the effects of the environment. It is to be applied to glove-boxes in which substances are handled which emit ionising radiation (radioactive substances). This norm is not restricted to glove-boxes in which processes are carried out on a technique scale. In accordance with this norm, only those pressures and temperatures are allowed to be present in the glove-boxes, that do not offer significantly from the work areas. Alongside the stipulations of this standard regard is also always to be taken of the regulations in the radiation protection ordinance. (orig./HP) [de

  9. Cosmetic Foot Surgery: Fashion's Pandora's Box

    Science.gov (United States)

    ... A A A | Print | Share Cosmetic Foot Surgery: Fashion’s Pandora’s Box? Foot and ankle surgeons warn against ... a "face lift" and fit them into high-fashion shoes. But physician members of the American College ...

  10. Black-Box Search by Unbiased Variation

    DEFF Research Database (Denmark)

    Lehre, Per Kristian; Witt, Carsten

    2012-01-01

    The complexity theory for black-box algorithms, introduced by Droste, Jansen, and Wegener (Theory Comput. Syst. 39:525–544, 2006), describes common limits on the efficiency of a broad class of randomised search heuristics. There is an obvious trade-off between the generality of the black-box model...... and the strength of the bounds that can be proven in such a model. In particular, the original black-box model provides for well-known benchmark problems relatively small lower bounds, which seem unrealistic in certain cases and are typically not met by popular search heuristics.In this paper, we introduce a more...... restricted black-box model for optimisation of pseudo-Boolean functions which we claim captures the working principles of many randomised search heuristics including simulated annealing, evolutionary algorithms, randomised local search, and others. The key concept worked out is an unbiased variation operator...

  11. ENERGY STAR Certified Set Top Boxes

    Data.gov (United States)

    U.S. Environmental Protection Agency — Certified models meet all ENERGY STAR requirements as listed in the Version 5.1 ENERGY STAR Program Requirements for Set-top Boxes that are effective as of January...

  12. A Lithium Vapor Box Divertor Similarity Experiment

    Science.gov (United States)

    Cohen, Robert A.; Emdee, Eric D.; Goldston, Robert J.; Jaworski, Michael A.; Schwartz, Jacob A.

    2017-10-01

    A lithium vapor box divertor offers an alternate means of managing the extreme power density of divertor plasmas by leveraging gaseous lithium to volumetrically extract power. The vapor box divertor is a baffled slot with liquid lithium coated walls held at temperatures which increase toward the divertor floor. The resulting vapor pressure differential drives gaseous lithium from hotter chambers into cooler ones, where the lithium condenses and returns. A similarity experiment was devised to investigate the advantages offered by a vapor box divertor design. We discuss the design, construction, and early findings of the vapor box divertor experiment including vapor can construction, power transfer calculations, joint integrity tests, and thermocouple data logging. Heat redistribution of an incident plasma-based heat flux from a typical linear plasma device is also presented. This work supported by DOE Contract No. DE-AC02-09CH11466 and The Princeton Environmental Institute.

  13. Weld Residual Stress in Corner Boxing Joints

    OpenAIRE

    Kazuyoshi, Matsuoka; Tokuharu, Yoshii; Ship Research Institute, Ministry of Transport; Ship Research Institute, Ministry of Transport

    1998-01-01

    Fatigue damage often occurs in corner boxing welded joints because of stress concentration and residual stress. The hot spot stress approach is applicable to stress concentration. However, the number of suitable methods for estimating residual stress in welded joints is limited. The purpose of this paper is to clarify the residual stress in corner boxing joints. The method of estimating residual stresses based on the inherent stress technique is presented. Residual stress measurements are per...

  14. HYDROGEN AND VOC RETENTION IN WASTE BOXES

    Energy Technology Data Exchange (ETDEWEB)

    PACE ME; MARUSICH RM

    2008-11-21

    The Hanford Waste Management Project Master Documented Safety Analysis (MDSA) (HNF-14741, 2003) identifies derived safety controls to prevent or mitigate the risks of a single-container deflagration during operations requiring moving, venting or opening transuranic (TRU)-waste containers. The issue is whether these safety controls are necessary for operations involving TRU-waste boxes that are being retrieved from burial at the Hanford Site. This paper investigates the potential for a deflagration hazard within these boxes and whether safety controls identified for drum deflagration hazards should be applied to operations involving these boxes. The study evaluates the accumulation of hydrogen and VOCs within the waste box and the transport of these gases and vapors out of the waste box. To perform the analysis, there were numerous and major assumptions made regarding the generation rate and the transport pathway dimensions and their number. Since there is little actual data with regards to these assumptions, analyses of three potential configurations were performed to obtain some indication of the bounds of the issue (the concentration of hydrogen or flammable VOCs within a waste box). A brief description of each of the three cases along with the results of the analysis is summarized.

  15. Autoassociative memory design using interconnected generalized brain-state-in-a-box neural networks.

    Science.gov (United States)

    Oh, Cheolhwan; Zak, Stanislaw H; Zhai, Guisheng

    2005-06-01

    A class of interconnected neural networks composed of generalized Brain-State-in-a-Box (gBSB) neural subnetworks is considered. Interconnected gBSB neural network architectures are proposed along with their stability conditions. The design of the interconnected neural networks is reduced to the problem of solving linear matrix inequalities (LMIs) to determine the interconnection parameters. A method for solving LMIs is devised generating the solutions that, in general, are further away from zero than the corresponding solutions obtained using MATLAB's LMI toolbox, thus resulting in stronger interconnections between the subnetworks. The proposed architectures are then used to construct neural associative memories. Simulations are performed to illustrate the results obtained.

  16. PENGARUH KEPEMIMPINAN SENIOR, TATA KELOLA DAN TANGGUNG JAWAB SOSIAL TERHADAP KINERJA KEPALA RUANG RAWAT INAP RUMAH SAKIT KARYA BHAKTI KOTA BOGOR TAHUN 2008

    Directory of Open Access Journals (Sweden)

    Adila Kasni Astiena

    2010-09-01

    Full Text Available AbstrakPenelitian ini bertujuan untuk mengetahui pengaruh Kepemimpinan Senior, Tata Kelola dan Tanggung Jawab Sosial Terhadap Kinerja Kepala Ruang Rawat Inap Rumah Sakit Karya Bhakti (RSKB Bogor Tahun 2008. Kerangka teori dari penelitian ini diambil dari Malcolm Baldrige Criteria for Performance Excellence (MBCfPE bagi institusi kesehatan dalam Hertz (2008. Kriteria MBCfPE yang diambil adalah kepemimpinan (leadership yang dijabarkan menjadi variabel Kepemimpinan Senior, Tata Kelola Dan Tanggung Jawab Sosial. Penelitian ini merupakan penelitian survei dengan pendekatan kuantitatif. Data yang dikumpulkan adalah data primer dengan menggunakan kuesioner dan diolah dengan menggunakan metode analisis jalur (Path Analysis. Responden penelitian ini adalah semua perawat ruang rawat inap Dahlia Anyelir RSKB tahun 2008. Hasil penelitian ditemukan bahwa Kepemimpinan Senior, Tata Kelola dan Tanggung Jawab Sosial mempengaruhi Kinerja Kepala Ruang sebesar 57.59% sedangkan sisanya 42.41% dipengaruhi oleh variabel yang tidak diteliti. Variabel yang paling besar mempengaruhi kinerja kepala ruang adalah kepemimpinan senior (30.44% disusul oleh variabel tata kelola (22.96% dan Tanggung Jawab Sosial (4.18%. Tanggung Jawab Sosial mempunyai koefisen jalur yang tidak bermakna dan sangat kecil, namun tetap dipertahankan dalam model akhir karena secara substantif, penting dalam menentukan kinerja kepala ruang. Berdasarkan penelitian ini disarankan untuk lebih memperhatikan dan meningkatkan kepemimpinan senior, tata kelola dan tanggung jawab sosial guna meningkatkan kinerja kepala ruang dengan cara (1 melakukan pembinaan dalam hal kepemimpinan mencakup kemampuan (ability, keterampilan (skill dan perilaku (behaviour. (2 Menciptakan kebijakan guna terciptanya kondisi peningkatan kemampuan kepemimpinan senior, tata kelola dan tanggung jawab sosial, termasuk memberikan kesempatan untuk menambah pengetahuan (3 Dalam pemilihan kepala ruang disarankan untuk memperhatikan

  17. 49 CFR 230.101 - Steam locomotive driving journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Steam locomotive driving journal boxes. 230.101... Locomotives and Tenders Running Gear § 230.101 Steam locomotive driving journal boxes. (a) Driving journal boxes. Driving journal boxes shall be maintained in a safe and suitable condition for service. Not more...

  18. 49 CFR 178.517 - Standards for plastic boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for plastic boxes. 178.517 Section 178... PACKAGINGS Non-bulk Performance-Oriented Packaging Standards § 178.517 Standards for plastic boxes. (a) The following are identification codes for plastic boxes: (1) 4H1 for an expanded plastic box; and (2) 4H2 for a...

  19. Interaction between TATA-Binding Protein (TBP and Multiprotein Bridging Factor-1 (MBF1 from the Filamentous Insect Pathogenic Fungus Beauveria bassiana.

    Directory of Open Access Journals (Sweden)

    Chi Song

    Full Text Available TATA-binding protein (TBP is a ubiquitous component of eukaryotic transcription factors that acts to nucleate assembly and position pre-initiation complexes. Multiprotein bridging factor 1 (MBF1 is thought to interconnect TBP with gene specific transcriptional activators, modulating transcriptional networks in response to specific signal and developmental programs. The insect pathogen, Beauveria bassiana, is a cosmopolitan fungus found in most ecosystems where it acts as an important regulator of insect populations and can form intimate associations with certain plants. In order to gain a better understanding of the function of MBF1 in filamentous fungi, its interaction with TBP was demonstrated. The MBF1 and TBP homologs in B. bassiana were cloned and purified from a heterologous E. coli expression system. Whereas purified BbTBP was shown to be able to bind oligonucleotide sequences containing the TATA-motif (Kd ≈ 1.3 nM including sequences derived from the promoters of the B. bassiana chitinase and protease genes. In contrast, BbMBF1 was unable to bind to these same target sequences. However, the formation of a ternary complex between BbMBF1, BbTBP, and a TATA-containing target DNA sequence was seen in agarose gel electrophoretic mobility shift assays (EMSA. These data indicate that BbMBF1 forms direct interactions with BbTBP, and that the complex is capable of binding to DNA sequences containing TATA-motifs, confirming that BbTBP can link BbMBF1 to target sequences as part of the RNA transcriptional machinery in fungi.

  20. The cultivation of medicinal, aromatic and spice plants in South Marocco. Relation to a trip to the regions between Agadir - Marrakech - Ouarzazate and Tata

    Directory of Open Access Journals (Sweden)

    Ait Chitt, M.

    1985-01-01

    Full Text Available Studies about aromatic, medicinal and seasoning plants are integrated into activities of Department of "Vegetables Cultures" of the Section of Agadir (Agronomical and Veterinary Institute Hassan II. An explanatory mission has been carried out in the provinces of Agadir and Marrakech in semi-barren areas and of Ouarzazate and Tata in Saharan regions. The mean cultivated species are listed. A technical and economical approach is considered.

  1. Salt-Mediated Electrostatics in the Association of TATA Binding Proteins to DNA: A Combined Molecular Mechanics/Poisson-Boltzmann Study

    OpenAIRE

    Bredenberg, Johan H.; Russo, Cristina; Fenley, Marcia O.

    2008-01-01

    The TATA-binding protein (TBP) is a key component of the archaea ternary preinitiation transcription assembly. The archaeon TBP, from the halophile/hyperthermophile organism Pyrococcus woesei, is adapted to high concentrations of salt and high-temperature environments. Although most eukaryotic TBPs are mesophilic and adapted to physiological conditions of temperature and salt, they are very similar to their halophilic counterparts in sequence and fold. However, whereas the binding affinity to...

  2. Interaction between TATA-Binding Protein (TBP) and Multiprotein Bridging Factor-1 (MBF1) from the Filamentous Insect Pathogenic Fungus Beauveria bassiana.

    Science.gov (United States)

    Song, Chi; Ortiz-Urquiza, Almudena; Ying, Sheng-Hua; Zhang, Jin-Xia; Keyhani, Nemat O

    2015-01-01

    TATA-binding protein (TBP) is a ubiquitous component of eukaryotic transcription factors that acts to nucleate assembly and position pre-initiation complexes. Multiprotein bridging factor 1 (MBF1) is thought to interconnect TBP with gene specific transcriptional activators, modulating transcriptional networks in response to specific signal and developmental programs. The insect pathogen, Beauveria bassiana, is a cosmopolitan fungus found in most ecosystems where it acts as an important regulator of insect populations and can form intimate associations with certain plants. In order to gain a better understanding of the function of MBF1 in filamentous fungi, its interaction with TBP was demonstrated. The MBF1 and TBP homologs in B. bassiana were cloned and purified from a heterologous E. coli expression system. Whereas purified BbTBP was shown to be able to bind oligonucleotide sequences containing the TATA-motif (Kd ≈ 1.3 nM) including sequences derived from the promoters of the B. bassiana chitinase and protease genes. In contrast, BbMBF1 was unable to bind to these same target sequences. However, the formation of a ternary complex between BbMBF1, BbTBP, and a TATA-containing target DNA sequence was seen in agarose gel electrophoretic mobility shift assays (EMSA). These data indicate that BbMBF1 forms direct interactions with BbTBP, and that the complex is capable of binding to DNA sequences containing TATA-motifs, confirming that BbTBP can link BbMBF1 to target sequences as part of the RNA transcriptional machinery in fungi.

  3. Predatory blue crabs induce stronger nonconsumptive effects in eastern oysters Crassostrea virginica than scavenging blue crabs

    Directory of Open Access Journals (Sweden)

    Avery E. Scherer

    2017-02-01

    Full Text Available By influencing critical prey traits such as foraging or habitat selection, predators can affect entire ecosystems, but the nature of cues that trigger prey reactions to predators are not well understood. Predators may scavenge to supplement their energetic needs and scavenging frequency may vary among individuals within a species due to preferences and prey availability. Yet prey reactions to consumers that are primarily scavengers versus those that are active foragers have not been investigated, even though variation in prey reactions to scavengers or predators might influence cascading nonconsumptive effects in food webs. Oysters Crassostrea virginica react to crab predators by growing stronger shells. We exposed oysters to exudates from crabs fed live oysters or fed aged oyster tissue to simulate scavenging, and to controls without crab cues. Oysters grew stronger shells when exposed to either crab exudate, but their shells were significantly stronger when crabs were fed live oysters. The stronger response to predators than scavengers could be due to inherent differences in diet cues representative of reduced risk in the presence of scavengers or to degradation of conspecific alarm cues in aged treatments, which may mask risk from potential predators subsisting by scavenging.

  4. Stronger Accent Following a Stroke: The Case of a Trilingual with Aphasia

    Science.gov (United States)

    Levy, Erika S.; Goral, Mira; De Diesbach, Catharine Castelluccio; Law, Franzo, II

    2011-01-01

    This study documents patterns of change in speech production in a multilingual with aphasia following a cerebrovascular accident (CVA). EC, a right-handed Hebrew-English-French trilingual man, had a left fronto-temporo-parietal CVA, after which he reported that his (native) Hebrew accent became stronger in his (second language) English. Recordings…

  5. Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

    DEFF Research Database (Denmark)

    Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

    2012-01-01

    Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological Seq...... al., 2007. J. Immunol. 178, 7890–7901. doi:10.1016/j.molimm.2012.02.025...

  6. First-order dominance: stronger characterization and a bivariate checking algorithm

    DEFF Research Database (Denmark)

    Range, Troels Martin; Østerdal, Lars Peter Raahave

    2018-01-01

    distributions. Utilizing that this problem can be formulated as a transportation problem with a special structure, we provide a stronger characterization of multivariate first-order dominance and develop a linear time complexity checking algorithm for the bivariate case. We illustrate the use of the checking...

  7. Fasting insulin is a stronger cardiovascular risk factor in women than in men

    NARCIS (Netherlands)

    Oterdoom, Leendert H.; de Vries, Aiko P. J.; Gansevoort, Ron T.; de Jong, Paul E.; Gans, Reinold O. B.; Bakker, Stephan J. L.

    Diabetes is a stronger risk factor for cardiovascular disease (CVD) in women than in men. It is not known whether there is also a sex difference in the association between hyperinsulinaemia, reflecting insulin resistance, and CVD. Fasting insulin was assessed with a specific assay in 6916 fasting,

  8. A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

    DEFF Research Database (Denmark)

    Heydorn, S; Andersen, Klaus Ejner; Johansen, Jeanne Duus

    2003-01-01

    Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...

  9. A Human Capital Framework for a Stronger Teacher Workforce. Advancing Teaching--Improving Learning. White Paper

    Science.gov (United States)

    Myung, Jeannie; Martinez, Krissia; Nordstrum, Lee

    2013-01-01

    Building a stronger teacher workforce requires the thoughtful orchestration of multiple processes working together in a human capital system. This white paper presents a framework that can be used to take stock of current efforts to enhance the teacher workforce in school districts or educational organizations, as well as their underlying theories…

  10. Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

    NARCIS (Netherlands)

    de Goeij, Moniek C. M.; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E.

    2017-01-01

    This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were

  11. Evolution and divergence of SBP-box genes in land plants.

    Science.gov (United States)

    Zhang, Shu-Dong; Ling, Li-Zhen; Yi, Ting-Shuang

    2015-10-14

    Squamosa promoter binding protein (SBP)-box family genes encode plant-specific transcription factors that control many important biological functions, including phase transition, inflorescence branching, fruit ripening, and copper homeostasis. Nevertheless, the evolutionary patterns of SBP-box genes and evolutionary forces driving them are still not well understood. 104 SBP-box gene candidates of five representative land plants were obtained from Phytozome database (v10.3). Phylogenetic combined with gene structure analyses were used to identify SBP-box gene lineages in land plants. Gene copy number and the sequence and structure features were then compared among these different SBP-box lineages. Selection analysis, relative rate tests and expression divergence were finally used to interpret the evolutionary relationships and divergence of SBP-box genes in land plants. We investigated 104 SBP-box genes from moss, Arabidopsis, poplar, rice, and maize. These genes are divided into group I and II, and the latter is further divided into two subgroups (subgroup II-1 and II-2) based on phylogenetic analysis. Interestingly, subgroup II-1 genes have similar sequence and structural features to group I genes, whereas subgroup II-2 genes exhibit intrinsic differences on these features, including high copy numbers and the presence of miR156/miR529 regulation. Further analyses indicate that subgroup II-1 genes are constrained by stronger purifying selection and evolve at a lower substitution rate than II-2 genes, just as group I genes do when compared to II genes. Among subgroup II-2 genes, miR156 targets evolve more rapidly than miR529 targets and experience comparatively relaxed purifying selection. These results suggest that group I and subgroup II-1 genes under strong selective constraint are conserved. By contrast, subgroup II-2 genes evolve under relaxed purifying selection and have diversified through gene copy duplications and changes in miR156/529 regulation, which

  12. Can absolute and proportional anthropometric characteristics distinguish stronger and weaker powerlifters?

    Science.gov (United States)

    Keogh, Justin W L; Hume, Patria A; Pearson, Simon N; Mellow, Peter J

    2009-11-01

    This study sought to compare the anthropometric profiles of 17 weaker and 17 stronger Australasian and Pacific powerlifters who had competed in a regional-, national-, or international-level powerlifting competition in New Zealand. Stronger lifters were defined as those having a Wilks score greater than 410, whereas those in the weaker group had a Wilks score less than 370. Each powerlifter was assessed for 37 anthropometric dimensions by International Society for the Advancement of Kinanthropometry (ISAK) level II and III accredited anthropometrists. Because all powerlifters were highly mesomorphic and possessed large girths and bone breadths, both in absolute terms and when expressed as Phantom-Z scores compared through the Phantom, relatively few significant anthropometric differences were observed. However, stronger lifters had significantly greater muscle mass and larger muscular girths in absolute terms as well as greater Brugsch Index (chest girth/height) and "Phantom"-normalized muscle mass, upper arm, chest, and forearm girths. In terms of the segment lengths and bone breadths, the only significant difference was that stronger lifters had a significantly shorter lower leg than weaker lifters. Because the majority of the significant differences were for muscle mass and muscular girths, it would appear likely that these differences contributed to the stronger lifters' superior performance. Powerlifters may therefore need to devote some of their training to the development of greater levels of muscular hypertrophy if they wish to continue to improve their performance. To better understand the anthropometric determinants of muscular strength, future research should recruit larger samples (particularly of elite lifters) and follow these subjects prospectively.

  13. Changes in position and quality of preferred nest box: effects on nest box use by laying hens

    DEFF Research Database (Denmark)

    Riber, Anja Brinch; Nielsen, Birte L.

    2013-01-01

    Using laying hens, we investigated whether position of a nest box, both within the pen and relative to other nest boxes, influenced the preference for a nest box, and how a sudden and marked change to the preferred box influenced the use of nest boxes by the hens. Groups (n=12) of 15 Isa Warren...... hens were housed in pens, each with five identical nest boxes in different positions: Two single (in a corner or not) and a triplet of nest boxes (one of which in a corner). The use of nest boxes was determined by the number of eggs laid daily in each box. Three experiments, each lasting 10 days, were...... carried out. First, the undisturbed use of each of the nest box types was investigated, and a strong preference (Peggs laid there. Second, each of the hen groups was moved to another pen allocated at random, and where...

  14. How to Use SNP_TATA_Comparator to Find a Significant Change in Gene Expression Caused by the Regulatory SNP of This Gene's Promoter via a Change in Affinity of the TATA-Binding Protein for This Promoter.

    Science.gov (United States)

    Ponomarenko, Mikhail; Rasskazov, Dmitry; Arkova, Olga; Ponomarenko, Petr; Suslov, Valentin; Savinkova, Ludmila; Kolchanov, Nikolay

    2015-01-01

    The use of biomedical SNP markers of diseases can improve effectiveness of treatment. Genotyping of patients with subsequent searching for SNPs more frequent than in norm is the only commonly accepted method for identification of SNP markers within the framework of translational research. The bioinformatics applications aimed at millions of unannotated SNPs of the "1000 Genomes" can make this search for SNP markers more focused and less expensive. We used our Web service involving Fisher's Z-score for candidate SNP markers to find a significant change in a gene's expression. Here we analyzed the change caused by SNPs in the gene's promoter via a change in affinity of the TATA-binding protein for this promoter. We provide examples and discuss how to use this bioinformatics application in the course of practical analysis of unannotated SNPs from the "1000 Genomes" project. Using known biomedical SNP markers, we identified 17 novel candidate SNP markers nearby: rs549858786 (rheumatoid arthritis); rs72661131 (cardiovascular events in rheumatoid arthritis); rs562962093 (stroke); rs563558831 (cyclophosphamide bioactivation); rs55878706 (malaria resistance, leukopenia), rs572527200 (asthma, systemic sclerosis, and psoriasis), rs371045754 (hemophilia B), rs587745372 (cardiovascular events); rs372329931, rs200209906, rs367732974, and rs549591993 (all four: cancer); rs17231520 and rs569033466 (both: atherosclerosis); rs63750953, rs281864525, and rs34166473 (all three: malaria resistance, thalassemia).

  15. Advances in the theory of box integrals

    Energy Technology Data Exchange (ETDEWEB)

    Bailey, David H.; Borwein, J.M.; Crandall, R.E.

    2009-06-25

    Box integrals - expectations <|{rvec r}|{sup s}> or <|{rvec r}-{rvec q}|{sup s}> over the unit n-cube (or n-box) - have over three decades been occasionally given closed forms for isolated n,s. By employing experimental mathematics together with a new, global analytic strategy, we prove that for n {le} 4 dimensions the box integrals are for any integer s hypergeometrically closed in a sense we clarify herein. For n = 5 dimensions, we show that a single unresolved integral we call K{sub 5} stands in the way of such hyperclosure proofs. We supply a compendium of exemplary closed forms that naturally arise algorithmically from this theory.

  16. Grey Box Modelling of Hydrological Systems

    DEFF Research Database (Denmark)

    Thordarson, Fannar Ørn

    The main topic of the thesis is grey box modelling of hydrologic systems, as well as formulation and assessment of their embedded uncertainties. Grey box model is a combination of a white box model, a physically-based model that is traditionally formulated using deterministic ordinary differential...... the lack of fit in state space formulation, and further support decisions for a model expansion. By using stochastic differential equations to formulate the dynamics of the hydrological system, either the complexity of the model can be increased by including the necessary hydrological processes...... in the model, or formulation of process noise can be considered so that it meets the physical limits of the hydrological system and give an adequate description of the embedded uncertainty in model structure. The thesis consists of two parts: a summary report and a part which contains six scientific papers...

  17. CASAS: A Smart Home in a Box.

    Science.gov (United States)

    Cook, Diane J; Crandall, Aaron S; Thomas, Brian L; Krishnan, Narayanan C

    2013-07-01

    While the potential benefits of smart home technology are widely recognized, a lightweight design is needed for the benefits to be realized at a large scale. We introduce the CASAS "smart home in a box", a lightweight smart home design that is easy to install and provides smart home capabilities out of the box with no customization or training. We discuss types of data analysis that have been performed by the CASAS group and can be pursued in the future by using this approach to designing and implementing smart home technologies.

  18. Democracy leadership (study approach of bureaucrats leadership at sub bagian tata usaha badan perencanaan pembangunan daerah, East Java province)

    Science.gov (United States)

    Lestari, Y.; Rosdiana, W.; Noviyanti

    2018-01-01

    The main key to organizational success depends on the success of a leadership. Each organization’s progress will require the ability of a leader to transformed the organization. The emergence of the democratic-leadership is one of the most humane style of leadership. Democratic leadership positioned people as the most important factor in the leadership exercised by the orientation and emphasis on relationships with members of the organization. This study raised that the democratic-leadership in government agencies to study the leadership approach of bureaucrats at Sub Bagian Tata Usaha Badan Perencanaan Pembangunan Daerah East Java Province. The data collection techniques used descriptive research with qualitative approach, then the techniques were interviews, observation and documentation. While, the research data analysis used interactive analysis model approach of Miles and Huberman, which includes: (1) data reduction; (2) the presentation of the data; and (3) conclusion. Based on Nawawi theory’s [1], this study showed that (1) Leaders are very obedient to the rules/procedures work, (2) Leaders look more autocratic, (3) leaders make familiarity with subordinates, (4) leaders develop kinship situation and teamwork, (5) the leaders seem monotonous work and do not like a modification, (6) Leaders seem slow in decision making, and (7) leaders are accustomed to low-risk jobs with less survival trends.

  19. Suppression of intragenic transcription requires the MOT1 and NC2 regulators of TATA-binding protein.

    Science.gov (United States)

    Koster, Maria J E; Yildirim, Asli D; Weil, P Anthony; Holstege, Frank C P; Timmers, H Th Marc

    2014-04-01

    Chromatin structure in transcribed regions poses a barrier for intragenic transcription. In a comprehensive study of the yeast chromatin remodelers and the Mot1p-NC2 regulators of TATA-binding protein (TBP), we detected synthetic genetic interactions indicative of suppression of intragenic transcription. Conditional depletion of Mot1p or NC2 in absence of the ISW1 remodeler, but not in the absence of other chromatin remodelers, activated the cryptic FLO8 promoter. Likewise, conditional depletion of Mot1p or NC2 in deletion backgrounds of the H3K36 methyltransferase Set2p or the Asf1p-Rtt106p histone H3-H4 chaperones, important factors involved in maintaining a repressive chromatin environment, resulted in increased intragenic FLO8 transcripts. Activity of the cryptic FLO8 promoter is associated with reduced H3 levels, increased TBP binding and tri-methylation of H3K4 and is independent of Spt-Ada-Gcn5-acetyltransferase function. These data reveal cooperation of negative regulation of TBP with specific chromatin regulators to inhibit intragenic transcription.

  20. Crosstalk in concurrent repeated games impedes direct reciprocity and requires stronger levels of forgiveness.

    Science.gov (United States)

    Reiter, Johannes G; Hilbe, Christian; Rand, David G; Chatterjee, Krishnendu; Nowak, Martin A

    2018-02-07

    Direct reciprocity is a mechanism for cooperation among humans. Many of our daily interactions are repeated. We interact repeatedly with our family, friends, colleagues, members of the local and even global community. In the theory of repeated games, it is a tacit assumption that the various games that a person plays simultaneously have no effect on each other. Here we introduce a general framework that allows us to analyze "crosstalk" between a player's concurrent games. In the presence of crosstalk, the action a person experiences in one game can alter the person's decision in another. We find that crosstalk impedes the maintenance of cooperation and requires stronger levels of forgiveness. The magnitude of the effect depends on the population structure. In more densely connected social groups, crosstalk has a stronger effect. A harsh retaliator, such as Tit-for-Tat, is unable to counteract crosstalk. The crosstalk framework provides a unified interpretation of direct and upstream reciprocity in the context of repeated games.

  1. A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

    DEFF Research Database (Denmark)

    Heydorn, S; Andersen, K E; Johansen, J D

    2003-01-01

    elicitation reaction than patch testing with the allergen (hydroxycitronellal) alone, in patients previously patch tested positive to hydroxycitronellal. A stronger patch test elicitation reaction was defined as at least 1 day of patch test reading showing more positive patch tests......Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...... (+, ++ or +++) on the forearm patch tested with 6 concentrations of SLS plus hydroxycitronellal than on the forearm tested with 6 concentrations of hydroxycitronellal alone and no day of patch test readings showing more positive tests on the hydroxycitronellal forearm. 15/20 (75%) had at least 1 day of patch test reading...

  2. Daytime warming has stronger negative effects on soil nematodes than night-time warming

    OpenAIRE

    Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

    2017-01-01

    Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatmen...

  3. World Bank: Management Controls Stronger, But Challenges in Fighting Corruption Remain

    Science.gov (United States)

    2000-04-01

    outline for possible World Development Report on institutions, including corruption . Completed • Prepare Europe and Central Asia Region...Management Controls Stronger, but Challenges in Fighting Corruption Remain If , 20000417 062 G A O Accountability * Integrity * Reliability GAO... corruption —broadly defined as the abuse of public office for private gain— ’The "World Bank" and "Bank" refer to the World Bank Group of institutions

  4. A stronger version of matrix convexity as applied to functions of Hermitian matrices

    Directory of Open Access Journals (Sweden)

    Kagan Abram

    1999-01-01

    Full Text Available A stronger version of matrix convexity, called hyperconvexity is introduced. It is shown that the function is hyperconvex on the set of Hermitian matrices and is hyperconvex on the set of positive definite Hermitian matrices. The new concept makes it possible to consider weighted averages of matrices of different orders. Proofs use properties of the Fisher information matrix, a fundamental concept of mathematical statistics.

  5. Cloning and analysis of the 5' and 3' flanking regions of the Crinum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... Usually, the structures of 5' gene flanking region of eukaryotes comprised four parts: the site of start transcription, TATA box, CAAT box and GC box. TATA boxes were generally located at -32±7 bp positions upstream from the start of transcription. The consensus sequence for the TATA box was [T(CG)TATA ...

  6. Interaction Buckling Experiments of Box columns

    OpenAIRE

    永藤, 寿宮

    1988-01-01

    Box sections present very interesting properties in the field of compressed elements. The purpose of this experiment is to supply experimental data of interaction buckling (overall and local buckling). Test columns are classified into 4 types according to those columns length. Support conditions are pin-ended type by using new developed bowl shoe.

  7. Cereal Box Design: An Interdisciplinary Graphics Activity

    Science.gov (United States)

    Fitzgerald, Mike; Tsosie, Teri

    2012-01-01

    The cereal box design activity is intriguing both for its simplicity and the resourcefulness that it can generate in young people. Also, it lends itself to a variety of curriculums. It covers both consumerism and Design for the Environment (DfE) concepts broadly and in depth. The activity introduces a wide range of topics. They include graphic…

  8. Study of WATCH GRB error boxes

    DEFF Research Database (Denmark)

    Gorosabel, J.; Castro-Tirado, A. J.; Lund, Niels

    1995-01-01

    We have studied the first WATCH GRB Catalogue ofγ-ray Bursts in order to find correlations between WATCH GRB error boxes and a great variety of celestial objects present in 33 different catalogues. No particular class of objects has been found to be significantly correlated with the WATCH GRBs....

  9. Reflective Cracking between Precast Prestressed Box Girders

    Science.gov (United States)

    2017-06-30

    The adjacent precast prestressed concrete box-beam bridge is the bridge of choice for short and short-to-medium span bridges. This choice is because of the ease of construction, favorable span-to-depth ratios, aesthetic appeal, and high torsional sti...

  10. PENGEMBANGAN PROGRAM VRML (VIRTUAL REALITY MODELLING LANGUAGE UNTUK E-LEARNING BERBASIS WEB TERINTEGRASI DALAM PHP-MySQL MATA KULIAH ILMU PENGETAHUAN BUMI DAN ANTARIKSA POKOK BAHASAN SISTEM TATA SURYA

    Directory of Open Access Journals (Sweden)

    Azwar Anas

    2012-01-01

    Full Text Available Pemahaman tentang fenomena sistem tata surya  membutuhkan daya imaginasi yang cukup. Hal ini merupakan salah satu kesulitan dalam memahami materi tentang sistem tata surya, sehingga diperlukan adanya visualisasi untuk membantu mengatasi kesulitan tersebut. Salah satu visualisasi adalah dengan menggunakan program visualisasi 3D. Pembuatan program diawali dengan identifikasi masalah dan persiapan perangkat lunak. Dalam hal ini program yang digunakan adalah VRML(Virtual Reality Modelling Language. Pelaksanaan pembuatan program dimulai dengan memodelkan gejala-gejala fisis yang terkait dengan fenomena sistem tata surya. Bahasa pemrograman VRML hanya mampu melakukan perhitungan dasar yang sangat sederhana. Untuk perhitungan data yang kompleks digunakan bantuan Microsoft Office Excel. Data yang dihasilkan dari perhitungan menggunakan Microsoft Office Excel kemudian dimasukkan ke dalam list program VRML. Hasil penelitian berupa pemodelan sistem tata surya yang diintergrasikan dalam e-learning berbasis web. Untuk menampilkan hasil program ini digunakan browser Cortona VRML player. Tampilan 3D yang dihasilkan menarik dan interaktif. User dapat mengamati model 3D dari berbagai sudut pengamatan dengan menggunakan toolbar yang tersedia pada browser. Kata kunci : VRML, visualisasi 3D, sistem tata surya

  11. Facies volcánicas del depósito de avalancha de detritos del volcán Tata Sabaya, Andes Centrales Volcanic facies of the debris avalanche deposit of Tata Sabaya Volcano, Central Andes

    Directory of Open Access Journals (Sweden)

    Benigno Godoy

    2012-09-01

    Full Text Available Las avalanchas de detritos, asociadas a colapsos parciales de edificios volcánicos, son fenómenos comunes en la evolución de un volcán. Este tipo de flujos son por inestabilidades, que pueden deberse a factores tales como la existencia de zonas afectadas por alteración hidrotermal, cambios climáticos, terremotos, intrusión de magmas en zonas superficiales (criptodomos y/o diques y/o movimiento de fallas bajo el edificio volcánico o cercanas a él. El producto final de estos flujos -denominado depósito de avalancha de detritos (DAD- presenta morfologías típicas de cerrillos y drenajes cerrados. En los Andes Centrales se han reconocido, al menos, 14 centros volcánicos con depósitos de avalancha asociados, entre los que está el volcán Tata Sabaya (Bolivia. El colapso que ha dado origen a este depósito podría haberse generado por una combinación de actividad sísmica y magmática en el volcán. El depósito asociado al colapso parcial de este volcán se distribuye sobre la parte baja del flanco sur del volcán y sobre la parte noroccidental de la cuenca del salar de Coipasa. Cubre una superficie de más de 230 km² y tiene un volumen estimado de 6±1 km³. Sobre la base de las composiciones litológicas, se ha establecido que el depósito está constituido por 6 tipos distintos de cerrillos, los cuales son: lávicos, piroclásticos, sedimentarios mixtos, brecha piroclástica y andesítico-basálticos. Considerando el tipo predominante de cerrillos y su distribución espacial dentro del depósito, se ha definido 6 facies diferentes (Facies de Bloques Toreva, Facies de Cerrillos Volcánicos, Facies Central, Facies de Cerrillos Sedimentarios, Facies Mixta y Facies de Cerrillos de Brecha Piroclástica. Tomando en cuenta la distribución espacial de estas facies, se propone la estructura del paleovolcán previa a su colapso parcial.Debris avalanches associated with partial sector collapse of volcanic edifices are common phenomena in the

  12. The Box Turtle: Room with a View on Species Decline.

    Science.gov (United States)

    Belzer, Bill; Steisslinger, Mary Beth

    1999-01-01

    Surveys salient aspects of eastern box-turtle natural history. Explores the societal and ecological factors that have contributed to the decline of the box-turtle population. Contains 18 references. (WRM)

  13. Sexual harassment and emotional and behavioural symptoms in adolescence: stronger associations among boys than girls.

    Science.gov (United States)

    Kaltiala-Heino, Riittakerttu; Fröjd, Sari; Marttunen, Mauri

    2016-08-01

    To study the associations between subjection to sexual harassment and emotional (depression) and behavioural (delinquency) symptoms among 14-to-18-year-old adolescents, and gender differences within these associations. 90,953 boys and 91,746 girls aged 14-18 participated in the School Health Promotion Study (SHPS), a school-based survey designed to examine the health, health behaviours, and school experiences of teenagers. Experiences of sexual harassment were elicited with five questions addressing five separate forms of harassment. Depression was measured by the 13-item Beck Depression Inventory and delinquency with a modified version of the International Self-Report Delinquency Study (ISRD) instrument. Data were analysed using cross-tabulations with Chi-square statistics and logistic regression. All sexual harassment experiences studied were associated with both depression (adjusted odds ratios varied from 2.2 to 2.7 in girls and from 2.0 to 5.1 in boys) and delinquency (adjusted odds ratios 3.1-5.0 in girls and 1.7-6.9 in boys). Sexual name-calling had a stronger association with depression and with delinquency in girls (adjusted odds ratios, respectively, 2.4 and 4.2), than in boys (adjusted odds ratios, respectively, 2.0 and 1.7), but otherwise stronger associations with emotional and behavioural symptoms were seen in boys. Subjection to sexual harassment is associated with both emotional and behavioural symptoms in both girls and boys. The associations are mostly stronger for boys. Boys subjected to sexual harassment may feel particularly threatened regarding their masculinity, and there may be less support available for boys traumatised due to sexual harassment.

  14. Seal boxes from the Viminacium site

    Directory of Open Access Journals (Sweden)

    Milovanović Bebina

    2013-01-01

    Full Text Available Bronze seal boxes that had the function of holding the wax seal on the Viminacium site - Upper Moesia (Stari Kostolac, Serbia, mainly from the area of the necropolis (ten were found in the graves and ten at the cemetery between the graves. Six are from buildings that had a storage function, five are from public facilities - an amphitheatre, and only one find is from the military fort of the legion VII Claudia, which was stationed in Viminacium in the second half of the 1st century. Thirty-two seal boxes have been processed: nine whole, six with fragmented upper and lower parts, seven bases and ten covers. Seal boxes consist of two parts: the cover and the base. The cover is decorated with figural images, concentric rings and especially with applied ornaments. Some of the motifs are filled with enamel. The base always has three to five circular perforations at the bottom, the side walls are a height of 4 to 5 mm with two opposed notches or slots which are thought to have facilitated the tying of the seal box to a package or a document. The lock mechanism is operated using the hinges principle. Some specimens have a circular extension on the cover with a thorn on the bottom. This fits the hollow in the base, through which passes a thorn for the additional fixing of the cover. Based on shape and decoration, seal boxes were classified into five types: I - elliptical or oval shaped with a figural representation on the cover derived in relief; II/1 - leaf or heart-shaped with a special, riveted ornament; II/2 - leaf or heart-shaped with enamel on the cover; III/1 - circular showing a form in relief; III/2 - circular with cast concentric rings, with no enamel; III/3 - circular with concentric rings with enamel on the cover; IV - diamond shaped with enamel on the cover and V - square with enamel on the cover. The seal boxes dominate chronologically from the first half of the 2nd and throughout the 3rd century.

  15. Building Stronger State Energy Partnerships with the U.S. Department of Energy

    Energy Technology Data Exchange (ETDEWEB)

    David Terry

    2008-09-30

    This final technical report details the results of total work efforts and progress made from July 2000 - July 2008 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Rebuild America/Energy Smart Schools, Higher Education Initiative, Winter/Summer Fuels Outlook Conferences, Energy Emergency, Clean Energy Integration, Energy Star, and Office of Electricity Delivery and Energy Reliability. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

  16. The University of Florida Department of Surgery: building a stronger tomorrow on yesterday's foundation.

    Science.gov (United States)

    Behrns, Kevin E; Copeland, Edward M; Howard, Richard J

    2012-01-01

    Established in 1957, the University of Florida Department of Surgery has a solid foundation on which current faculty are driven to build a stronger tomorrow. The department is focused on promoting patient-centered care, expanding its research portfolio to improve techniques and outcomes, and training the surgical leaders of tomorrow. It fosters an environment where faculty, residents, students, and staff challenge long-held traditions with the goal of improving the health of our patients, the quality of our care, and the vitality of our work environment.

  17. Production of plastified wood with stronger static bending strength means of polymerization induced by gamma radiation

    International Nuclear Information System (INIS)

    Silva Filho, Elias

    1999-01-01

    The use of gamma radiation to obtain wood-polymer composites is one of the applications of radiation that presents the most commercial interest. The process, denominated radiopolymerization, comprises the impregnation of monomers into the completely dried wood followed by exposure to gamma radiation to induce polymerization of the impregnated monomers. I this context, the present work aimed the application of this process to seven kinds of wood existing in the brazilian forests. The considered monomer is styrene and the gamma source is Cobalt-60. The obtained wood-polystyrene composites were found to have stronger static bending strength. (author)

  18. Building Stronger State Energy Partnerships with the U.S. Department of Energy

    Energy Technology Data Exchange (ETDEWEB)

    Marks, Kate

    2011-09-30

    This final technical report details the results of total work efforts and progress made from October 2007 – September 2011 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-07NT43264, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Energy Assurance and Critical Infrastructure, State and Regional Technical Assistance, Regional Initiative, Regional Coordination and Technical Assistance, and International Activities in China. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

  19. Ballast system for maintaining constant pressure in a glove box

    Science.gov (United States)

    Shlichta, Paul J.

    1989-09-01

    A ballast system is disclosed for a glove box including a fixed platform on which is mounted an inflatable bag on top of which resides a cover and a weight. The variable gas volume of the inflatable bag communicates with that of the glove box via a valved tube. The weight and the gas volume are selected to maintain a relatively constant pressure in the glove box despite variations in the glove box volume while avoiding the use of complicated valving apparatus.

  20. Doubly Spliced RNA of Hepatitis B Virus Suppresses Viral Transcription via TATA-Binding Protein and Induces Stress Granule Assembly.

    Science.gov (United States)

    Tsai, Kuen-Nan; Chong, Chin-Liew; Chou, Yu-Chi; Huang, Chien-Chiao; Wang, Yi-Ling; Wang, Shao-Win; Chen, Mong-Liang; Chen, Chun-Hong; Chang, Chungming

    2015-11-01

    The risk of liver cancer in patients infected with the hepatitis B virus (HBV) and their clinical response to interferon alpha therapy vary based on the HBV genotype. The mechanisms underlying these differences in HBV pathogenesis remain unclear. In HepG2 cells transfected with a mutant HBV(G2335A) expression plasmid that does not transcribe the 2.2-kb doubly spliced RNA (2.2DS-RNA) expressed by wild-type HBV genotype A, the level of HBV pregenomic RNA (pgRNA) was higher than that in cells transfected with an HBV genotype A expression plasmid. By using cotransfection with HBV genotype D and 2.2DS-RNA expression plasmids, we found that a reduction of pgRNA was observed in the cells even in the presence of small amounts of the 2.2DS-RNA plasmid. Moreover, ectopic expression of 2.2DS-RNA in the HBV-producing cell line 1.3ES2 reduced the expression of pgRNA. Further analysis showed that exogenously transcribed 2.2DS-RNA inhibited a reconstituted transcription in vitro. In Huh7 cells ectopically expressing 2.2DS-RNA, RNA immunoprecipitation revealed that 2.2DS-RNA interacted with the TATA-binding protein (TBP) and that nucleotides 432 to 832 of 2.2DS-RNA were required for efficient TBP binding. Immunofluorescence experiments showed that 2.2DS-RNA colocalized with cytoplasmic TBP and the stress granule components, G3BP and poly(A)-binding protein 1 (PABP1), in Huh7 cells. In conclusion, our study reveals that 2.2DS-RNA acts as a repressor of HBV transcription through an interaction with TBP that induces stress granule formation. The expression of 2.2DS-RNA may be one of the viral factors involved in viral replication, which may underlie differences in clinical outcomes of liver disease and responses to interferon alpha therapy between patients infected with different HBV genotypes. Patients infected with certain genotypes of HBV have a lower risk of hepatocellular carcinoma and exhibit a more favorable response to antiviral therapy than patients infected with other HBV

  1. TATA-binding protein-associated factor 7 regulates polyamine transport activity and polyamine analog-induced apoptosis.

    Science.gov (United States)

    Fukuchi, Junichi; Hiipakka, Richard A; Kokontis, John M; Nishimura, Kazuhiro; Igarashi, Kazuei; Liao, Shutsung

    2004-07-16

    Identification of the polyamine transporter gene will be useful for modulating polyamine accumulation in cells and should be a good target for controlling cell proliferation. Polyamine transport activity in mammalian cells is critical for accumulation of the polyamine analog methylglyoxal bis(guanylhydrazone) (MGBG) that induces apoptosis, although a gene responsible for transport activity has not been identified. Using a retroviral gene trap screen, we generated MGBG-resistant Chinese hamster ovary (CHO) cells to identify genes involved in polyamine transport activity. One gene identified by the method encodes TATA-binding protein-associated factor 7 (TAF7), which functions not only as one of the TAFs, but also a coactivator for c-Jun. TAF7-deficient cells had decreased capacity for polyamine uptake (20% of CHO cells), decreased AP-1 activation, as well as resistance to MGBG-induced apoptosis. Stable expression of TAF7 in TAF7-deficient cells restored transport activity (55% of CHO cells), AP-1 gene transactivation (100% of CHO cells), and sensitivity to MGBG-induced apoptosis. Overexpression of TAF7 in CHO cells did not increase transport activity, suggesting that TAF7 may be involved in the maintenance of basal activity. c-Jun NH2-terminal kinase inhibitors blocked MGBG-induced apoptosis without alteration of polyamine transport. Decreased TAF7 expression, by RNA interference, in androgen-independent human prostate cancer LN-CaP104-R1 cells resulted in lower polyamine transport activity (25% of control) and resistance to MGBG-induced growth arrest. Taken together, these results reveal a physiological function of TAF7 as a basal regulator for mammalian polyamine transport activity and MGBG-induced apoptosis.

  2. Trinucleotide repeat expansion of TATA-binding protein gene associated with Parkinson's disease: A Thai multicenter study.

    Science.gov (United States)

    Choubtum, Lulin; Witoonpanich, Pirada; Kulkantrakorn, Kongkiat; Hanchaiphiboolkul, Suchat; Pongpakdee, Sunsanee; Tiamkao, Somsak; Pulkes, Teeratorn

    2016-07-01

    Spinocerebellar ataxia type 17 (SCA17) is an inherited cerebellar degeneration associated with trinucleotide repeat expansions in the TATA-binding protein gene (TBP). Low-range expansions of TBP have recently been described in association with Parkinson's disease (PD). However, these low-range expansion alleles were also observed in healthy individuals. Prior distinct findings may result from reduced penetrance or age-dependent susceptibility, which may influence phenotypic expression. A case-control study of 456 PD patients and 374 control subjects was conducted. Data and blood samples were collected during 2008-2013. Control subjects were individuals over 65 years old without parkinsonism. Sizes of TBP trinucleotide repeats were analyzed. All available carriers of the TBP repeat of ≥40 repeats were re-examined. A high prevalence of carriers of TBP repeat expansion ≥41 developed PD, mainly at an advanced age. Half of these carriers had onset after 70 years of age (range 34-84). Seven participants carried expansion alleles of ≥42, and all had PD. Fourteen participants (six patients and eight controls) carried a heterozygous 41-repeat allele. At the current mean age of 79 years and mean follow-up period of 4 years, three out of the eight control carriers of the 41-repeat allele developed PD, while none of the thirteen asymptomatic carriers of the 40-repeat allele did. A high prevalence of PD was observed in carriers of low-range expansions of TBP (41-45 repeats), especially in elderly. This finding suggests that cut-off value for pathological TBP repeat expansion appear to be 41. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. 47 CFR 90.241 - Radio call box operations.

    Science.gov (United States)

    2010-10-01

    ... box installations in areas where such frequencies are available for fixed system use subject to the... 47 Telecommunication 5 2010-10-01 2010-10-01 false Radio call box operations. 90.241 Section 90... PRIVATE LAND MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.241 Radio call box...

  4. Grey-Box Modelling of Pharmacokinetic /Pharmacodynamic Systems

    DEFF Research Database (Denmark)

    Tornøe, Christoffer Wenzel; Jacobsen, Judith L.; Pedersen, Oluf

    2004-01-01

    Grey-box pharmacokinetic/pharmacodynamic (PK/PD) modelling is presented as a promising way of modelling PK/PD systems. The concept behind grey-box modelling is based on combining physiological knowledge along with information from data in the estimation of model parameters. Grey-box modelling...

  5. 30 CFR 18.49 - Connection boxes on machines.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Connection boxes on machines. 18.49 Section 18... Design Requirements § 18.49 Connection boxes on machines. Connection boxes used to facilitate replacement of cables or machine components shall be explosion-proof. Portable-cable terminals on cable reels...

  6. 31 CFR 515.326 - Custody of safe deposit boxes.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Custody of safe deposit boxes. 515... Definitions § 515.326 Custody of safe deposit boxes. Safe deposit boxes shall be deemed to be in the custody... upon the meaning of the term custody. ...

  7. 31 CFR 500.326 - Custody of safe deposit boxes.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Custody of safe deposit boxes. 500... Definitions § 500.326 Custody of safe deposit boxes. Safe deposit boxes shall be deemed to be in the custody... upon the meaning of the term custody. ...

  8. 49 CFR 230.103 - Tender roller bearing journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Tender roller bearing journal boxes. 230.103... Locomotives and Tenders Running Gear § 230.103 Tender roller bearing journal boxes. Tender roller bearing journal boxes shall be maintained in a safe and suitable condition. ...

  9. 49 CFR 230.102 - Tender plain bearing journal boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Tender plain bearing journal boxes. 230.102... Locomotives and Tenders Running Gear § 230.102 Tender plain bearing journal boxes. Plain bearing journal boxes... expected to damage the bearing; or have a detrimental effect on the lubrication of the journal and bearing...

  10. Using Origami Boxes to Explore Concepts of Geometry and Calculus

    Science.gov (United States)

    Wares, Arsalan

    2011-01-01

    The purpose of this classroom note is to provide an example of how a simple origami box can be used to explore important concepts of geometry and calculus. This article describes how an origami box can be folded, then it goes on to describe how its volume and surface area can be calculated. Finally, it describes how the box could be folded to…

  11. 77 FR 74513 - Folding Gift Boxes From China

    Science.gov (United States)

    2012-12-14

    ... COMMISSION Folding Gift Boxes From China Determination On the basis of the record \\1\\ developed in the... antidumping duty order on folding gift boxes from China would be likely to lead to continuation or recurrence... Commission are contained in USITC Publication 4365 (November 2012), entitled Folding Gift Boxes from China...

  12. A white box perspective on behavioural adaptation

    DEFF Research Database (Denmark)

    Bruni, Roberto; Corradini, Andrea; Gadducci, Fabio

    2015-01-01

    We present a white-box conceptual framework for adaptation developed in the context of the EU Project ASCENS coordinated by Martin Wirsing. We called it CoDA, for Control Data Adaptation, since it is based on the notion of control data. CoDA promotes a neat separation between application and adap......We present a white-box conceptual framework for adaptation developed in the context of the EU Project ASCENS coordinated by Martin Wirsing. We called it CoDA, for Control Data Adaptation, since it is based on the notion of control data. CoDA promotes a neat separation between application...... and adaptation logic through a clear identification of the set of data that is relevant for the latter. The framework provides an original perspective from which we survey a representative set of approaches to adaptation, ranging from programming languages and paradigms to computational models and architectural...

  13. The Central Nervous System of Box Jellyfish

    DEFF Research Database (Denmark)

    Garm, Anders Lydik; Ekström, Peter

    2008-01-01

    of behaviors in the box jellyfish such as obstacle avoidance and navigation. The need to process the visual information and turn it into the appropriate behavior puts strong demands on the nervous system of box jellyfish, which appears more elaborate than in other cnidarians. Here, the central part...... of this nervous system is described. Each rhopalium holds a separate part of the CNS with 1,000 nerve cells and a large amount of neuropil. The rhopalial nervous system has several subsystems defined by the anatomy, location, and immunocytochemistry of the cells. Most of the subsystems connect to one or more...... of the eye types, and it is likely that the rhopalial nervous system accounts for most of the visual processing. The major part of the CNS is made up of a ring nerve encircling the bell shaped body. The ring nerve holds around 10,000 cells and is directly connected to all four rhopalial nervous systems...

  14. Fatal exit the automotive black box debate

    CERN Document Server

    Kowalick, Tom

    2005-01-01

    "Fatal Exit: The Automotive Black Box Debate cuts through thirty years of political wrangling and institutional biases to provide an argument for the Motor Vehicle Event Data Recorder (MVEDR). This automotive equivalent of an airplane's flight recorder or black box is intended to solve the mysteries of car crashes and improve the safety of our roads. The reader is taken inside the automotive industry and the government highway safety establishment to foster an understanding of the politics and the positions on all sides of this safety debate. The author takes an unbiased approach, chronologically presenting each argument and uncovering the agendas and mandates of each of the stakeholders." "This publication is essential reading for all consumers who need to have their voices heard on this critical issue, as well as for attorneys, public safety advocates, public policy administrators, engineers, automotive professionals, journalists, and insurance executives."--Jacket.

  15. Do External or Internal Technology Spillovers Have a Stronger Influence on Innovation Efficiency in China?

    Directory of Open Access Journals (Sweden)

    Xionghe Qin

    2017-09-01

    Full Text Available In this study, we bridge an important gap in the literature by comparing the extent to which external technology spillovers, as indicated by foreign direct investment (FDI, and internal technology spillovers, as indicated by university-institute-industry cooperation (UIC, influence innovation efficiency in China. We divide the innovation process into two sequential stages, namely the knowledge creation and technology commercialization stages, and employ a network data envelopment analysis approach to measure innovation efficiency at each stage. The spatial analysis of the distribution of knowledge creation efficiency and technology commercialization efficiency reveals the heterogeneity of innovation efficiency at the provincial level. Then, a panel data regression is used to analyze the effect of FDI and UIC on innovation efficiency at each stage, using data from 2009 to 2015 for 30 provinces in China. By comparing FDI with UIC, we find that FDI has a higher coefficient and stronger significance level at the knowledge creation stage, while only industry-institute linkages exhibit a stronger association with innovation efficiency at the technology commercialization stage.

  16. The El Niño Southern Oscillation is Getting Bigger and Stronger

    Science.gov (United States)

    McNaught, C.; O'Brien, J.; Strazzo, S. E.

    2012-12-01

    The El Niño Southern Oscillation (ENSO) is an important natural climate variation that affects large portions of the world. We measure ENSO both in terms of its frequency and its magnitude. The different phases of ENSO - El Niño and La Niña - have different properties, and impact the global weather pattern differently. We examine the hypothesis that ENSO's frequency distribution is changing. We demonstrate that, indeed, El Niño's are getting stronger as measured by the maximum anomaly in sea surface temperature (SST). An analysis of the ENSO principal component is conducted using a fast Fourier transform to estimate the spectrum of the SST of the time series. We conclude that the intensity of El Niño events during the period 1970-2010 is statistically significantly higher when compared to the 1930—1970, with a broad spectral peak centered around 4 years. When we compare the SST spectrum for the period 1930-1970 with the spectrum for 1971- 2010, we find the latter period to be much stronger in power. Additionally recently classified ENSO types, including El Niño Modoki and Warm Pool ENSO, are briefly studied.; The first empirical orthogonal function of sea-surface temperatures (1930-2010) accounting for 75% of the variance. The values are indicative of departures from the mean, in °C. Positive (negative) values indicate anomalously higher (lower) sea-surface temperatures ; Normalized first principal component

  17. Stronger interference from distractors in the right hemifield during visual search.

    Science.gov (United States)

    Carlei, Christophe; Kerzel, Dirk

    2018-03-01

    The orientation-bias hypothesis states that there is a bias to attend to the right visual hemifield (RVF) when there is spatial competition between stimuli in the left and right hemifield [Pollmann, S. (1996). A pop-out induced extinction-like phenomenon in neurologically intact subjects. Neuropsychologia, 34(5), 413-425. doi: 10.1016/0028-3932(95)00125-5 ]. In support of this hypothesis, stronger interference was reported for RVF distractors with contralateral targets. In contrast, previous studies using rapid serial visual presentation (RSVP) found stronger interference from distractors in the left visual hemifield (LVF). We used the additional singleton paradigm to test whether this discrepancy was due to the different distractor features that were employed (colour vs. orientation). Interference from the colour distractor with contralateral targets was larger in the RVF than in the LVF. However, the asymmetrical interference disappeared when observers had to search for an inconspicuous colour target instead of the inconspicuous shape target. We suggest that the LVF orienting-bias is limited to situations where search is driven by bottom-up saliency (singleton search) instead of top-down search goals (feature search). In contrast, analysis of the literature suggests the opposite for the LVF bias in RSVP tasks. Thus, the attentional asymmetry may depend on whether the task involves temporal or spatial competition, and whether search is based on bottom-up or top-down signals.

  18. When surging seas meet stronger rain: Nuclear techniques in flood management

    International Nuclear Information System (INIS)

    Quevenco, Rodolfo

    2015-01-01

    Unusually high rainfall in many parts of the world is a result of climate change, scientists say. Since warmer air can hold more water, the rationale goes, increased temperatures will increase the chances of stronger rainfall events. And when surging seas combine with stronger rain, the outcome is almost certain: floods. Floods are the most frequently occurring natural disasters, and south-east Asia is particularly vulnerable. Climate change and variability are expected to bring about increased typhoon activities, rising sea levels and off-season monsoon rains in southeast Asia and other regions. These can cause devastating floods in countries like Cambodia, Laos, Pakistan, the Philippines, Thailand and Viet Nam. For the residents of these countries who have survived the ravages of major floods, the road to recovery can be long and arduous. As the flood water recedes, they have to contend with new forms of flood: floods of concern and worries as to how to rebuild their houses, their lives and their cities. Governments, too, face huge challenges in rebuilding roads, public buildings, infrastructure and natural resources destroyed or polluted by the flood.

  19. Monitoring Instrument for X-Ray Box

    CERN Document Server

    Cifuentes Ospina, Alberto; Kuehn, Susanne; Schaepe, Steffen; CERN. Geneva. EP Department

    2017-01-01

    A humidity and temperature readout instrument has been designed and implemented in order to monitor the X-Ray Box used for testing the silicon detectors prototypes of the ITk. The sensors are connected to an Arduino Mega board equipped with 16 analog inputs and a serial port to a computer. A user-friendly software has been also designed in order to give an easy access to all measurements.

  20. Removable glove for a glove box

    International Nuclear Information System (INIS)

    Lucas, J.M.

    1982-01-01

    The glove includes one part forming a cuff and another part forming the glove. These two parts are joined in a leak-tight manner by a rigid ring. The glove part is interchangeable without breaking the seal through two neighbouring grooves formed on the ring to receive a bead made on the open end of the glove. The grooves are visible when the glove is placed outside the glove box, thereby enabling the glove part to be changed in this position [fr

  1. The future of grey-box fuzzing

    OpenAIRE

    Hjelt, Isak

    2017-01-01

    Society are becoming more dependent on software, and more artifacts are being connected to the Internet each day [31]. This makes the work of tracking down vulnerabilities in software a moral obligation for software developers. Since manual testing is expensive [7], automated bug finding techniques are attractive within the quality assurance field, since it can save companies a lot of money. This thesis summarizes the research of an automated bug finding technique called grey-box fuzzing, wit...

  2. PCB-Based Break-Out Box

    Science.gov (United States)

    Lee, Jason H.

    2011-01-01

    Break-out boxes (BOBs) are necessary for all electrical integration/cable checkouts and troubleshooting. Because the price of a BOB is high, and no work can be done without one, often the procedure stops, simply waiting for a BOB. A less expensive BOB would take less time in the integration, testing, and troubleshooting process. The PCB-based BOB works and looks the same as a standard JPL BOB, called Gold Boxes. The only differences between the old BOB and the new PCB-based BOB is that the new one has 80 percent of its circuitry in a printed circuit board. This process reduces the time for fabrication, thus making the BOBs less expensive. Moreover, because of its unique design, the new BOBs can be easily assembled and fixed. About 80 percent of the new PCB-based BOB is in a $22 (at the time of this reporting) custom-designed, yet commercially available PCB. This device has been used successfully to verify that BOB cables were properly made. Also, upon completion, the BOB was beeped out via a multimeter to ensure that all sockets on the connectors were properly connected to the respective banana jack. When compared to the Gold Box BOBs, the new BOB has many advantages. It is much more cost efficient, it delivers equal usability at substantially lower cost of the BOB, and the Gold Box is much heavier when compared to the new BOB. The new BOB is also a bit longer and much more versatile in that connectors are easily changeable and if a banana jack is broken, it can be replaced instead of throwing away an entire BOB.

  3. Dry boxes and inert atmosphere techniques

    International Nuclear Information System (INIS)

    Bartak, D.E.

    1987-01-01

    Practitioners need to conduct experiments with molten salts in an inert atmosphere owing to the chemical reactivity of these media. Most fused salt solvent systems show reactivity to water and/or oxygen, which results in significant chemical changes in the properties of these solvents. Although several studies on the nature of an oxygen/oxide electrode in this melt have been reported, the reactions have not been fully understood because of apparent water contamination in many cases. Nitrate melt systems are also hygroscopic; for example, the LiNO 3 -KNO 3 eutectic (177 0 C) absorbs water to at least 0.2% by weight. The result is that the electrochemistry of heavier, electropositive metal ions has been significantly altered. In addition, trace amounts of water have been shown to significantly affect the oxygen-oxide redox chemistry in NaNO 3 -KNO 3 melts (250 0 C). The haloaluminates, which include AlCl 3 -NaCl (175 0 C), as well as AlCl 3 -organic salt binaries are particularly sensitive to the presence of both oxygen and moisture. Oxygen is a strong oxidant in the fused hydroxide systems with formation of superoxide ion from either oxide or water. This chapter describes general, inert atmosphere techniques which can be used by the molten salt experimentalist. Because of the limitations of volatility, vacuum manipulations are not considered. Rather, the use of glove boxes, glove bags, and inert bench-top techniques are discussed. The areas covered are: glove box and bag equipment, operation and maintenance of glove boxes and glove bags, and common operations conducted inside glove boxes

  4. Effectiveness of box trainers in laparoscopic training

    Directory of Open Access Journals (Sweden)

    Dhariwal Anender

    2007-01-01

    Full Text Available Rationale and Objectives: Various devices are used to aid in the education of laparoscopic skills ranging from simple box trainers to sophisticated virtual reality trainers. Virtual reality system is an advanced and effective training method, however it is yet to be adopted in India due to its cost and the advanced technology required for it. Therefore, box trainers are being used to train laparoscopic skills. Hence this study was undertaken to assess the overall effectiveness of the box-training course. Study Procedure: The study was conducted during six-day laparoscopic skills training workshops held during 2006. Twenty five surgeons; age range of 26 to 45 years, of either sex, who had not performed laparoscopic surgery before; attending the workshop were evaluated. Each participant was given a list of tasks to perform before beginning the box-training course on day one and was evaluated quantitatively by rating the successful completion of each test. Evaluation began when the subject placed the first tool into the cannula and ended with task completion. Two evaluation methods used to score the subject, including a global rating scale and a task-specific checklist. After the subject completed all sessions of the workshop, they were asked to perform the same tasks and were evaluated in the same manner. For each task completed by the subjects, the difference in the scores between the second and first runs were calculated and interpreted as an improvement as a percentage of the initial score. Statistical Analysis: Wilcoxon matched-paired signed-ranks test was applied to find out the statistical significance of the results obtained. Results: The mean percentage improvement in scores for both the tasks, using global rating scale, was 44.5% + 6.930 (Mean + SD. For task 1, using the global rating scale mean percentage improvement was 49.4% + 7.948 (Mean + SD. For task 2, mean percentage improvement using global rating scale was 39.6% + 10.4 (Mean

  5. Prohibiting Headgear for Safety in Amateur Boxing? Opinion of the Canadian Boxing Community: an Online Poll.

    Science.gov (United States)

    Dickinson, Philip; Rempel, Philip

    In 2013, the Amateur International Boxing Association (AIBA) introduced a rule banning headgear for male-senior open class boxers during competition. The AIBA has defended the rule change as motivated by safety and supported by internal unpublished studies. As a result, in 2018, the AIBA plans to universally prohibit headgear in competition: for all competitors (male and female), all ages and all levels. Within Canada, this ruling has generated controversy in the boxing community, yet there has been no overall measure of opinion. To address this, we instituted a voluntary, anonymous, online open-access poll to allow members of the boxing community to express their stance on headgear use in competition. In total, 636 responses were received. A total of 71.5 % of Canadian respondents believed headgear should be mandatory at all levels. Only 5.8 % agreed that headgear should be prohibited, as planned for 2018. Estimating results on a representative breakdown of boxing membership in Canada, a similar pattern emerged, whereby 68.2 % concurred with mandatory headgear while only 4.95 % supported its prohibition. Parents of boxers were almost unanimously against banning headgear, stating they would change sports as a result. Similarly, only 1.7 % of women believed headgear should be prohibited. The consensus of the Canadian boxing community largely opposes the rule changes that the AIBA has implemented. The results highlight risks posed to the long-term viability of the sport, if significant grassroots safety concerns are disregarded.

  6. Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

    DEFF Research Database (Denmark)

    Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

    2012-01-01

    of antigen processing and presentation in defining cytotoxic T lymphocyte (CTL) immunogenicity Assarsson et al., 2007. Using an affinity-balanced approach, we demonstrated that immunogenic peptides tend to be more stably bound to MHC-I molecules compared with non-immunogenic peptides. We also developed......Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological...... Sequence Analysis, Department of Systems Biology, Technical University of Denmark, Denmark Efficient presentation of peptide-MHC class I (pMHC-I) complexes to immune T cells should benefit from a stable peptide- MHC-I interaction. However, it has been difficult to distinguish stability from other...

  7. Bone mineral content has stronger association with lean mass than fat mass among Indian urban adolescents

    Directory of Open Access Journals (Sweden)

    Raman K Marwaha

    2015-01-01

    Full Text Available Introduction: There are conflicting reports on the relationship of lean mass (LM and fat mass (FM with bone mineral content (BMC. Given the high prevalence of Vitamin D deficiency in India, we planned the study to evaluate the relationship between LM and FM with BMC in Indian children and adolescents. The objective of the study was to evaluate the relationship of BMC with LM and FM. Materials and Methods: Total and regional BMC, LM, and FM using dual energy X-ray absorptiometry and pubertal staging were assessed in 1403 children and adolescents (boys [B]: 826; girls [G]: 577. BMC index, BMC/LM and BMC/FM ratio, were calculated. Results: The age ranged from 5 to 18 years, with a mean age of 13.2 ± 2.7 years. BMC adjusted for height (BMC index and BMC/height ratio was comparable in both genders. There was no difference in total BMC between genders in the prepubertal group but were higher in more advanced stages of pubertal maturation. The correlation of total as well as regional BMC was stronger for LM (B: Total BMC - 0.880, trunk - 0.715, leg - 0.894, arm - 0.891; G: Total BMC - 0.827, leg - 0.846, arm - 0.815 (all value indicate r2 , P < 0.0001 for all when compared with FM (B: Total BMC - 0.776, trunk - 0.676, leg - 0.772, arm - 0.728; G: Total BMC - 0.781, leg - 0.741, arm - 0.689; all P < 0.0001 except at trunk BMC (LM - 0.682 vs. FM - 0.721; all P < 0.0001, even after controlling for age, height, pubertal stage, and biochemical parameters. Conclusions: BMC had a stronger positive correlation with LM than FM.

  8. Candidate SNP Markers of Chronopathologies Are Predicted by a Significant Change in the Affinity of TATA-Binding Protein for Human Gene Promoters.

    Science.gov (United States)

    Ponomarenko, Petr; Rasskazov, Dmitry; Suslov, Valentin; Sharypova, Ekaterina; Savinkova, Ludmila; Podkolodnaya, Olga; Podkolodny, Nikolay L; Tverdokhleb, Natalya N; Chadaeva, Irina; Ponomarenko, Mikhail; Kolchanov, Nikolay

    2016-01-01

    Variations in human genome (e.g., single nucleotide polymorphisms, SNPs) may be associated with hereditary diseases, their complications, comorbidities, and drug responses. Using Web service SNP_TATA_Comparator presented in our previous paper, here we analyzed immediate surroundings of known SNP markers of diseases and identified several candidate SNP markers that can significantly change the affinity of TATA-binding protein for human gene promoters, with circadian consequences. For example, rs572527200 may be related to asthma, where symptoms are circadian (worse at night), and rs367732974 may be associated with heart attacks that are characterized by a circadian preference (early morning). By the same method, we analyzed the 90 bp proximal promoter region of each protein-coding transcript of each human gene of the circadian clock core. This analysis yielded 53 candidate SNP markers, such as rs181985043 (susceptibility to acute Q fever in male patients), rs192518038 (higher risk of a heart attack in patients with diabetes), and rs374778785 (emphysema and lung cancer in smokers). If they are properly validated according to clinical standards, these candidate SNP markers may turn out to be useful for physicians (to select optimal treatment for each patient) and for the general population (to choose a lifestyle preventing possible circadian complications of diseases).

  9. 49 CFR 178.512 - Standards for steel or aluminum boxes.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Standards for steel or aluminum boxes. 178.512... aluminum boxes. (a) The following are identification codes for steel or aluminum boxes: (1) 4A for a steel box; and (2) 4B for an aluminum box. (b) Construction requirements for steel or aluminum boxes are as...

  10. Peluang dan Tantangan Undang-undang Desa dalam Upaya Demokratisasi Tata Kelola Sumber Daya Alam Desa: Perspektif Agraria Kritis

    Directory of Open Access Journals (Sweden)

    Mohamad Shohibuddin

    2016-11-01

    Full Text Available Undang-undang Nomor 6 Tahun 2014 tentang Desa (UU Desa-terlepas dari terobosan politiknya dalam menggulirkan demokratisasi relasi negara-desa-memiliki keterbatasan mendasar terkait isu sumber daya alam di desa mengingat krisis agraria dan krisis ekologi yang terjadi di pedesaan. Selain tidak banyak mengelaborasi aspek-aspek penting dari isu sumber daya alam, UU Desa juga hanya memberikan kewenangan yang minim terhadap swakelola sumber daya alam desa oleh pemerintah desa serta tidak menyentuh ketimpangan akses warga desa terhadap sumber daya alam setempat. Dihadapkan pada tantangan struktural demikian, perjuangan "otonomi desa" akan sulit mendorong transformasi sosial yang berarti tanpa melibatkan upaya penataan sumber daya alam yang berkeadilan dan berkelanjutan. Pada saat yang sama, perjuangan "keadilan sosial-ekologis" akan sulit tampil sebagai agenda kolektif desa tanpa mengupayakan demokratisasi yang lebih dalam di internal desa sendiri. Tulisan ini menawarkan kerangka perjuangan "demokratisasi tata kelola sumber daya alam desa" sebagai konvergensi strategis dari dua perjuangan sebelumnya: "otonomi desa" dan "keadilan sosial-ekologis". Hal ini diupayakan melalui tiga agenda konkret yang saling terkait: penguatan kewenangan desa atas sumber daya alam setempat, demokratisasi relasi-relasi sosio-agraria di desa, dan pembalikan krisis pedesaan untuk merevitalisasi basis-basis produksi desa.Law Number 6 of 2014 on Village-apart from its political contribution in democratizing state-village relation-has a fundamental limitation on natural resource issues in the village in the light of agrarian and ecological crises. This Law offers a minor elaboration on natural resource issues and provides limited authority to the village on this field, while no reference is made to the problem of inequality in community's access to local natural resources. Confronted with such structural challenges, it is argued that "struggle for village autonomy" will

  11. Quantitative mass spectrometry of TATA binding protein-containing complexes and subunit phosphorylations during the cell cycle

    Directory of Open Access Journals (Sweden)

    Baltissen Marijke PA

    2009-12-01

    Full Text Available Abstract Background Progression through the cell cycle is accompanied by tightly controlled regulation of transcription. On one hand, a subset of genes is expressed in a cell cycle-dependent manner. On the other hand, a general inhibition of transcription occurs during mitosis. Genetic and genome-wide studies suggest cell cycle regulation at the level of transcription initiation by protein complexes containing the common DNA-binding subunit TATA binding protein (TBP. TBP is a key player in regulating transcription by all three nuclear RNA polymerases. It forms at least four distinct protein complexes with TBP-associated factors (TAFs: SL1, B-TFIID, TFIID, and TFIIIB. Some TAFs are known to remain associated with TBP during the cell cycle. Here we analyze all TAFs and their phosphorylation status during the cell cycle using a quantitative mass spectrometry approach. Results TBP protein complexes present in human cells at the G2/M and G1/S transitions were analyzed by combining affinity purification with quantitative mass spectrometry using stable isotope labeling with amino acids in cell culture (SILAC. Phosphorylations were mapped and quantified after enrichment of tryptic peptides by titanium dioxide. This revealed that subunit stoichiometries of TBP complexes remained intact, but their relative abundances in nuclear extracts changed during the cell cycle. Several novel phosphorylations were detected on subunits of the TBP complexes TFIID and SL1. G2/M-specific phosphorylations were detected on TAF1, TAF4, TAF7, and TAFI41/TAF1D, and G1/S-specific dephosphorylations were detected on TAF3. Many phosphorylated residues were evolutionary conserved from human to zebrafish and/or drosophila, and were present in conserved regions suggesting important regulatory functions. Conclusions This study provides the first quantitative proteomic analysis of human TBP containing protein complexes at the G2/M and G1/S transitions, and identifies new cell cycle

  12. Boxing headguard performance in punch machine tests.

    Science.gov (United States)

    McIntosh, Andrew S; Patton, Declan A

    2015-09-01

    The paper presents a novel laboratory method for assessing boxing headguard impact performance. The method is applied to examine the effects of headguards on head impact dynamics and injury risk. A linear impactor was developed, and a range of impacts was delivered to an instrumented Hybrid III head and neck system both with and without an AIBA (Association Internationale de Boxe Amateur)-approved headguard. Impacts at selected speeds between 4.1 and 8.3 m/s were undertaken. The impactor mass was approximately 4 kg and an interface comprising a semirigid 'fist' with a glove was used. The peak contact forces were in the range 1.9-5.9 kN. Differences in head impact responses between the Top Ten AIBA-approved headguard and bare headform in the lateral and forehead tests were large and/or significant. In the 8.3 m/s fist-glove impacts, the mean peak resultant headform accelerations for bare headform tests was approximately 130 g compared with approximately 85 g in the forehead impacts. In the 6.85 m/s bare headform impacts, mean peak resultant angular head accelerations were in the range of 5200-5600 rad/s(2) and almost halved by the headguard. Linear and angular accelerations in 45° forehead and 60° jaw impacts were reduced by the headguard. The data support the opinion that current AIBA headguards can play an important role in reducing the risk of concussion and superficial injury in boxing competition and training. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  13. Impact of aircraft exhaust on the atmosphere. Box model studies and 3-D mesoscale numerical case studies of seasonal differences

    Energy Technology Data Exchange (ETDEWEB)

    Petry, H.; Ebel, A.; Franzkowiak, V.; Hendricks, J.; Lippert, E.; Moellhoff, M. [Koeln Univ. (Germany). Inst. fuer Geophysik und Meteorologie

    1997-12-31

    The impact of aircraft emissions released in the tropopause region on atmospheric trace gases as O{sub 3} or HNO{sub 3} is investigated by means of model studies. Special emphasis is drawn on seasonal effects. A box model is applied as well as a 3-D mesoscale chemistry transport model. These model studies show that the impact of aircraft emissions on ozone in the tropopause region is much stronger in summer than in late autumn with a difference of one order of magnitude. (author) 14 refs.

  14. Design Research: Six Views in a Box

    DEFF Research Database (Denmark)

    2011-01-01

    ways to better understand the consequences of the disease, spread the knowledge to more people and diagnosis the disease as soon as possible. The class was partly sponsored by Johnson & Johnson, an international pharmaceutical company. The students also collaborated with the Danish Alzheimer...... Association. Future designers need competence in co-design. Just as important is the need to establish various formats for how to maintain the research results and make these a valuable asset for further inquiry. Thus, the outcome of the class is a box that can be used by Johnson & Johnson and other...

  15. Development of blanket box structure fabrication technology

    International Nuclear Information System (INIS)

    Mohri, K.; Sato, S.; Kawaguchi, I.; Sato, K.; Kuroda, T.; Hashimoto, T.; Sato, S.; Takatsu, H.

    1995-01-01

    Fabrication studies have been performed for the first wall and blanket box structure in the fusion experimental reactor designed in Japan. The hot isostatic pressing technique has been proposed as one of the most promising candidate methods for fabricating the first wall. This paper describes the trial fabrication of a half-scale mock-up for part of an outboard module near the midplane, without the internal structure of a breeding region, to investigate its feasibility and to clarify technological issues associated with the proposed fabrication technologies. (orig.)

  16. Piracy and Box Office Movie Revenues

    DEFF Research Database (Denmark)

    Peukert, Christian; Claussen, Jörg; Kretschmer, Tobias

    2017-01-01

    In this paper we evaluate the heterogeneous effects of online copyright enforcement. We ask whether the unexpected shutdown of the popular file hosting platform Megaupload had a differential effect on box office revenues of wide-release vs. niche movies. Identification comes from a comparison...... of movies that were available on Megaupload to those that were not. We show that only movies that premiere in a relatively large number of theaters benefitted from the shutdown of Megaupload. The average effect, however, is negative. We provide suggestive evidence that this result is driven by information...

  17. Keller-box method and its application

    CERN Document Server

    Prasad, Kerehalli V

    2014-01-01

    Most of the problems arising in science and engineering are nonlinear. They are inherently difficult to solve. Traditional analytical approximations are valid only for weakly nonlinear problems, and often break down for problems with strong nonlinearity. This book presents the current theoretical developments and applications of Keller-Box method to nonlinear problems. The first half of the bookaddresses basic concepts to understand the theoretical framework for the method. In the second half of the book, the authorsgive a number of examples of coupled nonlinear problems that have been solved

  18. Design Research: Six Views in a Box

    DEFF Research Database (Denmark)

    2011-01-01

    and close relations, and professional caretakers. Alzheimer's destroys brain cells, causing memory loss and problems with thinking and behavior severe enough to affect work, lifelong hobbies and social life. As Alzheimer’s is a fatal disease that affects many people, there is a strong interest in finding...... professional organizations in a user-driven approach to explore and learn what it means to identify and admit that a person has Alzheimer’s. Apart from making contributions to the common box, the students have written reports in which they reflect on their work both in relation to the design research process...

  19. Do Biomimetic Students Think Outside the Box?

    DEFF Research Database (Denmark)

    Lenau, Torben Anker

    2017-01-01

    Biomimetics is a recognized method in ideation for getting access to new and – for the designer – novel knowledge, which hopefully will result in more novel and useful products. But do designers actually find new knowledge, i.e. think outside the box or do they stick to well-known biological...... phenomena? If they concentrate on animals and plants, which they beforehand have knowledge about, it could be expected that solutions will remind of what they would have found without using biomimetics. To investigate this question, the empirical results from a university course in biomimetics have been...

  20. Test procedure for boxed waste assay system

    International Nuclear Information System (INIS)

    Wachter, J.

    1994-01-01

    This document, prepared by Los Alamos National Laboratory's NMT-4 group, details the test methodology and requirements for Acceptance/Qualification testing of a Boxed Waste Assay System (BWAS) designed and constructed by Pajarito Scientific Corporation. Testing of the BWAS at the Plutonium Facility (TA55) at Los Alamos National Laboratory will be performed to ascertain system adherence to procurement specification requirements. The test program shall include demonstration of conveyor handling capabilities, gamma ray energy analysis, and imaging passive/active neutron accuracy and sensitivity. Integral to these functions is the system's embedded operating and data reduction software

  1. Seismic stability of a standalone glove box structure

    International Nuclear Information System (INIS)

    Saraswat, A.; Reddy, G.R.; Ghosh, S.; Ghosh, A.K.; Kumar, Arun

    2014-01-01

    Highlights: • Glove box is a leak tight, safety related structure used for handling radiotoxic materials. • To study the seismic performance of a freestanding glove box, extensive shake table testing has been carried out. • Glove box maintained structural integrity and leak tightness up to design basis earthquake loading. • Detailed three-dimensional finite element model of the structure is developed and analyzed by using direct time integration methods. • Simplified numerical method is proposed and successfully applied, to quickly estimate sliding displacement and determine upper bounds for it. - Abstract: In a nuclear fuel cycle facility, radiotoxic materials are being handled in freestanding leak tight enclosures called glove boxes (GBs). These glove boxes act as a primary confinement for the radiotoxic materials. Glove boxes are designed as per codal requirements for class I component. They are designed to withstand extreme level of earthquake loading with a return period of 10,000 years. To evaluate seismic performance of the glove box, there is a need to check the stability (sliding and overturning), structural integrity (stresses and strains) and leak tightness under earthquake loading. Extensive shake table experiments were conducted on a single standalone glove box. Actual laboratory conditions were simulated during testing to check the response. After extensive shake table testing, glove box structure was also analyzed using finite element (FE) software. Detailed three-dimensional model of glove box structure was developed and analyzed using nonlinear time history method. It was observed that finite element methods could be utilized to accurately predict dynamic response of glove box structure. This paper discusses the details and results of shake table testing and methodology used for modelling and analysing freestanding glove box structure under seismic loading. In addition, simplified numerical procedure, developed using energy conservation

  2. Seismic stability of a standalone glove box structure

    Energy Technology Data Exchange (ETDEWEB)

    Saraswat, A., E-mail: anupams@barc.gov.in [Bhabha Atomic Research Centre, Mumbai (India); Reddy, G.R. [Bhabha Atomic Research Centre, Mumbai (India); Ghosh, S. [Indian Institute of Technology Bombay, Mumbai (India); Ghosh, A.K.; Kumar, Arun [Bhabha Atomic Research Centre, Mumbai (India)

    2014-09-15

    Highlights: • Glove box is a leak tight, safety related structure used for handling radiotoxic materials. • To study the seismic performance of a freestanding glove box, extensive shake table testing has been carried out. • Glove box maintained structural integrity and leak tightness up to design basis earthquake loading. • Detailed three-dimensional finite element model of the structure is developed and analyzed by using direct time integration methods. • Simplified numerical method is proposed and successfully applied, to quickly estimate sliding displacement and determine upper bounds for it. - Abstract: In a nuclear fuel cycle facility, radiotoxic materials are being handled in freestanding leak tight enclosures called glove boxes (GBs). These glove boxes act as a primary confinement for the radiotoxic materials. Glove boxes are designed as per codal requirements for class I component. They are designed to withstand extreme level of earthquake loading with a return period of 10,000 years. To evaluate seismic performance of the glove box, there is a need to check the stability (sliding and overturning), structural integrity (stresses and strains) and leak tightness under earthquake loading. Extensive shake table experiments were conducted on a single standalone glove box. Actual laboratory conditions were simulated during testing to check the response. After extensive shake table testing, glove box structure was also analyzed using finite element (FE) software. Detailed three-dimensional model of glove box structure was developed and analyzed using nonlinear time history method. It was observed that finite element methods could be utilized to accurately predict dynamic response of glove box structure. This paper discusses the details and results of shake table testing and methodology used for modelling and analysing freestanding glove box structure under seismic loading. In addition, simplified numerical procedure, developed using energy conservation

  3. Regular Exercisers Have Stronger Pelvic Floor Muscles than Non-Regular Exercisers at Midpregnancy.

    Science.gov (United States)

    Bø, Kari; Ellstrøm Engh, Marie; Hilde, Gunvor

    2017-12-26

    Today, all healthy pregnant women are encouraged to be physically active throughout pregnancy, with recommendations to participate in at least 30 min of aerobic activity on most days of the week, in addition to perform strength training of the major muscle groups 2-3 days per week, and also pelvic floor muscle training. There is, however, an ongoing debate whether general physical activity enhances or declines pelvic floor muscle function. To compare vaginal resting pressure, pelvic floor muscle strength and endurance in regular exercisers (exercise ≥ 30 minutes ≥ 3 times per week) and non-exercisers at mid-pregnancy. Furthermore, to assess whether regular general exercise or pelvic floor muscle strength was associated with urinary incontinence. This was a cross-sectional study at mean gestational week 20.9 (± 1.4) including 218 nulliparous pregnant women, mean age 28.6 years (range 19-40) and pre-pregnancy body mass index 23.9 kg/m 2 (SD 4.0). Vaginal resting pressure, pelvic floor muscle strength and pelvic floor muscle endurance were measured by a high precision pressure transducer connected to a vaginal balloon. International Consultation on Incontinence Questionnaire Urinary Incontinence Short Form was used to assess urinary incontinence. Differences between groups were analyzed using Independent Sample T-test. Linear regression analysis was conducted to adjust for pre-pregnancy body mass index, age, smoking during pregnancy and regular pelvic floor muscle training during pregnancy. P-value was set to ≤ 0.05. Regular exercisers had statistically significant stronger ( mean 6.4 cm H 2 O (95% CI: 1.7, 11.2)) and more enduring ( mean 39.9 cm H 2 Osec (95% CI: 42.2, 75.7)) pelvic floor muscles. Only pelvic floor muscle strength remained statistically significant, when adjusting for possible confounders. Pelvic floor muscle strength and not regular general exercise was associated with urinary continence (adjusted B: -6.4 (95% CI: -11.5, -1.4)). Regular

  4. Hippocampal-Prefrontal Reactivation during Learning Is Stronger in Awake Compared with Sleep States.

    Science.gov (United States)

    Tang, Wenbo; Shin, Justin D; Frank, Loren M; Jadhav, Shantanu P

    2017-12-06

    Hippocampal sharp-wave ripple (SWR) events occur during both behavior (awake SWRs) and slow-wave sleep (sleep SWRs). Awake and sleep SWRs both contribute to spatial learning and memory, thought to be mediated by the coordinated reactivation of behavioral experiences in hippocampal-cortical circuits seen during SWRs. Current hypotheses suggest that reactivation contributes to memory consolidation processes, but whether awake and sleep reactivation are suited to play similar or different roles remains unclear. Here we addressed that issue by examining the structure of hippocampal (area CA1) and prefrontal (PFC) activity recorded across behavior and sleep stages in male rats learning a spatial alternation task. We found a striking state difference: prefrontal modulation during awake and sleep SWRs was surprisingly distinct, with differing patterns of excitation and inhibition. CA1-PFC synchronization was stronger during awake SWRs, and spatial reactivation, measured using both pairwise and ensemble measures, was more structured for awake SWRs compared with post-task sleep SWRs. Stronger awake reactivation was observed despite the absence of coordination between network oscillations, namely hippocampal SWRs and cortical delta and spindle oscillations, which is prevalent during sleep. Finally, awake CA1-PFC reactivation was enhanced most prominently during initial learning in a novel environment, suggesting a key role in early learning. Our results demonstrate significant differences in awake and sleep reactivation in the hippocampal-prefrontal network. These findings suggest that awake SWRs support accurate memory storage and memory-guided behavior, whereas sleep SWR reactivation is better suited to support integration of memories across experiences during consolidation. SIGNIFICANCE STATEMENT Hippocampal sharp-wave ripples (SWRs) occur both in the awake state during behavior and in the sleep state after behavior. Awake and sleep SWRs are associated with memory

  5. Reconciling White-Box and Black-Box Perspectives on Behavioral Self-adaptation

    DEFF Research Database (Denmark)

    Bruni, Roberto; Corradini, Andrea; Gadducci, Fabio

    2015-01-01

    This paper proposes to reconcile two perspectives on behavioral adaptation commonly taken at different stages of the engineering of autonomic computing systems. Requirements engineering activities often take a black-box perspective: A system is considered to be adaptive with respect to an environ...

  6. TatAc, the Third TatA Subunit of Bacillus subtilis, Can Form Active Twin-Arginine Translocases with the TatCd and TatCy Subunits

    NARCIS (Netherlands)

    Monteferrante, Carmine G.; Baglieri, Jacopo; Robinson, Colin; van Dijl, Jan Maarten

    Two independent twin-arginine translocases (Tat) for protein secretion were previously identified in the Gram-positive bacterium Bacillus subtilis. These consist of the TatAd-TatCd and TatAy-TatCy subunits. The function of a third TatA subunit named TatAc was unknown. Here, we show that TatAc can

  7. The Design of the Orthogonal Box Cavity

    Energy Technology Data Exchange (ETDEWEB)

    Moretti, Alfred; /Fermilab

    2010-09-15

    The muon collider and/or the neutrino factory require large accelerating electric field gradients immersed in large (3 to 6 T) solenoidal magnetic fields for ionization cooling of muon beams. Our original vacuum breakdown study demonstrated a loss of achievable peak accelerating gradient in solenoidal magnetic fields by a factor 2 or greater. The Muon Collaboration has developed a theory of a method to suppress high electric field breakdown in vacuum cavities needed for a Muon collider or neutrino factory. It has been shown in our studies and by others that high gradient electric field emitted electrons (dark current) are the primary cause of breakdown. A DC magnetic field orthogonal to the RF electric accelerating field prevents dark current high field emitted electrons from traveling across the accelerating gap and then will prevent breakdown. We have decided to test this theory by building a special cavity in the shape of vacuum box. Figure 1 is a simplified view of the cavity design. The design is based on an 805 MHz WR975 waveguide cavity resonating in the TE{sub 101} mode. For the TE{sub 101} mode the resonant frequency f{sub 0} is given by the relationship f{sub 0} = c[(I/a){sup 2} + (m/b){sup 2} + (n/d){sup 2}]{sup 0.5}/2 where a and d are the lengths of the base sides and b is the height of the box in MKS units and c is the velocity of light.

  8. Flexible bulb large storage box hydrogen maser

    Science.gov (United States)

    Reinhardt, V.

    1973-01-01

    The principal limitation on the accuracy of the hydrogen maser as a primary frequency standard has been the irreproducibility of the frequency shift caused by collisions of the radiating atoms with the walls of the vessel containing them. The flexible bulb-large storage box hydrogen maser allows correction for this wall shift within a single device, sidestepping the reproducibility problem, and reducing the frequency error from the wall shift to the level imposed by the device's stability. The principles of the device are discussed including the flexible bulb technique and the complications caused by a multiple region storage bulb. The stability of the device is discussed including a comparison with an ordinary hydrogen maser. Data is presented from a working flexible bulb-large storage box hydrogen maser demonstrating the feasibility of the device and showing some of its operating characteristics. The flexibility of the device is demonstrated by showing how the device's added degrees of freedom allow measurement of parameters unmeasurable in an ordinary hydrogen maser.

  9. Hairy black holes in a box

    Energy Technology Data Exchange (ETDEWEB)

    Basu, Pallab [International Center for Theoretical Sciences,IISc Campus, Bangalore 560012 (India); Krishnan, Chethan; Subramanian, P.N. Bala [Center for High Energy Physics, Indian Institute of Science,Bangalore 560012 (India)

    2016-11-08

    We do a systematic study of the phases of gravity coupled to an electromagnetic field and charged scalar in flat space, with box boundary conditions. The scalar-less box has previously been investigated by Braden, Brown, Whiting and York (and others) before AdS/CFT and we elaborate and extend their results in a language more familiar from holography. The phase diagram of the system is analogous to that of AdS black holes, but we emphasize the differences and explain their origin. Once the scalar is added, we show that the system admits both boson stars as well as hairy black holes as solutions, providing yet another way to evade flat space no-hair theorems. Furthermore both these solutions can exist as stable phases in regions of the phase diagram. The final picture of the phases that emerges is strikingly similar to that found recently for holographic superconductors in global AdS, http://arxiv.org/abs/1602.07211. Our construction lays bare certain previously unnoticed subtleties associated to the definition quasi-local charges for gravitating scalar fields in finite regions.

  10. A Group Action Method for Construction of Strong Substitution Box

    Science.gov (United States)

    Jamal, Sajjad Shaukat; Shah, Tariq; Attaullah, Atta

    2017-06-01

    In this paper, the method to develop cryptographically strong substitution box is presented which can be used in multimedia security and data hiding techniques. The algorithm of construction depends on the action of a projective general linear group over the set of units of the finite commutative ring. The strength of substitution box and ability to create confusion is assessed with different available analyses. Moreover, the ability of resistance against malicious attacks is also evaluated. The substitution box is examined by bit independent criterion, strict avalanche criterion, nonlinearity test, linear approximation probability test and differential approximation probability test. This substitution box is equated with well-recognized substitution boxes such as AES, Gray, APA, S8, prime of residue, Xyi and Skipjack. The comparison shows encouraging results about the strength of the proposed box. The majority logic criterion is also calculated to analyze the strength and its practical implementation.

  11. [Design and application of hand-wrist caring moxibustion box].

    Science.gov (United States)

    Gao, Xi-Yan; Wang, Xin; Xu, Cui-Xiang; Gao, Ling; Ma, Qiao-Lin

    2013-11-01

    A hand-wrist moxibustion box is designed to effectively solve difficulty to have moxibustion at handwrist joint and problem of bad moxibustion effect as well as improve heat efficiency of moxibustion. The device is consisted of a box and protective screening. The box is hollow with opening on top and bottom. A reversible cover is fixed on the top of the box and support frames are put in the inner-middle. On the side wall there is a hole that is at the same horizontal level of support frames, and horizontal protective screening is put on the bottom. The design of this moxibustion box is novel and unique, simple and reasonable, which could give moxibustion on hand and wrist at the same time. Also it is easily made with low cost, easy to use and favorable effect. It is an innovation on moxibustion box.

  12. Stronger associations of obesity with prehypertension and hypertension in young women than in young men.

    Science.gov (United States)

    Wakabayashi, Ichiro

    2012-07-01

    Obesity is an important risk factor for prehypertension and hypertension, and there are sex-specific differences in prevalences of obesity and hypertension. The aim of this study was to determine whether sex influences the relationships of obesity with prehypertension and hypertension. The participants were 28,325 Japanese men and women aged 20-39 years. Obesity was evaluated by BMI (≥ 25 kg/m) and waist-to-height ratio (WHtR ≥ 0.5). Associations of obesity with prehypertension and hypertension were compared in men and women by using odds ratio (OR) and area under the curve (AUC). ORs for prehypertension and hypertension in participants with vs. participants without high BMI or WHtR were significantly higher than a reference level of 1.00 both in men and women and were significantly higher in women than in men. ORs for prehypertension and hypertension of participants with vs. participants without high BMI were 3.10 (2.84-3.38) (men) vs. 5.54 (4.80-6.40) (women) (P men) vs. 34.58 (26.55-45.04) (women) (P men. The results suggest that the associations of obesity with prehypertension and hypertension are stronger in women than in men.

  13. Stronger activation of SREBP-1a by nucleus-localized HBx

    International Nuclear Information System (INIS)

    Wu, Qi; Qiao, Ling; Yang, Jian; Zhou, Yan; Liu, Qiang

    2015-01-01

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication

  14. Stronger activation of SREBP-1a by nucleus-localized HBx

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qi [VIDO-InterVac, Veterinary Microbiology, University of Saskatchewan, Saskatoon (Canada); Qiao, Ling [VIDO-InterVac, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Yang, Jian [Drug Discovery Group, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Zhou, Yan [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)

    2015-05-08

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication.

  15. Length effects in pseudo-word spelling: stronger in dyslexic than in non-dyslexic students.

    Science.gov (United States)

    Juul, Holger; Petersen, Dorthe Klint

    2017-10-01

    It is often discussed whether dyslexics show a deviant pattern of reading and spelling development when compared to typically developing students, or whether they follow the same pattern as other students, only at markedly slower rate. The present cross-sectional study investigated phonological encoding skills in dyslexic Danish students. We compared dyslexic and non-dyslexic students from grades 3, 5, 7, and 9 and examined whether effects of item length were stronger in the dyslexic groups. Mixed between-within subjects analyses of variance revealed significant interactions between dyslexia status and item length as the dyslexics at all grade levels were more affected by item length than their non-dyslexic peers. A marked developmental delay was apparent as the dyslexic group from grade 9 performed on approximately the same level as the non-dyslexic group from grade 3. Although the overall difference between these two groups was not significant, a significant interaction between dyslexia status and item length remained because the grade 9 dyslexics were more affected by item length than the younger non-dyslexic students. This difference in error profiles suggests a difference in the developmental patterns of dyslexic vs. non-dyslexic students.

  16. Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations.

    Science.gov (United States)

    Hoogeveen, Heleen R; Jolij, Jacob; Ter Horst, Gert J; Lorist, Monicque M

    2016-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the actual perception of a food's sensory properties, and therefore highly rely on previous experiences of similar consumptions stored in memory. In this study we assessed the differential strength of food associations implicitly stored in memory, using an associative priming paradigm. Participants (N = 30) were exposed to a forced-choice picture-categorization task, in which the food or non-food target images were primed with either non-sensory or sensory related words. We observed a smaller N400 amplitude at the parietal electrodes when categorizing food as compared to non-food images. While this effect was enhanced by the presentation of a food-related word prime during food trials, the primes had no effect in the non-food trials. More specifically, we found that sensory associations are stronger implicitly represented in memory as compared to non-sensory associations. Thus, this study highlights the neuronal mechanisms underlying previous observations that sensory associations are important features of food memory, and therefore a primary motive in food choice.

  17. Phytoplankton Communities Exhibit a Stronger Response to Environmental Changes than Bacterioplankton in Three Subtropical Reservoirs.

    Science.gov (United States)

    Liu, Lemian; Yang, Jun; Lv, Hong; Yu, Xiaoqing; Wilkinson, David M; Yang, Jun

    2015-09-15

    The simultaneous analysis of multiple components of ecosystems is crucial for comprehensive studies of environmental changes in aquatic ecosystems, but such studies are rare. In this study, we analyzed simultaneously the bacterioplankton and phytoplankton communities in three Chinese subtropical reservoirs and compared the response of these two components to seasonal environmental changes. Time-lag analysis indicated that the temporal community dynamics of both bacterioplankton and phytoplankton showed significant directional changes, and variance partitioning suggested that the major reason was the gradual improvement of reservoir water quality from middle eutrophic to oligo-mesotrophic levels during the course of our study. In addition, we found a higher level of temporal stability or stochasticity in the bacterioplankton community than in the phytoplankton community. Potential explanations are that traits associated with bacteria, such as high abundance, widespread dispersal, potential for rapid growth rates, and rapid evolutionary adaptation, may underlie the different stability or stochasticity of bacterioplankton and phytoplankton communities to the environmental changes. In addition, the indirect response of bacterioplankton to nitrogen and phosphorus may result in the fact that environmental deterministic selection was stronger for the phytoplankton than for the bacterioplankton communities.

  18. Age differences in autobiographical memory across the adult lifespan: older adults report stronger phenomenology.

    Science.gov (United States)

    Luchetti, Martina; Sutin, Angelina R

    2018-01-01

    As an individual's life story evolves across adulthood, the subjective experience (phenomenology) of autobiographical memory likely changes. In addition to age at retrieval, both the recency of the memory and the age when a memory is formed may be particularly important to its phenomenology. The present work examines the effect of three temporal factors on phenomenology ratings: (a) age of the participant, (b) age at the event reported in the memory, and (c) memory age (recency). A large sample of Americans (N = 1120), stratified by chronological age, recalled and rated two meaningful memories, a Turning Point and an Early Childhood Memory. Ratings of phenomenology (e.g., vividness of turning points) were higher among older adults compared to younger adults. Memories of events from the reminiscence bump were more positive in valence than events from other time periods but did not differ on other phenomenological dimensions; recent memories had stronger phenomenology than remote memories. In contrast to phenomenology, narrative content was generally unrelated to participant age, age at the event, or memory age. Overall, the findings indicate age-related differences in how meaningful memories are re-experienced.

  19. Speed versus endurance tradeoff in plants: Leaves with higher photosynthetic rates show stronger seasonal declines.

    Science.gov (United States)

    Zhang, Yong-Jiang; Sack, Lawren; Cao, Kun-Fang; Wei, Xue-Mei; Li, Nan

    2017-02-10

    We tested for a tradeoff across species between plant maximum photosynthetic rate and the ability to maintain photosynthesis under adverse conditions in the unfavorable season. Such a trade-off would be consistent with the observed trade-off between maximum speed and endurance in athletes and some animals that has been explained by cost-benefit theory. This trend would have importance for the general understanding of leaf design, and would simplify models of annual leaf carbon relations. We tested for such a trade-off using a database analysis across vascular plants and using an experimental approach for 29 cycad species, representing an ancient plant lineage with diversified evergreen leaves. In both tests, a higher photosynthetic rate per mass or per area in the favorable season was associated with a stronger absolute or percent decline in the unfavorable season. We resolved a possible mechanism based on biomechanics and nitrogen allocation; cycads with high leaf toughness (leaf mass per area) and higher investment in leaf construction than in physiological function (C/N ratio) tended to have lower warm season photosynthesis but less depression in the cool season. We propose that this trade-off, consistent with cost-benefit theory, represents a significant physio-phenological constraint on the diversity and seasonal dynamics of photosynthetic rate.

  20. A stronger necessary condition for the multistationarity of chemical reaction networks.

    Science.gov (United States)

    Soliman, Sylvain

    2013-11-01

    Biochemical reaction networks grow bigger and bigger, fed by the high-throughput data provided by biologists and bred in open repositories of models allowing merging and evolution. Nevertheless, since the available data is still very far from permitting the identification of the increasing number of kinetic parameters of such models, the necessity of structural analyses for describing the dynamics of chemical networks appears stronger every day. Using the structural information, notably from the stoichiometric matrix, of a biochemical reaction system, we state a more strict version of the famous Thomas' necessary condition for multistationarity. In particular, the obvious cases where Thomas' condition was trivially satisfied, mutual inhibition due to a multimolecular reaction and mutual activation due to a reversible reaction, can now easily be ruled out. This more strict condition shall not be seen as some version of Thomas' circuit functionality for the continuous case but rather as related and complementary to the whole domain of the structural analysis of (bio)chemical reaction systems, as pioneered by the chemical reaction network theory.

  1. Plant Identity Exerts Stronger Effect than Fertilization on Soil Arbuscular Mycorrhizal Fungi in a Sown Pasture.

    Science.gov (United States)

    Zheng, Yong; Chen, Liang; Luo, Cai-Yun; Zhang, Zhen-Hua; Wang, Shi-Ping; Guo, Liang-Dong

    2016-10-01

    Arbuscular mycorrhizal (AM) fungi play key roles in plant nutrition and plant productivity. AM fungal responses to either plant identity or fertilization have been investigated. However, the interactive effects of different plant species and fertilizer types on these symbiotic fungi remain poorly understood. We evaluated the effects of the factorial combinations of plant identity (grasses Avena sativa and Elymus nutans and legume Vicia sativa) and fertilization (urea and sheep manure) on AM fungi following 2-year monocultures in a sown pasture field study. AM fungal extraradical hyphal density was significantly higher in E. nutans than that in A. sativa and V. sativa in the unfertilized control and was significantly increased by urea and manure in A. sativa and by manure only in E. nutans, but not by either fertilizers in V. sativa. AM fungal spore density was not significantly affected by plant identity or fertilization. Forty-eight operational taxonomic units (OTUs) of AM fungi were obtained through 454 pyrosequencing of 18S rDNA. The OTU richness and Shannon diversity index of AM fungi were significantly higher in E. nutans than those in V. sativa and/or A. sativa, but not significantly affected by any fertilizer in all of the three plant species. AM fungal community composition was significantly structured directly by plant identity only and indirectly by both urea addition and plant identity through soil total nitrogen content. Our findings highlight that plant identity has stronger influence than fertilization on belowground AM fungal community in this converted pastureland from an alpine meadow.

  2. Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

    Science.gov (United States)

    de Goeij, Moniek C M; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E

    2017-06-01

    This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were used to define episodic drinking (≥6 glasses on 1 day ≥1/week) and chronic drinking (≥14 glasses/week for women and ≥21 for men). These data were linked to longitudinal data from tax registries, to measure the experience and duration of job loss during a 5-year working history. Before the crisis, job loss experience and duration were not associated with harmful drinking. During the crisis, job loss for more than 6 months was associated with episodic drinking [OR 1.40 (95% CI 1.01; 1.94)], while current job loss was associated with chronic drinking [OR 1.43 (95% CI 1.03; 1.98)]. These associations were most clear in men and different between the pre-crisis and crisis period (p interaction = 0.023 and 0.035, respectively). The results suggest that economic crises strengthen the potential impact of job loss on harmful drinking, predominately among men.

  3. Deep Cropping via Attention Box Prediction and Aesthetics Assessment

    OpenAIRE

    Wang, Wenguan; Shen, Jianbing

    2017-01-01

    We model the photo cropping problem as a cascade of attention box regression and aesthetic quality classification, based on deep learning. A neural network is designed that has two branches for predicting attention bounding box and analyzing aesthetics, respectively. The predicted attention box is treated as an initial crop window where a set of cropping candidates are generated around it, without missing important information. Then, aesthetics assessment is employed to select the final crop ...

  4. Grey-box modelling of pharmacokinetic/pharmacodynamic systems

    DEFF Research Database (Denmark)

    Tornøe, Christoffer Wenzel; Jacobsen, Judith L; Pedersen, Oluf

    2004-01-01

    Grey-box pharmacokinetic/pharmacodynamic (PK/PD) modelling is presented as a promising way of modelling PK/PD systems. The concept behind grey-box modelling is based on combining physiological knowledge along with information from data in the estimation of model parameters. Grey-box modelling con...... in order to describe the complicated in vivo system of insulin and glucose following an IVGTT....

  5. Construction and properties of Box-Behnken designs

    OpenAIRE

    Jo, Jinnam

    1992-01-01

    Box-Behnken designs are used to estimate parameters in a second-order response surface model (Box and Behnken, 1960). These designs are formed by combining ideas from incomplete block designs (BIBD or PBIBD) and factorial experiments, specifically 2k full or 2k-1 fractional factorials. In this dissertation, a more general mathematical formulation of the Box-Behnken method is provided, a general expression for the coefficient matrix in the least squares analysis for estimatin...

  6. ORF Alignment: NC_003074 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available n By The Tata Box-Binding Protein Has Been ... Conserved Throughout Evolution. pdb|1QN4|A Chain A, ... ... ... Recognition By The Tata Box-Binding Protein Has Been ... Conserved Throughout Evolution. pdb|1...Tata Element ... Recognition By The Tata Box-Binding Protein Has Been ... Conserved Throughout Evolution...Recognition By The Tata Box-Binding Protein Has ... Been Conserved Throughout Evolution. pdb|1QNC|A C...ement ... Recognition By The Tata Box-Binding Protein Has Been ... Conserved Throughout Evolution

  7. Perceived stress and biological risk: is the link stronger in Russians than in Taiwanese and Americans?

    Science.gov (United States)

    Glei, Dana A; Goldman, Noreen; Shkolnikov, Vladimir M; Jdanov, Dmitri; Shkolnikova, Maria; Vaupel, James W; Weinstein, Maxine

    2013-07-01

    Allostatic load theory implies a relationship between exposure to psychological stress and multi-system physiological dysregulation. We used data from population-based samples of men and women in Russia (Moscow; n = 1800; age, mean 68.6 years), Taiwan (n = 1036; 65.6 years) and the United States (US; n = 1054; 58.0 years) -- which are likely to vary widely with respect to levels of stress exposure and biological markers -- to determine the magnitude of the association between perceived stress and physiological dysregulation. The measure of overall dysregulation was based on 15 markers including standard cardiovascular/metabolic risk factors as well as markers of inflammation and neuroendocrine activity. Subjective psychological stress was measured by the perceived stress scale. Only the Moscow sample demonstrated a positive association with overall dysregulation in both sexes. In the US, we found an association among women but not men. Among the Taiwanese, who report the lowest perceived stress, there was no association in women but an unexpected inverse relationship in men. The effects also varied across system-level subscores: the association with perceived stress was most consistent for standard cardiovascular/metabolic factors. Perceived stress was associated with inflammation and neuroendocrine activity in some samples. Although the evidence that perceived stress is the primary source of physiological dysregulation is generally modest, it was stronger in Russia where the level of perceived stress was particularly high. For Russia only, we had information about heart function based on a 24 h ambulatory electrocardiogram; perceived stress was consistently associated with heart rate dysregulation in Russian men and women.

  8. Stronger tests of mechanisms underlying geographic gradients of biodiversity: insights from the dimensionality of biodiversity.

    Directory of Open Access Journals (Sweden)

    Richard D Stevens

    Full Text Available Inference involving diversity gradients typically is gathered by mechanistic tests involving single dimensions of biodiversity such as species richness. Nonetheless, because traits such as geographic range size, trophic status or phenotypic characteristics are tied to a particular species, mechanistic effects driving broad diversity patterns should manifest across numerous dimensions of biodiversity. We develop an approach of stronger inference based on numerous dimensions of biodiversity and apply it to evaluate one such putative mechanism: the mid-domain effect (MDE. Species composition of 10,000-km(2 grid cells was determined by overlaying geographic range maps of 133 noctilionoid bat taxa. We determined empirical diversity gradients in the Neotropics by calculating species richness and three indices each of phylogenetic, functional and phenetic diversity for each grid cell. We also created 1,000 simulated gradients of each examined metric of biodiversity based on a MDE model to estimate patterns expected if species distributions were randomly placed within the Neotropics. For each simulation run, we regressed the observed gradient onto the MDE-expected gradient. If a MDE drives empirical gradients, then coefficients of determination from such an analysis should be high, the intercept no different from zero and the slope no different than unity. Species richness gradients predicted by the MDE fit empirical patterns. The MDE produced strong spatially structured gradients of taxonomic, phylogenetic, functional and phenetic diversity. Nonetheless, expected values generated from the MDE for most dimensions of biodiversity exhibited poor fit to most empirical patterns. The MDE cannot account for most empirical patterns of biodiversity. Fuller understanding of latitudinal gradients will come from simultaneous examination of relative effects of random, environmental and historical mechanisms to better understand distribution and abundance of the

  9. BUILDING STRONGER STATE ENERGY PARTNERSHIPS WITH THE U.S. DEPARTMENT OF ENERGY

    Energy Technology Data Exchange (ETDEWEB)

    Kate Burke

    2003-09-01

    This technical progress report includes an update of the progress during the third year of cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. The report also describes the barriers in conduct of the effort, and our assessment of future progress and activities. The approach of the project included three tasks during year three. First, NASEO and its Buildings Committee were to focus on raising awareness and coordination of Rebuild activities. Through education, one-on-one communications, and presentations at NASEO meetings and other events, staff and the committee will assist Rebuild officials in stimulating interest in the program and building greater support among State Energy Office Directors. The most recent subtasks added to the project, though not directly related to Rebuild America, fall under this initial task, and support: (a) state plans to implement integrated energy and environmental initiatives, including distributed generation technologies, and (b) initiation of a state collaborative on advanced turbines and hybrid systems. The advanced turbine piece was completed during this year. During the year, a new workplan was accepted by Rebuild America's Dan Sze to supplement the work in this task. This workplan is outlined below. Second, NASEO would work to improve the efficiency of America's schools by assisting states and DOE in promoting projects that result in more energy efficient and clean energy schools and a better learning environment. This task was fully completed during this year. The third task involves energy security issues which NASEO addressed by way of a Summer Fuels Outlook Conference held Tuesday, April 8, 2003. The purpose of this educational event was to inform state, federal, local, and other energy officials about the most recent transportation fuels data and trends. The public benefits part of this task was not funded for Year 3, thus no activity occurred.

  10. Association Between Self-Esteem and Depressive Symptoms Is Stronger Among Black than White Older Adults.

    Science.gov (United States)

    Assari, Shervin

    2017-08-01

    Although poor self-esteem is a core component of depression, we still do not know if racial and ethnic groups differ in the magnitude of this link. This study compared Black and White older adults on the association between self-esteem and depressive symptoms. With a cross-sectional design, this study enrolled 1493 older individuals (age 66 or more) from the 2001 Religion, Aging, and Health Survey, a nationally representative study in the United States. Participants were either Blacks (n = 734) or Whites (n = 759). Depressive symptoms and self-esteem were measured using brief measures of the Center for Epidemiological Studies-Depression scale (CES-D) and the Rosenberg Self-Esteem Scale, respectively. Demographics, socioeconomics, and self-rated health (SRH) were covariates and self-identified race was the moderator. Linear regression models were used for data analysis. Low self-esteem was associated with more depressive symptoms (B = 0.17, 95 % CI 0.15-0.28), above and beyond all covariates. We found a significant and positive interaction between race (Black) and poor self-esteem on depressive symptoms (B = 0.34, 95 % CI 0.17-0.36), suggesting a stronger association between self-esteem and depressive symptoms among Blacks compared to Whites. Although low self-esteem is associated with higher depressive symptoms in both Whites and Blacks (p self-esteem and high depressive symptoms are more closely associated among Blacks than Whites. It is not clear whether depression leaves a larger scar on self-esteem for Blacks, or Blacks are more vulnerable to the effect of low self-esteem on depression.

  11. Choreographies with Secure Boxes and Compromised Principals

    DEFF Research Database (Denmark)

    Carbone, Marco; Guttman, Joshua

    2009-01-01

      We equip choreography-level session descriptions with a simple abstraction of a security infrastruc- ture. Message components may be enclosed within (possibly nested) ”boxes” annotated with the intended source and destination of those components. The boxes are to be implemented with cryp......- tography. Strand spaces provide a semantics for these choreographies, in which some roles may be played by compromised principals. A skeleton is a partially ordered structure containing local behaviors (strands) executed by regular (non-compromised) principals. A skeleton is realized if it contains enough...... it embeds. Second, if no step is possible from a skeleton A, then A is DG realized. Finally, if a DG realized A′ is accessible from A, then A′ is minimal. Thus, the transition system provides a systematic way to construct the possible behaviors of the choreography, in the presence of compromised principals.  ...

  12. A Comparison of Energy Expenditure During "Wii Boxing" Versus Heavy Bag Boxing in Young Adults.

    Science.gov (United States)

    Perusek, Kristen; Sparks, Kenneth; Little, Kathleen; Motley, Mary; Patterson, Sheila; Wieand, Jennifer

    2014-02-01

    Traditional computer videogames are sedentary, whereas new computer videogames, such as the Nintendo(®) (Redmond, WA) "Wii™ Sports" games, allow users to physically interact while playing the sport. Energy expenditure (EE), heart rate (HR), and rating of perceived exertion (RPE) during heavy bag boxing versus the Nintendo "Wii Boxing" game were compared. Fifteen males and 14 females (mean age, 25.6 years; height, 171.3 cm; weight, 71.8 kg) randomly selected (by a coin toss) heavy bag boxing or "Wii Boxing" for their first test session and completed the other protocol at their second session at least 2 days later. Each session lasted for a total duration of 30 minutes and consisted of 10 3-minute exercise bouts with measurements of HR, RPE, and EE obtained from indirect calorimetry. A paired-samples t test was used to analyze the results. Significant differences were found for HR (bag, 156 beats per minute; Wii, 138 beats per minute; P=0.001) and RPE (bag, 13.8; Wii, 11.4; P=0.0001) but not for EE (bag, 8.0 kcal/minute; Wii, 7.1 kcal/minute; bag, 241 total kcal; Wii, 213 total kcal; P=0.078). The results suggest that computer active videogames, such as the Nintendo Wii, have the potential to provide similar EE as their traditional forms of exercise and may be a sufficient replacement for traditional target HR zone activities, especially in less fit individuals. Further research is needed to compare EE for different "Wii Sports" games with those for their traditional forms of exercise.

  13. ANALISIS TATA KELOLA OPTIMALISASI SUMBER DAYA SISTEM INFORMASI MANAJEMEN JEMBATAN TIMBANG (EDM04 BERDASARKAN KERANGKA KERJA COBIT 5 PADA DINAS PERHUBUNGAN KOMUNIKASI DAN INFORMATIKA PROVINSI JAWA TENGAH

    Directory of Open Access Journals (Sweden)

    Yudistira Dian Hastiti

    2016-06-01

    Full Text Available Dinas Perhubungan Komunikasi dan Informatika (Dinhubkominfo Provinsi Jawa tengah sebagai perumus dan pelaksana kebijakan teknis, fasilitator, dan evaluator terkait penyelengaraan kegiatan penimbangan kendaraan bermotor melalui 16 jembatan timbang yang tersebar di wilayah provinsi jawa tengah telah mengimplementasikan sebuah system yang dipergunakan untuk kemudahan dalam menimbang kendaraan dengan mendata setiap kendaraan pada suatu system yang disebut Sistem Informasi Manajemen Jembatan Timbang (SIM JT. Masalah yang ditemukan saat ini yaitu, melihat padatnya antrian panjang kendaraan yang akan ditimbang disebabkan karena SIM JT yang belum memiliki database identitas kendaraan dan tidak dapat terpantau secara real time yang terjadi saat local server dalam keadaan down. Berdasarkan hal tersebut Dinhubkominfo berupaya mengoptimalkan kinerja SIM JT baik dari segi sumber daya manajemen manusia, TI, serta keuangan untuk meminimalkan kesalahan serta meningkatkan efektifitas pelayanan. Dari hasil studi dokumen, wawancara, dan kuesioner  berdasarkan COBIT 5 menghasilkan tingkat kapabilitas tata kelola proses optimalisasi sumer daya (EDM04 pada Dinas Perhubungan Komunikasi dan Informatika Provinsi Jawa Tengah saat ini berada di level 3 dengan status pencapaian Largely Achieved sebesar 80,18% setara dengan 3,80 dimana level 0, 1, dan 2 mencapai status Fully Achieved. Hal ini menunjukan telah mengelola dengan baik proses optimalisasi sumber daya dan diimplementasikan untuk mendukung pengerjaan proses standar dan efektif. Untuk mencapai tingkat target, Dinhubkominfo dapat melakukan strategi perbaikan dengan memperhatikan secara bertahap dari proses atribut level 1 sampai 4 Kata Kunci: Analisis Tata Kelola TI, COBIT 5, Sistem Informasi Manajemen Jembatan Timbang, Analisis Tingkat Kapabilitas, Analisis Kesenjangan.

  14. A System for Cooling inside a Glove Box

    Science.gov (United States)

    Sanz, Martial

    2010-01-01

    An easy, efficient, reliable, and low-cost method of constructing a cooling system using a simple circulating pump is described. The system is employed in conjunction with an inert atmosphere glove box to achieve the synthesis of air- and moisture-sensitive compounds inside the glove box at controlled, low temperatures without contaminating the…

  15. Decontamination and dismantling of large plutonium-contamined glove boxes

    International Nuclear Information System (INIS)

    Draulans, J.

    1991-01-01

    This report describes the work performed in the frame of two C.E.C. - Contracts FI1D-002400-B Decommissioning of very large glove boxes and FI1D-0058 Decommissioning of a complex glove box structure to be dismounted partially on place. Detailed information is given about each glove box. The selection of the solution Transportation of the glove boxes to a specialized dismantling plant is justified. The necessary contacts inside the BELGONUCLEAIRE MOX plant and between the latter and other organizations are explained. The problems of manipulating large gloves are listed and the retained solution of building a so called Stiffening frame around each glove box is described. Furthermore information is given concerning required operators time for cleaning, manipulating, packing and dismantling together with received doses and quantities of waste produced. Concerning the glove box unit partially to be dismounted on place, detailed information is given about the way the glove boxes have been treated prior to this partial dismantling on place and about the way this partial dismantling has been performed. From these results one can conclude that such a delicate task can be performed without major difficulties. Finally information is given of the decontamination test of a highly Pu contaminated glove box with freon with rather poor results and of the preliminary CO 2 blasting tests on non active samples

  16. Getting started with Oracle VM VirtualBox

    CERN Document Server

    Dash, Pradyumna

    2013-01-01

    A step-by-step guide that will show you how to install, configure, and manage VirtualBox.This book is for system administrators, technical architects, and virtualization enthusiasts who want to learn how to set up a virtual machine. Knowledge of the Linux environment is expected. Prior experience with VirtualBox or knowledge of virtualization is not required.

  17. Current implementation of advance encryption standard (AES) S-Box

    African Journals Online (AJOL)

    Although the attack on cryptosystem is still not severe, the development of the scheme is still ongoing especially for the design of S-Box. Two main approach has beenused, which are heuristic method and algebraic method. Algebraic method as in current AES implementation has been proven to be the most secure S-Box ...

  18. A sealed enclosure of the glove box type

    International Nuclear Information System (INIS)

    Moreels, Pierre.

    1974-01-01

    The invention relates to a sealed enclosure of the glove-box type. According to the invention, the box-frame comprises: angle-bars having a right-angled cross-section, sealing joints, tightening bars and fastening means [fr

  19. Modelling of Box Type Solar Cooker Performance in a Tropical ...

    African Journals Online (AJOL)

    Thermal performance model of box type solar cooker with loaded water is presented. The model was developed using the method of Funk to estimate cooking power in terms of climatic and design parameters for box type solar cooker in a tropical environment. Coefficients for each term used in the model were determined ...

  20. Lightweight S-Box Architecture for Secure Internet of Things

    Directory of Open Access Journals (Sweden)

    A. Prathiba

    2018-01-01

    Full Text Available Lightweight cryptographic solutions are required to guarantee the security of Internet of Things (IoT pervasiveness. Cryptographic primitives mandate a non-linear operation. The design of a lightweight, secure, non-linear 4 × 4 substitution box (S-box suited to Internet of Things (IoT applications is proposed in this work. The structure of the 4 × 4 S-box is devised in the finite fields GF (24 and GF ((222. The finite field S-box is realized by multiplicative inversion followed by an affine transformation. The multiplicative inverse architecture employs Euclidean algorithm for inversion in the composite field GF ((222. The affine transformation is carried out in the field GF (24. The isomorphic mapping between the fields GF (24 and GF ((222 is based on the primitive element in the higher order field GF (24. The recommended finite field S-box architecture is combinational and enables sub-pipelining. The linear and differential cryptanalysis validates that the proposed S-box is within the maximal security bound. It is observed that there is 86.5% lesser gate count for the realization of sub field operations in the composite field GF ((222 compared to the GF (24 field. In the PRESENT lightweight cipher structure with the basic loop architecture, the proposed S-box demonstrates 5% reduction in the gate equivalent area over the look-up-table-based S-box with TSMC 180 nm technology.

  1. Dream Box Learning. What Works Clearinghouse Intervention Report

    Science.gov (United States)

    What Works Clearinghouse, 2013

    2013-01-01

    "DreamBox Learning" is a supplemental online mathematics program that provides adaptive instruction for students in grades K-5 and focuses on number and operations, place value, and number sense. The What Works Clearinghouse (WWC) identified one study of "DreamBox Learning" that both falls within the scope of the Elementary…

  2. Using Willie's Acid-Base Box for Blood Gas Analysis

    Science.gov (United States)

    Dietz, John R.

    2011-01-01

    In this article, the author describes a method developed by Dr. William T. Lipscomb for teaching blood gas analysis of acid-base status and provides three examples using Willie's acid-base box. Willie's acid-base box is constructed using three of the parameters of standard arterial blood gas analysis: (1) pH; (2) bicarbonate; and (3) CO[subscript…

  3. MADS-box genes controlling inflorescence morphogenesis in sunflower

    NARCIS (Netherlands)

    Shulga, O.A.; Shchennikova, A.V.; Angenent, G.C.; Skryabin, K.G.

    2008-01-01

    MADS-box genes play an important role in plant ontogeny, particularly, in the regulation of floral organ induction and development. Eight full-length cDNAs of HAM genes (Helianthus annuus MADS) have been isolated from sunflower. They encode MADS-box transcription factors expressed in inflorescence

  4. Heart Rate and Liking During "Kinect Boxing" Versus "Wii Boxing": The Potential for Enjoyable Vigorous Physical Activity Videogames.

    Science.gov (United States)

    Sanders, Gabriel J; Peacock, Corey A; Barkley, Jacob E; Gish, Brian; Brock, Scott; Volpenhein, Josh

    2015-08-01

    Nintendo(®) (Kyoto, Japan) "Wii™ Sports Boxing" ("Wii Boxing") and Xbox(®) (Microsoft, Redmond, WA) "Kinect(®) Sports Boxing" ("Kinect Boxing") are both boxing simulation videogames that are available for two different active videogame (AVG) systems. Although these AVGs are similar, the style of gameplay required is different (i.e., upper body only versus total body movements) and may alter physical activity intensity and one's preference for playing one game over the other. AVGs that elicit the greatest physiologic challenge and are preferred by users should be identified in an effort to enhance the efficacy of physical activity interventions and programs that include AVGs. The mean heart rate (HRmean) and peak heart rate (HRpeak) for 27 adults (22.7±4.2 years old) were recorded during four 10-minute conditions: seated rest, treadmill walking at 3 miles/hour, "Wii Boxing," and "Kinect Boxing." Upon completion of all four conditions, participants indicated which condition they preferred, and HRmean and HRpeak were calculated as a percentage of age-predicted maximum heart rate to classify physical activity intensity for the three activity conditions (treadmill, "Wii Boxing," and "Kinect Boxing"). "Kinect Boxing" significantly (P<0.001) increased percentage HRmean (64.1±1.6 percent of age-predicted maximum) and percentage HRpeak (76.5±1.9 percent) above all other conditions: Wii HRmean, 53.0±1.2 percent; Wii HRpeak, 61.8±1.5 percent; treadmill HRmean, 52.4±1.2 percent; treadmill HRpeak, 55.2±2.2 percent. Percentage HRpeak for "Kinect Boxing" was great enough to be considered a vigorous-intensity physical activity. There was no difference (P=0.55) in percentage HRmean between "Wii Boxing" and treadmill walking. Participants also preferred "Kinect Boxing" (P<0.001; n=26) to all other conditions ("Wii Boxing," n=1; treadmill n=0). "Kinect Boxing" was the most preferred and the only condition that was physiologically challenging enough to be classified as a

  5. Getting started with Citrix VDI-in-a-Box

    CERN Document Server

    Brown, Stuart Arthur

    2013-01-01

    A practical and fast-paced guide that gives you all the information you need to simplify and streamline virtual desktops so you get a production-quality solution while instantly lowering your costs and improving security.Getting Started with Citrix VDI-in-a-Box is great for IT professionals who are new to VDI-in-a-Box and who are looking for a good grounding in the product. You may be planning to research VDI-in-a-Box in more detail, or you may be tasked with researching how VDI-in-a-Box could improve the productivity of your organization. No prior knowledge of VDI-in-a-Box is required, just a

  6. Structural testing of the technology integration box beam

    Science.gov (United States)

    Griffin, C. F.

    1992-01-01

    A full-scale section of a transport aircraft wing box was designed, analyzed, fabricated, and tested. The wing box section, which was called the technology integration box beam, contained blade stiffened covers and T-stiffened channel spars constructed using graphite/epoxy materials. Covers, spars, and the aluminum ribs were assembled using mechanical fasteners. The box beam was statically tested for several loading conditions to verify the stiffness and strength characteristics of the composite wing design. Failure of the box beam occurred at 125 percent of design limit load during the combined upbending and torsion ultimate design load test. It appears that the failure initiated at a stiffener runout location in the upper cover which resulted in rupture of the upper cover and portions of both spars.

  7. Software sensors based on the grey-box modelling approach

    DEFF Research Database (Denmark)

    Carstensen, J.; Harremoës, P.; Strube, Rune

    1996-01-01

    In recent years the grey-box modelling approach has been applied to wastewater transportation and treatment Grey-box models are characterized by the combination of deterministic and stochastic terms to form a model where all the parameters are statistically identifiable from the on......-line measurements. With respect to the development of software sensors, the grey-box models possess two important features. Firstly, the on-line measurements can be filtered according to the grey-box model in order to remove noise deriving from the measuring equipment and controlling devices. Secondly, the grey......-box models may contain terms which can be estimated on-line by use of the models and measurements. In this paper, it is demonstrated that many storage basins in sewer systems can be used as an on-line flow measurement provided that the basin is monitored on-line with a level transmitter and that a grey...

  8. Tworty Box to Improve the Equipment Logistics of Container Lines

    Directory of Open Access Journals (Sweden)

    Ulrich Malchow

    2016-07-01

    Full Text Available A major share of all empty container positioning (deadheading is resulting from imbalances with regard to container sizes (20ft/40ft. In order to reduce the shipments of 'containerised air' a new type of container has been developed by the author: The Tworty Boxes can either be used as a standard 20ft or in coupled condition as a 40ft container. The outside appearance resembles any standard 20ft container. However the Tworty Box is unique in that it has an additional door at the front side that opens to the inside. This door can be fixed to the ceiling and by using of bonding elements another Tworty Box can be joined up, thereby creating the full 40ft inside space. Operated as a single 20ft box the additional door remains locked, access is only through the existing standard door. Tworty Boxes do not require any additional components and fulfil all ISO and CSC requirements.

  9. Removal of the nonconformities in the drug boxes packaging industry

    Directory of Open Access Journals (Sweden)

    Bălan Emilia

    2017-01-01

    Full Text Available The paper presents the specific quality aspects of cardboard drug boxes (folding boxes used as packaging in pharmaceutical industry. The types of defects and nonconformities that occur during offset printing and finishing of the packaging products are being identified and analyzed, such as: differences in color printing, scratches on the printed sheets, cracks during creasing, unparalleled gluing in respect to the closing flaps, ungluing, successive drug boxes stick to each other. The paper also focuses on aspects regarding the nonconformities removal of the drug boxes by establishing a control plan and preventive and corrective methods applicable in different technological stages of the production flow. Monitoring and analyzing activities for quality improvement of the drug boxes, in accordance with the quality specifications required by customers were performed for 20 months on a production line with Heidelberg machines. Nonconformities considered in this paper are also encountered in advertising printing.

  10. Bell inequalities stronger than the Clauser-Horne-Shimony-Holt inequality for three-level isotropic states

    International Nuclear Information System (INIS)

    Ito, Tsuyoshi; Imai, Hiroshi; Avis, David

    2006-01-01

    We show that some two-party Bell inequalities with two-valued observables are stronger than the CHSH inequality for 3x3 isotropic states in the sense that they are violated by some isotropic states in the 3x3 system that do not violate the CHSH inequality. These Bell inequalities are obtained by applying triangular elimination to the list of known facet inequalities of the cut polytope on nine points. This gives a partial solution to an open problem posed by Collins and Gisin. The results of numerical optimization suggest that they are candidates for being stronger than the I 3322 Bell inequality for 3x3 isotropic states. On the other hand, we found no Bell inequalities stronger than the CHSH inequality for 2x2 isotropic states. In addition, we illustrate an inclusion relation among some Bell inequalities derived by triangular elimination

  11. "This one is stronger". Spotlights on the lifelong learning professional-in-action

    Directory of Open Access Journals (Sweden)

    Josje van der Linden

    2016-06-01

    Full Text Available ABSTRACT“This one is stronger.” Spotlights on the lifelong learning professional-in-action Around the world, lifelong learning is being promoted as a strategy for coping with the changing realities of life and work. The fourth Sustainable Development Goal, agreed in September 2015, reflects this: “ensure equitable and inclusive quality education and promote lifelong learning opportunities for all”. Despite its importance, doubts remain about the implementation of this goal in practice (Van der Kamp, 2000; Regmi, 2015. This article looks at the practice of lifelong learning from the point of view of the professionals involved, their actions and the way these actions are challenged, supported and further developed. Following Schön’s “reflection-in-action” (1983, the term “professional-in-action” is used to stress the role of the professional in making the difference on the ground. The leading question is: how can lifelong learning professionals be supported in their contribution to surrounding society and its citizens? The professionals-in-action featured in this article include professionals based in the Netherlands as well as in other, less privileged contexts. Meaningful experiences are used to build a story about challenges, the right to exist, commitment, recognition and room to manoeuvre. The experiences reveal the importance of interacting with the learner and the professional space that is necessary to achieve this. Professionalization in professional learning communities and practice-oriented research must accompany this professional space. SAMENVATTING“Deze is sterker”. Spotlights op de leven lang leren professional-in-actieOm te kunnen omgaan met de veranderende realiteit in leven en werk, wordt wereldwijd een leven lang leren aangemoedigd. Het vierde duurzame ontwikkelingsdoel, vastgesteld in september 2015, weerspiegelt dit: “het verzekeren van kwalitatief goed onderwijs en het bevorderen van de mogelijkheden

  12. Design of strong wooden box coated with fiberglass reinforced resin for shipping and burial of contaminated glove boxes. Final report

    International Nuclear Information System (INIS)

    1982-01-01

    The project scope of work included the complete decontamination and decommissioning (D and D) of the Westinghouse ARD Fuel Laboratories at the Cheswick Site in the shortest possible time. This has been accomplished in the following four phases: (1) preparation of documents and necessary paperwork; packaging and shipping of all special nuclear materials in an acceptable form to a reprocessing agency; (2) decontamination of all facilities, glove boxes and equipment; loading of generated waste into bins, barrels and strong wooden boxes; (3) shipping of al bins, barrels and boxes containing waste to the designated burial site; removal of all utility services from the laboratories; and (4) final survey of remaining facilities and certification for nonrestricted use; preparation of final report. This attachment contains design of strong wooden box coated with fiberglass reinforced resin for shipping and burial of contaminated glove boxes

  13. Technology integration box beam failure study

    Science.gov (United States)

    Shuart, M. J.; Ambur, Damodar R.; Davis, D. D., Jr.; Davis, R. C.; Farley, G. L.; Lotts, C. G.; Wang, J. T.

    1993-01-01

    Composite structures have the potential to be cost-effective, structurally efficient primary aircraft structures. The Advanced Composites Technology (ACT) Program has the goal to develop the technology to exploit this potential for heavily loaded aircraft structures. As part of the ACT Program, Lockheed Aeronautical Systems Company completed the design and fabrication of the Technology Integration Box Beam (TIBB). The TIBB is an advanced composite prototype structure for the center wing section of the C-130 aircraft. Lockheed subjected the TIBB to downbending, upbending, torsion and combined upbending and torsion load conditions to verify the design. The TIBB failed at 83 percent of design ultimate load for the combined upbending and torsion load condition. The objective of this paper is to describe the mechanisms that led to the failure of the TIBB. The results of a comprehensive analytical and experimental study are presented. Analytical results include strain and deflection results from both a global analysis of the TIBB and a local analysis of the failure region. These analytical results are validated by experimental results from the TIBB tests. The analytical and experimental results from the TIBB tests are used to determine a sequence of events that resulted in failure of the TIBB. A potential cause of failure is high stresses in a stiffener runout region. Analytical and experimental results are also presented for a stiffener runout specimen that was used to simulate the TIBB failure mechanisms.

  14. Rethinking sanitation: panacea or Pandora's box.

    Science.gov (United States)

    Esrey, S A

    2000-01-01

    In the 19th century, sanitation solutions were designed and built on the premises that human excreta was a waste suitable only for disposal and that the environment was capable of assimilating the waste. The prevailing view last century was that vapors from smells caused disease, and the best way to deal with excreta was to convey it to rivers and streams where it could be diluted and cleansed. Times have changed, the premises are outdated, and current solutions contribute, either directly or indirectly, to many of the problems faced by society today: water pollution, scarcity of fresh water, food insecurity, destruction and loss of soil fertility, loss of biodiversity, depletion of the ozone layer, and global warming. A common denominator of all these problems is how society deals with its wastes, specifically how it deals with human excrement. We have to rethink past premises, design and build new systems, and contribute to the solving of society's most pressing problems. The panacea of the 19th century is turning out to be the pandora's box of the 21st century.

  15. Boxes of Model Building and Visualization.

    Science.gov (United States)

    Turk, Dušan

    2017-01-01

    Macromolecular crystallography and electron microscopy (single-particle and in situ tomography) are merging into a single approach used by the two coalescing scientific communities. The merger is a consequence of technical developments that enabled determination of atomic structures of macromolecules by electron microscopy. Technological progress in experimental methods of macromolecular structure determination, computer hardware, and software changed and continues to change the nature of model building and visualization of molecular structures. However, the increase in automation and availability of structure validation are reducing interactive manual model building to fiddling with details. On the other hand, interactive modeling tools increasingly rely on search and complex energy calculation procedures, which make manually driven changes in geometry increasingly powerful and at the same time less demanding. Thus, the need for accurate manual positioning of a model is decreasing. The user's push only needs to be sufficient to bring the model within the increasing convergence radius of the computing tools. It seems that we can now better than ever determine an average single structure. The tools work better, requirements for engagement of human brain are lowered, and the frontier of intellectual and scientific challenges has moved on. The quest for resolution of new challenges requires out-of-the-box thinking. A few issues such as model bias and correctness of structure, ongoing developments in parameters defining geometric restraints, limitations of the ideal average single structure, and limitations of Bragg spot data are discussed here, together with the challenges that lie ahead.

  16. Non-signaling boxes and quantum logics

    International Nuclear Information System (INIS)

    Tylec, T I; Kuś, M

    2015-01-01

    Using a quantum logic approach we analyze the structure of the so-called non-signaling theories respecting relativistic causality, but allowing correlations violating bounds imposed by quantum mechanics such as CHSH inequality. We discuss the relations among such theories, quantum mechanics, and classical physics. Our main result is the construction of a probability theory adequate for the simplest instance of a non-signaling theory—the two non-signaling boxes world—in which we exhibit its differences in comparison with classical and quantum probabilities. We show that the question of whether such a theory can be treated as a kind of ‘generalization’ of the quantum theory of the two-qubit system cannot be answered positively. Some of its features put it closer to the quantum world—on the one hand, for example, the measurements are destructive, though on the other hand the Heisenberg uncertainty relations are not satisfied. Another interesting property contrasting it from quantum mechanics is that the subset of ‘classically correlated states’, i.e. the states with only classical correlations, does not reproduce the classical world of the two two-state systems. Our results establish a new link between quantum information theory and the well-developed theory of quantum logics. (paper)

  17. Opening up a Colourful Cosmic Jewel Box

    Science.gov (United States)

    2009-10-01

    The combination of images taken by three exceptional telescopes, the ESO Very Large Telescope on Cerro Paranal , the MPG/ESO 2.2-metre telescope at ESO's La Silla observatory and the NASA/ESA Hubble Space Telescope, has allowed the stunning Jewel Box star cluster to be seen in a whole new light. Star clusters are among the most visually alluring and astrophysically fascinating objects in the sky. One of the most spectacular nestles deep in the southern skies near the Southern Cross in the constellation of Crux. The Kappa Crucis Cluster, also known as NGC 4755 or simply the "Jewel Box" is just bright enough to be seen with the unaided eye. It was given its nickname by the English astronomer John Herschel in the 1830s because the striking colour contrasts of its pale blue and orange stars seen through a telescope reminded Herschel of a piece of exotic jewellery. Open clusters [1] such as NGC 4755 typically contain anything from a few to thousands of stars that are loosely bound together by gravity. Because the stars all formed together from the same cloud of gas and dust their ages and chemical makeup are similar, which makes them ideal laboratories for studying how stars evolve. The position of the cluster amongst the rich star fields and dust clouds of the southern Milky Way is shown in the very wide field view generated from the Digitized Sky Survey 2 data. This image also includes one of the stars of the Southern Cross as well as part of the huge dark cloud of the Coal Sack [2]. A new image taken with the Wide Field Imager (WFI) on the MPG/ESO 2.2-metre telescope at ESO's La Silla Observatory in Chile shows the cluster and its rich surroundings in all their multicoloured glory. The large field of view of the WFI shows a vast number of stars. Many are located behind the dusty clouds of the Milky Way and therefore appear red [3]. The FORS1 instrument on the ESO Very Large Telescope (VLT) allows a much closer look at the cluster itself. The telescope's huge mirror

  18. Stronger Association Between Valence- and Arousal Ratings of Affective Pictures with Older Age: Evidence for Variation Across Emotion Categories

    DEFF Research Database (Denmark)

    Mikkelsen, Mai Bjørnskov; Mehlsen, Mimi Yung; Lyby, Marlene Skovgaard

    A sample of older and younger adults rated affective pictures according to valence, arousal and emotion category (happiness, sadness and disgust). Results indicate that older age is associated with a stronger linear association between ratings of arousal and valence. Further, the strength...

  19. Pilot testing of the "First You Should Get Stronger" program among caregivers of older adults with dementia.

    Science.gov (United States)

    Lök, Neslihan; Bademli, Kerime

    In this study, randomized controlled interventional study pattern was used to examine the effects of the "First You Should Get Stronger" program on the caregiving burden and healthy life style behavior of caregivers of dementia patients. "Zarit Caregiver Burden Scale" and "Healthy Life Style Behavior Scale" were used. The study was completed with 40 caregivers in total with 20 in the intervention group and 20 in the control group. A statistically significant difference was determined between the "Zarit Caregiving Burden Scale" and "Healthy Life Style Behavior Scale" score averages of the intervention group that participated in the "First You Should Get Stronger" program in comparison with those of the control group. It is important for the healths of caregivers to include similar programs for the caregivers of dementia patients in continuous and regular applications. The results highlight the importance of the "First You Should Get Stronger" program significantly decreased the caregiving burden and significantly developed the healthy lifestyle behaviors of caregivers in the intervention group. Since dementia is a difficult neurological syndrome with patients cared at home, it generally wears out the caregivers significantly. It is suggested that the nurses and healthcare professionals working with dementia patients are evaluated separately and that they carry out caregiving applications within the scope of the "First You Should Get Stronger" program. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Utilization of Boxes for Pesticide Storage in Sri Lanka

    DEFF Research Database (Denmark)

    Pieris, Ravi; Weerasinghe, Manjula; Abeywickrama, Tharaka

    2017-01-01

    Pesticide self-poisoning is now considered one of the two most common methods of suicide worldwide. Encouraging safe storage of pesticides is one particular approach aimed at reducing pesticide self-poisoning. CropLife Sri Lanka (the local association of pesticide manufacturers), with the aid...... of the Department of Agriculture, distributed lockable in-house pesticide storage boxes free of charge to a farming community in a rural district of Sri Lanka. Padlocks were not provided with the boxes. These storage boxes were distributed to the farmers without prior education. The authors carried out a cross...

  1. Optimal Black-Box Secret Sharing over Arbitrary Abelian Groups

    DEFF Research Database (Denmark)

    Cramer, Ronald; Fehr, Serge

    2002-01-01

    are defined over ℤ and are designed independently of the group G from which the secret and the shares are sampled. This means that perfect completeness and perfect privacy are guaranteed regardless of which group G is chosen. We define the black-box secret sharing problem as the problem of devising....... A recent example is secure general multi-party computation over black-box rings. In 1994 Desmedt and Frankel have proposed an elegant approach to the black-box secret sharing problem based in part on polynomial interpolation over cyclotomic number fields. For arbitrary given T t,n with 0

  2. Security of the AES with a Secret S-Box

    DEFF Research Database (Denmark)

    Tiessen, Tyge; Knudsen, Lars Ramkilde; Kölbl, Stefan

    2015-01-01

    How does the security of the AES change when the S-box is replaced by a secret S-box, about which the adversary has no knowledge? Would it be safe to reduce the number of encryption rounds? In this paper, we demonstrate attacks based on integral cryptanalysis which allow to recover both the secret...... key and the secret S-box for respectively four, five, and six rounds of the AES. Despite the significantly larger amount of secret information which an adversary needs to recover, the attacks are very efficient with time/data complexities of 217/216, 238/240 and 290/264, respectively. Another...

  3. Scattering phaseshift formulas for mesons and baryons in elongated boxes

    Science.gov (United States)

    Lee, Frank X.; Alexandru, Andrei

    2018-03-01

    We derive Lüscher phaseshift formulas for two-particle states in boxes elongated in one of the dimensions. Such boxes offer a cost-effective way of varying the relative momentum of the particles. Boosted states in the elongated direction, which allow wider access to energies, are also considered. The formulas for the various scenarios (moving and zero-momentum states in cubic and elongated boxes) are compared and relations between them are clarified. The results are applicable to a wide set of meson-meson and meson-baryon elastic scattering processes, with the two-particle system having equal or unequal masses.

  4. Visual pigments of the box jellyfish species Chiropsella bronzie

    DEFF Research Database (Denmark)

    O*Connor, Megan; Garm, Anders Lydik; Marshall, Justin

    2010-01-01

    Box jellyfish (Cubomedusae) possess a unique visual system comprising 24 eyes of four morphological types. Moreover, box jellyfish display several visually guided behaviours, including obstacle avoidance and light-shaft attractance. It is largely unknown what kind of visual information box jellyf...... results strongly indicate that only one type of visual pigment is present in the upper and lower lens eyes with a peak absorbance of approximately 510 nm. Additionally, the visual pigment appears to undergo bleaching, similar to that of vertebrate visual pigments....

  5. Two-electron atomic systems confined within spheroidal boxes

    Energy Technology Data Exchange (ETDEWEB)

    Corella-Madueno, A.; Rosas, R.A.; Marin, J.L.; Riera, R.

    2000-03-15

    The direct variational method is used to estimate some interesting physical properties of the He atom and the Li{sup +} ion confined within impenetrable spheroidal boxes. A comparative investigation f the ground=state energy, pressure, polarizability, dipole, and quadrupole moments with those of the He atom inside boxes with paraboloidal walls is made. The overall results show a similar qualitative behavior. However, for Li{sup +} there are quantitative differences on such properties due to its major nuclear charge, as expected. The trial wave function is constructed as a product of two hydrogenic wave functions adapted to the geometry of the confining boxes.

  6. Faster Black-Box Algorithms Through Higher Arity Operators

    DEFF Research Database (Denmark)

    Doerr, Benjamin; Johannsen, Daniel; Kötzing, Timo

    2011-01-01

    We extend the work of Lehre and Witt (GECCO 2010) on the unbiased black-box model by considering higher arity variation operators. In particular, we show that already for binary operators the black-box complexity of LeadingOnes drops from (n2) for unary operators to O(n log n). For OneMax, the (n...... log n) unary black-box complexity drops to O(n) in the binary case. For k-ary operators, k n, the OneMax-complexity further decreases to O(n= log k)....

  7. Deep Cuboid Detection: Beyond 2D Bounding Boxes

    OpenAIRE

    Dwibedi, Debidatta; Malisiewicz, Tomasz; Badrinarayanan, Vijay; Rabinovich, Andrew

    2016-01-01

    We present a Deep Cuboid Detector which takes a consumer-quality RGB image of a cluttered scene and localizes all 3D cuboids (box-like objects). Contrary to classical approaches which fit a 3D model from low-level cues like corners, edges, and vanishing points, we propose an end-to-end deep learning system to detect cuboids across many semantic categories (e.g., ovens, shipping boxes, and furniture). We localize cuboids with a 2D bounding box, and simultaneously localize the cuboid's corners,...

  8. Design of housing file box of fire academy based on RFID

    Science.gov (United States)

    Li, Huaiyi

    2018-04-01

    This paper presents a design scheme of intelligent file box based on RFID. The advantages of RFID file box and traditional file box are compared and analyzed, and the feasibility of RFID file box design is analyzed based on the actual situation of our university. After introducing the shape and structure design of the intelligent file box, the paper discusses the working process of the file box, and explains in detail the internal communication principle of the RFID file box and the realization of the control system. The application of the RFID based file box will greatly improve the efficiency of our school's archives management.

  9. The AirQuality SenseBox

    Science.gov (United States)

    Demuth, Dustin; Nuest, Daniel; Bröring, Arne; Pebesma, Edzer

    2013-04-01

    In the past year, a group of open hardware enthusiasts and citizen scientists had large success in the crowd-funding of an open hardware-based sensor platform for air quality monitoring, called the Air Quality Egg. Via the kickstarter platform, the group was able to collect triple the amount of money than needed to fulfill their goals. Data generated by the Air Quality Egg is pushed to the data logging platform cosm.com, which makes the devices a part of the Internet of Things. The project aims at increasing the participation of citizens in the collection of data, the development of sensors, the operation of sensor stations, and, as data on cosm is publicly available, the sharing, visualization and analysis of data. Air Quality Eggs can measure NO2 and CO concentrations, as well as relative humidity and temperature. The chosen sensors are low-cost and have limited precision and accurracy. The Air Quality Egg consists of a stationary outdoor and a stationary indoor unit. Each outdoor unit will wirelessly transmit air quality measurements to the indoor unit, which forwards the data to cosm. Most recent versions of the Air Quality Egg allow a rough calibration of the gas sensors and on-the-fly conversion from raw sensor readings (impedance) to meaningful air quality data expressed in units of parts per billion. Data generated by these low-cost platforms are not intended to replace well-calibrated official monitoring stations, but rather augment the density of the total monitoring network with citizen sensors. To improve the usability of the Air Quality Egg, we present a new and more advanced concept, called the AirQuality SenseBox. We made the outdoor platform more autonomous and location-aware by adding solarpanels and rechargeable batteries as a power source. The AirQuality SenseBox knows its own position from a GPS device attached to the platform. As a mobile sensor platform, it can for instance be attached to vehicles. A low-cost and low-power wireless chipset

  10. Activity of the upstream TATA-less promoter of the p21(Waf1/Cip1) gene depends on transcription factor IIA (TFIIA) in addition to TFIIA-reactive TBP-like protein.

    Science.gov (United States)

    Suzuki, Hidefumi; Maeda, Ryo; Nakadai, Tomoyoshi; Tamura, Taka-aki

    2014-07-01

    TATA-binding protein-like protein (TLP) binds to transcription factor IIA (TFIIA) with high affinity, although the significance of this binding is poorly understood. In this study, we investigated the role of TFIIA in transcriptional regulation of the p21(Waf1/Cip1) (p21) gene. It has been shown that TLP is indispensable for p53-activated transcription from an upstream TATA-less promoter of the p21 gene. We found that mutant TLPs having decreased TFIIA-binding ability exhibited weakened transcriptional activation function for the upstream promoter. Activity of the upstream promoter was enhanced considerably by an increased amount of TFIIA in a p53-dependent manner, whereas activity of the TATA-containing downstream promoter was enhanced only slightly. TFIIA potentiated the upstream promoter additively with TLP. Although TFIIA is recruited to both promoters, activity of the upstream promoter was much more dependent on TFIIA. Recruitment of TFIIA and TLP to the upstream promoter was augmented in etoposide-treated cells, in which the amount of TFIIA-TLP complex is increased, and TFIIA-reactive TLP was required for the recruitment of both factors. It was confirmed that etoposide-stimulated transcription depends on TLP. We also found that TFIIA-reactive TLP acts to decrease cell growth rate, which can be explained by interaction of the p21 promoter with the transcription factors that we examined. The results of the present study suggest that the upstream TATA-less promoter of p21 needs TFIIA and TFIIA-reactive TLP for p53-dependent transcriptional enhancement. © 2014 The Authors.FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

  11. Intercomparison of Chemical Multiphase Box Models

    Science.gov (United States)

    Ervens, B.; Barth, M. C.; Herrmann, H.; McNeill, V. F.; Carlton, A. G.; Lance, S.; Morichetti, M.; Tilgner, A.

    2017-12-01

    It has been recognized for several decades that chemical processes in clouds and fogs can substantially alter atmospheric oxidant budgets and lead to aerosol mass formation. However, many current regional and global models do not include detailed aqueous-phase chemical mechanisms due to the lack of complete understanding of the underlying chemical processes, but also due to the computational burden of adding more constituents. The cloud chemistry community has begun an effort in connection with the Whiteface Mountain Observatory in New York to sample a suite of chemical compounds in cloud water and to evaluate and compare the state of knowledge of current gas-aqueous chemistry 0-dimensional models. Using the 17-18 September 2016 cloud event at Whiteface Mountain Observatory for input data, a cloud chemistry box model intercomparison was conducted. The focus of the intercomparison was on the predicted oxidant levels in both the gas and aqueous phases and on the formation of sulfate and secondary organic aerosol mass via aqueous-phase chemistry. We will present model results from the model intercomparison participants and discuss commonalities and reasons for differences in predicted concentrations of various chemical species in both phases. The conclusions of this workshop include a ranking of the importance of chemical (e.g., number of chemical species and processes), microphysical (e.g., cloud parameters) and meteorological (e.g., vertical mixing) parameters. An outlook will be given with recommendations on the most suitable multiphase chemical mechanism and essential parameters that should be derived from field measurements in order to improve the current state of chemical multiphase modules in models of various scales.

  12. GREEN SUPERCOMPUTING IN A DESKTOP BOX

    Energy Technology Data Exchange (ETDEWEB)

    HSU, CHUNG-HSING [Los Alamos National Laboratory; FENG, WU-CHUN [NON LANL; CHING, AVERY [NON LANL

    2007-01-17

    The computer workstation, introduced by Sun Microsystems in 1982, was the tool of choice for scientists and engineers as an interactive computing environment for the development of scientific codes. However, by the mid-1990s, the performance of workstations began to lag behind high-end commodity PCs. This, coupled with the disappearance of BSD-based operating systems in workstations and the emergence of Linux as an open-source operating system for PCs, arguably led to the demise of the workstation as we knew it. Around the same time, computational scientists started to leverage PCs running Linux to create a commodity-based (Beowulf) cluster that provided dedicated computer cycles, i.e., supercomputing for the rest of us, as a cost-effective alternative to large supercomputers, i.e., supercomputing for the few. However, as the cluster movement has matured, with respect to cluster hardware and open-source software, these clusters have become much more like their large-scale supercomputing brethren - a shared (and power-hungry) datacenter resource that must reside in a machine-cooled room in order to operate properly. Consequently, the above observations, when coupled with the ever-increasing performance gap between the PC and cluster supercomputer, provide the motivation for a 'green' desktop supercomputer - a turnkey solution that provides an interactive and parallel computing environment with the approximate form factor of a Sun SPARCstation 1 'pizza box' workstation. In this paper, they present the hardware and software architecture of such a solution as well as its prowess as a developmental platform for parallel codes. In short, imagine a 12-node personal desktop supercomputer that achieves 14 Gflops on Linpack but sips only 185 watts of power at load, resulting in a performance-power ratio that is over 300% better than their reference SMP platform.

  13. Trial manufacture of portable type `WISH BOX`; Kahangata WISH BOX no shisaku kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    Ushiyama, I.; Sakuma, H.; Qin, W. [Ashikaga Institute of Technology, Tochigi (Japan); Onai, Y.

    1996-10-27

    This paper proposes the small portable type power source `WISH BOX` (wind and solar hybrid) composed of a small wind power generator and solar cell panels. Since solar radiation and wind power are complementary to each other in seasons, day and night, and fine and cloudy weather, WISH BOX is useful for standalone power source in non-power areas of developing countries, life spot in disasters, and outdoor leisure. The most small light-weight high-performance AIR303 produced by Southwest Windpower Co., USA is used as wind power generator, and two 50W solar cell panels HSC-5010-S produced by Daido Hokusan Co. is used. Sealed lead storage batteries (12V, 20Ah each) are also connected to cope with load fluctuation. In comparison with conventional portable gasoline engine generators, this environment-friendly generator is featured by fuel-free, no emission of gases, no noises and no fire occurrence, and can also supply stable power with small batteries even in the nighttime and cloudy weather by combining wind power. The generator of 400,000 yen is now in field experiment. 2 refs., 5 figs.

  14. Earthquake resistance test of full-scale glove box

    International Nuclear Information System (INIS)

    Fujita, T.; Ohtani, K.; Hayashi, M.; Kozeki, M.; Ide, T.; Sakuno, K.

    1989-01-01

    A glove box used at nuclear facilities must confine radioactive materials. High airtightness and negative internal pressure are used to prevent leaks. The allowable leakage rate of air is 0.1% vol/hr or less at the pre-service inspection. The negative pressure value is kept at - 30 mm H 2 O in normal operation. The glove box structural strength and its confinement reliability during an earthquake are major concerns. The verification of aseismic analysis methods and assumptions for a glove box are thus of great importance. Data on the dynamic behavior of giant glove boxes was recently obtained in large shaker experiments. This paper describes these experimental results and the appropriateness of aseismic analysis methods used in current design

  15. Injury and injury rates in Muay Thai kick boxing

    OpenAIRE

    Gartland, S; Malik, M; Lovell, M

    2001-01-01

    Objective—To determine the type and number of injuries that occur during the training and practice of Muay Thai kick boxing and to compare the data obtained with those from previous studies of karate and taekwondo.

  16. EPA EcoBox Tools by Stressors - Biological

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  17. Design and development of a freezer and chiller delivery box

    Science.gov (United States)

    Zakaria, Mohd Zakimi; Hung, Goh Chung; Dawi, Mohd Syedi Imran Mohd; Hussin, Radhwan; Khalil, Ahmad Nabil Mohd; Naim, Muhammad Khairy Md; Hilmi, Ahmad Humaizi

    2017-09-01

    This paper presents an action research of designed and fabricated using well insulating materials in order to ensure the coolness inside the freezer and chiller delivery box is as good minimize temperature raised. The main purpose of this study is to develop freeze and chiller delivery box that will be able to keep fresh meat during travelling long delivery. A range of freeze and chill solutions exists for that must be kept within a specific temperature range throughout the supply-and-distribution chain. This will help to minimize the activeness of bacteria to spoil the meats, at the same time it can linger the duration for meats to spoil. All affecting parameter such as temperature inside the delivery box, heat transfer rate, and natural convection flow pattern has been studied to design and development of the delivery box. Finally, temperature distribution analysis has been conducted which showed that in operating condition inside temperature are suitable to keep the fresh meats condition.

  18. EPA EcoBox Tools by Effects - Aquatic

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  19. Confirmation test on confinement performance of improved glove box

    International Nuclear Information System (INIS)

    Miura, S.; Kanazawa, J.; Nakajima, M.; Sakuno, K.; Miyata, H.

    1995-01-01

    Glove boxes are used at nuclear facilities to confine radioactive materials by ensuring a high level of airtightness and negative internal pressure. The allowable rate of air leakage is 0.1% vol/hr or less at the pre-service inspection. The negative pressure value is normally maintained at about -30 mm H 2 O. Structural strength and confinement reliability of glove boxes during earthquake are major concerns, and most important glove boxes are designed to withstand seismic class A events is Japan. This paper describes vibration tests done to confirm that improve large-sized glove boxes maintain their confinement performance and structural strength even during earthquake and that the design analysis methods used are appropriate. (author). 1 ref., 6 figs., 3 tabs

  20. Cryogenic distribution box for Fermi National Accelerator Laboratory

    Science.gov (United States)

    Svehla, M. R.; Bonnema, E. C.; Cunningham, E. K.

    2017-12-01

    Meyer Tool & Mfg., Inc (Meyer Tool) of Oak Lawn, Illinois is manufacturing a cryogenic distribution box for Fermi National Accelerator Laboratory (FNAL). The distribution box will be used for the Muon-to-electron conversion (Mu2e) experiment. The box includes twenty-seven cryogenic valves, two heat exchangers, a thermal shield, and an internal nitrogen separator vessel, all contained within a six-foot diameter ASME coded vacuum vessel. This paper discusses the design and manufacturing processes that were implemented to meet the unique fabrication requirements of this distribution box. Design and manufacturing features discussed include: 1) Thermal strap design and fabrication, 2) Evolution of piping connections to heat exchangers, 3) Nitrogen phase separator design, 4) ASME code design of vacuum vessel, and 5) Cryogenic valve installation.

  1. Experts’ Misinterpretation of Box Plots – a Dual Processing Approach

    Directory of Open Access Journals (Sweden)

    Stephanie Lem

    2014-11-01

    Full Text Available Recent studies have shown that students often misinterpret the area of the box in box plots as representing the frequency or proportion of observations in that interval, while it actually represents density. This misinterpretation has been shown to be based on the saliency of this area and can be explained by heuristic reasoning as defined by dual process theories. In this study we tested whether expert users of box plots also display this misinterpretation and show signs of the same heuristic reasoning as found in students. Using a reaction time test, we found signs of heuristic reasoning in experts, both with respect to accuracy and reaction times. If even experts have difficulty interpreting box plots, one can question whether these are an appropriate form of representation to use when reporting data and deserve the prominent place they currently have in the statistics curriculum.

  2. Fusion welded fabrication of unshielded steel glove boxes

    International Nuclear Information System (INIS)

    1981-04-01

    This Specification deals with the manufacture, testing, inspection and delivery of fabricated glove boxes, including such internal and/or external fittings as are shown on the relevant drawings. (author)

  3. Radiotheraphy of tumors of osseus box of encephalos

    International Nuclear Information System (INIS)

    Cintra e Oliveira, V.; Morales, F.C.

    1984-01-01

    A revision of malignant pathology involving the osseous box of encephalos (and base of skull), their peculiarities, histological patterns and used treatment plans are made. The frequency of pathology and the clinical behaviour are showed. (Author) [pt

  4. Box photosynthesis modeling results for WRF/CMAQ LSM

    Data.gov (United States)

    U.S. Environmental Protection Agency — Box Photosynthesis model simulations for latent heat and ozone at 6 different FLUXNET sites. This dataset is associated with the following publication: Ran, L., J....

  5. EPA EcoBox Tools by Stressors - Physical

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  6. EPA EcoBox Tools by Exposure Pathways

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  7. EPA EcoBox Tools by Exposure Pathways - Air

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  8. EPA EcoBox Tools by Exposure Pathways - Soil

    Science.gov (United States)

    Eco-Box is a toolbox for exposure assessors. Its purpose is to provide a compendium of exposure assessment and risk characterization tools that will present comprehensive step-by-step guidance and links to relevant exposure assessment data bases

  9. Cistern and planter box monitoring in Camden, NJ revisited

    Science.gov (United States)

    The Camden County Municipal Utilities Authority installed green infrastructure Stormwater Control Measures at multiple locations around the city of Camden, NJ. The Stormwater Control Measures include raised downspout planter boxes and cisterns. EPA is monitoring a subset of the ...

  10. Design, analysis, and fabrication of the technology integration box beam

    Science.gov (United States)

    Griffin, C. F.; Meade, L. E.

    1991-01-01

    Numerous design concepts, materials, and manufacturing methods were investigated analytically and empirically for the covers and spars of a transport wing box. This information was applied to the design, analysis, and fabrication of a full-scale section of a transport wing box. A blade-stiffened design was selected for the upper and lower covers of the box. These covers have been constructed using three styles of AS4/974 prepreg fabrics. The front and rear T-stiffened channel spars were filament wound using AS4/1806 towpreg. Covers, ribs, and spars were assembled using mechanical fasteners. When they are completed later this year, the tests on the technology integration box beam will demonstrate the structural integrity of an advanced composite wing design which is 25 percent lighter than the metal baseline.

  11. Molecular cloning and characterization of an F-box family gene CarF-box1 from chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Jia, Yuying; Gu, Hanyan; Wang, Xiansheng; Chen, Quanjia; Shi, Shubing; Zhang, Jusong; Ma, Lin; Zhang, Hua; Ma, Hao

    2012-03-01

    F-box protein family has been found to play important roles in plant development and abiotic stress responses via the ubiquitin pathway. In this study, an F-box gene CarF-box1 (for Cicer arietinum F-box gene 1, Genbank accession no. GU247510) was isolated based on a cDNA library constructed with chickpea seedling leaves treated by polyethylene glycol. CarF-box1 encoded a putative protein with 345 amino acids and contained no intron within genomic DNA sequence. CarF-box1 is a KFB-type F-box protein, having a conserved F-box domain in the N-terminus and a Kelch repeat domain in the C-terminus. CarF-box1 was localized in the nucleus. CarF-box1 exhibited organ-specific expression and showed different expression patterns during seed development and germination processes, especially strongly expressed in the blooming flowers. In the leaves, CarF-box1 could be significantly induced by drought stress and slightly induced by IAA treatment, while in the roots, CarF-box1 could be strongly induced by drought, salinity and methyl jasmonate stresses. Our results suggest that CarF-box1 encodes an F-box protein and may be involved in various plant developmental processes and abiotic stress responses.

  12. Function and Diversification of MADS-Box Genes in Rice

    OpenAIRE

    Takahiro Yamaguchi; Hiro-Yuki Hirano

    2006-01-01

    MADS-box genes play critical roles in a number of developmental processes in flowering plants, such as specification of floral organ identity, control of flowering time, and regulation of fruit development. Because of their crucial functions in flower development, diversification of the MADS-box gene family has been suggested to be a major factor responsible for floral diversity during radiation of the flowering plants. Inflorescences and flowers in the grass species have unique structures th...

  13. Safety evaluation for packaging (onsite) depleted uranium waste boxes

    Energy Technology Data Exchange (ETDEWEB)

    McCormick, W.A.

    1997-08-27

    This safety evaluation for packaging (SEP) allows the one-time shipment of ten metal boxes and one wooden box containing depleted uranium material from the Fast Flux Test Facility to the burial grounds in the 200 West Area for disposal. This SEP provides the analyses and operational controls necessary to demonstrate that the shipment will be safe for the onsite worker and the public.

  14. Safety evaluation for packaging (onsite) depleted uranium waste boxes

    International Nuclear Information System (INIS)

    McCormick, W.A.

    1997-01-01

    This safety evaluation for packaging (SEP) allows the one-time shipment of ten metal boxes and one wooden box containing depleted uranium material from the Fast Flux Test Facility to the burial grounds in the 200 West Area for disposal. This SEP provides the analyses and operational controls necessary to demonstrate that the shipment will be safe for the onsite worker and the public

  15. Accounting for latent classes in movie box office modeling

    OpenAIRE

    Antipov, Evgeny; Pokryshevskaya, Elena

    2010-01-01

    This paper addresses the issue of unobserved heterogeneity in film characteristics influence on box-office. We argue that the analysis of pooled samples, most common among researchers, does not shed light on underlying segmentations and leads to significantly different estimates obtained by researchers running similar regressions for movie success modeling. For instance, it may be expected that a restrictive MPAA rating is a box office poison for a family comedy, while it insignificantly infl...

  16. The determinants of Polish movies’ box office performance in Poland

    OpenAIRE

    Natalia Gmerek

    2015-01-01

    This paper provides an empirical analysis of financial performance of movies produced in Poland between 2000 and 2011. To understand the reason for a motion picture’s success in the theatrical channel various factors concerning total domestic box office performance were regressed from the box office results of 207 movies. This study proposes that the success of a movie can be determined by three elements: product attributes, distribution-related variables and information sources. The results ...

  17. Dynamics underlying Box-office: Movie Competition on Recommender Systems

    OpenAIRE

    Yeung, C. H.; Cimini, G.; Jin, C. -H.

    2010-01-01

    We introduce a simple model to study movie competition in the recommender systems. Movies of heterogeneous quality compete against each other through viewers' reviews and generate interesting dynamics of box-office. By assuming mean-field interactions between the competing movies, we show that run-away effect of popularity spreading is triggered by defeating the average review score, leading to hits in box-office. The average review score thus characterizes the critical movie quality necessar...

  18. Boxing training for patients with Parkinson disease: a case series.

    Science.gov (United States)

    Combs, Stephanie A; Diehl, M Dyer; Staples, William H; Conn, Lindsay; Davis, Kendra; Lewis, Nicole; Schaneman, Katie

    2011-01-01

    A nontraditional form of exercise recently applied for patients with Parkinson disease (PD) is boxing training. The primary purpose of this case series is to describe the effects of disease severity and duration of boxing training (short term and long term) on changes in balance, mobility, and quality of life for patients with mild or moderate to severe PD. The feasibility and safety of the boxing training program also were assessed. Six patients with idiopathic PD attended 24 to 36 boxing training sessions for 12 weeks, with the option of continuing the training for an additional 24 weeks (a seventh patient attended sessions for only 4 weeks). The 90-minute sessions included boxing drills and traditional stretching, strengthening, and endurance exercises. Outcomes were tested at the baseline and after 12, 24, and 36 weeks of boxing sessions (12-, 24-, and 36-week tests). The outcome measures were the Functional Reach Test, Berg Balance Scale, Activities-specific Balance Confidence Scale, Timed "Up & Go" Test, Six-Minute Walk Test, gait speed, cadence, stride length, step width, activities of daily living and motor examination subscales of the Unified Parkinson Disease Rating Scale, and Parkinson Disease Quality of Life Scale. Six patients completed all phases of the case series, showed improvements on at least 5 of the 12 outcome measures over the baseline at the 12-week test, and showed continued improvements at the 24- and 36-week tests. Patients with mild PD typically showed improvements earlier than those with moderate to severe PD. Despite the progressive nature of PD, the patients in this case series showed short-term and long-term improvements in balance, gait, activities of daily living, and quality of life after the boxing training program. A longer duration of training was necessary for patients with moderate to severe PD to show maximal training outcomes. The boxing training program was feasible and safe for these patients with PD.

  19. Gray-box modelling approach for description of storage tunnel

    DEFF Research Database (Denmark)

    Harremoës, Poul; Carstensen, Jacob

    1999-01-01

    The dynamics of a storage tunnel is examined using a model based on on-line measured data and a combination of simple deterministic and black-box stochastic elements. This approach, called gray-box modeling, is a new promising methodology for giving an on-line state description of sewer systems. ...... in a SCADA system because the most important information on the specific system is provided on-line...

  20. Gold sales forecasting: The Box-Jenkins methodology

    OpenAIRE

    Johannes Tshepiso Tsoku; Nonofo Phukuntsi; Daniel Metsileng

    2017-01-01

    The study employs the Box-Jenkins Methodology to forecast South African gold sales. For a resource economy like South Africa where metals and minerals account for a high proportion of GDP and export earnings, the decline in gold sales is very disturbing. Box-Jenkins time series technique was used to perform time series analysis of monthly gold sales for the period January 2000 to June 2013 with the following steps: model identification, model estimation, diagnostic checking and forecasting. F...

  1. Obesity-related known and candidate SNP markers can significantly change affinity of TATA-binding protein for human gene promoters.

    Science.gov (United States)

    Arkova, Olga V; Ponomarenko, Mikhail P; Rasskazov, Dmitry A; Drachkova, Irina A; Arshinova, Tatjana V; Ponomarenko, Petr M; Savinkova, Ludmila K; Kolchanov, Nikolay A

    2015-01-01

    Obesity affects quality of life and life expectancy and is associated with cardiovascular disorders, cancer, diabetes, reproductive disorders in women, prostate diseases in men, and congenital anomalies in children. The use of single nucleotide polymorphism (SNP) markers of diseases and drug responses (i.e., significant differences of personal genomes of patients from the reference human genome) can help physicians to improve treatment. Clinical research can validate SNP markers via genotyping of patients and demonstration that SNP alleles are significantly more frequent in patients than in healthy people. The search for biomedical SNP markers of interest can be accelerated by computer-based analysis of hundreds of millions of SNPs in the 1000 Genomes project because of selection of the most meaningful candidate SNP markers and elimination of neutral SNPs. We cross-validated the output of two computer-based methods: DNA sequence analysis using Web service SNP_TATA_Comparator and keyword search for articles on comorbidities of obesity. Near the sites binding to TATA-binding protein (TBP) in human gene promoters, we found 22 obesity-related candidate SNP markers, including rs10895068 (male breast cancer in obesity); rs35036378 (reduced risk of obesity after ovariectomy); rs201739205 (reduced risk of obesity-related cancers due to weight loss by diet/exercise in obese postmenopausal women); rs183433761 (obesity resistance during a high-fat diet); rs367732974 and rs549591993 (both: cardiovascular complications in obese patients with type 2 diabetes mellitus); rs200487063 and rs34104384 (both: obesity-caused hypertension); rs35518301, rs72661131, and rs562962093 (all: obesity); and rs397509430, rs33980857, rs34598529, rs33931746, rs33981098, rs34500389, rs63750953, rs281864525, rs35518301, and rs34166473 (all: chronic inflammation in comorbidities of obesity). Using an electrophoretic mobility shift assay under nonequilibrium conditions, we empirically validated the

  2. Striking dynamics and kinetic properties of boxing and MMA gloves

    Directory of Open Access Journals (Sweden)

    Benjamin Lee

    2014-08-01

    Full Text Available With the growing popularity of Mixed Martial Arts (MMA as a competitive sport, questions regarding the dynamic response and properties of MMA gloves arise. High-energy impacts from punches are very similar to boxing yet MMA competition requires the use of 4 oz fingerless glove, compared to the larger full enclosure boxing glove. This work assessed the kinetic properties and strike dynamics of MMA gloves and compared findings with traditional boxing gloves. Gloves mounted on a molded fist were impacted repetitively on an instrumental anvil designed for impact, over a 5 hour period resulting in 10,000 continuous and consistent strikes. Kinetic data from impacts were sampled at the beginning of the data collection and subsequently every 30 minutes (every 1,000 strikes. MMA gloves produced 4-5 times greater peak force and 5 times faster load rate compared to the boxing glove. However, MMA gloves also showed signs of material fatigue, with peak force increasing by 35% and rate of loading increasing by 60% over the duration of the test. Boxing glove characteristics did deteriorate but to a lesser extent. In summary, the kinetic properties of MMA glove differed substantially from the boxing glove resulting in impacts characterized by higher peak forces and more rapid development of force. Material properties including stiffness and thickness play a role in the kinetic characteristics upon impact, and can be inferred to alter injury mechanisms of blunt force trauma.

  3. Unconventional Bearing Capacity Analysis and Optimization of Multicell Box Girders

    Directory of Open Access Journals (Sweden)

    Jovan Tepic

    2014-01-01

    Full Text Available This study deals with unconventional bearing capacity analysis and the procedure of optimizing a two-cell box girder. The generalized model which enables the local stress-strain analysis of multicell girders was developed based on the principle of cross-sectional decomposition. The applied methodology is verified using the experimental data (Djelosevic et al., 2012 for traditionally formed box girders. The qualitative and quantitative evaluation of results obtained for the two-cell box girder is realized based on comparative analysis using the finite element method (FEM and the ANSYS v12 software. The deflection function obtained by analytical and numerical methods was found consistent provided that the maximum deviation does not exceed 4%. Multicell box girders are rationally designed support structures characterized by much lower susceptibility of their cross-sectional elements to buckling and higher specific capacity than traditionally formed box girders. The developed local stress model is applied for optimizing the cross section of a two-cell box carrier. The author points to the advantages of implementing the model of local stresses in the optimization process and concludes that the technological reserve of bearing capacity amounts to 20% at the same girder weight and constant load conditions.

  4. Construction of dry-boxes for plutonium metallurgy

    International Nuclear Information System (INIS)

    Grison, E.; Pascard, R.

    1958-01-01

    The dry-boxes used at Chatillon are of two main types: a) boxes with a metal frame work of welded angle-pieces, panels of plexiglass, bakelite, duralumin, etc... They include a standard panel which enables them to be connected up to the contaminated repairs workshop; b) boxes made entirely of welded plastic. The working face only is of plexiglas held by screw clamps to a pure rubber joint. These boxes, which cannot be connected to the contaminated workshop, are generally reserved for small pieces of chemical apparatus. None has yet been used for working under argon, although their airtightness is excellent. After an interval of several hours, in fact, no decrease in the pressure inside the box can be detected. Several means can be adopted to ensure that the joints between panels and mountings are absolutely air-tight. Up to the present we are using three types of box with metal framework at the same time, without being able to make a definitive choice. (author) [fr

  5. Closure of an analytical chemistry glove box in alpha laboratory

    International Nuclear Information System (INIS)

    Adelfang, P.; Aparicio, G.; Cassaniti, P.

    1990-01-01

    The works with plutonium are performed in gloves box, operated below atmospheric pressure, to protect the experimenters from this alpha-active material. After 12 years of continual processes, it was necessary the decommissioning of the chemistry glove box in our alpha-laboratory. A great deal of our attention was devoted to the working techniques because of extreme care needed to avoid activity release. The decommissioning includes the following main operations: a) Planning and documentation for the regulatory authority. b) Internal decontamination with surface cleaning and chelating agents. c) Measurement of the remainder internal radioactivity. d) Sealing of the glove ports and nozzles. e) Disconnection of the glove box from the exhaust duct. f) Design and construction of a container for the glove box. g) Transportation of the glove box from alpha-laboratory, to a transitory storage until its final disposal. The above mentioned operations are described in this paper including too: data of personal doses during the operations, characteristics and volumes of radioactive wastes and a description of the instrument used for the measurement of inside glove box activity. (Author) [es

  6. Box Office Forecasting considering Competitive Environment and Word-of-Mouth in Social Networks: A Case Study of Korean Film Market.

    Science.gov (United States)

    Kim, Taegu; Hong, Jungsik; Kang, Pilsung

    2017-01-01

    Accurate box office forecasting models are developed by considering competition and word-of-mouth (WOM) effects in addition to screening-related information. Nationality, genre, ratings, and distributors of motion pictures running concurrently with the target motion picture are used to describe the competition, whereas the numbers of informative, positive, and negative mentions posted on social network services (SNS) are used to gauge the atmosphere spread by WOM. Among these candidate variables, only significant variables are selected by genetic algorithm (GA), based on which machine learning algorithms are trained to build forecasting models. The forecasts are combined to improve forecasting performance. Experimental results on the Korean film market show that the forecasting accuracy in early screening periods can be significantly improved by considering competition. In addition, WOM has a stronger influence on total box office forecasting. Considering both competition and WOM improves forecasting performance to a larger extent than when only one of them is considered.

  7. Principal Investigator-in-a-Box

    Science.gov (United States)

    Young, Laurence R.

    1999-01-01

    Human performance in orbit is currently limited by several factors beyond the intrinsic awkwardness of motor control in weightlessness. Cognitive functioning can be affected by such factors as cumulative sleep loss, stress and the psychological effects of long-duration small-group isolation. When an astronaut operates a scientific experiment, the performance decrement associated with such factors can lead to lost or poor quality data and even the total loss of a scientific objective, at great cost to the sponsors and to the dismay of the Principal Investigator. In long-duration flights, as anticipated on the International Space Station and on any planetary exploration, the experimental model is further complicated by long delays between training and experiment, and the large number of experiments each crew member must perform. Although no documented studies have been published on the subject, astronauts report that an unusually large number of simple errors are made in space. Whether a result of the effects of microgravity, accumulated fatigue, stress or other factors, this pattern of increased error supports the need for a computerized decision-making aid for astronauts performing experiments. Artificial intelligence and expert systems might serve as powerful tools for assisting experiments in space. Those conducting space experiments typically need assistance exactly when the planned checklist does not apply. Expert systems, which use bits of human knowledge and human methods to respond appropriately to unusual situations, have a flexibility that is highly desirable in circumstances where an invariably predictable course of action/response does not exist. Frequently the human expert on the ground is unavailable, lacking the latest information, or not consulted by the astronaut conducting the experiment. In response to these issues, we have developed "Principal Investigator-in-a-Box," or [PI], to capture the reasoning process of the real expert, the Principal

  8. Meal box schemes a convenient way to avoid convenience food? Uses and understandings of meal box schemes among Danish consumers.

    Science.gov (United States)

    Hertz, Frej Daniel; Halkier, Bente

    2017-07-01

    The term convenience food is subject to diversification, lack of clarity and moral ambiguity. In this paper we address these issues and critically discuss convenience food by using empirical findings from a Danish study that deals with practitioners' uses of meal box schemes. The methodological design consists of thirteen individual interviews, four focus groups and some observations of cooking practices. We combine the empirical findings with a particular definition of convenience food by Brunner et al. (2010) and selected practice theoretical concepts. This particular combination enables us to categorize meal box schemes as a new form of convenience food called convenient food. In addition, results suggest that meal box schemes reduce leftovers from dinner. Meal boxes also influence dinner related activities such as planning ahead in time and grocery shopping, which require less physical and mental effort. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Comparative Human and Automatic Evaluation of Glass-Box and Black-Box Approaches to Interactive Translation Prediction

    Directory of Open Access Journals (Sweden)

    Torregrosa Daniel

    2017-06-01

    Full Text Available Interactive translation prediction (ITP is a modality of computer-aided translation that assists professional translators by offering context-based computer-generated continuation suggestions as they type. While most state-of-the-art ITP systems follow a glass-box approach, meaning that they are tightly coupled to an adapted machine translation system, a black-box approach which does not need access to the inner workings of the bilingual resources used to generate the suggestions has been recently proposed in the literature: this new approach allows new sources of bilingual information to be included almost seamlessly. In this paper, we compare for the first time the glass-box and the black-box approaches by means of an automatic evaluation of translation tasks between related languages such as English–Spanish and unrelated ones such as Arabic–English and English–Chinese, showing that, with our setup, 20%–50% of keystrokes could be saved using either method and that the black-box approach outperformed the glass-box one in five out of six scenarios operating under similar conditions. We also performed a preliminary human evaluation of English to Spanish translation for both approaches. On average, the evaluators saved 10% keystrokes and were 4% faster with the black-box approach, and saved 15% keystrokes and were 12% slower with the glass-box one; but they could have saved 51% and 69% keystrokes respectively if they had used all the compatible suggestions. Users felt the suggestions helped them to translate faster and easier. All the tools used to perform the evaluation are available as free/open–source software.

  10. Influence of dimension box differences and time differences during operations of red box for motorcycles at signalized intersection

    Science.gov (United States)

    Mulyadi, Agah Muhammad

    2017-11-01

    Performance of signalized intersection has declined due to a large number of motorcycles. The number of motorcycles reached 98.2 million units and the composition of motorcycles has reached around 81.7% of the total composition of vehicles in Indonesia (AISI, 2017). To solve that problem, the red box for motorcycles are provided at the signalized intersection. Red box for the motorcycle at signalized intersections was developed from the concept of Advance Stop Line (ASL) for bicycles. The Red Box was developed to split the queue between motorcycles and other vehicles when waiting at red light. This paper aims to evaluate the influence of the red box dimension and red time operation differences. The survey was conducted as many as 30 cycles of traffic signals per day. The data were analyzed using software IBM SPSS Statistics 20 by using Analysis of Variance (ANOVA) to obtain p-value (significant). The analysis shows that there are insignificant influences between the occupancy rates to the dimension of Red Box. Furthermore, that there is a significant difference that shows the dependency of only motorcycles in the Red Box Area towards red time operation.

  11. 76 FR 54931 - Post Office (PO) Box Fee Groups for Merged Locations

    Science.gov (United States)

    2011-09-06

    ... 111 Post Office (PO) Box Fee Groups for Merged Locations AGENCY: Postal Service TM . ACTION: Final..., Domestic Mail Manual (DMM ) 508.4 to allow Post Office Box TM (PO Box TM ) fee groups to be merged due to... lower, and only once per calendar year. Absent this change, where a box section is merged with a...

  12. Analysis of polyglutamine-coding repeats in the TATA-binding protein in different human populations and in patients with schizophrenia an bipolar affective disorder

    Energy Technology Data Exchange (ETDEWEB)

    Rubinsztein, D.C.; Leggo, J. [Addenbrooke`s National Health Service Trust, Cambridge (United Kingdom); Crow, T.J. [Cambridge Univ. (United Kingdom)] [and others

    1996-09-20

    A new class of disease (including Huntington disease, Kennedy disease, and spinocerebellar ataxias types 1 and 3) results from abnormal expansions of CAG trinucleotides in the coding regions of genes. In all of these diseases the CAG repeats are thought to be translated into polyglutamine tracts. There is accumulating evidence arguing for CAG trinucleotide expansions as one of the causative disease mutations in schizophrenia and bipolar affective disorder. We and others believe that the TATA-binding protein (TBP) is an important candidate to investigate in these diseases as it contains a highly polymorphic stretch of glutamine codons, which are close to the threshold length where the polyglutamine tracts start to be associated with disease. Thus, we examined the lengths of this polyglutamine repeat in normal unrelated East Anglians, South African Blacks, sub-Saharan Africans mainly from Nigeria, and Asian Indians. We also examined 43 bipolar affective disorder patients and 65 schizophrenic patients. The range of polyglutamine tract-lengths that we found in humans was from 26-42 codons. No patients with bipolar affective disorder and schizophrenia had abnormal expansions at this locus. 22 refs., 1 tab.

  13. Cloning, expression, and characterization of the TATA-binding protein (TBP) promoter binding factor, a transcription activator of the Acanthamoeba TBP gene.

    Science.gov (United States)

    Huang, W; Bateman, E

    1995-12-01

    TATA-binding protein (TBP) gene promoter binding factor (TPBF) is a transactivator which binds to the TBP promoter element (TPE) sequence of the Acanthamoeba TBP gene promoter and stimulates transcription in vitro. We have isolated a cDNA clone encoding TPBF. TPBF is a polypeptide of 327 amino acids with a calculated molecular mass of 37 kDa. The predicted amino acid sequence of TPBF shows no significant homology to other proteins. TPBF has two potential coiled-coil regions, a basic region, a proline-rich region, a histidine-rich N terminus, and a nuclear targeting sequence. The recombinant protein has an apparent molecular mass of 50 kDa, identical with that of TPBF purified from Acanthamoeba. Recombinant TPBF is able to bind DNA and activate transcription with the same specificity as natural Acanthamoeba TPBF, demonstrating the authenticity of the clone. Mobility shift assays of co-translated TPBF polypeptides and chemical cross-linking demonstrate that TPBF is tetrameric in solution and when bound to DNA. Analyses of TPBF mutants show that Coiled-coil II is essential for DNA binding, but Coiled-coil I and the basic region are also involved. TPBF is thus a novel DNA-binding protein with functional similarity to the tumor suppressor protein p53.

  14. Regulation of anti-sense transcription by Mot1p and NC2 via removal of TATA-binding protein (TBP) from the 3'-end of genes.

    Science.gov (United States)

    Koster, Maria J E; Timmers, H Th Marc

    2015-01-01

    The activity and dynamic nature of TATA-binding protein (TBP) crucial to RNA polymerase II-mediated transcription is under control of the Mot1p and NC2 complexes. Here we show that both TBP regulatory factors play 'hidden' roles in ensuring transcription fidelity by restricting anti-sense non-coding RNA (ncRNA) synthesis. Production of anti-sense ncRNA transcripts is suppressed by Mot1p- and NC2-mediated release of TBP from binding sites at the 3'-end of genes. In this, Mot1p and NC2 collaborate with the Nrd1p-Nab3p-Sen1p (NNS) complex that terminates the synthesis of anti-sense ncRNAs. In several cases anti-sense ncRNA expression interferes with expression of the cognate sense transcript. Our data reveal a novel regulatory mechanism to suppress anti-sense ncRNA expression and pre-initiation complex (PIC) formation at spurious sites. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eukaryotes

    Science.gov (United States)

    Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1994-01-01

    The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.

  16. Boxing participation by children and adolescents: A joint statement with the American Academy of Pediatrics

    OpenAIRE

    Purcell, Laura K; LeBlanc, Claire MA

    2012-01-01

    Thousands of boys and girls younger than 19 years of age participate in boxing in North America. Although boxing provides benefits for participants, including exercise, self-discipline and self-confidence, the sport of boxing encourages and rewards deliberate blows to the head and face. Participants in boxing are at risk of head, face and neck injuries, including chronic and even fatal neurological injuries. Concussions are one of the most common injuries occurring in boxing. Because of the r...

  17. Computational Fluid Dynamics Analysis of Flexible Duct Junction Box Design

    Energy Technology Data Exchange (ETDEWEB)

    Beach, Robert [IBACOS Inc., Pittsburgh, PA (United States); Prahl, Duncan [IBACOS Inc., Pittsburgh, PA (United States); Lange, Rich [IBACOS Inc., Pittsburgh, PA (United States)

    2013-12-01

    IBACOS explored the relationships between pressure and physical configurations of flexible duct junction boxes by using computational fluid dynamics (CFD) simulations to predict individual box parameters and total system pressure, thereby ensuring improved HVAC performance. Current Air Conditioning Contractors of America (ACCA) guidance (Group 11, Appendix 3, ACCA Manual D, Rutkowski 2009) allows for unconstrained variation in the number of takeoffs, box sizes, and takeoff locations. The only variables currently used in selecting an equivalent length (EL) are velocity of air in the duct and friction rate, given the first takeoff is located at least twice its diameter away from the inlet. This condition does not account for other factors impacting pressure loss across these types of fittings. For each simulation, the IBACOS team converted pressure loss within a box to an EL to compare variation in ACCA Manual D guidance to the simulated variation. IBACOS chose cases to represent flows reasonably correlating to flows typically encountered in the field and analyzed differences in total pressure due to increases in number and location of takeoffs, box dimensions, and velocity of air, and whether an entrance fitting is included. The team also calculated additional balancing losses for all cases due to discrepancies between intended outlet flows and natural flow splits created by the fitting. In certain asymmetrical cases, the balancing losses were significantly higher than symmetrical cases where the natural splits were close to the targets. Thus, IBACOS has shown additional design constraints that can ensure better system performance.

  18. Evaluation for rigidity of box construction of nuclear reactor building

    International Nuclear Information System (INIS)

    Yamakawa, Tetsuo

    1979-01-01

    A huge box-shaped structure (hereafter, called box construction) of reinforced concrete is presently utilized as the reactor building structure in nuclear power plants. Evaluation of the rigidity of the huge box construction is required for making a vibration analysis model of nuclear reactor buildings. It is necessary to handle the box construction as the plates to which the force in plane is applied. This paper describes that the bending theory in elementary beam theory is equivalent to a peculiar, orthogonally anisotropic plate, the shearing rigidity and film rigidity in y direction of which are put to infinity and the Poisson's ratio is put to zero, viewed from the two-dimensional theory of elasticity. The form factor of 1.2 for shearing deformation in rectangular cross section was calculated from the parabolic distribution of shearing stress intensity, and it is the maximum value. The factor is equal to 1.2 for slender beams, but smaller than 1.2 for short and thick beams, having tendency to converge to 1.0. The non-conformity of boundary conditions regarding the shearing force at the both ends of cantilevers does not affect very seriously the evaluation of shearing rigidity. From the above results, it was found that the application of the theory to the box construction was able to give the rigidity evaluation with sufficient engineering accuracy. The theory can also be applied to the evaluation of tube type ultrahigh buildings. (Wakatsuki, Y.)

  19. Integrated Box Interrogation System (IBIS) Preliminary Design Study

    Energy Technology Data Exchange (ETDEWEB)

    DR. Stephen Croft; Mr. David Martancik; Dr. Brian Young; Dr. Patrick MJ Chard; Dr. Robert J Estop; Sheila Melton; Gaetano J. Arnone

    2003-01-13

    Canberra Industries has won the tendered solicitation, INEEL/EST-99-00121 for boxed waste Nondestructive Assay Development and Demonstration. Canberra will provide the Integrated Box Interrogation System (IBIS) which is a suite of assay instrumentation and a data reduction system that addresses the measurement needs for Boxed Wastes identified in the solicitation and facilitates the associated experimental program and demonstration of system capability. The IBIS system will consist of the next generation CWAM system, i.e. CWAM II, which is a Scanning Passive/Active Neutron interrogation system which we will call a Box Segmented Neutron Scanner (BSNS), combined with a physically separate Box Segmented Gamma-ray Scanning (BSGS) system. These systems are based on existing hardware designs but will be tailored to the large sample size and enhanced to allow the program to evaluate the following measurement criteria:Characterization and correction for matrix heterogeneity Characterization of non-uniform radio-nuclide and isotopic compositions Assay of high density matrices (both high-Z and high moderator contents)Correction for radioactive material physical form - such as self shielding or multiplication effects due to large accumulations of radioactive materials.Calibration with a minimal set of reference standards and representative matrices.THis document summarizes the conceptual design parameters of the IBIS and indicates areas key to the success of the project where development is to be centered. The work presented here is a collaborative effort between scientific staff within Canberra and within the NIS-6 group at LANL.

  20. Qualification of box HEPA filters for nuclear applications

    International Nuclear Information System (INIS)

    Bergman, W.; Larsen, G.; Wilson, K.; Rainer, F.

    1995-03-01

    We have successfully completed qualification tests on high efficiency particulate air (HEPA) filters that are encapsulated within a box and manufactured by American Air Filters. The qualification tests are required by the American Society of Mechanical Engineers Standard ASME N509 and the U.S. Military Standard MIL-F-51068 for HEPA filters to be used in nuclear applications. The qualification tests specify minimum filter efficiencies following exposure to heated air, overpressure, and rough handling. Prior to this study, no box HEPA filters from any manufacturer had been qualified despite their wide-spread use in Department of Energy (DOE) facilities. Box HEPA filters are not addressed in any of the existing HEPA standards and only briefly discussed in the Nuclear Air Cleaning Handbook

  1. A Finite Segment Method for Skewed Box Girder Analysis

    Directory of Open Access Journals (Sweden)

    Xingwei Xue

    2018-01-01

    Full Text Available A finite segment method is presented to analyze the mechanical behavior of skewed box girders. By modeling the top and bottom plates of the segments with skew plate beam element under an inclined coordinate system and the webs with normal plate beam element, a spatial elastic displacement model for skewed box girder is constructed, which can satisfy the compatibility condition at the corners of the cross section for box girders. The formulation of the finite segment is developed based on the variational principle. The major advantage of the proposed approach, in comparison with the finite element method, is that it can simplify a three-dimensional structure into a one-dimensional structure for structural analysis, which results in significant saving in computational times. At last, the accuracy and efficiency of the proposed finite segment method are verified by a model test.

  2. BOX-COX REGRESSION METHOD IN TIME SCALING

    Directory of Open Access Journals (Sweden)

    ATİLLA GÖKTAŞ

    2013-06-01

    Full Text Available Box-Cox regression method with λj, for j = 1, 2, ..., k, power transformation can be used when dependent variable and error term of the linear regression model do not satisfy the continuity and normality assumptions. The situation obtaining the smallest mean square error  when optimum power λj, transformation for j = 1, 2, ..., k, of Y has been discussed. Box-Cox regression method is especially appropriate to adjust existence skewness or heteroscedasticity of error terms for a nonlinear functional relationship between dependent and explanatory variables. In this study, the advantage and disadvantage use of Box-Cox regression method have been discussed in differentiation and differantial analysis of time scale concept.

  3. Ber analysis of the box relaxation for BPSK signal recovery

    KAUST Repository

    Thrampoulidis, Christos

    2016-06-24

    We study the problem of recovering an n-dimensional BPSK signal from m linear noise-corrupted measurements using the box relaxation method which relaxes the discrete set {±1}n to the convex set [-1,1]n to obtain a convex optimization algorithm followed by hard thresholding. When the noise and measurement matrix have iid standard normal entries, we obtain an exact expression for the bit-wise probability of error Pe in the limit of n and m growing and m/n fixed. At high SNR our result shows that the Pe of box relaxation is within 3dB of the matched filter bound (MFB) for square systems, and that it approaches the (MFB) as m grows large compared to n. Our results also indicate that as m, n → ∞, for any fixed set of size k, the error events of the corresponding k bits in the box relaxation method are independent.

  4. Publishing Outside the Box: Unforeseen Dividends of Talking to Strangers.

    Science.gov (United States)

    Schlinger, Henry D

    2014-10-01

    This article describes publishing outside behavior analysis, letters to editors, and columns, as well as communicating outside the box with editors, authors, and journalists. Publishing can occur in a wide range of journals (e.g., Consciousness and Cognition), in-house publications of professional associations (e.g., Association for Psychological Science's Observer), general science publications (e.g., American Scientist, The Scientist), publications in service to professions (e.g., The Chronicle of Higher Education), general interest and specialized magazines (e.g., Atlantic Monthly, Skeptical Inquirer), and newspapers (e.g., Los Angeles Times). Communicating with editors, authors, and journalists includes, for instance, formal correspondence with editors and personal correspondence with authors and journalists outside the box about misunderstandings, commonalities, and complementarities of their work with respect to ours. The consequences of publishing and communicating are often unforeseen and fortuitous, many of which can never occur by remaining in the box.

  5. Glass Stronger than Steel

    Science.gov (United States)

    Yarris, Lynn

    2011-03-28

    A new type of damage-tolerant metallic glass, demonstrating a strength and toughness beyond that of steel or any other known material, has been developed and tested by a collaboration of researchers from Berkeley Lab and Caltech.

  6. Are Tornadoes Getting Stronger?

    Science.gov (United States)

    Elsner, J.; Jagger, T.

    2013-12-01

    A cumulative logistic model for tornado damage category is developed and examined. Damage path length and width are significantly correlated to the odds of a tornado receiving the next highest damage category. Given values for the cube root of path length and square root of path width, the model predicts a probability for each category. The length and width coefficients are insensitive to the switch to the Enhanced Fujita (EF) scale and to distance from nearest city although these variables are statistically significant in the model. The width coefficient is sensitive to whether or not the tornado caused at least one fatality. This is likely due to the fact that the dimensions and characteristics of the damage path for such events are always based on ground surveys. The model predicted probabilities across the categories are then multiplied by the center wind speed from the categorical EF scale to obtain an estimate of the highest tornado wind speed on a continuous scale in units of meters per second. The estimated wind speeds correlate at a level of .82 (.46, .95) [95% confidence interval] to wind speeds estimated independently from a doppler radar calibration. The estimated wind speeds allow analyses to be done on the tornado database that are not possible with the categorical scale. The modeled intensities can be used in climatology and in environmental and engineering applications. More work needs to be done to understand the upward trends in path length and width. The increases lead to an apparent increase in tornado intensity across all EF categories.

  7. Osteo-articular, mammographic and thoracic films: clinical evaluation of digital view box versus conventional view box.

    Science.gov (United States)

    Magarelli, N; Guglielmi, G; Savastano, M A; Toro, V; Mattei, P A; Bonomo, L

    2002-01-01

    To compare in a clinical setting a conventional view box with a digital view box (Smart Light 2000 Digital Film Viewer System, Smart Light, Israel) in the identification of osteo-articular, mammographic and thoracic lesions. Six radiologists (two for each imaging procedure), experts in osteo-articular, mammographic and thoracic diseases, independently, compared 600 plain films (100 patient with two projections for each imaging procedure). The radiologists evaluated the films by filling-out a multiple choice questionnaire containing questions concerning the type of pathology seen and the technical quality of the radiography in terms of exposure along with specific questions concerning each of the imaging procedures. We observed a higher sensitivity of the digital view box for lesion identification (p 0.75). The better lesion perception derived from the increase luminance of the digital view box in the evaluation of higher film densities, such as in overexposed films. DISCUSSION. The technical characteristics of the digital view box reduce or eliminate negative factors that reduce perceptional performance, and often permit the recovery of films that would have otherwise been considered technically unreadable.

  8. Surface reflectance drives nest box temperature profiles and thermal suitability for target wildlife.

    Directory of Open Access Journals (Sweden)

    Stephen R Griffiths

    Full Text Available Thermal properties of tree hollows play a major role in survival and reproduction of hollow-dependent fauna. Artificial hollows (nest boxes are increasingly being used to supplement the loss of natural hollows; however, the factors that drive nest box thermal profiles have received surprisingly little attention. We investigated how differences in surface reflectance influenced temperature profiles of nest boxes painted three different colors (dark-green, light-green, and white: total solar reflectance 5.9%, 64.4%, and 90.3% respectively using boxes designed for three groups of mammals: insectivorous bats, marsupial gliders and brushtail possums. Across the three different box designs, dark-green (low reflectance boxes experienced the highest average and maximum daytime temperatures, had the greatest magnitude of variation in daytime temperatures within the box, and were consistently substantially warmer than light-green boxes (medium reflectance, white boxes (high reflectance, and ambient air temperatures. Results from biophysical model simulations demonstrated that variation in diurnal temperature profiles generated by painting boxes either high or low reflectance colors could have significant ecophysiological consequences for animals occupying boxes, with animals in dark-green boxes at high risk of acute heat-stress and dehydration during extreme heat events. Conversely in cold weather, our modelling indicated that there are higher cumulative energy costs for mammals, particularly smaller animals, occupying light-green boxes. Given their widespread use as a conservation tool, we suggest that before boxes are installed, consideration should be given to the effect of color on nest box temperature profiles, and the resultant thermal suitability of boxes for wildlife, particularly during extremes in weather. Managers of nest box programs should consider using several different colors and installing boxes across a range of both orientations and

  9. Surface reflectance drives nest box temperature profiles and thermal suitability for target wildlife.

    Science.gov (United States)

    Griffiths, Stephen R; Rowland, Jessica A; Briscoe, Natalie J; Lentini, Pia E; Handasyde, Kathrine A; Lumsden, Linda F; Robert, Kylie A

    2017-01-01

    Thermal properties of tree hollows play a major role in survival and reproduction of hollow-dependent fauna. Artificial hollows (nest boxes) are increasingly being used to supplement the loss of natural hollows; however, the factors that drive nest box thermal profiles have received surprisingly little attention. We investigated how differences in surface reflectance influenced temperature profiles of nest boxes painted three different colors (dark-green, light-green, and white: total solar reflectance 5.9%, 64.4%, and 90.3% respectively) using boxes designed for three groups of mammals: insectivorous bats, marsupial gliders and brushtail possums. Across the three different box designs, dark-green (low reflectance) boxes experienced the highest average and maximum daytime temperatures, had the greatest magnitude of variation in daytime temperatures within the box, and were consistently substantially warmer than light-green boxes (medium reflectance), white boxes (high reflectance), and ambient air temperatures. Results from biophysical model simulations demonstrated that variation in diurnal temperature profiles generated by painting boxes either high or low reflectance colors could have significant ecophysiological consequences for animals occupying boxes, with animals in dark-green boxes at high risk of acute heat-stress and dehydration during extreme heat events. Conversely in cold weather, our modelling indicated that there are higher cumulative energy costs for mammals, particularly smaller animals, occupying light-green boxes. Given their widespread use as a conservation tool, we suggest that before boxes are installed, consideration should be given to the effect of color on nest box temperature profiles, and the resultant thermal suitability of boxes for wildlife, particularly during extremes in weather. Managers of nest box programs should consider using several different colors and installing boxes across a range of both orientations and shade profiles (i

  10. Stress analysis of the NET outboard first wall box

    International Nuclear Information System (INIS)

    Cardella, A.; Gorenflo, H.

    1986-01-01

    A very important topic related to the F.W. designs in form of a tight box that envelopes the breeding blanket is the overall behaviour under the severe operating conditions of NET fusion reactor. In this paper the results of the 3-D stress analysis of the NET outboard F.W. box is presented. These results have been incorporated in the preliminary evaluation of the thermal fatigue limits for the F.W. of NET. (Paper presented in the same Technical Committee Meeting by G. Vieider). (author)

  11. Low-profile self-sealing sample transfer flexure box.

    Science.gov (United States)

    Simon, Kevin; Porz, Lukas; Swamy, Tushar; Chiang, Yet-Ming; Slocum, Alexander

    2017-08-01

    A flexural bearing mechanism has enabled the development of a self-sealing box for protecting air sensitive samples during transfer between glove boxes, micro-machining equipment, and microscopy equipment. The simplicity and self-actuating feature of this design makes it applicable to many devices that operate under vacuum conditions. The models used to design the flexural mechanism are presented in detail. The device has been tested in a Zeiss Merlin GEMINI II scanning electron microscope with Li 3 PS 4 samples, showing effective isolation from air and corrosion prevention.

  12. Tworty Box to Improve the Equipment Logistics of Container Lines

    OpenAIRE

    Ulrich Malchow

    2016-01-01

    A major share of all empty container positioning (deadheading) is resulting from imbalances with regard to container sizes (20ft/40ft). In order to reduce the shipments of 'containerised air' a new type of container has been developed by the author: The Tworty Boxes can either be used as a standard 20ft or in coupled condition as a 40ft container. The outside appearance resembles any standard 20ft container. However the Tworty Box is unique in that it has an additional door at the front side ...

  13. Tests of CMS Hadron Forward Calorimeter Upgrade Readout Box Prototype

    CERN Document Server

    Chatrchyan, Sergey; Sirunyan, Albert; Tumasyan, Armen; Mossolov, Vladimir; Shumeiko, Nikolai; Cornelis, Tom; Ochesanu, Silvia; Roland, Benoit Florent; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Spilbeeck, Alex; Alves, Gilvan Augusto; Martins, Thiago Dos Reis; Pol, Maria Elena; Vaz Da Silva Filho, Mario; Alda Junior, Walter Luiz; Carvalho, Wagner De Paula; Chinellato, Jose Augusto; De Oliveira Martins, Carley Pedro; Figueiredo, Diego Matos; Tonelli Manganote, Edmilson Jose; Molina Insfran, Jorge Andres; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Rosa Lopes Zachi, Alessandro; Finger, Miroslav; Finger, Michael; Tsamalaidze, Zviad; Borras, Kerstin; Gunnellini, Paolo; Jung, Hannes; Knutsson, Albert Hans; Lutz, Benjamin; Ribeiro Cipriano, Pedro Miguel; Sen, Niladri; Baus, Colin; Katkov, Igor; Ulrich, Ralf Matthias; Wohrmann, H; Panagiotou, Apostolos; Bencze, Gyorgy; Horvath, D; Bala, Suman; Gupta, Ruchi; Jindal, M; Lal, Manjit Kaur; Nishu, Nishu; Saini, Lovedeep Kaur; Banerjee, Sunanda; Bhattacharya, S; Gomber, Bhawna; Jain, Shilpi; Khurana, Raman; Sharan, Manoj Kumar; Aziz, Tariq; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Katta, Sudhakar; Banerjee, Sudeshna; Dugad, Shashikant Raichand; Etesami, Seyed Mohsen; Fahim, Ali; Jafari, Abideh; Paktinat Mehdiabadi, Saeid; Zeinali, Maryam; Penzo, Aldo; Afanasyev, A; Bunin, Pavel; Ershov, Yuri; Fedoseev, Oleg; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Konoplynikov, V; Malakhov, Alexander; Moisenz, Petr; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoly; Andreev, Yuri; Dermenev, Alexander; Krasnikov, Nikolay; Pashenkov, Anatoli; Tlisov, Danila; Toropin, A; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Kosov, Mikhail Vladimirovich; Kudinov, Ilya; Lychkovskaya, Natalia; Popov, V; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlassov, Evgueni; Zhokin, Alexander; Belyaev, A; Boos, Eduard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Korotkikh, Vladimir; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Popov, Andrey; Savrin, Victor; Snigirev, Alexander; Vardanyan, Irina; Andreev, V; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Vinogradov, Alexey; Bayshev, Igor; Bityukov, Sergey; Grishin, Viatcheslav; Kryshkin, Victor; Petrov, V; Ryutin, Roman; Sobol, Andrey; Turchanovich, Leonid; Troshin, Sergey; Uzunyan, Andrey; Volkov, Alexey; Santanastasio, Francesco; Adiguzel, Aytul; Bakirci, Numan Mustafa; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; G�kbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karapinar, Guler; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Latife Nukhet; Vergili, Mehmet; Aliyev, Takhmasib; Deniz, Muhammed; Guler, Ali Murat; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Zeyrek, Mehmet; Deliomeroglu, Mehmet; Gulmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Cankocak, Kerem; Levchuk, Leonid; Hatakeyama, Kenichi; Liu, H; Scarborough, Tara Ann; Rumerio, Paolo; Heister, Arno; Hill, C; Lawson, Philip Daniel; Lazic, Dragoslav; Rohlf, James; St. John, Jason; Sulak, Lawrence; Gennadiy, G; Laird, Edward; Landsberg, Greg; Narain, Meenakshi; Sinthuprasith, Tutanon; Tsang, Ka Vang; Long, Owen Rosser; Nguyen, Harold; Paramesvaran, Sudarshan; Sturdy, Jared; Stuart, David; To, Wing; West, Christopher Alan; Apresyan, Artur; Chen, Y; Mott, Alexander Robert; Spiropulu, Maria; Winn, David; Abdoulline, Salavat; Anderson, J; Chlebana, Frank; Freeman, James; Green, Daniel; Hanlon, J; Hirschauer, James Francis; Joshi, Umeshwar; Kunori, Shuichi; Musienko, Yuri; Sharma, Seema; Spalding, William Jeffrey; Tkaczyk, Slawomir; Vidal, Richard; Whitmore, Juliana; Wu, W; Gaultney, Vanessa; Linn, Stephan; Markowitz, Pete Edward; Martinez, German Ruben; Gleyzer, Sergei; Hagopian, Sharon Lee; Hagopian, Vasken; Jenkins, Charles Merrill; Baarmand, Marc M; Dorney, Brian L; Vodopiyanov, Igor; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren James; Duru, Firdevs; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony Richard; Nachtman, Jane; Newsom, Charles Ray; Norbeck, John Edwin; Olson, Jonathan Edward; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Schmidt, Ianos; Tiras, Emrah; Yetkin, Taylan; Yi, Kai; Kenny, Raymond Patrick; Murray, Michael Joseph; Wood, Jeffrey Scott; Baden, Andrew; Calvert, Brian Michael; Eno, Sarah Catherine; Gomez, Jaime Arturo; Grassi, Tullio; Hadley, Nicholas John; Kellogg, Richard; Kolberg, Ted; Lu, Y; Marionneau, Matthieu; Mignerey, Alice Louise Cox; Peterman, Alison Marie; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite Belt; Kao, Shih-Chuan; Klapoetke, Kevin Humphrey; Mans, Jeremiah Michael; Pastika, Nathaniel Joseph; Kroeger, Robert; Rahmat, Rahmat; Sanders, David; Cremaldi, Lucien Marcus; Jain, S; Anastassov, Anton; Velasco, Mayda Marie; Won, Steven; Heering, Adriaan; Karmgard, Daniel; Pearson, Tessa Jae; Ruchti, Randal; Berry, Edmund A; Halyo, Valerie; Hebda, Philip; Hunt, Adam Paul; Lujan, Paul Joseph; Marlow, Daniel; Medvedeva, Tatiana; Saka, Halil; Tully, Christopher; Zuranski, Andrzej Maciej; Barnes, Virgil Everett; Laasanen, Alvin; Bodek, Arie; Chung, Yeon Sei; de Barbaro, Pawel Jan; Eshaq, Yossof; Garcia-bellido, Aran Angel; Goldenzweig, Pablo David; Han, Ji Yeon; Harel, Amnon; Miner, Daniel Carl; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert Adam; Flanagan, Will Hogan; Kamon, Teruki; Montalvo, Roy Joaquin; Sakuma, Tai; Akchurin, Nural; Damgov, Jordan; Dudero, Phillip Russell; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Gurrola, Alfredo; Milstene, Caroline

    2012-01-01

    A readout box prototype for CMS Hadron Forward calorimeter upgrade is built and tested in CERN H2 beamline. The prototype is designed to enable simultaneous tests of different readout options for the four anode upgrade PMTs, new front-end electronics design and new cabling. The response of the PMTs with different readout options is uniform and the background response is minimal. Multi-channel readout options further enhance the background elimination. Passing all the electronics, mechanical and physics tests, the readout box proves to be capable of providing the forward hadron calorimeter operations requirements in the upgrade era.

  14. Well-Defined Coverage Metrics for the Glass Box Test

    OpenAIRE

    Schmidberger, Rainer

    2014-01-01

    Part 2: Tools and Frameworks; International audience; The Glass Box Test (GBT), also known as White Box Test or Structural Test, shows which parts of the program under test have, or have not, been executed. Many GBT tools are available for almost any programming language. Industry standards for safety-critical software require a very high or even complete coverage. At first glance, the GBT seems to be a well-established and mature testing technique that is based on standardized metrics. But o...

  15. Smart Remote for the Setup Box Using Gesture Control

    OpenAIRE

    Surepally Uday Kumar; K. Shamini

    2016-01-01

    The basic purpose of this project is to provide a means to control a set top box (capable of infrared communication), in this case Hathway using hand gestures. Thus, this system will act like a remote control for operating set top box, but this will be achieved through hand gestures instead of pushing buttons. To send and receive remote control signals, this project uses an infrared LED as Transmitter. Using an infrared receiver, an Arduino can detect the bits being sent by a remo...

  16. KIR2DL2/2DL3-E35 alleles are functionally stronger than -Q35 alleles

    Science.gov (United States)

    Bari, Rafijul; Thapa, Rajoo; Bao, Ju; Li, Ying; Zheng, Jie; Leung, Wing

    2016-03-01

    KIR2DL2 and KIR2DL3 segregate as alleles of a single locus in the centromeric motif of the killer cell immunoglobulin-like receptor (KIR) gene family. Although KIR2DL2/L3 polymorphism is known to be associated with many human diseases and is an important factor for donor selection in allogeneic hematopoietic stem cell transplantation, the molecular determinant of functional diversity among various alleles is unclear. In this study we found that KIR2DL2/L3 with glutamic acid at position 35 (E35) are functionally stronger than those with glutamine at the same position (Q35). Cytotoxicity assay showed that NK cells from HLA-C1 positive donors with KIR2DL2/L3-E35 could kill more target cells lacking their ligands than NK cells with the weaker -Q35 alleles, indicating better licensing of KIR2DL2/L3+ NK cells with the stronger alleles. Molecular modeling analysis reveals that the glutamic acid, which is negatively charged, interacts with positively charged histidine located at position 55, thereby stabilizing KIR2DL2/L3 dimer and reducing entropy loss when KIR2DL2/3 binds to HLA-C ligand. The results of this study will be important for future studies of KIR2DL2/L3-associated diseases as well as for donor selection in allogeneic stem cell transplantation.

  17. The impact of gambling advertising: Problem gamblers report stronger impacts on involvement, knowledge, and awareness than recreational gamblers.

    Science.gov (United States)

    Hanss, Daniel; Mentzoni, Rune A; Griffiths, Mark D; Pallesen, Ståle

    2015-06-01

    Although there is a general lack of empirical evidence that advertising influences gambling participation, the regulation of gambling advertising is hotly debated among academic researchers, treatment specialists, lobby groups, regulators, and policymakers. This study contributes to the ongoing debate by investigating perceived impacts of gambling advertising in a sample of gamblers drawn from the general population in Norway (n = 6,034). Three dimensions of advertising impacts were identified, representing perceived impacts on (a) gambling-related attitudes, interest, and behavior ("involvement"); (b) knowledge about gambling options and providers ("knowledge"); and (c) the degree to which people are aware of gambling advertising ("awareness"). Overall, impacts were strongest for the knowledge dimension, and, for all 3 dimensions, the impact increased with level of advertising exposure. Those identified as problem gamblers in the sample (n = 57) reported advertising impacts concerning involvement more than recreational gamblers, and this finding was not attributable to differences in advertising exposure. Additionally, younger gamblers reported stronger impacts on involvement and knowledge but were less likely to agree that they were aware of gambling advertising than older gamblers. Male gamblers were more likely than female gamblers to report stronger impacts on both involvement and knowledge. These findings are discussed with regard to existing research on gambling advertising as well as their implications for future research and policy-making. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  18. Removal of proprioception by BCI raises a stronger body ownership illusion in control of a humanlike robot.

    Science.gov (United States)

    Alimardani, Maryam; Nishio, Shuichi; Ishiguro, Hiroshi

    2016-09-22

    Body ownership illusions provide evidence that our sense of self is not coherent and can be extended to non-body objects. Studying about these illusions gives us practical tools to understand the brain mechanisms that underlie body recognition and the experience of self. We previously introduced an illusion of body ownership transfer (BOT) for operators of a very humanlike robot. This sensation of owning the robot's body was confirmed when operators controlled the robot either by performing the desired motion with their body (motion-control) or by employing a brain-computer interface (BCI) that translated motor imagery commands to robot movement (BCI-control). The interesting observation during BCI-control was that the illusion could be induced even with a noticeable delay in the BCI system. Temporal discrepancy has always shown critical weakening effects on body ownership illusions. However the delay-robustness of BOT during BCI-control raised a question about the interaction between the proprioceptive inputs and delayed visual feedback in agency-driven illusions. In this work, we compared the intensity of BOT illusion for operators in two conditions; motion-control and BCI-control. Our results revealed a significantly stronger BOT illusion for the case of BCI-control. This finding highlights BCI's potential in inducing stronger agency-driven illusions by building a direct communication between the brain and controlled body, and therefore removing awareness from the subject's own body.

  19. Genetic selection for context-dependent stochastic phenotypes: Sp1 and TATA mutations increase phenotypic noise in HIV-1 gene expression.

    Directory of Open Access Journals (Sweden)

    Kathryn Miller-Jensen

    Full Text Available The sequence of a promoter within a genome does not uniquely determine gene expression levels and their variability; rather, promoter sequence can additionally interact with its location in the genome, or genomic context, to shape eukaryotic gene expression. Retroviruses, such as human immunodeficiency virus-1 (HIV, integrate their genomes into those of their host and thereby provide a biomedically-relevant model system to quantitatively explore the relationship between promoter sequence, genomic context, and noise-driven variability on viral gene expression. Using an in vitro model of the HIV Tat-mediated positive-feedback loop, we previously demonstrated that fluctuations in viral Tat-transactivating protein levels generate integration-site-dependent, stochastically-driven phenotypes, in which infected cells randomly 'switch' between high and low expressing states in a manner that may be related to viral latency. Here we extended this model and designed a forward genetic screen to systematically identify genetic elements in the HIV LTR promoter that modulate the fraction of genomic integrations that specify 'Switching' phenotypes. Our screen identified mutations in core promoter regions, including Sp1 and TATA transcription factor binding sites, which increased the Switching fraction several fold. By integrating single-cell experiments with computational modeling, we further investigated the mechanism of Switching-fraction enhancement for a selected Sp1 mutation. Our experimental observations demonstrated that the Sp1 mutation both impaired Tat-transactivated expression and also altered basal expression in the absence of Tat. Computational analysis demonstrated that the observed change in basal expression could contribute significantly to the observed increase in viral integrations that specify a Switching phenotype, provided that the selected mutation affected Tat-mediated noise amplification differentially across genomic contexts. Our study

  20. Alcohol induces RNA polymerase III-dependent transcription through c-Jun by co-regulating TATA-binding protein (TBP) and Brf1 expression.

    Science.gov (United States)

    Zhong, Shuping; Machida, Keigo; Tsukamoto, Hide; Johnson, Deborah L

    2011-01-28

    Chronic alcohol consumption is associated with steatohepatitis and cirrhosis, enhancing the risk for hepatocellular carcinoma. RNA polymerase (pol) III transcribes a variety of small, untranslated RNAs, including tRNAs and 5S rRNAs, which determine the biosynthetic capacity of cells. Increased RNA pol III-dependent transcription, observed in transformed cells and human tumors, is required for oncogenic transformation. Given that alcohol consumption increases risk for liver cancer, we examined whether alcohol regulates this class of genes. Ethanol induces RNA pol III-dependent transcription in both HepG2 cells and primary mouse hepatocytes in a manner that requires ethanol metabolism and the activation of JNK1. This regulatory event is mediated, at least in part, through the ability of ethanol to induce expression of the TFIIIB components, Brf1, and the TATA-binding protein (TBP). Induction of TBP, Brf1, and RNA pol III-dependent gene expression is driven by enhanced c-Jun expression. Ethanol promotes a marked increase in the direct recruitment of c-Jun to TBP, Brf1, and tRNA gene promoters. Chronic alcohol administration in mice leads to enhanced expression of TBP, Brf1, tRNA, and 5S rRNA gene transcription in the liver. These alcohol-dependent increases are more pronounced in transgenic animals that express the HCV NS5A protein that display increased incidence of liver tumors. Together, these results identify a new class of genes that are regulated by alcohol through the co-regulation of TFIIIB components and define a central role for c-Jun in this process.