WorldWideScience

Sample records for stronger shrna activity

  1. Adenovirus vectors lacking virus-associated RNA expression enhance shRNA activity to suppress hepatitis C virus replication

    Science.gov (United States)

    Pei, Zheng; Shi, Guoli; Kondo, Saki; Ito, Masahiko; Maekawa, Aya; Suzuki, Mariko; Saito, Izumu; Suzuki, Tetsuro; Kanegae, Yumi

    2013-12-01

    First-generation adenovirus vectors (FG AdVs) expressing short-hairpin RNA (shRNA) effectively downregulate the expressions of target genes. However, this vector, in fact, expresses not only the transgene product, but also virus-associated RNAs (VA RNAs) that disturb cellular RNAi machinery. We have established a production method for VA-deleted AdVs lacking expression of VA RNAs. Here, we showed that the highest shRNA activity was obtained when the shRNA was inserted not at the popularly used E1 site, but at the E4 site. We then compared the activities of shRNAs against hepatitis C virus (HCV) expressed from VA-deleted AdVs or conventional AdVs. The VA-deleted AdVs inhibited HCV production much more efficiently. Therefore, VA-deleted AdVs were more effective than the currently used AdVs for shRNA downregulation, probably because of the lack of competition between VA RNAs and the shRNAs. These VA-deleted AdVs might enable more effective gene therapies for chronic hepatitis C.

  2. Stronger activation of SREBP-1a by nucleus-localized HBx

    International Nuclear Information System (INIS)

    Wu, Qi; Qiao, Ling; Yang, Jian; Zhou, Yan; Liu, Qiang

    2015-01-01

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication

  3. Stronger activation of SREBP-1a by nucleus-localized HBx

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qi [VIDO-InterVac, Veterinary Microbiology, University of Saskatchewan, Saskatoon (Canada); Qiao, Ling [VIDO-InterVac, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Yang, Jian [Drug Discovery Group, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Zhou, Yan [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)

    2015-05-08

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication.

  4. Physical activity, obesity and mortality: does pattern of physical activity have stronger epidemiological associations?

    DEFF Research Database (Denmark)

    Bauman, Adrian E.; Grunseit, Anne C.; Rangul, Vegar

    2017-01-01

    outcomes, compared to single time-point measure of PA. Methods: Data were the Danish MONICA (MONItoring Trends and Determinants in CArdiovascular Disease) study over three waves 1982-3 (time 1), 1987-8 (time 2) and 1993-4 (time 3). Associations between leisure time single time-point PA levels at time 1...... and time 3, and sport and active travel at times 1 and 2 with BMI, waist, hip circumference and mortality (death from coronary heart disease (CHD) and cardiovascular disease (CVD)) were compared to 'PA patterns' spanning multiple time points. PA pattern classified participants' PA as either 1) inactive...... or low PA at both time points; 2) moderate level PA at time 1 and high activity at time 3; or 3) a 'mixed PA pattern' indicating a varying levels of activity over time. Similarly, sport and active travel were also classified as indicating stable low, stable high and mixed patterns. Results...

  5. Stronger synergies

    CERN Document Server

    Antonella Del Rosso

    2012-01-01

    CERN was founded 58 years ago under the auspices of UNESCO. Since then, both organisations have grown to become world leaders in their respective fields. The links between the two have always existed but today they are even stronger, with new projects under way to develop a more efficient way of exchanging information and devise a common strategy on topics of mutual interest.   CERN and UNESCO are a perfect example of natural partners: their common field is science and education is one of the pillars on which both are built. Historically, they share a common heritage. Both UNESCO and CERN were born of the desire to use scientific cooperation to rebuild peace and security in the aftermath of the Second World War. "Recently, building on our common roots and in close collaboration with UNESCO, we have been developing more structured links to ensure the continuity of the actions taken over the years," says Maurizio Bona, who is in charge of CERN relations with international orga...

  6. Stronger effects of Roundup than its active ingredient glyphosate in damselfly larvae.

    Science.gov (United States)

    Janssens, Lizanne; Stoks, Robby

    2017-12-01

    Pesticides are causing strong decreases in aquatic biodiversity at concentrations assumed safe by legislation. One reason for the failing risk assessment may be strong differences in the toxicity of the active ingredient of pesticides and their commercial formulations. Sublethal effects, especially those on behaviour, have been largely ignored in this context, yet can be equally important as lethal effects at the population and ecosystem levels. Here, we compared the toxicity of the herbicide Roundup and its active ingredient glyphosate on survival, but also on ecologically relevant sublethal traits (life history, behaviour and physiology) in damselfly larvae. Roundup was more toxic than glyphosate with negative effects on survival, behaviour and most of the physiological traits being present at lower concentrations (food intake, escape swimming speed) or even only present (survival, sugar and total energy content and muscle mass) following Roundup exposure. This confirms the toxicity of the surfactant POEA. Notably, also glyphosate was not harmless: a realistic concentration of 2mg/l resulted in reduced growth rate, escape swimming speed and fat content. Our results therefore indicate that the toxicity of Roundup cannot be fully attributed to its surfactant, thereby suggesting that also the new generation of glyphosate-based herbicides with other mixtures of surfactants likely will have adverse effects on non-target aquatic organisms. Ecotoxicological studies comparing the toxicity of active ingredients and their commercial formulations typically ignore behaviour while the here observed differential effects on behaviour likely will negatively impact damselfly populations. Our data highlight that risk assessment of pesticides ignoring sublethal effects may contribute to the negative effects of pesticides on aquatic biodiversity. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Carbon sink activity is stronger under grazing than under mowing: results from a paired eddy flux towers experiment

    Science.gov (United States)

    Pintér, Krisztina; Balogh, János; Koncz, Péter; Hidy, Dóra; Cserhalmi, Dóra; Papp, Marianna; Fóti, Szilvia; Nagy, Zoltán

    2014-05-01

    Effect of grazing vs. mowing on carbon balance of a grassland was investigated by a paired eddy towers (one of them measuring the grazed, the another the mowed treatment) experiment at the Bugacpuszta sandy grassland site (HU-Bug, 46.69° N, 19.6° E, 114m asl, 10.4 ° C annual mean temperature, 562 mm annual precipitation sum) located in the Hungarian Plain. Eddy covariance measurements started in July, 2002. The area of the mowed treatment is 1 ha, it is located within the grazed treatment (500 ha). Electric fence was set up around the selected area in spring of 2011. Study years include 2011, 2012 and 2013. The pasture is managed extensively (average grazing pressure of 0.5 cattle per hectare), the cattle herd regularly took several kilometres during a grazing day. Annual net ecosystem exchange (NEE) of the grassland is strongly limited by precipitation, there were 2 source years within the 11 years (2003-2013) of measurements, during which the average annual balance was -109 gCm-2year-1 with standard deviation of 106 gCm-2year-1. Carbon sink activity of the grassland was stronger in the grazed treatment than in the mowed treatment during the three year study period (paired t-test, P=0.058). In the grazed treatment the average sink strength was -142.8 ±40 gCm-2year-1, while in the mowed treatment the average sink strength was -61.5 ±46.5 gCm-2year-1. Differences of carbon balances between the treatments were positively correlated to the annual sum of evapotranspiration (ET), while ETs of the treatments were almost identical (differences within a 10mm year-1 range) in each study year. Water use efficiency in the mowed treatment was 44% of that in the grazed treatment (P=0.045) as a result of the differences in sink capacity. The higher sensitivity to drought by the mowed treatment manifested in decreased sink capacity during summer and in decreased regeneration capacity during autumn rains as shown by the cumulative NEE in the different years. Minor but

  8. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision

    Directory of Open Access Journals (Sweden)

    Hubert Denise

    2014-01-01

    Full Text Available TT-034 (PF-05095808 is a recombinant adeno-associated virus serotype 8 (AAV8 agent expressing three short hairpin RNA (shRNA pro-drugs that target the hepatitis C virus (HCV RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA drugs. Using next-generation sequencing (NGS to identify and characterize active shRNAs maturation products, we observed that each TT-034–encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5′ RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi enzymes Dicer and siRNA-induced silencing complex (siRISC.

  9. Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

    International Nuclear Information System (INIS)

    Zhu, Zhuoli; Gan, Xueqi; Fan, Hongyi; Yu, Haiyang

    2015-01-01

    Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

  10. Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Zhuoli; Gan, Xueqi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Fan, Hongyi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Department of Applied Mechanics, College of Architecture and Environment, Sichuan University, Chengdu 610065 (China); Yu, Haiyang, E-mail: yhyang6812@foxmail.com [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China)

    2015-12-25

    Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

  11. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  12. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  13. Analogues of the Frog-skin Antimicrobial Peptide Temporin 1Tb Exhibit a Wider Spectrum of Activity and a Stronger Antibiofilm Potential as Compared to the Parental Peptide

    Science.gov (United States)

    Grassi, Lucia; Maisetta, Giuseppantonio; Maccari, Giuseppe; Esin, Semih; Batoni, Giovanna

    2017-04-01

    The frog skin-derived peptide Temporin 1Tb (TB) has gained increasing attention as novel antimicrobial agent for the treatment of antibiotic-resistant and/or biofilm-mediated infections. Nevertheless, such a peptide possesses a preferential spectrum of action against Gram-positive bacteria. In order to improve the therapeutic potential of TB, the present study evaluated the antibacterial and antibiofilm activities of two TB analogues against medically relevant bacterial species. Of the two analogues, TB_KKG6A has been previously described in the literature, while TB_L1FK is a new analogue designed by us through statistical-based computational strategies. Both TB analogues displayed a faster and stronger bactericidal activity than the parental peptide, especially against Gram-negative bacteria in planktonic form. Differently from the parental peptide, TB_KKG6A and TB_L1FK were able to inhibit the formation of Staphylococcus aureus biofilms by more than 50% at 12 μM, while only TB_KKG6A prevented the formation of Pseudomonas aeruginosa biofilms at 24 μM. A marked antibiofilm activity against preformed biofilms of both bacterial species was observed for the two TB analogues when used in combination with EDTA. Analysis of synergism at the cellular level suggested that the antibiofilm activity exerted by the peptide-EDTA combinations against mature biofilms might be due mainly to a disaggregating effect on the extracellular matrix in the case of S. aureus, and to a direct activity on biofilm-embedded cells in the case of P. aeruginosa. Both analogues displayed a low hemolytic effect at the active concentrations and, overall, TB_L1FK resulted less cytotoxic towards mammalian cells. Collectively, the results obtained demonstrated that subtle changes in the primary sequence of TB may provide TB analogues that, used alone or in combination with adjuvant molecules such as EDTA, exhibit promising features against both planktonic and biofilm cells of medically relevant

  14. piggyBac transposon-derived targeting shRNA interference against the Bombyx mori nucleopolyhedrovirus (BmNPV).

    Science.gov (United States)

    Zhou, Fang; Chen, Rui-ting; Lu, Yan; Liang, Shuang; Wang, Mei-xian; Miao, Yun-gen

    2014-12-01

    The Bombyx mori nucleopolyhedrovirus (BmNPV) is one of the most destructive diseases in silkworm, which has caused the main damage to sericulture industry. In this study, we developed a system of RNAi to prevent the BmNPV infection using the piggyBac transposon-derived targeting short hairpin RNA (shRNA) interference. The shRNAs targeting the genes of i.e.-1, lef-1, lef-2 and lef-3 of BmNPV were designed and used to inhibit the intracellular replication or multiplication of BmNPV in Bm cells. The highest activity was presented in the shRNA targeting the i.e.-1c of BmNPV, of which the inhibition rate reached 94.5 % in vitro. Further a stable Bm cell line of piggyBac transposon-derived targeting shRNA interference against BmNPV was established, which has a highly efficacious suppression on virus proliferation. These results indicated that the recombinant shRNA expression system was a useful tool for resistance to BmNPV in vitro. The approach by recombinant shRNAs opens a door of RNAi technology as a strategy that offering technically simpler, cheaper, and quicker gene knockdown for promising research and biotechnology application on silkworm lethal diseases.

  15. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    The origin of a chemical reaction between two reactant atoms is associated with the activation energy, on the assumption that, high-energy collisions between these atoms, are the ones that overcome the activation energy. Here, we show that a stronger attractive van der Waals (vdW) and electron-ion Coulomb interactions ...

  16. Suppression of cancer progression by MGAT1 shRNA knockdown.

    Directory of Open Access Journals (Sweden)

    Reza Beheshti Zavareh

    Full Text Available Oncogenic signaling promotes tumor invasion and metastasis, in part, by increasing the expression of tri- and tetra- branched N-glycans. The branched N-glycans bind to galectins forming a multivalent lattice that enhances cell surface residency of growth factor receptors, and focal adhesion turnover. N-acetylglucosaminyltransferase I (MGAT1, the first branching enzyme in the pathway, is required for the addition of all subsequent branches. Here we have introduced MGAT1 shRNA into human HeLa cervical and PC-3-Yellow prostate tumor cells lines, generating cell lines with reduced transcript, enzyme activity and branched N-glycans at the cell surface. MGAT1 knockdown inhibited HeLa cell migration and invasion, but did not alter cell proliferation rates. Swainsonine, an inhibitor of α-mannosidase II immediately downstream of MGAT1, also inhibited cell invasion and was not additive with MGAT1 shRNA, consistent with a common mechanism of action. Focal adhesion and microfilament organization in MGAT1 knockdown cells also indicate a less motile phenotype. In vivo, MGAT1 knockdown in the PC-3-Yellow orthotopic prostate cancer xenograft model significantly decreased primary tumor growth and the incidence of lung metastases. Our results demonstrate that blocking MGAT1 is a potential target for anti-cancer therapy.

  17. Prospects for stronger calandria tubes

    International Nuclear Information System (INIS)

    Ells, C.E.; Coleman, C.E.; Hosbons, R.R.; Ibrahim, E.F.; Doubt, G.L.

    1990-12-01

    The CANDU calandria tubes, made of seam welded and annealed Zircaloy-2, have given exemplary service in-reactor. Although not designed as a system pressure containment, calandria tubes may remain intact even in the face of pressure tube rupture. One such incident at Pickering Unit 2 demonstrated the economic advantage of such an outcome, and a case can be made for increasing the probability that other calandria tubes would perform in a similar fashion. Various methods of obtaining stronger calandria tubes are available, and reviewed here. When the tubes are internally pressurized, the weld is the weak section of the tube. Increasing the oxygen concentration in the starting sheet, and thickening the weld, are promising routes to a stronger tube

  18. Mental health benefits of neighbourhood green space are stronger among physically active adults in middle-to-older age: evidence from 260,061 Australians.

    Science.gov (United States)

    Astell-Burt, Thomas; Feng, Xiaoqi; Kolt, Gregory S

    2013-11-01

    While many studies report that green spaces promote mental health, some suggest the psychological benefits of physical activity are amplified if participation occurs within greener environs. We investigated whether this relationship could be observed among adults in middle-to-older age. Multilevel logit regression was used to investigate association between green space and psychological distress (Kessler scores of 22+) among 260,061 Australians over 45 years old living in New South Wales (2006-2009). Physical activity was measured using the Active Australia survey. Percentage green space was estimated within a 1-kilometre of residence. In comparison to residents of the least green areas, those in the greenest neighbourhoods were at a lower risk of psychological distress (Odds Ratio 0.83, 95% CI: 0.76, 0.92) and were less sedentary (0.81: 0.77, 0.87). An interaction was observed between physical activity and green space (p=0.0028). More green space did not appear to benefit mental health among the least active (0.99: 0.85, 1.15), but there was a protective association for the more physically active (0.82: 0.67, 0.99). For adults in middle-to-older age, green spaces are not only important for promoting physical activity, but the mental health benefits of greener environs appear contingent upon those active lifestyles. © 2013.

  19. shRNA suppression of thymidylate synthase produces DNA mismatches and results in excellent radiosensitization

    Science.gov (United States)

    Flanagan, Sheryl A.; Cooper, Kristin S.; Mannava, Sudha; Nikiforov, Mikhail A.; Shewach, Donna S.

    2012-01-01

    Purpose To determine the effect of shRNA-mediated suppression of thymidylate synthase (TS) on cytotoxicity and radiosensitization and the mechanism by which these events occur. Methods and Materials shRNA suppression of TS was compared to FdUrd inactivation of TS ± ionizing radiation in HCT116 and HT29 colon cancer cells. Cytotoxicity and radiosensitization were measured via clonogenic assay. Cell cycle effects were measured by flow cytometry. Effects of FdUrd or shRNA suppression of TS on dNTP imbalances and consequent nucleotide mis-incorporations into DNA were analyzed by HPLC and as pSP189 plasmid mutations, respectively. Results TS shRNA produced profound (≥ 90%) and prolonged (≥ 8 days) suppression of TS in HCT116 and HT29 cells while FdUrd increased TS expression. TS shRNA also produced more specific and prolonged effects on dNTPs compared to FdUrd. TS shRNA suppression allowed accumulation of cells in S-phase, though its effects were not as long-lasting as FdUrd. Both treatments resulted in phosphorylation of chk1. TS shRNA alone was less cytotoxic than FdUrd, but was equally effective as FdUrd in eliciting radiosensitization (radiation enhancement ratio (RER): TS shRNA, 1.5 – 1.7; FdUrd, 1.4 – 1.6). TS shRNA and FdUrd produced a similar increase in the number and type of pSP189 mutations. Conclusions TS shRNA produced less cytotoxicity than FdUrd, but was equally effective at radiosensitizing tumor cells. Thus, the inhibitory effect of FdUrd on TS alone is sufficient to elicit radiosensitization with FdUrd, but only partially explains FdUrd-mediated cytotoxicity and cell cycle inhibition. The increase in DNA mismatches following TS shRNA or FdUrd supports a causal and sufficient role for the depletion of dTTP and consequent DNA mismatches underlying radiosensitization. Importantly, shRNA suppression of TS avoids FP-mediated TS elevation and its negative prognostic role. These studies support further exploration of TS suppression as a novel

  20. Viral delivery of shRNA to amygdala neurons leads to neurotoxicity and deficits in Pavlovian fear conditioning.

    Science.gov (United States)

    de Solis, Christopher A; Holehonnur, Roopashri; Banerjee, Anwesha; Luong, Jonathan A; Lella, Srihari K; Ho, Anthony; Pahlavan, Bahram; Ploski, Jonathan E

    2015-10-01

    The use of viral vector technology to deliver short hairpin RNAs (shRNAs) to cells of the nervous system of many model organisms has been widely utilized by neuroscientists to study the influence of genes on behavior. However, there have been numerous reports that delivering shRNAs to the nervous system can lead to neurotoxicity. Here we report the results of a series of experiments where adeno-associated viruses (AAV), that were engineered to express shRNAs designed to target known plasticity associated genes (i.e. Arc, Egr1 and GluN2A) or control shRNAs that were designed not to target any rat gene product for depletion, were delivered to the rat basal and lateral nuclei of the amygdala (BLA), and auditory Pavlovian fear conditioning was examined. In our first set of experiments we found that animals that received AAV (3.16E13-1E13 GC/mL; 1 μl/side), designed to knockdown Arc (shArc), or control shRNAs targeting either luciferase (shLuc), or nothing (shCntrl), exhibited impaired fear conditioning compared to animals that received viruses that did not express shRNAs. Notably, animals that received shArc did not exhibit differences in fear conditioning compared to animals that received control shRNAs despite gene knockdown of Arc. Viruses designed to harbor shRNAs did not induce obvious morphological changes to the cells/tissue of the BLA at any dose of virus tested, but at the highest dose of shRNA virus examined (3.16E13 GC/mL; 1 μl/side), a significant increase in microglia activation occurred as measured by an increase in IBA1 immunoreactivity. In our final set of experiments we infused viruses into the BLA at a titer of (1.60E+12 GC/mL; 1 μl/side), designed to express shArc, shLuc, shCntrl or shRNAs designed to target Egr1 (shEgr1), or GluN2A (shGluN2A), or no shRNA, and found that all groups exhibited impaired fear conditioning compared to the group which received a virus that did not express an shRNA. The shEgr1 and shGluN2A groups exhibited gene

  1. Modified gateway system for double shRNA expression and Cre/lox based gene expression

    Directory of Open Access Journals (Sweden)

    Leung Lisa

    2011-03-01

    Full Text Available Abstract Background The growing need for functional studies of genes has set the stage for the development of versatile tools for genetic manipulations. Results Aiming to provide tools for high throughput analysis of gene functions, we have developed a modified short hairpin RNA (shRNA and gene expression system based on Gateway Technology. The system contains a series of entry and destination vectors that enables easy transfer of shRNA or cDNA into lentiviral expression systems with a variety of selection or marker genes (i.e. puromycin, hygromycin, green fluorescent protein-EGFP, yellow fluorescent protein-YFP and red fluorescent protein-dsRed2. Our shRNA entry vector pENTR.hU6.hH1 containing two tandem human shRNA expression promoters, H1 and U6, was capable of co-expressing two shRNA sequences simultaneously. The entry vector for gene overexpression, pENTR.CMV.ON was constructed to contain CMV promoter with a multiple cloning site flanked by loxP sites allowing for subsequent Cre/lox recombination. Both shRNA and cDNA expression vectors also contained attL sites necessary for recombination with attR sites in our destination expression vectors. As proof of principle we demonstrate the functionality and efficiency of this system by testing expression of several cDNA and shRNA sequences in a number of cell lines. Conclusion Our system is a valuable addition to already existing library of Gateway based vectors and can be an essential tool for many aspects of gene functional studies.

  2. Modified gateway system for double shRNA expression and Cre/lox based gene expression.

    Science.gov (United States)

    Radulovich, Nikolina; Leung, Lisa; Tsao, Ming-Sound

    2011-03-22

    The growing need for functional studies of genes has set the stage for the development of versatile tools for genetic manipulations. Aiming to provide tools for high throughput analysis of gene functions, we have developed a modified short hairpin RNA (shRNA) and gene expression system based on Gateway Technology. The system contains a series of entry and destination vectors that enables easy transfer of shRNA or cDNA into lentiviral expression systems with a variety of selection or marker genes (i.e. puromycin, hygromycin, green fluorescent protein-EGFP, yellow fluorescent protein-YFP and red fluorescent protein-dsRed2). Our shRNA entry vector pENTR.hU6.hH1 containing two tandem human shRNA expression promoters, H1 and U6, was capable of co-expressing two shRNA sequences simultaneously. The entry vector for gene overexpression, pENTR.CMV.ON was constructed to contain CMV promoter with a multiple cloning site flanked by loxP sites allowing for subsequent Cre/lox recombination. Both shRNA and cDNA expression vectors also contained attL sites necessary for recombination with attR sites in our destination expression vectors. As proof of principle we demonstrate the functionality and efficiency of this system by testing expression of several cDNA and shRNA sequences in a number of cell lines. Our system is a valuable addition to already existing library of Gateway based vectors and can be an essential tool for many aspects of gene functional studies.

  3. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  4. Design and cloning strategies for constructing shRNA expression vectors

    Directory of Open Access Journals (Sweden)

    McIntyre Glen J

    2006-01-01

    Full Text Available Abstract Background Short hairpin RNA (shRNA encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies, a PCR approach using hairpin containing primers (22 % and primer extension of hairpin templates (4 %. Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process.

  5. shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

    Science.gov (United States)

    Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

    2016-12-01

    RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

  6. High-throughput RNA interference screening using pooled shRNA libraries and next generation sequencing.

    Science.gov (United States)

    Sims, David; Mendes-Pereira, Ana M; Frankum, Jessica; Burgess, Darren; Cerone, Maria-Antonietta; Lombardelli, Cristina; Mitsopoulos, Costas; Hakas, Jarle; Murugaesu, Nirupa; Isacke, Clare M; Fenwick, Kerry; Assiotis, Ioannis; Kozarewa, Iwanka; Zvelebil, Marketa; Ashworth, Alan; Lord, Christopher J

    2011-10-21

    RNA interference (RNAi) screening is a state-of-the-art technology that enables the dissection of biological processes and disease-related phenotypes. The commercial availability of genome-wide, short hairpin RNA (shRNA) libraries has fueled interest in this area but the generation and analysis of these complex data remain a challenge. Here, we describe complete experimental protocols and novel open source computational methodologies, shALIGN and shRNAseq, that allow RNAi screens to be rapidly deconvoluted using next generation sequencing. Our computational pipeline offers efficient screen analysis and the flexibility and scalability to quickly incorporate future developments in shRNA library technology.

  7. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    In this study, shRNA vectors having different stem length were constructed and their silencing effect was tested in mouse embryonic fibroblast and in vivo. Interfering RNAs were designed with stems of 21, 27, and 29 bp. The enhanced green fluorescent protein gene was used as target gene. The synthesized single strands ...

  8. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... and are presumably processed similar to the microRNA maturation pathways. The basic structure of an ordinary. shRNA consists of paired antisense and sense strands connected by a loop of unpaired nucleotides. A duplex stem of 19 to 29 bp, either fully paired or with miRNA- style internal mismatches, is ...

  9. The Power Decoder Simulator for the Evaluation of Pooled shRNA Screen Performance.

    Science.gov (United States)

    Stombaugh, Jesse; Licon, Abel; Strezoska, Žaklina; Stahl, Joshua; Anderson, Sarah Bael; Banos, Michael; van Brabant Smith, Anja; Birmingham, Amanda; Vermeulen, Annaleen

    2015-09-01

    RNA interference screening using pooled, short hairpin RNA (shRNA) is a powerful, high-throughput tool for determining the biological relevance of genes for a phenotype. Assessing an shRNA pooled screen's performance is difficult in practice; one can estimate the performance only by using reproducibility as a proxy for power or by employing a large number of validated positive and negative controls. Here, we develop an open-source software tool, the Power Decoder simulator, for generating shRNA pooled screening experiments in silico that can be used to estimate a screen's statistical power. Using the negative binomial distribution, it models both the relative abundance of multiple shRNAs within a single screening replicate and the biological noise between replicates for each individual shRNA. We demonstrate that this simulator can successfully model the data from an actual laboratory experiment. We then use it to evaluate the effects of biological replicates and sequencing counts on the performance of a pooled screen, without the necessity of gathering additional data. The Power Decoder simulator is written in R and Python and is available for download under the GNU General Public License v3.0. © 2015 Society for Laboratory Automation and Screening.

  10. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  11. States agree on stronger physical protection regime

    International Nuclear Information System (INIS)

    2005-01-01

    Full text: Delegates from 89 countries agreed on 8 July to fundamental changes that will substantially strengthen the Convention on the Physical Protection of Nuclear Material (CPPNM). IAEA Director General Mohamed ElBaradei welcomed the agreement in saying 'This new and stronger treaty is an important step towards greater nuclear security by combating, preventing, and ultimately punishing those who would engage in nuclear theft, sabotage or even terrorism. It demonstrates that there is indeed a global commitment to remedy weaknesses in our nuclear security regime.' The amended CPPNM makes it legally binding for States Parties to protect nuclear facilities and material in peaceful domestic use, storage as well as transport. It will also provide for expanded cooperation between and among States regarding rapid measures to locate and recover stolen or smuggled nuclear material, mitigate any radiological consequences of sabotage, and prevent and combat related offences. The original CPPNM applied only to nuclear material in international transport. Conference President Dr. Alec Baer said 'All 89 delegations demonstrated real unity of purpose. They put aside some very genuine national concerns in favour of the global interest and the result is a much improved convention that is better suited to addressing the nuclear security challenges we currently face.' The new rules will come into effect once they have been ratified by two-thirds of the 112 States Parties of the Convention, expected to take several years. 'But concrete actions are already taking place around the world. For more than 3 years, the IAEA has been implementing a systematic Nuclear Security plan, including physical protection activities designed to prevent, detect and respond to malicious acts,' said Anita Nillson, Director of the IAEA's Office of Nuclear Security. The Agency's Nuclear Security Fund, set up after the events of 9/11, has delivered $19.5 million in practical assistance to 121 countries

  12. Periodic Mechanical Stress Activates PKCδ-Dependent EGFR Mitogenic Signals in Rat Chondrocytes via PI3K-Akt and ERK1/2

    Directory of Open Access Journals (Sweden)

    Peng He

    2016-09-01

    Full Text Available Background/Aims: The present study aimed to analyze the mechanisms by which periodic mechanical stress is translated into biochemical signals, and to verify the important role of signaling molecules including phosphatidylinositol-3-kinase (PI3K-Akt, protein kinase C (PKC, and epidermal growth factor receptor (EGFR in chondrocyte proliferation. The effects of periodic mechanical stress on the mitogenesis of chondrocytes have been studied extensively in recent years. However, the mechanisms underlying the ability of chondrocytes to sense and respond to periodic mechanical stress need further investigation. Methods: Two steps were undertaken in the experiment. In the first step, the cells were pretreated with shRNA targeted to Akt or EGFR or PKCδ or control scrambled shRNA. Moreover, they were pretreated with LY294002, GF109203X, Gö6976, rottlerin, and AG1478. They were maintained under static conditions or periodic mechanical stress for 3 days, 8 h per day, prior to direct cell counting and CCK-8 assay, respectively. In the second step, the cells were pretreated with shRNA targeted to Akt or EGFR or PKCδ or control scrambled shRNA. Moreover, they were pretreated with LY294002, AG1478, and rottlerin. They were maintained under static conditions or periodic mechanical stress for 1 h prior to Western blot analysis. Results: Proliferation was inhibited by pretreatment with PKC or PKCδ inhibitor GF109203X or rottlerin and by short hairpin RNA (shRNA targeted to PKCδ, but not by PKCα inhibitor Gö6976 in chondrocytes in response to periodic mechanical stress. Meantime, rottlerin and shRNA targeted to PKCδ also attenuated EGFR, Akt, and ERK1/2 activation. Furthermore, inhibiting EGFR activity by AG1478 and shRNA targeted to EGFR abrogated chondrocyte proliferation and phosphorylation levels of Akt and extracellular signal-regulated kinase (ERK1/2 subjected to periodic mechanical stress, while the phosphorylation site of PKCδ was not affected. In

  13. Lentivirus-mediated shRNA interference targeting SLUG inhibits lung cancer growth and metastasis.

    Science.gov (United States)

    Wang, Yao-Peng; Wang, Ming-Zhao; Luo, Yi-Ren; Shen, Yi; Wei, Zhao-Xia

    2012-01-01

    Lung cancer is a deadly cancer, whose kills more people worldwide than any other malignancy. SLUG (SNAI2, Snail2) is involved in the epithelial mesenchymal transition in physiological and in pathological contexts and is implicated in the development and progression of lung cancer. We constructed a lentivirus vector with SLUG shRNA (LV-shSLUG). LV-shSLUG and a control lentivirus were infected into the non-small cell lung cancer cell A549 and real-time PCR, Western blot and IHC were applied to assess expression of the SLUG gene. Cell proliferation and migration were detected using MTT and clony formation methods. Real-time PCR, Western Blot and IHC results confirmed down-regulation of SLUG expression by its shRNA by about 80%~90% at both the mRNA and protein levels. Knockdown of SLUG significantly suppressed lung cancer cell proliferation. Furthermore, knockdown of SLUG significantly inhibited lung cancer cell invasion and metastasis. Finally, knockdown of SLUG induced the down-regulation of Bcl-2 and up-regulation of E-cadherin. These results indicate that SLUG is a newly identified gene associated with lung cancer growth and metastasis. SLUG may serve as a new therapeutic target for the treatment of lung cancer in the future.

  14. LHC Season 2: A stronger machine

    CERN Multimedia

    Dominguez, Daniel

    2015-01-01

    1) New magnets / De nouveaux aimants 2) Stronger connections / Des jonctions électriques renforcées 3) Safer magnets / Des aimants plus sûrs 4) Higher energy beams / Des faisceaux d’énergie plus élevée 5) Narrower beams / Des faisceaux plus serrés 6) Smaller but closer proton packets / Des groupes de protons plus petits mais plus rapprochés 7) Higher voltage / Une tension plus haute 8) Superior cryogenics / Un système cryogénique amélioré 9) Radiation-resistant electronics / Une électronique qui résiste aux radiations 10) More secure vacuum / Un vide plus sûr

  15. Gas Marbles: Much Stronger than Liquid Marbles

    Science.gov (United States)

    Timounay, Yousra; Pitois, Olivier; Rouyer, Florence

    2017-06-01

    Enwrapping liquid droplets with hydrophobic particles allows the manufacture of so-called "liquid marbles" [Aussillous and Quéré Nature (London) 411, 924 (2001); , 10.1038/35082026Mahadevan Nature (London)411, 895 (2001), 10.1038/35082164]. The recent intensive research devoted to liquid marbles is justified by their very unusual physical and chemical properties and by their potential for various applications, from microreactors to water storage, including water pollution sensors [Bormashenko Curr. Opin. Colloid Interface Sci. 16, 266 (2011), 10.1016/j.cocis.2010.12.002]. Here we demonstrate that this concept can be successfully applied for encapsulating and protecting small gas pockets within an air environment. Similarly to their liquid counterparts, those new soft-matter objects, that we call "gas marbles," can sustain external forces. We show that gas marbles are surprisingly tenfold stronger than liquid marbles and, more importantly, they can sustain both positive and negative pressure differences. This magnified strength is shown to originate from the strong cohesive nature of the shell. Those interesting properties could be exploited for imprisoning valuable or polluted gases or for designing new aerated materials.

  16. Target discovery screens using pooled shRNA libraries and next-generation sequencing: A model workflow and analytical algorithm.

    Directory of Open Access Journals (Sweden)

    Christiane Schaefer

    Full Text Available In the search for novel therapeutic targets, RNA interference screening has become a valuable tool. High-throughput technologies are now broadly accessible but their assay development from baseline remains resource-intensive and challenging. Focusing on this assay development process, we here describe a target discovery screen using pooled shRNA libraries and next-generation sequencing (NGS deconvolution in a cell line model of Ewing sarcoma. In a strategy designed for comparative and synthetic lethal studies, we screened for targets specific to the A673 Ewing sarcoma cell line. Methods, results and pitfalls are described for the entire multi-step screening procedure, from lentiviral shRNA delivery to bioinformatics analysis, illustrating a complete model workflow. We demonstrate that successful studies are feasible from the first assay performance and independent of specialized screening units. Furthermore, we show that a resource-saving screen depth of 100-fold average shRNA representation can suffice to generate reproducible target hits despite heterogeneity in the derived datasets. Because statistical analysis methods are debatable for such datasets, we created ProFED, an analysis package designed to facilitate descriptive data analysis and hit calling using an aim-oriented profile filtering approach. In its versatile design, this open-source online tool provides fast and easy analysis of shRNA and other count-based datasets to complement other analytical algorithms.

  17. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  18. Stronger Schrödinger-like uncertainty relations

    International Nuclear Information System (INIS)

    Song, Qiu-Cheng; Qiao, Cong-Feng

    2016-01-01

    Highlights: • A stronger Schrödinger-like uncertainty relation in the sum of variances of two observables is obtained. • An improved Schrödinger-like uncertainty relation in the product of variances of two observables is obtained. • A stronger uncertainty relation in the sum of variances of three observables is proposed. - Abstract: Uncertainty relation is one of the fundamental building blocks of quantum theory. Nevertheless, the traditional uncertainty relations do not fully capture the concept of incompatible observables. Here we present a stronger Schrödinger-like uncertainty relation, which is stronger than the relation recently derived by Maccone and Pati (2014) [11]. Furthermore, we give an additive uncertainty relation which holds for three incompatible observables, which is stronger than the relation newly obtained by Kechrimparis and Weigert (2014) [12] and the simple extension of the Schrödinger uncertainty relation.

  19. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  20. Co-delivery of doxorubicin and recombinant plasmid pHSP70-Plk1-shRNA by bacterial magnetosomes for osteosarcoma therapy

    Science.gov (United States)

    Cheng, Li; Ke, Youqun; Yu, Shuisheng; Jing, Juehua

    2016-01-01

    To explore a novel combination of chemotherapy, gene therapy, and thermotherapy for osteosarcoma, a targeted heat-sensitive co-delivery system based on bacterial magnetosomes (BMs) was developed. The optimal culture conditions of magnetotactic bacteria (MTB) AMB-1 and characterization of BMs were achieved. A recombinant eukaryotic plasmid heat shock protein 70-polo-like kinase 1-short hairpin RNA (pHSP70-Plk1-shRNA) under transcriptional control of a thermosensitive promoter (human HSP70 promoter) was constructed for gene therapy. Doxorubicin (DOX) and pHSP70-Plk1-shRNA were included in the targeted thermosensitive co-delivery system, and in vitro DOX release activity, targeted gene silencing efficiency and in vitro antitumor efficacy were investigated. The results showed that the optimal culture conditions of MTB AMB-1 are an oxygen concentration of 4.0%, a pH value of 7.0, 20 μmol/L of ferrous sulfate, 800 mg/L of sodium nitrate, and 200 mg/L of succinic acid. The temperature of BMs reached 43°C within 3 minutes and could be maintained for 30 minutes by adjusting the magnitude of the alternating magnetic field (AMF). The diameters of BMs, BM-DOX, BM-recombinant eukaryotic plasmid pHSP70-Plk1-shRNA (shPlk1), and BM-DOX-shPlk1 were 43.7±4.6, 79.2±5.4, 88.9±7.8, and 133.5±11.4 nm, respectively. The zeta potentials of BMs, BM-DOX, BM-shPlk1, and BM-DOX-shPlk1 were −29.4±6.9, −9.5±5.6, −16.7±4.8, and −10.3±3.1 mV, respectively. Besides, the system exhibited good release behavior. DOX release rate from BM-DOX-shPlk1 was 54% after incubation with phosphate-buffered saline at 43°C and 37% after incubation with 50% fetal bovine serum, which was significantly higher than that at 37°C (P<0.05). In addition, the expressions of Plk1 mRNA and protein were significantly suppressed in cells treated with BM-DOX-shPlk1 following hyperthermia treatment under the influence of an AMF compared to other groups (P<0.05). Furthermore, evaluation of the effect of in

  1. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  2. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  3. Expression of P2X7R in breast cancer tissue and the induction of apoptosis by the gene-specific shRNA in MCF-7 cells

    OpenAIRE

    TAN, CHAO; HAN, LI; ZOU, LILI; LUO, CHUNHUA; LIU, AIHUA; SHENG, XIEJING; XI, DEE

    2015-01-01

    The aim of the present study was to investigate the effects of P2X7R short hairpin (sh)RNA on the proliferation and apoptosis of MCF-7 cells, and to detect the expression of P2X7R in breast cancer and MCF-7 cells. In order to detect the expression of P2X7R in normal breast and breast cancer tissues, quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blot analysis and immunohistochemistry were performed. A P2X7-targeted shRNA sequence and a scrambled sequence were ...

  4. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  5. Women's political participation leads to stronger local economies ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Edgard Rodriguez - IDRC. Women attend a self-help group meeting near Hyderabad, India. Keenara Khanderia. Under changes to India's constitution, Indian women are gaining a stronger political voice. Legal reforms are encouraging women to contribute to economic growth and investments in community growth.

  6. A Stronger Reason for the Right to Sign Languages

    Science.gov (United States)

    Trovato, Sara

    2013-01-01

    Is the right to sign language only the right to a minority language? Holding a capability (not a disability) approach, and building on the psycholinguistic literature on sign language acquisition, I make the point that this right is of a stronger nature, since only sign languages can guarantee that each deaf child will properly develop the…

  7. Increasing Arctic sea ice export driven by stronger winds

    Science.gov (United States)

    Sorteberg, A.; Smedsrud, L. H.; Sirevaag, A.; Kloster, K.

    2010-12-01

    Arctic sea ice area has decreased steadily over the last three decades. A thinner and more seasonal Arctic ice cover, related to increased long wave radiation, has become evident. Changes in circulation, including drift patterns of the Arctic pack ice, have been less obvious. Arctic sea ice export estimates have been hampered by low resolution spatial and temporal satellite imagery, especially during summer, making accurate detection difficult. Here we present a new ice area export dataset calculated from sea ice motion and concentration profiles along 79N. Ice drift vectors are calculated from ice feature displacement using Envisat ASAR WideSwath images every 3 days from 2004 while ice concentration is based on DMSP F13 SSMI and AQUA AMSR-E brightness temperature data. The two data sets are combined to give the ice-area flux in consecutive 3-day periods, uninterrupted year-round coverage along 79N. It is shown that sea ice export variability is closely linked to the geostrophic wind in the Fram Strait (correlation of 0.84). Using geostrophic winds from reanalysis back to the 1950s as a proxy for ice export indicates that the Arctic sea ice has annually lost an increasing area since the 1950's driven by stronger winds. Ice concentration has decreased slightly, but does not contribute significantly. The ice export has overall increased by ~25% over the period. Using cyclone tracking the changes in winds seems directly related to a higher low pressure activity in the Nordic Seas. Our results demonstrate that the changes in atmospheric circulation over the Arctic and sub-Arctic have contributed to a trend in the Fram Strait ice export. The Fram Strait between Greenland and Svalbard with average sea ice concentration for summer (red, June through August) and winter (black, January through March). Solid lines are 50%, dashed lines are 15%. Above mean southward ice drift across 79N from August 2004 to July 2010 in 1 degree bins based on SAR imagery, and mean ice

  8. Stronger declines in youth alcohol consumption thanks to stronger integrated alcohol policies? A qualitative comparison of ten Dutch municipalities.

    Science.gov (United States)

    de Goeij, Moniek C M; Harting, Janneke; Kunst, Anton E

    2017-03-02

    Little detailed evidence is available on how integrated policies could impact population health and under what conditions such policies could be realized. The aim of this study was to assess how youth alcohol consumption trends in the province of Noord-Brabant, The Netherlands, were related to the development and implementation of integrated policies. In a retrospective multiple case study, alcohol policies of six municipalities with stronger declines in youth alcohol consumption between 2007 and 2011 (cases) were compared to four municipalities with weaker declines (controls). Information on the policy process in the same period was obtained through semi-structured in-depth interviews with policy advisors. Information on implemented interventions was extracted from policy documents and checked by the interviewees. Interviews were analyzed for thematic content. Only municipalities with stronger declines in alcohol consumption involved sectors other than public health and had started to implement interventions that use regulatory or enforcement strategies. Their involvement was facilitated by framing youth alcohol consumption as a safety rather than a health problem, whereby local media played a substantial role. Implementation of integrated policies was further facilitated by dedicated leadership and sufficient resources. Reductions in youth alcohol consumption in Noord-Brabant were stronger when municipalities started to develop integrated policies. Results suggest that integrated policies framing a health problem as a broader societal problem could positively influence population health.

  9. Predatory blue crabs induce stronger nonconsumptive effects in eastern oysters Crassostrea virginica than scavenging blue crabs

    Directory of Open Access Journals (Sweden)

    Avery E. Scherer

    2017-02-01

    Full Text Available By influencing critical prey traits such as foraging or habitat selection, predators can affect entire ecosystems, but the nature of cues that trigger prey reactions to predators are not well understood. Predators may scavenge to supplement their energetic needs and scavenging frequency may vary among individuals within a species due to preferences and prey availability. Yet prey reactions to consumers that are primarily scavengers versus those that are active foragers have not been investigated, even though variation in prey reactions to scavengers or predators might influence cascading nonconsumptive effects in food webs. Oysters Crassostrea virginica react to crab predators by growing stronger shells. We exposed oysters to exudates from crabs fed live oysters or fed aged oyster tissue to simulate scavenging, and to controls without crab cues. Oysters grew stronger shells when exposed to either crab exudate, but their shells were significantly stronger when crabs were fed live oysters. The stronger response to predators than scavengers could be due to inherent differences in diet cues representative of reduced risk in the presence of scavengers or to degradation of conspecific alarm cues in aged treatments, which may mask risk from potential predators subsisting by scavenging.

  10. The right of the stronger: The play Sisyphus and critias

    Directory of Open Access Journals (Sweden)

    Jordović Ivan

    2004-01-01

    Full Text Available The Focus of this study is the standpoint of the play Sisyphus and critias the leader of the thirty towards the right of the stronger. this is a question of constant interest in scientific circles, since its answer can serve as the indicator of the influence this famous theory has had. this interest has been encouraged by the fact that critias’ authorship of the play is questionable. however, the question of the author is not of primary importance for this article, because there are some arguments, among some well known ones, which were not considered and which Show that in this satire, regardless of the author and the purpose of this fragment, the right of the stronger is actually non-existant. the first argument to support this theory is that nomosphysis antithesis is nowhere explicitly mentioned although it is the crucial element of the right of the stronger. in addition there is no claim in the play that the exploitation of the strong by the week or by law accrued. the second argument is that despite the incapability of laws to prevent the secret injustice, they and their importance for the human society are depicted in a positive light. it should also be noted that, unlike callicles and glaucon, laws are created to stop the bad and not the good. the third argument is that the invention of religion is accepted as a positive achievement, which finally enables the overcoming of primeval times and lawlessness. the reflection of this argument is a positive characterization of the individual who invented the fear of gods. the fourth argument, which has not been taken into consideration so far is the way the supporters and opponents of lawlessness are described and marked as κακοί and έσξλοί in the satire only physically strong are considered as strong as opposed to callicles, where they are also spiritually superior. intelectually superior in Sisyphus is the inventor of the fear of gods who is also in favor of law and order. the fact

  11. Stronger misdirection in curved than in straight motion

    Directory of Open Access Journals (Sweden)

    Jorge eOtero-Millan

    2011-11-01

    Full Text Available Illusions developed by magicians are a rich and largely untapped source of insight into perception and cognition. Here we show that curved motion, as employed by the magician in a classic sleight of hand trick, generates stronger misdirection than rectilinear motion, and that this difference can be explained by the differential engagement of the smooth pursuit and the saccadic oculomotor systems. This research moreover exemplifies how the magician’s intuitive understanding of the spectator’s mindset can surpass that of the cognitive scientist in specific instances, and that observation-based behavioral insights developed by magicians are worthy of quantitative investigation in the neuroscience laboratory.

  12. Expression of P2X7R in breast cancer tissue and the induction of apoptosis by the gene-specific shRNA in MCF-7 cells.

    Science.gov (United States)

    Tan, Chao; Han, L I; Zou, Lili; Luo, Chunhua; Liu, Aihua; Sheng, Xiejing; Xi, Dee

    2015-10-01

    The aim of the present study was to investigate the effects of P2X7R short hairpin (sh)RNA on the proliferation and apoptosis of MCF-7 cells, and to detect the expression of P2X7R in breast cancer and MCF-7 cells. In order to detect the expression of P2X7R in normal breast and breast cancer tissues, quantitative reverse transcription-polymerase chain reaction (qRT-PCR), western blot analysis and immunohistochemistry were performed. A P2X7-targeted shRNA sequence and a scrambled sequence were inserted into the pLKO.1 expression vector, and MCF-7 cells with stable transfection of P2X7R-shRNA and P2X7R-scrambled shRNA (control) were selected. qRT-PCR was used to detect the mRNA expression levels of P2X7R in the MCF-7 cells transfected with P2X7R-shRNA and scrambled shRNA. In addition, protein expression levels of P2X7R in the fresh tumor tissues were detected by western blot analysis. An MTT assay was used to detect the proliferation rate at different time points, while flow cytometry was used to detect the growth inhibition and apoptosis rate of the stably transfected MCF-7 cells. P2X7R expression levels in the breast cancer tissues were higher when compared with the normal breast tissue, and a positive correlation was observed with the estrogen receptor (ER + ), as shown by qRT-PCR, western blot analysis and immunohistochemistry. Plasmids expressing P2X7 gene-specific shRNA and scrambled shRNA were constructed and transfected into MCF-7 cells. The qRT-PCR results revealed lower mRNA expression levels of P2X7 in the P2X7R-shRNA cells when compared with the scrambled shRNA cells. Furthermore, western blot analysis demonstrated that P2X7 protein was highly expressed in the MCF-7 cells transfected with scrambled shRNA, while low expression was observed in the P2X7R-shRNA-transfected cells. Following transfection of the recombinant plasmids into the MCF-7 cells, the proliferation rate in each group was analyzed. The P2X7R-shRNA and KN-62 groups were shown to have

  13. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  14. Enhancing the throughput and multiplexing capabilities of next generation sequencing for efficient implementation of pooled shRNA and CRISPR screens.

    Science.gov (United States)

    Islam, Md Fahmid; Watanabe, Atsushi; Wong, Lai; Lazarou, Conor; Vizeacoumar, Frederick S; Abuhussein, Omar; Hill, Wayne; Uppalapati, Maruti; Geyer, C Ronald; Vizeacoumar, Franco J

    2017-04-21

    Next generation sequencing is becoming the method of choice for functional genomic studies that use pooled shRNA or CRISPR libraries. A key challenge in sequencing these mixed-oligo libraries is that they are highly susceptible to hairpin and/or heteroduplex formation. This results in polyclonal, low quality, and incomplete reads and reduces sequencing throughput. Unfortunately, this challenge is significantly magnified in low-to-medium throughput bench-top sequencers as failed reads significantly perturb the maximization of sequence coverage and multiplexing capabilities. Here, we report a methodology that can be adapted to maximize the coverage on a bench-top, Ion PGM System for smaller shRNA libraries with high efficiency. This ligation-based, half-shRNA sequencing strategy minimizes failed sequences and is also equally amenable to high-throughput sequencers for increased multiplexing. Towards this, we also demonstrate that our strategy to reduce heteroduplex formation improves multiplexing capabilities of pooled CRISPR screens using Illumina NextSeq 500. Overall, our method will facilitate sequencing of pooled shRNA or CRISPR libraries from genomic DNA and maximize sequence coverage.

  15. Conservatives Anticipate and Experience Stronger Emotional Reactions to Negative Outcomes.

    Science.gov (United States)

    Joel, Samantha; Burton, Caitlin M; Plaks, Jason E

    2014-02-01

    The present work examined whether conservatives and liberals differ in their anticipation of their own emotional reactions to negative events. In two studies, participants imagined experiencing positive or negative outcomes in domains that do not directly concern politics. In Study 1, 190 American participants recruited online (64 male, Mage  = 32 years) anticipated their emotional responses to romantic relationship outcomes. In Study 2, 97 Canadian undergraduate students (26 male, Mage  = 21 years) reported on their anticipated and experienced emotional responses to academic outcomes. In both studies, more conservative participants predicted they would feel stronger negative emotions following negative outcomes than did more liberal participants. Furthermore, a longitudinal follow-up of Study 2 participants revealed that more conservative participants actually felt worse than more liberal participants after receiving a lower-than-desired exam grade. These effects remained even when controlling for the Big Five traits, prevention focus, and attachment style (Study 1), and optimism (Study 2). We discuss how the relationship between political orientation and anticipated affect likely contributes to differences between conservatives and liberals in styles of decision and policy choices. © 2013 Wiley Periodicals, Inc.

  16. Stronger inducible defences enhance persistence of intraguild prey.

    Science.gov (United States)

    Kratina, Pavel; Hammill, Edd; Anholt, Bradley R

    2010-09-01

    1. Intraguild predation is widespread in nature despite its potentially destabilizing effect on food web dynamics. 2. Anti-predator inducible defences affect both birth and death rates of populations and have the potential to substantially modify food web dynamics and possibly increase persistence of intraguild prey. 3. In a chemostat experiment, we investigated the long-term effects of inducible defences on the dynamics of aquatic microbial food webs consisting of an intraguild predator, intraguild prey, and a basal resource. We controlled environmental conditions and selected strains of intraguild prey that varied in the strength of expressed inducible defences. 4. We found that intraguild prey with a stronger tendency to induce an anti-predator morphology persist for significantly longer periods of time. In addition, model selection analysis implied that flexibility in defensive phenotype (inducibility itself) is most likely the factor responsible for the enhanced persistence. 5. As patterns at the community level often emerge as a result of the life-history traits of individuals, we propose that inducible defences increase the persistence of populations and may contribute to the widespread occurrence of theoretically unstable intraguild predation systems in nature.

  17. Building Stronger State Energy Partnerships with the U.S. Department of Energy

    Energy Technology Data Exchange (ETDEWEB)

    Marks, Kate

    2011-09-30

    This final technical report details the results of total work efforts and progress made from October 2007 – September 2011 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-07NT43264, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Energy Assurance and Critical Infrastructure, State and Regional Technical Assistance, Regional Initiative, Regional Coordination and Technical Assistance, and International Activities in China. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

  18. Is Polar Amplification Deeper and Stronger than Dynamicists Assume?

    Science.gov (United States)

    Scheff, J.; Maroon, E.

    2017-12-01

    In the CMIP multi-model mean under strong future warming, Arctic amplification is confined to the lower troposphere, so that the meridional gradient of warming reverses around 500 mb and the upper troposphere is characterized by strong "tropical amplification" in which warming weakens with increasing latitude. This model-derived pattern of warming maxima in the upper-level tropics and lower-level Arctic has become a canonical assumption driving theories of the large-scale circulation response to climate change. Yet, several lines of evidence and reasoning suggest that Arctic amplification may in fact extend through the entire depth of the troposphere, and/or may be stronger than commonly modeled. These include satellite Microwave Sounding Unit (MSU) temperature trends as a function of latitude and vertical level, the recent discovery that the extratropical negative cloud phase feedback in models is largely spurious, and the very strong polar amplification observed in past warm and lukewarm climates. Such a warming pattern, with deep, dominant Arctic amplification, would have very different implications for the circulation than a canonical CMIP-like warming: instead of slightly shifting poleward and strengthening, eddies, jets and cells might shift equatorward and considerably weaken. Indeed, surface winds have been mysteriously weakening ("stilling") at almost all stations over the last half-century or so, there has been no poleward shift in northern hemisphere circulation metrics, and past warm climates' subtropics were apparently quite wet (and their global ocean circulations were weak.) To explore these possibilities more deeply, we examine the y-z structure of warming and circulation changes across a much broader range of models, scenarios and time periods than the CMIP future mean, and use an MSU simulator to compare them to the satellite warming record. Specifically, we examine whether the use of historical (rather than future) forcing, AMIP (rather than CMIP

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. Effect of lentivirus-mediated shRNA inactivation of HK1, HK2, and HK3 genes in colorectal cancer and melanoma cells.

    Science.gov (United States)

    Kudryavtseva, Anna V; Fedorova, Maria S; Zhavoronkov, Alex; Moskalev, Alexey A; Zasedatelev, Alexander S; Dmitriev, Alexey A; Sadritdinova, Asiya F; Karpova, Irina Y; Nyushko, Kirill M; Kalinin, Dmitry V; Volchenko, Nadezhda N; Melnikova, Nataliya V; Klimina, Kseniya M; Sidorov, Dmitry V; Popov, Anatoly Y; Nasedkina, Tatiana V; Kaprin, Andrey D; Alekseev, Boris Y; Krasnov, George S; Snezhkina, Anastasiya V

    2016-12-22

    The switch from oxidative phosphorylation to glycolysis in proliferating cancer cells, even under aerobic conditions, has been shown first in 1926 by Otto Warburg. Today this phenomenon is known as the "Warburg effect" and recognized as a hallmark of cancer. The metabolic shift to glycolysis is associated with the alterations in signaling pathways involved in energy metabolism, including glucose uptake and fermentation, and regulation of mitochondrial functions. Hexokinases (HKs), which catalyze the first step of glycolysis, have been identified to play a role in tumorigenesis of human colorectal cancer (CRC) and melanoma. However, the mechanism of action of HKs in the promotion of tumor growth remains unclear. The purpose of the present study was to investigate the effect of silencing of hexokinase genes (HK1, HK2, and HK3) in colorectal cancer (HT-29, SW 480, HCT-15, RKO, and HCT 116) and melanoma (MDA-MB-435S and SK-MEL-28) cell lines using short hairpin RNA (shRNA) lentiviral vectors. shRNA lentiviral plasmid vectors pLSLP-HK1, pLSLP-HK2, and pLSLP-HK3 were constructed and then transfected separately or co-transfected into the cells. HK2 inactivation was associated with increased expression of HK1 in colorectal cancer cell lines pointing to the compensation effect. Simultaneous attenuation of HK1 and HK2 levels led to decreased cell viability. Co-transfection with shRNA vectors against HK1, HK2, and HK3 mRNAs resulted in a rapid cell death via apoptosis. We have demonstrated that simultaneous inactivation of HK1 and HK2 was sufficient to decrease proliferation and viability of melanoma and colorectal cancer cells. Our results suggest that HK1 and HK2 could be the key therapeutic targets for reducing aerobic glycolysis in examined cancers.

  1. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  2. One Year After Fukushima, Nuclear Safety Is Stronger

    International Nuclear Information System (INIS)

    2012-01-01

    Full text: Nuclear power is safer than it was a year ago as the nuclear industry, regulators and governments act on the lessons of Fukushima, but that safety must never be taken for granted, said Yukiya Amano, Director General of the International Atomic Energy Agency (IAEA). Speaking ahead of the first anniversary of the Fukushima Daiichi nuclear accident on 11 March, Amano said a culture of constant vigilance and improvement was vital to ensure that the benefits of nuclear power could be harnessed as safely as humanly possible. 'Nuclear safety is stronger than it was a year ago', he said. 'Fukushima Daiichi was a very serious accident, but we know what went wrong and we have a clear course of action to tackle those causes - not only in Japan, but anywhere in the world. 'Now we have to keep up the momentum. Complacency can kill'. On 11 March 2011 a huge earthquake and tsunami left more than 20 000 people dead or missing in eastern Japan. Amidst widespread destruction, the tsunami slammed into the Fukushima Daiichi Nuclear Power Station, disabling cooling systems and leading to fuel meltdowns in three of the six Units. The accident was a jolt to the nuclear industry, regulators and governments. It was triggered by a massive force of nature, but it was existing weaknesses of design regarding defence against natural hazards, regulatory oversight, accident management and emergency response that allowed it to unfold as it did. For example: The nuclear regulator was not sufficiently independent, allowing weak oversight of the operator, TEPCO, and regulatory requirements fell short of international best practice; Not enough attention was paid to guarding against possible extreme events at the Fukushima Daiichi site, leaving critical safety functions such as cooling systems vulnerable to the tsunami; Training to respond to serious accidents was inadequate, as were mitigation measures to prevent hydrogen explosions and protect the venting system; and Accident command lines

  3. Reduce Fraud Risk in Your District with Stronger Internal Controls

    Science.gov (United States)

    Okrzesik, Daryl J.; Nuehring, Bert G.

    2011-01-01

    Internal accounts offer schools a faster, more convenient way to handle the income and expenses that result from student fees, school clubs and organizations, field trips, fund-raising, and similar activities. But this convenience also incurs the added risk of fraud. Fortunately, there are proven ways to strengthen internal controls and reduce…

  4. A Small Indel Mutant Mouse Model of Epidermolytic Palmoplantar Keratoderma and Its Application to Mutant-specific shRNA Therapy

    Directory of Open Access Journals (Sweden)

    Ya-Su Lyu

    2016-01-01

    Full Text Available Epidermolytic palmoplantar keratoderma (EPPK is a relatively common autosomal-dominant skin disorder caused by mutations in the keratin 9 gene (KRT9, with few therapeutic options for the affected so far. Here, we report a knock-in transgenic mouse model that carried a small insertion–deletion (indel mutant of Krt9, c.434delAinsGGCT (p.Tyr144delinsTrpLeu, corresponding to the human mutation KRT9/c.500delAinsGGCT (p.Tyr167delinsTrpLeu, which resulted in a human EPPK-like phenotype in the weight-stress areas of the fore- and hind-paws of both Krt9+/mut and Krt9mut/mut mice. The phenotype confirmed that EPPK is a dominant-negative condition, such that mice heterozygotic for the K9-mutant allele (Krt9+/mut showed a clear EPPK-like phenotype. Then, we developed a mutant-specific short hairpin RNA (shRNA therapy for EPPK mice. Mutant-specific shRNAs were systematically identified in vitro using a luciferase reporter gene assay and delivered into Krt9+/mut mice. shRNA-mediated knockdown of mutant protein resulted in almost normal morphology and functions of the skin, whereas the same shRNA had a negligible effect in wild-type K9 mice. Our results suggest that EPPK can be treated by gene therapy, and this has significant implications for future clinical application.

  5. When surging seas meet stronger rain: Nuclear techniques in flood management

    International Nuclear Information System (INIS)

    Quevenco, Rodolfo

    2015-01-01

    Unusually high rainfall in many parts of the world is a result of climate change, scientists say. Since warmer air can hold more water, the rationale goes, increased temperatures will increase the chances of stronger rainfall events. And when surging seas combine with stronger rain, the outcome is almost certain: floods. Floods are the most frequently occurring natural disasters, and south-east Asia is particularly vulnerable. Climate change and variability are expected to bring about increased typhoon activities, rising sea levels and off-season monsoon rains in southeast Asia and other regions. These can cause devastating floods in countries like Cambodia, Laos, Pakistan, the Philippines, Thailand and Viet Nam. For the residents of these countries who have survived the ravages of major floods, the road to recovery can be long and arduous. As the flood water recedes, they have to contend with new forms of flood: floods of concern and worries as to how to rebuild their houses, their lives and their cities. Governments, too, face huge challenges in rebuilding roads, public buildings, infrastructure and natural resources destroyed or polluted by the flood.

  6. Stronger Dopamine D1 Receptor-Mediated Neurotransmission in Dyskinesia.

    Science.gov (United States)

    Farré, Daniel; Muñoz, Ana; Moreno, Estefanía; Reyes-Resina, Irene; Canet-Pons, Júlia; Dopeso-Reyes, Iria G; Rico, Alberto J; Lluís, Carme; Mallol, Josefa; Navarro, Gemma; Canela, Enric I; Cortés, Antonio; Labandeira-García, José L; Casadó, Vicent; Lanciego, José L; Franco, Rafael

    2015-12-01

    Radioligand binding assays to rat striatal dopamine D1 receptors showed that brain lateralization of the dopaminergic system were not due to changes in expression but in agonist affinity. D1 receptor-mediated striatal imbalance resulted from a significantly higher agonist affinity in the left striatum. D1 receptors heteromerize with dopamine D3 receptors, which are considered therapeutic targets for dyskinesia in parkinsonian patients. Expression of both D3 and D1-D3 receptor heteromers were increased in samples from 6-hydroxy-dopamine-hemilesioned rats rendered dyskinetic by treatment with 3, 4-dihydroxyphenyl-L-alanine (L-DOPA). Similar findings were obtained using striatal samples from primates. Radioligand binding studies in the presence of a D3 agonist led in dyskinetic, but not in lesioned or L-DOPA-treated rats, to a higher dopamine sensitivity. Upon D3-receptor activation, the affinity of agonists for binding to the right striatal D1 receptor increased. Excess dopamine coming from L-DOPA medication likely activates D3 receptors thus making right and left striatal D1 receptors equally responsive to dopamine. These results show that dyskinesia occurs concurrently with a right/left striatal balance in D1 receptor-mediated neurotransmission.

  7. Ministers at IAEA Conference Call for Stronger Nuclear Security

    International Nuclear Information System (INIS)

    2013-01-01

    Full text: Despite substantial progress in strengthening nuclear security in recent years, more needs to be done worldwide to defend against the threat of nuclear terrorism and other malicious acts involving nuclear or radiological material, a Ministerial Declaration at the IAEA's International Conference on Nuclear Security: Enhancing Global Efforts stated today. More than 1 300 participants at the Conference, which is open to all 159 IAEA Member States, will analyse past and current efforts and consider how future challenges can best be met to ensure effective and sustainable nuclear security worldwide. The Conference, which started in Vienna today and ends on Friday, includes representatives from 123 countries and 21 governmental and non-governmental organizations. The Ministerial Declaration, adopted at a plenary session attended by 34 government ministers and other Heads of Delegation including the Conference President, Hungarian Foreign Affairs Minister Janos Martonyi, says they ''remain concerned about the threat of nuclear and radiological terrorism and of other malicious acts or sabotage related to facilities and activities involving nuclear and other radioactive material.'' The Declaration - the first of its kind for nuclear security - notes that all States are responsible for their own nuclear security, but that international cooperation is important in supporting States' efforts to fulfil their responsibilities. It affirms the central role of the IAEA in strengthening nuclear security globally, and leading coordination of international activities in this field. ''We encourage all States to maintain highly effective nuclear security, including physical protection, for all nuclear and other radioactive material, their transport, use and storage and their associated facilities, as well as protecting sensitive information and maintaining the necessary nuclear security systems and measures to assess and manage their nuclear security effectively,'' the

  8. Ultrasound-targeted microbubble destruction (UTMD assisted delivery of shRNA against PHD2 into H9C2 cells.

    Directory of Open Access Journals (Sweden)

    Li Zhang

    Full Text Available Gene therapy has great potential for human diseases. Development of efficient delivery systems is critical to its clinical translation. Recent studies have shown that microbubbles in combination with ultrasound (US can be used to facilitate gene delivery. An aim of this study is to investigate whether the combination of US-targeted microbubble destruction (UTMD and polyethylenimine (PEI (UTMD/PEI can mediate even greater gene transfection efficiency than UTMD alone and to optimize ultrasonic irradiation parameters. Another aim of this study is to investigate the biological effects of PHD2-shRNA after its transfection into H9C2 cells. pEGFP-N1 or eukaryotic shPHD2-EGFP plasmid was mixed with albumin-coated microbubbles and PEI to form complexes for transfection. After these were added into H9C2 cells, the cells were exposed to US with various sets of parameters. The cells were then harvested and analyzed for gene expression. UTMD/PEI was shown to be highly efficient in gene transfection. An US intensity of 1.5 W/cm2, a microbubble concentration of 300μl/ml, an exposure time of 45s, and a plasmid concentration of 15μg/ml were found to be optimal for transfection. UTMD/PEI-mediated PHD2-shRNA transfection in H9C2 cells significantly down regulated the expression of PHD2 and increased expression of HIF-1α and downstream angiogenesis factors VEGF, TGF-β and bFGF. UTMD/PEI, combined with albumin-coated microbubbles, warrants further investigation for therapeutic gene delivery.

  9. Coupling shRNA screens with single-cell RNA-seq identifies a dual role for mTOR in reprogramming-induced senescence.

    Science.gov (United States)

    Aarts, Marieke; Georgilis, Athena; Beniazza, Meryam; Beolchi, Patrizia; Banito, Ana; Carroll, Thomas; Kulisic, Marizela; Kaemena, Daniel F; Dharmalingam, Gopuraja; Martin, Nadine; Reik, Wolf; Zuber, Johannes; Kaji, Keisuke; Chandra, Tamir; Gil, Jesús

    2017-10-15

    Expression of the transcription factors OCT4, SOX2, KLF4, and cMYC (OSKM) reprograms somatic cells into induced pluripotent stem cells (iPSCs). Reprogramming is a slow and inefficient process, suggesting the presence of safeguarding mechanisms that counteract cell fate conversion. One such mechanism is senescence. To identify modulators of reprogramming-induced senescence, we performed a genome-wide shRNA screen in primary human fibroblasts expressing OSKM. In the screen, we identified novel mediators of OSKM-induced senescence and validated previously implicated genes such as CDKN1A We developed an innovative approach that integrates single-cell RNA sequencing (scRNA-seq) with the shRNA screen to investigate the mechanism of action of the identified candidates. Our data unveiled regulation of senescence as a novel way by which mechanistic target of rapamycin (mTOR) influences reprogramming. On one hand, mTOR inhibition blunts the induction of cyclin-dependent kinase (CDK) inhibitors (CDKIs), including p16 INK4a , p21 CIP1 , and p15 INK4b , preventing OSKM-induced senescence. On the other hand, inhibition of mTOR blunts the senescence-associated secretory phenotype (SASP), which itself favors reprogramming. These contrasting actions contribute to explain the complex effect that mTOR has on reprogramming. Overall, our study highlights the advantage of combining functional screens with scRNA-seq to accelerate the discovery of pathways controlling complex phenotypes. © 2017 Aarts et al.; Published by Cold Spring Harbor Laboratory Press.

  10. Stronger learning recruits additional cell-signaling cascades: c-Jun-N-terminal kinase 1 (JNK1) is necessary for expression of stronger contextual fear conditioning.

    Science.gov (United States)

    Leach, Prescott T; Kenney, Justin W; Gould, Thomas J

    2015-02-01

    Increased training often results in stronger memories but the neural changes responsible for these stronger memories are poorly understood. It is proposed here that higher levels of training that result in stronger memories recruit additional cell signaling cascades. This study specifically examined if c-Jun N-terminal kinase 1 (JNK1) is involved in the formation of stronger fear conditioning memories. Wildtype (WT), JNK1 heterozygous (Het), and JNK1 knockout (KO) mice were fear conditioned with 1 trial, 2 trials, or 4 trials. All mice learned both contextual (hippocampus-dependent) and cued (hippocampus-independent) fear conditioning but for contextual fear conditioning only, the JNK1 KO mice did not show higher levels of learning with increased trials. That is, WT mice showed a significant linear increase in contextual fear conditioning as training trials increased from 1 to 2 to 4 trials whereas KO mice showed the same level of contextual fear conditioning as WT mice for 1 trial training but did not have increased levels of contextual fear conditioning with additional trials. These data suggest that JNK1 may not be critical for learning but when higher levels of hippocampus-dependent learning occur, JNK1 signaling is recruited and is necessary for stronger hippocampus-dependent memory formation. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Regular Exercisers Have Stronger Pelvic Floor Muscles than Non-Regular Exercisers at Midpregnancy.

    Science.gov (United States)

    Bø, Kari; Ellstrøm Engh, Marie; Hilde, Gunvor

    2017-12-26

    Today, all healthy pregnant women are encouraged to be physically active throughout pregnancy, with recommendations to participate in at least 30 min of aerobic activity on most days of the week, in addition to perform strength training of the major muscle groups 2-3 days per week, and also pelvic floor muscle training. There is, however, an ongoing debate whether general physical activity enhances or declines pelvic floor muscle function. To compare vaginal resting pressure, pelvic floor muscle strength and endurance in regular exercisers (exercise ≥ 30 minutes ≥ 3 times per week) and non-exercisers at mid-pregnancy. Furthermore, to assess whether regular general exercise or pelvic floor muscle strength was associated with urinary incontinence. This was a cross-sectional study at mean gestational week 20.9 (± 1.4) including 218 nulliparous pregnant women, mean age 28.6 years (range 19-40) and pre-pregnancy body mass index 23.9 kg/m 2 (SD 4.0). Vaginal resting pressure, pelvic floor muscle strength and pelvic floor muscle endurance were measured by a high precision pressure transducer connected to a vaginal balloon. International Consultation on Incontinence Questionnaire Urinary Incontinence Short Form was used to assess urinary incontinence. Differences between groups were analyzed using Independent Sample T-test. Linear regression analysis was conducted to adjust for pre-pregnancy body mass index, age, smoking during pregnancy and regular pelvic floor muscle training during pregnancy. P-value was set to ≤ 0.05. Regular exercisers had statistically significant stronger ( mean 6.4 cm H 2 O (95% CI: 1.7, 11.2)) and more enduring ( mean 39.9 cm H 2 Osec (95% CI: 42.2, 75.7)) pelvic floor muscles. Only pelvic floor muscle strength remained statistically significant, when adjusting for possible confounders. Pelvic floor muscle strength and not regular general exercise was associated with urinary continence (adjusted B: -6.4 (95% CI: -11.5, -1.4)). Regular

  12. Hippocampal-Prefrontal Reactivation during Learning Is Stronger in Awake Compared with Sleep States.

    Science.gov (United States)

    Tang, Wenbo; Shin, Justin D; Frank, Loren M; Jadhav, Shantanu P

    2017-12-06

    Hippocampal sharp-wave ripple (SWR) events occur during both behavior (awake SWRs) and slow-wave sleep (sleep SWRs). Awake and sleep SWRs both contribute to spatial learning and memory, thought to be mediated by the coordinated reactivation of behavioral experiences in hippocampal-cortical circuits seen during SWRs. Current hypotheses suggest that reactivation contributes to memory consolidation processes, but whether awake and sleep reactivation are suited to play similar or different roles remains unclear. Here we addressed that issue by examining the structure of hippocampal (area CA1) and prefrontal (PFC) activity recorded across behavior and sleep stages in male rats learning a spatial alternation task. We found a striking state difference: prefrontal modulation during awake and sleep SWRs was surprisingly distinct, with differing patterns of excitation and inhibition. CA1-PFC synchronization was stronger during awake SWRs, and spatial reactivation, measured using both pairwise and ensemble measures, was more structured for awake SWRs compared with post-task sleep SWRs. Stronger awake reactivation was observed despite the absence of coordination between network oscillations, namely hippocampal SWRs and cortical delta and spindle oscillations, which is prevalent during sleep. Finally, awake CA1-PFC reactivation was enhanced most prominently during initial learning in a novel environment, suggesting a key role in early learning. Our results demonstrate significant differences in awake and sleep reactivation in the hippocampal-prefrontal network. These findings suggest that awake SWRs support accurate memory storage and memory-guided behavior, whereas sleep SWR reactivation is better suited to support integration of memories across experiences during consolidation. SIGNIFICANCE STATEMENT Hippocampal sharp-wave ripples (SWRs) occur both in the awake state during behavior and in the sleep state after behavior. Awake and sleep SWRs are associated with memory

  13. A stronger necessary condition for the multistationarity of chemical reaction networks.

    Science.gov (United States)

    Soliman, Sylvain

    2013-11-01

    Biochemical reaction networks grow bigger and bigger, fed by the high-throughput data provided by biologists and bred in open repositories of models allowing merging and evolution. Nevertheless, since the available data is still very far from permitting the identification of the increasing number of kinetic parameters of such models, the necessity of structural analyses for describing the dynamics of chemical networks appears stronger every day. Using the structural information, notably from the stoichiometric matrix, of a biochemical reaction system, we state a more strict version of the famous Thomas' necessary condition for multistationarity. In particular, the obvious cases where Thomas' condition was trivially satisfied, mutual inhibition due to a multimolecular reaction and mutual activation due to a reversible reaction, can now easily be ruled out. This more strict condition shall not be seen as some version of Thomas' circuit functionality for the continuous case but rather as related and complementary to the whole domain of the structural analysis of (bio)chemical reaction systems, as pioneered by the chemical reaction network theory.

  14. BUILDING STRONGER STATE ENERGY PARTNERSHIPS WITH THE U.S. DEPARTMENT OF ENERGY

    Energy Technology Data Exchange (ETDEWEB)

    Kate Burke

    2003-09-01

    This technical progress report includes an update of the progress during the third year of cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. The report also describes the barriers in conduct of the effort, and our assessment of future progress and activities. The approach of the project included three tasks during year three. First, NASEO and its Buildings Committee were to focus on raising awareness and coordination of Rebuild activities. Through education, one-on-one communications, and presentations at NASEO meetings and other events, staff and the committee will assist Rebuild officials in stimulating interest in the program and building greater support among State Energy Office Directors. The most recent subtasks added to the project, though not directly related to Rebuild America, fall under this initial task, and support: (a) state plans to implement integrated energy and environmental initiatives, including distributed generation technologies, and (b) initiation of a state collaborative on advanced turbines and hybrid systems. The advanced turbine piece was completed during this year. During the year, a new workplan was accepted by Rebuild America's Dan Sze to supplement the work in this task. This workplan is outlined below. Second, NASEO would work to improve the efficiency of America's schools by assisting states and DOE in promoting projects that result in more energy efficient and clean energy schools and a better learning environment. This task was fully completed during this year. The third task involves energy security issues which NASEO addressed by way of a Summer Fuels Outlook Conference held Tuesday, April 8, 2003. The purpose of this educational event was to inform state, federal, local, and other energy officials about the most recent transportation fuels data and trends. The public benefits part of this task was not funded for Year 3, thus no activity occurred.

  15. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  17. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Perceived stress and biological risk: is the link stronger in Russians than in Taiwanese and Americans?

    Science.gov (United States)

    Glei, Dana A; Goldman, Noreen; Shkolnikov, Vladimir M; Jdanov, Dmitri; Shkolnikova, Maria; Vaupel, James W; Weinstein, Maxine

    2013-07-01

    Allostatic load theory implies a relationship between exposure to psychological stress and multi-system physiological dysregulation. We used data from population-based samples of men and women in Russia (Moscow; n = 1800; age, mean 68.6 years), Taiwan (n = 1036; 65.6 years) and the United States (US; n = 1054; 58.0 years) -- which are likely to vary widely with respect to levels of stress exposure and biological markers -- to determine the magnitude of the association between perceived stress and physiological dysregulation. The measure of overall dysregulation was based on 15 markers including standard cardiovascular/metabolic risk factors as well as markers of inflammation and neuroendocrine activity. Subjective psychological stress was measured by the perceived stress scale. Only the Moscow sample demonstrated a positive association with overall dysregulation in both sexes. In the US, we found an association among women but not men. Among the Taiwanese, who report the lowest perceived stress, there was no association in women but an unexpected inverse relationship in men. The effects also varied across system-level subscores: the association with perceived stress was most consistent for standard cardiovascular/metabolic factors. Perceived stress was associated with inflammation and neuroendocrine activity in some samples. Although the evidence that perceived stress is the primary source of physiological dysregulation is generally modest, it was stronger in Russia where the level of perceived stress was particularly high. For Russia only, we had information about heart function based on a 24 h ambulatory electrocardiogram; perceived stress was consistently associated with heart rate dysregulation in Russian men and women.

  19. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  20. Stronger Accent Following a Stroke: The Case of a Trilingual with Aphasia

    Science.gov (United States)

    Levy, Erika S.; Goral, Mira; De Diesbach, Catharine Castelluccio; Law, Franzo, II

    2011-01-01

    This study documents patterns of change in speech production in a multilingual with aphasia following a cerebrovascular accident (CVA). EC, a right-handed Hebrew-English-French trilingual man, had a left fronto-temporo-parietal CVA, after which he reported that his (native) Hebrew accent became stronger in his (second language) English. Recordings…

  1. Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

    DEFF Research Database (Denmark)

    Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

    2012-01-01

    Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological Seq...... al., 2007. J. Immunol. 178, 7890–7901. doi:10.1016/j.molimm.2012.02.025...

  2. First-order dominance: stronger characterization and a bivariate checking algorithm

    DEFF Research Database (Denmark)

    Range, Troels Martin; Østerdal, Lars Peter Raahave

    2018-01-01

    distributions. Utilizing that this problem can be formulated as a transportation problem with a special structure, we provide a stronger characterization of multivariate first-order dominance and develop a linear time complexity checking algorithm for the bivariate case. We illustrate the use of the checking...

  3. Fasting insulin is a stronger cardiovascular risk factor in women than in men

    NARCIS (Netherlands)

    Oterdoom, Leendert H.; de Vries, Aiko P. J.; Gansevoort, Ron T.; de Jong, Paul E.; Gans, Reinold O. B.; Bakker, Stephan J. L.

    Diabetes is a stronger risk factor for cardiovascular disease (CVD) in women than in men. It is not known whether there is also a sex difference in the association between hyperinsulinaemia, reflecting insulin resistance, and CVD. Fasting insulin was assessed with a specific assay in 6916 fasting,

  4. A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

    DEFF Research Database (Denmark)

    Heydorn, S; Andersen, Klaus Ejner; Johansen, Jeanne Duus

    2003-01-01

    Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...

  5. A Human Capital Framework for a Stronger Teacher Workforce. Advancing Teaching--Improving Learning. White Paper

    Science.gov (United States)

    Myung, Jeannie; Martinez, Krissia; Nordstrum, Lee

    2013-01-01

    Building a stronger teacher workforce requires the thoughtful orchestration of multiple processes working together in a human capital system. This white paper presents a framework that can be used to take stock of current efforts to enhance the teacher workforce in school districts or educational organizations, as well as their underlying theories…

  6. Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

    NARCIS (Netherlands)

    de Goeij, Moniek C. M.; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E.

    2017-01-01

    This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were

  7. Can absolute and proportional anthropometric characteristics distinguish stronger and weaker powerlifters?

    Science.gov (United States)

    Keogh, Justin W L; Hume, Patria A; Pearson, Simon N; Mellow, Peter J

    2009-11-01

    This study sought to compare the anthropometric profiles of 17 weaker and 17 stronger Australasian and Pacific powerlifters who had competed in a regional-, national-, or international-level powerlifting competition in New Zealand. Stronger lifters were defined as those having a Wilks score greater than 410, whereas those in the weaker group had a Wilks score less than 370. Each powerlifter was assessed for 37 anthropometric dimensions by International Society for the Advancement of Kinanthropometry (ISAK) level II and III accredited anthropometrists. Because all powerlifters were highly mesomorphic and possessed large girths and bone breadths, both in absolute terms and when expressed as Phantom-Z scores compared through the Phantom, relatively few significant anthropometric differences were observed. However, stronger lifters had significantly greater muscle mass and larger muscular girths in absolute terms as well as greater Brugsch Index (chest girth/height) and "Phantom"-normalized muscle mass, upper arm, chest, and forearm girths. In terms of the segment lengths and bone breadths, the only significant difference was that stronger lifters had a significantly shorter lower leg than weaker lifters. Because the majority of the significant differences were for muscle mass and muscular girths, it would appear likely that these differences contributed to the stronger lifters' superior performance. Powerlifters may therefore need to devote some of their training to the development of greater levels of muscular hypertrophy if they wish to continue to improve their performance. To better understand the anthropometric determinants of muscular strength, future research should recruit larger samples (particularly of elite lifters) and follow these subjects prospectively.

  8. Injectable supramolecular hydrogel formed from α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron for sustained MMP-9 shRNA plasmid delivery.

    Science.gov (United States)

    Lin, Qianming; Yang, Yumeng; Hu, Qian; Guo, Zhong; Liu, Tao; Xu, Jiake; Wu, Jianping; Kirk, Thomas Brett; Ma, Dong; Xue, Wei

    2017-02-01

    Hydrogels have attracted much attention in cancer therapy and tissue engineering due to their sustained gene delivery ability. To obtain an injectable and high-efficiency gene delivery hydrogel, methoxypolyethylene glycol (MPEG) was used to conjugate with the arginine-functionalized poly(l-lysine) dendron (PLLD-Arg) by click reaction, and then the synthesized MPEG-PLLD-Arg interacted with α-cyclodextrin (α-CD) to form the supramolecular hydrogel by the host-guest interaction. The gelation dynamics, hydrogel strength and shear viscosity could be modulated by α-CD content in the hydrogel. MPEG-PLLD-Arg was confirmed to bind and deliver gene effectively, and its gene transfection efficiency was significantly higher than PEI-25k under its optimized condition. After gelation, MMP-9 shRNA plasmid (pMMP-9) could be encapsulated into the hydrogel matrix in situ and be released from the hydrogels sustainedly, as the release rate was dependent on α-CD content. The released MPEG-PLLD-Arg/pMMP-9 complex still showed better transfection efficiency than PEI-25k and induced sustained tumor cell apoptosis. Also, in vivo assays indicated that this pMMP-9-loaded supramolecular hydrogel could result in the sustained tumor growth inhibition meanwhile showed good biocompatibility. As an injectable, sustained and high-efficiency gene delivery system, this supramolecular hydrogel is a promising candidate for long-term gene therapy. To realize the sustained gene delivery for gene therapy, a supramolecular hydrogel with high-efficiency gene delivery ability was prepared through the host-guest interaction between α-cyclodextrin and PEGylated arginine-functionalized poly(l-lysine) dendron. The obtained hydrogel was injectable and biocompatible with adjustable physicochemical property. More importantly, the hydrogel showed the high-efficiency and sustained gene transfection to our used cells, better than PEI-25k. The supramolecular hydrogel resulted in the sustained tumor growth

  9. Crosstalk in concurrent repeated games impedes direct reciprocity and requires stronger levels of forgiveness.

    Science.gov (United States)

    Reiter, Johannes G; Hilbe, Christian; Rand, David G; Chatterjee, Krishnendu; Nowak, Martin A

    2018-02-07

    Direct reciprocity is a mechanism for cooperation among humans. Many of our daily interactions are repeated. We interact repeatedly with our family, friends, colleagues, members of the local and even global community. In the theory of repeated games, it is a tacit assumption that the various games that a person plays simultaneously have no effect on each other. Here we introduce a general framework that allows us to analyze "crosstalk" between a player's concurrent games. In the presence of crosstalk, the action a person experiences in one game can alter the person's decision in another. We find that crosstalk impedes the maintenance of cooperation and requires stronger levels of forgiveness. The magnitude of the effect depends on the population structure. In more densely connected social groups, crosstalk has a stronger effect. A harsh retaliator, such as Tit-for-Tat, is unable to counteract crosstalk. The crosstalk framework provides a unified interpretation of direct and upstream reciprocity in the context of repeated games.

  10. A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

    DEFF Research Database (Denmark)

    Heydorn, S; Andersen, K E; Johansen, J D

    2003-01-01

    elicitation reaction than patch testing with the allergen (hydroxycitronellal) alone, in patients previously patch tested positive to hydroxycitronellal. A stronger patch test elicitation reaction was defined as at least 1 day of patch test reading showing more positive patch tests......Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...... (+, ++ or +++) on the forearm patch tested with 6 concentrations of SLS plus hydroxycitronellal than on the forearm tested with 6 concentrations of hydroxycitronellal alone and no day of patch test readings showing more positive tests on the hydroxycitronellal forearm. 15/20 (75%) had at least 1 day of patch test reading...

  11. Daytime warming has stronger negative effects on soil nematodes than night-time warming

    OpenAIRE

    Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

    2017-01-01

    Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatmen...

  12. World Bank: Management Controls Stronger, But Challenges in Fighting Corruption Remain

    Science.gov (United States)

    2000-04-01

    outline for possible World Development Report on institutions, including corruption . Completed • Prepare Europe and Central Asia Region...Management Controls Stronger, but Challenges in Fighting Corruption Remain If , 20000417 062 G A O Accountability * Integrity * Reliability GAO... corruption —broadly defined as the abuse of public office for private gain— ’The "World Bank" and "Bank" refer to the World Bank Group of institutions

  13. A stronger version of matrix convexity as applied to functions of Hermitian matrices

    Directory of Open Access Journals (Sweden)

    Kagan Abram

    1999-01-01

    Full Text Available A stronger version of matrix convexity, called hyperconvexity is introduced. It is shown that the function is hyperconvex on the set of Hermitian matrices and is hyperconvex on the set of positive definite Hermitian matrices. The new concept makes it possible to consider weighted averages of matrices of different orders. Proofs use properties of the Fisher information matrix, a fundamental concept of mathematical statistics.

  14. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  15. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  16. Sexual harassment and emotional and behavioural symptoms in adolescence: stronger associations among boys than girls.

    Science.gov (United States)

    Kaltiala-Heino, Riittakerttu; Fröjd, Sari; Marttunen, Mauri

    2016-08-01

    To study the associations between subjection to sexual harassment and emotional (depression) and behavioural (delinquency) symptoms among 14-to-18-year-old adolescents, and gender differences within these associations. 90,953 boys and 91,746 girls aged 14-18 participated in the School Health Promotion Study (SHPS), a school-based survey designed to examine the health, health behaviours, and school experiences of teenagers. Experiences of sexual harassment were elicited with five questions addressing five separate forms of harassment. Depression was measured by the 13-item Beck Depression Inventory and delinquency with a modified version of the International Self-Report Delinquency Study (ISRD) instrument. Data were analysed using cross-tabulations with Chi-square statistics and logistic regression. All sexual harassment experiences studied were associated with both depression (adjusted odds ratios varied from 2.2 to 2.7 in girls and from 2.0 to 5.1 in boys) and delinquency (adjusted odds ratios 3.1-5.0 in girls and 1.7-6.9 in boys). Sexual name-calling had a stronger association with depression and with delinquency in girls (adjusted odds ratios, respectively, 2.4 and 4.2), than in boys (adjusted odds ratios, respectively, 2.0 and 1.7), but otherwise stronger associations with emotional and behavioural symptoms were seen in boys. Subjection to sexual harassment is associated with both emotional and behavioural symptoms in both girls and boys. The associations are mostly stronger for boys. Boys subjected to sexual harassment may feel particularly threatened regarding their masculinity, and there may be less support available for boys traumatised due to sexual harassment.

  17. Building Stronger State Energy Partnerships with the U.S. Department of Energy

    Energy Technology Data Exchange (ETDEWEB)

    David Terry

    2008-09-30

    This final technical report details the results of total work efforts and progress made from July 2000 - July 2008 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Rebuild America/Energy Smart Schools, Higher Education Initiative, Winter/Summer Fuels Outlook Conferences, Energy Emergency, Clean Energy Integration, Energy Star, and Office of Electricity Delivery and Energy Reliability. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

  18. The University of Florida Department of Surgery: building a stronger tomorrow on yesterday's foundation.

    Science.gov (United States)

    Behrns, Kevin E; Copeland, Edward M; Howard, Richard J

    2012-01-01

    Established in 1957, the University of Florida Department of Surgery has a solid foundation on which current faculty are driven to build a stronger tomorrow. The department is focused on promoting patient-centered care, expanding its research portfolio to improve techniques and outcomes, and training the surgical leaders of tomorrow. It fosters an environment where faculty, residents, students, and staff challenge long-held traditions with the goal of improving the health of our patients, the quality of our care, and the vitality of our work environment.

  19. Production of plastified wood with stronger static bending strength means of polymerization induced by gamma radiation

    International Nuclear Information System (INIS)

    Silva Filho, Elias

    1999-01-01

    The use of gamma radiation to obtain wood-polymer composites is one of the applications of radiation that presents the most commercial interest. The process, denominated radiopolymerization, comprises the impregnation of monomers into the completely dried wood followed by exposure to gamma radiation to induce polymerization of the impregnated monomers. I this context, the present work aimed the application of this process to seven kinds of wood existing in the brazilian forests. The considered monomer is styrene and the gamma source is Cobalt-60. The obtained wood-polystyrene composites were found to have stronger static bending strength. (author)

  20. Do External or Internal Technology Spillovers Have a Stronger Influence on Innovation Efficiency in China?

    Directory of Open Access Journals (Sweden)

    Xionghe Qin

    2017-09-01

    Full Text Available In this study, we bridge an important gap in the literature by comparing the extent to which external technology spillovers, as indicated by foreign direct investment (FDI, and internal technology spillovers, as indicated by university-institute-industry cooperation (UIC, influence innovation efficiency in China. We divide the innovation process into two sequential stages, namely the knowledge creation and technology commercialization stages, and employ a network data envelopment analysis approach to measure innovation efficiency at each stage. The spatial analysis of the distribution of knowledge creation efficiency and technology commercialization efficiency reveals the heterogeneity of innovation efficiency at the provincial level. Then, a panel data regression is used to analyze the effect of FDI and UIC on innovation efficiency at each stage, using data from 2009 to 2015 for 30 provinces in China. By comparing FDI with UIC, we find that FDI has a higher coefficient and stronger significance level at the knowledge creation stage, while only industry-institute linkages exhibit a stronger association with innovation efficiency at the technology commercialization stage.

  1. The El Niño Southern Oscillation is Getting Bigger and Stronger

    Science.gov (United States)

    McNaught, C.; O'Brien, J.; Strazzo, S. E.

    2012-12-01

    The El Niño Southern Oscillation (ENSO) is an important natural climate variation that affects large portions of the world. We measure ENSO both in terms of its frequency and its magnitude. The different phases of ENSO - El Niño and La Niña - have different properties, and impact the global weather pattern differently. We examine the hypothesis that ENSO's frequency distribution is changing. We demonstrate that, indeed, El Niño's are getting stronger as measured by the maximum anomaly in sea surface temperature (SST). An analysis of the ENSO principal component is conducted using a fast Fourier transform to estimate the spectrum of the SST of the time series. We conclude that the intensity of El Niño events during the period 1970-2010 is statistically significantly higher when compared to the 1930—1970, with a broad spectral peak centered around 4 years. When we compare the SST spectrum for the period 1930-1970 with the spectrum for 1971- 2010, we find the latter period to be much stronger in power. Additionally recently classified ENSO types, including El Niño Modoki and Warm Pool ENSO, are briefly studied.; The first empirical orthogonal function of sea-surface temperatures (1930-2010) accounting for 75% of the variance. The values are indicative of departures from the mean, in °C. Positive (negative) values indicate anomalously higher (lower) sea-surface temperatures ; Normalized first principal component

  2. Stronger interference from distractors in the right hemifield during visual search.

    Science.gov (United States)

    Carlei, Christophe; Kerzel, Dirk

    2018-03-01

    The orientation-bias hypothesis states that there is a bias to attend to the right visual hemifield (RVF) when there is spatial competition between stimuli in the left and right hemifield [Pollmann, S. (1996). A pop-out induced extinction-like phenomenon in neurologically intact subjects. Neuropsychologia, 34(5), 413-425. doi: 10.1016/0028-3932(95)00125-5 ]. In support of this hypothesis, stronger interference was reported for RVF distractors with contralateral targets. In contrast, previous studies using rapid serial visual presentation (RSVP) found stronger interference from distractors in the left visual hemifield (LVF). We used the additional singleton paradigm to test whether this discrepancy was due to the different distractor features that were employed (colour vs. orientation). Interference from the colour distractor with contralateral targets was larger in the RVF than in the LVF. However, the asymmetrical interference disappeared when observers had to search for an inconspicuous colour target instead of the inconspicuous shape target. We suggest that the LVF orienting-bias is limited to situations where search is driven by bottom-up saliency (singleton search) instead of top-down search goals (feature search). In contrast, analysis of the literature suggests the opposite for the LVF bias in RSVP tasks. Thus, the attentional asymmetry may depend on whether the task involves temporal or spatial competition, and whether search is based on bottom-up or top-down signals.

  3. Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

    DEFF Research Database (Denmark)

    Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

    2012-01-01

    of antigen processing and presentation in defining cytotoxic T lymphocyte (CTL) immunogenicity Assarsson et al., 2007. Using an affinity-balanced approach, we demonstrated that immunogenic peptides tend to be more stably bound to MHC-I molecules compared with non-immunogenic peptides. We also developed......Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological...... Sequence Analysis, Department of Systems Biology, Technical University of Denmark, Denmark Efficient presentation of peptide-MHC class I (pMHC-I) complexes to immune T cells should benefit from a stable peptide- MHC-I interaction. However, it has been difficult to distinguish stability from other...

  4. Bone mineral content has stronger association with lean mass than fat mass among Indian urban adolescents

    Directory of Open Access Journals (Sweden)

    Raman K Marwaha

    2015-01-01

    Full Text Available Introduction: There are conflicting reports on the relationship of lean mass (LM and fat mass (FM with bone mineral content (BMC. Given the high prevalence of Vitamin D deficiency in India, we planned the study to evaluate the relationship between LM and FM with BMC in Indian children and adolescents. The objective of the study was to evaluate the relationship of BMC with LM and FM. Materials and Methods: Total and regional BMC, LM, and FM using dual energy X-ray absorptiometry and pubertal staging were assessed in 1403 children and adolescents (boys [B]: 826; girls [G]: 577. BMC index, BMC/LM and BMC/FM ratio, were calculated. Results: The age ranged from 5 to 18 years, with a mean age of 13.2 ± 2.7 years. BMC adjusted for height (BMC index and BMC/height ratio was comparable in both genders. There was no difference in total BMC between genders in the prepubertal group but were higher in more advanced stages of pubertal maturation. The correlation of total as well as regional BMC was stronger for LM (B: Total BMC - 0.880, trunk - 0.715, leg - 0.894, arm - 0.891; G: Total BMC - 0.827, leg - 0.846, arm - 0.815 (all value indicate r2 , P < 0.0001 for all when compared with FM (B: Total BMC - 0.776, trunk - 0.676, leg - 0.772, arm - 0.728; G: Total BMC - 0.781, leg - 0.741, arm - 0.689; all P < 0.0001 except at trunk BMC (LM - 0.682 vs. FM - 0.721; all P < 0.0001, even after controlling for age, height, pubertal stage, and biochemical parameters. Conclusions: BMC had a stronger positive correlation with LM than FM.

  5. Strategies of Building a Stronger Sense of Community for Sustainable Neighborhoods: Comparing Neighborhood Accessibility with Community Empowerment Programs

    Directory of Open Access Journals (Sweden)

    Te-I Albert Tsai

    2014-05-01

    Full Text Available New Urbanist development in the U.S. aims at enhancing a sense of community and seeks to return to the design of early transitional neighborhoods which have pedestrian-oriented environments with retail shops and services within walking distances of housing. Meanwhile, 6000 of Taiwan’s community associations have been running community empowerment programs supported by the Council for Cultural Affairs that have helped many neighborhoods to rebuild so-called community cohesion. This research attempts to evaluate whether neighborhoods with facilities near housing and shorter travel distances within a neighborhood would promote stronger social interactions and form a better community attachment than neighborhoods that have various opportunities for residents to participate in either formal or informal social gatherings. After interviewing and surveying residents from 19 neighborhoods in Taipei’s Beitou District, and correlating the psychological sense of community with inner neighborhood’s daily travel distances and numbers of participatory activities held by community organizations under empowerment programs together with frequencies of regular individual visits and casual meetings, statistical evidence yielded that placing public facilities near residential locations is more effective than providing various programs for elevating a sense of community.

  6. Ni2P Makes Application of the PtRu Catalyst Much Stronger in Direct Methanol Fuel Cells.

    Science.gov (United States)

    Chang, Jinfa; Feng, Ligang; Liu, Changpeng; Xing, Wei

    2015-10-12

    PtRu is regarded as the best catalyst for direct methanol fuel cells, but the performance decay resulting from the loss of Ru seriously hinders commercial applications. Herein, we demonstrated that the presence of Ni2 P largely reduces Ru loss, which thus makes the application of PtRu much stronger in direct methanol fuel cells. Outstanding catalytic activity and stability were observed by cyclic voltammetry. Upon integrating the catalyst material into a practical direct methanol fuel cell, the highest maximum power density was achieved on the PtRu-Ni2P/C catalyst among the reference catalysts at different temperatures. A maximum power density of 69.9 mW cm(-2) at 30 °C was obtained on PtRu-Ni2P/C, which is even higher than the power density of the state-of-the-art commercial PtRu catalyst at 70 °C (63.1 mW cm(-2)). Moreover, decay in the performance resulting from Ru loss was greatly reduced owing to the presence of Ni2 P, which is indicative of very promising applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Stronger associations of obesity with prehypertension and hypertension in young women than in young men.

    Science.gov (United States)

    Wakabayashi, Ichiro

    2012-07-01

    Obesity is an important risk factor for prehypertension and hypertension, and there are sex-specific differences in prevalences of obesity and hypertension. The aim of this study was to determine whether sex influences the relationships of obesity with prehypertension and hypertension. The participants were 28,325 Japanese men and women aged 20-39 years. Obesity was evaluated by BMI (≥ 25 kg/m) and waist-to-height ratio (WHtR ≥ 0.5). Associations of obesity with prehypertension and hypertension were compared in men and women by using odds ratio (OR) and area under the curve (AUC). ORs for prehypertension and hypertension in participants with vs. participants without high BMI or WHtR were significantly higher than a reference level of 1.00 both in men and women and were significantly higher in women than in men. ORs for prehypertension and hypertension of participants with vs. participants without high BMI were 3.10 (2.84-3.38) (men) vs. 5.54 (4.80-6.40) (women) (P men) vs. 34.58 (26.55-45.04) (women) (P men. The results suggest that the associations of obesity with prehypertension and hypertension are stronger in women than in men.

  8. Length effects in pseudo-word spelling: stronger in dyslexic than in non-dyslexic students.

    Science.gov (United States)

    Juul, Holger; Petersen, Dorthe Klint

    2017-10-01

    It is often discussed whether dyslexics show a deviant pattern of reading and spelling development when compared to typically developing students, or whether they follow the same pattern as other students, only at markedly slower rate. The present cross-sectional study investigated phonological encoding skills in dyslexic Danish students. We compared dyslexic and non-dyslexic students from grades 3, 5, 7, and 9 and examined whether effects of item length were stronger in the dyslexic groups. Mixed between-within subjects analyses of variance revealed significant interactions between dyslexia status and item length as the dyslexics at all grade levels were more affected by item length than their non-dyslexic peers. A marked developmental delay was apparent as the dyslexic group from grade 9 performed on approximately the same level as the non-dyslexic group from grade 3. Although the overall difference between these two groups was not significant, a significant interaction between dyslexia status and item length remained because the grade 9 dyslexics were more affected by item length than the younger non-dyslexic students. This difference in error profiles suggests a difference in the developmental patterns of dyslexic vs. non-dyslexic students.

  9. Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations.

    Science.gov (United States)

    Hoogeveen, Heleen R; Jolij, Jacob; Ter Horst, Gert J; Lorist, Monicque M

    2016-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the actual perception of a food's sensory properties, and therefore highly rely on previous experiences of similar consumptions stored in memory. In this study we assessed the differential strength of food associations implicitly stored in memory, using an associative priming paradigm. Participants (N = 30) were exposed to a forced-choice picture-categorization task, in which the food or non-food target images were primed with either non-sensory or sensory related words. We observed a smaller N400 amplitude at the parietal electrodes when categorizing food as compared to non-food images. While this effect was enhanced by the presentation of a food-related word prime during food trials, the primes had no effect in the non-food trials. More specifically, we found that sensory associations are stronger implicitly represented in memory as compared to non-sensory associations. Thus, this study highlights the neuronal mechanisms underlying previous observations that sensory associations are important features of food memory, and therefore a primary motive in food choice.

  10. Phytoplankton Communities Exhibit a Stronger Response to Environmental Changes than Bacterioplankton in Three Subtropical Reservoirs.

    Science.gov (United States)

    Liu, Lemian; Yang, Jun; Lv, Hong; Yu, Xiaoqing; Wilkinson, David M; Yang, Jun

    2015-09-15

    The simultaneous analysis of multiple components of ecosystems is crucial for comprehensive studies of environmental changes in aquatic ecosystems, but such studies are rare. In this study, we analyzed simultaneously the bacterioplankton and phytoplankton communities in three Chinese subtropical reservoirs and compared the response of these two components to seasonal environmental changes. Time-lag analysis indicated that the temporal community dynamics of both bacterioplankton and phytoplankton showed significant directional changes, and variance partitioning suggested that the major reason was the gradual improvement of reservoir water quality from middle eutrophic to oligo-mesotrophic levels during the course of our study. In addition, we found a higher level of temporal stability or stochasticity in the bacterioplankton community than in the phytoplankton community. Potential explanations are that traits associated with bacteria, such as high abundance, widespread dispersal, potential for rapid growth rates, and rapid evolutionary adaptation, may underlie the different stability or stochasticity of bacterioplankton and phytoplankton communities to the environmental changes. In addition, the indirect response of bacterioplankton to nitrogen and phosphorus may result in the fact that environmental deterministic selection was stronger for the phytoplankton than for the bacterioplankton communities.

  11. Age differences in autobiographical memory across the adult lifespan: older adults report stronger phenomenology.

    Science.gov (United States)

    Luchetti, Martina; Sutin, Angelina R

    2018-01-01

    As an individual's life story evolves across adulthood, the subjective experience (phenomenology) of autobiographical memory likely changes. In addition to age at retrieval, both the recency of the memory and the age when a memory is formed may be particularly important to its phenomenology. The present work examines the effect of three temporal factors on phenomenology ratings: (a) age of the participant, (b) age at the event reported in the memory, and (c) memory age (recency). A large sample of Americans (N = 1120), stratified by chronological age, recalled and rated two meaningful memories, a Turning Point and an Early Childhood Memory. Ratings of phenomenology (e.g., vividness of turning points) were higher among older adults compared to younger adults. Memories of events from the reminiscence bump were more positive in valence than events from other time periods but did not differ on other phenomenological dimensions; recent memories had stronger phenomenology than remote memories. In contrast to phenomenology, narrative content was generally unrelated to participant age, age at the event, or memory age. Overall, the findings indicate age-related differences in how meaningful memories are re-experienced.

  12. Speed versus endurance tradeoff in plants: Leaves with higher photosynthetic rates show stronger seasonal declines.

    Science.gov (United States)

    Zhang, Yong-Jiang; Sack, Lawren; Cao, Kun-Fang; Wei, Xue-Mei; Li, Nan

    2017-02-10

    We tested for a tradeoff across species between plant maximum photosynthetic rate and the ability to maintain photosynthesis under adverse conditions in the unfavorable season. Such a trade-off would be consistent with the observed trade-off between maximum speed and endurance in athletes and some animals that has been explained by cost-benefit theory. This trend would have importance for the general understanding of leaf design, and would simplify models of annual leaf carbon relations. We tested for such a trade-off using a database analysis across vascular plants and using an experimental approach for 29 cycad species, representing an ancient plant lineage with diversified evergreen leaves. In both tests, a higher photosynthetic rate per mass or per area in the favorable season was associated with a stronger absolute or percent decline in the unfavorable season. We resolved a possible mechanism based on biomechanics and nitrogen allocation; cycads with high leaf toughness (leaf mass per area) and higher investment in leaf construction than in physiological function (C/N ratio) tended to have lower warm season photosynthesis but less depression in the cool season. We propose that this trade-off, consistent with cost-benefit theory, represents a significant physio-phenological constraint on the diversity and seasonal dynamics of photosynthetic rate.

  13. Plant Identity Exerts Stronger Effect than Fertilization on Soil Arbuscular Mycorrhizal Fungi in a Sown Pasture.

    Science.gov (United States)

    Zheng, Yong; Chen, Liang; Luo, Cai-Yun; Zhang, Zhen-Hua; Wang, Shi-Ping; Guo, Liang-Dong

    2016-10-01

    Arbuscular mycorrhizal (AM) fungi play key roles in plant nutrition and plant productivity. AM fungal responses to either plant identity or fertilization have been investigated. However, the interactive effects of different plant species and fertilizer types on these symbiotic fungi remain poorly understood. We evaluated the effects of the factorial combinations of plant identity (grasses Avena sativa and Elymus nutans and legume Vicia sativa) and fertilization (urea and sheep manure) on AM fungi following 2-year monocultures in a sown pasture field study. AM fungal extraradical hyphal density was significantly higher in E. nutans than that in A. sativa and V. sativa in the unfertilized control and was significantly increased by urea and manure in A. sativa and by manure only in E. nutans, but not by either fertilizers in V. sativa. AM fungal spore density was not significantly affected by plant identity or fertilization. Forty-eight operational taxonomic units (OTUs) of AM fungi were obtained through 454 pyrosequencing of 18S rDNA. The OTU richness and Shannon diversity index of AM fungi were significantly higher in E. nutans than those in V. sativa and/or A. sativa, but not significantly affected by any fertilizer in all of the three plant species. AM fungal community composition was significantly structured directly by plant identity only and indirectly by both urea addition and plant identity through soil total nitrogen content. Our findings highlight that plant identity has stronger influence than fertilization on belowground AM fungal community in this converted pastureland from an alpine meadow.

  14. Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

    Science.gov (United States)

    de Goeij, Moniek C M; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E

    2017-06-01

    This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were used to define episodic drinking (≥6 glasses on 1 day ≥1/week) and chronic drinking (≥14 glasses/week for women and ≥21 for men). These data were linked to longitudinal data from tax registries, to measure the experience and duration of job loss during a 5-year working history. Before the crisis, job loss experience and duration were not associated with harmful drinking. During the crisis, job loss for more than 6 months was associated with episodic drinking [OR 1.40 (95% CI 1.01; 1.94)], while current job loss was associated with chronic drinking [OR 1.43 (95% CI 1.03; 1.98)]. These associations were most clear in men and different between the pre-crisis and crisis period (p interaction = 0.023 and 0.035, respectively). The results suggest that economic crises strengthen the potential impact of job loss on harmful drinking, predominately among men.

  15. Stronger tests of mechanisms underlying geographic gradients of biodiversity: insights from the dimensionality of biodiversity.

    Directory of Open Access Journals (Sweden)

    Richard D Stevens

    Full Text Available Inference involving diversity gradients typically is gathered by mechanistic tests involving single dimensions of biodiversity such as species richness. Nonetheless, because traits such as geographic range size, trophic status or phenotypic characteristics are tied to a particular species, mechanistic effects driving broad diversity patterns should manifest across numerous dimensions of biodiversity. We develop an approach of stronger inference based on numerous dimensions of biodiversity and apply it to evaluate one such putative mechanism: the mid-domain effect (MDE. Species composition of 10,000-km(2 grid cells was determined by overlaying geographic range maps of 133 noctilionoid bat taxa. We determined empirical diversity gradients in the Neotropics by calculating species richness and three indices each of phylogenetic, functional and phenetic diversity for each grid cell. We also created 1,000 simulated gradients of each examined metric of biodiversity based on a MDE model to estimate patterns expected if species distributions were randomly placed within the Neotropics. For each simulation run, we regressed the observed gradient onto the MDE-expected gradient. If a MDE drives empirical gradients, then coefficients of determination from such an analysis should be high, the intercept no different from zero and the slope no different than unity. Species richness gradients predicted by the MDE fit empirical patterns. The MDE produced strong spatially structured gradients of taxonomic, phylogenetic, functional and phenetic diversity. Nonetheless, expected values generated from the MDE for most dimensions of biodiversity exhibited poor fit to most empirical patterns. The MDE cannot account for most empirical patterns of biodiversity. Fuller understanding of latitudinal gradients will come from simultaneous examination of relative effects of random, environmental and historical mechanisms to better understand distribution and abundance of the

  16. Association Between Self-Esteem and Depressive Symptoms Is Stronger Among Black than White Older Adults.

    Science.gov (United States)

    Assari, Shervin

    2017-08-01

    Although poor self-esteem is a core component of depression, we still do not know if racial and ethnic groups differ in the magnitude of this link. This study compared Black and White older adults on the association between self-esteem and depressive symptoms. With a cross-sectional design, this study enrolled 1493 older individuals (age 66 or more) from the 2001 Religion, Aging, and Health Survey, a nationally representative study in the United States. Participants were either Blacks (n = 734) or Whites (n = 759). Depressive symptoms and self-esteem were measured using brief measures of the Center for Epidemiological Studies-Depression scale (CES-D) and the Rosenberg Self-Esteem Scale, respectively. Demographics, socioeconomics, and self-rated health (SRH) were covariates and self-identified race was the moderator. Linear regression models were used for data analysis. Low self-esteem was associated with more depressive symptoms (B = 0.17, 95 % CI 0.15-0.28), above and beyond all covariates. We found a significant and positive interaction between race (Black) and poor self-esteem on depressive symptoms (B = 0.34, 95 % CI 0.17-0.36), suggesting a stronger association between self-esteem and depressive symptoms among Blacks compared to Whites. Although low self-esteem is associated with higher depressive symptoms in both Whites and Blacks (p self-esteem and high depressive symptoms are more closely associated among Blacks than Whites. It is not clear whether depression leaves a larger scar on self-esteem for Blacks, or Blacks are more vulnerable to the effect of low self-esteem on depression.

  17. Ipr1 modified BCG as a novel vaccine induces stronger immunity than BCG against tuberculosis infection in mice.

    Science.gov (United States)

    Wang, Yuwei; Yang, Chun; He, Yonglin; Zhan, Xingxing; Xu, Lei

    2016-08-01

    Tuberculosis is a major challenge to global public health. However, the Bacille Calmette‑Guérin (BCG), the only vaccine available against tuberculosis, has been questioned for the low protective effect. The present study used the mouse gene intracellular pathogen resistance I (Ipr1) gene to alter the current BCG vaccine and evaluated its immunity effect against tuberculosis. This study also investigated the intrinsic relationships of Ipr1 and innate immunity. The reformed BCG (BCGi) carrying the Ipr1 gene was constructed. The mice were intranasally challenged with the M. tuberculosis H37Rv strain after vaccination with BCGi. Protection efficacy of the vaccine was assessed by the organ coefficient, bacterial load and pathological changes in the lung. The differential expression of 113 immune‑related genes between BCGi and BCG groups were detected by an oligo microarray. According to the results of organ coefficient, bacterial load and pathological changes in the organization, BCGi had been shown to have stronger protective effects against M. tuberculosis than BCG. The oligo microarray and reverse transcription‑quantitative polymerase chain reaction further revealed that the Ipr1 gene could upregulate the expression of 13 genes, including a >3‑fold increase in Toll‑like receptor (TLR)4 and 10‑fold increase in surfactant protein D (sftpd). The two genes not only participate in innate immunity against pathogens, but also are closely interrelated. Ipr1 could activate the TLR4 and sftpd signaling pathway and improve the innate immunity against tuberculosis, therefore Ipr1 modified BCG may be a candidate vaccine against M. tuberculosis.

  18. Bell inequalities stronger than the Clauser-Horne-Shimony-Holt inequality for three-level isotropic states

    International Nuclear Information System (INIS)

    Ito, Tsuyoshi; Imai, Hiroshi; Avis, David

    2006-01-01

    We show that some two-party Bell inequalities with two-valued observables are stronger than the CHSH inequality for 3x3 isotropic states in the sense that they are violated by some isotropic states in the 3x3 system that do not violate the CHSH inequality. These Bell inequalities are obtained by applying triangular elimination to the list of known facet inequalities of the cut polytope on nine points. This gives a partial solution to an open problem posed by Collins and Gisin. The results of numerical optimization suggest that they are candidates for being stronger than the I 3322 Bell inequality for 3x3 isotropic states. On the other hand, we found no Bell inequalities stronger than the CHSH inequality for 2x2 isotropic states. In addition, we illustrate an inclusion relation among some Bell inequalities derived by triangular elimination

  19. "This one is stronger". Spotlights on the lifelong learning professional-in-action

    Directory of Open Access Journals (Sweden)

    Josje van der Linden

    2016-06-01

    Full Text Available ABSTRACT“This one is stronger.” Spotlights on the lifelong learning professional-in-action Around the world, lifelong learning is being promoted as a strategy for coping with the changing realities of life and work. The fourth Sustainable Development Goal, agreed in September 2015, reflects this: “ensure equitable and inclusive quality education and promote lifelong learning opportunities for all”. Despite its importance, doubts remain about the implementation of this goal in practice (Van der Kamp, 2000; Regmi, 2015. This article looks at the practice of lifelong learning from the point of view of the professionals involved, their actions and the way these actions are challenged, supported and further developed. Following Schön’s “reflection-in-action” (1983, the term “professional-in-action” is used to stress the role of the professional in making the difference on the ground. The leading question is: how can lifelong learning professionals be supported in their contribution to surrounding society and its citizens? The professionals-in-action featured in this article include professionals based in the Netherlands as well as in other, less privileged contexts. Meaningful experiences are used to build a story about challenges, the right to exist, commitment, recognition and room to manoeuvre. The experiences reveal the importance of interacting with the learner and the professional space that is necessary to achieve this. Professionalization in professional learning communities and practice-oriented research must accompany this professional space. SAMENVATTING“Deze is sterker”. Spotlights op de leven lang leren professional-in-actieOm te kunnen omgaan met de veranderende realiteit in leven en werk, wordt wereldwijd een leven lang leren aangemoedigd. Het vierde duurzame ontwikkelingsdoel, vastgesteld in september 2015, weerspiegelt dit: “het verzekeren van kwalitatief goed onderwijs en het bevorderen van de mogelijkheden

  20. Stronger Association Between Valence- and Arousal Ratings of Affective Pictures with Older Age: Evidence for Variation Across Emotion Categories

    DEFF Research Database (Denmark)

    Mikkelsen, Mai Bjørnskov; Mehlsen, Mimi Yung; Lyby, Marlene Skovgaard

    A sample of older and younger adults rated affective pictures according to valence, arousal and emotion category (happiness, sadness and disgust). Results indicate that older age is associated with a stronger linear association between ratings of arousal and valence. Further, the strength...

  1. Pilot testing of the "First You Should Get Stronger" program among caregivers of older adults with dementia.

    Science.gov (United States)

    Lök, Neslihan; Bademli, Kerime

    In this study, randomized controlled interventional study pattern was used to examine the effects of the "First You Should Get Stronger" program on the caregiving burden and healthy life style behavior of caregivers of dementia patients. "Zarit Caregiver Burden Scale" and "Healthy Life Style Behavior Scale" were used. The study was completed with 40 caregivers in total with 20 in the intervention group and 20 in the control group. A statistically significant difference was determined between the "Zarit Caregiving Burden Scale" and "Healthy Life Style Behavior Scale" score averages of the intervention group that participated in the "First You Should Get Stronger" program in comparison with those of the control group. It is important for the healths of caregivers to include similar programs for the caregivers of dementia patients in continuous and regular applications. The results highlight the importance of the "First You Should Get Stronger" program significantly decreased the caregiving burden and significantly developed the healthy lifestyle behaviors of caregivers in the intervention group. Since dementia is a difficult neurological syndrome with patients cared at home, it generally wears out the caregivers significantly. It is suggested that the nurses and healthcare professionals working with dementia patients are evaluated separately and that they carry out caregiving applications within the scope of the "First You Should Get Stronger" program. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Six Districts Begin the Principal Pipeline Initiative. Building a Stronger Principalship: Volume 1

    Science.gov (United States)

    Turnbull, Brenda J.; Riley, Derek L.; Arcaira, Erikson R.; Anderson, Leslie M.; MacFarlane, Jaclyn R.

    2013-01-01

    This first report of an ongoing evaluation of "The Wallace Foundation's Principal Pipeline Initiative" describes the six participating school districts' plans and activities during the first year of their grants. The evaluation, conducted by "Policy Studies Associates" and the "RAND Corporation," is intended to inform…

  3. [Effects on survival of shRNA mediated APE/Ref1 gene silencing in rat spiral ganglion cells in oxidative stress].

    Science.gov (United States)

    Jiang, Zhendong; Zhong, Cheng; Li, Taijun; Xiang, Zhaolan; Zhang, Xueyuan

    2014-02-01

    To investigate the effects of reducing APE/Ref1 expression in the cultures of rat spiral ganglion cells with oxidative damage induced by H(2)O(2). Primary cultured rat spiral ganglion cells were infected with small interfering RNA to APE/Ref1 (Ape1siRNA) for 72 h, followed by treating with H(2)O(2) (0, 10, 25, 50, 100 and 300 µmol/L) for 1 h , and then cultured in normal medium for 24 h. Western blot were used to detect the level of APE/Ref1 protein and phosphorylation of histone protein H2AX in the infected cells. The caspase3 activation was tested by spectrophotometric method . The cell viability was determined by MTT and the apoptosis of spiral ganglion cells was determined by terminal-deoxynucleotidyl transferase mediated nick and labeling (TUNEL). Western blot showed that infection with Ape1siRNA resulted in APE/Ref1 reduced expression in the spiral ganglion cells. Exposing spiral ganglion cultures with reduced expression of APE/Ref1 to H(2)O(2) (50, 100, 300 µmol/L) for 1 h resulted in increasing in the phosphorylation of histone protein H2AX. The reduction in APE/Ref1 significantly reduced cell viability in cultures 24 h after 1 h expression to 50-300 µmol/L H(2)O(2). The apoptosis of cells and caspase 3 activity was detected significantly improved. The induced of APE/Ref1 results in significantly decrease in spiral ganglion cells viability in oxidative stress. The repairing function of APE/Ref1 is necessary for optimal levels of neuronal rat spiral ganglion cells survival.

  4. Controlling radioactive sources. Stronger 'cradle-to-grave' security needed, IAEA says

    International Nuclear Information System (INIS)

    2002-01-01

    This article highlights the IAEA activities in the field of radiation safety and security of radiation sources and other radioactive materials in its Member States. The IAEA has been active in lending its expertise to search out and secure orphaned sources in several countries. Additionally more than 70 States have joined with the IAEA to collect and share information on trafficking incidents and other unauthorized movements of radioactive sources and other radioactive materials. In March 2002 the IAEA Board of Governors approved a multi-faceted Action plan to Combat Nuclear Terrorism that includes upgrading radiation safety and security. One programme is designed to ensure that significant, uncontrolled radioactive sources are brought under regulatory control and properly secured by providing assistance to Member States in their efforts to identify, locate and secure or dispose of orphan sources

  5. Autophagy, stress, and cancer metabolism: what doesn't kill you makes you stronger.

    Science.gov (United States)

    Mathew, R; White, E

    2011-01-01

    Altered metabolism is a hallmark of cancer. Oncogenic events that lead to cancerous states reorganize metabolic pathways to increase nutrient uptake, which promotes biosynthetic capabilities and cell-autonomous behavior. Increased biosynthesis dictates metabolic demand for ATP, building blocks, and reducing equivalents, rendering cancer cells metabolically in a perpetually hungry state. Moreover, most chemotherapy agents induce acute metabolic stress that cancer cells must overcome for their survival. These metabolic stress cues in cancer cells can activate and cause dependence on the self-cannibalization mechanism of macroautophagy (autophagy hereafter) for the lysosomal turnover and recycling of organelles and proteins for energy and stress survival. For example, activating mutations in Ras or Ras-effector pathways induce autophagy, and cancer cell lines with Ras activation show elevated levels of basal autophagy that is essential for starvation survival and tumor growth. The metabolic implications of this are profound and multifaceted. First, autophagy-mediated degradation and recycling of cellular substrates can support metabolism and promote survival and tumor growth. Second, acute autophagy activation in response to cancer therapy can potentially lead to refractory tumors resistant to conventional chemotherapy. For example, a specific form of autophagy that targets mitochondria (mitophagy) may also function to promote cell survival by the clearance of damaged mitochondria that are potential sources of reactive oxygen species (ROS). These point to the possibility that autophagy is a unique metabolic need, important for survival as well as therapy resistance in cancer cells. Targeting autophagy in single-agent therapy to sensitize aggressive cancers that are dependent on autophagy for survival or in combination with therapeutic agents that induce autophagy as a resistance mechanism may be an effective therapeutic strategy to treat cancer.

  6. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  7. Becoming stronger by becoming weaker: the hunger strike as a mode of doing politics

    DEFF Research Database (Denmark)

    Abrahamsson, Carl Sebastian; Danyi, Endre

    2018-01-01

    Drawing on Judith Butler’s work and a series of studies associated with actor–network theory (ANT), this paper engages with political agency through the concept of performativity. Based on the empirical analysis of a hunger strike that took place in Brussels in 2012 and involved 23 illegal...... immigrants, we aim to achieve three things. First, we foreground physical bodies as political entities caught up in multiple modes of doing politics. Second, we show how such modes relate to one another, reinforcing citizenship, activism and party politics as specific performances of agency associated...

  8. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  9. Implicit and Explicit Gender Beliefs in Spatial Ability: Stronger Stereotyping in Boys than Girls

    Directory of Open Access Journals (Sweden)

    Karin Vander Heyden

    2016-07-01

    Full Text Available Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering and mathematics (STEM and girls’ underrepresentation in these domains. In the current study we investigated the presence of stereotypic gender beliefs on spatial ability (i.e., ‘spatial ability is for boys’ in 10- and 12-year-old children. We used both an explicit measure (i.e., a self-report questionnaire and an implicit measure (i.e., a child IAT. Results of the explicit measure showed that both sexes associated spatial ability with boys, with boys holding more male stereotyped attitudes than girls. On the implicit measure, boys associated spatial ability with boys, while girls were gender-neutral. In addition, we examined the effects of gender beliefs on spatial performance, by experimentally activating gender beliefs within a pretest – instruction – posttest design. We compared three types of instruction: boys are better, girls are better, and no sex differences. No effects of these gender belief instructions were found on children’s spatial test performance (i.e., mental rotation and paper folding. The finding that children of this age already have stereotypic beliefs about the spatial capacities of their own sex is important, as these beliefs may influence children’s choices for spatial leisure activities and educational tracks in the STEM domain.

  10. Implicit and Explicit Gender Beliefs in Spatial Ability: Stronger Stereotyping in Boys than Girls

    Science.gov (United States)

    Vander Heyden, Karin M.; van Atteveldt, Nienke M.; Huizinga, Mariette; Jolles, Jelle

    2016-01-01

    Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering, and mathematics (STEM) and girls' underrepresentation in these domains. In the current study we investigated the presence of stereotypic gender beliefs on spatial ability (i.e., “spatial ability is for boys”) in 10- and 12-year-old children. We used both an explicit measure (i.e., a self-report questionnaire) and an implicit measure (i.e., a child IAT). Results of the explicit measure showed that both sexes associated spatial ability with boys, with boys holding more male stereotyped attitudes than girls. On the implicit measure, boys associated spatial ability with boys, while girls were gender-neutral. In addition, we examined the effects of gender beliefs on spatial performance, by experimentally activating gender beliefs within a pretest—instruction—posttest design. We compared three types of instruction: boys are better, girls are better, and no sex differences. No effects of these gender belief instructions were found on children's spatial test performance (i.e., mental rotation and paper folding). The finding that children of this age already have stereotypic beliefs about the spatial capacities of their own sex is important, as these beliefs may influence children's choices for spatial leisure activities and educational tracks in the STEM domain. PMID:27507956

  11. Implicit and Explicit Gender Beliefs in Spatial Ability: Stronger Stereotyping in Boys than Girls.

    Science.gov (United States)

    Vander Heyden, Karin M; van Atteveldt, Nienke M; Huizinga, Mariette; Jolles, Jelle

    2016-01-01

    Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering, and mathematics (STEM) and girls' underrepresentation in these domains. In the current study we investigated the presence of stereotypic gender beliefs on spatial ability (i.e., "spatial ability is for boys") in 10- and 12-year-old children. We used both an explicit measure (i.e., a self-report questionnaire) and an implicit measure (i.e., a child IAT). Results of the explicit measure showed that both sexes associated spatial ability with boys, with boys holding more male stereotyped attitudes than girls. On the implicit measure, boys associated spatial ability with boys, while girls were gender-neutral. In addition, we examined the effects of gender beliefs on spatial performance, by experimentally activating gender beliefs within a pretest-instruction-posttest design. We compared three types of instruction: boys are better, girls are better, and no sex differences. No effects of these gender belief instructions were found on children's spatial test performance (i.e., mental rotation and paper folding). The finding that children of this age already have stereotypic beliefs about the spatial capacities of their own sex is important, as these beliefs may influence children's choices for spatial leisure activities and educational tracks in the STEM domain.

  12. Hydroxytyrosyl ethyl ether exhibits stronger intestinal anticarcinogenic potency and effects on transcript profiles compared to hydroxytyrosol.

    Science.gov (United States)

    Pereira-Caro, G; Mateos, R; Traka, M H; Bacon, J R; Bongaerts, R; Sarriá, B; Bravo, L; Kroon, P A

    2013-06-01

    The anticarcinogenic activity of hydroxytyrosyl ethyl ether (HTy-Et) compared to its precursor hydroxytyrosol (HTy) has been studied in human Caco-2 colon adenocarcinoma cells. 451 and 977 genes were differentially expressed in Caco-2 cells exposed to HTy or HTy-Et for 24h, respectively, compared with untreated cells (Parrested the cell cycle by up-regulating p21 and CCNG2 and down-regulating CCNB1 protein expression. HTy and HTy-Et also altered the transcription of specific genes involved in apoptosis, as suggested by the up-regulation of BNIP3, BNIP3L, PDCD4 and ATF3 and the activation of caspase-3. Moreover, these polyphenols up-regulated xenobiotic metabolizing enzymes UGT1A10 and CYP1A1, enhancing carcinogen detoxification. In conclusion, these results highlight that HTy and its derivative HTy-Et modulate molecular mechanisms involved in colon cancer, with HTy-Et being more effective than HTy. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

    Science.gov (United States)

    Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

    2018-01-01

    Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

  14. gammadelta and alphabeta T cell lineage choice: resolution by a stronger sense of being.

    Science.gov (United States)

    Wong, Gladys W; Zúñiga-Pflücker, Juan Carlos

    2010-08-01

    A common bipotent thymocyte precursor gives rise to both lineages of T cells, alphabeta and gammadelta. However, the cell intrinsic and extrinsic factors that influence alphabeta- versus gammadelta-lineage bifurcation remain controversial. gammadelta T cells play a unique and vital role in host defense, from maintaining integrity at epithelial and mucosal barriers to their newly defined role as an important innate source of interleukin-17. Although a T cell receptor (TCR)-independent fate choice may take place, emerging data supports a model in which the differential signaling capacity of alphabeta and gammadeltaTCRs play an instructional role in specifying lineage fate, with strength of signal measured by the amount of ERK/MAPK pathway activation. Here we discuss how the interplay between intrinsic TCR signals and cell extrinsic signals provided by Notch and TCR ligands help to assign and support a final lineage fate decision. 2010 Elsevier Ltd. All rights reserved.

  15. Stronger Together: Use of Storytelling at a Dietetics Conference to Promote Professional Collaboration.

    Science.gov (United States)

    Fox, Ann; Gillis, Doris; Anderson, Barb; Lordly, Daphne

    2017-03-01

    During a Dietitians of Canada conference session (2015), 4 facilitators drew upon "Alice's Adventures in Wonderland" (Alice) to engage participants in discussing the future of dietetic education. The aim was to feature Nova Scotia (NS) collaborative experiences as an example of dietetic education planning that could be implemented elsewhere. Three vignettes from the Alice story were chosen as metaphoric representations of dilemmas and assumptions commonly faced by dietetic educators. Story quotations and facilitator questions related to each vignette-guided discussion. The 3-part story-based arts approach of hearing stories, recognizing stories, and telling stories enabled participants to reflect on their own practice, relate to the challenges of others, and question conventional wisdom. Participants heard the Alice stories, recognized their experiences through the NS examples and had an opportunity to tell their own stories during discussions. Participants identified barriers to and strategies for collaborative planning in their own regions. Evaluation suggests most participants were positively engaged by the storytelling approach. Participants recommended that future offerings allow more time for orientation and for completion of planned activities. Bilingual programming should also be considered. Participants valued the unconventional approach to workshop engagement and planned to implement it in their own workplaces.

  16. Stronger sexual selection in warmer waters: the case of a sex role reversed pipefish.

    Directory of Open Access Journals (Sweden)

    Nuno M Monteiro

    Full Text Available In order to answer broader questions about sexual selection, one needs to measure selection on a wide array of phenotypic traits, simultaneously through space and time. Nevertheless, studies that simultaneously address temporal and spatial variation in reproduction are scarce. Here, we aimed to investigate the reproductive dynamics of a cold-water pipefish simultaneously through time (encompassing variation within each breeding cycle and as individuals grow and space (by contrasting populations experiencing distinct water temperature regimes in order to test hypothesized differences in sexual selection. Even though the sampled populations inhabited locations with very different water temperature regimes, they exhibited considerable similarities in reproductive parameters. The most striking was the existence of a well-defined substructure in reproductive activity, where larger individuals reproduce for longer periods, which seemed dependent on a high temperature threshold for breeding rather than on the low temperatures that vary heavily according to latitude. Furthermore, the perceived disparities among populations, such as size at first reproduction, female reproductive investment, or degree of sexual size dimorphism, seemed dependent on the interplay between seawater temperature and the operational sex ratio (OSR. Contrary to our expectations of an enhanced opportunity for sexual selection in the north, we found the opposite: higher female reproductive investment coupled with increased sexual size dimorphism in warmer waters, implying that a prolonged breeding season does not necessarily translate into reduced sexual selection pressure. In fact, if the limited sex has the ability to reproduce either continuously or recurrently during the entire breeding season, an increased opportunity for sexual selection might arise from the need to compete for available partners under strongly biased OSRs across protracted breeding seasons. A more general

  17. Forging stronger partnerships between academic health centers and patient-driven organizations.

    Science.gov (United States)

    Gallin, Elaine K; Bond, Enriqueta; Califf, Robert M; Crowley, William F; Davis, Pamela; Galbraith, Richard; Reece, E Albert

    2013-09-01

    In this article, the authors review the unique role that patient-driven organizations, such as patient advocacy groups and voluntary health organizations (PAG/VHOs), play in translational and clinical research. The importance of fostering collaborations between these organizations and U.S. academic health centers (AHCs) is also discussed. Although both the PAG/VHO community and AHCs are heterogeneous, and although not all organizations are well governed or provide independent, well-researched views, there are many outstanding, well-managed, independent PAG/VHOs in the United States whose missions overlap with those of AHCs. The characteristics of effective PAG/VHOs that would serve as excellent partners for AHCs are discussed, and examples are provided regarding their many contributions, which have included advancing research on rare diseases, recruiting patients for clinical trials, and establishing patient registries and biospecimen banks. The authors present feedback obtained from informal discussions with PAG/VHO staff, as well as a survey of a small sample of organizations, that has identified bureaucratic processes, negotiating intellectual property rights, and institutional review board (IRB) delays as the most problematic areas of interactions with AHCs. Actions are suggested for building effective partnerships between the two sectors and the activities that AHCs should undertake to facilitate their interactions with PAG/VHOs including streamlining contract review and IRB processes and finding ways to better align the incentives motivating academic clinical and translational investigators with the goals of PAG/VHOs. This article is one product of the Clinical Research Forum's Partnering with Patient Advocacy Groups Initiative.

  18. Coastal Bacterioplankton Metabolism Is Stimulated Stronger by Anthropogenic Aerosols than Saharan Dust

    Directory of Open Access Journals (Sweden)

    Isabel Marín

    2017-11-01

    Full Text Available In oligotrophic regions, such as the Mediterranean Sea, atmospheric deposition has the potential to stimulate heterotrophic prokaryote growth and production in surface waters, especially during the summer stratification period. Previous studies focused on the role of leaching nutrients from mineral particles of Saharan (S origin, and were restricted to single locations at given times of the year. In this study, we evaluate the effect of atmospheric particles from diverse sources and with a markedly different chemical composition [S dust and anthropogenic (A aerosols] on marine planktonic communities from three locations of the northwestern Mediterranean with contrasted anthropogenic footprint. Experiments were also carried out at different times of the year, considering diverse initial conditions. We followed the dynamics of the heterotrophic community and a range of biogeochemical and physiological parameters in six experiments. While the effect of aerosols on bacterial abundance was overall low, bacterial heterotrophic production was up to 3.3 and 2.1 times higher in the samples amended with A and S aerosols, respectively, than in the controls. Extracellular enzymatic activities [leu-aminopeptidase (AMA and β-glucosidase (β-Gl] were also enhanced with aerosols, especially from A origin. AMA and β-Gl increased up to 7.1 in the samples amended with A aerosols, and up to 1.7 and 2.1 times, respectively, with S dust. The larger stimulation observed with A aerosols might be attributed to their higher content in nitrate. However, the response was variable depending the initial status of the seawater. In addition, we found that both A and S aerosols stimulated bacterial abundance and metabolism significantly more in the absence of competitors and predators.

  19. Glass Stronger than Steel

    Science.gov (United States)

    Yarris, Lynn

    2011-03-28

    A new type of damage-tolerant metallic glass, demonstrating a strength and toughness beyond that of steel or any other known material, has been developed and tested by a collaboration of researchers from Berkeley Lab and Caltech.

  20. Are Tornadoes Getting Stronger?

    Science.gov (United States)

    Elsner, J.; Jagger, T.

    2013-12-01

    A cumulative logistic model for tornado damage category is developed and examined. Damage path length and width are significantly correlated to the odds of a tornado receiving the next highest damage category. Given values for the cube root of path length and square root of path width, the model predicts a probability for each category. The length and width coefficients are insensitive to the switch to the Enhanced Fujita (EF) scale and to distance from nearest city although these variables are statistically significant in the model. The width coefficient is sensitive to whether or not the tornado caused at least one fatality. This is likely due to the fact that the dimensions and characteristics of the damage path for such events are always based on ground surveys. The model predicted probabilities across the categories are then multiplied by the center wind speed from the categorical EF scale to obtain an estimate of the highest tornado wind speed on a continuous scale in units of meters per second. The estimated wind speeds correlate at a level of .82 (.46, .95) [95% confidence interval] to wind speeds estimated independently from a doppler radar calibration. The estimated wind speeds allow analyses to be done on the tornado database that are not possible with the categorical scale. The modeled intensities can be used in climatology and in environmental and engineering applications. More work needs to be done to understand the upward trends in path length and width. The increases lead to an apparent increase in tornado intensity across all EF categories.

  1. KIR2DL2/2DL3-E35 alleles are functionally stronger than -Q35 alleles

    Science.gov (United States)

    Bari, Rafijul; Thapa, Rajoo; Bao, Ju; Li, Ying; Zheng, Jie; Leung, Wing

    2016-03-01

    KIR2DL2 and KIR2DL3 segregate as alleles of a single locus in the centromeric motif of the killer cell immunoglobulin-like receptor (KIR) gene family. Although KIR2DL2/L3 polymorphism is known to be associated with many human diseases and is an important factor for donor selection in allogeneic hematopoietic stem cell transplantation, the molecular determinant of functional diversity among various alleles is unclear. In this study we found that KIR2DL2/L3 with glutamic acid at position 35 (E35) are functionally stronger than those with glutamine at the same position (Q35). Cytotoxicity assay showed that NK cells from HLA-C1 positive donors with KIR2DL2/L3-E35 could kill more target cells lacking their ligands than NK cells with the weaker -Q35 alleles, indicating better licensing of KIR2DL2/L3+ NK cells with the stronger alleles. Molecular modeling analysis reveals that the glutamic acid, which is negatively charged, interacts with positively charged histidine located at position 55, thereby stabilizing KIR2DL2/L3 dimer and reducing entropy loss when KIR2DL2/3 binds to HLA-C ligand. The results of this study will be important for future studies of KIR2DL2/L3-associated diseases as well as for donor selection in allogeneic stem cell transplantation.

  2. The impact of gambling advertising: Problem gamblers report stronger impacts on involvement, knowledge, and awareness than recreational gamblers.

    Science.gov (United States)

    Hanss, Daniel; Mentzoni, Rune A; Griffiths, Mark D; Pallesen, Ståle

    2015-06-01

    Although there is a general lack of empirical evidence that advertising influences gambling participation, the regulation of gambling advertising is hotly debated among academic researchers, treatment specialists, lobby groups, regulators, and policymakers. This study contributes to the ongoing debate by investigating perceived impacts of gambling advertising in a sample of gamblers drawn from the general population in Norway (n = 6,034). Three dimensions of advertising impacts were identified, representing perceived impacts on (a) gambling-related attitudes, interest, and behavior ("involvement"); (b) knowledge about gambling options and providers ("knowledge"); and (c) the degree to which people are aware of gambling advertising ("awareness"). Overall, impacts were strongest for the knowledge dimension, and, for all 3 dimensions, the impact increased with level of advertising exposure. Those identified as problem gamblers in the sample (n = 57) reported advertising impacts concerning involvement more than recreational gamblers, and this finding was not attributable to differences in advertising exposure. Additionally, younger gamblers reported stronger impacts on involvement and knowledge but were less likely to agree that they were aware of gambling advertising than older gamblers. Male gamblers were more likely than female gamblers to report stronger impacts on both involvement and knowledge. These findings are discussed with regard to existing research on gambling advertising as well as their implications for future research and policy-making. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  3. Removal of proprioception by BCI raises a stronger body ownership illusion in control of a humanlike robot.

    Science.gov (United States)

    Alimardani, Maryam; Nishio, Shuichi; Ishiguro, Hiroshi

    2016-09-22

    Body ownership illusions provide evidence that our sense of self is not coherent and can be extended to non-body objects. Studying about these illusions gives us practical tools to understand the brain mechanisms that underlie body recognition and the experience of self. We previously introduced an illusion of body ownership transfer (BOT) for operators of a very humanlike robot. This sensation of owning the robot's body was confirmed when operators controlled the robot either by performing the desired motion with their body (motion-control) or by employing a brain-computer interface (BCI) that translated motor imagery commands to robot movement (BCI-control). The interesting observation during BCI-control was that the illusion could be induced even with a noticeable delay in the BCI system. Temporal discrepancy has always shown critical weakening effects on body ownership illusions. However the delay-robustness of BOT during BCI-control raised a question about the interaction between the proprioceptive inputs and delayed visual feedback in agency-driven illusions. In this work, we compared the intensity of BOT illusion for operators in two conditions; motion-control and BCI-control. Our results revealed a significantly stronger BOT illusion for the case of BCI-control. This finding highlights BCI's potential in inducing stronger agency-driven illusions by building a direct communication between the brain and controlled body, and therefore removing awareness from the subject's own body.

  4. Fasting insulin has a stronger association with an adverse cardiometabolic risk profile than insulin resistance: the RISC study

    DEFF Research Database (Denmark)

    de Rooij, Susanne R; Dekker, Jacqueline M; Kozakova, Michaela

    2009-01-01

    OBJECTIVE: Fasting insulin concentrations are often used as a surrogate measure of insulin resistance. We investigated the relative contributions of fasting insulin and insulin resistance to cardiometabolic risk and preclinical atherosclerosis. DESIGN AND METHODS: The Relationship between Insulin...... insulin, a simple and practical measure, may be a stronger and independent contributor to cardiometabolic risk and atherosclerosis in a healthy population than hyperinsulinemic euglycemic clamp-derived insulin sensitivity.......OBJECTIVE: Fasting insulin concentrations are often used as a surrogate measure of insulin resistance. We investigated the relative contributions of fasting insulin and insulin resistance to cardiometabolic risk and preclinical atherosclerosis. DESIGN AND METHODS: The Relationship between Insulin...... of the metabolic syndrome in 1177 participants. Carotid artery intima media thickness (IMT) was measured by ultrasound to assess preclinical atherosclerosis. RESULTS: Fasting insulin was correlated with all elements of the metabolic syndrome. Insulin sensitivity (M/I) was correlated with most elements. The odds...

  5. Collective Nostalgia Is Associated With Stronger Outgroup-Directed Anger and Participation in Ingroup-Favoring Collective Action

    Directory of Open Access Journals (Sweden)

    Wing-Yee Cheung

    2017-08-01

    Full Text Available Collective nostalgia refers to longing for the way society used to be. We tested whether collective nostalgia is associated with ingroup-favoring collective action and whether this association is mediated by outgroup-directed anger and outgroup-directed contempt. We conducted an online study of Hong Kong residents (N = 111 during a large-scale democratic social movement, the Umbrella Movement, that took place in Hong Kong in 2014 in response to proposed electoral reforms by the Chinese government in Mainland China. Reported collective nostalgia for Hong Kong’s past was high in our sample and collective nostalgia predicted stronger involvement in ingroup-favoring collective action, and it did so indirectly via higher intensity of outgroup-directed anger (but not through outgroup-directed contempt. We argue that collective nostalgia has implications for strengthening ingroup-serving collective action, and we highlight the importance of arousal of group-based emotions in this process.

  6. Elite level rhythmic gymnasts have significantly more and stronger pain than peers of similar age: a prospective study.

    Science.gov (United States)

    Sabeti, Manuel; Jeremian, Lusine; Graf, Alexandra; Kandelhart, Robert

    2015-01-01

    Rhythmic gymnastics (RG) unites aesthetic, ballet-like motion, and all aspects of gymnastics. To reach elite level, girls begin at early age the intensive training. To date it is unclear if such demanding training influences the incidence and intensity of painful overuse injuries. The purpose of this study is to analyze anatomical painful regions and pain intensity in elite level rhythmic gymnasts (elRG) and compare results with an age-matched control group (CG). This prospective field study was carried out at the European Championship in RG 2013 (218 participating athletes, Vienna, Austria). Volunteering athletes were interviewed according to a preformed questionnaire. As CG secondary school pupils without any competitive sports experience were analyzed accordingly. Overall, 243 young females (144 elRG/66 % of all participants and 99 CG) were observed. ElRGs were significantly (s.) smaller, lighter, and had s. stronger pain (p < 0.001). A total of 72 % of athletes reported to have at least one painful body region compared with 52 % of CG (p < 0.001). ElRG had nearly three times more serious injuries than the CG. In all 23 % off all elRG reported to have had no access to professional medical care. ElRGs were s. more frequently (25 vs 9 %) affected at the lumbar spine and the ankle joint (17.4 vs 7 %). To our knowledge, this trial analyzes the largest cohort of elRG to date. Hence, it is clearly alluded that intensive training in RG is a significant factor causing more and stronger pain than in a CG.

  7. Executive Control Over Cognition: Stronger and Earlier Rule-Based Modulation of Spatial Category Signals in Prefrontal Cortex Relative to Parietal Cortex

    Science.gov (United States)

    Goodwin, Shikha J.; Blackman, Rachael K.; Sakellaridi, Sofia

    2012-01-01

    Human cognition is characterized by flexibility, the ability to select not only which action but which cognitive process to engage to best achieve the current behavioral objective. The ability to tailor information processing in the brain to rules, goals, or context is typically referred to as executive control, and although there is consensus that prefrontal cortex is importantly involved, at present we have an incomplete understanding of how computational flexibility is implemented at the level of prefrontal neurons and networks. To better understand the neural mechanisms of computational flexibility, we simultaneously recorded the electrical activity of groups of single neurons within prefrontal and posterior parietal cortex of monkeys performing a task that required executive control of spatial cognitive processing. In this task, monkeys applied different spatial categorization rules to reassign the same set of visual stimuli to alternative categories on a trial-by-trial basis. We found that single neurons were activated to represent spatially defined categories in a manner that was rule dependent, providing a physiological signature of a cognitive process that was implemented under executive control. We found also that neural signals coding rule-dependent categories were distributed between the parietal and prefrontal cortex—however, not equally. Rule-dependent category signals were stronger, more powerfully modulated by the rule, and earlier to emerge in prefrontal cortex relative to parietal cortex. This suggests that prefrontal cortex may initiate the switch in neural representation at a network level that is important for computational flexibility. PMID:22399773

  8. Project Stronger Together: Protocol to Test a Dyadic Intervention to Improve Engagement in HIV Care Among Sero-Discordant Male Couples in Three US Cities.

    Science.gov (United States)

    Stephenson, Rob; Suarez, Nicolas A; Garofalo, Robert; Hidalgo, Marco A; Hoehnle, Samuel; Thai, Jennie; Mimiaga, Matthew J; Brown, Emily; Bratcher, Anna; Wimbly, Taylor; Sullivan, Patrick

    2017-08-31

    An estimated one- to-two-thirds of new human immunodeficiency virus (HIV) infections among US men who have sex with men (MSM) occur within the context of primary partnerships. Despite this fact, there remains a lack of prevention interventions that focus on male sero-discordant dyads. Interventions that provide male couples with skills to manage HIV risk, and to support each other towards active engagement in HIV prevention and care, are urgently needed. The objective of this paper is to describe the protocol for an innovative dyadic intervention (Stronger Together) that combines couples' HIV testing and dyadic adherence counseling to improve treatment adherence and engagement in care among HIV sero-discordant male couples in the United States. The research activities involve a prospective randomized controlled trial (RCT) of approximately 165 venue- and clinic-recruited sero-discordant male couples (330 individuals: 165 HIV sero-negative and 165 HIV sero-positive). Couples randomized into the intervention arm receive couples' HIV counseling and testing plus dyadic adherence counseling, while those randomized to the control arm receive individual HIV counseling and testing. The study takes place in three cities: Atlanta, GA (study site Emory University); Boston, MA (study site The Fenway Institute); and Chicago, IL (study site Ann & Robert H. Lurie Children's Hospital of Chicago). Cohort recruitment began in 2015. Couples are followed prospectively for 24 months, with study assessments at baseline, 6, 12, 18, and 24 months. Stronger Together was launched in August 2014. To date, 160 couples (97% of the target enrollment) have been enrolled and randomized. The average retention rate across the three sites is 95%. Relationship dissolution has been relatively low, with only 13 couples breaking up during the RCT. Of the 13 couples who have broken up, 10 of the 13 HIV-positive partners have been retained in the cohort; none of these HIV-positive partners have enrolled

  9. Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

    Science.gov (United States)

    Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

    2013-01-01

    Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

  10. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  11. Attentional bias in restrictive eating disorders. Stronger attentional avoidance of high-fat food compared to healthy controls?

    Science.gov (United States)

    Veenstra, Esther M; de Jong, Peter J

    2012-02-01

    A striking feature of the restricting subtype of anorexia nervosa (AN) is that these patients are extremely successful in restricting their food intake. Possibly, they are highly efficient in avoiding attentional engagement of food cues, thereby preventing more elaborate processing of food cues and thus subsequent craving. This study examined whether patients diagnosed with restrictive eating disorders ('restricting AN-like patients'; N=88) indeed show stronger attentional avoidance of visual food stimuli than healthy controls (N=76). Attentional engagement and disengagement were assessed by means of a pictorial exogenous cueing task, and (food and neutral) pictures were presented for 300, 500, or 1000 ms. In the 500 ms condition, both restricting AN-like patients and healthy controls demonstrated attentional avoidance of high-fat food as indexed by a negative cue-validity effect and impaired attentional engagement with high-fat food, whereas no evidence was found for facilitated disengagement from high-fat food. Within the group of restricting AN-like patients, patients with relatively severe eating pathology showed relatively strong attentional engagement with low-fat food. There was no evidence for attentional bias in the 300 and 1000 ms condition. The pattern of findings indicate that attentional avoidance of high-fat food is a common phenomenon that may become counterproductive in restricting AN-like patients, as it could facilitate their restricted food intake. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Conspecific flowers of Sinapis arvensis are stronger competitors for pollinators than those of the invasive weed Bunias orientalis

    Science.gov (United States)

    Hochkirch, Axel; Mertes, Tamara; Rautenberg, Julia

    2012-03-01

    Biological invasions can affect the structure and function of ecosystems and threaten native plant species. Since most weeds rely on mutualistic relationships in their new environment, they may act as new competitors for pollinators. Pollinator competition is likely to be density dependent, but it is often difficult to disentangle competition caused by flower quality from effects caused by flower quantity. In order to test the effects of the presence and number of flowers of the invasive weed Bunias orientalis on the insect visitation rates in a native species ( Sinapis arvensis), we performed two replacement experiments using plants with standardised flower numbers. The visitation rates in S. arvensis were significantly higher than in B. orientalis and the number of insect visits dropped significantly with increasing density of S. arvensis flowers. These results suggest that intraspecific competition among flowers of S. arvensis is stronger than the competitive effect of alien flowers. As flowers of B. orientalis do not seem to distract visitors from S. arvensis, it is unlikely that pollinator competition between these two plant species plays a crucial role. However, it cannot be excluded that mass blossom stands of B. orientalis may distract flower visitors from native species.

  13. How the biotin–streptavidin interaction was made even stronger: investigation via crystallography and a chimaeric tetramer

    Science.gov (United States)

    Chivers, Claire E.; Koner, Apurba L.; Lowe, Edward D.; Howarth, Mark

    2011-01-01

    The interaction between SA (streptavidin) and biotin is one of the strongest non-covalent interactions in Nature. SA is a widely used tool and a paradigm for protein–ligand interactions. We previously developed a SA mutant, termed Tr (traptavidin), possessing a 10-fold lower off-rate for biotin, with increased mechanical and thermal stability. In the present study, we determined the crystal structures of apo-Tr and biotin–Tr at 1.5 Å resolution. In apo-SA the loop (L3/4), near biotin's valeryl tail, is typically disordered and open, but closes upon biotin binding. In contrast, L3/4 was shut in both apo-Tr and biotin–Tr. The reduced flexibility of L3/4 and decreased conformational change on biotin binding provide an explanation for Tr's reduced biotin off- and on-rates. L3/4 includes Ser45, which forms a hydrogen bond to biotin consistently in Tr, but erratically in SA. Reduced breakage of the biotin–Ser45 hydrogen bond in Tr is likely to inhibit the initiating event in biotin's dissociation pathway. We generated a Tr with a single biotin-binding site rather than four, which showed a simi-larly low off-rate, demonstrating that Tr's low off-rate was governed by intrasubunit effects. Understanding the structural features of this tenacious interaction may assist the design of even stronger affinity tags and inhibitors. PMID:21241253

  14. Meta-Analysis of the Effect of Bowel Preparation on Adenoma Detection: Early Adenomas Affected Stronger than Advanced Adenomas.

    Science.gov (United States)

    Sulz, Michael C; Kröger, Arne; Prakash, Meher; Manser, Christine N; Heinrich, Henriette; Misselwitz, Benjamin

    2016-01-01

    Low-quality bowel preparation reduces efficacy of colonoscopy. We aimed to summarize effects of bowel preparation on detection of adenomas, advanced adenomas and colorectal cancer. A systematic literature search was performed regarding detection of colonic lesions after normal and low-quality bowel preparation. Reported bowel preparation quality was transformed to the Aronchick scale with its qualities "excellent", "good", "fair", "poor", and "insufficient" or "optimal" (good/excellent), "suboptimal" (fair/poor/insufficient), "adequate" (good/excellent/fair) and "inadequate" (poor/insufficient). We identified two types of studies: i) Comparative studies, directly comparing lesion detection according to bowel preparation quality, and ii) repeat colonoscopy studies, reporting results of a second colonoscopy after previous low-quality preparation. The detection of early adenomas was reduced with inadequate vs. adequate bowel preparation (Odds Ratio (OR) 0.53, CI: 0.46-0.62, panalysis resulted in smaller confidence intervals compared to earlier studies. Classifying the bowel-preparation quality as suboptimal vs. optimal led to the same qualitative conclusion (OR: 0.81, CI: 0.74-0.89, pdetection were insufficient. Inadequate bowel preparation affects detection of early colonic lesions stronger than advanced lesions.

  15. Risk factors for obesity: further evidence for stronger effects on overweight children and adolescents compared to normal-weight subjects.

    Directory of Open Access Journals (Sweden)

    Andreas Beyerlein

    Full Text Available BACKGROUND: We recently showed that in preschoolers risk factors for overweight show stronger associations with BMI in children with high BMI values. However, it is unclear whether these findings might also pertain to adolescents. METHODS: We extracted data on 3-10 year-old (n = 7,237 and 11-17 year-old (n = 5,986 children from a representative cross-sectional German health survey (KiGGS conducted between 2003 and 2006 and calculated quantile regression models for each age group. We used z-scores of children's body mass index (BMI as outcome variable and maternal BMI, maternal smoking in pregnancy, low parental socioeconomic status, exclusive formula-feeding and high TV viewing time as explanatory variables. RESULTS: In both age groups, the estimated effects of all risk factors except formula-feeding on BMI z-score were greatest for children with the highest BMI z-score. The median BMI z-score of 11-17 year-old children with high TV viewing time, for example, was 0.11 [95% CI: 0.03, 0.19] units higher than the median BMI z-score of teenage children with low TV viewing time. This risk factor was associated with an average difference of 0.18 [0.06, 0.30] units at the 90(th percentile of BMI z-score and of 0.20 [0.07, 0.33] units at the 97(th percentile. CONCLUSIONS: We confirmed that risk factors for childhood overweight are associated with greater shifts in the upper parts of the children's BMI distribution than in the middle and lower parts. These findings pertain also to teenagers and might possibly help to explain the secular shift in the upper BMI percentiles in children and adolescents.

  16. Density regulation in Northeast Atlantic fish populations: Density dependence is stronger in recruitment than in somatic growth.

    Science.gov (United States)

    Zimmermann, Fabian; Ricard, Daniel; Heino, Mikko

    2018-01-30

    Population regulation is a central concept in ecology, yet in many cases its presence and the underlying mechanisms are difficult to demonstrate. The current paradigm maintains that marine fish populations are predominantly regulated by density-dependent recruitment. While it is known that density-dependent somatic growth can be present too, its general importance remains unknown and most practical applications neglect it. This study aimed to close this gap by for the first time quantifying and comparing density dependence in growth and recruitment over a large set of fish populations. We fitted density-dependent models to time-series data on population size, recruitment and age-specific weight from commercially exploited fish populations in the Northeast Atlantic Ocean and the Baltic Sea. Data were standardized to enable a direct comparison within and among populations, and estimated parameters were used to quantify the impact of density regulation on population biomass. Statistically significant density dependence in recruitment was detected in a large proportion of populations (70%), whereas for density dependence in somatic growth the prevalence of density dependence depended heavily on the method (26% and 69%). Despite age-dependent variability, the density dependence in recruitment was consistently stronger among age groups and between alternative approaches that use weight-at-age or weight increments to assess growth. Estimates of density-dependent reduction in biomass underlined these results: 97% of populations with statistically significant parameters for growth and recruitment showed a larger impact of density-dependent recruitment on population biomass. The results reaffirm the importance of density-dependent recruitment in marine fishes, yet they also show that density dependence in somatic growth is not uncommon. Furthermore, the results are important from an applied perspective because density dependence in somatic growth affects productivity and

  17. Can an amine be a stronger acid than a carboxylic acid? The surprisingly high acidity of amine-borane complexes.

    Science.gov (United States)

    Martín-Sómer, Ana; Lamsabhi, Al Mokhtar; Yáñez, Manuel; Dávalos, Juan Z; González, Javier; Ramos, Rocío; Guillemin, Jean-Claude

    2012-12-03

    The gas-phase acidity of a series of amine-borane complexes has been investigated through the use of electrospray mass spectrometry (ESI-MS), with the application of the extended Cooks kinetic method, and high-level G4 ab initio calculations. The most significant finding is that typical nitrogen bases, such as aniline, react with BH(3) to give amine-borane complexes, which, in the gas phase, have acidities as high as those of either phosphoric, oxalic, or salicylic acid; their acidity is higher than many carboxylic acids, such as formic, acetic, and propanoic acid. Indeed the complexation of different amines with BH(3) leads to a substantial increase (from 167 to 195 kJ mol(-1)) in the intrinsic acidity of the system; in terms of ionization constants, this increase implies an increase as large as fifteen orders of magnitude. Interestingly, this increase in acidity is almost twice as large as that observed for the corresponding phosphine-borane analogues. The agreement between the experimental and the G4-based calculated values is excellent. The analysis of the electron-density rearrangements of the amine and the borane moieties indicates that the dative bond is significantly stronger in the N-deprotonated anion than in the corresponding neutral amine-borane complex, because the deprotonated amine is a much better electron donor than the neutral amine. On the top of that, the newly created lone pair on the nitrogen atom in the deprotonated species, conjugates with the BN bonding pair. The dispersion of the extra electron density into the BH(3) group also contributes to the increased stability of the deprotonated species. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. 37% Phosphoric Acid Induced Stronger Matrix Metalloproteinase-8 Expression of the Dental Pulp than 19% Ethylene Diamine Tetraacetic Acid

    Directory of Open Access Journals (Sweden)

    Nadie Fatimatuzzahro

    2014-11-01

    Full Text Available Etching agents such as ethylene diamine tetraacetic acid (EDTA and phosphoric acid which are widely used in adhesive restoration system aimed to increase for retention of restorative materials, may act a chemical irritant that induce inflammation of dental pulp. Inflammation is a body response against irritant and infectious agents. Matrix metalloproteinase-8, the major collagenolytic enzyme, degrades collagen type 1. This enzyme is expressed in low level in normal condition, however, the expression will increase during inflammation. The purpose of the present research was to study the effect of 19% EDTA and 37% phosphoric acid application as an etching agents on the MMP-8 expression of dental pulp. Forty-five male Sprague Dawley rats were divided into 3 groups. Cavity preparation was made on the occlusal surface of maxillary first molar using a round diamond bur. 19% EDTA, 37% phosphoric acid, and distilled water were applied on the surface of the cavity of the teeth in group I, II, and III subsequently. The cavity then filed by glass ionomer cements. The rats were sacrified at 1, 3, 5, 7, and 14 days after the treatment (n=3 for each day. The specimens were then processed histologically. Immunohistochemical (IHC analysis was performed using rabbit anti rat MMP-8 polyclonal antibody to examine MMP-8 expression and HE (Hematoxylen Eosin staining to observe the number of macrophages. The results showed 37% phosphoric acid application induced stronger expression of MMP-8 and higher number of macrophages than 19% EDTA. The strongest expression of MMP-8 seems on 5 days after the treatment where the highest number of macrophages were also found.

  19. Stronger pack warnings predict quitting more than weaker ones: finding from the ITC Malaysia and Thailand surveys.

    Science.gov (United States)

    Fathelrahman, Ahmed I; Li, Lin; Borland, Ron; Yong, Hua-Hie; Omar, Maizurah; Awang, Rahmat; Sirirassamee, Buppha; Fong, Geoffrey T; Hammond, David

    2013-09-18

    mechanisms for influencing quitting regardless of warning strength. The larger and more informative Thai warnings were associated with higher levels of reactions predictive of quitting and stronger associations with subsequent quitting, demonstrating their greater potency.

  20. microRNA-135b expression silences Ppm1e to provoke AMPK activation and inhibit osteoblastoma cell proliferation.

    Science.gov (United States)

    Li, Zheng-Wei; Zhu, Yun-Rong; Zhou, Xiao-Zhong; Zhuo, Bao-Biao; Wang, Xiao-Dong

    2017-04-18

    Forced-activation of AMP-activated protein kinase (AMPK) can possibly inhibit osteoblastoma cells. Here, we aim to provoke AMPK activation via microRNA silencing its phosphatase Ppm1e (protein phosphatase Mg2+/Mn2+-dependent 1e). We showed that microRNA-135b-5p ("miR-135b-5p"), the anti-Ppm1e microRNA, was significantly downregulated in human osteoblastoma tissues. It was correlated with Ppm1e upregulation and AMPKα1 de-phosphorylation. Forced-expression of miR-135b-5p in human osteoblastoma cells (MG-63 and U2OS lines) silenced Ppm1e, and induced a profound AMPKα1 phosphorylation (at Thr-172). Osteoblastoma cell proliferation was inhibited after miR-135b-5p expression. Intriguingly, Ppm1e shRNA knockdown similarly induced AMPKα1 phosphorylation, causing osteoblastoma cell proliferation. Reversely, AMPKα1 shRNA knockdown or dominant negative mutation almost abolished miR-135b-5p's actions in osteoblastoma cells. Further in vivo studies demonstrated that U2OS tumor growth in mice was dramatically inhibited after expressing miR-135b-5p or Ppm1e shRNA. Together, our results suggest that miR-135b-induced Ppm1e silence induces AMPK activation to inhibit osteoblastoma cell proliferation.

  1. microRNA-135b expression silences Ppm1e to provoke AMPK activation and inhibit osteoblastoma cell proliferation

    Science.gov (United States)

    Li, Zheng-Wei; Zhu, Yun-Rong; Zhou, Xiao-Zhong; Zhuo, Bao-Biao; Wang, Xiao-Dong

    2017-01-01

    Forced-activation of AMP-activated protein kinase (AMPK) can possibly inhibit osteoblastoma cells. Here, we aim to provoke AMPK activation via microRNA silencing its phosphatase Ppm1e (protein phosphatase Mg2+/Mn2+-dependent 1e). We showed that microRNA-135b-5p (“miR-135b-5p”), the anti-Ppm1e microRNA, was significantly downregulated in human osteoblastoma tissues. It was correlated with Ppm1e upregulation and AMPKα1 de-phosphorylation. Forced-expression of miR-135b-5p in human osteoblastoma cells (MG-63 and U2OS lines) silenced Ppm1e, and induced a profound AMPKα1 phosphorylation (at Thr-172). Osteoblastoma cell proliferation was inhibited after miR-135b-5p expression. Intriguingly, Ppm1e shRNA knockdown similarly induced AMPKα1 phosphorylation, causing osteoblastoma cell proliferation. Reversely, AMPKα1 shRNA knockdown or dominant negative mutation almost abolished miR-135b-5p's actions in osteoblastoma cells. Further in vivo studies demonstrated that U2OS tumor growth in mice was dramatically inhibited after expressing miR-135b-5p or Ppm1e shRNA. Together, our results suggest that miR-135b-induced Ppm1e silence induces AMPK activation to inhibit osteoblastoma cell proliferation. PMID:28460435

  2. Complex Karyotype is a Stronger Predictor than Del(17p) for Inferior Outcome in Relapsed or Refractory CLL Patients Treated with Ibrutinib-Based Regimens

    Science.gov (United States)

    Thompson, Philip A.; O’Brien, Susan M.; Wierda, William G.; Ferrajoli, Alessandra; Stingo, Francesco; Smith, Susan C.; Burger, Jan A.; Estrov, Zeev; Jain, Nitin; Kantarjian, Hagop M.; Keating, Michael J.

    2016-01-01

    Background Ibrutinib is active in patients with relapsed/refractory (R/R) CLL. In patients treated with ibrutinib for R/R CLL, del(17p) identified by interphase fluorescence in situ hybridization (FISH) is associated with inferior progression-free survival, despite equivalent initial response rates. Del(17p) is frequently associated with complex metaphase karyotype (CKT); the prognostic significance of CKT in ibrutinib-treated patients has not been reported. Methods We reviewed 88 patients treated for R/R CLL at MD Anderson Cancer Center with investigational ibrutinib-based regimens from 2010–2013. Pre-treatment FISH and Lipopolysaccharide-stimulated metaphase cytogenetic analysis were performed on bone marrow. Results Adequate pre-treatment metaphase karyotype was available for 56/88 patients. Karyotype was complex in 21 of 56 cases; 17 of the 21 had del(17p) by FISH. Overall response rate, including partial remission with persistent lymphocytosis, was 94% with 17% complete responses. In multivariable analysis (MVA), only CKT was significantly associated with event-free survival (EFS) [HR 6.6 (1.7–25.6), p=0.006]. Fludarabine-refractory CLL [HR 6.9 (1.8–27.1), p=0.005] and CKT [HR 5.9 (1.6–22.2), p=0.008] were independently associated with inferior overall survival (OS) in MVA. Del(17p) by FISH was not significantly associated with EFS or OS in MVA. Conclusions CKT is a powerful predictor of outcome in ibrutinib-treated patients with R/R CLL and may be a stronger predictor of biological behavior than del(17p) by FISH. Given their relatively poor outcomes, patients with CKT are ideal candidates for studies of consolidative treatment strategies or novel treatment combinations. PMID:26193999

  3. In roots of Arabidopsis thaliana, the damage-associated molecular pattern AtPep1 is a stronger elicitor of immune signalling than flg22 or the chitin heptamer.

    Directory of Open Access Journals (Sweden)

    Lorenzo Poncini

    Full Text Available Plants interpret their immediate environment through perception of small molecules. Microbe-associated molecular patterns (MAMPs such as flagellin and chitin are likely to be more abundant in the rhizosphere than plant-derived damage-associated molecular patterns (DAMPs. We investigated how the Arabidopsis thaliana root interprets MAMPs and DAMPs as danger signals. We monitored root development during exposure to increasing concentrations of the MAMPs flg22 and the chitin heptamer as well as of the DAMP AtPep1. The tissue-specific expression of defence-related genes in roots was analysed using a toolkit of promoter::YFPN lines reporting jasmonic acid (JA-, salicylic acid (SA-, ethylene (ET- and reactive oxygen species (ROS- dependent signalling. Finally, marker responses were analysed during invasion by the root pathogen Fusarium oxysporum. The DAMP AtPep1 triggered a stronger activation of the defence markers compared to flg22 and the chitin heptamer. In contrast to the tested MAMPs, AtPep1 induced SA- and JA-signalling markers in the root and caused a severe inhibition of root growth. Fungal attack resulted in a strong activation of defence genes in tissues close to the invading fungal hyphae. The results collectively suggest that AtPep1 presents a stronger danger signal to the Arabidopsis root than the MAMPs flg22 and chitin heptamer.

  4. In roots of Arabidopsis thaliana, the damage-associated molecular pattern AtPep1 is a stronger elicitor of immune signalling than flg22 or the chitin heptamer.

    Science.gov (United States)

    Poncini, Lorenzo; Wyrsch, Ines; Dénervaud Tendon, Valérie; Vorley, Thomas; Boller, Thomas; Geldner, Niko; Métraux, Jean-Pierre; Lehmann, Silke

    2017-01-01

    Plants interpret their immediate environment through perception of small molecules. Microbe-associated molecular patterns (MAMPs) such as flagellin and chitin are likely to be more abundant in the rhizosphere than plant-derived damage-associated molecular patterns (DAMPs). We investigated how the Arabidopsis thaliana root interprets MAMPs and DAMPs as danger signals. We monitored root development during exposure to increasing concentrations of the MAMPs flg22 and the chitin heptamer as well as of the DAMP AtPep1. The tissue-specific expression of defence-related genes in roots was analysed using a toolkit of promoter::YFPN lines reporting jasmonic acid (JA)-, salicylic acid (SA)-, ethylene (ET)- and reactive oxygen species (ROS)- dependent signalling. Finally, marker responses were analysed during invasion by the root pathogen Fusarium oxysporum. The DAMP AtPep1 triggered a stronger activation of the defence markers compared to flg22 and the chitin heptamer. In contrast to the tested MAMPs, AtPep1 induced SA- and JA-signalling markers in the root and caused a severe inhibition of root growth. Fungal attack resulted in a strong activation of defence genes in tissues close to the invading fungal hyphae. The results collectively suggest that AtPep1 presents a stronger danger signal to the Arabidopsis root than the MAMPs flg22 and chitin heptamer.

  5. Short-hairpin RNA-induced suppression of adenine nucleotide translocase-2 in breast cancer cells restores their susceptibility to TRAIL-induced apoptosis by activating JNK and modulating TRAIL receptor expression

    Directory of Open Access Journals (Sweden)

    Kim Chul-Woo

    2010-09-01

    Full Text Available Abstract Background Tumor necrosis factor (TNF-related apoptosis-inducing ligand (TRAIL; apo2 ligand induces apoptosis in cancer cells but has little effect on normal cells. However, many cancer cell types are resistant to TRAIL-induced apoptosis, limiting the clinical utility of TRAIL as an anti-cancer agent. We previously reported that the suppression of adenine nucleotide translocase-2 (ANT2 by short-hairpin RNA (shRNA induces apoptosis of breast cancer cells, which frequently express high levels of ANT2. In the present study, we examined the effect of RNA shRNA-induced suppression of ANT2 on the resistance of breast cancer cells to TRAIL-induced apoptosis in vitro and in vivo. Results ANT2 shRNA treatment sensitized MCF7, T47 D, and BT474 cells to TRAIL-induced apoptosis by up-regulating the expression of TRAIL death receptors 4 and 5 (DR4 and DR5 and down-regulating the TRAIL decoy receptor 2 (DcR2. In MCF7 cells, ANT2 knockdown activated the stress kinase c-Jun N-terminal kinase (JNK, subsequently stabilizing and increasing the transcriptional activity of p53 by phosphorylating it at Thr81; it also enhanced the expression and activity of DNA methyltransferase 1 (DNMT1. ANT2 shRNA-induced overexpression of DR4/DR5 and TRAIL sensitization were blocked by a p53 inhibitor, suggesting that p53 activation plays an important role in the transcriptional up-regulation of DR4/DR5. However, ANT2 knockdown also up-regulated DR4/DR5 in the p53-mutant cell lines BT474 and T47 D. In MCF7 cells, ANT2 shRNA treatment led to DcR2 promoter methylation and concomitant down-regulation of DcR2 expression, consistent with the observed activation of DNMT1. Treatment of the cells with a demethylating agent or JNK inhibitor prevented the ANT2 shRNA-induced down-regulation of DcR2 and activation of both p53 and DNMT1. In in vivo experiments using nude mice, ANT2 shRNA caused TRAIL-resistant MCF7 xenografts to undergo TRAIL-induced cell death, up-regulated DR4/DR5

  6. Hydrogen bonds of RNA are stronger than those of DNA, but NMR monitors only presence of methyl substituent in uracil/thymine

    NARCIS (Netherlands)

    Swart, M.; Fonseca Guerra, C.; Bickelhaupt, F.M.

    2004-01-01

    Recently, Vakonakis and LiWang (J. Am. Chem. Soc. 2004, 126, 5688) reported experimental evidence for stronger hydrogen bonds in RNA A:U than in DNA A:T base pairs, which was based on differences in NMR shielding for adenine C2. We have analyzed the proposed correlation between NMR shielding and

  7. Stronger diversity effects with increased environmental stress : A study of multitrophic interactions between oak, powdery mildew and ladybirds

    NARCIS (Netherlands)

    Dillen, Mathias; Smit, Christian; Buyse, Martijn; Höfte, Monica; De Clercq, Patrick; Verheyen, Kris

    2017-01-01

    Recent research has suggested that increasing neighbourhood tree species diversity may mitigate the impact of pests or pathogens by supporting the activities of their natural enemies and/or reducing the density of available hosts. In this study, we attempted to assess these mechanisms in a

  8. Plant diversity effects on soil microbial functions and enzymes are stronger than warming in a grassland experiment.

    Science.gov (United States)

    Steinauer, Katja; Tilman, David; Wragg, Peter D; Cesarz, Simone; Cowles, Jane M; Pritsch, Karin; Reich, Peter B; Weisser, Wolfgang W; Eisenhauer, Nico

    2015-01-01

    Anthropogenic changes in biodiversity and atmospheric temperature significantly influence ecosystem processes. However, little is known about potential interactive effects of plant diversity and warming on essential ecosystem properties, such as soil microbial functions and element cycling. We studied the effects of orthogonal manipulations of plant diversity (one, four, and 16 species) and warming (ambient, +1.5 degrees C, and +3 degrees C) on soil microbial biomass, respiration, growth after nutrient additions, and activities of extracellular enzymes in 2011 and 2012 in the BAC (biodiversity and climate) perennial grassland experiment site at Cedar Creek, Minnesota, USA. Focal enzymes are involved in essential biogeochemical processes of the carbon, nitrogen, and phosphorus cycles. Soil microbial biomass and some enzyme activities involved in the C and N cycle increased significantly with increasing plant diversity in both years. In addition, 16-species mixtures buffered warming induced reductions in topsoil water content. We found no interactive effects of plant diversity and warming on soil microbial biomass and growth rates. However, the activity of several enzymes (1,4-beta-glucosidase, 1,4-beta-N-acetylglucosaminidase, phosphatase, peroxidase) depended on interactions between plant diversity and warming with elevated activities of enzymes involved in the C, N, and P cycles at both high plant diversity and high warming levels. Increasing plant diversity consistently decreased microbial biomass-specific enzyme activities and altered soil microbial growth responses to nutrient additions, indicating that plant diversity changed nutrient limitations and/or microbial community composition. In contrast to our expectations, higher plant diversity only buffered temperature effects on soil water content, but not on microbial functions. Temperature effects on some soil enzymes were greatest at high plant diversity. In total, our results suggest that the fundamental

  9. Stronger control of ATP/ADP by proton leak in pancreatic beta-cells than skeletal muscle mitochondria.

    Science.gov (United States)

    Affourtit, Charles; Brand, Martin D

    2006-01-01

    Pancreatic beta cells respond to rising blood glucose concentrations by increasing their oxidative metabolism, which leads to an increased ATP/ADP ratio, closure of K(ATP) channels, depolarization of the plasma membrane potential, influx of calcium and the eventual secretion of insulin. Such a signalling mechanism implies that the ATP/ADP ratio is flexible in beta cells (beta-cells), which is in contrast with other cell types (e.g. muscle and liver) that maintain a stable ATP/ADP poise while respiring at widely varying rates. To determine whether this difference in flexibility is accounted for by mitochondrial peculiarities, we performed a top-down metabolic control analysis to quantitatively assess how ATP/ADP is controlled in mitochondria isolated from rat skeletal muscle and cultured beta cells. We show that the ATP/ADP ratio is more strongly controlled (approx. 7.5-fold) by proton leak in beta cells than in muscle. The comparatively high importance of proton leak in beta cell mitochondria (relative to phosphorylation) is evidenced furthermore by its relatively high level of control over membrane potential and overall respiratory activity. Modular-kinetic analysis of oxidative phosphorylation reveals that these control differences can be fully explained by a higher relative leak activity in beta cell mitochondria, which results in a comparatively high contribution of proton leak to the overall respiratory activity in this system.

  10. Isopropylnorsynephrine is a stronger lipolytic agent in human adipocytes than synephrine and other amines present in Citrus aurantium.

    Science.gov (United States)

    Mercader, Josep; Wanecq, Estelle; Chen, Jian; Carpéné, Christian

    2011-09-01

    The weight loss observed in consumers of extracts of Citrus aurantium (bitter orange) has been tentatively attributed to the lipolytic and thermogenic effects of the alkaloids abundant in the unripe fruit. Synephrine, octopamine, tyramine, and other alkaloids have been repeatedly identified and quantified in Citrus members of the Rutaceae family or in their extracts incorporated in dietary supplements for weight management. However, there are only scarce reports on their lipolytic action. This study aimed at comparing the acute lipolytic activity of synephrine, octopamine, tyramine, and N-methyltyramine in rat and human adipocytes. Maximal response to the prototypical β-adrenergic agonist isoprenaline was taken as reference in both species. In rat, octopamine was slightly more active than synephrine while tyramine and N-methyl tyramine did not stimulate-and even inhibited-lipolysis. In human adipocytes, none of these amines stimulated lipolysis when tested up to 10 μg/ml. At higher doses (≥100 μg/ml), tyramine and N-methyl tyramine induced only 20% of the maximal lipolysis and exhibited antilipolytic properties. Synephrine and octopamine were partially stimulatory at high doses. Since synephrine is more abundant than octopamine in C. aurantium, it should be the main responsible for the putative lipolytic action of the extracts claimed to mitigate obesity. Noteworthy, their common isopropyl derivative, isopropylnorsynephrine (also named isopropyloctopamine or betaphrine), was clearly lipolytic: active at 1 μg/ml and reproducing more than 60% of isoprenaline maximal effect in human adipocytes. This compound, not detected in C. aurantium, and which has few reported adverse effects to date, might be useful for in vivo triglyceride breakdown.

  11. Using social capital to construct a conceptual International Classification of Functioning, Disability, and Health Children and Youth version-based framework for stronger inclusive education policies in Europe.

    Science.gov (United States)

    Maxwell, Gregor; Koutsogeorgou, Eleni

    2012-02-01

    Inclusive education is part of social inclusion; therefore, social capital can be linked to an inclusive education policy and practice. This association is explored in this article, and a practical measure is proposed. Specifically, the World Health Organization's International Classification of Functioning, Disability and Health Children and Youth Version (ICF-CY) is proposed as the link between social capital and inclusive education. By mapping participation and trust indicators of social capital to the ICF-CY and by using the Matrix to Analyse Functioning in Education Systems (MAFES) to analyze the functioning of inclusive education policies and systems, a measure for stronger inclusive education policies is proposed. Such a tool can be used for policy planning and monitoring to ensure better inclusive education environments. In conclusion, combining enhanced social capital linked to stronger inclusive education policies, by using the ICF-CY, can lead to better health and well-being for all.

  12. Gross Primary Production of a Wheat Canopy Relates Stronger to Far Red Than to Red Solar-Induced Chlorophyll Fluorescence

    Directory of Open Access Journals (Sweden)

    Yves Goulas

    2017-01-01

    Full Text Available Sun-induced chlorophyll fluorescence (SIF is a radiation flux emitted by chlorophyll molecules in the red (RSIF and far red region (FRSIF, and is considered as a potential indicator of the functional state of photosynthesis in remote sensing applications. Recently, ground studies and space observations have demonstrated a strong empirical linear relationship between FRSIF and carbon uptake through photosynthesis (GPP, gross primary production. In this study, we investigated the potential of RSIF and FRSIF to represent the functional status of photosynthesis at canopy level on a wheat crop. RSIF and FRSIF were continuously measured in the O2-B (SIF687 and O2-A bands (SIF760 at a high frequency rate from a nadir view at a height of 21 m, simultaneously with carbon uptake using eddy covariance (EC techniques. The relative fluorescence yield (Fyield and the photochemical yield were acquired at leaf level using active fluorescence measurements. SIF was normalized with photosynthetically active radiation (PAR to derive apparent spectral fluorescence yields (ASFY687, ASFY760. At the diurnal scale, we found limited variations of ASFY687 and ASFY760 during sunny days. We also did not find any link between Fyield and light use efficiency (LUE derived from EC, which would prevent SIF from indicating LUE changes. The coefficient of determination ( r 2 of the linear regression between SIF and GPP is found to be highly variable, depending on the emission wavelength, the time scale of observation, sky conditions, and the phenological stage. Despite its photosystem II (PSII origin, SIF687 correlates less than SIF760 with GPP in any cases. The strongest SIF–GPP relationship was found for SIF760 during canopy growth. When canopy is in a steady state, SIF687 and SIF760 are almost as effective as PAR in predicting GPP. Our results imply some constraints in the use of simple linear relationships to infer GPP from SIF, as they are expected to be better predictive

  13. Knockdown of Mgat5 inhibits breast cancer cell growth with activation of CD4+ T cells and macrophages.

    Science.gov (United States)

    Li, Dongqing; Li, Yanmei; Wu, Xianglei; Li, Qiao; Yu, Jing; Gen, Jie; Zhang, Xiao-Lian

    2008-03-01

    N-acetylglucosaminyltransferase V (Mgat5 or GnT-V) is an enzyme that catalyzes beta1-6 branching of N-acetylglucosamine on asparagine (N)-linked oligosaccharides (N-glycan) of cell proteins. The levels of Mgat5 glycan products commonly are increased in malignancies. Although Mgat5 is known to be important in tumor metastases, the effects of Mgat5 on host immune responses are not fully defined. In this study, a Mgat5 specific-short hairpin RNA (shRNA) vector was transfected into murine mammary adenocarcinoma MA782 cells to assess the effects of Mgat5 on tumor cell growth, T cells, and macrophages following inoculation of mice with shRNA-transfected cancer cells. The results showed that blocking expression of Mgat5-modified glycans in MA782 cells significantly suppressed tumor progression both in vivo and in vitro, strongly stimulated Th1 cytokine production, and enhanced opsonophagocytic capability of macrophages in vivo. Importantly, reduction of complex N-glycans on MA782 tumor cells by Mgat5-shRNA resulted in significantly increased proliferation and CD45 surface expression of CD4+ T cells. Our data suggest Mgat5-shRNA could serve as a useful tool to treat breast cancer as well as a powerful tool for the functional investigation of N-glycans and glycoprotein synthesis. Our data suggest that knockdown of Mgat5 inhibits breast cancer cells' growth with activation of CD4+ T cells and macrophages.

  14. The benefits of biotics in erosion control materials for critical sites : better business, improved soil and stronger vegetation

    Energy Technology Data Exchange (ETDEWEB)

    Myrowich, M.; Nelson, R. [Verdyol Plant Research, Riverton, MB (Canada)

    2010-07-01

    This paper discussed the advantages of biotics in erosion control materials, such as the inclusion of hydraulic growth mediums (HGMs) and beneficial growth stimulants, for critical sites. Biotics provide organic additives, and the growth mediums stimulate natural microbial activity, soil aggregate formation, and other natural topsoil forming processes to ensure the long-term health of vegetation. HGMs provide a living base for plants to grow without having to overhaul the entire topsoil structure. The two main components are the biotic system for improving soil and promoting vegetation and a tackifier to secure the HGM to the soil, enhance soil formation processes, and allow vegetation to get established. HGMs are suitable for mining and industrial reclamation because they improve soils and are more cost effective and environmentally sound than trucking in new soil to a site. Two case studies showed how vegetation is quickly established for long-term protection and the benefits for businesses using these erosion-control techniques. The second case study described the manner in which Hydro Quebec successfully employed HGMs to reclaim sensitive roadsides that were being built at construction sites near James Bay. HGMs were found to offer the right solution to the specifics of the site, such as highly erodible subsoil, no available topsoil, and an extremely short growing season. It was concluded that HGMs with biotic components and strong tackifiers improve the performance and economics of erosion control and the overall health of soils for the long-term sustainability of vegetative cover at sensitive sites. 7 refs., 2 figs.

  15. More concerns and stronger beliefs about the necessity of medication in patients with acromegaly are associated with negative illness perceptions and impairment in quality of life.

    Science.gov (United States)

    Andela, Cornelie D; Biermasz, Nienke R; Kaptein, Adrian A; Pereira, Alberto M; Tiemensma, Jitske

    2015-10-01

    Patients with acromegaly can be treated with surgery, radiotherapy and/or medical treatment. In general, patients' beliefs about medication are associated with illness perceptions, a contributory factor of Quality of Life (QoL). At present, there are no quantitative studies on medication beliefs in patients with acromegaly. Here, we aimed to examine possible associations between medication beliefs, illness perceptions, and QoL. Furthermore we aimed to explore whether illness perceptions of patients with remission of acromegaly receiving medical treatment differ from patients without medical treatment. Cross-sectional evaluation of 73 patients with remission of acromegaly (n = 28 patients with medication, n = 45 without medication). The Beliefs about Medicines Questionnaire (BMQ), Illness Perception Questionnaire-Revised (IPQ-R), EuroQoL-5D, and AcroQoL were used for the assessment. Stronger beliefs about the necessity of medical treatment and stronger concerns about the adverse effects were associated with attributing more symptoms to acromegaly, perceiving more negative consequences, and having a stronger belief in a cyclical timeline (BMQ, all P IPQ-R, P = 0.002). Negative medication beliefs were related to more negative illness perceptions and worse disease-specific QoL. Patients receiving medical treatment for acromegaly tend to perceive a more chronic timeline of their disease, compared to patients with remission without medical treatment. These psychological factors need to be taken into account when treating patients and developing a psychosocial education program aiming to improve QoL. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Increasing BMI is associated with reduced expression of P-glycoprotein (ABCB1 gene) in the human brain with a stronger association in African-Americans than Caucasians

    DEFF Research Database (Denmark)

    Nielsen, Julie Vendelbo; Olesen, Rasmus Hansen; Lauridsen, Jesper Krogh

    2016-01-01

    . Using microarray data analysis from 145 neurologically sound adults, this study investigated the association between body mass index (BMI) and ABCB1 expression in the frontal cortex. Increasing BMI values were associated with a statistically significantly reduced expression of ABCB1. Investigation...... of DNA methylation patterns in a subgroup of 52 individuals found that the methylation/expression ratios of ABCB1 were unaffected by increasing BMI values. Interestingly, the effect of BMI on ABCB1 expression appeared stronger in African Americans than in Caucasians.The Pharmacogenomics Journal advance...

  17. Are melanized feather barbs stronger?

    Science.gov (United States)

    Butler, Michael; Johnson, Amy S

    2004-01-01

    Melanin has been associated with increased resistance to abrasion, decreased wear and lowered barb breakage in feathers. But, this association was inferred without considering barb position along the rachis as a potentially confounding variable. We examined the cross-sectional area, breaking force, breaking stress, breaking strain and toughness of melanized and unmelanized barbs along the entire rachis of a primary feather from an osprey (Pandion haliaetus). Although breaking force was higher for melanized barbs, breaking stress (force divided by cross-sectional area) was greater for unmelanized barbs. But when position was considered, all mechanical differences between melanized and unmelanized barbs disappeared. Barb breaking stress, breaking strain and toughness decreased, and breaking stiffness increased, distally along the rachis. These proximal-distal material property changes are small and seem unlikely to affect flight performance of barbs. Our observations of barb bending, breaking and morphology, however, lead us to propose a design principle for barbs. We propose that, by being thicker-walled dorso-ventrally, the barb's flexural stiffness is increased during flight; but, by allowing for twisting when loaded with dangerously high forces, barbs firstly avoid failure by bending and secondly avoid complete failure by buckling rather than rupturing.

  18. A stronger, more supranational Union

    DEFF Research Database (Denmark)

    Beach, Derek

    2012-01-01

    Are we witnessing a transformation of the EU from a strong supranational institution into a weaker Union dominated by governments? This chapter analyzes developments in the past two decades, investigating whether we have seen a shift in power from the EU to member state governments. Is there a sh......Are we witnessing a transformation of the EU from a strong supranational institution into a weaker Union dominated by governments? This chapter analyzes developments in the past two decades, investigating whether we have seen a shift in power from the EU to member state governments....... Is there a shift in the EU towards a new, more intergovernmental Union? The argument in this chapter is that what we are seeing is actually the gradual strengthening of the supranational character of the Union, following a typical trajectory. When a policy area is first included as part of the EU, decision...

  19. A stronger perfume for LPG

    Energy Technology Data Exchange (ETDEWEB)

    Willcox, C.K.

    1996-11-01

    The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

  20. A stronger perfume for LPG

    International Nuclear Information System (INIS)

    Willcox, C.K.

    1996-01-01

    The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

  1. Faster-higher-stronger -- greener

    International Nuclear Information System (INIS)

    Burgess, A.

    2000-01-01

    The Toronto Olympic Bid Committee is reported to have adopted a strong environmental orientation in its bid to bring the 2008 Olympic Games to Toronto. In a recent address, the President of the Committee outlined details of the bid's environmental component which emphasizes the role of sustainable development within the Olympics and the consequences of this orientation on the design, construction and operation of facilities. The Toronto Bid Committee has gained inspiration and momentum for its 'green bid' from the host city of the 2000 Olympic Games, Sidney, Australia, which has won widespread praise for its efforts to clean up Homebush Bay, a brownfield site long seen as a liability for the city. The Toronto Bid Committee is making itself accountable for: creating the healthiest possible conditions for the athletes, visitors and residents; designing for sustainability; protecting, restoring and enhancing human and natural habitats; conserving resources and minimizing the ecological impact of the Games; promoting innovative, technically proven Canadian environmental technology; and fostering environmental awareness and education. The Committee intends to make the environment a priority and not just an afterthought in the bidding process. It hopes to develop specific goals and where possible, quantifiable targets in non-polluting designs for all Olympic housing and sports facilities. Wherever possible renewable power such as wind, solar and fuel cells will be used, and cleaner fuels such as natural gas where green power is not a viable option

  2. Working Longer Makes Students Stronger?

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup

    classroom hours in literacy and maths on ninth grade (aged 16) student performance in writing and maths, respectively. Using population data for Denmark in 2003-2006, I exploit unique policy-induced variation in classroom hours.On average, the reform changed classroom hours by 2.2-3.3% in literacy and maths...

  3. The polar 2e/12c bond in phenalenyl-azaphenalenyl hetero-dimers: Stronger stacking interaction and fascinating interlayer charge transfer

    Science.gov (United States)

    Zhong, Rong-Lin; Xu, Hong-Liang; Li, Zhi-Ru

    2016-08-01

    An increasing number of chemists have focused on the two-electron/multicenter bond (2e/mc) that was first introduced to interpret the bonding mechanism of radical dimers. Herein, we report the polar two-electron/twelve center (2e/12c) bonding character in a series of phenalenyl-azaphenalenyl radical hetero-dimers. Interestingly, the bonding energy of weaker polar hetero-dimer (P-TAP) is dominated by the overlap of the two different singly occupied molecular orbital of radicals, while that of stronger polar hetero-dimer (P-HAP) is dominated by the electrostatic attraction. Results show that the difference between the electronegativity of the monomers plays a prominent role in the essential attribution of the polar 2e/12c bond. Correspondingly, a stronger stacking interaction in the hetero-dimer could be effectively achieved by increasing the difference of nitrogen atoms number between the monomers. It is worthy of note that an interesting interlayer charge transfer character is induced in the polar hetero-dimers, which is dependent on the difference between the electronegativity of the monomers. It is our expectation that the new knowledge about the bonding nature of radical hetero-dimers might provide important information for designing radical based functional materials with various applications.

  4. CCR2 elimination in mice results in larger and stronger tibial bones but bone loss is not attenuated following ovariectomy or muscle denervation.

    Science.gov (United States)

    Mader, Tara L; Novotny, Susan A; Lin, Angela S; Guldberg, Robert E; Lowe, Dawn A; Warren, Gordon L

    2014-11-01

    Bone loss due to age and disuse contributes to osteoporosis and increases fracture risk. It has been hypothesized that such bone loss can be attenuated by modulation of the C-C chemokine receptor 2 (CCR2) and/or its ligands. The objectives of this study were to examine the effects of genetic elimination of CCR2 on cortical and trabecular bones in the mouse tibia and how bone loss was impacted following disuse and estrogen loss. Female CCR2 knockout (CCR2(-/-)) and wildtype mice underwent ovariectomy (OVX) or denervation of musculature adjacent to the tibia (DEN) to induce bone loss. Cortical and trabecular structural properties as well as mechanical properties (i.e., strength) of tibial bones were measured. Compared to wildtype mice, CCR2(-/-) mice had tibiae that were up to 9% larger and stronger; these differences could be explained mainly by the 17% greater body mass (P bone loss per se. These findings indicate that while CCR2(-/-) mice do have larger and stronger bones than do wildtype mice, there is minimal evidence that CCR2 elimination provides protection against bone loss during disuse and estrogen loss.

  5. Anticancer activity of the intraperitoneal-delivered DFP-10825, the cationic liposome-conjugated RNAi molecule targeting thymidylate synthase, on peritoneal disseminated ovarian cancer xenograft model

    Directory of Open Access Journals (Sweden)

    Iizuka K

    2018-03-01

    Full Text Available Kenzo Iizuka, Cheng Jin, Kokoro Eshima, Mei Hua Hong, Kiyoshi Eshima, Masakazu Fukushima Division of Research and Development, Delta-Fly Pharma Inc., Tokushima, Japan Introduction: Peritoneal disseminated ovarian cancer is one of the most difficult cancers to treat with conventional anti-cancer drugs and the treatment options are very limited, although an intraperitoneal (ip paclitaxel has shown some clinical benefit. Therefore, treatment of peritoneal disseminated ovarian cancer is a highly unmet medical need and it is urgent to develop a new ip delivered drug regulating the fast DNA synthesis. Methods: We developed a unique RNAi molecule consisting of shRNA against the thymidylate synthase (TS and a cationic liposome (DFP-10825 and tested its antitumor activity and PK profile in peritoneally disseminated human ovarian cancer ascites models by the luciferase gene-transfected SCID mice. DFP-10825 alone, paclitaxel alone or combination with DFP-10825 and paclitaxel were administered in an ip route to the tumor-bearing mice. The TS expression level was measured by conventional RT-PCR. The anti-tumor activity and host survival benefit by DFP-10825 treatment on tumor-bearing mice were observed as resulting from the specific TS mRNA knock-down in tumors. Results: DFP-10825 alone significantly suppressed the growth of SKOV3-luc tumore ascites cells and further extended the survival time of these tumor-bearing mice. Combination with the ip paclitaxel augmented the antitumor efficacy of DFP-10825 and significantly prolonged the survival time in the tumor-bearing mice. Short-hairpin RNA for TS (TS shRNA levels derived from DFP-10825 in the ascetic fluid were maintained at a nM range across 24 hours but not detected in the plasma, suggesting that TS shRNA is relatively stable in the peritoneal cavity, to be able to exert its anti-tumor activity, but not in blood stream, indicating little or no systemic effect. Conclusion: Collectively, the ip delivery of

  6. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  7. Heparanase activity in alveolar and embryonal rhabdomyosarcoma: implications for tumor invasion

    Directory of Open Access Journals (Sweden)

    Rosolen Angelo

    2009-08-01

    Full Text Available Abstract Background Rhabdomyosarcoma (RMS is a malignant soft tissue sarcoma of childhood including two major histological subtypes, alveolar (ARMS and embryonal (ERMS RMS. Like other human malignancies RMS possesses high metastatic potential, more pronounced in ARMS than in ERMS. This feature is influenced by several biological molecules, including soluble factors secreted by tumor cells, such as heparanase (HPSE. HPSE is an endo-β-D-glucuronidase that cleaves heparan sulphate proteoglycans. Methods We determined HPSE expression by Western blot analysis in ARMS and ERMS cells lines and activity in supernatants by an ELISA assay. Stable HPSE silencing has been performed by shRNA technique in RH30 and RD cell lines and their invasiveness has been evaluated by Matrigel-invasion assay. HPSE activity and mRNA expression have also been quantified in plasma and biopsies from RMS patients. Results HPSE expression and activity have been detected in all RMS cell lines. Stable HPSE silencing by shRNA technique determined a significant knockdown of gene expression equal to 76% and 58% in RH30 and RD cell lines respectively and induced a less invasive behaviour compared to untreated cells. Finally, we observed that HPSE mRNA expression in biopsies was higher than in foetal skeletal muscle and that plasma from RMS patients displayed significantly more elevated HPSE levels than healthy subjects with a trend to higher levels in ARMS. Conclusion In conclusion, our data demonstrate for the first time HPSE expression and activity in RMS and highlight its involvement in tumor cell invasion as revealed by shRNA silencing. Moreover, HPSE expression in RMS patients is significantly higher with respect to healthy subjects. Further studies are warranted to assess possible relationships between HPSE and clinical behaviour in RMS.

  8. Why Selection Might Be Stronger When Populations Are Small: Intron Size and Density Predict within and between-Species Usage of Exonic Splice Associated cis-Motifs

    Science.gov (United States)

    Wu, XianMing; Hurst, Laurence D.

    2015-01-01

    The nearly neutral theory predicts that small effective population size provides the conditions for weakened selection. This is postulated to explain why our genome is more “bloated” than that of, for example, yeast, ours having large introns and large intergene spacer. If a bloated genome is also an error prone genome might it, however, be the case that selection for error-mitigating properties is stronger in our genome? We examine this notion using splicing as an exemplar, not least because large introns can predispose to noisy splicing. We thus ask whether, owing to genomic decay, selection for splice error-control mechanisms is stronger, not weaker, in species with large introns and small populations. In humans much information defining splice sites is in cis-exonic motifs, most notably exonic splice enhancers (ESEs). These act as splice-error control elements. Here then we ask whether within and between-species intron size is a predictor of the commonality of exonic cis-splicing motifs. We show that, as predicted, the proportion of synonymous sites that are ESE-associated and under selection in humans is weakly positively correlated with the size of the flanking intron. In a phylogenetically controlled framework, we observe, also as expected, that mean intron size is both predicted by Ne.μ and is a good predictor of cis-motif usage across species, this usage coevolving with splice site definition. Unexpectedly, however, across taxa intron density is a better predictor of cis-motif usage than intron size. We propose that selection for splice-related motifs is driven by a need to avoid decoy splice sites that will be more common in genes with many and large introns. That intron number and density predict ESE usage within human genes is consistent with this, as is the finding of intragenic heterogeneity in ESE density. As intronic content and splice site usage across species is also well predicted by Ne.μ, the result also suggests an unusual circumstance in

  9. Supporting young people living with cancer to tell their stories in ways that make them stronger: The Beads of Life approach.

    Science.gov (United States)

    Portnoy, Sara; Girling, Isabella; Fredman, Glenda

    2016-04-01

    This article describes the 'Beads of Life' approach--a five-part methodology informed by narrative therapy to enable children and young people to make sense of their cancer journey in ways that make them stronger. Young people are invited to use beads as prompts to tell preferred stories of their identity to create a safe place to stand from which to story their cancer journey. The approach positions young people as experts in their lives. It aims to change their relationship with cancer to reduce its negative impact on life by lessening isolation. By enabling medical staff to get to know the young person apart from the cancer, this approach aims to create hope for the future and improve quality of care. © The Author(s) 2015.

  10. Interleukin 6 Is a Stronger Predictor of Clinical Events Than High-Sensitivity C-Reactive Protein or D-Dimer During HIV Infection

    DEFF Research Database (Denmark)

    Borges, Alvaro Humberto Diniz; O'Connor, Jemma L; Phillips, Andrew N

    2016-01-01

    BACKGROUND: Interleukin 6 (IL-6), high-sensitivity C-reactive protein (hsCRP), and D-dimer levels are linked to adverse outcomes in human immunodeficiency virus (HIV) infection, but the strength of their associations with different clinical end points warrants investigation. METHODS: Participants...... receiving standard of care in 2 HIV trials with measured biomarker levels were followed to ascertain all-cause death, non-AIDS-related death, AIDS, cardiovascular disease (CVD), and non-AIDS-defining malignancies. Hazard ratios (HRs) and 95% confidence intervals (CIs) of each end point for quartiles and log......-dimer (P = .20) as a predictor for different end points. CONCLUSIONS: IL-6 is a stronger predictor of fatal events than of CVD and non-AIDS-defining malignancies. Adjuvant antiinflammatory and antithrombotic therapies should be tested in HIV-infected individuals....

  11. CDC'S Testing Makes Us Stronger (TMUS) Campaign: Was Campaign Exposure Associated With HIV Testing Behavior Among Black Gay and Bisexual Men?

    Science.gov (United States)

    Habarta, Nancy; Boudewyns, Vanessa; Badal, Hannah; Johnston, Jennie; Uhrig, Jennifer; Green, Donata; Ruddle, Paul; Rosenthal, Jacqueline; Stryker, Jo Ellen

    2017-06-01

    This study assessed exposure among Black gay, bisexual, and other men who have sex with men (BMSM) to a communication campaign, Testing Makes Us Stronger (TMUS), and its association with HIV testing to determine campaign effectiveness. Data from an online survey (N = 3,105) were analyzed using propensity score weight-adjusted logistic regression to examine the effect of exposure on HIV testing. Among BMSM aged 18-44 (n = 702), 43.2% reported TMUS exposure. The majority of those exposed were aged 25-34 (54%), HIV-negative (65%), and had some college education (87%). TMUS exposure was associated with reported increased HIV testing behaviors at 6- and 12-month frequencies. Communication campaigns with clear implementation strategies, focused objectives, and online and event presence can be associated with longer-term outcomes such as HIV testing.

  12. Network-based analysis reveals stronger local diffusion-based connectivity and different correlations with oral language skills in brains of children with high functioning autism spectrum disorders.

    Science.gov (United States)

    Li, Hai; Xue, Zhong; Ellmore, Timothy M; Frye, Richard E; Wong, Stephen T C

    2014-02-01

    Neuroimaging has uncovered both long-range and short-range connectivity abnormalities in the brains of individuals with autism spectrum disorders (ASD). However, the precise connectivity abnormalities and the relationship between these abnormalities and cognition and ASD symptoms have been inconsistent across studies. Indeed, studies find both increases and decreases in connectivity, suggesting that connectivity changes in the ASD brain are not merely due to abnormalities in specific connections, but rather, due to changes in the structure of the network in which the brain areas interact (i.e., network topology). In this study, we examined the differences in the network topology between high-functioning ASD patients and age and gender matched typically developing (TD) controls. After quantitatively characterizing the whole-brain connectivity network using diffusion tensor imaging (DTI) data, we searched for brain regions with different connectivity between ASD and TD. A measure of oral language ability was then correlated with the connectivity changes to determine the functional significance of such changes. Whole-brain connectivity measures demonstrated greater local connectivity and shorter path length in ASD as compared to TD. Stronger local connectivity was found in ASD, especially in regions such as the left superior parietal lobule, the precuneus and angular gyrus, and the right supramarginal gyrus. The relationship between oral language ability and local connectivity within these regions was significantly different between ASD and TD. Stronger local connectivity was associated with better performance in ASD and poorer performance in TD. This study supports the notion that increased local connectivity is compensatory for supporting cognitive function in ASD. Copyright © 2012 Wiley Periodicals, Inc.

  13. Brain responds to another person's eye blinks in a natural setting-the more empathetic the viewer the stronger the responses.

    Science.gov (United States)

    Mandel, Anne; Helokunnas, Siiri; Pihko, Elina; Hari, Riitta

    2015-10-01

    An observer's brain is known to respond to another person's small nonverbal signals, such as gaze shifts and eye blinks. Here we aimed to find out how an observer's brain reacts to a speaker's eye blinks in the presence of other audiovisual information. Magnetoencephalographic brain responses along with eye gaze were recorded from 13 adults who watched a video of a person telling a story. The video was presented first without sound (visual), then with sound (audiovisual), and finally the audio story was presented with a still-frame picture on the screen (audio control). The viewers mainly gazed at the eye region of the speaker. Their saccades were suppressed at about 180 ms after the start of the speaker's blinks, a subsequent increase of saccade occurence to the base level, or higher, at around 340 ms. The suppression occurred in visual and audiovisual conditions but not during the control audio presentation. Prominent brain responses to blinks peaked in the viewer's occipital cortex at about 250 ms, with no differences in mean peak amplitudes or latencies between visual and audiovisual conditions. During the audiovisual, but not visual-only, presentation, the responses were the stronger the more empathetic the subject was according to the Empathic Concern score of the Interpersonal Reactivity Index questionnaire (Spearman's rank correlation, 0.73). The other person's eye blinks, nonverbal signs that often go unnoticed, thus elicited clear brain responses even in the presence of attention-attracting audiovisual information from the narrative, with stronger responses in people with higher empathy scores. © 2015 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  14. shRNA libraries and their use in cancer genetics

    NARCIS (Netherlands)

    Bernards, R.A.; Brummelkamp, T.R.; Beijersbergen, R.L.

    2006-01-01

    RNA interference was originally described as a powerful tool to inhibit gene expression in model organisms. Until recently, loss-of-function genetic screens in mammalian cells were hampered by a lack of suitable tools that can be used in a high-throughput format. Here we discuss the construction of

  15. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... The essence of cancer development and growth is that mutant cells unlimitedly proliferate and cannot ... big enzyme family that can act on ester bonds between phosphoglyceric acetic substituents and .... extracted using small plasmid extractive kit (Takara, Japan). The absorbance and concentrations of the ...

  16. Climate and development: enhancing impact through stronger linkages in the implementation of the Paris Agreement and the Sustainable Development Goals (SDGs).

    Science.gov (United States)

    Gomez-Echeverri, Luis

    2018-05-13

    One of the greatest achievements in the global negotiations of 2015 that delivered the 2030 Agenda for Sustainable Development or Sustainable Development Goals (SDGs) and the Paris Agreement on climate change is that, for the first time, the linkages between climate and development were enshrined in each of the documents. This was done in recognition that climate change and development need to be addressed together in order not only to avoid harmful trade-offs and high costs, particularly for poorer countries, but also to exploit the benefits that come from strengthening these linkages. This review presents some of the latest data that argue for stronger linkages as well as the challenges of implementation which are not only politically and economically related but also include issues such as knowledge gaps, finance and governance. Finally, the review also presents a glimpse at the pathways that will be required to reach the ambitious global temperature targets of the Paris Agreement of less than 2°C above pre-industrial levels with efforts to limit temperature rise even further to 1.5°C. This provides the context for some conclusions and recommendations for policy-makers, including on methodologies for assessing linkages and leveraging them for greater benefit.This article is part of the theme issue 'The Paris Agreement: understanding the physical and social challenges for a warming world of 1.5°C above pre-industrial levels'. © 2018 The Authors.

  17. Long-Term Experience of Chinese Calligraphic Handwriting Is Associated with Better Executive Functions and Stronger Resting-State Functional Connectivity in Related Brain Regions

    Science.gov (United States)

    He, Yong; Gao, Yang; Zhang, Cuiping; Chen, Chuansheng; Bi, Suyu; Yang, Pin; Wang, Yiwen; Wang, Wenjing

    2017-01-01

    Chinese calligraphic handwriting (CCH) is a traditional art form that requires high levels of concentration and motor control. Previous research has linked short-term training in CCH to improvements in attention and memory. Little is known about the potential impacts of long-term CCH practice on a broader array of executive functions and their potential neural substrates. In this cross-sectional study, we recruited 36 practitioners with at least 5 years of CCH experience and 50 control subjects with no more than one month of CCH practice and investigated their differences in the three components of executive functions (i.e., shifting, updating, and inhibition). Valid resting-state fMRI data were collected from 31 CCH and 40 control participants. Compared with the controls, CCH individuals showed better updating (as measured by the Corsi Block Test) and inhibition (as measured by the Stroop Word-Color Test), but the two groups did not differ in shifting (as measured by a cue-target task). The CCH group showed stronger resting-state functional connectivity (RSFC) than the control group in brain areas involved in updating and inhibition. These results suggested that long-term CCH training may be associated with improvements in specific aspects of executive functions and strengthened neural networks in related brain regions. PMID:28129407

  18. EVOLUTION--taking charge and growing stronger: the design, acceptability, and feasibility of a secondary prevention empowerment intervention for young women living with HIV.

    Science.gov (United States)

    Brothers, Jennifer; Harper, Gary W; Fernandez, M Isabel; Hosek, Sybil G

    2014-01-01

    In the United States, youth of 13-24 years account for nearly a quarter of all new HIV infections, with almost 1000 young men and women being infected per month. Young women account for 20% of those new infections.This article describes the design, feasibility, and acceptability of a secondary prevention empowerment intervention for young women living with HIV entitled Young Women Taking Charge and Growing Stronger. The nine session intervention aimed to reduce secondary transmission by enhancing social and behavioral skills and knowledge pertaining to young women's physical, social, emotional, and sexual well-being,while addressing the moderating factors such as sexual inequality and power imbalances. Process evaluation data suggest that EVOLUTION is a highly acceptable and feasible intervention for young women living with HIV. Participants reported enjoying both the structure and comprehensive nature of the intervention. Both participants and interventionists reported that the intervention was highly relevant to the lives of young women living with HIV since it not only provided opportunities for them to broaden their knowledge and risk reduction skills in HIV, but it also addressed important areas that impact their daily lives such as stressors, relationships,and their emotional and social well-being. Thus, this study demonstrates that providing a gender-specific,comprehensive group-based empowerment intervention for young women living with HIV appears to be both feasible and acceptable.

  19. Malnutrition Increases With Obesity and Is a Stronger Independent Risk Factor for Postoperative Complications: A Propensity-Adjusted Analysis of Total Hip Arthroplasty Patients.

    Science.gov (United States)

    Fu, Michael C; D'Ambrosia, Christopher; McLawhorn, Alexander S; Schairer, William W; Padgett, Douglas E; Cross, Michael B

    2016-11-01

    Obesity is frequently associated with complications after total hip arthroplasty (THA) and is often concomitant with malnutrition. The purpose of this study was to investigate the independent morbidity risk of malnutrition relative to obesity. The National Surgical Quality Improvement Program from 2005 to 2013 was queried for elective primary THA cases. Malnutrition was defined as albumin malnutrition with 30-day outcomes. A total of 40,653 THA cases were identified, of which 20,210 (49.7%) had preoperative albumin measurements. Propensity score adjustment successfully reduced potential selection bias, with P > .05 for differences between those with and without albumin data. Malnutrition incidence increased from 2.8% in obese I to 5.7% in obese III patients. With multivariable propensity-adjusted logistic regression, malnutrition was a more robust predictor than any obesity class for any postoperative complication(s) (odds ratio [OR] 1.61, 95% confidence interval [CI] 1.25-2.08), major complications (OR 1.63, 95% CI 1.21-2.19), respiratory complications (OR 2.35, 95% CI 1.27-4.37), blood transfusions (OR 1.71, 95% CI 1.44-2.03), and extended length of stay (OR 1.35, 95% CI 1.14-1.59). Malnutrition incidence increased significantly from obese I to obese III patients and was a stronger and more consistent predictor than obesity of complications after THA. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Decision making of heavy cannabis users on the Iowa Gambling Task: stronger association with THC of hair analysis than with personality traits of the Tridimensional Personality Questionnaire.

    Science.gov (United States)

    Hermann, Derik; Leménager, Tagrid; Gelbke, Jan; Welzel, Helga; Skopp, Gisela; Mann, Karl

    2009-01-01

    It is unclear whether impairment in decision making, measured by the Iowa Gambling Task (IGT), in addiction is substance-induced or the consequence of personality structure. Analysis of the IGT, the Tridimensional Personality Questionnaire (TPQ) and cannabinoids in hair and urine were performed in 13 cannabis users and matched controls. Hair Delta(9)-tetrahydrocannabinol (THC) correlated negatively with the last subtrial (cards 80-100) of the IGT (R = -0.67). In all participants (n = 26) the TPQ dimension, harm avoidance, correlated negatively with the total IGT score (R = -0.46). The last IGT-subtrial correlated with adventure seeking (R = 0.43), harm avoidance (R = -0.39) and reward dependence (R = -0.44). The last subtrial gives information on whether a participant has learned the IGT strategy. Multiple regression confirmed the impact of THC on the last subtrial, whereas TPQ personality traits did not additionally explain variance. Former indications of the IGT performance depending on the amount of cannabis consumed were replicated with an objective measurement of chronic cannabis consumption (hair THC). Multiple regression analysis argues for a stronger impact of chronic THC consumption than personality traits, but does not provide a causal relationship. Other factors (e.g. genetic) may also play a role. 2009 S. Karger AG, Basel.

  1. SC79 protects retinal pigment epithelium cells from UV radiation via activating Akt-Nrf2 signaling.

    Science.gov (United States)

    Gong, Yi-Qing; Huang, Wei; Li, Ke-Ran; Liu, Yuan-Yuan; Cao, Guo-Fan; Cao, Cong; Jiang, Qin

    2016-09-13

    Excessive Ultra-violet (UV) radiation causes oxidative damages and apoptosis in retinal pigment epithelium (RPE) cells. Here we tested the potential activity of SC79, a novel small molecule activator of Akt, against the process. We showed that SC79 activated Akt in primary and established (ARPE-19 line) RPE cells. It protected RPE cells from UV damages possibly via inhibiting cell apoptosis. Akt inhibition, via an Akt specific inhibitor (MK-2206) or Akt1 shRNA silence, almost abolished SC79-induced RPE cytoprotection. Further studies showed that SC79 activated Akt-dependent NF-E2-related factor 2 (Nrf2) signaling and inhibited UV-induced oxidative stress in RPE cells. Reversely, Nrf2 shRNA knockdown or S40T mutation attenuated SC79-induced anti-UV activity. For the in vivo studies, we showed that intravitreal injection of SC79 significantly protected mouse retina from light damages. Based on these results, we suggest that SC79 protects RPE cells from UV damages possibly via activating Akt-Nrf2 signaling axis.

  2. SC79 protects retinal pigment epithelium cells from UV radiation via activating Akt-Nrf2 signaling

    Science.gov (United States)

    Cao, Guo-fan; Cao, Cong; Jiang, Qin

    2016-01-01

    Excessive Ultra-violet (UV) radiation causes oxidative damages and apoptosis in retinal pigment epithelium (RPE) cells. Here we tested the potential activity of SC79, a novel small molecule activator of Akt, against the process. We showed that SC79 activated Akt in primary and established (ARPE-19 line) RPE cells. It protected RPE cells from UV damages possibly via inhibiting cell apoptosis. Akt inhibition, via an Akt specific inhibitor (MK-2206) or Akt1 shRNA silence, almost abolished SC79-induced RPE cytoprotection. Further studies showed that SC79 activated Akt-dependent NF-E2-related factor 2 (Nrf2) signaling and inhibited UV-induced oxidative stress in RPE cells. Reversely, Nrf2 shRNA knockdown or S40T mutation attenuated SC79-induced anti-UV activity. For the in vivo studies, we showed that intravitreal injection of SC79 significantly protected mouse retina from light damages. Based on these results, we suggest that SC79 protects RPE cells from UV damages possibly via activating Akt-Nrf2 signaling axis. PMID:27517753

  3. Kaempferol induces autophagic cell death of hepatocellular carcinoma cells via activating AMPK signaling.

    Science.gov (United States)

    Han, Bing; Yu, Yi-Qun; Yang, Qi-Lian; Shen, Chun-Ying; Wang, Xiao-Juan

    2017-10-17

    In the present study, we demonstrate that Kaempferol inhibited survival and proliferation of established human hepatocellular carcinoma (HCC) cell lines (HepG2, Huh-7, BEL7402, and SMMC) and primary human HCC cells. Kaempferol treatment in HCC cells induced profound AMP-activated protein kinase (AMPK) activation, which led to Ulk1 phosphorylation, mTOR complex 1 inhibition and cell autophagy. Autophagy induction was reflected by Beclin-1/autophagy gene 5 upregulation and p62 degradation as well as light chain 3B (LC3B)-I to LC3B-II conversion and LC3B puncta formation. Inhibition of AMPK, via AMPKα1 shRNA or dominant negative mutation, reversed above signaling changes. AMPK inhibition also largely inhibited Kaempferol-induced cytotoxicity in HCC cells. Autophagy inhibition, by 3-methyaldenine or Beclin-1 shRNA, also protected HCC cells from Kaempferol. Kaempferol downregulated melanoma antigen 6, the AMPK ubiquitin ligase, causing AMPKα1 stabilization and accumulation. We conclude that Kaempferol inhibits human HCC cells via activating AMPK signaling.

  4. Spatial Autocorrelation Can Generate Stronger Correlations between Range Size and Climatic Niches Than the Biological Signal - A Demonstration Using Bird and Mammal Range Maps.

    Science.gov (United States)

    Boucher-Lalonde, Véronique; Currie, David J

    2016-01-01

    Species' geographic ranges could primarily be physiological tolerances drawn in space. Alternatively, geographic ranges could be only broadly constrained by physiological climatic tolerances: there could generally be much more proximate constraints on species' ranges (dispersal limitation, biotic interactions, etc.) such that species often occupy a small and unpredictable subset of tolerable climates. In the literature, species' climatic tolerances are typically estimated from the set of conditions observed within their geographic range. Using this method, studies have concluded that broader climatic niches permit larger ranges. Similarly, other studies have investigated the biological causes of incomplete range filling. But, when climatic constraints are measured directly from species' ranges, are correlations between species' range size and climate necessarily consistent with a causal link? We evaluated the extent to which variation in range size among 3277 bird and 1659 mammal species occurring in the Americas is statistically related to characteristics of species' realized climatic niches. We then compared how these relationships differed from the ones expected in the absence of a causal link. We used a null model that randomizes the predictor variables (climate), while retaining their broad spatial autocorrelation structure, thereby removing any causal relationship between range size and climate. We found that, although range size is strongly positively related to climatic niche breadth, range filling and, to a lesser extent, niche position in nature, the observed relationships are not always stronger than expected from spatial autocorrelation alone. Thus, we conclude that equally strong relationships between range size and climate would result from any processes causing ranges to be highly spatially autocorrelated.

  5. Spatial Autocorrelation Can Generate Stronger Correlations between Range Size and Climatic Niches Than the Biological Signal — A Demonstration Using Bird and Mammal Range Maps

    Science.gov (United States)

    Boucher-Lalonde, Véronique; Currie, David J.

    2016-01-01

    Species’ geographic ranges could primarily be physiological tolerances drawn in space. Alternatively, geographic ranges could be only broadly constrained by physiological climatic tolerances: there could generally be much more proximate constraints on species’ ranges (dispersal limitation, biotic interactions, etc.) such that species often occupy a small and unpredictable subset of tolerable climates. In the literature, species’ climatic tolerances are typically estimated from the set of conditions observed within their geographic range. Using this method, studies have concluded that broader climatic niches permit larger ranges. Similarly, other studies have investigated the biological causes of incomplete range filling. But, when climatic constraints are measured directly from species’ ranges, are correlations between species’ range size and climate necessarily consistent with a causal link? We evaluated the extent to which variation in range size among 3277 bird and 1659 mammal species occurring in the Americas is statistically related to characteristics of species’ realized climatic niches. We then compared how these relationships differed from the ones expected in the absence of a causal link. We used a null model that randomizes the predictor variables (climate), while retaining their broad spatial autocorrelation structure, thereby removing any causal relationship between range size and climate. We found that, although range size is strongly positively related to climatic niche breadth, range filling and, to a lesser extent, niche position in nature, the observed relationships are not always stronger than expected from spatial autocorrelation alone. Thus, we conclude that equally strong relationships between range size and climate would result from any processes causing ranges to be highly spatially autocorrelated. PMID:27855201

  6. Critical high-dimensional state transitions in cell populations or why cancers follow the principle ``What does not kill me makes me stronger''

    Science.gov (United States)

    Huang, Sui

    Transitions between high-dimensional attractor states in the quasi-potential landscape of the gene regulatory network, induced by environmental perturbations and/or facilitated by mutational rewiring of the network, underlie cell phenotype switching in development as well as in cancer progression, including acquisition of drug-resistant phenotypes. Considering heterogeneous cell populations as statistical ensembles of cells, and single-cell resolution gene expression profiling of cell populations undergoing a cell phenotype shift allow us now to map the topography of the landscape and its distortion. From snapshots of single-cell expression patterns of a cell population measured during major transitions we compute a quantity that identifies symmetry-breaking destabilization of attractors (bifurcation) and concomitant dimension-reduction of the state space manifold (landscape distortion) which precede critical transitions to new attractor states. The model predicts, and we show experimentally, the almost inevitable generation of aberrant cells associated with such critical transitions in multi-attractor landscapes: therapeutic perturbations which seek to push cancer cells to the apoptotic state, almost always produce ``rebellious'' cells which move in the ``opposite direction'': instead of dying they become more stem-cell-like and malignant. We show experimentally that the inadvertent generation of more malignant cancer cells by therapy indeed results from transition of surviving (but stressed) cells into unforeseen attractor states and not simply from selection of inherently more resistant cells. Thus, cancer cells follow not so much Darwin, as generally thought (survival of the fittest), but rather Nietzsche (What does not kill me makes me stronger). Supported by NIH (NCI, NIGMS), Alberta Innovates.

  7. Stronger default mode network connectivity is associated with poorer clinical insight in youth at ultra high-risk for psychotic disorders.

    Science.gov (United States)

    Clark, Sarah V; Mittal, Vijay A; Bernard, Jessica A; Ahmadi, Aral; King, Tricia Z; Turner, Jessica A

    2018-03-01

    Impaired clinical insight (CI) is a common symptom of psychotic disorders and a promising treatment target. However, to date, our understanding of how variability in CI is tied to underlying brain dysfunction in the clinical high-risk period is limited. Developing a stronger conception of this link will be a vital first step for efforts to determine if CI can serve as a useful prognostic indicator. The current study investigated whether variability in CI is related to major brain networks in adolescents and young adults at ultra high-risk (UHR) of developing psychosis. Thirty-five UHR youth were administered structured clinical interviews as well as an assessment for CI and underwent resting-state magnetic resonance imaging scans. Functional connectivity was calculated in the default mode network (DMN) and fronto-parietal network (FPN), two major networks that are dysfunctional in psychosis and are hypothesized to affect insight. Greater DMN connectivity between the posterior cingulate/precuneus and ventromedial prefrontal cortex (DMN) was related to poorer CI (R 2 =0.399). There were no significant relationships between insight and the FPN. This is the first study to relate a major brain network to clinical insight before the onset of psychosis. Findings are consistent with evidence if a hyperconnected DMN in schizophrenia and UHR, and similar to a previous study of insight and connectivity in schizophrenia. Results suggest that a strongly connected DMN may be related to poor self-awareness of subthreshold psychotic symptoms in UHR adolescents and young adults. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Propofol induces proliferation and invasion of gallbladder cancer cells through activation of Nrf2

    Directory of Open Access Journals (Sweden)

    Zhang Lingmin

    2012-08-01

    Full Text Available Abstract Background Propofol is one of the most commonly used intravenous anaesthetic agents during cancer resection surgery, but the effect of propofol on gallbladder cancer is not clear. NF-E2-related factor 2 (Nrf2 is abundantly expressed in cancer cells and relates to proliferation, invasion, and chemoresistance. The aims of the current study were to evaluate effects of propofol on the behavior of human GC cells and role of Nrf2 in these effects. Method The effects of propofol on cell proliferation, apoptosis, and invasion were detected by MTT assays, flow cytometry, and transwell assay. Also, activation of Nrf2 was determined by western blot, RT-PCR, and immunofluorescence assays. Nrf2 was knocked-down in GBC-SD cells by shRNA before evaluating the role of Nrf2 in the influence of propofol on biological behaviors. Results Propofol promoted the proliferation of GBC-SD cells in a dose- and time- dependent manner. After exposure to propofol for 48 h, GBC-SD cells showed decreased apoptosis and increased invasion. Also, propofol over-expressed Nrf2 at both the protein and mRNA levels and induced translocation of Nrf2 into the nucleus. Finally, loss of Nrf2 by shRNA reversed the effect of propofol on cell proliferation, apoptosis, and invasion. Conclusion Propofol induces proliferation and promotes invasion of GC cells through activation of Nrf2.

  9. Targeting activating mutations of EZH2 leads to potent cell growth inhibition in human melanoma by derepression of tumor suppressor genes

    OpenAIRE

    Tiffen, Jessamy C.; Gunatilake, Dilini; Gallagher, Stuart J.; Gowrishankar, Kavitha; Heinemann, Anja; Cullinane, Carleen; Dutton-Regester, Ken; Pupo, Gulietta M.; Strbenac, Dario; Yang, Jean Y.; Madore, Jason; Mann, Graham J.; Hayward, Nicholas K.; McArthur, Grant A.; Filipp, Fabian V.

    2015-01-01

    The epigenetic modifier EZH2 is part of the polycomb repressive complex that suppresses gene expression via histone methylation. Activating mutations in EZH2 are found in a subset of melanoma that contributes to disease progression by inactivating tumor suppressor genes. In this study we have targeted EZH2 with a specific inhibitor (GSK126) or depleted EZH2 protein by stable shRNA knockdown. We show that inhibition of EZH2 has potent effects on the growth of both wild-type and EZH2 mutant hum...

  10. Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

    Science.gov (United States)

    Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

    2017-01-03

    Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

  11. Does knowledge of teen driving risks and awareness of current law translate into support for stronger GDL provisions? Lessons learned from one state.

    Science.gov (United States)

    Campbell, Brendan T; Chaudhary, Neil K; Saleheen, Hassan; Borrup, Kevin; Lapidus, Garry

    2009-08-01

    Many states are considering strengthening their graduated driving licensing (GDL) systems for teenage drivers but most do not know the level of public support for proposed upgrades. This study provides a method for states to identify specific demographic groups that may differ with regard to their awareness of teen driving risks, knowledge of current GDL law, and support for GDL upgrades. A 28-item questionnaire was administered to Connecticut adults by phone survey during January 2008. We collected demographic information and whether respondents understood driving risks, were aware of the current GDL system, and whether they would support GDL upgrades. The state's motor vehicle crash file (1999-2006) was used to calculate motor vehicle crash rate among 16- and 17-year-old drivers by town and correlate that with support for GDL upgrades. Eight hundred seven people were interviewed. More women than men (92% vs. 86%, p towns (38%). Two thirds supported a passenger restriction upgrade with no differences based upon sex or geographic location. There was less support for an increased penalties in Fairfield County when compared to all other counties (55% vs. 63%, p County versus all other counties (70% vs. 58%, p < .05). Parents of Connecticut teens were more knowledgeable of current law but less supportive of GDL upgrades compared to other adults. Women were more apt to favor GDL upgrades than men. This study identifies subgroups that can be targeted for prevention activities and illustrates a useful method to assess public support for GDL upgrades.

  12. MYC/BCL2 Co-Expression Is a Stronger Prognostic Factor Compared With the Cell-of-Origin Classification in Primary CNS DLBCL.

    Science.gov (United States)

    Shi, Qian-Yun; Feng, Xiao; Bao, Wei; Ma, Jie; Lv, Jing-Huan; Wang, Xuan; Rao, Qiu; Shi, Qun-Li

    2017-11-01

    Primary central nervous system (CNS) diffuse large B-cell lymphoma (DLBCL) is a subtype of DLBCL with an unfavorable prognosis and a poor response to the treatment. As we know, DLBCL is stratified into germinal center B-cell (GCB)-like and activated B-cell (ABC)-like subtypes with different prognosis according to their gene-expression characteristics. In this study, we analyzed a case series of 77 patients with primary CNS DLBCL. A difference in prognosis of GCB-like and ABC-like subtypes was noticed, but no statistical significance was found. However, significant prognostic value of MYC/BCL2 co-expression was shown. The cases with MYC/BCL2 co-expression did not show any predominance of the 2 subtypes in our cases. Furthermore, patients with MYC/BCL2 co-expression had significantly worse overall survival for both cell of origin (COO) subtypes. We conjecture that MYC/BCL2 co-expression is associated with a poorer prognosis and is independent of COO classification. Moreover, the data suggest that MYC/BCL2 co-expression is superior to COO classification assessed by immunohistochemical analysis in patients with primary CNS DLBCL. © 2017 American Association of Neuropathologists, Inc. All rights reserved.

  13. Can absence make a team grow stronger?

    Science.gov (United States)

    Majchrzak, Ann; Malhotra, Arvind; Stamps, Jeffrey; Lipnack, Jessica

    2004-05-01

    Some projects have such diverse requirements that they need a variety of specialists to work on them. But often the best-qualified specialists are scattered around the globe, perhaps at several companies. Remarkably, an extensive benchmarking study reveals, it isn't necessary to bring team members together to get their best work. In fact, they can be even more productive if they stay separated and do all their collaborating virtually. The scores of successful virtual teams the authors examined didn't have many of the psychological and practical obstacles that plagued their more traditional, face-to-face counterparts. Team members felt freer to contribute--especially outside their established areas of expertise. The fact that such groups could not assemble easily actually made their projects go faster, as people did not wait for meetings to make decisions, and individuals, in the comfort of their own offices, had full access to their files and the complementary knowledge of their local colleagues. Reaping those advantages, though, demanded shrewd management of a virtual team's work processes and social dynamics. Rather than depend on videoconferencing or e-mail, which could be unwieldy or exclusionary, successful virtual teams made extensive use of sophisticated online team rooms, where everyone could easily see the state of the work in progress, talk about the work in ongoing threaded discussions, and be reminded of decisions, rationales, and commitments. Differences were most effectively hashed out in tele-conferences, which team leaders also used to foster group identity and solidarity. When carefully managed in this way, the clash of perspectives led not to acrimony but, rather, to fundamental solutions, turning distance and diversity into competitive advantage.

  14. Essentially stronger - 1999 EPCOR annual report

    International Nuclear Information System (INIS)

    1999-01-01

    The year 1999 has been a year of consolidation for EPCOR Utilities, uniting the the former brands of Edmonton Power, Aquaalta and Eltec under a new single brand, EPCOR, to provide Edmontonians with a safe, high quality and reliable essential service at competitive prices . The company is building for growth by augmenting its product line with natural gas and green power, accessing new capital, proceeding with new projects at various sites, creating EPCOR Power Development Corporation with an ambitious mandate to grow beyond the Utilities traditional service areas. In proof of that, EPCOR Water Services won a strategically important contract in Port Hardy, BC; EPCOR Technologies also has been involved in projects beyond Alberta. As a sign of confidence in the company, the City of Edmonton voted to retain ownership of the company in July. The Utility also managed to win national awards for both safety and environmental practices and is the first utility company to have all its generating plants meet ISO 14001 standards. During 2000 the company will tackle the evolution of industry restructuring , will explore more diverse financial structures to accommodate growth and the increase in demand for services to make sure that EPCOR will be a leading provider of electric power and natural gas services as the era of deregulated competitive electrical services in Alberta begins in 2001. This report provides details of the achievements of the company's business units in 1999, accompanied by a consolidated financial statement

  15. Accelerator Sector - together we're stronger

    CERN Document Server

    2002-01-01

    From 1 January onwards, the Accelerator Sector will be reorganised into two new divisions AB and AT. We talked to the leaders of these two divisions, Steve Myers and Philippe Lebrun, about this reorganisation.

  16. Nursing is stronger when we work together.

    Science.gov (United States)

    Catton, Howard

    2017-01-11

    There are some striking similarities between Brexit and the election of Donald Trump as president of the United States: anger with an out-of-touch establishment, a desire to take back control and many people feeling left behind by globalisation.

  17. Citius, Altius, Fortius: Faster, Higher, Stronger

    Science.gov (United States)

    2013-06-01

    yang theories or sexual symbolism. Further, the visceral reaction to same sex hand holding is the basis for gender, ethnic, class, or national hatred...categories-reappear-in-todays-china-276381.html. 68 Jinxia, Women, Sport and Society in Modern China, 76. 69 Jung Chang, Wild Swans: Three Daughters of...women, do exemplify Confucian 143 Jeffrey Richey, “Gender and Sexuality ,” Patheos Library, (n.d

  18. Essentially stronger -1999 EPCOR annual report

    International Nuclear Information System (INIS)

    2000-01-01

    This annual report provides details of the financial operations of EPCOR, the newly formed utility, combining together three essential elements of modern living --electric power, water and natural gas-- as a single entity. In addition to this report on financial management, there are two companion reports on environmental performance entitled E ssential Balance', and on contributions to the community with the title of 'Essential Spirit'. While this report focuses on the Corporation's financial performance, it also provides a summary on the Corporation's growth, operational excellence, regulatory matters, environmental achievements and management of the Corporation's people resources. The financial report includes the customary consolidated financial statements, the auditor's report, and management's discussion and analysis of the financial report. Revenues for 1999 totalled just over one billion dollars ($978 million in 1998); net income was $116 million ($121 million in 1998); operating expenses were higher than in 1998 ($765 million versus $642 million) due to higher natural gas prices; capital spending was $198 million, compared to $153 million in 1998. Operations, maintenance, and administrative costs were also higher in 1999 due to higher employee costs across the EPCOR Group, one-time costs associated with EPCOR's master branding initiative, Y2K testing and remediation, and increased business development costs

  19. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    fulfilling this condition, these atoms still need to have an overall strong attractive interaction (either before or after the collision) to form the required transition state. For example, the transition state by definition gives equal probability for the reaction to go either way (to form reactant atoms, or the reaction product). There-.

  20. (When) Do Stronger Patents Increase Continual Innovation?

    OpenAIRE

    Chen, Yongmin; Pan, Shiyuan; Zhang, Tianle

    2012-01-01

    Under continual innovation, greater patent strength expands innovating firms’ profit against imitation, but also shifts profit from current to past innovators. We show how the impact of patents on innovation, as determined by these two opposing effects, varies with industry characteristics. When the discount factor is sufficiently high, the negative profit division effect is negligible, and innovation monotonically increases in patent strength; otherwise, innovation has an inverted-U relation...

  1. Stronger links between CERN and South Africa

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    iThemba LABS in South Africa is a research facility that, about twenty years ago, started to treat oncological patients with particle beams. Its collaboration with CERN has steadily grown over the years. After becoming a member of the ALICE and ATLAS Collaborations, today iThemba LABS is planning to buy a new medical-use cyclotron proton facility, and is seeking to strengthen its links with CERN and Europe also in this field by collaborating with ENLIGHT. The cyclotron will be dedicated to proton therapy – the only one of its kind in the southern hemisphere.   iThemba LABS (Laboratory for Accelerator Based Sciences) was established near Cape Town, South Africa almost 50 years ago as the continent's base for the Southern Universities Nuclear Institute that is now used mainly for material science research. In the 1980s, iThemba built a 200MeV cyclotron and, following its construction, in the early 1990s branched into a new scientific field: radiation and nuclear medicine. ...

  2. Minimal residual method stronger than polynomial preconditioning

    Energy Technology Data Exchange (ETDEWEB)

    Faber, V.; Joubert, W.; Knill, E. [Los Alamos National Lab., NM (United States)] [and others

    1994-12-31

    Two popular methods for solving symmetric and nonsymmetric systems of equations are the minimal residual method, implemented by algorithms such as GMRES, and polynomial preconditioning methods. In this study results are given on the convergence rates of these methods for various classes of matrices. It is shown that for some matrices, such as normal matrices, the convergence rates for GMRES and for the optimal polynomial preconditioning are the same, and for other matrices such as the upper triangular Toeplitz matrices, it is at least assured that if one method converges then the other must converge. On the other hand, it is shown that matrices exist for which restarted GMRES always converges but any polynomial preconditioning of corresponding degree makes no progress toward the solution for some initial error. The implications of these results for these and other iterative methods are discussed.

  3. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    tum mechanical phenomena that made biological life possible on earth, which can also be manipulated to discover novel 'green' chemistry, and to avoid 'toxic' ..... diagrams for clarity, but their analyses apply regardless of whether a given system is one-, two- or three-dimensional. particular, (A) depicts isotropic polarization ...

  4. Bcl-2 antagonists interact synergistically with bortezomib in DLBCL cells in association with JNK activation and induction of ER stress.

    Science.gov (United States)

    Dasmahapatra, Girija; Lembersky, Dmitry; Rahmani, Mohamed; Kramer, Lora; Friedberg, Jonathan; Fisher, Richard I; Dent, Paul; Grant, Steven

    2009-05-01

    Mechanisms underlying interactions between the proteasome inhibitor bortezomib and small molecule Bcl-2 antagonists were examined in GC- and ABC-type human DLBCL (diffuse lymphocytic B-cell lymphoma) cells. Concomitant or sequential exposure to non- or minimally toxic concentrations of bortezomib or other proteasome inhibitors and either HA14-1 or gossypol resulted in a striking increase in Bax/Bak conformational change/translocation, cytochrome c release, caspase activation and synergistic induction of apoptosis in both GC- and ABC-type cells. These events were associated with a sharp increase in activation of the stress kinase JNK and evidence of ER stress induction (e.g., eIF2alpha phosphorylation, activation of caspases-2 and -4, and Grp78 upregulation). Pharmacologic or genetic (e.g., shRNA knockdown) interruption of JNK signaling attenuated HA14-1/bortezomib lethality and ER stress induction. Genetic disruption of the ER stress pathway (e.g., in cells expressing caspase-4 shRNA or DN-eIF2alpha) significantly attenuated lethality. The toxicity of this regimen was independent of ROS generation. Finally, HA14-1 significantly increased bortezomib-mediated JNK activation, ER stress induction, and lethality in bortezomib-resistant cells. Collectively these findings indicate that small molecule Bcl-2 antagonists promote bortezomib-mediated mitochondrial injury and lethality in DLBCL cells in association with enhanced JNK activation and ER stress induction. They also raise the possibility that such a strategy may be effective in different DLBCL sub-types (e.g., GC- or ABC), and in bortezomib-resistant disease.

  5. Activation of odorant receptor in colorectal cancer cells leads to inhibition of cell proliferation and apoptosis.

    Directory of Open Access Journals (Sweden)

    Lea Weber

    Full Text Available The analysis and functional characterization of ectopically expressed human olfactory receptors (ORs is becoming increasingly important, as many ORs have been identified in several healthy and cancerous tissues. OR activation has been demonstrated to have influence on cancer cell growth and progression. Here, ORs were identified using RNA-Seq analyses and RT-PCR. We demonstrated the OR protein localization in HCT116 cells using immunocytochemistry (IHC. In order to analyze the physiological role of OR51B4, we deorphanized the receptor by the use of CRE-Luciferase assays, conducted calcium imaging experiments as well as scratch- and proliferation assays. Furthermore, western blot analyses revealed the involvement of different protein kinases in the ligand-dependent signaling pathway. Receptor knockdown via shRNA was used to analyze the involvement of OR51B4. We identified OR51B4, which is highly expressed in the colon cancer cell line HCT116 and in native human colon cancer tissues. We deorphanized the receptor and identified Troenan as an effective ligand. Troenan stimulation of HCT116 cells has anti-proliferative, anti-migratory and pro-apoptotic effects, mediated by changes in the intracellular calcium level upon PLC activation. These effects cause changes in the phosphorylation levels of p38, mTor and Akt kinases. Knockdown of the receptor via shRNA confirmed the involvement of OR51B4. This study emphasizes the importance of ectopically expressed ORs in the therapy for several diseases. The findings provide the basis for alternative treatments of colorectal cancer.

  6. Saturated free fatty acid sodium palmitate-induced lipoapoptosis by targeting glycogen synthase kinase-3β activation in human liver cells.

    Science.gov (United States)

    Cao, Jie; Feng, Xiao-Xia; Yao, Long; Ning, Bo; Yang, Zhao-Xia; Fang, Dian-Liang; Shen, Wei

    2014-02-01

    Elevated serum saturated fatty acid levels and hepatocyte lipoapoptosis are features of nonalcoholic fatty liver disease (NAFLD). The purpose of this study was to investigate saturated fatty acid induction of lipoapoptosis in human liver cells and the underlying mechanisms. Human liver L02 and HepG2 cells were treated with sodium palmitate, a saturated fatty acid, for up to 48 h with or without lithium chloride, a glycogen synthase kinase-3β (GSK-3β) inhibitor, or GSK-3β shRNA transfection. Transmission electron microscopy was used to detect morphological changes, flow cytometry was used to detect apoptosis, a colorimetric assay was used to detect caspase-3 activity, and western blot analysis was used to detect protein expression. The data showed that sodium palmitate was able to induce lipoapoptosis in L02 and HepG2 cells. Western blot analysis showed that sodium palmitate activated GSK-3β protein, which was indicated by dephosphorylation of GSK-3β at Ser-9. However, inhibition of GSK-3β activity with lithium chloride treatment or knockdown of GSK-3β expression with shRNA suppressed sodium palmitate-induced lipoapoptosis in L02 and HepG2 cells. On a molecular level, inhibition of GSK-3β expression or activity suppressed sodium palmitate-induced c-Jun-N-terminal kinase (JNK) phosphorylation and Bax upregulation, whereas GSK-3β inhibition did not affect endoplasmic reticulum stress-induced activation of unfolded protein response. The present data demonstrated that saturated fatty acid sodium palmitate-induced lipoapoptosis in human liver L02 and HepG2 cells was regulated by GSK-3β activation, which led to JNK activation and Bax upregulation. This finding indicates that GSK-3β inhibition may be a potential therapeutic target to control NAFLD.

  7. Suppression of the lipopolysaccharide-induced expression of MARCKS-related protein (MRP) affects transmigration in activated RAW264.7 cells.

    Science.gov (United States)

    Chun, Kwang-Rok; Bae, Eun Mi; Kim, Jae-Kwan; Suk, Kyoungho; Lee, Won-Ha

    2009-01-01

    The molecular action mechanism of MRP, one of the protein kinase C (PKC) substrates, has been under intense investigation, but reports on its role in macrophage function remain controversial. The treatment of macrophage cell lines with bacterial lipopolysaccharide (LPS) induced a high level of MRP expression suggesting that MRP plays a role in the function of activated macrophages. In order to investigate the role of MRP in activated RAW264.7 cells, we stably transfected MRP-specific shRNA expression constructs and tested for alterations in macrophage-related functions. The down-regulation of MRP expression resulted in a marked reduction in chemotaxis toward MCP-1 or extracellular matrix proteins. Furthermore, pharmacological inhibitors of PKC significantly inhibited the chemotaxis in RAW264.7 cells. These data reveals the pivotal role of MRP in the transmigration of activated RAW264.7 cells.

  8. “Environmental Psychology” the mental benefits of physical activities in natural settings

    DEFF Research Database (Denmark)

    De Dominicis, Stefano

    2017-01-01

    Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising...

  9. Dentin sialophosphoprotein (DSPP gene-silencing inhibits key tumorigenic activities in human oral cancer cell line, OSC2.

    Directory of Open Access Journals (Sweden)

    Rajeshree Joshi

    2010-11-01

    Full Text Available We determined recently that dentin sialophosphoprotein (DSPP, a member of the SIBLING (Small integrin-binding ligand N-linked glycoproteins family of phosphoglycoproteins, is highly upregulated in human oral squamous cell carcinomas (OSCCs where upregulation is associated with tumor aggressiveness. To investigate the effects of DSPP-silencing on the tumorigenic profiles of the oral cancer cell line, OSC2, short-hairpin RNA (shRNA interference was employed to silence DSPP in OSC2 cells.Multiple regions of DSPP transcript were targeted for shRNA interference using hDSP-shRNA lentiviral particles designed to silence DSPP gene expression. Control shRNA plasmid encoding a scrambled sequence incapable of degrading any known cellular mRNA was used for negative control. Following puromycin selection of stable lines of DSSP-silenced OSC2 cells, phenotypic hallmarks of oral carcinogenesis were assayed by western blot and RT-PCR analyses, MTT (cell-viability, colony-formation, modified Boyden-Chamber (migration and invasion, and flow cytometry (cell-cycle and apoptosis analyses. DSPP-silenced OSC2 cells showed altered cell morphology, reduced viability, decreased colony-formation ability, decreased migration and invasion, G0/G1 cell-cycle arrest, and increased tumor cell sensitivity to cisplatin-induced apoptosis. Furthermore, MMP-2, MMP-3, MMP-9, VEGF, Ki-67, p53, and EGFR were down-regulated. There was a direct correlation between the degree of DSPP-silencing and MMP suppression, as indicated by least squares regression: MMP-2 {(y = 0.850x, p<0.001 (y = 1.156x, p<0.001}, MMP-3 {(y = 0.994x, p<0.001 (y = 1.324x, p = 0.004}, and MMP-9 {(y = 1.248x, p = 0.005, y = 0.809, p = 0.013}.DSPP-silencing in OSC2 cell decreased salient hallmarks of oral tumorigenesis and provides the first functional evidence of a potential key role for DSPP in oral cancer biology. The down-regulation of MMP-2, MMP-3, MMP-9, p53 and VEGF in DSPP

  10. Novel chemokine-like activities of histones in tumor metastasis.

    Science.gov (United States)

    Chen, Ruochan; Xie, Yangchun; Zhong, Xiao; Fu, Yongmin; Huang, Yan; Zhen, Yixiang; Pan, Pinhua; Wang, Haichao; Bartlett, David L; Billiar, Timothy R; Lotze, Michael T; Zeh, Herbert J; Fan, Xue-Gong; Tang, Daolin; Kang, Rui

    2016-09-20

    Histones are intracellular nucleosomal components and extracellular damage-associated molecular pattern molecules that modulate chromatin remodeling, as well as the immune response. However, their extracellular roles in cell migration and invasion remain undefined. Here, we demonstrate that histones are novel regulators of tumor metastasis with chemokine-like activities. Indeed, exogenous histones promote both hepatocellular carcinoma (HCC) cell migration and invasion through toll-like receptor (TLR)4, but not TLR2 or the receptor for advanced glycosylation end product. TLR4-mediated activation of nuclear factor-κB (NF-κB) by extracellular signal-regulated kinase (ERK) is required for histone-induced chemokine (e.g., C-C motif ligand 9/10) production. Pharmacological and genetic inhibition of TLR4-ERK-NF-κB signaling impairs histone-induced chemokine production and HCC cell migration. Additionally, TLR4 depletion (by using TLR4-/- mice and TLR4-shRNA) or inhibition of histone release/activity (by administration of heparin and H3 neutralizing antibody) attenuates lung metastasis of HCC cells injected via the tail vein of mice. Thus, histones promote tumor metastasis of HCC cells through the TLR4-NF-κB pathway and represent novel targets for treating patients with HCC.

  11. phytochemical properties and antibacterial activities of the leaf

    African Journals Online (AJOL)

    DR. AMINU

    antibacterial effects of the plant parts revealed that the leaf extracts had stronger activity in .... Extraction protocols. This was carried out according to the method of. Fatope et al (1993) using soxhlet extraction technique. A quantity (100 g) of the fine powder of the leaves ..... Antibacterial activity of some essential oil.

  12. Scaffold protein enigma homolog activates CREB whereas a short splice variant prevents CREB activation in cardiomyocytes.

    Science.gov (United States)

    Ito, Jumpei; Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Kuroda, Shun'ichi; Maturana, Andrés D

    2015-12-01

    Enigma Homolog (ENH1 or Pdlim5) is a scaffold protein composed of an N-terminal PDZ domain and three LIM domains at the C-terminal end. The enh gene encodes for several splice variants with opposing functions. ENH1 promotes cardiomyocytes hypertrophy whereas ENH splice variants lacking LIM domains prevent it. ENH1 interacts with various Protein Kinase C (PKC) isozymes and Protein Kinase D1 (PKD1). In addition, the binding of ENH1's LIM domains to PKC is sufficient to activate the kinase without stimulation. The downstream events of the ENH1-PKC/PKD1 complex remain unknown. PKC and PKD1 are known to phosphorylate the transcription factor cAMP-response element binding protein (CREB). We tested whether ENH1 could play a role in the activation of CREB. We found that, in neonatal rat ventricular cardiomyocytes, ENH1 interacts with CREB, is necessary for the phosphorylation of CREB at ser133, and the activation of CREB-dependent transcription. On the contrary, the overexpression of ENH3, a LIM-less splice variant, inhibited the phosphorylation of CREB. ENH3 overexpression or shRNA knockdown of ENH1 prevented the CREB-dependent transcription. Our results thus suggest that ENH1 plays an essential role in CREB's activation and dependent transcription in cardiomyocytes. At the opposite, ENH3 prevents the CREB transcriptional activity. In conclusion, these results provide a first molecular explanation to the opposing functions of ENH splice variants. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. A novel AMPK activator hernandezine inhibits LPS-induced TNFα production.

    Science.gov (United States)

    Li, Ping; Li, Xiaofang; Wu, Yonghong; Li, Manxiang; Wang, Xiaochuang

    2017-09-15

    Here, we found that hernandezine, a novel AMPK activator, inhibited LPS-induced TNFα expression/production in human macrophage cells (THP-1 and U937 lines). Activation of AMPK is required for hernandezine-induced anti-LPS response. AMPKα shRNA or dominant negative mutation (T172A) blocked hernandezine-induced AMPK activation, which almost completely reversed anti-LPS activity by hernandezine. Exogenous expression of the constitutively activate AMPKα (T172D, caAMPKα) also suppressed TNFα production by LPS. Remarkably, hernandezine was unable to further inhibit LPS-mediated TNFα production in caAMPKα-expressing cells. Hernandezine inhibited LPS-induced reactive oxygen species (ROS) production and nuclear factor kappa B (NFκB) activation. Treatment of hernandezine in ex-vivo cultured primary human peripheral blood mononuclear cells (PBMCs) also largely attenuated LPS-induced TNFα production. Together, we conclude that AMPK activation by hernandezine inhibits LPS-induced TNFα production in macrophages/monocytes.

  14. A novel chimeric Hepatitis B virus S/preS1 antigen produced in mammalian and plant cells elicits stronger humoral and cellular immune response than the standard vaccine-constituent, S protein.

    Science.gov (United States)

    Dobrica, Mihaela-Olivia; Lazar, Catalin; Paruch, Lisa; Skomedal, Hanne; Steen, Hege; Haugslien, Sissel; Tucureanu, Catalin; Caras, Iuliana; Onu, Adrian; Ciulean, Sonya; Branzan, Alexandru; Clarke, Jihong Liu; Stavaru, Crina; Branza-Nichita, Norica

    2017-08-01

    Chronic Hepatitis B Virus (HBV) infection leads to severe liver pathogenesis associated with significant morbidity and mortality. As no curable medication is yet available, vaccination remains the most cost-effective approach to limit HBV spreading and control the infection. Although safe and efficient, the standard vaccine based on production of the small (S) envelope protein in yeast fails to elicit an effective immune response in about 10% of vaccinated individuals, which are at risk of infection. One strategy to address this issue is the development of more immunogenic antigens. Here we describe a novel HBV antigen obtained by combining relevant immunogenic determinants of S and large (L) envelope proteins. Our approach was based on the insertion of residues 21-47 of the preS1 domain of the L protein (nomenclature according to genotype D), involved in virus attachment to hepatocytes, within the external antigenic loop of S. The resulting S/preS1 21-47 chimera was successfully produced in HEK293T and Nicotiana benthamiana plants, as a more economical recombinant protein production platform. Comparative biochemical, functional and electron microscopy analysis indicated assembly of the novel antigen into subviral particles in mammalian and plant cells. Importantly, these particles preserve both S- and preS1-specific epitopes and elicit significantly stronger humoral and cellular immune responses than the S protein, in both expression systems used. Our data promote this antigen as a promising vaccine candidate to overcome poor responsiveness to the conventional, S protein-based, HBV vaccine. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ

    Directory of Open Access Journals (Sweden)

    Pingping Xia

    2018-03-01

    Full Text Available Background/Aims: Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. Methods: The cerebral injury was established by middle cerebral artery occlusion (MCAO. in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD. ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. Results: We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO. Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. Conclusion: The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling

  16. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ.

    Science.gov (United States)

    Xia, Pingping; Pan, Yundan; Zhang, Fan; Wang, Na; Wang, E; Guo, Qulian; Ye, Zhi

    2018-01-01

    Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. The cerebral injury was established by middle cerebral artery occlusion (MCAO). in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD). ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO). Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH) release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA) could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling pathway. Moreover, the inhibition of Rac1 promoted this function

  17. The RASSF1A tumor suppressor activates Bax via MOAP-1.

    Science.gov (United States)

    Vos, Michele D; Dallol, Ashraf; Eckfeld, Kristin; Allen, Nadia P C; Donninger, Howard; Hesson, Luke B; Calvisi, Diego; Latif, Farida; Clark, Geoffrey J

    2006-02-24

    The novel tumor suppressor RASSF1A is frequently inactivated during human tumorigenesis by promoter methylation. RASSF1A may serve as a node in the integration of signaling pathways controlling a range of critical cellular functions including cell cycle, genomic instability, and apoptosis. The mechanism of action of RASSF1A remains under investigation. We now identify a novel pathway connecting RASSF1A to Bax via the Bax binding protein MOAP-1. RASSF1A and MOAP-1 interact directly, and this interaction is enhanced by the presence of activated K-Ras. RASSF1A can activate Bax via MOAP-1. Moreover, activated K-Ras, RASSF1A, and MOAP-1 synergize to induce Bax activation and cell death. Analysis of a tumor-derived point mutant of RASSF1A showed that the mutant was defective for the MOAP-1 interaction and for Bax activation. Moreover, inhibition of RASSF1A by shRNA impaired the ability of K-Ras to activate Bax. Thus, we identify a novel pro-apoptotic pathway linking K-Ras, RASSF1A and Bax that is specifically impaired in some human tumors.

  18. The NOD2 p.Leu1007fsX1008 mutation (rs2066847 is a stronger predictor of the clinical course of Crohn's disease than the FOXO3A intron variant rs12212067.

    Directory of Open Access Journals (Sweden)

    Fabian Schnitzler

    Full Text Available Very recently, a sub-analysis of genome-wide association scans revealed that the non-coding single nucleotide polymorphism (SNP rs12212067 in the FOXO3A gene is associated with a milder course of Crohn's disease (CD (Cell 2013;155:57-69. The aim of our study was to evaluate the clinical value of the SNP rs12212067 in predicting the severity of CD by correlating CD patient genotype status with the most relevant complications of CD such as stenoses, fistulas, and CD-related surgery.We genotyped 550 CD patients for rs12212067 (FOXO3A and the three common CD-associated NOD2 mutations rs2066844, rs2066847, and rs2066847 and performed genotype-phenotype analyses.No significant phenotypic differences were found between the wild-type genotype TT of the FOXO3A SNP rs12212067 and the minor genotypes TG and GG independently from NOD2 variants. The allele frequency of the minor G allele was 12.7%. Age at diagnosis, disease duration, body mass index, surgery rate, stenoses, fistula, need for immunosuppressive therapy, and disease course were not significantly different. In contrast, the NOD2 mutant p.Leu1007fsX1008 (rs2066847 was highly associated with penetrating CD (p = 0.01, the development of fistulas (p = 0.01 and stenoses (p = 0.01, and ileal disease localization (p = 0.03. Importantly, the NOD2 SNP rs2066847 was a strong separator between an aggressive and a mild course of CD (p = 2.99×10(-5, while the FOXO3A SNP rs12212067 did not separate between mild and aggressive CD behavior in our cohort (p = 0.35. 96.2% of the homozygous NOD2 p.Leu1007fsX1008 carriers had an aggressive disease behavior compared to 69.3% of the patients with the NOD2 wild-type genotype (p = 0.007.In clinical practice, the NOD2 variant p.Leu1007fsX1008 (rs2066847, in particular in homozygous form, is a much stronger marker for a severe clinical phenotype than the FOXO3A rs12212067 SNP for a mild disease course on an individual patient level despite

  19. O-Linked β-N-Acetylglucosamine Modification of A20 Enhances the Inhibition of NF-κB (Nuclear Factor-κB) Activation and Elicits Vascular Protection After Acute Endoluminal Arterial Injury.

    Science.gov (United States)

    Yao, Dan; Xu, Lijuan; Xu, Oufan; Li, Rujun; Chen, Mingxing; Shen, Hui; Zhu, Huajiang; Zhang, Fengyi; Yao, Deshang; Chen, Yiu-Fai; Oparil, Suzanne; Zhang, Zhengang; Gong, Kaizheng

    2018-04-05

    Recently, we have demonstrated that acute glucosamine-induced augmentation of protein O-linked β-N-acetylglucosamine (O-GlcNAc) levels inhibits inflammation in isolated vascular smooth muscle cells and neointimal formation in a rat model of carotid injury by interfering with NF-κB (nuclear factor-κB) signaling. However, the specific molecular target for O-GlcNAcylation that is responsible for glucosamine-induced vascular protection remains unclear. In this study, we test the hypothesis that increased A20 O-GlcNAcylation is required for glucosamine-mediated inhibition of inflammation and vascular protection. In cultured rat vascular smooth muscle cells, both glucosamine and the selective O-linked N-acetylglucosaminidase inhibitor thiamet G significantly increased A20 O-GlcNAcylation. Thiamet G treatment did not increase A20 protein expression but did significantly enhance binding to TAX1BP1, a key regulatory protein for A20 activity. Adenovirus-mediated A20 overexpression further enhanced the effects of thiamet G on prevention of TNF-α (tumor necrosis factor-α)-induced IκB degradation, p65 phosphorylation, and increases in DNA-binding activity. A20 overexpression enhanced the inhibitory effects of thiamet G on TNF-α-induced proinflammatory cytokine expression and vascular smooth muscle cell migration and proliferation, whereas silencing endogenous A20 by transfection of specific A20 shRNA significantly attenuated these inhibitory effects. In balloon-injured rat carotid arteries, glucosamine treatment markedly inhibited neointimal formation and p65 activation compared with vehicle treatment. Adenoviral delivery of A20 shRNA to the injured arteries dramatically reduced balloon injury-induced A20 expression and inflammatory response compared with scramble shRNA and completely abolished the vascular protection of glucosamine. These results suggest that O-GlcNAcylation of A20 plays a key role in the negative regulation of NF-κB signaling cascades in TNF

  20. Liposomal C6 Ceramide Activates Protein Phosphatase 1 to Inhibit Melanoma Cells.

    Directory of Open Access Journals (Sweden)

    Fangzhen Jiang

    Full Text Available Melanoma is one common skin cancer. In the present study, the potential anti-melanoma activity by a liposomal C6 ceramide was tested in vitro. We showed that the liposomal C6 (ceramide was cytotoxic and anti-proliferative against a panel of human melanoma cell lines (SK-Mel2, WM-266.4 and A-375 and WM-115. In addition, liposomal C6 induced caspase-dependent apoptotic death in the melanoma cells. Reversely, its cytotoxicity was attenuated by several caspase inhibitors. Intriguingly, liposomal C6 was non-cytotoxic to B10BR mouse melanocytes and primary human melanocytes. Molecularly, liposomal C6 activated protein phosphatase 1 (PP1 to inactivate Akt-mammalian target of rapamycin (mTOR signaling in melanoma cells. On the other hand, PP1 shRNA knockdown or exogenous expression of constitutively activate Akt1 (CA-Akt1 restored Akt-mTOR activation and significantly attenuated liposomal C6-mediated cytotoxicity and apoptosis in melanoma cells. Our results suggest that liposomal C6 activates PP1 to inhibit melanoma cells.

  1. Inhibition of porcine transmissible gastroenteritis virus (TGEV) replication in mini-pigs by shRNA.

    Science.gov (United States)

    Zhou, Junfang; Huang, Fen; Hua, Xiuguo; Cui, Li; Zhang, Wen; Shen, Yan; Yan, Yijia; Chen, Piren; Ding, Dezhong; Mou, Jing; Chen, Qi; Lan, Daoliang; Yang, Zhibiao

    2010-04-01

    Transmissible gastroenteritis virus (TGEV) is the causative agent of porcine transmissible gastroenteritis (TGE), characterized by high mortality and severely retarded growth in piglets that dramatically affects the porcine industry. Previously, we have identified two shRNA-expressing plasmids pEGFP-U6/P1 and pEGFP-U6/P2 that target RNA-dependent RNA polymerase (RdRP) gene of TGEV with more than 95% of virus inhibition in vitro. In this study, inhibition of the TGEV replication by pEGFP-U6/P1 and pEGFP-U6/P2 was tested in mini-pigs. SPF mini-pigs at 25 days old were injected with the shRNA-expressing plasmids and then infected with TGEV. The results from the analyses of clinical signs, histopathology, indirect immunofluorescence (IIF) and RT-PCR show that the two shRNA-expressing plasmids could significantly decrease the quantity of TGEV in different organs and protect mini-pigs from TGEV infection. These findings illustrate the prospect for TGEV-specific shRNAs to be new anti-TGEV agents. Crown Copyright 2010. Published by Elsevier B.V. All rights reserved.

  2. Potential of adenovirus and baculovirus vectors for the delivery of shRNA against morbilliviruses.

    Science.gov (United States)

    Nizamani, Zaheer Ahmed; Keil, Gunther M; Albina, Emmanuel; Holz, Carine; Minet, Cécile; Kwiatek, Olivier; Libeau, Geneviève; Servan de Almeida, Renata

    2011-04-01

    Morbilliviruses are important pathogens of humans, ruminants, carnivores and marine mammals. Although good vaccines inducing long-term immunity are available, recurrent outbreaks of measles, canine distemper and peste des petits ruminants (PPR) are observed. In control strategies, antivirals thus could be useful to confine virus spread and application of interfering RNAs is a promising approach, provided they can be delivered efficiently into the host cells. We have constructed recombinant adenovirus and baculovirus vectors expressing short hairpin RNAs (shRNAs) against the PPR virus (PPRV) and compared them in vitro. It was found that both recombinant viruses inhibited PPRV replication with the baculovirus vector, which inhibited generation of infectious progeny by more than 2 log10 and the nucleoprotein expression of PPRV by 73%, being the more efficient. The results show that baculoviral shRNA-expressing vectors have the potential for therapeutic use against morbillivirus infections. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Targeting cleavage and polyadenylation specific factor 1 via shRNA ...

    Indian Academy of Sciences (India)

    Beiguang Zhang

    2017-07-27

    Jul 27, 2017 ... the mRNA level of CPSF1 was overexpressed in ovarian cancer tissues using Oncomine Cancer Microarray database. .... cells was analysed by blue fluorescent Hoechst 33342 dye .... Quantitative data of CDK4 and Cyclin D1 proteins were expressed as mean ± standard deviation (SD) of three repeated.

  4. Targeting cleavage and polyadenylation specific factor 1 via shRNA ...

    Indian Academy of Sciences (India)

    Cleavage and polyadenylation specificity factor 1 (CPSF1), a member of CPSF complex, has been reported to play a keyrole in pre-mRNA 30-end formation, but its possible role in ovarian cancer remains unclear. In the present study, we foundthe mRNA level of CPSF1 was overexpressed in ovarian cancer tissues using ...

  5. Identification of Prostate Cancer Metastasis-Suppressor Genes Using Genomic shRNA Libraries

    National Research Council Canada - National Science Library

    Gelman, Irwin H

    2008-01-01

    .... However, little is known regarding the genetics that control disease recurrence. Our proposed research was to screen for metastasis- inducing genes in LNCaP and LAPC-4 CaP cells using libraries expressing RNAi covering the entire human genome...

  6. Towards improved shRNA and miRNA reagents as inhibitors of HIV-1 replication

    NARCIS (Netherlands)

    Berkhout, Ben; Liu, Ying Poi

    2014-01-01

    miRNAs are the key players of the RNAi mechanism, which regulates the expression of a large number of mRNAs in human cells. shRNAs are man-made synthetic miRNA mimics that exploit similar intracellular RNA processing routes. Massive amounts of data derived from next-generation sequencing have

  7. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  8. Detection of Extracellular Enzyme Activities in Ganoderma neo-japonicum

    OpenAIRE

    Jo, Woo-Sik; Park, Ha-Na; Cho, Doo-Hyun; Yoo, Young-Bok; Park, Seung-Chun

    2011-01-01

    The ability of Ganoderma to produce extracellular enzymes, including β-glucosidase, cellulase, avicelase, pectinase, xylanase, protease, amylase, and ligninase was tested in chromogenic media. β-glucosidase showed the highest activity, among the eight tested enzymes. In particular, Ganoderma neo-japonicum showed significantly stronger activity for β-glucosidase than that of the other enzymes. Two Ganoderma lucidum isolates showed moderate activity for avicelase; however, Ganoderma neo-japonic...

  9. Antioxidant activity of Vitex agnus-castus L. extracts.

    Science.gov (United States)

    Sağlam, Hüsniye; Pabuçcuoğlu, Aysun; Kivçak, Bijen

    2007-11-01

    The ethanol, n-hexane and water extracts of Vitex agnus-castus L. leaves and fruits were screened for antioxidant activity. The antioxidant activity of plant extracts was determined by an improved assay based on the decolorization of the radical monocation of 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS.+). The water and ethanol extracts showed stronger antioxidant activity than the n-hexane extracts. Copyright (c) 2007 John Wiley & Sons, Ltd.

  10. Activation of the PI3K/AKT pathway in Merkel cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Christian Hafner

    Full Text Available Merkel cell carcinoma (MCC is a highly aggressive skin cancer with an increasing incidence. The understanding of the molecular carcinogenesis of MCC is limited. Here, we scrutinized the PI3K/AKT pathway, one of the major pathways activated in human cancer, in MCC. Immunohistochemical analysis of 41 tumor tissues and 9 MCC cell lines revealed high levels of AKT phosphorylation at threonine 308 in 88% of samples. Notably, the AKT phosphorylation was not correlated with the presence or absence of the Merkel cell polyoma virus (MCV. Accordingly, knock-down of the large and small T antigen by shRNA in MCV positive MCC cells did not affect phosphorylation of AKT. We also analyzed 46 MCC samples for activating PIK3CA and AKT1 mutations. Oncogenic PIK3CA mutations were found in 2/46 (4% MCCs whereas mutations in exon 4 of AKT1 were absent. MCC cell lines demonstrated a high sensitivity towards the PI3K inhibitor LY-294002. This finding together with our observation that the PI3K/AKT pathway is activated in the majority of human MCCs identifies PI3K/AKT as a potential new therapeutic target for MCC patients.

  11. Synthesis and antimicrobial activity of cholic acid hydrazone analogues.

    Science.gov (United States)

    Rasras, Anas J M; Al-Tel, Taleb H; Al-Aboudi, Amal F; Al-Qawasmeh, Raed A

    2010-06-01

    Synthesis and antimicrobial activity of cholic acid analogues 4a-t are reported. The synthesis of 4a-t was accomplished from ethylcholate 2. The hydrazone moiety was introduced via coupling of the cholic acid hydrazide (3) with appropriately functionalized aldehyde utilizing acetic acid as a catalyst. Quiet of interest in relation to the synthesized hydrazones is the formation of two rotamers s-cis.E and s-trans.E. Most compounds showed stronger antimicrobial activity against Gram-positive bacteria than Cefaclor and Cefixime. Compounds 4d, 4i and 4j indicated 15-fold stronger antimicrobial activities against Enterobacter faecalis compared to Cefaclor and Cefixime. Some of the synthesized compounds (e.g. 4a, 4c, 4d, 4i, and 4l) reflected two-folds less activity against Escherichia coli relative to Cefixime. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

  12. Identification of P450 Oxidoreductase as a Major Determinant of Sensitivity to Hypoxia-Activated Prodrugs.

    Science.gov (United States)

    Hunter, Francis W; Young, Richard J; Shalev, Zvi; Vellanki, Ravi N; Wang, Jingli; Gu, Yongchuan; Joshi, Naveen; Sreebhavan, Sreevalsan; Weinreb, Ilan; Goldstein, David P; Moffat, Jason; Ketela, Troy; Brown, Kevin R; Koritzinsky, Marianne; Solomon, Benjamin; Rischin, Danny; Wilson, William R; Wouters, Bradly G

    2015-10-01

    Hypoxia is a prevalent feature of many tumors contributing to disease progression and treatment resistance, and therefore constitutes an attractive therapeutic target. Several hypoxia-activated prodrugs (HAP) have been developed, including the phase III candidate TH-302 (evofosfamide) and the preclinical agent SN30000, which is an optimized analogue of the well-studied HAP tirapazamine. Experience with this therapeutic class highlights an urgent need to identify biomarkers of HAP sensitivity, including enzymes responsible for prodrug activation during hypoxia. Using genome-scale shRNA screens and a high-representation library enriched for oxidoreductases, we identified the flavoprotein P450 (cytochrome) oxidoreductase (POR) as the predominant determinant of sensitivity to SN30000 in three different genetic backgrounds. No other genes consistently modified SN30000 sensitivity, even within a POR-negative background. Knockdown or genetic knockout of POR reduced SN30000 reductive metabolism and clonogenic cell death and similarly reduced sensitivity to TH-302 under hypoxia. A retrospective evaluation of head and neck squamous cell carcinomas showed heterogeneous POR expression and suggested a possible relationship between human papillomavirus status and HAP sensitivity. Taken together, our study identifies POR as a potential predictive biomarker of HAP sensitivity that should be explored during the clinical development of SN30000, TH-302, and other hypoxia-directed agents. ©2015 American Association for Cancer Research.

  13. Bufotalin-induced apoptosis in osteoblastoma cells is associated with endoplasmic reticulum stress activation.

    Science.gov (United States)

    Zhu, Yun-Rong; Xu, Yong; Fang, Jian-Feng; Zhou, Feng; Deng, Xiong-Wei; Zhang, Yun-Qing

    2014-08-15

    The search for novel and more efficient chemo-agents against malignant osteoblastoma is important. In this study, we examined the potential anti-osteoblastoma function of bufotalin, and studied the underlying mechanisms. Our results showed that bufotalin induced osteoblastoma cell death and apoptosis in dose- and time-dependent manners. Further, bufotalin induced endoplasmic reticulum (ER) stress activation in osteoblastoma cells, the latter was detected by the induction of C/EBP homologous protein (CHOP), phosphorylation of inositol-requiring enzyme 1 (IRE1) and PKR-like endoplasmic reticulum kinase (PERK), as well as caspase-12 activation. Conversely, the ER stress inhibitor salubrinal, the caspase-12 inhibitor z-ATAD-fmk as well as CHOP depletion by shRNA significantly inhibited bufotalin-induced osteoblastoma cell death and apoptosis. Finally, by using a mice xenograft model, we demonstrated that bufotalin inhibited U2OS osteoblastoma cell growth in vivo. In summary, our results suggest that ER stress contributes to bufotalin-induced apoptosis in osteoblastoma cells. Bufotalin might be investigated as a novel anti-osteoblastoma agent. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Expression and activity of eIF6 trigger malignant pleural mesothelioma growth in vivo.

    Science.gov (United States)

    Miluzio, Annarita; Oliveto, Stefania; Pesce, Elisa; Mutti, Luciano; Murer, Bruno; Grosso, Stefano; Ricciardi, Sara; Brina, Daniela; Biffo, Stefano

    2015-11-10

    eIF6 is an antiassociation factor that regulates the availability of active 80S. Its activation is driven by the RACK1/PKCβ axis, in a mTORc1 independent manner. We previously described that eIF6 haploinsufficiency causes a striking survival in the Eμ-Myc mouse lymphoma model, with lifespans extended up to 18 months. Here we screen for eIF6 expression in human cancers. We show that Malignant Pleural Mesothelioma tumors (MPM) and a MPM cell line (REN cells) contain high levels of hyperphosphorylated eIF6. Enzastaurin is a PKC beta inhibitor used in clinical trials. We prove that Enzastaurin treatment decreases eIF6 phosphorylation rate, but not eIF6 protein stability. The growth of REN, in vivo, and metastasis are reduced by either Enzastaurin treatment or eIF6 shRNA. Molecular analysis reveals that eIF6 manipulation affects the metabolic status of malignant mesothelioma cells. Less glycolysis and less ATP content are evident in REN cells depleted for eIF6 or treated with Enzastaurin (Anti-Warburg effect). We propose that eIF6 is necessary for malignant mesothelioma growth, in vivo, and can be targeted by kinase inhibitors.

  15. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  16. Synthesis and anti-inflammatory activity of phenylbutenoid dimer analogs

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Soo; Fang, Yuan Ying; Park, Hae Eil [Kangwon National University, Chuncheon (Korea, Republic of)

    2015-06-15

    Several phenylbutenoid dimer (PBD) analogs were synthesized and evaluated for their inhibitory activities against nitric oxide (NO) production and TNF-α release. The PBD analogs were synthesized via Diels–Alder and subsequent Schlosser reactions as key steps. Among the tested compounds, two analogs (8c, 8f) exhibited much stronger inhibitory activity against LPS-stimulated NO production and TNF-α release in RAW 264.7 cells than that of wogonin.

  17. Src homology phosphotyrosyl phosphatase 2 mediates cisplatin-related drug resistance by inhibiting apoptosis and activating the Ras/PI3K/Akt1/survivin pathway in lung cancer cells.

    Science.gov (United States)

    Tang, Chunlan; Luo, Hu; Luo, Dan; Yang, Heping; Zhou, Xiangdong

    2018-02-01

    Cisplatin resistance is a major cause of chemotherapeutic failure in lung cancer patients. Unraveling the molecular mechanisms underlying cisplatin (CDDP) resistance is important in lung cancer therapeutics. To explore the role of Src homology phosphotyrosyl phosphatase 2 (SHP2) in the development of cisplatin resistance in lung cancer and the underlying mechanism, we established stable SHP2‑overexpressing H446‑SHP2-OE cells and SHP2‑knockdown H446/CDDP‑SHP2-shRNA cells derived from H446 and H446/CDDP (cisplatin-resistant) parental lung cancer cells. The cell viability and apoptosis of these cells exposed to CDDP were observed to determine the influence of SHP2 on drug resistance. In addition, the expression of SHP2, Ras, Akt1 and survivin was assessed by western blot analysis after the lung cancer cells were challenged by cisplatin or silenced by Ras siRNA. As a result, the 50% inhibitory concentration (IC50) of the H446-SHP2-OE cells exposed to CDDP increased from 1.01 to 1.218 µg/ml vs. the H446-control vector cells. The percentage of apoptotic cells was smaller in the H446-SHP2-OE cells vs. the H446-control vector cells after cisplatin challenge. In addition, the expression of Ras, pAkt1, Akt1 and survivin in the H446/CDDP cells was significantly increased vs. the H446 cells. Furthermore, the IC50 of the H446/CDDP‑SHP2‑shRNA cells exposed to CDDP decreased from 11.92 to 4.382 µg/ml vs. the H446/CDDP‑mock cells. There were significantly more apoptotic cells among the H446/CDDP‑SHP2-shRNA cells vs. the H446/CDDP-mock cells exposed to cisplatin. A smaller percentage of the H446/CDDP-SHP2-shRNA cells vs. the H446/CDDP‑mock cells was observed. In addition, the expression of pAkt1 and survivin in the H446, H446/CDDP and H446/CDDP-mock cells was increased upon exposure to cisplatin however, a corresponding change was not observed in the H446/CDDP-SHP2-shRNA cells. Upon Ras RNA silencing with cisplatin, the Ras expression was significantly

  18. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bing, E-mail: wangbin69@yahoo.com; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-07-19

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells.

  19. Protein kinase C-α signals P115RhoGEF phosphorylation and RhoA activation in TNF-α-induced mouse brain microvascular endothelial cell barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Deng Xiaolu

    2011-04-01

    Full Text Available Abstract Background Tumor necrosis factor-α (TNF-α, a proinflammatory cytokine, is capable of activating the small GTPase RhoA, which in turn contributes to endothelial barrier dysfunction. However, the underlying signaling mechanisms remained undefined. Therefore, we aimed to determine the role of protein kinase C (PKC isozymes in the mechanism of RhoA activation and in signaling TNF-α-induced mouse brain microvascular endothelial cell (BMEC barrier dysfunction. Methods Bend.3 cells, an immortalized mouse brain endothelial cell line, were exposed to TNF-α (10 ng/mL. RhoA activity was assessed by pull down assay. PKC-α activity was measured using enzyme assasy. BMEC barrier function was measured by transendothelial electrical resistance (TER. p115RhoGEF phosphorylation was detected by autoradiography followed by western blotting. F-actin organization was observed by rhodamine-phalloidin staining. Both pharmacological inhibitors and knockdown approaches were employed to investigate the role of PKC and p115RhoGEF in TNF-α-induced RhoA activation and BMEC permeability. Results We observed that TNF-α induces a rapid phosphorylation of p115RhoGEF, activation of PKC and RhoA in BMECs. Inhibition of conventional PKC by Gö6976 mitigated the TNF-α-induced p115RhoGEF phosphorylation and RhoA activation. Subsequently, we found that these events are regulated by PKC-α rather than PKC-β by using shRNA. In addition, P115-shRNA and n19RhoA (dominant negative mutant of RhoA transfections had no effect on mediating TNF-α-induced PKC-α activation. These data suggest that PKC-α but not PKC-β acts as an upstream regulator of p115RhoGEF phosphorylation and RhoA activation in response to TNF-α. Moreover, depletion of PKC-α, of p115RhoGEF, and inhibition of RhoA activation also prevented TNF-α-induced stress fiber formation and a decrease in TER. Conclusions Taken together, our results show that PKC-α phosphorylation of p115RhoGEF mediates TNF

  20. Hypoxic activation of the unfolded protein response (UPR) induces expression of the metastasis-associated gene LAMP3

    International Nuclear Information System (INIS)

    Mujcic, Hilda; Rzymski, Tomasz; Rouschop, Kasper M.A.; Koritzinsky, Marianne; Milani, Manuela; Harris, Adrian L.; Wouters, Bradly G.

    2009-01-01

    Background and purpose: Tumour hypoxia contributes to failure of cancer treatment through its ability to protect against therapy and adversely influence tumour biology. In particular, several studies suggest that hypoxia promotes metastasis. Hypoxia-induced cellular changes are mediated by oxygen-sensitive signaling pathways that activate downstream transcription factors. We have investigated the induction and transcriptional regulation of a novel metastasis-associated gene, LAMP3 during hypoxia. Materials and methods: Microarray, quantitative PCR, Western blot analysis and immunohistochemistry were used to investigate hypoxic regulation of LAMP3. The mechanism for LAMP3 induction was investigated using transient RNAi and stable shRNA targeting components of the hypoxic response. Endoplasmic reticulum stress inducing agents, including proteasome inhibitors were assessed for their ability to regulate LAMP3. Results: LAMP3 is strongly induced by hypoxia at both the mRNA and protein levels in a large panel of human tumour cell lines. Induction of LAMP3 occurs as a consequence of the activation of the PERK/eIF2α/ATF4 arm of the unfolded protein response (UPR) and is independent of HIF-1α. LAMP3 is expressed heterogeneously within the microenvironment of tumours, overexpressed in breast cancer, and increases in tumours treated with avastin. Conclusions: These data identify LAMP3 as a novel hypoxia-inducible gene regulated by the UPR. LAMP3 is a new candidate biomarker of UPR activation by hypoxia in tumours and is a potential mediator of hypoxia-induced metastasis.

  1. Induction of Non-Apoptotic Cell Death by Activated Ras Requires Inverse Regulation of Rac1 and Arf6

    Science.gov (United States)

    Bhanot, Haymanti; Young, Ashley M.; Overmeyer, Jean H.; Maltese, William A.

    2010-01-01

    Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Methuosis can be induced in glioblastoma cells by expression of constitutively active Ras. This study identifies the small GTPases, Rac1 and Arf6, and the Arf6 GTPase-activating-protein, GIT1, as key downstream components of the signaling pathway underlying Ras-induced methuosis. The extent to which graded expression of active H-Ras(G12V) triggers cytoplasmic vacuolization correlates with the amount of endogenous Rac1 in the active GTP state. Blocking Rac1 activation with the specific Rac inhibitor, EHT 1864, or co-expression of dominant-negative Rac1(T17N), prevents the accumulation of vacuoles induced by H-Ras(G12V). Coincident with Rac1 activation, H-Ras(G12V) causes a decrease in the amount of active Arf6, a GTPase that functions in recycling of clathrin-independent endosomes. The effect of H-Ras(G12V) on Arf6 is blocked by EHT 1864, indicating that the decrease in Arf6-GTP is directly linked to activation of Rac1. Constitutively active Rac1(G12V) interacts with GIT1 in immunoprecipitation assays. Ablation of GIT1 by shRNA prevents the decrease in active Arf6, inhibits vacuolization, and prevents loss of cell viability in cells expressing Rac1(G12V). Together the results suggest that perturbations of endosome morphology associated with Ras-induced methuosis are due to downstream activation of Rac1, combined with reciprocal inactivation of Arf6. The latter appears to be mediated through Rac1 stimulation of GIT1. Further insights into this pathway could suggest opportunities for induction of methuosis in cancers that are resistant to apoptotic cell death. PMID:20713492

  2. Transcriptional activation of the human CD2AP promoter by E2F1.

    Directory of Open Access Journals (Sweden)

    Li Zou

    Full Text Available CD2-associated protein (CD2AP is an adaptor molecule involved in T cell receptor signaling and podocyte homeostasis. CD2AP-deficient mice develop nephritic syndrome and renal failure caused by glomerulosclerosis. Transcription factor E2F1 is a key regulator of cell proliferation and apoptosis. Here we report that E2F1 up-regulates the human CD2AP promoter and further increases the mRNA and protein levels of the human CD2AP in human embryonic kidney (HEK 293 cells. By semi-quantitative RT-PCR and Western blot analysis we demonstrate that ectopic expression of E2F1 elevates the mRNA and protein levels of CD2AP. Consistently, transient transfection assays prove that overexpression of E2F1 transactivates the CD2AP promoter while knocking-down of endogenous E2F1 by a shRNA strategy results in reduction of the CD2AP promoter activity. Toward understanding the underlying mechanism of this regulation, we performed chromatin immunoprecipitation and mutations of the putative Sp1 binding sites, demonstrating that E2F1 can bind to Sp1 binding site and overexpression of E2F1 is capable of increasing the binding of E2F1 and decreasing the binding of Sp1 to Sp1 binding sites.

  3. Stat3 activates the receptor tyrosine kinase like orphan receptor-1 gene in chronic lymphocytic leukemia cells.

    Directory of Open Access Journals (Sweden)

    Ping Li

    Full Text Available BACKGROUND: The receptor tyrosine kinase like orphan receptor (ROR-1 gene is overexpressed in chronic lymphocytic leukemia (CLL. Because Stat3 is constitutively activated in CLL and sequence analysis revealed that the ROR1 promoter harbors gamma-interferon activation sequence-like elements typically activated by Stat3, we hypothesized that Stat3 activates ROR1. METHODOLOGY/PRINCIPAL FINDINGS: Because IL-6 induced Stat3 phosphorylation and upregulated Ror1 protein levels in MM1 cells, we used these cells as a model. We transfected MM1 cells with truncated ROR1 promoter luciferase reporter constructs and found that IL-6 induced luciferase activity of ROR1-195 and upstream constructs. Co-transfection with Stat3 siRNA reduced the IL-6-induced luciferase activity, suggesting that IL-6 induced luciferase activity by activating Stat3. EMSA and the ChIP assay confirmed that Stat3 binds ROR1, and EMSA studies identified two Stat3 binding sites. In CLL cells, EMSA and ChIP studies determined that phosphorylated Stat3 bound to the ROR1 promoter at those two ROR1 promoter sites, and ChIP analysis showed that Stat3 co-immunoprecipitated DNA of STAT3, ROR1, and several Stat3-regulated genes. Finally, like STAT3-siRNA in MM1 cells, STAT3-shRNA downregulated STAT3, ROR1, and STAT3-regulated genes and Stat3 and Ror1 protein levels in CLL cells. CONCLUSION/SIGNIFICANCE: Our data suggest that constitutively activated Stat3 binds to the ROR1 promoter and activates ROR1 in CLL cells.

  4. BAS-drive trait modulates dorsomedial striatum activity during reward response-outcome associations.

    Science.gov (United States)

    Costumero, Víctor; Barrós-Loscertales, Alfonso; Fuentes, Paola; Rosell-Negre, Patricia; Bustamante, Juan Carlos; Ávila, César

    2016-09-01

    According to the Reinforcement Sensitivity Theory, behavioral studies have found that individuals with stronger reward sensitivity easily detect cues of reward and establish faster associations between instrumental responses and reward. Neuroimaging studies have shown that processing anticipatory cues of reward is accompanied by stronger ventral striatum activity in individuals with stronger reward sensitivity. Even though establishing response-outcome contingencies has been consistently associated with dorsal striatum, individual differences in this process are poorly understood. Here, we aimed to study the relation between reward sensitivity and brain activity while processing response-reward contingencies. Forty-five participants completed the BIS/BAS questionnaire and performed a gambling task paradigm in which they received monetary rewards or punishments. Overall, our task replicated previous results that have related processing high reward outcomes with activation of striatum and medial frontal areas, whereas processing high punishment outcomes was associated with stronger activity in insula and middle cingulate. As expected, the individual differences in the activity of dorsomedial striatum correlated positively with BAS-Drive. Our results agree with previous studies that have related the dorsomedial striatum with instrumental performance, and suggest that the individual differences in this area may form part of the neural substrate responsible for modulating instrumental conditioning by reward sensitivity.

  5. CFTR impairment upregulates c-Src activity through IL-1β autocrine signaling.

    Science.gov (United States)

    Massip-Copiz, María Macarena; Clauzure, Mariángeles; Valdivieso, Ángel Gabriel; Santa-Coloma, Tomás Antonio

    2017-02-15

    Cystic Fibrosis (CF) is a disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Previously, we found several genes showing a differential expression in CFDE cells (epithelial cells derived from a CF patient). One corresponded to c-Src; its expression and activity was found increased in CFDE cells, acting as a signaling molecule between the CFTR activity and MUC1 overexpression. Here we report that bronchial IB3-1 cells (CF cells) also showed increased c-Src activity compared to 'CFTR-corrected' S9 cells. In addition, three different Caco-2 cell lines, each stably transfected with a different CFTR-specific shRNAs, displayed increased c-Src activity. The IL-1β receptor antagonist IL1RN reduced the c-Src activity of Caco-2/pRS26 cells (expressing a CFTR-specific shRNA). In addition, increased mitochondrial and cellular ROS levels were detected in Caco-2/pRS26 cells. ROS levels were partially reduced by incubation with PP2 (c-Src inhibitor) or IL1RN, and further reduced by using the NOX1/4 inhibitor GKT137831. Thus, IL-1β→c-Src and IL-1β→NOX signaling pathways appear to be responsible for the production of cellular and mitochondrial ROS in CFTR-KD cells. In conclusion, IL-1β constitutes a new step in the CFTR signaling pathway, located upstream of c-Src, which is stimulated in cells with impaired CFTR activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

    Science.gov (United States)

    Frampton, Gabriel; Coufal, Monique; Li, Huang; Ramirez, Jonathan; DeMorrow, Sharon

    2010-01-01

    The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the γ-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors; and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2-containing- γ-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation and nuclear translocation was determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors prior to stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment and the involvement of presenilin 1 and 2 in the cannabinoid induced effects were demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the γ-secretase complex whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system, or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management. PMID:20347808

  7. Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

    Energy Technology Data Exchange (ETDEWEB)

    Frampton, Gabriel; Coufal, Monique [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Li, Huang [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Department of Hepatobiliary Surgery, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou (China); Ramirez, Jonathan [Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States); DeMorrow, Sharon, E-mail: demorrow@medicine.tamhsc.edu [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States)

    2010-05-15

    The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the {gamma}-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-{gamma}-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the {gamma}-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.

  8. Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling.

    Science.gov (United States)

    Frampton, Gabriel; Coufal, Monique; Li, Huang; Ramirez, Jonathan; DeMorrow, Sharon

    2010-05-15

    The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the gamma-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-gamma-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the gamma-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management. Copyright 2010 Elsevier Inc. All rights reserved.

  9. Active Teachers - Active Students

    DEFF Research Database (Denmark)

    Learning is active in nature. It is something you do, not something that is done to you. Engineering educators around the world recognize this basic truth and implement one or another form of active learning to enhance their teaching. Active learning in Engineering (ALE) was started as an initiat...

  10. Structure-activity relationships of rosiglitazone for peroxisome proliferator-activated receptor gamma transrepression.

    Science.gov (United States)

    Toyota, Yosuke; Nomura, Sayaka; Makishima, Makoto; Hashimoto, Yuichi; Ishikawa, Minoru

    2017-06-15

    Anti-inflammatory effects of peroxisome proliferator-activated receptor gamma (PPRAγ) ligands are thought to be largely due to PPARγ-mediated transrepression. Thus, transrepression-selective PPARγ ligands without agonistic activity or with only partial agonistic activity should exhibit anti-inflammatory properties with reduced side effects. Here, we investigated the structure-activity relationships (SARs) of PPARγ agonist rosiglitazone, focusing on transrepression activity. Alkenic analogs showed slightly more potent transrepression with reduced efficacy of transactivating agonistic activity. Removal of the alkyl group on the nitrogen atom improved selectivity for transrepression over transactivation. Among the synthesized compounds, 3l exhibited stronger transrepressional activity (IC 50 : 14μM) and weaker agonistic efficacy (11%) than rosiglitazone or pioglitazone. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. The imperative for stronger vaccine supply and logistics systems.

    Science.gov (United States)

    Zaffran, Michel; Vandelaer, Jos; Kristensen, Debra; Melgaard, Bjørn; Yadav, Prashant; Antwi-Agyei, K O; Lasher, Heidi

    2013-04-18

    With the introduction of new vaccines, developing countries are facing serious challenges in their vaccine supply and logistics systems. Storage capacity bottlenecks occur at national, regional, and district levels and system inefficiencies threaten vaccine access, availability, and quality. As countries adopt newer and more expensive vaccines and attempt to reach people at different ages and in new settings, their logistics systems must be strengthened and optimized. As a first step, national governments, donors, and international agencies have crafted a global vision for 2020 vaccine supply and logistics systems with detailed plans of action to achieve five priority objectives. Vaccine products and packaging are designed to meet the needs of developing countries. Immunization supply systems support efficient and effective vaccine delivery. The environmental impact of energy, materials, and processes used in immunization systems is minimized. Immunization information systems enable better and more timely decision-making. Competent and motivated personnel are empowered to handle immunization supply chain issues. Over the next decade, vaccine supply and logistics systems in nearly all developing countries will require significant investments of time and resources from global and national partners, donors, and governments. These investments are critical if we are to reach more people with current and newer vaccines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Women's political participation leads to stronger local economies ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-06-08

    Jun 8, 2016 ... Changes in key laws, such as the Hindu Succession Act, have benefited Hindu women by providing them with access to assets, such as property rights. This has increased their potential to participate in the decision-making process, and encouraged them to participate in the local economy. Reforms have ...

  13. Stronger Collaborations Needed for Successful Space Weather Research

    Science.gov (United States)

    Akasofu, Syun-Ichi

    2007-12-01

    One of the purposes of space weather research is to predict when and how the electromagnetic environment around the Earth will be disturbed after specific (solar storms,) which are defined here as various transient solar phenomena that occur at the time of solar flares [Akasofu and Chapman, 1972]. Accurate space weather predictions require an integrating and synthesizing research effort by a close collaboration among solar physicists, interplanetary physicists, magnetospheric physicists, and upper atmosphere physicists. Unfortunately, such integration/synthesis (I/S) projects in the past have often become an umbrella under which individual researchers in the four disciplines pursue only subjects of their own interests, disintegrate into individual projects, and even encourage the trend of infinite specialization because of the potential availability of additional funds.

  14. CIOs Talk about Budgets: Emerging Stronger and Leaner

    Science.gov (United States)

    Maas, Bruce; Miller, Fredrick; Orr, Pattie; Ouska, Julie; Waggener, Shelton M.; Goldstein, Philip J., Comp.

    2009-01-01

    To explore current and future implications of the economic downturn, "EDUCAUSE Review" assembled a panel of senior IT leaders: (1) Bruce Maas, CIO, University of Wisconsin-Milwaukee; (2) Fredrick Miller, CIO, Furman University; (3) Pattie Orr, Vice President for IT and Dean of University Libraries, Baylor University; (4) Julie Ouska, CIO…

  15. Collective Impact: Stronger Results with Community-Based Organizations

    Science.gov (United States)

    ExpandED Schools, 2014

    2014-01-01

    Cross-sector cradle-to-career initiatives are increasingly central to communities' strategies to support children and youth. StriveTogether Cradle to Career Civic Infrastructure provides a framework for how a community comes together around a vision; improves and builds upon those efforts over time; and invests the community's resources…

  16. Stronger at Depth: Jamming Grippers as Deep Sea Sampling Tools.

    Science.gov (United States)

    Licht, Stephen; Collins, Everett; Mendes, Manuel Lopes; Baxter, Christopher

    2017-12-01

    In this work we experimentally demonstrate (a) that the holding strength of universal jamming grippers increases as a function of the jamming pressure to greater than three atmospheres, and (b) that jamming grippers can be operated in the deep sea in ambient pressures exceeding one hundred atmospheres, where such high jamming pressures can be readily achieved. Laboratory experiments in a pressurized, water-filled test cell are used to measure the holding force of a "universal" style jamming gripper as a function of the pressure difference between internal membrane pressure and ambient pressure. Experiments at sea are used to demonstrate that jamming grippers can be installed on, and operated from, remotely operated vehicles at depths in excess of 1200 m. In both experiments, the jamming gripper consists of a latex balloon filled with a mixture of fresh water and ∼200 μm glass beads, which are cheaply available in large quantities as sand blasting media. The use of a liquid, rather than a gas, as the fluid media allows operation of the gripper with a closed-loop fluid system; jamming pressure is controlled with an electrically driven water hydraulic cylinder in the laboratory and with an oil hydraulic-driven large-bore water hydraulic cylinder at sea.

  17. Effective and Innovative Practices for Stronger Facilities Management.

    Science.gov (United States)

    Banick, Sarah

    2002-01-01

    Describes the five winners of the APPA's Effective & Innovative Practices Award. These facilities management programs and processes were recognized for enhancing service delivery, lowering costs, increasing productivity, improving customer service, generating revenue, or otherwise benefiting the educational institution. (EV)

  18. A three-legged stool needs a stronger third leg.

    Science.gov (United States)

    Greenberg, Ramon

    2013-12-01

    Whereas the target article stresses the neurobiology and psychology of dreams, this commentary emphasizes that the role of dreams in emotional integration and adaptation contributes to a fuller understanding of dreaming and memory. The dream presented in the target article is used, within the constraints of space, as a possible example of a broader approach to dream material.

  19. Does pattern-welding make Anglo-Saxon swords stronger?

    DEFF Research Database (Denmark)

    Birch, Thomas

    2013-01-01

    The purpose of pattern-welding, used for the construction of some Anglo-Saxon swords, has yet to be fully resolved. One suggestion is that the technique enhanced the mechanical properties of a blade. Another explanation is that pattern-welding created a desired aesthetic appearance. In order to a...

  20. Does Good Corporate Governance Lead to Stronger Productivity Growth?

    NARCIS (Netherlands)

    Koeke, J.; Renneboog, L.D.R.

    2002-01-01

    This study investigates the impact of corporate governance and product market competition on total factor productivity growth in Germany and the UK.For Germany, the prototype of a bank-based governance system, productivity grows faster in firms controlled by financial institutions (in particular,

  1. Fine time course expression analysis identifies cascades of activation and repression and maps a putative regulator of mammalian sex determination.

    Directory of Open Access Journals (Sweden)

    Steven C Munger

    Full Text Available In vertebrates, primary sex determination refers to the decision within a bipotential organ precursor to differentiate as a testis or ovary. Bifurcation of organ fate begins between embryonic day (E 11.0-E12.0 in mice and likely involves a dynamic transcription network that is poorly understood. To elucidate the first steps of sexual fate specification, we profiled the XX and XY gonad transcriptomes at fine granularity during this period and resolved cascades of gene activation and repression. C57BL/6J (B6 XY gonads showed a consistent ~5-hour delay in the activation of most male pathway genes and repression of female pathway genes relative to 129S1/SvImJ, which likely explains the sensitivity of the B6 strain to male-to-female sex reversal. Using this fine time course data, we predicted novel regulatory genes underlying expression QTLs (eQTLs mapped in a previous study. To test predictions, we developed an in vitro gonad primary cell assay and optimized a lentivirus-based shRNA delivery method to silence candidate genes and quantify effects on putative targets. We provide strong evidence that Lmo4 (Lim-domain only 4 is a novel regulator of sex determination upstream of SF1 (Nr5a1, Sox9, Fgf9, and Col9a3. This approach can be readily applied to identify regulatory interactions in other systems.

  2. PTP-PEST targets a novel tyrosine site in p120 catenin to control epithelial cell motility and Rho GTPase activity.

    Science.gov (United States)

    Espejo, Rosario; Jeng, Yowjiun; Paulucci-Holthauzen, Adriana; Rengifo-Cam, William; Honkus, Krysta; Anastasiadis, Panos Z; Sastry, Sarita K

    2014-02-01

    Tyrosine phosphorylation is implicated in regulating the adherens junction protein, p120 catenin (p120), however, the mechanisms are not well defined. Here, we show, using substrate trapping, that p120 is a direct target of the protein tyrosine phosphatase, PTP-PEST, in epithelial cells. Stable shRNA knockdown of PTP-PEST in colon carcinoma cells results in an increased cytosolic pool of p120 concomitant with its enhanced tyrosine phosphorylation and decreased association with E-cadherin. Consistent with this, PTP-PEST knockdown cells exhibit increased motility, enhanced Rac1 and decreased RhoA activity on a collagen substrate. Furthermore, p120 localization is enhanced at actin-rich protrusions and lamellipodia and has an increased association with the guanine nucleotide exchange factor, VAV2, and cortactin. Exchange factor activity of VAV2 is enhanced by PTP-PEST knockdown whereas overexpression of a VAV2 C-terminal domain or DH domain mutant blocks cell motility. Analysis of point mutations identified tyrosine 335 in the N-terminal domain of p120 as the site of PTP-PEST dephosphorylation. A Y335F mutant of p120 failed to induce the 'p120 phenotype', interact with VAV2, stimulate cell motility or activate Rac1. Together, these data suggest that PTP-PEST affects epithelial cell motility by controlling the distribution and phosphorylation of p120 and its availability to control Rho GTPase activity.

  3. PTP-PEST targets a novel tyrosine site in p120 catenin to control epithelial cell motility and Rho GTPase activity

    Science.gov (United States)

    Espejo, Rosario; Jeng, Yowjiun; Paulucci-Holthauzen, Adriana; Rengifo-Cam, William; Honkus, Krysta; Anastasiadis, Panos Z.; Sastry, Sarita K.

    2014-01-01

    ABSTRACT Tyrosine phosphorylation is implicated in regulating the adherens junction protein, p120 catenin (p120), however, the mechanisms are not well defined. Here, we show, using substrate trapping, that p120 is a direct target of the protein tyrosine phosphatase, PTP-PEST, in epithelial cells. Stable shRNA knockdown of PTP-PEST in colon carcinoma cells results in an increased cytosolic pool of p120 concomitant with its enhanced tyrosine phosphorylation and decreased association with E-cadherin. Consistent with this, PTP-PEST knockdown cells exhibit increased motility, enhanced Rac1 and decreased RhoA activity on a collagen substrate. Furthermore, p120 localization is enhanced at actin-rich protrusions and lamellipodia and has an increased association with the guanine nucleotide exchange factor, VAV2, and cortactin. Exchange factor activity of VAV2 is enhanced by PTP-PEST knockdown whereas overexpression of a VAV2 C-terminal domain or DH domain mutant blocks cell motility. Analysis of point mutations identified tyrosine 335 in the N-terminal domain of p120 as the site of PTP-PEST dephosphorylation. A Y335F mutant of p120 failed to induce the ‘p120 phenotype’, interact with VAV2, stimulate cell motility or activate Rac1. Together, these data suggest that PTP-PEST affects epithelial cell motility by controlling the distribution and phosphorylation of p120 and its availability to control Rho GTPase activity. PMID:24284071

  4. Inhibition of protein degradation induces apoptosis through a microtubule-associated protein 1 light chain 3-mediated activation of caspase-8 at intracellular membranes.

    Science.gov (United States)

    Pan, Ji-An; Ullman, Erica; Dou, Zhixun; Zong, Wei-Xing

    2011-08-01

    The accumulation of damaged or misfolded proteins, if unresolved, can lead to a detrimental consequence within cells termed proteotoxicity. Since cancerous cells often display elevated protein synthesis and by-product disposal, inhibition of the protein degradation pathways is an emerging approach for cancer therapy. However, the molecular mechanism underlying proteotoxicity remains largely unclear. We show here that inhibition of proteasomal degradation results in an increased oligomerization and activation of caspase-8 on the cytosolic side of intracellular membranes. This enhanced caspase-8 oligomerization and activation are promoted through its interaction with the ubiquitin-binding protein SQSTM1/p62 and the microtubule-associated protein light chain 3 (LC3), which are enriched at intracellular membranes in response to proteotoxic stress. Silencing LC3 by shRNA, or the LC3 mutants defective in membrane localization or p62 interaction fail to induce caspase-8 activation and apoptosis. Our results unveiled a previously unknown mechanism through which disruption of protein homeostasis induces caspase-8 oligomerization, activation, and apoptosis.

  5. “Environmental Psychology” the mental benefits of physical activities in natural settings

    OpenAIRE

    De Dominicis, Stefano

    2017-01-01

    Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising and playing sports in natural environments. Specifically, given their intrinsic characteristics, such contexts are more prone then urban environments to foster positive emotions, controlled cognition...

  6. Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yi; Cui, Jiang-Tao, E-mail: cuijingtaopaper@126.com

    2016-09-02

    Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

  7. Activation of mPTP-dependent mitochondrial apoptosis pathway by a novel pan HDAC inhibitor resminostat in hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Meili [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Shi, Wenhong [Department of Radiotherapy, Linyi Tumor Hospital, Linyi (China); Li, Zhengling [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, No. 27 Jiefang Road, Linyi 276000, Shandong (China)

    2016-09-02

    Over-expression and aberrant activation of histone deacetylases (HDACs) are often associated with poor prognosis of hepatocellular carcinoma (HCC). Here, we evaluated the potential anti-hepatocellular carcinoma (HCC) cell activity by resminostat, a novel pan HDAC inhibitor (HDACi). We demonstrated that resminostat induced potent cytotoxic and anti-proliferative activity against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, resminostat treatment in HCC cells activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway, which was evidenced by physical association of cyclophilin-D and adenine nucleotide translocator 1 (ANT-1), mitochondrial depolarization, cytochrome C release and caspase-9 activation. Intriguingly, the mPTP blockers (sanglifehrin A and cyclosporine A), shRNA knockdown of cyclophilin-D or the caspase-9 inhibitor dramatically attenuated resminostat-induced HCC cell apoptosis and cytotoxicity. Reversely, HCC cells with exogenous cyclophilin-D over-expression were hyper-sensitive to resminostat. Intriguingly, a low concentration of resminostat remarkably potentiated sorafenib-induced mitochondrial apoptosis pathway activation, leading to a profound cytotoxicity in HCC cells. The results of this preclinical study indicate that resminostat (or plus sorafenib) could be further investigated as a valuable anti-HCC strategy. - Highlights: • Resminostat inhibits human HCC cell survival and proliferation. • Resminostat activates mPTP-dependent mitochondrial apoptosis pathway in HCC cells. • Resminostat potentiates sorafenib-induced mitochondrial apoptosis pathway activation. • mPTP or caspase-9 inhibition attenuates apoptosis by resminostat or plus sorafenib.

  8. Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

    International Nuclear Information System (INIS)

    Li, Yi; Cui, Jiang-Tao

    2016-01-01

    Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

  9. Stronger declines in youth alcohol consumption thanks to stronger integrated alcohol policies? A qualitative comparison of ten Dutch municipalities

    NARCIS (Netherlands)

    de Goeij, Moniek C. M.; Harting, Janneke; Kunst, Anton E.

    2017-01-01

    Little detailed evidence is available on how integrated policies could impact population health and under what conditions such policies could be realized. The aim of this study was to assess how youth alcohol consumption trends in the province of Noord-Brabant, The Netherlands, were related to the

  10. Attenuated food anticipatory activity and abnormal circadian locomotor rhythms in Rgs16 knockdown mice.

    Directory of Open Access Journals (Sweden)

    Naoto Hayasaka

    Full Text Available Regulators of G protein signaling (RGS are a multi-functional protein family, which functions in part as GTPase-activating proteins (GAPs of G protein α-subunits to terminate G protein signaling. Previous studies have demonstrated that the Rgs16 transcripts exhibit robust circadian rhythms both in the suprachiasmatic nucleus (SCN, the master circadian light-entrainable oscillator (LEO of the hypothalamus, and in the liver. To investigate the role of RGS16 in the circadian clock in vivo, we generated two independent transgenic mouse lines using lentiviral vectors expressing short hairpin RNA (shRNA targeting the Rgs16 mRNA. The knockdown mice demonstrated significantly shorter free-running period of locomotor activity rhythms and reduced total activity as compared to the wild-type siblings. In addition, when feeding was restricted during the daytime, food-entrainable oscillator (FEO-driven elevated food-anticipatory activity (FAA observed prior to the scheduled feeding time was significantly attenuated in the knockdown mice. Whereas the restricted feeding phase-advanced the rhythmic expression of the Per2 clock gene in liver and thalamus in the wild-type animals, the above phase shift was not observed in the knockdown mice. This is the first in vivo demonstration that a common regulator of G protein signaling is involved in the two separate, but interactive circadian timing systems, LEO and FEO. The present study also suggests that liver and/or thalamus regulate the food-entrained circadian behavior through G protein-mediated signal transduction pathway(s.

  11. PKR-like endoplasmic reticulum kinase is necessary for lipogenic activation during HCMV infection.

    Science.gov (United States)

    Yu, Yongjun; Pierciey, Francis J; Maguire, Tobi G; Alwine, James C

    2013-01-01

    PKR-like endoplasmic reticulum (ER) kinase (PERK) is an ER-associated stress sensor protein which phosphorylates eukaryotic initiation factor 2α (eIF2α) to induce translation attenuation in response to ER stress. PERK is also a regulator of lipogenesis during adipocyte differentiation through activation of the cleavage of sterol regulatory element binding protein 1 (SREBP1), resulting in the upregulation of lipogenic enzymes. Our recent studies have shown that human cytomegalovirus (HCMV) infection in human fibroblasts (HF) induces adipocyte-like lipogenesis through the activation of SREBP1. Here, we report that PERK expression is highly increased in HCMV-infected cells and is necessary for HCMV growth. Depletion of PERK, using short hairpin RNA (shRNA), resulted in attenuation of HCMV growth, inhibition of lipid synthesis and reduction of lipogenic gene expression. Examination of the cleavage of SREBP proteins showed PERK depletion inhibited the cleavage of SREBP1, but not SREBP2, in HCMV-infected cells, suggesting different cleavage regulatory mechanisms for SREBP1 and 2. Further studies showed that the depletion of SREBP1, but not SREBP2, reduced lipid synthesis in HCMV infection, suggesting that activation of SREBP1 is sufficient to induce lipogenesis in HCMV infection. The reduction of lipid synthesis by PERK depletion can be partially restored by expressing a Flag-tagged nuclear form of SREBP1a. Our studies also suggest that the induction of PERK in HCMV-infected cells stimulates SREBP1 cleavage by reducing levels of Insig1 (Insulin inducible gene 1) protein; this occurs independent of the phosphorylation of eIF2α. Introduction of an exogenous Insig1-Myc into HCMV infected cells significantly reduced HCMV growth and lipid synthesis. Our data demonstrate that the induction of PERK during HCMV infection is necessary for full activation of lipogenesis; this effect appears to be mediated by limiting the levels of Insig1 thus freeing SREBP1-SCAP complexes for

  12. PKR-like endoplasmic reticulum kinase is necessary for lipogenic activation during HCMV infection.

    Directory of Open Access Journals (Sweden)

    Yongjun Yu

    Full Text Available PKR-like endoplasmic reticulum (ER kinase (PERK is an ER-associated stress sensor protein which phosphorylates eukaryotic initiation factor 2α (eIF2α to induce translation attenuation in response to ER stress. PERK is also a regulator of lipogenesis during adipocyte differentiation through activation of the cleavage of sterol regulatory element binding protein 1 (SREBP1, resulting in the upregulation of lipogenic enzymes. Our recent studies have shown that human cytomegalovirus (HCMV infection in human fibroblasts (HF induces adipocyte-like lipogenesis through the activation of SREBP1. Here, we report that PERK expression is highly increased in HCMV-infected cells and is necessary for HCMV growth. Depletion of PERK, using short hairpin RNA (shRNA, resulted in attenuation of HCMV growth, inhibition of lipid synthesis and reduction of lipogenic gene expression. Examination of the cleavage of SREBP proteins showed PERK depletion inhibited the cleavage of SREBP1, but not SREBP2, in HCMV-infected cells, suggesting different cleavage regulatory mechanisms for SREBP1 and 2. Further studies showed that the depletion of SREBP1, but not SREBP2, reduced lipid synthesis in HCMV infection, suggesting that activation of SREBP1 is sufficient to induce lipogenesis in HCMV infection. The reduction of lipid synthesis by PERK depletion can be partially restored by expressing a Flag-tagged nuclear form of SREBP1a. Our studies also suggest that the induction of PERK in HCMV-infected cells stimulates SREBP1 cleavage by reducing levels of Insig1 (Insulin inducible gene 1 protein; this occurs independent of the phosphorylation of eIF2α. Introduction of an exogenous Insig1-Myc into HCMV infected cells significantly reduced HCMV growth and lipid synthesis. Our data demonstrate that the induction of PERK during HCMV infection is necessary for full activation of lipogenesis; this effect appears to be mediated by limiting the levels of Insig1 thus freeing SREBP1-SCAP

  13. MMP-9 directed shRNAs as relevant inhibitors of matrix metalloproteinase 9 activity and signaling

    Directory of Open Access Journals (Sweden)

    Ewa Nowak

    2013-08-01

    Full Text Available Introduction: The main function of matrix metalloproteinases is the degradation of extracellular matrix components, which is related to changes in the proliferation of cells, their differentiation, motility, and death. MMPs play an important role in physiological processes such as embryogenesis, angiogenesis and tissue remodeling. The increase of MMPs activity is also observed in pathological conditions including tumorigenesis where MMP-2 (gelatinase A and MMP-9 (gelatinase B show the ability to degrade the basement membrane of vessels and they are involved in metastasis. The aim of our study was to verify the changes of MMP-9 enzymatic activity and the mobility of cells after inhibition of MMP-9 gene expression.Material and Methods: The oligonucleotide shRNA insert had been designed to silence MMP-9 gene expression and was cloned into the pSUPER.neo expression vector. The construct was introduced into the HeLa (CCL-2 cervical cancer cells by lipotransfection. Simultaneously in control cells MMP-9 were inhibited by doxycycline. Changes in activity of MMP-9 were analyzed by gelatin zymography and wound-healing assay.Results/Conclusions: Gelatin zymography allowed us to confirm that activity of MMP-9 in cells transfected by shRNA-MMP-9 and treated by doxycycline were similar and significantly lower in comparison with control cells. Phenotypic tests of migration in vitro confirm statistically significant (P<0.05 changes in cell migration – control cells healed 3 to 5 times faster in comparison with transfected or doxycycline treated cells. Our studies show the significant role of MMP-9 in mobility and invasiveness of tumor cells, thus indicating a potential target point of interest for gene therapy.

  14. Epigenetic mediated transcriptional activation of WNT5A participates in arsenical-associated malignant transformation

    International Nuclear Information System (INIS)

    Jensen, Taylor J.; Wozniak, Ryan J.; Eblin, Kylee E.; Wnek, Sean M.; Gandolfi, A. Jay; Futscher, Bernard W.

    2009-01-01

    Arsenic is a human carcinogen with exposure associated with cancer of the lung, skin, and bladder. Many potential mechanisms have been implicated as playing a role in the process of arsenical-induced malignancy including the perturbation of signaling pathways and aberrant epigenetic regulation. We initiated studies to examine the role of a member of the non-canonical WNT signaling pathway, WNT5A, in UROtsa cells and arsenite [URO-ASSC] and monomethylarsonous acid [URO-MSC] malignantly transformed variants. We present data herein that suggest that WNT5A is transcriptionally activated during arsenical-induced malignant transformation. This WNT5A transcriptional activation is correlated with the enrichment of permissive histone modifications and the reduction of repressive modifications in the WNT5A promoter region. The epigenetic activation of WNT5A expression and acetylation of its promoter remain after the removal of the arsenical, consistent with the maintenance of an anchorage independent growth phenotype in these cells. Additionally, treatment with epigenetic modifying drugs supports a functional role for these epigenetic marks in controlling gene expression. Reduction of WNT5A using lentiviral shRNA greatly attenuated the ability of these cells to grow in an anchorage independent fashion. Extension of our model into human bladder cancer cell lines indicates that each of the cell lines examined also express WNT5A. Taken together, these data suggest that the epigenetic remodeling of the WNT5A promoter is correlated with its transcriptional activation and this upregulation likely participates in arsenical-induced malignant transformation

  15. [Screening and identification of Bacillus pumilus producing double active protein of anticoagulation and thrombolysis].

    Science.gov (United States)

    Liu, Binghua; Luo, Yaxiong; Tao, Xuemei; Xie, Xiaoying; Ma, Xupan; Zhang, Lin

    2014-03-04

    The aim of this study was to screen bacteria that can produce antithrombotic. We screened the target bacteria on VY/4 plate and casein plate from more than 20 samples such as water, soil, rabbit manure, sheep manure and deadwood. We detected the antithrombotic activity by fibrin plate and fibrin tube. We identified the target bacteria by morphological characteristics, physical and chemical properties and 16S DNA sequence homology. We obtained 5 strains that can produce antithrombotic. We found that the extracellular protein of strain LDS33 shows both stronger fibrinolytic activity and stronger anticoagulation activity. According to the morphology, physiochemical properties, 16S DNA sequencing and phylogenetic tree, strain LDS33 is identified as Bacillus pumilus. Bacillus pumilus LDS33 can produce highly active anticoagulation and thrombolysis double active protein.

  16. miRNA-141 attenuates UV-induced oxidative stress via activating Keap1-Nrf2 signaling in human retinal pigment epithelium cells and retinal ganglion cells

    Science.gov (United States)

    Cheng, Li-Bo; Li, Ke-ran; Yi, Nan; Li, Xiu-miao; Wang, Feng; Xue, Bo; Pan, Ying-shun; Yao, Jin; Jiang, Qin; Wu, Zhi-feng

    2017-01-01

    Activation of NF-E2-related factor 2 (Nrf2) signaling could protect cells from ultra violet (UV) radiation. We aim to provoke Nrf2 activation via downregulating its inhibitor Keap1 by microRNA-141 (“miR-141”). In both human retinal pigment epithelium cells (RPEs) and retinal ganglion cells (RGCs), forced-expression of miR-141 downregulated Keap1, causing Nrf2 stabilization, accumulation and nuclear translocation, which led to transcription of multiple antioxidant-responsive element (ARE) genes (HO1, NOQ1 and GCLC). Further, UV-induced reactive oxygen species (ROS) production and cell death were significantly attenuated in miR-141-expressing RPEs and RGCs. On the other hand, depletion of miR-141 via expressing its inhibitor antagomiR-141 led to Keap1 upregulation and Nrf2 degradation, which aggravated UV-induced death of RPEs and RGCs. Significantly, Nrf2 shRNA knockdown almost abolished miR-141-mediated cytoprotection against UV in RPEs. These results demonstrate that miR-141 targets Keap1 to activate Nrf2 signaling, which protects RPEs and RGCs from UV radiation. PMID:28061435

  17. Identification of Chloride Channels CLCN3 and CLCN5 Mediating the Excitatory Cl− Currents Activated by Sphingosine-1-Phosphate in Sensory Neurons

    Directory of Open Access Journals (Sweden)

    Yanmei Qi

    2018-02-01

    Full Text Available Sphingosine-1-phosphate (S1P is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception.

  18. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  19. Labor Mobility, Social Network Effects, and Innovative Activity

    DEFF Research Database (Denmark)

    Kaiser, Ulrich; Kongsted, H.C.; Rønde, Thomas

    We study the mapping between labor mobility and industrial innovative activity for the population of R&D active Danish firms observed between 1999 and 2004. Our study documents a positive relationship between the number of workers who join a firm and the firm’s innovative activity....... This relationship is stronger if workers join from innovative firms. We also find evidence for positive feedback from workers who leave for an innovative firm, presumably because the worker who left stays in contact with their former colleagues. This implies that the positive feedback (“social network effects...

  20. Synthesis of Diethylpropione Derivatives and Their Leukocyte-Increasing Activities

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chung Gang; Sun, Yi Ping; Wang, Guo Ping; Tan, Xiang Duan [Guilin Medical University, Guilin (China)

    2014-09-15

    In search of new antileukopenia agents, twenty dithiolopyrrolone derivatives were synthesized and evaluated for their leukocyte-increasing activities in normal mice. Among the synthesized compounds 4-23, compounds 5 and 6 showed significant leukocyte-increasing activity ( p < 0.01), and compounds 4, 9 and 16 had a moderate effect ( p < 0.05). Compound 5 also displayed stronger leukocyte-increasing activity than that of the positive recombinant human granulocyte colony stimulating factor (rhG-CSF). Above all, compound 5 would be a potential antileukopenia agent which deserved further research.

  1. The primacy of β1 integrin activation in the metastatic cascade.

    Directory of Open Access Journals (Sweden)

    Hisashi Kato

    Full Text Available After neoplastic cells leave the primary tumor and circulate, they may extravasate from the vasculature and colonize tissues to form metastases. β1 integrins play diverse roles in tumorigenesis and tumor progression, including extravasation. In blood cells, activation of β1 integrins can be regulated by "inside-out" signals leading to extravasation from the circulation into tissues. However, a role for inside-out β1 activation in tumor cell metastasis is uncertain. Here we show that β1 integrin activation promotes tumor metastasis and that activated β1 integrin may serve as a biomarker of metastatic human melanoma. To determine whether β1 integrin activation can influence tumor cell metastasis, the β1 integrin subunit in melanoma and breast cancer cell lines was stably knocked down with shRNA and replaced with wild-type or constitutively-active β1. When tumor cells expressing constitutively-active β1 integrins were injected intravenously into chick embryos or mice, they demonstrated increased colonization of the liver when compared to cells expressing wild-type β1 integrins. Rescue expression with mutant β1 integrins revealed that tumor cell extravasation and hepatic colonization required extracellular ligand binding to β1 as well as β1 interaction with talin, an intracellular mediator of integrin activation by the Rap1 GTPase. Furthermore, shRNA-mediated knock down of talin reduced hepatic colonization by tumor cells expressing wild-type β1, but not constitutively-active β1. Overexpression in tumor cells of the tumor suppressor, Rap1GAP, inhibited Rap1 and β1 integrin activation as well as hepatic colonization. Using an antibody that detects activated β1 integrin, we found higher levels of activated β1 integrins in human metastatic melanomas compared to primary melanomas, suggesting that activated β1 integrin may serve as a biomarker of invasive tumor cells. Altogether, these studies establish that inside-out activation of

  2. Downregulation of cell division cycle 25 homolog C reduces the radiosensitivity and proliferation activity of esophageal squamous cell carcinoma.

    Science.gov (United States)

    Yin, Yachao; Dou, Xiaoyan; Duan, Shimiao; Zhang, Lei; Xu, Quanjing; Li, Hongwei; Li, Duojie

    2016-09-30

    Radiation therapy is one of the most important methods of contemporary cancer treatment. Cells in the G2 and M phases are more sensitive to radiation therapy, and cell division cycle 25 homolog C (CDC25C) is essential in shifting the cell cycle between these two phases. In this study, the knockdown of CDC25C in human esophageal squamous carcinoma EC9706 cells was mediated by transfecting shRNA against human CDC25C-subcloning into pGV248. The levels of CDC25C mRNA and protein expression were assessed by reverse transcription-polymerase chain reaction (RT-PCR) and western blotting, respectively. Moreover, cell proliferation and radiosensitivity were measured. Stable CDC25C-knockdown EC9706 cell lines were successfully established. Furthermore, the proliferation of both control and CDC25C-shRNA-EC9706 cells was inhibited after the cells were treated with increasing X-ray doses, and the proliferation of the control cells was affected more significantly (pcell colony formation assays allowed us to reach the same conclusion. Taken together, our experiments demonstrated that the knockdown of CDC25C can reduce both the radiotherapy sensitivity and the proliferation activity of EC9706 cells. Thus, CDC25C might be a potential biomarker for radiotherapy treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Driving dreams: cortical activations during imagined passive and active whole body movement.

    Science.gov (United States)

    Flanagin, Virginia L; Wutte, Magdalena; Glasauer, Stefan; Jahn, Klaus

    2009-05-01

    It is unclear how subjects perceive and process self-motion cues in virtual reality environments. Movement could be perceived as passive, akin to riding in a car, or active, such as walking down the street. These two very different types of self-motion were studied here using motor imagery in fMRI. In addition, the relative importance of visual and proprioceptive training cues was examined. Stronger activations were found during proprioceptive motor imagery compared with visual motor imagery, suggesting that proprioceptive signals are important for successful imagined movement. No significant activations were found during active movement with proprioceptive training. Passive locomotion, however, was correlated with activity in an occipital-parietal and parahippocampal cortical network, which are the same regions found during navigation with virtual reality stimuli.

  4. The protein kinase C inhibitor enzastaurin exhibits antitumor activity against uveal melanoma.

    Directory of Open Access Journals (Sweden)

    Xinqi Wu

    Full Text Available GNAQ mutations at codon 209 have been recently identified in approximately 50% of uveal melanomas (UM and are reported to be oncogenic through activating the MAPK/Erk1/2 pathway. Protein kinase C (PKC is a component of signaling from GNAQ to Erk1/2. Inhibition of PKC might regulate GNAQ mutation-induced Erk1/2 activation, resulting in growth inhibition of UM cells carrying GNAQ mutations. UM cells carrying wild type or mutant GNAQ were treated with the PKC inhibitor enzastaurin. Effects on proliferation, apoptosis, and signaling events were evaluated. Enzastaurin downregulated the expression of several PKC isoforms including PKCβII PKCθ, PKCε and/or their phosphorylation in GNAQ mutated cells. Downregulation of these PKC isoforms in GNAQ mutated cells by shRNA resulted in reduced viability. Enzastaurin exhibited greater antiproliferative effect on GNAQ mutant cells than wild type cells through induction of G1 arrest and apoptosis. Enzastaurin-induced G1 arrest was associated with inhibition of Erk1/2 phosphorylation, downregulation of cyclin D1, and accumulation of cyclin dependent kinase inhibitor p27(Kip1. Furthermore, enzastaurin reduced the expression of antiapoptotic Bcl-2 and survivin in GNAQ mutant cells. Inhibition of Erk1/2 phosphorylation with a MEK specific inhibitor enhanced the sensitivity of GNAQ wild type cells to enzastaurin, accompanied by p27(Kip1 accumulation and/or inhibition of enzastaurin-induced survivin and Bcl-2 upregulation. PKC inhibitors such as enzastaurin have activity against UM cells carrying GNAQ mutations through inhibition of the PKC/Erk1/2 pathway and induction of G1 arrest and apoptosis. Inhibition of the PKC pathway provides a basis for clinical investigation in patients with UM.

  5. Constructivist Learning Environment During Virtual and Real Laboratory Activities

    Directory of Open Access Journals (Sweden)

    Ari Widodo

    2017-04-01

    Full Text Available Laboratory activities and constructivism are two notions that have been playing significant roles in science education. Despite common beliefs about the importance of laboratory activities, reviews reported inconsistent results about the effectiveness of laboratory activities. Since laboratory activities can be expensive and take more time, there is an effort to introduce virtual laboratory activities. This study aims at exploring the learning environment created by a virtual laboratory and a real laboratory. A quasi experimental study was conducted at two grade ten classes at a state high school in Bandung, Indonesia. Data were collected using a questionnaire called Constructivist Learning Environment Survey (CLES before and after the laboratory activities. The results show that both types of laboratories can create constructivist learning environments. Each type of laboratory activity, however, may be stronger in improving certain aspects compared to the other. While a virtual laboratory is stronger in improving critical voice and personal relevance, real laboratory activities promote aspects of personal relevance, uncertainty and student negotiation. This study suggests that instead of setting one type of laboratory against the other, lessons and follow up studies should focus on how to combine both types of laboratories to support better learning.

  6. Antioxidant, Antibacterial activity and Brine shrimp toxicity test of some Mountainous Lichens from Nepal

    Directory of Open Access Journals (Sweden)

    Babita Paudel

    2012-01-01

    Full Text Available A total of twenty four lichen species belonging to six families were collected from mountainous region of Nepal. The methanol extracts of each species were tested for antimicrobial and antioxidant activitiesin vitro. It was found that extracts of twenty one lichen species were active againstB. subtilis and seven species were active againstS. aureus. Similarly, in DPPH assay, three speciesPeltigera sp.,Cladonia sp., andCanoparmelia sp. showed comparable activity with commercial standard, BHA. In ABTS+ assay, extracts ofParmoterma sp.,Ramalina sp.,Peltigera sp. andCladonia sp. showed stronger activity than ascorbic acid. The observed data after comparison with previously published reports indicated that the high altitude lichens contain stronger antioxidant and antibacterial constituents. Similarly, the methanol extracts ofHeterodermia sp. andRamalina sp. showed comparable toxicity effect with commercial standard berberine chloride indicating a potent source of anticancer drugs.

  7. Extracurricular activities, athletic participation, and adolescent alcohol use: gender-differentiated and school-contextual effects.

    Science.gov (United States)

    Hoffmann, John P

    2006-09-01

    This research investigates the effects of extracurricular activities on alcohol use among male (n = 4,495) and female (n = 5,398) adolescents who participated in the 1990-92 National Education Longitudinal Study. Previous studies have assessed the association between extracurricular activities and alcohol use, but none have explored whether the association depends on the school context. Using a multilevel model, I examine whether school-level factors affect the relationship between involvement in athletic or nonathletic activities and changes in adolescent alcohol use from 1990 to 1992. The results indicate that the negative association between nonathletic activities and alcohol use is stronger among males in low-minority-population schools. Moreover the positive association between athletic involvement and alcohol use is stronger among females in lower-socioeconomic-status schools and males in higher-socioeconomic-status schools. I propose that these results reflect variation in high school cultures and in the resources available to schools.

  8. ERK1/2 signaling plays an important role in topoisomerase II poison-induced G2/M checkpoint activation.

    Science.gov (United States)

    Kolb, Ryan H; Greer, Patrick M; Cao, Phu T; Cowan, Kenneth H; Yan, Ying

    2012-01-01

    Topo II poisons, which target topoisomerase II (topo II) to generate enzyme mediated DNA damage, have been commonly used for anti-cancer treatment. While clinical evidence demonstrate a capability of topo II poisons in inducing apoptosis in cancer cells, accumulating evidence also show that topo II poison treatment frequently results in cell cycle arrest in cancer cells, which was associated with subsequent resistance to these treatments. Results in this report indicate that treatment of MCF-7 and T47D breast cancer cells with topo II poisons resulted in an increased phosphorylation of extracellular signal-regulated kinase 1 and 2 (ERK1/2) and an subsequent induction of G2/M cell cycle arrest. Furthermore, inhibition of ERK1/2 activation using specific inhibitors markedly attenuated the topo II poison-induced G2/M arrest and diminished the topo II poison-induced activation of ATR and Chk1 kinases. Moreover, decreased expression of ATR by specific shRNA diminished topo II poison-induced G2/M arrest but had no effect on topo II poison-induced ERK1/2 activation. In contrast, inhibition of ERK1/2 signaling had little, if any, effect on topo II poison-induced ATM activation. In addition, ATM inhibition by either incubation of cells with ATM specific inhibitor or transfection of cells with ATM specific siRNA did not block topo II poison-induced G2/M arrest. Ultimately, inhibition of ERK1/2 signaling greatly enhanced topo II poison-induced apoptosis. These results implicate a critical role for ERK1/2 signaling in the activation of G2/M checkpoint response following topo II poison treatment, which protects cells from topo II poison-induced apoptosis.

  9. Evolution of Neuroplasticity in Response to Physical Activity in Old Age: The Case for Dancing

    OpenAIRE

    Müller, Patrick; Rehfeld, Kathrin; Schmicker, Marlen; Hökelmann, Anita; Dordevic, Milos; Lessmann, Volkmar; Brigadski, Tanja; Kaufmann, Jörn; Müller, Notger G.

    2017-01-01

    From animal research, it is known that combining physical activity with sensory enrichment has stronger and longer-lasting effects on the brain than either treatment alone. For humans dancing has been suggested to be analogous to such combined training. Here we assessed whether a newly designed dance training program that stresses the constant learning of new movement patterns is superior in terms of neuroplasticity to conventional fitness activities with repetitive exercises and whether exte...

  10. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Science.gov (United States)

    2012-01-01

    Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS) involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L). The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50) values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA) in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L), was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT) became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L). Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves against oxidative stress mediated by ascorbic acid induced hydrogen peroxide production. The antioxidative enzyme catalase is important to protect cancer cells against cytotoxic hydrogen peroxide

  11. Brain network activity in monolingual and bilingual older adults.

    Science.gov (United States)

    Grady, Cheryl L; Luk, Gigi; Craik, Fergus I M; Bialystok, Ellen

    2015-01-01

    Bilingual older adults typically have better performance on tasks of executive control (EC) than do their monolingual peers, but differences in brain activity due to language experience are not well understood. Based on studies showing a relation between the dynamic range of brain network activity and performance on EC tasks, we hypothesized that life-long bilingual older adults would show increased functional connectivity relative to monolinguals in networks related to EC. We assessed intrinsic functional connectivity and modulation of activity in task vs. fixation periods in two brain networks that are active when EC is engaged, the frontoparietal control network (FPC) and the salience network (SLN). We also examined the default mode network (DMN), which influences behavior through reduced activity during tasks. We found stronger intrinsic functional connectivity in the FPC and DMN in bilinguals than in monolinguals. Although there were no group differences in the modulation of activity across tasks and fixation, bilinguals showed stronger correlations than monolinguals between intrinsic connectivity in the FPC and task-related increases of activity in prefrontal and parietal regions. This bilingual difference in network connectivity suggests that language experience begun in childhood and continued throughout adulthood influences brain networks in ways that may provide benefits in later life. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. The reinforcing value and liking of resistance training and aerobic exercise as predictors of adult’s physical actively behavior

    Science.gov (United States)

    Background: Reinforcing value is a stronger predictor than hedonic value (liking) for engaging in drug use, gambling, and eating. The associations of reinforcing value and liking with physical activity of adults have not yet been studied and may depend on the mode of exercise available during exerc...

  13. Sex differences in neural activation to facial expressions denoting contempt and disgust.

    Directory of Open Access Journals (Sweden)

    André Aleman

    Full Text Available The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt than women. We performed an experiment using functional magnetic resonance imaging (fMRI, in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus, anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions, in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our

  14. Sex differences in neural activation to facial expressions denoting contempt and disgust.

    Science.gov (United States)

    Aleman, André; Swart, Marte

    2008-01-01

    The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt) than women. We performed an experiment using functional magnetic resonance imaging (fMRI), in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus), anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions), in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our results suggest a

  15. When the future becomes the past: Differences in brain activation patterns for episodic memory and episodic future thinking.

    Science.gov (United States)

    Weiler, Julia A; Suchan, Boris; Daum, Irene

    2010-10-15

    Episodic memory and episodic future thinking activate a network of overlapping brain regions, but little is known about the mechanism with which the brain separates the two processes. It was recently suggested that differential activity for memory and future thinking may be linked to differences in the phenomenal properties (e.g., richness of detail). Using functional magnetic resonance imaging in healthy subjects and a novel experimental design, we investigated the networks involved in the imagery of future and the recall of past events for the same target occasion, i.e. the Christmas and New Year's holidays, thereby keeping temporal distance and content similar across conditions. Although ratings of phenomenal characteristics were comparable for future thoughts and memories, differential activation patterns emerged. The right posterior hippocampus exhibited stronger memory-related activity during early event recall, and stronger future thought-related activity during late event imagination. Other regions, e.g., the precuneus and lateral prefrontal cortex, showed the reverse activation pattern with early future-associated and late past-associated activation. Memories compared to future thoughts were further related to stronger activation in several visual processing regions, which accords with a reactivation of the original perceptual experience. In conclusion, the results showed for the first time unique neural signatures for both memory and future thinking even in the absence of differences in phenomenal properties and suggested different time courses of brain activation for episodic memory and future thinking. Copyright 2010 Elsevier B.V. All rights reserved.

  16. Obstructing Androgen Receptor Activation in Prostate Cancer Cells Through Post-translational Modification by NEDD8

    Science.gov (United States)

    2012-11-01

    Science 298:608-11. 10. Dahle, O., T. O. Andersen, O. Nordgard, V. Matre, G. Del Sal , and O. S. Gabrielsen. 2003. Transactivation properties of c-Myb are...sequence is 50-GGT CCG GCT CCC CCA AAT G-30, which has no homologous sequences in the vertebrate transcriptome. After 24 h of transfection with the shRNA

  17. Large-pore mesoporous silica nanospheres as vehicles for delivering TRAF3-shRNA plasmids to Kupffer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Junyong, E-mail: zhangmachine@hotmail.com [Department of Hepatobiliary Surgery and Department of Urinary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Guo, Shipeng, E-mail: guoshipeng2008@126.com [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Zhang, Wenfeng, E-mail: Sadengren8881@163.com [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China); Niu, Dechao, E-mail: niudechao_2002@163.com [Low-Dimensional Materials Chemistry, Key Laboratory for Ultrafine Materials of Ministry of Education, School of Materials Science and Engineering, East China University of Science and Technology (China); Gong, Jianping, E-mail: gjp_cqmu@yeah.net [Department of Hepatobiliary Surgery, The Second Affiliated Hospital of Chongqing Medical University (China)

    2016-01-08

    The currently available techniques for transferring exogenous genes into macrophages, especially the targeted import of exogenous genes into Kupffer cells (KCs) in vivo, are inefficient and achieve only low targeting. Novel Large-Pore Mesoporous Silica Nanospheres (LPMSNs) may be a promising gene transfection agent for KCs because of their superior biodegradation and hypotoxic characteristics, as well as their ability to retain the biological function of KCs and the high loading-rate of exogenous plasmid. LPMSNs were able to completely adsorb shRNA-TRAF3 (tumor necrosis factor receptor-associated factor-3) plasmid at a mass ratio as low as 30:1, and exhibited a low cytotoxicity for KCs. LPMSNs were detected in KC cytoplasm in vitro, and transmission electron microscopy (TEM) revealed that they were present only in KCs in liver tissue in vivo. The max KC transfection efficiency with LPMSNs was 34.8± 0.07%, as evaluated using flow cytometry, and the protein and mRNA levels of TRAF3 were significantly inhibited (P < 0.05) by shRNA-TRAF3 plasmid transfection after 24 h in vitro and 48 h in vivo. In conclusion, KC targeted transfection was achieved successfully by LPMSNs carrying shRNA-TRAF3 plasmids in vitro and vivo. The protein and mRNA levels of TRAF3 were suppressed significantly. These results suggest that LPMSNs are a promising vehicle for delivering exogenous genes into KCs in vitro and vivo. - Highlights: • We constructed Large-Pore Mesoporous Silica Nanospheres (LPMSNs). • LPMSNs adsorbed high quantity of plasmid. • Low cytotoxicity of LPMSNs to Kupffer cells. • LPMSNs delivered plasmid into Kupffer cells.

  18. Gene therapy targeting hepatocellular carcinoma by a dual-regulated oncolytic adenovirus harboring the focal adhesion kinase shRNA.

    Science.gov (United States)

    Gao, Yang; Zhu, Yayun; Huang, Xinyu; Ai, Kaixing; Zheng, Qi; Yuan, Zhou

    2015-08-01

    Cancer targeting gene-viro-therapy (CTGVT) approach has become a hotspot and a trend in the field of cancer biotherapy and oncolytic adenovirus is an ideal vector to carry the targeting genes. In this study, we used human telomerase reverse transcriptase (hTERT) promoter to control the adenovirus early region 1a (E1A) and the human α-fetoprotein (AFP) promoter integrated with hypoxia response element (HRE) to control the adenovirus early region 1b (E1B). Then the novel double-regulated adenovirus Ad-hTERT-HREAF (named SG505) was engineered. The short-hairpin RNA against focal adhesion kinase (FAK) was inserted into SG505 and thus forming Ad-hTERT-HREAF-shRNA (called SG505‑siFAK). Then various oncolytic adenoviruses were examined to verify whether they could suppress liver cancer cells selectively and efficiently both in vitro and in vivo. Both replicative and replication-defective adenoviruses carrying FAK-shRNA significantly inhibited the expression of FAK in Hep3B and SMMC-7721 cell lines and efficiently suppressed the growth of liver cancer cell lines with minor effect to normal cells. Furthermore, the recombined oncolytic adenoviruses, SG505-siFAK, SG505-EGFP and SG505 were able to selectively propagate in AFP-positive liver cancer cells in vitro and the SG505-siFAK efficiently suppressed the expression of FAK. SG505-siFAK showed the most potent tumor inhibition capability among the three recombined adenovirus with IC50 levels of 0.092±0.009 and 0.424±0.414 pfu/cell in the Hep3B and HepG2 cell line, respectively. Animal experiment further confirmed that SG505-siFAK achieved the most significant tumor inhibition of Hep3B liver cancer xenografted growth by intratumoral injection comparing to the intravenous injection among the three recombined viruses. Immunohistochemical results indicated that FAK expression was downregulated significantly in the tumors treated with SG505-siFAK. The dual-regulated oncolytic adenovirus SG505-siFAK was proven to inhibit the growth of liver cancer cells selectively and efficiently, therefore SG505-siFAK could be a potential agent for future clinical trials of hepatocellular carcinoma.

  19. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  20. Fluid Shear Stress Regulates the Invasive Potential of Glioma Cells via Modulation of Migratory Activity and Matrix Metalloproteinase Expression

    Science.gov (United States)

    Qazi, Henry; Shi, Zhong-Dong; Tarbell, John M.

    2011-01-01

    Background Glioma cells are exposed to elevated interstitial fluid flow during the onset of angiogenesis, at the tumor periphery while invading normal parenchyma, within white matter tracts, and during vascular normalization therapy. Glioma cell lines that have been exposed to fluid flow forces in vivo have much lower invasive potentials than in vitro cell motility assays without flow would indicate. Methodology/Principal Findings A 3D Modified Boyden chamber (Darcy flow through collagen/cell suspension) model was designed to mimic the fluid dynamic microenvironment to study the effects of fluid shear stress on the migratory activity of glioma cells. Novel methods for gel compaction and isolation of chemotactic migration from flow stimulation were utilized for three glioma cell lines: U87, CNS-1, and U251. All physiologic levels of fluid shear stress suppressed the migratory activity of U87 and CNS-1 cell lines. U251 motility remained unaltered within the 3D interstitial flow model. Matrix Metalloproteinase (MMP) inhibition experiments and assays demonstrated that the glioma cells depended on MMP activity to invade, and suppression in motility correlated with downregulation of MMP-1 and MMP-2 levels. This was confirmed by RT-PCR and with the aid of MMP-1 and MMP-2 shRNA constructs. Conclusions/Significance Fluid shear stress in the tumor microenvironment may explain reduced glioma invasion through modulation of cell motility and MMP levels. The flow-induced migration trends were consistent with reported invasive potentials of implanted gliomas. The models developed for this study imply that flow-modulated motility involves mechanotransduction of fluid shear stress affecting MMP activation and expression. These models should be useful for the continued study of interstitial flow effects on processes that affect tumor progression. PMID:21637818

  1. Fluid shear stress regulates the invasive potential of glioma cells via modulation of migratory activity and matrix metalloproteinase expression.

    Directory of Open Access Journals (Sweden)

    Henry Qazi

    Full Text Available Glioma cells are exposed to elevated interstitial fluid flow during the onset of angiogenesis, at the tumor periphery while invading normal parenchyma, within white matter tracts, and during vascular normalization therapy. Glioma cell lines that have been exposed to fluid flow forces in vivo have much lower invasive potentials than in vitro cell motility assays without flow would indicate.A 3D Modified Boyden chamber (Darcy flow through collagen/cell suspension model was designed to mimic the fluid dynamic microenvironment to study the effects of fluid shear stress on the migratory activity of glioma cells. Novel methods for gel compaction and isolation of chemotactic migration from flow stimulation were utilized for three glioma cell lines: U87, CNS-1, and U251. All physiologic levels of fluid shear stress suppressed the migratory activity of U87 and CNS-1 cell lines. U251 motility remained unaltered within the 3D interstitial flow model. Matrix Metalloproteinase (MMP inhibition experiments and assays demonstrated that the glioma cells depended on MMP activity to invade, and suppression in motility correlated with downregulation of MMP-1 and MMP-2 levels. This was confirmed by RT-PCR and with the aid of MMP-1 and MMP-2 shRNA constructs.Fluid shear stress in the tumor microenvironment may explain reduced glioma invasion through modulation of cell motility and MMP levels. The flow-induced migration trends were consistent with reported invasive potentials of implanted gliomas. The models developed for this study imply that flow-modulated motility involves mechanotransduction of fluid shear stress affecting MMP activation and expression. These models should be useful for the continued study of interstitial flow effects on processes that affect tumor progression.

  2. Relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis.

    Science.gov (United States)

    Ehrlich-Jones, Linda; Lee, Jungwha; Semanik, Pamela; Cox, Cheryl; Dunlop, Dorothy; Chang, Rowland W

    2011-12-01

    To determine the relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis (RA). A cross-sectional study used baseline data from 185 adults with RA enrolled in a randomized clinical trial assessing the effectiveness of an intervention to promote physical activity. Data included patients' self-reported beliefs that physical activity can be beneficial for their disease, motivation for physical activity participation, worries about physical activity participation, and average daily accelerometer counts of activity over a week's time. Body mass index (BMI), sex, age, race, and disease activity were measured as potential statistical moderators of physical activity. Physical activity participation was greater for those with higher scores on scales measuring beliefs that physical activity is beneficial for their disease (P for trend = 0.032) and motivation for physical activity participation (P for trend = 0.007) when adjusted for age, sex, BMI, race, and disease activity. There was a positive but nonsignificant trend in physical activity participation in relation to worries. Stronger beliefs that physical activity can be helpful for managing disease and increased motivation to engage in physical activity are related to higher levels of physical activity participation. These data provide a preliminary empirical rationale for why interventions targeting these concepts should lead to improved physical activity participation in adults with RA. Copyright © 2011 by the American College of Rheumatology.

  3. Activating the Wnt/β-Catenin Pathway for the Treatment of Melanoma--Application of LY2090314, a Novel Selective Inhibitor of Glycogen Synthase Kinase-3.

    Directory of Open Access Journals (Sweden)

    Jennifer M Atkinson

    Full Text Available It has previously been observed that a loss of β-catenin expression occurs with melanoma progression and that nuclear β-catenin levels are inversely proportional to cellular proliferation, suggesting that activation of the Wnt/β-catenin pathway may provide benefit for melanoma patients. In order to further probe this concept we tested LY2090314, a potent and selective small-molecule inhibitor with activity against GSK3α and GSK3β isoforms. In a panel of melanoma cell lines, nM concentrations of LY2090314 stimulated TCF/LEF TOPFlash reporter activity, stabilized β-catenin and elevated the expression of Axin2, a Wnt responsive gene and marker of pathway activation. Cytotoxicity assays revealed that melanoma cell lines are very sensitive to LY2090314 in vitro (IC50 ~10 nM after 72hr of treatment in contrast to other solid tumor cell lines (IC50 >10 uM as evidenced by caspase activation and PARP cleavage. Cell lines harboring mutant B-RAF or N-RAS were equally sensitive to LY2090314 as were those with acquired resistance to the BRAF inhibitor Vemurafenib. shRNA studies demonstrated that β-catenin stabilization is required for apoptosis following treatment with the GSK3 inhibitor since the sensitivity of melanoma cell lines to LY290314 could be overcome by β-catenin knockdown. We further demonstrate that in vivo, LY2090314 elevates Axin2 gene expression after a single dose and produces tumor growth delay in A375 melanoma xenografts with repeat dosing. The activity of LY2090314 in preclinical models suggests that the role of Wnt activators for the treatment of melanoma should be further explored.

  4. Is activation analysis still active?

    International Nuclear Information System (INIS)

    Chai Zhifang

    2001-01-01

    This paper reviews some aspects of neutron activation analysis (NAA), covering instrumental neutron activation analysis (INAA), k 0 method, prompt gamma-ray neutron activation analysis (PGNAA), radiochemical neutron activation analysis (RNAA) and molecular activation analysis (MAA). The comparison of neutron activation analysis with other analytical techniques are also made. (author)

  5. Cortical spectral activity and connectivity during active and viewed arm and leg movement

    Directory of Open Access Journals (Sweden)

    Julia eKline

    2016-03-01

    Full Text Available Active and viewed limb movement activate many similar neural pathways, however, to date most comparison studies have focused on subjects making small, discrete movements of the hands and feet. The purpose of this study was to determine if high-density electroencephalography (EEG could detect differences in cortical activity and connectivity during active and viewed rhythmic arm and leg movements in humans. Our primary hypothesis was that we would detect similar but weaker electrocortical spectral fluctuations and effective connectivity fluctuations during viewed limb exercise compared to active limb exercise due to the similarities in neural recruitment. A secondary hypothesis was that we would record stronger cortical spectral fluctuations for arm exercise compared to leg exercise, because rhythmic arm exercise would be more dependent on supraspinal control than rhythmic leg exercise. We recorded EEG data while ten young healthy subjects exercised on a recumbent stepper with: 1 both arms and legs, 2 just legs, and 3 just arms. Subjects also viewed video playback of themselves or another individual performing the same exercises. We performed independent component analysis, dipole fitting, spectral analysis, and effective connectivity analysis on the data. Cortical areas comprising the premotor and supplementary motor cortex, the anterior cingulate, the posterior cingulate, and the parietal cortex exhibited significant spectral fluctuations during rhythmic limb exercise. These fluctuations tended to be greater for the arms exercise conditions than for the legs only exercise condition, which suggests that human rhythmic arm movements are under stronger cortical control than rhythmic leg movements. We did not find consistent spectral fluctuations in these areas during the viewed conditions, but effective connectivity fluctuated at harmonics of the exercise frequency during both active and viewed rhythmic limb exercise. The right premotor and

  6. Brain activations to emotional pictures are differentially associated with valence and arousal ratings

    Directory of Open Access Journals (Sweden)

    Antje B M Gerdes

    2010-10-01

    Full Text Available Several studies have investigated the neural responses triggered by emotional pictures, but the specificity of the involved structures such as the amygdala or the ventral striatum is still under debate. Furthermore, only few studies examined the association of stimuli’s valence and arousal and the underlying brain responses. Therefore, we investigated brain responses with functional magnetic resonance imaging of 17 healthy subjects to pleasant and unpleasant affective pictures with comparable arousal levels and afterwards assessed ratings of valence and arousal. As expected, unpleasant pictures strongly activated the right and left amygdala, the right hippocampus, and the medial occipital lobe, whereas pleasant pictures elicited significant activations in left occipital regions, and in parts of the medial temporal lobe. The direct comparison of unpleasant and pleasant pictures which were comparable in arousal clearly indicated stronger amygdala activation in response to the unpleasant pictures. Most important, correlational analyses revealed on the one hand that the arousal of unpleasant pictures was significantly associated with activations in the right amygdala and the left caudate body. On the other hand, valence of pleasant pictures was significantly correlated with activations in the right caudate head, extending to the nucleus accumbens (NAcc and the left dorso-lateral prefrontal cortex. These findings support the notion that the amygdala is primarily involved in processing of unpleasant stimuli, and the stronger the more arousing the stimuli are, whereas reward-related structures like the NAcc primarily responds to pleasant stimuli, the stronger the more positive the valence of these stimuli is.

  7. Get Active

    Science.gov (United States)

    ... activity are best for you. Get tips on physical activity and diabetes Learn how physical activity helps high blood pressure What if I have ... benefits by stepping up your routine. Getting more physical activity can further lower your risk for: ... cancer Colorectal cancer Do more vigorous activities. ...

  8. Hypoxia promotes uveal melanoma invasion through enhanced Notch and MAPK activation.

    Directory of Open Access Journals (Sweden)

    Laura Asnaghi

    Full Text Available The transcriptional response promoted by hypoxia-inducible factors has been associated with metastatic spread of uveal melanoma. We found expression of hypoxia-inducible factor 1α (HIF-1α protein in well-vascularized tumor regions as well as in four cell lines grown in normoxia, thus this pathway may be important even in well-oxygenated uveal melanoma cells. HIF-1α protein accumulation in normoxia was inhibited by rapamycin. As expected, hypoxia (1% pO2 further induced HIF-1α protein levels along with its target genes VEGF and LOX. Growth in hypoxia significantly increased cellular invasion of all 5 uveal melanoma lines tested, as did the introduction of an oxygen-insensitive HIF-1α mutant into Mel285 cells with low HIF-1α baseline levels. In contrast, HIF-1α knockdown using shRNA significantly decreased growth in hypoxia, and reduced by more than 50% tumor invasion in four lines with high HIF-1α baseline levels. Pharmacologic blockade of HIF-1α protein expression using digoxin dramatically suppressed cellular invasion both in normoxia and in hypoxia. We found that Notch pathway components, including Jag1-2 ligands, Hes1-Hey1 targets and the intracellular domain of Notch1, were increased in hypoxia, as well as the phosphorylation levels of Erk1-2 and Akt. Pharmacologic and genetic inhibition of Notch largely blocked the hypoxic induction of invasion as did the pharmacologic suppression of Erk1-2 activity. In addition, the increase in Erk1-2 and Akt phosphorylation by hypoxia was partially reduced by inhibiting Notch signaling. Our findings support the functional importance of HIF-1α signaling in promoting the invasive capacity of uveal melanoma cells in both hypoxia and normoxia, and suggest that pharmacologically targeting HIF-1α pathway directly or through blockade of Notch or Erk1-2 pathways can slow tumor spread.

  9. Future role and significance of space activities in reflection of global social, technological and economic trends

    Science.gov (United States)

    Diekmann, Andreas; Richarz, Hans.-Peter

    The paper describes the interrelation of space activities and global socio-economic trends like "globalisation of markets" and "renaissance of fine arts". The interrelation reveals the economic strategic, technological and scientific dimension of space activities and their benefits to mankind. Then, the significance and perspectives of space activities in these dimensions are examined in more detail. The paper calls (1) for a more visible initiative to employ space activities to tackle urgent questions of global change and development, and (2) for a stronger impetus to secure European economic position in space sector as a key industry of the 21st century.

  10. Physical Activity and Adiposity Markers at Older Ages: Accelerometer Vs Questionnaire Data

    Science.gov (United States)

    Sabia, Séverine; Cogranne, Pol; van Hees, Vincent T.; Bell, Joshua A.; Elbaz, Alexis; Kivimaki, Mika; Singh-Manoux, Archana

    2015-01-01

    Objective Physical activity is critically important for successful aging, but its effect on adiposity markers at older ages is unclear as much of the evidence comes from self-reported data on physical activity. We assessed the associations of questionnaire-assessed and accelerometer-assessed physical activity with adiposity markers in older adults. Design/Setting/Participants This was a cross-sectional study on 3940 participants (age range 60-83 years) of the Whitehall II study who completed a 20-item physical activity questionnaire and wore a wrist-mounted accelerometer for 9 days in 2012 and 2013. Measurements Total physical activity was estimated using metabolic equivalent hours/week for the questionnaire and mean acceleration for the accelerometer. Time spent in moderate-and-vigorous physical activity (MVPA) was also assessed by questionnaire and accelerometer. Adiposity assessment included body mass index, waist circumference, and fat mass index. Fat mass index was calculated as fat mass/height² (kg/m²), with fat mass estimated using bioimpedance. Results Greater total physical activity was associated with lower adiposity for all adiposity markers in a dose-response manner. In men, the strength of this association was 2.4 to 2.8 times stronger with the accelerometer than with questionnaire data. In women, it was 1.9 to 2.3 times stronger. For MVPA, questionnaire data in men suggested no further benefit for adiposity markers past 1 hour/week of activity. This was not the case for accelerometer-assessed MVPA where, for example, compared with men undertaking physical activity with adiposity markers in older adults was stronger when physical activity was assessed by accelerometer compared with questionnaire, suggesting that physical activity might be more important for adiposity than previously estimated. PMID:25752539

  11. Anticoagulant activity of Moon jellyfish (Aurelia aurita) tentacle extract.

    Science.gov (United States)

    Rastogi, Akriti; Biswas, Sumit; Sarkar, Angshuman; Chakrabarty, Dibakar

    2012-10-01

    Moon jellyfish (Aurelia aurita) tentacle extract was studied for its anticoagulant activity in vitro. The Jellyfish Tentacle Extract (JFTE) showed very strong fibrinogenolytic activity by cleaving Aα and Bβ chain of fibrinogen molecule. The fibrinogenolytic activity was found to be stronger than some snake venom derived anticoagulants. JFTE also completely liquefied fibrin clots in 24 h. JFTE was found to contain both high and low molecular weight proteins/peptides. The fibrinogenolysis appears to be caused by high molecular weight fractions of the extract. It has been also noted that PMSF significantly reduced fibrinogenolytic activity and heating totally abolished it. Autolytic degradation of the high molecular weight protein was also noted. Autolysis slowed down, but did not abolish the fibrinogenolytic activity of the extract. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Resveratrol induces growth arrest and apoptosis through activation of FOXO transcription factors in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Qinghe Chen

    2010-12-01

    Full Text Available Resveratrol, a naturally occurring phytopolyphenol compound, has attracted extensive interest in recent years because of its diverse pharmacological characteristics. Although resveratrol possesses chemopreventive properties against several cancers, the molecular mechanisms by which it inhibits cell growth and induces apoptosis have not been clearly understood. The present study was carried out to examine whether PI3K/AKT/FOXO pathway mediates the biological effects of resveratrol.Resveratrol inhibited the phosphorylation of PI3K, AKT and mTOR. Resveratrol, PI3K inhibitors (LY294002 and Wortmannin and AKT inhibitor alone slightly induced apoptosis in LNCaP cells. These inhibitors further enhanced the apoptosis-inducing potential of resveratrol. Overexpression of wild-type PTEN slightly induced apoptosis. Wild type PTEN and PTEN-G129E enhanced resveratrol-induced apoptosis, whereas PTEN-G129R had no effect on proapoptotic effects of resveratrol. Furthermore, apoptosis-inducing potential of resveratrol was enhanced by dominant negative AKT, and inhibited by wild-type AKT and constitutively active AKT. Resveratrol has no effect on the expression of FKHR, FKHRL1 and AFX genes. The inhibition of FOXO phosphorylation by resveratrol resulted in its nuclear translocation, DNA binding and transcriptional activity. The inhibition of PI3K/AKT pathway induced FOXO transcriptional activity resulting in induction of Bim, TRAIL, p27/KIP1, DR4 and DR5, and inhibition of cyclin D1. Similarly, resveratrol-induced FOXO transcriptional activity was further enhanced when activation of PI3K/AKT pathway was blocked. Over-expression of phosphorylation deficient mutants of FOXO proteins (FOXO1-TM, FOXO3A-TM and FOXO4-TM induced FOXO transcriptional activity, which was further enhanced by resveratrol. Inhibition of FOXO transcription factors by shRNA blocked resveratrol-induced upregulation of Bim, TRAIL, DR4, DR5, p27/KIP1 and apoptosis, and inhibition of cyclin D1 by

  13. TRPP2 and TRPV4 form an EGF-activated calcium permeable channel at the apical membrane of renal collecting duct cells.

    Directory of Open Access Journals (Sweden)

    Zhi-Ren Zhang

    Full Text Available Regulation of apical calcium entry is important for the function of principal cells of the collecting duct. However, the molecular identity and the regulators of the transporter/channel, which is responsible for apical calcium entry and what factors regulate the calcium conduction remain unclear.We report that endogenous TRPP2 and TRPV4 assemble to form a 23-pS divalent cation-permeable non-selective ion channel at the apical membrane of renal principal cells of the collecting duct. TRPP2\\TRPV4 channel complex was identified by patch-clamp, immunofluorescence and co-immunprecipitation studies in both principal cells that either possess normal cilia (cilia (+ or in which cilia are absent (cilia (-. This channel has distinct biophysical and pharmacological and regulatory profiles compared to either TRPP2 or TRPV4 channels. The rate of occurrence detected by patch clamp was higher in cilia (- compared to cilia (+ cells. In addition, shRNA knockdown of TRPP2 increased the prevalence of TRPV4 channel activity while knockdown of TRPV4 resulted in TRPP2 activity and knockdown of both proteins vastly decreased the 23-pS channel activity. Epidermal growth factor (EGF stimulated TRPP2\\TRPV4 channel through the EGF receptor (EGFR tyrosine kinase-dependent signaling. With loss of cilia, apical EGF treatment resulted in 64-fold increase in channel activity in cilia (- but not cilia (+ cells. In addition EGF increased cell proliferation in cilia (- cell that was dependent upon TRPP2\\TRPV4 channel mediated increase in intracellular calcium.We conclude that in the absence of cilia, an EGF activated TRPP2\\TRPV4 channel may play an important role in increased cell proliferation and cystogenesis.

  14. Distinct patterns of brain activity characterise lexical activation and competition in spoken word production.

    Directory of Open Access Journals (Sweden)

    Vitória Piai

    Full Text Available According to a prominent theory of language production, concepts activate multiple associated words in memory, which enter into competition for selection. However, only a few electrophysiological studies have identified brain responses reflecting competition. Here, we report a magnetoencephalography study in which the activation of competing words was manipulated by presenting pictures (e.g., dog with distractor words. The distractor and picture name were semantically related (cat, unrelated (pin, or identical (dog. Related distractors are stronger competitors to the picture name because they receive additional activation from the picture relative to other distractors. Picture naming times were longer with related than unrelated and identical distractors. Phase-locked and non-phase-locked activity were distinct but temporally related. Phase-locked activity in left temporal cortex, peaking at 400 ms, was larger on unrelated than related and identical trials, suggesting differential activation of alternative words by the picture-word stimuli. Non-phase-locked activity between roughly 350-650 ms (4-10 Hz in left superior frontal gyrus was larger on related than unrelated and identical trials, suggesting differential resolution of the competition among the alternatives, as reflected in the naming times. These findings characterise distinct patterns of activity associated with lexical activation and competition, supporting the theory that words are selected by competition.

  15. Inhibitory effect of burdock leaves on elastase and tyrosinase activity

    Science.gov (United States)

    Horng, Chi-Ting; Wu, Hsing-Chen; Chiang, Ni-Na; Lee, Chiu-Fang; Huang, Yu-Syuan; Wang, Hui-Yun; Yang, Jai-Sing; Chen, Fu-An

    2017-01-01

    Burdock (Arctium lappa L.) leaves generate a considerable amount of waste following burdock root harvest in Taiwan. To increase the use of burdock leaves, the present study investigated the optimal methods for producing burdock leaf extract (BLE) with high antioxidant polyphenolic content, including drying methods and solvent extraction concentration. In addition, the elastase and tyrosinase inhibitory activity of BLE was examined. Burdock leaves were dried by four methods: Shadow drying, oven drying, sun drying and freeze-drying. The extract solution was then subjected to total polyphenol content analysis and the method that produced BLE with the highest amount of total antioxidant components was taken forward for further analysis. The 1,1-diphenyl-2-pycrylhydrazyl scavenging, antielastase and antityrosinase activity of the BLE were measured to enable the evaluation of the antioxidant and skin aging-associated enzyme inhibitory activities of BLE. The results indicated that the total polyphenolic content following extraction with ethanol (EtOH) was highest using the freeze-drying method, followed by the oven drying, shadow drying and sun drying methods. BLE yielded a higher polyphenol content and stronger antioxidant activity as the ratio of the aqueous content of the extraction solvent used increased. BLE possesses marked tyrosinase and elastase inhibitory activities, with its antielastase activity notably stronger compared with its antityrosinase activity. These results indicate that the concentration of the extraction solvent was associated with the antioxidant and skin aging-associated enzyme inhibitory activity of BLE. The reactive oxygen species scavenging theory of skin aging may explain the tyrosinase and elastase inhibitory activity of BLE. In conclusion, the optimal method for obtaining BLE with a high antioxidant polyphenolic content was freeze-drying followed by 30–50% EtOH extraction. In addition, the antielastase and antityrosinase activities of the

  16. Active turbulence in active nematics

    Science.gov (United States)

    Thampi, S. P.; Yeomans, J. M.

    2016-07-01

    Dense, active systems show active turbulence, a state characterised by flow fields that are chaotic, with continually changing velocity jets and swirls. Here we review our current understanding of active turbulence. The development is primarily based on the theory and simulations of active liquid crystals, but with accompanying summaries of related literature.

  17. Age-specific activation of cerebral areas in motor imagery - a fMRI study

    International Nuclear Information System (INIS)

    Wang, Li; Qiu, Mingguo; Zhang, Jingna; Zhang, Ye; Sang, Linqiong; Liu, Chen; Yang, Jun; Yan, Rubing; Zheng, Xiaolin

    2014-01-01

    The objectives of this study were to study the age-specific activation patterns of cerebral areas during motor execution (ME) and motor imaging (MI) of the upper extremities and to discuss the age-related neural mechanisms associated with ME or MI. The functional magnetic resonance imaging technique was used to monitor the pattern and intensity of brain activation during the ME and MI of the upper extremities in 20 elderly (>50 years) and 19 young healthy subjects (<25 years). No major differences were identified regarding the activated brain areas during ME or MI between the two groups; however, a minor difference was noted. The intensity of the activated brain area during ME was stronger in the older group than in the younger group, while the results with MI were the opposite. The posterior central gyrus and supplementary motor area during MI were more active in the younger group than in the older group. The putamen, lingual, and so on demonstrated stronger activation during dominant hand MI in the older group. The results of this study revealed that the brain structure was altered and that neuronal activity was attenuated with age, and the cerebral cortex and subcortical tissues were found to be over-activated to achieve the same level of ME and MI, indicating that the activating effects of the left hemisphere enhanced with age, whereas the inhibitory effects declined during ME, and activation of the right hemisphere became more difficult during MI. (orig.)

  18. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    International Nuclear Information System (INIS)

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L.; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As 2 O 3 ), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As 2 O 3 -challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As 2 O 3 -induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As 2 O 3 -induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As 2 O 3 in AML cells. • Sensitization of THP-1 cells to As 2 O 3 toxicity by ethionamide is NRF2-dependent.

  19. An Orally Active Allosteric GLP-1 Receptor Agonist Is Neuroprotective in Cellular and Rodent Models of Stroke.

    Directory of Open Access Journals (Sweden)

    Huinan Zhang

    Full Text Available Diabetes is a major risk factor for the development of stroke. Glucagon-like peptide-1 receptor (GLP-1R agonists have been in clinical use for the treatment of diabetes and also been reported to be neuroprotective in ischemic stroke. The quinoxaline 6,7-dichloro-2-methylsulfonyl-3-N-tert- butylaminoquinoxaline (DMB is an agonist and allosteric modulator of the GLP-1R with the potential to increase the affinity of GLP-1 for its receptor. The aim of this study was to evaluate the neuroprotective effects of DMB on transient focal cerebral ischemia. In cultured cortical neurons, DMB activated the GLP-1R, leading to increased intracellular cAMP levels with an EC50 value about 100 fold that of exendin-4. Pretreatment of neurons with DMB protected against necrotic and apoptotic cell death was induced by oxygen-glucose deprivation (OGD. The neuroprotective effects of DMB were blocked by GLP-1R knockdown with shRNA but not by GLP-1R antagonism. In C57BL/6 mice, DMB was orally administered 30 min prior to middle cerebral artery occlusion (MCAO surgery. DMB markedly reduced the cerebral infarct size and neurological deficits caused by MCAO and reperfusion. The neuroprotective effects were mediated by activation of the GLP-1R through the cAMP-PKA-CREB signaling pathway. DMB exhibited anti-apoptotic effects by modulating Bcl-2 family members. These results provide evidence that DMB, a small molecular GLP-1R agonist, attenuates transient focal cerebral ischemia injury and inhibits neuronal apoptosis induced by MCAO. Taken together, these data suggest that DMB is a potential neuroprotective agent against cerebral ischemia.

  20. Feedback regulation of ALDOA activates the HIF-1α/MMP9 axis to promote lung cancer progression.

    Science.gov (United States)

    Chang, Yu-Chan; Chan, Yung-Chieh; Chang, Wei-Ming; Lin, Yuan-Feng; Yang, Chih-Jen; Su, Chia-Yi; Huang, Ming-Shyan; Wu, Alexander T H; Hsiao, Michael

    2017-09-10

    Distant metastasis and recurrence are the greatest challenges in the clinical management of lung cancer. Despite advances in targeted therapies, high mortality rates persist. Therefore, alternative therapeutic interventions are urgently required. Accumulating evidence indicates that normalizing tumor metabolism may be a way to increase therapeutic efficacy and to reduce tumor malignancy. Here, we analyzed integrated transcriptomics data and an shRNA library against glycolytic enzymes and found that elevated Aldolase A expression is highly correlated with metastatic potential and a poor prognosis in patients with non-small cell lung cancer (NSCLC). We validated our in silico findings with an immunohistochemical analysis of clinical samples. Aldolase A silencing significantly suppressed metastatic potential both in vitro and in vivo, whereas the ectopic overexpression of Aldolase A resulted in the opposite phenotype. Furthermore, our microarray and Ingenuity Pathway Analyses (IPA) revealed that Aldolase A-driven lung cancer metastasis was closely linked to hypoxia inducible factor 1 alpha (HIF-1α)-downstream signaling. Importantly, Aldolase A overexpression may promote the release of lactate to block PHD activities and further induce HIF-1α stabilization. Aldolase A and nuclear HIF-1α overexpression levels were positively correlated and were significantly associated with a poorer survival rate in lung cancer patients (P = 0.008 for Overall Survival, P = 0.021 for Disease-free Survival). Furthermore, MMP9, a downstream target of HIF-1α, was significantly upregulated after ALDOA overexpression. A MMP9 inhibitor significantly inhibited cell invasion and migration in ALDOA-HIF-1α axis-induced lung cancer. In summary, our results reveal the molecular mechanism of Aldolase A in promoting lung cancer metastasis via PHD-mediated stabilization of HIF-1α and the subsequent activation of MMP9. The ALDOA-HIF-1α axis may provide a new therapeutic target for

  1. LB-1 Exerts Antitumor Activity in Pancreatic Cancer by Inhibiting HIF-1α and Stat3 Signaling.

    Science.gov (United States)

    Niu, Fei; Li, Yan; Lai, Fang-Fang; Ni, Lin; Ji, Ming; Jin, Jing; Yang, Han-Ze; Wang, Chao; Zhang, Dong-Ming; Chen, Xiao-Guang

    2015-09-01

    Hypoxia is widely present in pancreatic cancer and subsequently causes the overexpression of hypoxia-inducible factor-1α (HIF-1α) and signal transducer and activator of transcription-3 (Stat3). HIF-1α and Stat3 function cooperatively to regulate a number of downstream genes that are implicated in tumorigenesis. Thus, inhibition of HIF-1α and Stat3 is a potential therapeutic strategy for pancreatic cancer. In this study, we explored how LB-1, a novel triptolide (LA) derivative, exerted its antitumor effect through blockade of HIF-1α and Stat3 signaling. Our data showed that LB-1 was able to inhibit the proliferation and colony formation of Mia-PaCa2 and SW1990 cells. LB-1 suppressed HIF-1α protein accumulation by promoting its proteasome degradation and reducing transactivation. Moreover, the silence of HIF-1α by shRNA partially prevented the proliferation inhibition triggered by LB-1. As expected, LB-1 also decreased Stat3 protein accumulation and blocked the physical interactions between HIF-1α/p300/phosphor-Stat3 (p-Stat3) at the pharmacological concentration to reduce VEGF expression, thereby hypoxia-induced angiogenesis. In the Mia-PaCa2 nude xenograft model, therapeutic treatment with LB-1 significantly inhibited tumor growth and had minimal systemic toxicity compared to the mother drug LA. Furthermore, in accordance with in vitro results, HIF-1α activation and Stat3 expression in tumors were blocked by LB-1 through mTOR-dependent pathway. Taken together, these results illustrate that, as a potent inhibitor of HIF-1α and Stat3 signaling, LB-1 exhibits antitumor effect and could be potentially used to treat pancreatic cancer. © 2015 Wiley Periodicals, Inc.

  2. Transient human auditory cortex activation during volitional attention shifting.

    Directory of Open Access Journals (Sweden)

    Christian Harm Uhlig

    Full Text Available While strong activation of auditory cortex is generally found for exogenous orienting of attention, endogenous, intra-modal shifting of auditory attention has not yet been demonstrated to evoke transient activation of the auditory cortex. Here, we used fMRI to test if endogenous shifting of attention is also associated with transient activation of the auditory cortex. In contrast to previous studies, attention shifts were completely self-initiated and not cued by transient auditory or visual stimuli. Stimuli were two dichotic, continuous streams of tones, whose perceptual grouping was not ambiguous. Participants were instructed to continuously focus on one of the streams and switch between the two after a while, indicating the time and direction of each attentional shift by pressing one of two response buttons. The BOLD response around the time of the button presses revealed robust activation of the auditory cortex, along with activation of a distributed task network. To test if the transient auditory cortex activation was specifically related to auditory orienting, a self-paced motor task was added, where participants were instructed to ignore the auditory stimulation while they pressed the response buttons in alternation and at a similar pace. Results showed that attentional orienting produced stronger activity in auditory cortex, but auditory cortex activation was also observed for button presses without focused attention to the auditory stimulus. The response related to attention shifting was stronger contralateral to the side where attention was shifted to. Contralateral-dominant activation was also observed in dorsal parietal cortex areas, confirming previous observations for auditory attention shifting in studies that used auditory cues.

  3. Aryl hydrocarbon receptor/cytochrome P450 1A1 pathway mediates breast cancer stem cells expansion through PTEN inhibition and β-Catenin and Akt activation.

    Science.gov (United States)

    Al-Dhfyan, Abdullah; Alhoshani, Ali; Korashy, Hesham M

    2017-01-19

    Breast cancer stem cells (CSCs) are small sub-type of the whole cancer cells that drive tumor initiation, progression and metastasis. Recent studies have demonstrated a role for the aryl hydrocarbon receptor (AhR)/cytochrome P4501A1 pathway in CSCs expansion. However, the exact molecular mechanisms remain unclear. The current study was designed to a) determine the effect of AhR activation and inhibition on breast CSCs development, maintenance, self-renewal, and chemoresistance at the in vitro and in vivo levels and b) explore the role of β-Catenin, PI3K/Akt, and PTEN signaling pathways. To test this hypothesis, CSC characteristics of five human breast cancer cells; SKBR-3, MCF-7, and MDA-MB231, HS587T, and T47D treated with AhR activators or inhibitor were determined using Aldefluor assay, side population, and mammosphere formation. The mRNA, protein expression, cellular content and localization of the target genes were determined by RT-PCR, Western blot analysis, and Immunofluorescence, respectively. At the in vivo level, female Balb/c mice were treated with AhR/CYP1A1 inducer and histopathology changes and Immunohistochemistry examination for target proteins were determined. The constitutive mRNA expression and cellular content of CYP1A1 and CYP1B1, AhR-regulated genes, were markedly higher in CSCs more than differentiating non-CSCs of five different human breast cancer cells. Activation of AhR/CYP1A1 in MCF-7 cells by TCDD and DMBA, strong AhR activators, significantly increased CSC-specific markers, mammosphere formation, aldehyde dehydrogenase (ALDH) activity, and percentage of side population (SP) cells, whereas inactivation of AhR/CYP1A1 using chemical inhibitor, α-naphthoflavone (α-NF), or by genetic shRNA knockdown, significantly inhibited the upregulation of ALDH activity and SP cells. Importantly, inactivation of the AhR/CYP1A1 significantly increased sensitization of CSCs to the chemotherapeutic agent doxorubicin. Mechanistically, Induction of Ah

  4. Local Residential Segregation Matters: Stronger Association of Census Tract Compared to Conventional City-Level Measures with Fatal and Non-Fatal Assaults (Total and Firearm Related), Using the Index of Concentration at the Extremes (ICE) for Racial, Economic, and Racialized Economic Segregation, Massachusetts (US), 1995-2010.

    Science.gov (United States)

    Krieger, Nancy; Feldman, Justin M; Waterman, Pamela D; Chen, Jarvis T; Coull, Brent A; Hemenway, David

    2017-04-01

    Research on residential segregation and health, primarily conducted in the USA, has chiefly employed city or regional measures of racial segregation. To test our hypothesis that stronger associations would be observed using local measures, especially for racialized economic segregation, we analyzed risk of fatal and non-fatal assault in Massachusetts (1995-2010), since this outcome is strongly associated with residential segregation. The segregation metrics comprised the Index of Concentration at the Extremes (ICE), the Index of Dissimilarity, and poverty rate, with measures computed at both the census tract and city/town level. Key results were that larger associations between fatal and non-fatal assaults and residential segregation occurred for models using the census tract vs. city/town measures, with the greatest associations observed for racialized economic segregation. For fatal assaults, comparing the bottom vs. top quintiles, the incidence rate ratio (and 95% confidence interval (CI)) in models using the census tract measures equaled 3.96 (95% CI 3.10, 5.06) for the ICE for racialized economic segregation, 3.26 (95% CI 2.58, 4.14) for the ICE for income, 3.14 (95% CI 2.47, 3.99) for poverty, 2.90 (95% CI 2.21, 3.81) for the ICE for race/ethnicity, and only 0.93 (95% CI 0.79, 1.11) for the Index of Dissimilarity; in models that included both census tract and city/town ICE measures, this risk ratio for the ICE for racialized economic segregation was higher at the census tract (3.29; 95% CI 2.43, 4.46) vs. city/town level (1.61; 95% CI 1.12, 2.32). These results suggest that, at least in the case of fatal and non-fatal assaults, research on residential segregation should employ local measures, including of racialized economic segregation, to avoid underestimating the adverse impact of segregation on health.

  5. Female directors and real activities manipulation: Evidence from China

    Directory of Open Access Journals (Sweden)

    Jin-hui Luo

    2017-06-01

    Full Text Available Unlike previous studies that focus on accrual-based earnings management, this study analyzes real activities manipulation and investigates whether female directors on boards of directors (BoDs affect managers’ real activities manipulation. Using a large sample of 11,831 firm-year observations from Chinese listed companies from the 2000 to 2011 period, we find that higher female participation on BoDs is associated with lower levels of real activities manipulation, and that this negative relationship is stronger when female directors have higher ownership. These results hold for a battery of robustness checks. Overall, our findings indicate that board gender diversity may serve as a substitute mechanism for corporate governance to curb real activities manipulation and thus provide interested stakeholders with higher quality earnings reports.

  6. The Importance of Leisure Activities in the Relationship between Physical Health and Well-Being in a Life Span Sample.

    Science.gov (United States)

    Paggi, Michelle E; Jopp, Daniela; Hertzog, Christopher

    2016-01-01

    Previous studies have examined the relationships between physical health and leisure activities and between leisure activities and well-being, but, to our knowledge, none has examined these relationships simultaneously. This study investigated the relationships between leisure activities, health and well-being considering the role of age, and whether leisure activities mediate the relationship between physical health and well-being. Utilizing a cross-sectional database of 259 adults (ages 18-81 years) who completed several questionnaires, linear regression models and mediation models were tested. Regression analyses indicated that physical health was related to leisure activities and leisure activities were related to well-being. When physical health was measured by subjective ratings, age had a stronger relationship with leisure activities. However, when physical health was indicated by health restrictions, physical health had a stronger relationship with leisure activities than did age. Leisure activities were a partial mediator of the relationship between physical health and well-being. The results demonstrated that the reduction in leisure activities with age has more to do with physical health limitations than with older age itself. In addition, regardless of age, the benefits of physical health for well-being are due in part to the level of leisure activity participation. These results highlight the importance of leisure activities for successful aging throughout the adult life span. Interventions designed to improve well-being through increasing leisure activity participation should take physical health into consideration, particularly for older adults. © 2016 S. Karger AG, Basel.

  7. Tumor Necrosis Factor-Like Weak Inducer of Apoptosis Accelerates the Progression of Renal Fibrosis in Lupus Nephritis by Activating SMAD and p38 MAPK in TGF-β1 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Zhiqin Liu

    2016-01-01

    Full Text Available This study aim was to explore the effects of tumor necrosis factor-like weak inducer of apoptosis (TWEAK in lupus nephritis and its potential underlying mechanisms. MRL/lpr mice were used for in vivo experiments and human proximal tubular cells (HK2 cells were used for in vitro experiments. Results showed that MRL/lpr mice treated with vehicle solution or LV-Control shRNA displayed significant proteinuria and severe renal histopathological changes. LV-TWEAK-shRNA treatment reversed these changes and decreased renal expressions of TWEAK, TGF-β1, p-p38 MAPK, p-Smad2, COL-1, and α-SMA proteins. In vitro, hTWEAK treatment upregulated the expressions of TGF-β1, p-p38 MAPK, p-SMAD2, α-SMA, and COL-1 proteins in HK2 cells and downregulated the expressions of E-cadherin protein, which were reversed by cotreatment with anti-TWEAK mAb or SB431542 treatment. These findings suggest that TWEAK may contribute to chronic renal changes and renal fibrosis by activating TGF-β1 signaling pathway, and phosphorylation of Smad2 and p38 MAPK proteins was also involved in this signaling pathway.

  8. Immunomodulating Activity of Aronia melanocarpa Polyphenols

    Directory of Open Access Journals (Sweden)

    Giang T. T. Ho

    2014-06-01

    Full Text Available The immunomodulating effects of isolated proanthocyanidin-rich fractions, procyanidins C1, B5 and B2 and anthocyanins of Aronia melanocarpa were investigated. In this work, the complement-modulating activities, the inhibitory activities on nitric oxide (NO production in LPS-induced RAW 264.7 macrophages and effects on cell viability of these polyphenols were studied. Several of the proanthocyanidin-rich fractions, the procyanidins C1, B5 and B2 and the cyanidin aglycone possessed strong complement-fixing activities. Cyanidin 3-glucoside possessed stronger activity than the other anthocyanins. Procyanidins C1, B5 and B2 and proanthocyanidin-rich fractions having an average degree of polymerization (PD of 7 and 34 showed inhibitory activities on NO production in LPS-stimulated RAW 264.7 mouse macrophages. All, except for the fraction containing proanthocyanidins with PD 34, showed inhibitory effects without affecting cell viability. This study suggests that polyphenolic compounds of A. melanocarpa may have beneficial effects as immunomodulators and anti-inflammatory agents.

  9. Longitudinal examination of social and environmental influences on motivation for physical activity.

    Science.gov (United States)

    Richards, Elizabeth A; McDonough, Meghan; Fu, Rong

    2017-10-01

    Physical activity behavior is influenced by numerous factors including motivation, social interactions, and the walkability of the environment. To examine how social contexts and environmental features affect physical activity motivational processes across time. Participants (N=104) completed 3 monthly online surveys assessing self-determination theory constructs, social partners in physical activity, neighborhood walkability, and weekly physical activity. Longitudinal path analysis examined the degree to which physical activity was predicted by individual goals, orientation, and autonomy support and whether these associations were meditated by motivation and moderated by the social and environmental contexts of physical activity. The effect of controlled exercise orientations on physical activity was mediated by autonomous motivation. This association was stronger among those who perceived less crime in their neighborhoods. To improve the ability to tailor physical activity counseling it is important to understand how each person views exercise situations and to understand his/her social and neighborhood environments. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. The suppression of bromodomain and extra-terminal domain inhibits vascular inflammation by blocking NF-κB and MAPK activation.

    Science.gov (United States)

    Huang, Mingcheng; Zeng, Shan; Zou, Yaoyao; Shi, Maohua; Qiu, Qian; Xiao, Youjun; Chen, Guoqiang; Yang, Xiuyan; Liang, Liuqin; Xu, Hanshi

    2017-01-01

    There is increasing evidence indicating that bromodomain and extra-terminal domain (BET) proteins play a critical role in the regulation of immune and inflammatory responses; however, their contribution to vascular inflammation has not yet been elucidated. In this study, we investigated the effect of inhibiting BET bromodomain on vascular inflammation and the underlying mechanisms. HUVECs were isolated from fresh umbilical cords. JQ1, a specific BET bromodomain inhibitor, and Brd shRNA were used to evaluate the regulation of the BET proteins in vascular inflammation. Leukocyte adhesion to HUVECs was measure by an adhesion assay. Western blot or immunohistochemical analysis was used to detect the protein expression. Real-time PCR was used to evaluate mRNA expression. Leukocyte accumulation in vivo was determined by an acute lung inflammation model. BET bromodomain inhibition suppressed the expression of adhesion molecules induced by TNF-α- or LPS, including ICAM-1, VCAM-1 and E-selectin, and inhibited leukocyte adhesion to activated HUVEC monolayers. Treatment with JQ1 also attenuated the LPS-induced accumulation of leukocytes and expression of endothelial adhesion molecules in the acute lung inflammation model in vivo. Furthermore, BET bromodomain inhibition reduced the activity of p38 and JNK MAPKs and NF-κB in TNF-α-stimulated HUVECs. TNF-α-induced NF-κB activation was also blocked by inhibitors of p38 (SB203580) or JNK (SP600125). BET bromodomain is important for regulating endothelial inflammation. Strategies targeting endothelial BET bromodomain may provide a new therapeutic approach for controlling inflammatory-related diseases. © 2016 The British Pharmacological Society.

  11. Small molecule activators of the Nrf2-HO-1 antioxidant axis modulate heme metabolism and inflammation in BV2 microglia cells.

    Science.gov (United States)

    Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto

    2013-10-01

    The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Identity Activities

    Science.gov (United States)

    2016-08-03

    various types of accommodations (including dwellings, shelters and institutions for the homeless or other living quarters). Appendix D D-4 JDN X-XX...activity capabilities can be severely impacted by a lack of forethought and planning related to these factors. Assessing Identity Activities Threat...complement and reinforce many of the activities making up civil-military counterinsurgency (COIN) operations. (c) Criminal Networks. Areas that lack

  13. Physical Activity

    DEFF Research Database (Denmark)

    Andersen, Lars Bo; Anderssen, Sigmund Alfred; Wisløff, Ulrik

    2014-01-01

    Andersen LB, Anderssen SA, Wisløff U, Hellénius M-L, Fogelholm M, Ekelund U. (Expert Group) Nordic Nutrition Recommendations 2012. Integrating nutrition and physical activity. Chapter: Physical Activity p. 195-217.Nordic Counsil of Ministers.......Andersen LB, Anderssen SA, Wisløff U, Hellénius M-L, Fogelholm M, Ekelund U. (Expert Group) Nordic Nutrition Recommendations 2012. Integrating nutrition and physical activity. Chapter: Physical Activity p. 195-217.Nordic Counsil of Ministers....

  14. An RNAi screen for Aire cofactors reveals a role for Hnrnpl in polymerase release and Aire-activated ectopic transcription.

    Science.gov (United States)

    Giraud, Matthieu; Jmari, Nada; Du, Lina; Carallis, Floriane; Nieland, Thomas J F; Perez-Campo, Flor M; Bensaude, Olivier; Root, David E; Hacohen, Nir; Mathis, Diane; Benoist, Christophe

    2014-01-28

    Aire induces the expression of a large set of autoantigen genes in the thymus, driving immunological tolerance in maturing T cells. To determine the full spectrum of molecular mechanisms underlying the Aire transactivation function, we screened an AIRE-dependent gene-expression system with a genome-scale lentiviral shRNA library, targeting factors associated with chromatin architecture/function, transcription, and mRNA processing. Fifty-one functional allies were identified, with a preponderance of factors that impact transcriptional elongation compared with initiation, in particular members of the positive transcription elongation factor b (P-TEFb) involved in the release of "paused" RNA polymerases (CCNT2 and HEXIM1); mRNA processing and polyadenylation factors were also highlighted (HNRNPL/F, SFRS1, SFRS3, and CLP1). Aire's functional allies were validated on transfected and endogenous target genes, including the generation of lentigenic knockdown (KD) mice. We uncovered the effect of the splicing factor Hnrnpl on Aire-induced transcription. Transcripts sensitive to the P-TEFb inhibitor flavopiridol were reduced by Hnrnpl knockdown in thymic epithelial cells, independently of their dependence on Aire, therefore indicating a general effect of Hnrnpl on RNA elongation. This conclusion was substantiated by demonstration of HNRNPL interactions with P-TEFb components (CDK9, CCNT2, HEXIM1, and the small 7SK RNA). Aire-containing complexes include 7SK RNA, the latter interaction disrupted by HNRNPL knockdown, suggesting that HNRNPL may partake in delivering inactive P-TEFb to Aire. Thus, these results indicate that mRNA processing factors cooperate with Aire to release stalled polymerases and to activate ectopic expression of autoantigen genes in the thymus.

  15. The neural coding of expected and unexpected monetary performance outcomes: dissociations between active and observational learning.

    Science.gov (United States)

    Bellebaum, C; Jokisch, D; Gizewski, E R; Forsting, M; Daum, I

    2012-02-01

    Successful adaptation to the environment requires the learning of stimulus-response-outcome associations. Such associations can be learned actively by trial and error or by observing the behaviour and accompanying outcomes in other persons. The present study investigated similarities and differences in the neural mechanisms of active and observational learning from monetary feedback using functional magnetic resonance imaging. Two groups of 15 subjects each - active and observational learners - participated in the experiment. On every trial, active learners chose between two stimuli and received monetary feedback. Each observational learner observed the choices and outcomes of one active learner. Learning performance as assessed via active test trials without feedback was comparable between groups. Different activation patterns were observed for the processing of unexpected vs. expected monetary feedback in active and observational learners, particularly for positive outcomes. Activity for unexpected vs. expected reward was stronger in the right striatum in active learning, while activity in the hippocampus was bilaterally enhanced in observational and reduced in active learning. Modulation of activity by prediction error (PE) magnitude was observed in the right putamen in both types of learning, whereas PE related activations in the right anterior caudate nucleus and in the medial orbitofrontal cortex were stronger for active learning. The striatum and orbitofrontal cortex thus appear to link reward stimuli to own behavioural reactions and are less strongly involved when the behavioural outcome refers to another person's action. Alternative explanations such as differences in reward value between active and observational learning are also discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Activity report

    International Nuclear Information System (INIS)

    1990-11-01

    The Department of Physics and Measurement Technology, Biology and Chemistry (IFM) presents every year a progress report containing a brief description of activities in research and education within the department. The report is intended as an information for colleagues and institutions. The present report contains activities for the academic year July 1989 to June 1990

  17. Unabated adenovirus replication following activation of the cGAS/STING-dependent antiviral response in human cells.

    Science.gov (United States)

    Lam, Eric; Falck-Pedersen, Erik

    2014-12-01

    The cGAS/STING DNA sensing complex has recently been established as a predominant pathogen recognition receptor (PRR) for DNA-directed type I interferon (IFN) innate immune activation. Using replication-defective adenovirus vectors and replication-competent wild-type adenovirus, we have modeled the influence of the cGAS/STING cascade in permissive human cell lines (A549, HeLa, ARPE19, and THP1). Wild-type adenovirus induced efficient early activation of the cGAS/STING cascade in a cell-specific manner. In all responsive cell lines, cGAS/STING short hairpin RNA (shRNA) knockdown resulted in a loss of TBK1 and interferon response factor 3 (IRF3) activation, a lack of beta interferon transcript induction, loss of interferon-dependent STAT1 activation, and diminished induction of interferon-stimulated genes (ISGs). Adenoviruses that infect through the coxsackievirus-adenovirus receptor (CAR) (Ad2 and Ad5) and the CD46 (Ad35) and desmoglein-2 (Ad7) viral receptors all induce the cGAS/STING/TBK1/IRF3 cascade. The magnitude of the IRF3/IFN/ISG antiviral response was strongly influenced by serotype, with Ad35>Ad7>Ad2. For each serotype, no enhancement of viral DNA replication or virus production occurred in cGAS or STING shRNA-targeted cell line pools. We found no replication advantage in permissive cell lines that do not trigger the cGAS/STING cascade following infection. The cGAS/STING/TBK1/IRF3 cascade was not a direct target of viral antihost strategies, and we found no evidence that Ad stimulation of the cGAS/STING DNA response had an impact on viral replication efficiency. This study shows for the first time that the cGAS DNA sensor directs a dominant IRF3/IFN/ISG antiviral response to adenovirus in human cell lines. Activation of cGAS occurs with viruses that infect through different high-affinity receptors (CAR, CD46, and desmoglein-2), and the magnitude of the cGAS/STING DNA response cascade is influenced by serotype-specific functions. Furthermore, activation of

  18. Evaluation of the Antioxidant Activity of Syzygium cumini Leaves

    Directory of Open Access Journals (Sweden)

    Yi Ming Lin

    2008-10-01

    Full Text Available The antioxidant activity of Syzygium cumini leaf extracts was investigated using the 2,2-diphenyl-1-picrylhydrazyl (DPPH free radical-scavenging and ferric-reducing antioxidant power (FRAP assays. The methanolic extract and its four water, ethyl acetate, chloroform, and n-hexane fractions were prepared and subjected to antioxidant evaluation. The results showed that the ethyl acetate fraction had stronger antioxidant activity than the other ones. HPLC data indicated that S. cumini leaf extracts contained phenolic compounds, such as ferulic acid and catechin, responsible for their antioxidant activity. A significant linear relationship between antioxidant potency, free radical-scavenging ability and the content of phenolic compounds of leaf extracts supported this observation.

  19. Inhibitory Activities of Alkyl Syringates and Related Compounds on Aflatoxin Production.

    Science.gov (United States)

    Furukawa, Tomohiro; Iimura, Kurin; Kimura, Taichi; Yamamoto, Toshiyoshi; Sakuda, Shohei

    2016-06-07

    Inhibitors of aflatoxin production of aflatoxigenic fungi are useful for preventing aflatoxin contamination in crops. As methyl syringate weakly inhibits aflatoxin production, aflatoxin production inhibitory activities of additional alkyl syringates with alkyl chains from ethyl to octyl were examined. Inhibitory activity toward aflatoxin production of Aspergillus flavus became stronger as the length of the alkyl chains on the esters became longer. Pentyl, hexyl, heptyl, and octyl syringates showed strong activity at 0.05 mM. Heptyl and octyl parabens, and octyl gallate also inhibited aflatoxin production as strongly as octyl syringate. Alkyl parabens and alkyl gallates inhibit the complex II activity of the mitochondrial respiration chain; thus, whether alkyl syringates inhibit complex II activity was examined. Inhibitory activities of alkyl syringates toward complex II also became stronger as the length of the alkyl chains increased. The complex II inhibitory activity of octyl syringate was comparable to that of octyl paraben and octyl gallate. These results suggest that alkyl syringates, alkyl parabens, and alkyl gallates, including commonly used food additives, are useful for aflatoxin control.

  20. Inhibitory Activities of Alkyl Syringates and Related Compounds on Aflatoxin Production

    Directory of Open Access Journals (Sweden)

    Tomohiro Furukawa

    2016-06-01

    Full Text Available Inhibitors of aflatoxin production of aflatoxigenic fungi are useful for preventing aflatoxin contamination in crops. As methyl syringate weakly inhibits aflatoxin production, aflatoxin production inhibitory activities of additional alkyl syringates with alkyl chains from ethyl to octyl were examined. Inhibitory activity toward aflatoxin production of Aspergillus flavus became stronger as the length of the alkyl chains on the esters became longer. Pentyl, hexyl, heptyl, and octyl syringates showed strong activity at 0.05 mM. Heptyl and octyl parabens, and octyl gallate also inhibited aflatoxin production as strongly as octyl syringate. Alkyl parabens and alkyl gallates inhibit the complex II activity of the mitochondrial respiration chain; thus, whether alkyl syringates inhibit complex II activity was examined. Inhibitory activities of alkyl syringates toward complex II also became stronger as the length of the alkyl chains increased. The complex II inhibitory activity of octyl syringate was comparable to that of octyl paraben and octyl gallate. These results suggest that alkyl syringates, alkyl parabens, and alkyl gallates, including commonly used food additives, are useful for aflatoxin control.

  1. Goal conflict and the moderating effects of intention stability in intention-behavior relations: physical activity among Hong Kong chinese.

    Science.gov (United States)

    Li, Kin-Kit; Chan, Darius K S

    2008-02-01

    This study examined how goal conflict influences the pattern of the moderating effects of intention stability on the intention-behavior relations in the context of physical activity participation. A longitudinal study of 136 young adult students with three waves of data collection (a 2-week interval between waves) was conducted. Results showed a significant three-way interaction among intention, goal conflict,& intention stability in explaining vigorous-intensity physical activity (Beta = -.25, p goal conflict was low, the intention-behavior relations were stronger with stable intentions and weaker with unstable intentions. However, when the level of goal conflict was high, the intention-behavior relations were weaker with stable intentions and stronger with unstable intentions. Possible underlying processes of goal conflict and intention stability on the intention-behavior relations are discussed.

  2. Woodfruticosin (woodfordin C), a new inhibitor of DNA topoisomerase II. Experimental antitumor activity.

    Science.gov (United States)

    Kuramochi-Motegi, A; Kuramochi, H; Kobayashi, F; Ekimoto, H; Takahashi, K; Kadota, S; Takamori, Y; Kikuchi, T

    1992-11-17

    Woodfruticosin (woodfordin C) (WFC), a new inhibitor of DNA topoisomerase II (topo-II), was isolated from methanol extract of Woodfordia fruticosa Kurz (Lythraceae) and studied for in vitro and in vivo antitumor activities in comparison with Adriamycin (ADR) and etoposide (ETP), well known inhibitors of topo-II. The inhibitory activity against DNA topo-II shown by WFC was much stronger than that shown by ETP or ADR. WFC inhibited strongly intracellular DNA synthesis but not RNA and protein synthesis. On the other hand, WFC had a weaker growth inhibitory activity against various human tumor cells than ETP or ADR, but it showed remarkable activity against PC-1 cells and moderate activity against MKN45 and KB cells. Furthermore, WFC had in vivo growth inhibitory activity against s.c. inoculated colon38. These results indicate that the mechanism by which WFC exhibits antitumor activity may be through inhibition of topo-II.

  3. Arsenic treatment increase Aurora-A overexpression through E2F1 activation in bladder cells.

    Science.gov (United States)

    Kao, Yu-Ting; Wu, Chin-Han; Wu, Shan-Ying; Lan, Sheng-Hui; Liu, Hsiao-Sheng; Tseng, Ya-Shih

    2017-04-18

    Arsenic is a widely distributed metalloid compound that has biphasic effects on cultured cells. In large doses, arsenic can be toxic enough to trigger cell death. In smaller amounts, non-toxic doses may promote cell proliferation and induces carcinogenesis. Aberration of chromosome is frequently detected in epithelial cells and lymphocytes of individuals from arsenic contaminated areas. Overexpression of Aurora-A, a mitotic kinase, results in chromosomal instability and cell transformation. We have reported that low concentration (≦1 μM) of arsenic treatment increases Aurora-A expression in immortalized bladder urothelial E7 cells. However, how arsenic induces carcinogenesis through Aurora-A activation remaining unclear. Bromodeoxyuridine (BrdU) staining, MTT assay, and flow cytometry assay were conducted to determine cell proliferation. Messenger RNA and protein expression levels of Aurora-A were detected by reverse transcriptional-PCR and Western blotting, respectively. Centrosome of cells was observed by immunofluorescent staining. The transcription factor of Aurora-A was investigated by promoter activity, chromosome immunoprecipitation (ChIP), and small interfering RNA (shRNA) assays. Mouse model was utilized to confirm the relationship between arsenic and Aurora-A. We reveal that low dosage of arsenic treatment increased cell proliferation is associated with accumulated cell population at S phase. We also detected increased Aurora-A expression at mRNA and protein levels in immortalized bladder urothelial E7 cells exposed to low doses of arsenic. Arsenic-treated cells displayed increased multiple centrosome which is resulted from overexpressed Aurora-A. Furthermore, the transcription factor, E2F1, is responsible for Aurora-A overexpression after arsenic treatment. We further disclosed that Aurora-A expression and cell proliferation were increased in bladder and uterus tissues of the BALB/c mice after long-term arsenic (1 mg/L) exposure for 2 months. We

  4. Activation of c-MET induces a stem-like phenotype in human prostate cancer.

    Directory of Open Access Journals (Sweden)

    Geert J L H van Leenders

    Full Text Available Prostate cancer consists of secretory cells and a population of immature cells. The function of immature cells and their mutual relation with secretory cells are still poorly understood. Immature cells either have a hierarchical relation to secretory cells (stem cell model or represent an inducible population emerging upon appropriate stimulation of differentiated cells. Hepatocyte Growth Factor (HGF receptor c-MET is specifically expressed in immature prostate cells. Our objective is to determine the role of immature cells in prostate cancer by analysis of the HGF/c-MET pathway.Gene-expression profiling of DU145 prostate cancer cells stimulated with HGF revealed induction of a molecular signature associated with stem cells, characterized by up-regulation of CD49b, CD49f, CD44 and SOX9, and down-regulation of CD24 ('stem-like signature'. We confirmed the acquisition of a stem-like phenotype by quantitative PCR, FACS analysis and Western blotting. Further, HGF led to activation of the stem cell related Notch pathway by up-regulation of its ligands Jagged-1 and Delta-like 4. Small molecules SU11274 and PHA665752 targeting c-MET activity were both able to block the molecular and biologic effects of HGF. Knock-down of c-MET by shRNA infection resulted in significant reduction and delay of orthotopic tumour-formation in male NMRI mice. Immunohistochemical analysis in prostatectomies revealed significant enrichment of c-MET positive cells at the invasive front, and demonstrated co-expression of c-MET with stem-like markers CD49b and CD49f.In conclusion, activation of c-MET in prostate cancer cells induced a stem-like phenotype, indicating a dynamic relation between differentiated and stem-like cells in this malignancy. Its mediation of efficient tumour-formation in vivo and predominant receptor expression at the invasive front implicate that c-MET regulates tumour infiltration in surrounding tissues putatively by acquisition of a stem-like phenotype.

  5. Accelerometer-Derived Total Activity Counts, Bouted Minutes of Moderate to Vigorous Activity, and Insulin Resistance: NHANES 2003-2006.

    Science.gov (United States)

    Boyer, William R; Wolff-Hughes, Dana L; Bassett, David R; Churilla, James R; Fitzhugh, Eugene C

    2016-10-20

    The objective of this study was to compare the associations of accelerometer-derived total activity counts per day and minutes of bouted moderate to vigorous physical activity (MVPA) with insulin resistance. The sample included 2,394 adults (aged ≥20 y) from the 2003-2006 National Health and Nutrition Examination Survey. Time spent in MVPA, measured by using 2 cutpoints (≥2,020 counts/min [MVPA 2,020 ] and ≥760 counts/min [MVPA 760 ]), was calculated for bouts of at least 8 to 10 minutes. Total activity counts per day reflects the total amount of activity across all intensities. Insulin resistance was measured via the homeostatic model assessment of insulin resistance (HOMA-IR) and the quantitative insulin sensitivity check index (QUICKI). Two nested regression models regressed HOMA-IR and QUICKI, respectively, on minutes of bouted MVPA and total activity counts per day. We used an adjusted Wald F statistic to illustrate strength of association. After adjustment for covariates, total activity counts per day was more strongly associated with both HOMA-IR (adjusted Wald F = 36.83 , P activity counts per day was more strongly associated with both HOMA-IR (adjusted Wald F = 13.64, P activity counts per day has stronger associations with insulin resistance compared with minutes of bouted MVPA. The most likely explanation is that total activity counts per day captures data on light physical activity and intermittent MVPA, both of which influence insulin resistance.

  6. Epigenetic activation of the Foxa2 gene is required for maintaining the potential of neural precursor cells to differentiate into dopaminergic neurons after expansion.

    Science.gov (United States)

    Bang, So-Young; Kwon, So Hee; Yi, Sang-Hoon; Yi, Sang Ah; Park, Eun Kyung; Lee, Jae-Cheol; Jang, Choon-Gon; You, Jueng Soo; Lee, Sang-Hun; Han, Jeung-Whan

    2015-02-15

    Dysregulation of forkhead box protein A2 (Foxa2) expression in fetal ventral mesencephalon (VM)-derived neural precursor cells (NPCs) appears to be associated with the loss of their potential to differentiate into dopaminergic (DA) neurons after mitogenic expansion in vitro, hindering their efficient use as a transplantable cell source. Here, we report that epigenetic activation of Foxa2 in VM-derived NPCs by inducing histone hyperacetylation rescues the mitogenic-expansion-dependent decrease of differentiation potential to DA neurons. The silencing of Foxa2 gene expression after expansion is accompanied by repressive histone modifications, including hypoacetylation of histone H3 and H4 and trimethylation of H3K27 on the Foxa2 promoter, as well as on the global level. In addition, histone deacetylase 7 (HDAC7) is highly expressed during differentiation and recruited to the Foxa2 promoter. Induction of histone acetylation in VM-derived NPCs by either knockdown of HDAC7 or treatment with the HDAC inhibitor apicidin upregulates Foxa2 expression via hyperacetylation of H3 and a decrease in H3K27 trimethylation on the promoter regions, leading to the expression of DA neuron developmental genes and enhanced differentiation of DA neurons. These effects are antagonized by the expression of shRNAs specific for Foxa2 but enhanced by shRNA for HDAC7. Collectively, these findings indicate that loss of differentiation potential of expanded VM-derived NPCs is attributed to a decrease in Foxa2 expression and suggest that activation of the endogenous Foxa2 gene by epigenetic regulation might be an approach to enhance the generation of DA neurons.

  7. Radiation-resistant cancer stem-like cell properties are regulated by PTEN through the activity of nuclear β-catenin in nasopharyngeal carcinoma.

    Science.gov (United States)

    Zhang, Gong; Wang, Wenjun; Yao, Chunxiao; Zhang, Shuping; Liang, Lili; Han, Muyuan; Ren, Jinjin; Qi, Xiurong; Zhang, Xiaofeng; Wang, Shuye; Li, Lei

    2017-09-26

    Radiotherapy is the primary and most important treatment for nasopharyngeal carcinoma (NPC). Cancer stem-like cells (CSCs) have been shown to be resistant to radiation. The phosphatase and tensin homolog deleted on chromosome 10 (PTEN) tumor suppressor gene has been suggested to play a role in stem cell self-renewal. In the present study, we sorted PTEN-/+ cells using a flow cytometer. The clone formation assay showed that PTEN- cells were more radioresistant than PTEN+ NPC cells. We found that PTEN- cells demonstrated a significant increase in tumorsphere formation and CSCs markers compared with PTEN+ cells. Silencing the expression of PTEN with siRNA resulted in increased expression of p-AKT, active β-catenin and Nanog. siPTEN cells irradiated showed more radioresistant and DNA damage than parental cells. We also confirmed that down-regulation of β-catenin expression with shRNA resulted in a reduced percentage of side population cells and expression of Nanog. shβ-catenin cells significantly decreased survivin expression at 4 Gy irradiation in PTEN- cells compared with PTEN+ cells. In siPTEN cells, β-catenin staining shifted from the cytoplasmic membrane to the nucleus. Furthermore, immunofluorescence showed that following irradiation of PTEN- cells, at 4 Gy, active β-catenin was mainly found in the nucleus. Immunohistochemistry analysis also demonstrated that the PTEN-/p-AKT+/β-catenin+/Nanog+ axis may indicate poor prognosis and radioresistance in clinical NPC specimens. Thus, our findings strongly suggest that PTEN- cells have CSCs properties that are resistant to radiation in NPC. PTEN exerts these effects through the downstream effector PI3K/AKT/β-catenin/Nanog axis which depends on nuclear β-catenin accumulation.

  8. Activation of human stearoyl-coenzyme A desaturase 1 contributes to the lipogenic effect of PXR in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.

  9. R-spondin3-LGR4 signaling protects hepatocytes against DMOG-induced hypoxia/reoxygenation injury through activating β-catenin.

    Science.gov (United States)

    Liu, Shiying; Yin, Yue; Yu, Ruili; Li, Yin; Zhang, Weizhen

    2018-04-30

    Leucine-rich repeat G-protein-coupled receptor 4 (LGR4) and its ligands R-spondin1-4 (Rspos) have been vastly investigated in embryonic development. The biological functions of Rspos-LGR4 system in liver remains largely unknown. Here, we explored whether it protects hepatocytes against hypoxia/reoxygenation (H/R) induced damage. H/R injury was induced by dimethyloxalylglycine (DMOG) in AML12 cells and the effects of Rspo3 on cell proliferation and apoptosis were assessed. Specific shRNAs were used to interfere LGR4 or β-catenin. DMOG caused hepatocytes damage evidenced by increase in HIF-1α, cell death and apoptosis genes p27 and Bax, with concurrent decrease of cell proliferation genes PCNA and CyclinD1. Of all the Rspos, Rspo3 is predominantly expressed in AML12 hepatocytes. Importantly, Rspo3 demonstrated an alteration in a manner similar to proliferation-related genes during H/R injury. Rspo3 pretreatment rendered hepatocytes less vulnerable to DMOG induced H/R injury. Ablation of LGR4 using shRNA attenuated the protective effects of Rspo3. Wnt3a also protected AML12 cells from damages caused by H/R, showing enhanced proliferation activity. Notably, knockdown of β-catenin in hepatocytes completely abolished the effect of Rspo3 pretreatment on the expression levels of PCNA and CyclinD1. Rspo3-LGR4 axis protects hepatocytes from H/R injury via activating β-catenin. Copyright © 2018. Published by Elsevier Inc.

  10. Active Galaxies

    DEFF Research Database (Denmark)

    Kilerci Eser, Ece

    Galaxy formation and evolution is one of the main research themes of modern astronomy. Active galaxies such as Active Galactic Nuclei (AGN) and Ultraluminous Infrared Galaxies (ULIRGs) are important evolutionary stages of galaxies. The ULIRG stage is mostly associated with galaxy mergers...... and interactions. During the interactions of gas-rich galaxies, the gas inflows towards the centers of the galaxies and can trigger both star formation and AGN activity. The ULIRG stage includes rapid star formation activity and fast black hole growth that is enshrouded by dust. Once the AGN emission...... one is related to the mass estimates of supermassive black holes (SMBHs). Mass estimates of SMBHs are important to understand the formation and evolution of SMBHs and their host galaxies. Black hole masses in Type 1 AGN are measured with the reverberation mapping (RM) technique. Reverberation mapping...

  11. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  12. Peroxynitrite scavenging activities of aromatic compounds isolated from Konnyaku, Amorphophallus konjac K.Koch.

    Science.gov (United States)

    Niwa, Tatsuya; Murakami, Kazushi; Ohtake, Tetsuro; Etoh, Hideo; Shimizu, Atsushi; Shimizu, Yasuo; Kato, Yoji; Tanaka, Hitoshi

    2002-06-01

    (+/-)-5,5'-Dimethoxysesamin, erythrinasinate, indole-3-carbaldehyde, (7R,8S)-dihydrodehydrodiconiferyl alcohol 9-O-beta-D-glucopyranoside, cis- and trans-N-(p-coumaroyl)serotonin, serotonin, 3,4-dihydroxybenzoic acid, and 3,4-dihydroxybenzaldehyde have been found in tobiko, a food by-product, and evaluation of their peroxynitrite scavenging activities has been done. Among these compounds, serotonin, trans-N-(p-coumaroyl)serotonin, 3,4-dihydroxybenzaldehyde, and 3,4-dihydroxybenzoic acid showed stronger activities than that of BHT (butylated hydroxytoluene) at 200 microM.

  13. Population activity structure of excitatory and inhibitory neurons.

    Science.gov (United States)

    Bittner, Sean R; Williamson, Ryan C; Snyder, Adam C; Litwin-Kumar, Ashok; Doiron, Brent; Chase, Steven M; Smith, Matthew A; Yu, Byron M

    2017-01-01

    Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

  14. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  15. The NDUFB6 subunit of the mitochondrial respiratory chain complex I is required for electron transfer activity: A proof of principle study on stable and controlled RNA interference in human cell lines

    International Nuclear Information System (INIS)

    Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule; Rustin, Pierre

    2011-01-01

    Highlights: → NDUFB6 is required for activity of mitochondrial complex I in human cell lines. → Lentivirus based RNA interference results in frequent off target insertions. → Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.

  16. The NDUFB6 subunit of the mitochondrial respiratory chain complex I is required for electron transfer activity: A proof of principle study on stable and controlled RNA interference in human cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France); Rustin, Pierre, E-mail: pierre.rustin@inserm.fr [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France)

    2011-10-22

    Highlights: {yields} NDUFB6 is required for activity of mitochondrial complex I in human cell lines. {yields} Lentivirus based RNA interference results in frequent off target insertions. {yields} Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.

  17. Effects of nitrogen enrichment on phosphatase activity and nitrogen : phosphorus relationships in Cladonia portentosa.

    Science.gov (United States)

    Hogan, E J; Minnullina, G; Smith, R I; Crittenden, P D

    2010-06-01

    *Relationships between nitrogen deposition in the UK and phosphomonoesterase (PME) activity and nitrogen (N) and phosphorus (P) concentrations in Cladonia portentosa were quantified to understand factors limiting lichen growth and to further develop biomarkers for N pollution. *Lichen was collected from sites differing either in rates of wet N (NH(4)(+) + NO(3)(-)) deposition or in annual mean N concentration in rainfall based on both measured and modelled data sets. The PME activity, and total N and P concentrations were measured in specific horizontal strata in lichen mats and PME activity in the thallus was located using an enzyme-labelled fluorescent phosphatase substrate. *With an increase in modelled N deposition from 4.1 to 32.8 kg N ha(-1) yr(-1), PME activity, thallus N and N : P ratio increased by factors of 2.3, 1.4 and 1.8, respectively. Correlations with modelled data were generally stronger than with measured data and those with N deposition were stronger than those with N concentration in rainfall. The PME activity was located solely in the lichen fungus in outer regions of the thallus. *Nitrogen enrichment changes lichen N : P ratios from values typical of N limitation (for example, 10) to those indicative of P limitation (for example, 26) driving upregulation of PME activity.

  18. IKKα/CHUK regulates extracellular matrix remodeling independent of its kinase activity to facilitate articular chondrocyte differentiation.

    Directory of Open Access Journals (Sweden)

    Eleonora Olivotto

    Full Text Available BACKGROUND: The non-canonical NF-κB activating kinase IKKα, encoded by CHUK (conserved-helix-loop-helix-ubiquitous-kinase, has been reported to modulate pro- or anti- inflammatory responses, cellular survival and cellular differentiation. Here, we have investigated the mechanism of action of IKKα as a novel effector of human and murine chondrocyte extracellular matrix (ECM homeostasis and differentiation towards hypertrophy. METHODOLOGY/PRINCIPAL FINDINGS: IKKα expression was ablated in primary human osteoarthritic (OA chondrocytes and in immature murine articular chondrocytes (iMACs derived from IKKα(f/f:CreERT2 mice by retroviral-mediated stable shRNA transduction and Cre recombinase-dependent Lox P site recombination, respectively. MMP-10 was identified as a major target of IKKα in chondrocytes by mRNA profiling, quantitative RT-PCR analysis, immunohistochemistry and immunoblotting. ECM integrity, as assessed by type II collagen (COL2 deposition and the lack of MMP-dependent COL2 degradation products, was enhanced by IKKα ablation in mice. MMP-13 and total collagenase activities were significantly reduced, while TIMP-3 (tissue inhibitor of metalloproteinase-3 protein levels were enhanced in IKKα-deficient chondrocytes. IKKα deficiency suppressed chondrocyte differentiation, as shown by the quantitative inhibition of.Alizarin red staining and the reduced expression of multiple chondrocyte differentiation effectors, including Runx2, Col10a1 and Vegfa,. Importantly, the differentiation of IKKα-deficient chondrocytes was rescued by a kinase-dead IKKα protein mutant. CONCLUSIONS/SIGNIFICANCE: IKKα acts independent of its kinase activity to help drive chondrocyte differentiation towards a hypertrophic-like state. IKKα positively modulates ECM remodeling via multiple downstream targets (including MMP-10 and TIMP-3 at the mRNA and post-transcriptional levels, respectively to maintain maximal MMP-13 activity, which is required for ECM

  19. Physics activities

    International Nuclear Information System (INIS)

    1997-09-01

    As we move into the 21st Century, nuclear technology is on the verge of rejuvenation in advanced Member States and of expansion in developing Member States. The principal responsibilities of the IAEA are transferring technologies, co-ordinating scientific research, managing specialized projects and maintaining analytical quality control. The IAEA physics activities provide assistance with nuclear instrumentation, promote more effective utilization of research reactors and accelerators, and facilitate global co-operation in nuclear fusion research. These activities will help Member States improve their standards of living through the benefits of nuclear technology. This booklet presents a brief profile on the physics activities and involvement in these fields of the Physics Section, IAEA

  20. [Antibacterial and anti-hemolysin activities of tea catechins and their structural relatives].

    Science.gov (United States)

    Toda, M; Okubo, S; Ikigai, H; Shimamura, T

    1990-03-01

    Among catechins tested, (-)epigallocatechin (EGC), (-)epicatechin gallate (ECg), (-) epigallocatechin gallate (EGCg) inhibited the growth of Staphylococcus aureus, Vibrio cholerae O1 classical Inaba 569B and El Tor Inaba V86. S. aureus was more sensitive than V. cholerae O1 to these compounds. EGCg showed also a bactericidal activity against V. cholerae O1 569B. Pyrogallol showed a stronger antibacterial activity against S. aureus and V. cholerae O1 than tannic and gallic acid. Rutin or caffein had no effect on them. ECg and EGCg showed the most potent anti-hemolysin activity against S. aureus alpha-toxin, Vibrio parahaemolyticus thermostable direct hemolysin (Vp-TDH) and cholera hemolysin. Among catechin relatives, only tannic acid had a potent anti-hemolysin activity against alpha-toxin. These results suggest that the catechol and pyrogallol groups are responsible for the antibacterial and bactericidal activities, while the conformation of catechins might play an important role in the anti-hemolysin activity.

  1. [Effects of RAGE on Cell Proliferation and Tumor Growth in Pancreatic Cancer].

    Science.gov (United States)

    Chen, Wei-Wei; Guo, Qiang; Zhang, Zhao-da; Hu, Wei-Ming

    2017-01-01

    To investigate the effect of receptor for advanced glycation end products (RAGE) on cell proliferation and tumor growth in nude mice with pancreatic cancer. PANC-1 cells were transfected with shRNA RAGE -1, -2, -3 to down-regulate the expression of RAGE. Cholecystokinin octopeptide-8 (CCK-8), real-time PCR and Western blot were performed to test the impact of shRNA RAGE on the expressions of mRNAs and proteins of RAGE, matrix metalloproteinase-2 (MMP-2), MMP-9, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), and vascular endothelial growth factor (VEGF). Tumor growth and microvessel density in the nude mice implanted with shRNA RAGE transfected PANC-1 cells were observed using immunohistochemistry. The shRNA RAGE -1, -2, -3 transfected cells had lower absorbance values than the controls 24 h after transfection, and the absorbance value reached the lowest at 48 h. The specific shRNA sequences significantly inhibited the expressions of mRNA and protein of RAGE. The mice implanted with shRNA RAGE -2 had lower tumor volume and microvessel density than shRNA RAGE -1, -3. The expressions of mRNAs and proteins of RAGE, MMP-2, NF-κB, MMP-9 and VEGF were lower in the cells transfected with shRNA RAGE -2 compared with shRNA RAGE -1, -3. RAGE is involved in the progression of pancreatic cancer in vitro and in vivo . The RAGE expression could influence the process of tumor angiogenesis.

  2. Active handling

    International Nuclear Information System (INIS)

    Wheelton, I.S.

    1988-01-01

    The paper describes the work carried out by the National Nuclear Corporation on radioactive handling projects. The categories of these active handling projects include: irradiated reactor fuel and components handling for AGR fuel and fast reactor fuel, nuclear facilities for laboratory facilities and tritium handling, and nuclear waste from power station arisings and repository design. A description is given of the design work and responsibility for the facilities in each of the above active handling categories. The work requires a consistent approach to compliance with design codes and radiological protection criteria. (U.K.)

  3. Activating schoolyards

    DEFF Research Database (Denmark)

    Andersen, Henriette Bondo; Pawlowski, Charlotte Skau; Scheller, Hanne Bebendorf

    2015-01-01

    BACKGROUND: The aim of the Activating Schoolyards Study is to develop, implement, document and assess a comprehensive schoolyard intervention to promote physical activity (PA) during school recess for primary school children (grade 4-8). The intervention is designed to implement organizational...... project schools (cases) were selected by means of an open competition and the interventions were developed using a participatory bottom-up approach. DISCUSSION: The participatory approach and case selection strategy make the study design novel. The use of a mixed methods design including qualitative...... in the schoolyard will lead to recommendations for schools undergoing schoolyard renovations at some point in the future....

  4. Regulatory activities

    International Nuclear Information System (INIS)

    2001-01-01

    This publication, compiled in 8 chapters, presents the regulatory system developed by the Nuclear Regulatory Authority (NRA) of the Argentine Republic. The following activities and developed topics in this document describe: the evolution of the nuclear regulatory activity in Argentina; the Argentine regulatory system; the nuclear regulatory laws and standards; the inspection and safeguards of nuclear facilities; the emergency systems; the environmental systems; the environmental monitoring; the analysis laboratories on physical and biological dosimetry, prenatal irradiation, internal irradiation, radiation measurements, detection techniques on nuclear testing, medical program on radiation protection; the institutional relations with national and international organization; the training courses and meeting; the technical information

  5. Presurgical language fMRI activation correlates with postsurgical verbal memory decline in left-sided temporal lobe epilepsy.

    Science.gov (United States)

    Labudda, Kirsten; Mertens, Markus; Aengenendt, Joerg; Ebner, Alois; Woermann, Friedrich G

    2010-12-01

    We analysed the association of presurgical language fMRI activations and postsurgical verbal memory changes in 16 left-sided mesial temporal lobe epilepsy patients with initially intact memory. Patients with severe verbal memory decline after surgery (n = 9) had stronger presurgical fMRI activations within the left posterior temporal lobe, compared to those with no decline (n = 7). Language fMRI activation may predict verbal memory outcome, even in patients with a high risk of postsurgical memory deterioration. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. Activated Charcoal

    Science.gov (United States)

    ... if you are pregnant. Gastrointestinal (GI) blockage or slow movement of food through the intestine: Don’t use activated charcoal ... obstruction. Also, if you have a condition that slows the passage of food through your intestine (reduced peristalsis), don’t use ...

  7. Activated Sludge.

    Science.gov (United States)

    Saunders, F. Michael

    1978-01-01

    Presents the 1978 literature review of wastewater treatment. This review covers: (1) activated sludge process; (2) process control; (3) oxygen uptake and transfer; (4) phosphorus removal; (5) nitrification; (6) industrial wastewater; and (7) aerobic digestion. A list of 136 references is also presented. (HM)

  8. Total Activity Counts and Bouted Minutes of Moderate-to-Vigorous Physical Activity: Relationships With Cardiometabolic Biomarkers Using 2003-2006 NHANES.

    Science.gov (United States)

    Wolff-Hughes, Dana L; Fitzhugh, Eugene C; Bassett, David R; Churilla, James R

    2015-05-01

    To contrast associations of accelerometer-measured moderate-to-vigorous physical activity (MVPA) accumulated in bouts and total activity counts (TAC) with cardiometabolic biomarkers in U.S. adults. Using 2003-2006 National Health and Nutrition Examination Survey (NHANES) data, the sample was comprised of adults ≥ 20 years, not pregnant or lactating, with self-reported PA and at least 4 days of ≥ 10 hours accelerometer wear time (N = 5668). Bouted MVPA represented the minutes/day with ≥ 2020 counts/minute in bouts of 10 minutes or longer and TAC represented the total activity counts per day. Biomarkers included: cholesterol, triglyceride, glycohemoglobin, plasma glucose, C-peptide, insulin, C-reactive protein, homocysteine, blood pressure, body mass index (BMI), waist circumference, and skinfolds. Nested regression models were conducted which regressed each biomarker on bouted MVPA and TAC simultaneously, while adjusting for relevant covariates. Results indicated TAC was more strongly associated with 11 biomarkers: HDL-C, triglyceride, plasma glucose, C-peptide, insulin, C-reactive protein, homocysteine, systolic blood pressure, waist circumference, triceps skinfold, and subscapular skinfold. Bouted MVPA, however, only displayed stronger associations with BMI. The total volume of physical activity, represented by TAC, appears to have stronger associations with cardiometabolic biomarkers than MVPA accumulated in bouts.

  9. Staying Active: Physical Activity and Exercise

    Science.gov (United States)

    ... Patients About ACOG Staying Active: Physical Activity and Exercise Home For Patients Search FAQs Staying Active: Physical ... 2016 PDF Format Staying Active: Physical Activity and Exercise Women's Health What are the benefits of physical ...

  10. Diterpenoids with thioredoxin reductase inhibitory activities from Jatropha multifida.

    Science.gov (United States)

    Zhu, Jian-Yong; Zhang, Chun-Yang; Dai, Jing-Jing; Rahman, Khalid; Zhang, Hong

    2017-12-01

    Chemical investigation of the Jatropha multifida has led to the isolation of nine diterpenoids (1-9), including a new jatromulone A, four podocarpane diterpenoids (2-5), two lathyrane-type diterpenoids (6 and 7) and two dinorditerpenoids (8 and 9). Their structures were elucidated by spectroscopic analysis, and the absolute configurations of 1 were determined by CD analysis. All of the diterpenoids were screened for inhibitory activity against thioredoxin reductase (TrxR), which is a potential target for cancer chemotherapy with redox balance and antioxidant functions. Compounds 6 and 7 exhibited stronger activity (IC 50 : 23.4 and 10.6 μM, respectively) than the positive control, curcumin (IC 50  = 25.0 μM). Compounds 2-9 were isolated from J. multifida for the first time.

  11. Enhanced biological activity of carotenoids stabilized by phenyl groups.

    Science.gov (United States)

    You, Ji Suk; Jeon, Sunhwa; Byun, Youn Jung; Koo, Sangho; Choi, Shin Sik

    2015-06-15

    Carotenoids are lipid soluble food ingredients with multifunction including antioxidant and anticancer activities. However, carotenoids are destructively oxidized upon reaction with radicals resulting in toxic effects on biological systems. Two synthetic carotenoids (BAS and BTS) containing the aromatic phenyl groups with a para-substituent (OMe and Me, respectively) at C-13 and C-13' position were prepared in order to overcome a structural instability of carotenoid. Both BAS and BTS exerted stronger radical scavenging activity than β-carotene in DPPH and ABTS assays. In particular, BTS significantly reduced in vivo ROS (reactive oxygen species) levels and improved body growth and reproduction of Caenorhabditiselegans. BTS has a great potential for the advanced and modified carotenoid material with stability leading to enhanced bioavailability. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  13. Activating transcription factor-3 (ATF3) functions as a tumor suppressor in colon cancer and is up-regulated upon heat-shock protein 90 (Hsp90) inhibition

    International Nuclear Information System (INIS)

    Hackl, Christina; Stoeltzing, Oliver; Lang, Sven A; Moser, Christian; Mori, Akira; Fichtner-Feigl, Stefan; Hellerbrand, Claus; Dietmeier, Wolfgang; Schlitt, Hans J; Geissler, Edward K

    2010-01-01

    Activating transcription factor-3 (ATF3) is involved in the complex process of cellular stress response. However, its exact role in cancer is discussed controversially because both tumor suppressive and oncogenic effects have been described. Here we followed-up on our previous observation that inhibition of Hsp90 may increase ATF3 expression and sought to determine the role of ATF3 in colon cancer. Regulation of ATF3 was determined in cancer cells using signaling inhibitors and a heat-shock protein-90 (Hsp90) antagonist. Human HCT116 cancer cells were stably transfected with an ATF3-shRNA or a luciferase-shRNA expression plasmid and alterations in cell motility were assessed in migration assays. The impact of ATF3 down-regulation on cancer growth and metastasis were investigated in a subcutaneous tumor model, a model of hepatic tumor growth and in a model of peritoneal carcinomatosis. Human colon cancer tissues were analyzed for ATF3 expression. The results show that therapeutic Hsp90 inhibition substantially up-regulates the expression of ATF3 in various cancer cells, including colon, gastric and pancreatic cancer. This effect was evident both in vitro and in vivo. RNAi mediated knock-down of ATF3 in HCT116 colon cancer cells significantly increased cancer cell migration in vitro. Moreover, in xenogenic mouse models, ATF3 knock-down promoted subcutaneous tumor growth and hepatic metastasis, as well as peritoneal carcinomatosis. Importantly, ATF3 expression was lower in human colon cancer specimens, as compared to corresponding normal surrounding tissues, suggesting that ATF3 may represent a down-regulated tumor suppressor in colon cancer. In conclusion, ATF3 down-regulation in colon cancer promotes tumor growth and metastasis. Considering that blocking Hsp90 induces ATF3 expression, Hsp90 inhibition may represent a valid strategy to treat metastatic colon cancer by up-regulating this anti-metastatic transcription factor

  14. Cortical effect of oxaliplatin associated with sustained neuropathic pain: exacerbation of cortical activity and down-regulation of potassium channel expression in somatosensory cortex.

    Science.gov (United States)

    Thibault, Karine; Calvino, Bernard; Dubacq, Sophie; Roualle-de-Rouville, Marie; Sordoillet, Vallier; Rivals, Isabelle; Pezet, Sophie

    2012-08-01

    Oxaliplatin is a third-generation platinum-based chemotherapy drug that has gained importance in the treatment of advanced metastatic colorectal cancer. Its dose-limiting side effect is the production of chronic peripheral neuropathy. Using a modified model of oxaliplatin-induced sensory neuropathy, we investigated plastic changes at the cortical level as possible mechanisms underlying the chronicity of pain sensation in this model. Changes in gene expression were studied using DNA microarray which revealed that when oxaliplatin-treated animals displayed clinical neuropathic pain symptoms, including mechanical and thermal hypersensitivity, approximately 900 were down-regulated in the somatosensory cortex. Because of the known role of potassium channels in neuronal excitability, the study further focussed on the down-regulation of these channels as the possible molecular origin of cortical hyperexcitability. Quantification of the magnitude of neuronal extracellular signal-regulated kinase (ERK) phosphorylation in cortical neurons as a marker of neuronal activity revealed a 10-fold increase induced by oxaliplatin treatment, suggesting that neurons of cortical areas involved in transmission of painful stimuli undergo a chronic cortical excitability. We further demonstrated, using cortical injection of lentiviral vector shRNA against Kv2.2, that down-regulation of this potassium channel in naive animals induced a sustained thermal and mechanical hypersensitivity. In conclusion, although the detailed mechanisms leading to this cortical excitability are still unknown, our study demonstrated that a cortical down regulation of potassium channels could underlie pain chronicity in this model of chemotherapy-induced neuropathic pain. Copyright © 2012 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  15. Active particles

    CERN Document Server

    Degond, Pierre; Tadmor, Eitan

    2017-01-01

    This volume collects ten surveys on the modeling, simulation, and applications of active particles using methods ranging from mathematical kinetic theory to nonequilibrium statistical mechanics. The contributing authors are leading experts working in this challenging field, and each of their chapters provides a review of the most recent results in their areas and looks ahead to future research directions. The approaches to studying active matter are presented here from many different perspectives, such as individual-based models, evolutionary games, Brownian motion, and continuum theories, as well as various combinations of these. Applications covered include biological network formation and network theory; opinion formation and social systems; control theory of sparse systems; theory and applications of mean field games; population learning; dynamics of flocking systems; vehicular traffic flow; and stochastic particles and mean field approximation. Mathematicians and other members of the scientific commu...

  16. Culture but not gender modulates amygdala activation during explicit emotion recognition

    Directory of Open Access Journals (Sweden)

    Derntl Birgit

    2012-05-01

    Full Text Available Abstract Background Mounting evidence indicates that humans have significant difficulties in understanding emotional expressions from individuals of different ethnic backgrounds, leading to reduced recognition accuracy and stronger amygdala activation. However, the impact of gender on the behavioral and neural reactions during the initial phase of cultural assimilation has not been addressed. Therefore, we investigated 24 Asians students (12 females and 24 age-matched European students (12 females during an explicit emotion recognition task, using Caucasian facial expressions only, on a high-field MRI scanner. Results Analysis of functional data revealed bilateral amygdala activation to emotional expressions in Asian and European subjects. However, in the Asian sample, a stronger response of the amygdala emerged and was paralleled by reduced recognition accuracy, particularly for angry male faces. Moreover, no significant gender difference emerged. We also observed a significant inverse correlation between duration of stay and amygdala activation. Conclusion In this study we investigated the “alien-effect” as an initial problem during cultural assimilation and examined this effect on a behavioral and neural level. This study has revealed bilateral amygdala activation to emotional expressions in Asian and European females and males. In the Asian sample, a stronger response of the amygdala bilaterally was observed and this was paralleled by reduced performance, especially for anger and disgust depicted by male expressions. However, no gender difference occurred. Taken together, while gender exerts only a subtle effect, culture and duration of stay as well as gender of poser are shown to be relevant factors for emotion processing, influencing not only behavioral but also neural responses in female and male immigrants.

  17. Preparation of the different derivatives of the low-molecular-weight porphyran from Porphyra haitanensis and their antioxidant activities in vitro.

    Science.gov (United States)

    Zhang, Zhongshan; Zhang, Quanbin; Wang, Jing; Zhang, Hong; Niu, Xizhen; Li, Pengcheng

    2009-07-01

    Porphyran extracted from Porphyra haitanensis is a sulfated polysaccharide, which possesses excellent antioxidant activities. In this study, we prepared one low-molecular-weight porphyran and its sulfated, acetylated, phosphorylated and benzoylated derivatives. Their antioxidant activities were investigated including scavenging effect of superoxide, hydroxyl and 1,1-diphenyl-2-picrylhydrazyl radicals. The results of chemical analysis and FT-IR spectrums showed the modification was successful. And in addition, we found that certain derivative exhibited stronger antioxidant activity than low-molecular-weight porphyran. The benzoylated derivative showed the most excellent antioxidant activity in three assays, so this derivative needs to be attended to.

  18. Antiradical, Chelating and Antioxidant Activities of Hydroxamic Acids and Hydroxyureas

    Directory of Open Access Journals (Sweden)

    Branka Zorc

    2011-07-01

    Full Text Available Reactive oxygen species, along with reactive nitrogen species, may play an important role in the pathogenesis and progress of many diseases, including cancer, diabetes and sickle cell disease. It has been postulated that hydroxyurea, one of the main treatments in sickle cell disease, achieves its activity partly also through its antioxidant properties. A series of hydroxyurea derivatives of L- and D-amino acid amides and cycloalkyl-N-aryl-hydroxamic acids was synthesized and investigated for their radical scavenging activity, chelating properties and antioxidant activity. All the compounds showed exceptional antiradical activities. For example, free radical scavenging activities of investigated hydroxyureas were higher than the activity of standard antioxidant, butylated hydroxyanisole (BHA. Moreover, most of the investigated hydroxamic acids were stronger Fe2+ ion chelators than quercetin. In addition, the investigated compounds, especially hydroxamic acids, were proven to be excellent antioxidants. They were as effective as BHA in inhibiting b-carotene-linoleic acid coupled oxidation. It is reasonable to assume that the antioxidant activity of the investigated compounds could contribute to their previously proven biological properties as cytostatic and antiviral agents.

  19. Corticokinematic coherence during active and passive finger movements.

    Science.gov (United States)

    Piitulainen, H; Bourguignon, M; De Tiège, X; Hari, R; Jousmäki, V

    2013-05-15

    Corticokinematic coherence (CKC) refers to coupling between magnetoencephalographic (MEG) brain activity and hand kinematics. For voluntary hand movements, CKC originates mainly from the primary sensorimotor (SM1) cortex. To learn about the relative motor and sensory contributions to CKC, we recorded CKC from 15 healthy subjects during active and passive right index-finger movements. The fingertip was either touching or not touching table, resulting in active-touch, active-no-touch, passive-touch, and passive-no-touch conditions. The kinematics of the index-finger was measured with a 3-axis accelerometer. Beamformer analysis was used to locate brain activations for the movements; somatosensory-evoked fields (SEFs) elicited by pneumatic tactile stimulation of the index finger served as a functional landmark for cutaneous input. All active and passive movements resulted in statistically significant CKC at the movement frequency (F0) and its first harmonic (F1). The main CKC sources at F0 and F1 were in the contralateral SM1 cortex with no spatial differences between conditions, and distinct from the SEF sources. At F1, the coherence was by two thirds stronger for passive than active movements, with no difference between touch vs. no-touch conditions. Our results suggest that the CKC occurring during repetitive finger movements is mainly driven by somatosensory, primarily proprioceptive, afferent input to the SM1 cortex, with negligible effect of cutaneous input. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  20. Structure-activity relationships of diverse xanthones against multidrug resistant human tumor cells.

    Science.gov (United States)

    Wang, Qiwen; Ma, Chenyao; Ma, Yun; Li, Xiang; Chen, Yong; Chen, Jianwei

    2017-02-01

    Thirteen xanthones were isolated naturally from the stem of Securidaca inappendiculata Hassk, and structure-activity relationships (SARs) of these compounds were comparatively predicted for their cytotoxic activity against three human multidrug resistant (MDR) cell lines MCF-7/ADR, SMMC-7721/Taxol, and A549/Taxol cells. The results showed that the selected xanthones exhibited different potent cytotoxic activity against the growth of different human tumor cell lines, and most of the xanthones exhibited selective cytotoxicity against SMMC-7721/Taxol cells. Furthermore, some tested xanthones showed stronger cytotoxicity than Cisplatin, which has been used in clinical application extensively. The SARs analysis revealed that the cytotoxic activities of diverse xanthones were affected mostly by the number and position of methoxyl and hydroxyl groups. Xanthones with more free hydroxyl and methoxyl groups increased the cytotoxic activity significantly, especially for those with the presence of C-3 hydroxyl and C-4 methoxyl groups. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Relation between physical activity and academic performance in 3rd-year secondary education students.

    Science.gov (United States)

    Morales, José; Pellicer-Chenoll, Maite; García-Masso, Xavier; Gomis, Manuel; González, Luis-Millán

    2011-10-01

    The main aim of this study was to analyze the relationship between the amount of physical activity and academic performance in 3rd-year secondary education students. The sample was taken from three secondary schools in the area of Barcelona. 284 students (158 girls, 126 boys) with an average age of 14.7 yr. participated. The International Physical Activity Questionnaire was used by students to self-report their amount of physical activity. Students' academic records were obtained for comparisons. Results showed that there was a linear relationship between academic performance and physical activity; nevertheless, there was a trend to stronger correlation when modeling the relationship between these variables with a quadratic equation. Further research should focus on whether academic performance and physical activity might be better explained with a second-order equation.

  2. [The significance of extracurricular activities in the life of junior high school students].

    Science.gov (United States)

    Sumiya, S; Muto, T

    2001-06-01

    In this study, the significance of extracurricular activities in the life of junior high school students were examined. Seventh and eighth graders participated in a two-stage questionnaire survey, administered in May and October. Based on developmental stage-environment fit theory (Eccles, Wigfield, & Schiefele, 1998), how well extracurricular activity settings fit needs of the students was analyzed. In support of the theory's hypothesis, results indicated that whether an extracurricular activity satisfied the student's developmental needs affected his/her sense of fulfillment and satisfaction in school life. In addition, the effect of seventh graders' commitment to extracurricular activities on their satisfaction of school life was stronger in October than in May. The findings suggested that for students who felt uneasy in class for whatever reasons, extracurricular activities provided an opportunity for relief.

  3. ANTIMICROBIAL ACTIVITY OF COPPER(II COMPLEXES

    Directory of Open Access Journals (Sweden)

    Andrea Čongrádyová

    2014-02-01

    Full Text Available Two novel copper(II 5-chlorosalicylate complexes with either 1,10-phenantroline or its methyl derivative 2,9-dimethyl-1,10-phenanthroline (neocuproine have been prepared and studied. A potential antimicrobial or antifungal activity of both complexes has been tested on prokaryotic Escherichia coli and eukaryotic Saccharomyces cerevisiae model organisms. Crystal structure of [Cu(phen(5-Clsal(5-ClsalH2]2 a dimeric structure, whereas the second complex of formula [Cu(H2O(5-Clsal(Neo] has been shown to be monomeric. Our results confirmed the toxic effect of prepared copper complexes as well as bioactive ligands on the yeast and bacteria growth. The effect of copper complexes was stronger compared to the solutions of free ligands. Our preliminary results showed that the complex [Cu(H2O(5-Clsal(Neo] exhibited higher antimicrobial activity compared to the complex [Cu(phen(5-Clsal(5-ClsalH2]2.

  4. Activation analysis

    International Nuclear Information System (INIS)

    Beeck, J. OP de

    1977-01-01

    It is shown that activation analysis is especially suited to serve as a basis for determining the chemical similarity between samples defined by their trace-element concentration patterns. The general problem of classification and identification is discussed. The nature of possible classification structures and their appropriate clustering strategies is considered. A practical computer method is suggested and its application as well as the graphical representation of classification results are given. The possibility for classification using information theory is mentioned. Classification of chemical elements is discussed and practically realized after Hadamard transformation of the concentration variation patterns in a series of samples. (Sz.N.Z.)

  5. Chocolate active

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    There is a table of current radioactivity values for various foods and mushrooms. A special accent is on milk and chocolate. Chocolate sorts with more powdered milk are more active. Finally there is a chapter on radionucleides contained in the Chernobyl fallout, other than cesium 137, cesium 134 and strontium 90. The amounts of ruthenium 106, antimony 125, cerium 144, silver 110 m, cesium 134, strontium 90 and plutonium 239 relative to cesium 137 in soil samples in autumn 1987 are given. Special emphasis is on ruthenium 'hot particles' and on plutonium. (qui)

  6. Antibacterial and anti-PAF activity of lipid extracts from sea bass (Dicentrarchus labrax) and gilthead sea bream (Sparus aurata).

    Science.gov (United States)

    Nasopoulou, Constantina; Karantonis, Haralabos C; Andriotis, Michalis; Demopoulos, Constantinos A; Zabetakis, Ioannis

    2008-11-15

    The anti-PAF and the antibacterial activities of lipid extracts obtained from cultured sea bass (Dicentrarchus labrax) and cultured gilthead sea bream (Sparus aurata) were evaluated. Total lipids of sea bass and gilthead sea bream exerted PAF-like activity while, in higher amounts they inhibited this PAF activity. Neutral lipids of both sea bass and gilthead sea bream contained only PAF antagonists while the polar lipid fractions contained both PAF antagonists and agonists. Total lipids of sea bass exhibited stronger PAF-like activity than did those of gilthead sea bream; however, neutral lipids of sea bass contained stronger PAF antagonists than did gilthead sea bream. Total lipids of both sea bass and gilthead sea bream exhibited antibacterial activity only towards Staphylococcus aureus (S. aureus) with those of sea bass being more potent. Subsequently, neutral lipids of both sea bass and gilthead sea bream also showed antibacterial activity against S. aureus and less so towards Escherichia coli (E. coli), while only neutral lipids of sea bass showed antibacterial activity against Enterococcusfaecalis (E. faecalis). Sea bass neutral lipids were more active against S. aureus than were those of gilthead sea bream, while their activity towards E. coli was similar. Polar lipids of both sea bass and gilthead sea bream showed antibacterial activity against all bacteria strains. Sea bass polar lipids were more active towards S. aureus than were those of gilthead sea bream, while their activities against E. faecalis and E. coli were the same. The detected antibacterial activities of the lipid extracts isolated from sea bass and gilthead sea bream were observed in amounts equal to those that exerted either PAF inhibition or PAF-like activity, suggesting that PAF antagonists and agonists of fish lipids may be responsible for the antibacterial activity. Copyright © 2008 Elsevier Ltd. All rights reserved.

  7. PGE2 promotes breast cancer-associated lymphangiogenesis by activation of EP4 receptor on lymphatic endothelial cells.

    Science.gov (United States)

    Nandi, Pinki; Girish, Gannareddy V; Majumder, Mousumi; Xin, Xiping; Tutunea-Fatan, Elena; Lala, Peeyush K

    2017-01-05

    Lymphatic metastasis, facilitated by lymphangiogenesis is a common occurrence in breast cancer, the molecular mechanisms remaining incompletely understood. We had earlier shown that cyclooxygenase (COX)-2 expression by human or murine breast cancer cells promoted lymphangiogenesis and lymphatic metastasis by upregulating VEGF-C/D production by tumor cells or tumor-associated macrophages primarily due to activation of the prostaglandin receptor EP4 by endogenous PGE2. It is not clear whether tumor or host-derived PGE2 has any direct effect on lymphangiogenesis, and if so, whether EP4 receptors on lymphatic endothelial cells (LEC) play any role. Here, we address these questions employing in vitro studies with a COX-2-expressing and VEGF-C/D-producing murine breast cancer cell line C3L5 and a rat mesenteric (RM) LEC line and in vivo studies in nude mice. RMLEC responded to PGE2, an EP4 agonist PGE1OH, or C3L5 cell-conditioned media (C3L5-CM) by increased proliferation, migration and accelerated tube formation on growth factor reduced Matrigel. Native tube formation by RMLEC on Matrigel was abrogated in the presence of a selective COX-2 inhibitor or an EP4 antagonist. Addition of PGE2 or EP4 agonist, or C3L5-CM individually in the presence of COX-2 inhibitor, or EP4 antagonist, restored tube formation, reinforcing the role of EP4 on RMLEC in tubulogenesis. These results were partially duplicated with a human dermal LEC (HMVEC-dLyAd) and a COX-2 expressing human breast cancer cell line MDA-MB-231. Knocking down EP4 with shRNA in RMLEC abrogated their tube forming capacity on Matrigel in the absence or presence of PGE2, EP4 agonist, or C3L5-CM. RMLEC tubulogenesis following EP4 activation by agonist treatment was dependent on PI3K/Akt and Erk signaling pathways and VEGFR-3 stimulation. Finally in a directed in vivo lymphangiogenesis assay (DIVLA) we demonstrated the lymphangiogenic as well as angiogenic capacity of PGE2 and EP4 agonist in vivo. These results demonstrate

  8. Activity levels in mothers and their preschool children.

    Science.gov (United States)

    Hesketh, Kathryn R; Goodfellow, Laura; Ekelund, Ulf; McMinn, Alison M; Godfrey, Keith M; Inskip, Hazel M; Cooper, Cyrus; Harvey, Nicholas C; van Sluijs, Esther M F

    2014-04-01

    To investigate the association between objectively measured maternal and preschool-aged children's physical activity, determine how this association differs by demographic and temporal factors, and identify factors associated with maternal activity levels. In the UK Southampton Women's Survey, physical activity levels of 554 4-year-olds and their mothers were measured concurrently by using accelerometry for ≤7 days. Two-level mixed-effects linear regression was used to model the association between maternal and children's minutes spent sedentary, in light (LPA) and moderate-to-vigorous physical activity (MVPA). Linear regression was used to investigate correlates of maternal activity. Mother-child daily activity levels were positively associated at all activity intensities (sedentary, LPA, and MVPA; all P children (versus those who were overweight/obese), and those attending preschool part-time (versus full-time). The mother-child association for LPA differed by maternal education and was stronger at the weekend (versus weekdays). The opposite was true for MVPA. Sedentary time and MVPA were most strongly associated in mornings, with LPA most strongly associated in the evenings. Maternal BMI, age leaving school, number and age of children at home, and working hours were independently associated with maternal daily sedentary time and LPA. Physical activity levels in mothers and their 4-year-old children are directly associated, with associations at different activity intensities influenced by temporal and demographic factors. Influences on maternal physical activity levels also differ by activity intensity. Providing targeted interventions for mothers of young children may increase both groups' activity.

  9. URG4/URGCP enhances the angiogenic capacity of human hepatocellular carcinoma cells in vitro via activation of the NF-κB signaling pathway

    International Nuclear Information System (INIS)

    Xing, Sizhong; Zhang, Bing; Hua, Ruixi; Tai, William Chi-shing; Zeng, Zhirong; Xie, Binhui; Huang, Chenghui; Xue, Jisu; Xiong, Shiqiu; Yang, Jianyong; Liu, Side; Li, Heping

    2015-01-01

    Angiogenesis is essential for tumor growth. Hepatocellular carcinoma (HCC) is characterized by hypervascularity; high levels of angiogenesis are associated with poor prognosis and a highly invasive phenotype in HCC. Up-regulated gene-4 (URG4), also known as upregulator of cell proliferation (URGCP), is overexpressed in multiple tumor types and has been suggested to act as an oncogene. This study aimed to elucidate the effect of URG4/URGCP on the angiogenic capacity of HCC cells in vitro. Expression of URG4/URGCP in HCC cell lines and normal liver epithelial cell lines was examined by Western blotting and quantitative real-time PCR. URG4/URGCP was stably overexpressed or transiently knocked down using a shRNA in two HCC cell lines. The human umbilical vein endothelial cell (HUVEC) tubule formation and Transwell migration assays and chicken chorioallantoic membrane (CAM) assay were used to examine the angiogenic capacity of conditioned media from URG4/URGCP-overexpressing and knockdown cells. A luciferase reporter assay was used to examine the transcriptional activity of nuclear factor kappa – light – chain - enhancer of activated B cells (NF-κB). NF-κB was inhibited by overexpressing degradation-resistant mutant inhibitor of κB (IκB)-α. Expression of vascular endothelial growth factor C (VEGFC), tumor necrosis factor-α (TNFα), interleukin (IL)-6, IL-8 and v-myc avian myelocytomatosis viral oncogene homolog (MYC) were examined by quantitative real-time PCR; VEGFC protein expression was analyzed using an ELISA. URG4/URGCP protein and mRNA expression were significantly upregulated in HCC cell lines. Overexpressing URG4/URGCP enhanced - while silencing URG4/URGCP decreased - the capacity of HCC cell conditioned media to induce HUVEC tubule formation and migration and neovascularization in the CAM assay. Furthermore, overexpressing URG4/URGCP increased - whereas knockdown of URG4/URGCP decreased - VEGFC expression, NF-κB transcriptional activity, the levels

  10. Theory of corticothalamic brain activity in a spherical geometry: Spectra, coherence, and correlation

    Science.gov (United States)

    Mukta, K. N.; MacLaurin, J. N.; Robinson, P. A.

    2017-11-01

    Corticothalamic neural field theory is applied to a spherical geometry to better model neural activity in the human brain and is also compared with planar approximations. The frequency power spectrum, correlation, and coherence functions are computed analytically and numerically. The effects of cortical boundary conditions and resulting modal aspects of spherical corticothalamic dynamics are explored, showing that the results of spherical and finite planar geometries converge to those for the infinite planar geometry in the limit of large brain size. Estimates are made of the point at which modal series can be truncated and it is found that for physiologically plausible parameters only the lowest few spatial eigenmodes are needed for an accurate representation of macroscopic brain activity. A difference between the geometries is that there is a low-frequency 1 /f spectrum in the infinite planar geometry, whereas in the spherical geometry it is 1 /f2 . Another difference is that the alpha peak in the spherical geometry is sharper and stronger than in the planar geometry. Cortical modal effects can lead to a double alpha peak structure in the power spectrum, although the main determinant of the alpha peak is corticothalamic feedback. In the spherical geometry, the cross spectrum between two points is found to only depend on their relative distance apart. At small spatial separations the low-frequency cross spectrum is stronger than for an infinite planar geometry and the alpha peak is sharper and stronger due to the partitioning of the energy into discrete modes. In the spherical geometry, the coherence function between points decays monotonically as their separation increases at a fixed frequency, but persists further at resonant frequencies. The correlation between two points is found to be positive, regardless of the time lag and spatial separation, but decays monotonically as the separation increases at fixed time lag. At fixed distance the correlation has peaks

  11. Theory of corticothalamic brain activity in a spherical geometry: Spectra, coherence, and correlation.

    Science.gov (United States)

    Mukta, K N; MacLaurin, J N; Robinson, P A

    2017-11-01

    Corticothalamic neural field theory is applied to a spherical geometry to better model neural activity in the human brain and is also compared with planar approximations. The frequency power spectrum, correlation, and coherence functions are computed analytically and numerically. The effects of cortical boundary conditions and resulting modal aspects of spherical corticothalamic dynamics are explored, showing that the results of spherical and finite planar geometries converge to those for the infinite planar geometry in the limit of large brain size. Estimates are made of the point at which modal series can be truncated and it is found that for physiologically plausible parameters only the lowest few spatial eigenmodes are needed for an accurate representation of macroscopic brain activity. A difference between the geometries is that there is a low-frequency 1/f spectrum in the infinite planar geometry, whereas in the spherical geometry it is 1/f^{2}. Another difference is that the alpha peak in the spherical geometry is sharper and stronger than in the planar geometry. Cortical modal effects can lead to a double alpha peak structure in the power spectrum, although the main determinant of the alpha peak is corticothalamic feedback. In the spherical geometry, the cross spectrum between two points is found to only depend on their relative distance apart. At small spatial separations the low-frequency cross spectrum is stronger than for an infinite planar geometry and the alpha peak is sharper and stronger due to the partitioning of the energy into discrete modes. In the spherical geometry, the coherence function between points decays monotonically as their separation increases at a fixed frequency, but persists further at resonant frequencies. The correlation between two points is found to be positive, regardless of the time lag and spatial separation, but decays monotonically as the separation increases at fixed time lag. At fixed distance the correlation has peaks

  12. Halal Activism

    DEFF Research Database (Denmark)

    Fischer, Johan

    2016-01-01

    zones between new forms of Islamic revivalism, the ethnicised state and Muslim consumer culture. Organisations such as the Muslim Consumers Association of Malaysia play an important role in pushing and protecting halal in Malaysia, that is, halal activists constantly call on the state to tighten halal......The purpose of this article is to further our understanding of contemporary Muslim consumer activism in Malaysia with a particular focus on halal (in Arabic, literally “permissible” or “lawful”) products and services. Muslim activists and organisations promote halal on a big scale in the interface...... in particular historical/national settings and that these issues should be explored in the interfaces between Islam, the state and market. More specifically, this article examines the above issues building on ethnography from fieldwork with three Muslim organisations in Malaysia....

  13. Could strength of exposure to the residential neighbourhood modify associations between walkability and physical activity?

    Science.gov (United States)

    Ivory, Vivienne C; Blakely, Tony; Pearce, Jamie; Witten, Karen; Bagheri, Nasser; Badland, Hannah; Schofield, Grant

    2015-12-01

    The importance of neighbourhoods for health and wellbeing may vary according to an individual's reliance on their local resources, but this assertion is rarely tested. We investigate whether greater neighbourhood 'exposure' through reliance on or engagement with the residential setting magnifies neighbourhood-health associations. Three built environment characteristics (destination density, streetscape (attractiveness of built environment) and street connectivity) and two physical activity components (weekday and weekend accelerometer counts) were measured for 2033 residents living in 48 neighbourhoods within four New Zealand cities in 2009-2010, giving six different built environment-physical activity associations. Interactions for each built environment-physical activity association with four individual-level characteristics (acting as proxies for exposure: gender, working status, car access, and income) were assessed with multi-level regression models; a total of 24 'tests'. Of the 12 weekday built environment-physical activity tests, 5 interaction terms were significant (p < 0.05) in the expected direction (e.g. stronger streetscape-physical activity among those with restricted car access). For weekend tests, one association was statistically significant. No significant tests were contradictory. Pooled across the 12 weekday physical activity 'tests', a 1 standard deviation increase in the walkability of the built environment was associated with an overall 3.8% (95% CI: 3.6%-4.1%) greater increase in weekday physical activity across all the types of people we hypothesised to spend more time in their residential neighbourhood, and for weekend physical activity it was 4.2% (95% CI 3.9%-4.5%). Using multiple evaluation methods, interactions were in line with our hypothesis, with a stronger association seen for proxy exposure indicators (for example, restricted car access). Added to the wider evidence base, our study strengthens causal evidence of an effect of the

  14. Gritty people try harder: grit and effort-related cardiac autonomic activity during an active coping challenge.

    Science.gov (United States)

    Silvia, Paul J; Eddington, Kari M; Beaty, Roger E; Nusbaum, Emily C; Kwapil, Thomas R

    2013-05-01

    Grit, a recently proposed personality trait associated with persistence for long-range goals, predicts achievement in a wide range of important life outcomes. Using motivational intensity theory, the present research examined the physiological underpinnings of grit during an active coping task. Forty young adults completed the Short Grit Scale and worked on a self-paced mental effort task. Effort-related autonomic nervous system (ANS) activity was assessed using impedance cardiography, which yielded measures of sympathetic activity (pre-ejection period; PEP) and parasympathetic activity (respiratory sinus arrhythmia; RSA). Multilevel models revealed that people high on the Perseverance of Effort subscale showed autonomic coactivation: both PEP and RSA became stronger during the task, reflecting higher activity of both ANS divisions. The Consistency of Interest subscale, in contrast, predicted only weaker sympathetic activity (slower PEP). Taken together, the findings illuminate autonomic processes associated with how "gritty" people pursue goals, and they suggest that more attention should be paid to the facets' distinct effects. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. What propels sexual murderers: a proposed integrated theory of social learning and routine activities theories.

    Science.gov (United States)

    Chan, Heng Choon Oliver; Heide, Kathleen M; Beauregard, Eric

    2011-04-01

    Despite the great interest in the study of sexual homicide, little is known about the processes involved in an individual's becoming motivated to sexually kill, deciding to sexually kill, and acting on that desire, intention, and opportunity. To date, no comprehensive model of sexual murdering from the offending perspective has been proposed in the criminological literature. This article incorporates the works of Akers and Cohen and Felson regarding their social learning theory and routine activities theory, respectively, to construct an integrated conceptual offending framework in sexual homicide. This integrated model produces a stronger and more comprehensive explanation of sexual murder than any single theory currently available.

  16. Meridional Flow Variations in Cycles 23 and 24: Active Latitude Control of Sunspot Cycle Amplitudes

    Science.gov (United States)

    Hathaway, David H.; Upton, Lisa

    2013-01-01

    We have measured the meridional motions of magnetic elements observed in the photosphere over sunspot cycles 23 and 24 using magnetograms from SOHO/MDI and SDO/HMI. Our measurements confirm the finding of Komm, Howard, and Harvey (1993) that the poleward meridional flow weakens at cycle maxima. Our high spatial and temporal resolution analyses show that this variation is in the form of a superimposed inflow toward the active latitudes. This inflow is weaker in cycle 24 when compared to the inflow in 23, the stronger cycle. This systematic modulation of the meridional flow can modulate the amplitude of the following sunspot cycle through its influence on the Sun's polar fields.

  17. Ras activation and symmetry breaking during Dictyostelium chemotaxis.

    Science.gov (United States)

    Kortholt, Arjan; Keizer-Gunnink, Ineke; Kataria, Rama; Van Haastert, Peter J M

    2013-10-01

    Central to chemotaxis is the molecular mechanism by which a shallow spatial gradient of chemoattractant induces symmetry breaking of activated signaling molecules. Previously, we have used Dictyostelium mutants to investigate the minimal requirements for chemotaxis, and identified a basal signaling module providing activation of Ras and F-actin at the leading edge. Here, we show that Ras activation after application of a pipette releasing the chemoattractant cAMP has three phases, each depending on specific guanine-nucleotide-exchange factors (GEFs). Initially a transient activation of Ras occurs at the entire cell boundary, which is proportional to the local cAMP concentrations and therefore slightly stronger at the front than in the rear of the cell. This transient Ras activation is present in gα2 (gpbB)-null cells but not in gβ (gpbA)-null cells, suggesting that Gβγ mediates the initial activation of Ras. The second phase is symmetry breaking: Ras is activated only at the side of the cell closest to the pipette. Symmetry breaking absolutely requires Gα2 and Gβγ, but not the cytoskeleton or four cAMP-induced signaling pathways, those dependent on phosphatidylinositol (3,4,5)-triphosphate [PtdIns(3,4,5)P3], cGMP, TorC2 and PLA2. As cells move in the gradient, the crescent of activated Ras in the front half of the cell becomes confined to a small area at the utmost front of the cell. Confinement of Ras activation leads to cell polarization, and depends on cGMP formation, myosin and F-actin. The experiments show that activation, symmetry breaking and confinement of Ras during Dictyostelium chemotaxis uses different G-protein subunits and a multitude of Ras GEFs and GTPase-activating proteins (GAPs).

  18. Antioxidant activity of amino acids in soybean oil at frying temperature: Structural effects and synergism with tocopherols.

    Science.gov (United States)

    Hwang, Hong-Sik; Winkler-Moser, Jill K

    2017-04-15

    The purpose of this study was to evaluate amino acids as natural antioxidants for frying. Twenty amino acids were added to soybean oil heated to 180°C, and the effects of amino acid structure on the antioxidant activity were investigated. Amino acids containing a thiol, a thioether, or an extra amine group such as arginine, cysteine, lysine, methionine, and tryptophan had the strongest antioxidant activities. At 5.5mM, these amino acids had stronger antioxidant activities than 0.02% (1.1mM) tert-butylhydroquinone (TBHQ). A functional group such as an amide, carboxylic acid, imidazole, or phenol appeared to negatively affect amino acid antioxidant activity. Synergism between amino acids and tocopherols was demonstrated, and we found that this synergistic interaction may be mostly responsible for the antioxidant activity that was observed. In a frying study with potato cubes, 5.5mM l-methionine had significantly stronger antioxidant activity than 0.02% TBHQ. Published by Elsevier Ltd.

  19. Position in Educational Activity and Empathy Ability in Adolescence and Teenage Years

    Directory of Open Access Journals (Sweden)

    Klimenkova E.N.

    2017-11-01

    Full Text Available The article is devoted to the study of the relationship between empathy and learning activity position in adolescence and young. We present the results of empirical research of 78 assisting professions students (psychologists and teachers and 42 Polytechnic College students with the techniques of studying empathic abilities (questionnaire of the Interpersonal Reactivity Index of M. Davis in the adaptation of TD Karyagina, projective technique "Consolation Strategies" Vasiluk and EV Sheryagina, processing in the modification of AB Kholmogorova, and the the subject position (the questionnaire "Subject Position in studying activity" by Yu.V. Zaretsky and V.K. Zaretsky. Students less likely to use emotional support, the objective position is more clearly expressed and less subjective in relation to learning activity. Subjects with a subjective learning activity position have stronger empathy, perspective taking and the ability to provide support. Subjects with a subject position often use emotional support.

  20. Active sharing

    CERN Multimedia

    2012-01-01

    The big news this week is, of course, the conclusions from the LHC performance workshop held in Chamonix from 6 to 10 February . The main recommendation, endorsed by CERN’s Machine Advisory Committee and adopted by the Management, is that the LHC will run at 4 TeV per beam this year. You can find all the details from Chamonix in the slides presented on Wednesday at the summary session, which leaves me free to talk about another important development coming up soon.   In ten days time, a new kind of gathering will be taking place in Geneva, bringing together two previously separate conferences, one driven by physics, the other by the medical community, but both looking to apply physics to the advancement of health. The merger of the International Conference for Translational Research in Radio-Oncology and CERN’s workshop on Physics for Health in Europe (ICTR-PHE) makes for a very eclectic mix. Presentations range from active shielding for interplanetary flight to the rather...

  1. PARP-1 depletion in combination with carbon ion exposure significantly reduces MMPs activity and overall increases TIMPs expression in cultured HeLa cells

    International Nuclear Information System (INIS)

    Ghorai, Atanu; Sarma, Asitikantha; Chowdhury, Priyanka; Ghosh, Utpal

    2016-01-01

    Hadron therapy is an innovative technique where cancer cells are precisely killed leaving surrounding healthy cells least affected by high linear energy transfer (LET) radiation like carbon ion beam. Anti-metastatic effect of carbon ion exposure attracts investigators into the field of hadron biology, although details remain poor. Poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors are well-known radiosensitizer and several PARP-1 inhibitors are in clinical trial. Our previous studies showed that PARP-1 depletion makes the cells more radiosensitive towards carbon ion than gamma. The purpose of the present study was to investigate combining effects of PARP-1 inhibition with carbon ion exposure to control metastatic properties in HeLa cells. Activities of matrix metalloproteinases-2, 9 (MMP-2, MMP-9) were measured using the gelatin zymography after 85 MeV carbon ion exposure or gamma irradiation (0- 4 Gy) to compare metastatic potential between PARP-1 knock down (HsiI) and control cells (H-vector - HeLa transfected with vector without shRNA construct). Expression of MMP-2, MMP-9, tissue inhibitor of MMPs such as TIMP-1, TIMP-2 and TIMP-3 were checked by immunofluorescence and western blot. Cell death by trypan blue, apoptosis and autophagy induction were studied after carbon ion exposure in each cell-type. The data was analyzed using one way ANOVA and 2-tailed paired-samples T-test. PARP-1 silencing significantly reduced MMP-2 and MMP-9 activities and carbon ion exposure further diminished their activities to less than 3 % of control H-vector. On the contrary, gamma radiation enhanced both MMP-2 and MMP-9 activities in H-vector but not in HsiI cells. The expression of MMP-2 and MMP-9 in H-vector and HsiI showed different pattern after carbon ion exposure. All three TIMPs were increased in HsiI, whereas only TIMP-1 was up-regulated in H-vector after irradiation. Notably, the expressions of all TIMPs were significantly higher in HsiI than H-vector at 4 Gy. Apoptosis was

  2. Cyclin T1-dependent genes in activated CD4 T and macrophage cell lines appear enriched in HIV-1 co-factors.

    Directory of Open Access Journals (Sweden)

    Wendong Yu

    2008-09-01

    Full Text Available HIV-1 is dependent upon cellular co-factors to mediate its replication cycle in CD4(+ T cells and macrophages, the two major cell types infected by the virus in vivo. One critical co-factor is Cyclin T1, a subunit of a general RNA polymerase II elongation factor known as P-TEFb. Cyclin T1 is targeted directly by the viral Tat protein to activate proviral transcription. Cyclin T1 is up-regulated when resting CD4(+ T cells are activated and during macrophage differentiation or activation, conditions that are also necessary for high levels of HIV-1 replication. Because Cyclin T1 is a subunit of a transcription factor, the up-regulation of Cyclin T1 in these cells results in the induction of cellular genes, some of which might be HIV-1 co-factors. Using shRNA depletions of Cyclin T1 and transcriptional profiling, we identified 54 cellular mRNAs that appear to be Cyclin T1-dependent for their induction in activated CD4(+ T Jurkat T cells and during differentiation and activation of MM6 cells, a human monocytic cell line. The promoters for these Cyclin T1-dependent genes (CTDGs are over-represented in two transcription factor binding sites, SREBP1 and ARP1. Notably, 10 of these CTDGs have been reported to be involved in HIV-1 replication, a significant over-representation of such genes when compared to randomly generated lists of 54 genes (p value<0.00021. The results of siRNA depletion and dominant-negative protein experiments with two CTDGs identified here, CDK11 and Casein kinase 1 gamma 1, suggest that these genes are involved either directly or indirectly in HIV-1 replication. It is likely that the 54 CTDGs identified here include novel HIV-1 co-factors. The presence of CTDGs in the protein space that was available for HIV-1 to sample during its evolution and acquisition of Tat function may provide an explanation for why CTDGs are enriched in viral co-factors.

  3. REX-1 expression and p38 MAPK activation status can determine proliferation/differentiation fates in human mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Dilli Ram Bhandari

    Full Text Available BACKGROUND: REX1/ZFP42 is a well-known embryonic stem cell (ESC marker. However, the role of REX1, itself, is relatively unknown because the function of REX1 has only been reported in the differentiation of ESCs via STAT signaling pathways. Human mesenchymal stem cells (hMSCs isolated from young tissues and cancer cells express REX1. METHODOLOGY/PRINCIPAL FINDING: Human umbilical cord blood-derived MSCs (hUCB-MSCs and adipose tissue-derived MSCs (hAD-MSCs strongly express REX1 and have a lower activation status of p38 MAPK, but bone marrow-derived MSCs (hBM-MSCs have weak REX1 expression and higher activation of p38 MAPK. These results indicated that REX1 expression in hMSCs was positively correlated with proliferation rates but inversely correlated with the phosphorylation of p38 MAPK. In hUCB-MSCs, the roles of REX1 and p38 MAPK were investigated, and a knockdown study was performed using a lentiviral vector-based small hairpin RNA (shRNA. After REX1 knockdown, decreased cell proliferation was observed. In REX1 knocked-down hUCB-MSCs, the osteogenic differentiation ability deteriorated, but the adipogenic potential increased or was similar to that observed in the controls. The phosphorylation of p38 MAPK in hUCB-MSCs significantly increased after REX1 knockdown. After p38 MAPK inhibitor treatment, the cell growth in REX1 knocked-down hUCB-MSCs almost recovered, and the suppressed expression levels of CDK2 and CCND1 were also restored. The expression of MKK3, an upstream regulator of p38 MAPK, significantly increased in REX1 knocked-down hUCB-MSCs. The direct binding of REX1 to the MKK3 gene was confirmed by a chromatin immunoprecipitation (ChIP assay. CONCLUSIONS/SIGNIFICANCE: These findings showed that REX1 regulates the proliferation/differentiation of hMSCs through the suppression of p38 MAPK signaling via the direct suppression of MKK3. Therefore, p38 MAPK and REX-1 status can determine the cell fate of adult stem cells (ASCs. These

  4. Emission activity of the Be star 60 Cygni

    Directory of Open Access Journals (Sweden)

    Šejnová K.

    2017-01-01

    Full Text Available In this paper we present results of spectroscopic analysis of the H® line profile of the Be star 60 Cygni. We present time evolution of the equivalent width of the H® line profiles during years 1992 - 2016 and V=R variation during years 1995 - 2016. We analyzed data from Ondřejov Observatory and from BeSS Database. The circumstellar disk of the star was present twice during years 1992 - 2016 and the second cycle shows stronger emission activity. We found out that the formation of the disk takes longer time than the disk extinction (the extinction is much steeper than the formation and that there is no evident period of changes in the V=R variation.

  5. Media Framing of Third Sector Activities in Europe

    DEFF Research Database (Denmark)

    Lund, Anker Brink; Lilleør, Anton Sylvest

    , an affinity between the media framing of different third sector fields and civil society roles is indicated. Advocacy is particularly emphasised in relation to environmental sustainability and community development. Service provision is stronger in relation to social services and healthcare. Please note...... of this kind. The media content analysis (section 2) summarizes the major trends in mediated discourse on third sector activities in the Czech Republic, Denmark, France, Germany, Italy, the Netherlands, Spain, Sweden and the United Kingdom 2003-2013. These tendencies are related to social innovation policy...... references to specific organizations and individuals performing advocacy and services provision on a non-profit basis. In the relatively few instances where social innovation policy in a more general sense is related to the third sector media coverage, the reporting is overwhelmingly loyal to government...

  6. Hepatitis C virus core protein potentiates proangiogenic activity of hepatocellular carcinoma cells.

    Science.gov (United States)

    Shao, Yu-Yun; Hsieh, Min-Shu; Wang, Han-Yu; Li, Yong-Shi; Lin, Hang; Hsu, Hung-Wei; Huang, Chung-Yi; Hsu, Chih-Hung; Cheng, Ann-Lii

    2017-10-17

    Increased angiogenic activity has been demonstrated in hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC), but the mechanism was unclear. To study the role of HCV core protein, we used tube formation and Matrigel plug assays to assess the proangiogenic activity of an HCC cell line, HuH7, and 2 of its stable clones-HuH7-core-high and HuH7-core-low, with high and low HCV core protein expression, respectively. In both assays, HuH7-core-high and HuH7-core-low cells dose-dependently induced stronger angiogenesis than control cells. HuH7 cells with HCV core protein expression showed increased mRNA and protein expression of vascular endothelial growth factor (VEGF). VEGF inhibition by bevacizumab reduced the proangiogenic activity of HuH7-core-high cells. The promotor region of VEGF contains the binding site of activator protein-1 (AP-1). Compared with controls, HuH7-core-high cells had an increased AP-1 activity and nuclear localization of phospho-c-jun. AP-1 inhibition using either RNA knockdown or AP-1 inhibitors reduced the VEGF mRNA expression and the proangiogenic activity of HuH7-core-high cells. Among 131 tissue samples from HCC patients, HCV-related HCC revealed stronger VEGF expression than did hepatitis B virus-related HCC. In conclusion, increased VEGF expression through AP-1 activation is a crucial mechanism underlying the proangiogenic activity of the HCV core protein in HCC cells.

  7. Bioactivity-guided isolation of polyacetylenes with inhibitory activity against NO production in LPS-activated RAW264.7 macrophages from the rhizomes of Atractylodes macrocephala.

    Science.gov (United States)

    Yao, Chun-Mei; Yang, Xiu-Wei

    2014-02-03

    The rhizome of Atractylodes macrocephala (Compositae) is one of the most well-known traditional Chinese medicine in China, Japan and Korea, which has a long history of use for the treatment of splenic asthenia, edema, anorexia, and excessive perspiration, etc. As active compounds of anti-inflammatory activity of this medicinal plant have not been fully elucidated, the aim of this study was to isolate and identify the active constituents inhibiting nitric oxide (NO) production from the rhizomes of A. macrocephala. Inhibitory activity against NO production in lipopolysaccharide-activated RAW264.7 macrophages was evaluated by Griess reaction. Fifteen polyacetylenes were isolated from the active ethyl acetate extract using activity-guided screening. The structures of all compounds were elucidated by spectroscopic methods and comparison with published data. The compounds were further tested for their inhibitory activity against NO production. Seven new polyacetylenes, named atractylodemaynes A-G (1-7), along with eight known ones (8-15) were isolated. Compound 14 was isolated for the first time from the rhizomes of A. macrocephala. The study showed that the tested compounds exhibited inhibitory activity against NO production in a dose-dependent manner. Among them, compounds 10, 11 and 12 had relatively stronger inhibitory effect with IC50 values of 28, 23 and 19μM, respectively. The results demonstrated that the polyacetylenes might greatly contribute to the anti-inflammatory activity of the rhizomes of A. macrocephala. © 2013 Elsevier Ireland Ltd. All rights reserved.

  8. Lateralized frontal activity for Japanese phonological processing during child development

    Directory of Open Access Journals (Sweden)

    Takaaki eGoto

    2015-07-01

    Full Text Available Phonological awareness is essential for reading, and is common to all language systems, including alphabetic languages and Japanese. This cognitive factor develops during childhood, and is thought to be associated with shifts in brain activity. However, the nature of this neurobiological developmental shift is unclear for speakers of Japanese, which is not an alphabetical language. The present study aimed to reveal a shift in brain functions for processing phonological information in native-born Japanese children. We conducted a phonological awareness task and examined hemodynamic activity in 103 children aged 7 to 12 years. While younger children made mistakes and needed more time to sort phonological information in reverse order, older children completed the task quickly and accurately. Additionally, younger children exhibited increased activity in the bilateral dorsolateral prefrontal cortex, which may be evidence of immature phonological processing skills. Older children exhibited dominant activity in the left compared with the right dorsolateral prefrontal cortex, suggesting that they had already acquired phonological processing skills. We also found significant effects of age and lateralized activity on behavioral performance. During earlier stages of development, the degree of left lateralization appears to have a smaller effect on behavioral performance. Conversely, in later stages of development, the degree of left lateralization appears to have a stronger influence on behavioral performance. These initial findings regarding a neurobiological developmental shift in Japanese speakers suggest that common brain regions play a critical role in the development of phonological processing skills among different languages systems, such as Japanese and alphabetical languages.

  9. Activation Energy

    Science.gov (United States)

    Gadeken, Owen

    2002-01-01

    Teaming is so common in today's project management environment that most of us assume it comes naturally. We further assume that when presented with meaningful and challenging work, project teams will naturally engage in productive activity to complete their tasks. This assumption is expressed in the simple (but false) equation: Team + Work = Teamwork. Although this equation appears simple and straightforward, it is far from true for most project organizations whose reality is a complex web of institutional norms based on individual achievement and rewards. This is illustrated by the very first successful team experience from my early Air Force career. As a young lieutenant, I was sent to Squadron Officer School, which was the first in the series of Air Force professional military education courses I was required to complete during my career. We were immediately formed into teams of twelve officers. Much of the course featured competition between these teams. As the most junior member of my team, I quickly observed the tremendous pressure to show individual leadership capability. At one point early in the course, almost everyone in our group was vying to become the team leader. This conflict was so intense that it caused us to fail miserably in our first outdoor team building exercise. We spent so much time fighting over leadership that we were unable to complete any of the events on the outdoor obstacle course. This complete lack of success was so disheartening to me that I gave our team little hope for future success. What followed was a very intense period of bickering, conflict, and even shouting matches as our dysfunctional team tried to cope with our early failures and find some way to succeed. British physician and researcher Wilfred Bion (Experiences in Groups, 1961) discovered that there are powerful psychological forces inherent in all groups that divert from accomplishing their primary tasks. To overcome these restraining forces and use the potential

  10. Catalyst Activity Comparison of Alcohols over Zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Ramasamy, Karthikeyan K.; Wang, Yong

    2013-01-01

    Alcohol transformation to transportation fuel range hydrocarbon on HZSM-5 (SiO2 / Al2O3 = 30) catalyst was studied at 360oC and 300psig. Product distributions and catalyst life were compared using methanol, ethanol, 1-propanol or 1-butanol as a feed. The catalyst life for 1-propanol and 1-butanol was more than double compared to that for methanol and ethanol. For all the alcohols studied, the product distributions (classified to paraffin, olefin, napthene, aromatic and naphthalene compounds) varied with time on stream (TOS). At 24 hours TOS, liquid product from 1-propanol and 1-butanol transformation primarily contains higher olefin compounds. The alcohol transformation process to higher hydrocarbon involves a complex set of reaction pathways such as dehydration, oligomerization, dehydrocyclization, and hydrogenation. Compared to ethylene generated from methanol and ethanol, oligomerization of propylene and butylene has a lower activation energy and can readily take place on weaker acidic sites. On the other hand, dehydrocyclization of propylene and butylene to form the cyclic compounds requires the sits with stronger acid strength. Combination of the above mentioned reasons are the primary reasons for olefin rich product generated in the later stage of the time on stream and for the extended catalyst life time for 1 propanol and 1 butanol compared to methanol and ethanol conversion over HZSM-5.

  11. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System.

    Directory of Open Access Journals (Sweden)

    Urs M Nater

    Full Text Available Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies.In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies.Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest.Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals.

  12. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  13. Downregulation of KLF8 expression by shRNA induces inhibition of cell proliferation in CAL27 human oral cancer cells.

    Science.gov (United States)

    Bin, Zhang; Ke-Yi, Li; Wei-Feng, Zhang; Li-Cheng, Jiang; Xian-Bin, Liu; Chun-Peng, Xia; Dao-Ying, Yuan; Shu-Wei, Liu

    2013-07-01

    KLF8 is a member of KLF transcription factors which play an important tolr in oncogenesis. It is barely expressed in normal human epithelial cells but highly overexpressed in several types of human cancer cell lines. In the present study, we investigate the role of KLF8 in oral cancer and the effects of KLF8 knockdown via lentivirus mediated siRNA infection in human adenosquamos carcinoma CAL 27 cells. We developed a vector-based siRNA expression system that can induce RNAi in CAL 27 oral cancer cells. Downregulation of KLF8 was confirmed by evaluating GFP expressions, RT-PCR and western blot analysis. Finally, the effects of KLF8 downregulation were analyzed by MTT assay and colony formation assays. The expression levels of KLF8 mRNA and proteins are reduced in CAL 27 cells that transfected with 21-nt siRNA against KLF8. Lentivirus-mediated silencing of KLF8 reduces cell proliferation and colonies number, thereby indicating the role of KLF8 in cell proliferation and tumorigenesis. These results strongly suggest that KLF8 is essential for growth of CAL 27 cancer cells. A better understanding of KLF8 function and processing may provide novel insights into the clinical therapy of oral cancer.

  14. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  15. Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs.

    Science.gov (United States)

    Bertero, Alessandro; Pawlowski, Matthias; Ortmann, Daniel; Snijders, Kirsten; Yiangou, Loukia; Cardoso de Brito, Miguel; Brown, Stephanie; Bernard, William G; Cooper, James D; Giacomelli, Elisa; Gambardella, Laure; Hannan, Nicholas R F; Iyer, Dharini; Sampaziotis, Fotios; Serrano, Felipe; Zonneveld, Mariëlle C F; Sinha, Sanjay; Kotter, Mark; Vallier, Ludovic

    2016-12-01

    Inducible loss of gene function experiments are necessary to uncover mechanisms underlying development, physiology and disease. However, current methods are complex, lack robustness and do not work in multiple cell types. Here we address these limitations by developing single-step optimized inducible gene knockdown or knockout (sOPTiKD or sOPTiKO) platforms. These are based on genetic engineering of human genomic safe harbors combined with an improved tetracycline-inducible system and CRISPR/Cas9 technology. We exemplify the efficacy of these methods in human pluripotent stem cells (hPSCs), and show that generation of sOPTiKD/KO hPSCs is simple, rapid and allows tightly controlled individual or multiplexed gene knockdown or knockout in hPSCs and in a wide variety of differentiated cells. Finally, we illustrate the general applicability of this approach by investigating the function of transcription factors (OCT4 and T), cell cycle regulators (cyclin D family members) and epigenetic modifiers (DPY30). Overall, sOPTiKD and sOPTiKO provide a unique opportunity for functional analyses in multiple cell types relevant for the study of human development. © 2016. Published by The Company of Biologists Ltd.

  16. FTY720 and two novel butterfly derivatives exert a general anti-inflammatory potential by reducing immune cell adhesion to endothelial cells through activation of S1P(3) and phosphoinositide 3-kinase.

    Science.gov (United States)

    Imeri, Faik; Blanchard, Olivier; Jenni, Aurelio; Schwalm, Stephanie; Wünsche, Christin; Zivkovic, Aleksandra; Stark, Holger; Pfeilschifter, Josef; Huwiler, Andrea

    2015-12-01

    Sphingosine-1-phosphate (S1P) is a key lipid regulator of a variety of cellular responses including cell proliferation and survival, cell migration, and inflammatory reactions. Here, we investigated the effect of S1P receptor activation on immune cell adhesion to endothelial cells under inflammatory conditions. We show that S1P reduces both tumor necrosis factor (TNF)-α- and lipopolysaccharide (LPS)-stimulated adhesion of Jurkat and U937 cells to an endothelial monolayer. The reducing effect of S1P was reversed by the S1P1+3 antagonist VPC23019 but not by the S1P1 antagonist W146. Additionally, knockdown of S1P3, but not S1P1, by short hairpin RNA (shRNA) abolished the reducing effect of S1P, suggesting the involvement of S1P3. A suppression of immune cell adhesion was also seen with the immunomodulatory drug FTY720 and two novel butterfly derivatives ST-968 and ST-1071. On the molecular level, S1P and all FTY720 derivatives reduced the mRNA expression of LPS- and TNF-α-induced adhesion molecules including ICAM-1, VCAM-1, E-selectin, and CD44 which was reversed by the PI3K inhibitor LY294002, but not by the MEK inhibitor U0126.In summary, our data demonstrate a novel molecular mechanism by which S1P, FTY720, and two novel butterfly derivatives acted anti-inflammatory that is by suppressing gene transcription of various endothelial adhesion molecules and thereby preventing adhesion of immune cells to endothelial cells and subsequent extravasation.

  17. miR-221/222 promote cancer stem-like cell properties and tumor growth of breast cancer via targeting PTEN and sustained Akt/NF-κB/COX-2 activation.

    Science.gov (United States)

    Li, Bailong; Lu, Ying; Yu, Lihui; Han, Xiaocui; Wang, Honghai; Mao, Jun; Shen, Jie; Wang, Bo; Tang, Jianwu; Li, Chunyan; Song, Bo

    2017-11-01

    MicroRNAs (miRNAs) play an important role in regulating cancer stem cell (CSC). Previous studies have shown that microRNA-221/222 (miR-221/222) cluster are involved in the propagation of breast cancer stem cell (BCSC), however, the underlying molecular mechanisms are still not fully understood. In this study, we found that miR-221/222 were overexpressed in highly aggressive breast cancer MDA-MB-231 cells, that are enriched in markers for epithelial-mesenchymal transition (EMT) and BCSCs, than in MCF-7 cells. Phosphatase and tensin homolog (PTEN) was confirmed to be the target of miR-221/222 in breast cancer cells. MiR-221/222 enhanced breast cancer cell growth, migration and invasion by downregulating PTEN. Importantly, both ectopic expression of miR-221/222 and PTEN knockdown increased the mammosphere formation capacity and the expression of the stemness marker ALDH1. MiR-221/222 lentivirus vector infected MCF-7 cells produced larger subcutaneous tumors, while shRNA vector of PTEN showed similar trend. Along with the downregulation of PTEN caused by miR-221/222 in the breast cancer cells and the xenograft tumor tissues, Akt phosphorylation (p-Akt), NF-κB p65 and phosphorylated p65 (p-p65), and cyclooxygenase-2 (COX-2) were all overexpressed compared to the negative control. Taken together, our findings indicate that miR-221/222 play a critical role in the propagation of BCSCs and tumor growth possibly through targeting PTEN, which in turn activating the Akt/NF-κB/COX-2 pathway. MiR-221/222 might represent the potential target of breast cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Adsorption of heavy metals onto activated carbons derived from polyacrylonitrile fiber.

    Science.gov (United States)

    Zaini, Muhammad Abbas Ahmad; Amano, Yoshimasa; Machida, Motoi

    2010-08-15

    The aim of this research is to produce activated carbons derived from polyacrylonitrile (PAN) fiber and to examine their feasibility of removing heavy metals from aqueous solution. Thermogravimetric analysis was used to identify the suitable conditions for preparing oxidized fiber and coke as activated carbon precursors. Steam and CO(2) were used to activate the precursors. Activated carbons were characterized by their pore texture, elemental compositions and surface functionalities. Batch adsorption and desorption studies were carried out to determine the metal-binding ability of activated carbons. Two commercial activated carbon fibers (ACFs), i.e., A-20 and W10-W, were employed to compare the removal performance of PAN derived activated carbons. Influence of oxidation treatment of PAN fiber prior to steam activation was also explored and discussed. Results indicated that steam produced a higher surface area but a lower resultant yield as compared to CO(2). Also, precursors activated by steam showed a greater removal performance. For both activation methods, fiber displayed a better metal-binding ability than coke. A small nitrogen loss from PAN fiber as a result of oxidation treatment assisted a greater removal of Cu(II) and Pb(II), but the interaction to Cu(II) was found stronger. It is proposed that the formation of cyclized structure by oxidation treatment minimized the nitrogen loss during steam activation, hence increased the uptake performance. Copyright 2010 Elsevier B.V. All rights reserved.

  19. Active Commuting: Workplace Health Promotion for Improved Employee Well-Being and Organizational Behavior.

    Science.gov (United States)

    Page, Nadine C; Nilsson, Viktor O

    2016-01-01

    Objective: This paper describes a behavior change intervention that encourages active commuting using electrically assisted bikes (e-bikes) for health promotion in the workplace. This paper presents the preliminary findings of the intervention's impact on improving employee well-being and organizational behavior, as an indicator of potential business success. Method: Employees of a UK-based organization participated in a workplace travel behavior change intervention and used e-bikes as an active commuting mode; this was a change to their usual passive commuting behavior. The purpose of the intervention was to develop employee well-being and organizational behavior for improved business success. We explored the personal benefits and organizational co-benefits of active commuting and compared these to a travel-as-usual group of employees who did not change their behavior and continued taking non-active commutes. Results: Employees who changed their behavior to active commuting reported more positive affect, better physical health and more productive organizational behavior outcomes compared with passive commuters. In addition, there was an interactive effect of commuting mode and commuting distance: a more frequent active commute was positively associated with more productive organizational behavior and stronger overall positive employee well-being whereas a longer passive commute was associated with poorer well-being, although there was no impact on organizational behavior. Conclusion: This research provides emerging evidence of the value of an innovative workplace health promotion initiative focused on active commuting in protecting and improving employee well-being and organizational behavior for stronger business performance. It considers the significant opportunities for organizations pursuing improved workforce well-being, both in terms of employee health, and for improved organizational behavior and business success.

  20. Physical activity and mammographic parenchymal patterns among Greek postmenopausal women.

    Science.gov (United States)

    Marmara, Eleni A; Papacharalambous, Xenofon N; Kouloulias, Vassilios E; Maridaki, D Maria; Baltopoulos, J Panayiotis

    2011-05-01

    To examine whether physical activity during the last five years is related to later breast mammographic density in postmenopausal Greek women. We designed a cross-sectional study in 724 women, of ages 45-67 years. An interview-administered questionnaire was used to obtain information on duration and intensity of recreational physical activity during five years preceding study recruitment. Mammograms were evaluated according to BIRADS classification and BIRADS score was also estimated. Multivariate ordinal logistic regression analysis was used to assess associations between physical activity index and breast density according to the BIRADS classification methods. We observed a statistically significant inverse association of mammographic breast density measured by the BIRADS classification method and recreational exercise (OR=-0.10; 95% CI -0.018, -0.001; p=0.022). For one unit increase in physical activity as expressed by the MET-h/week score, the odds of lower versus higher breast density categories are 1.105 greater, given that all of the other variables in the model are held constant. A modifying effect by age at recruitment was evident among participants, with a stronger inverse association between recreational activity and mammographic breast density among older women (OR=-0.036; 95% CI -0.063, -0.009; p=0.009). An inverse association between physical activity and BIRADS score was evident, not reaching statistical significance (OR=0.00; 95% CI -0.009, 0.008; p=0.887). Mammographic breast area was lower in postmenopausal women who participated in sports/recreational physical activity compared to inactive controls. Increasing physical activity levels among postmenopausal women might be a reasonable approach to reduce mammographic density. However, until more physical activity and mammographic breast density studies are conducted that confirm our findings, they have to be interpreted with caution, due to the retrospective nature of our data and the possibility of

  1. Effect of imbalance in activities between ON- and OFF-center LGN cells on orientation map formation.

    Science.gov (United States)

    Nakagama, H; Saito, T; Tanaka, S

    2000-08-01

    It has been reported that the OFF responses of cells in the visual pathway are stronger, on average, than the ON responses early in the life of cats and ferrets. In this study, we theoretically investigate the effects of this imbalance in activity on the orientation map formation. We carry out computer simulations based on our previously proposed self-organization model, in which the correlated activities between ON- and OFF-center cells in the lateral geniculate nucleus regulate the formation of orientation maps in the visual cortex. When imbalance between the activities of these ON- and OFF-center cells is assumed, we obtain orientation maps with spatial periodicity, as observed in the experiments. On the other hand, when balanced activities are assumed, orientation maps do not show periodicity. This suggests that the imbalance in activities between ON- and OFF-center cells contributes to the elaboration of orientation maps during the critical period.

  2. Physical Activity Basics

    Science.gov (United States)

    ... Weight Breastfeeding Micronutrient Malnutrition State and Local Programs Physical Activity Basics Recommend on Facebook Tweet Share Compartir How much physical activity do you need? Regular physical activity helps ...

  3. Infectious Bursal Disease Virus Activates c-Src To Promote α4β1 Integrin-Dependent Viral Entry by Modulating the Downstream Akt-RhoA GTPase-Actin Rearrangement Cascade.

    Science.gov (United States)

    Ye, Chengjin; Han, Xinpeng; Yu, Zhaoli; Zhang, Enli; Wang, Lijuan; Liu, Hebin

    2017-02-01

    While the entry of infectious bursal disease virus (IBDV) is initiated by the binding of the virus to the two major receptors integrin and HSP90, the signaling events after receptor binding and how they contribute to virus entry remain elusive. We show here that IBDV activates c-Src by inducing the phosphorylation of the Y416 residue in c-Src both in DF-1 chicken fibroblasts and in vivo in the bursa of Fabricius from specific-pathogen-free (SPF) chickens. Importantly, inactivated IBDV fails to stimulate c-Src Y416 phosphorylation, and a very virulent IBDV strain induces a much higher level of c-Src Y416 phosphorylation than does an attenuated strain. Inhibition of c-Src activation by an Src kinase inhibitor or expression of a c-Src dominant negative mutant results in a significant decrease in the internalization of IBDV but has little effect on virus adhesion. Furthermore, short hairpin RNA (shRNA) downregulation of integrin, either the α4 or β1 subunit, but not HSP90 remarkably attenuates IBDV-induced c-Src Y416 phosphorylation, resulting in a decrease in IBDV internalization but not virus adhesion. Moreover, interestingly, inhibition of either c-Src downstream of the phosphatidylinositol 3-kinase (PI3K)/Akt-RhoA signaling cascade or actin rearrangement leads to a significant decrease in IBDV internalization irrespective of the IBDV-induced high levels of c-Src phosphorylation. Cumulatively, our results suggest a novel feed-forward model whereby IBDV activates c-Src for benefiting its cell entry via an integrin-mediated pathway by the activation of downstream PI3K/Akt-RhoA signaling and cytoskeleton actin rearrangement. While IBDV-caused immunosuppression is highly related to viral invasion, the molecular basis of the cellular entry of IBDV remains elusive. In this study, we demonstrate that IBDV activates c-Src by inducing the phosphorylation of the Y416 residue in c-Src to promote virus internalization but not virus adhesion. The ability to induce the level of

  4. TRIANGULATION OF INSTRUMENTATION AND DATA SOURCE: A STRONGER METHOD IN ASSESSING ENGLISH LANGUAGE NEEDS

    Directory of Open Access Journals (Sweden)

    Meedy Nugraha

    2002-01-01

    Full Text Available This paper proposes the importance of multiple instrumentation and data source (triangulation in a needs analysis. Various data gathering methods developed in assessing learners' English language needs are reviewed. The justification of employing more than a single data gathering method and data source in a needs analysis is also presented by examining the strengths and weaknesses of each method and evaluating previous needs analyses carried out in some Asian countries. Highlights are then given to the methodology mostly implemented in assessing English needs in Indonesia and a recommendation is addressed to further studies on learners's needs in Indonesia

  5. Stronger Lagrangian bounds by use of slack variables: applications to machine scheduling problems

    NARCIS (Netherlands)

    J.A. Hoogeveen (Han); S.L. van de Velde (Steef)

    1995-01-01

    textabstractLagrangian relaxation is a powerful bounding technique that has been applied successfully to manyNP-hard combinatorial optimization problems. The basic idea is to see anNP-hard problem as an easy-to-solve problem complicated by a number of nasty side constraints. We show that

  6. Space debris mitigation and prevention: how to bilt a stronger international regime

    Czech Academy of Sciences Publication Activity Database

    Perek, Luboš

    2004-01-01

    Roč. 2, č. 2 (2004), s. 215-226 ISSN 1477-7622 Institutional research plan: CEZ:AV0Z1003909 Keywords : space debris * registration * paper satellites Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics

  7. Magnetic materials and devices for the 21st century: stronger, lighter, and more energy efficient.

    Science.gov (United States)

    Gutfleisch, Oliver; Willard, Matthew A; Brück, Ekkes; Chen, Christina H; Sankar, S G; Liu, J Ping

    2011-02-15

    A new energy paradigm, consisting of greater reliance on renewable energy sources and increased concern for energy efficiency in the total energy lifecycle, has accelerated research into energy-related technologies. Due to their ubiquity, magnetic materials play an important role in improving the efficiency and performance of devices in electric power generation, conditioning, conversion, transportation, and other energy-use sectors of the economy. This review focuses on the state-of-the-art hard and soft magnets and magnetocaloric materials, with an emphasis on their optimization for energy applications. Specifically, the impact of hard magnets on electric motor and transportation technologies, of soft magnetic materials on electricity generation and conversion technologies, and of magnetocaloric materials for refrigeration technologies, are discussed. The synthesis, characterization, and property evaluation of the materials, with an emphasis on structure-property relationships, are discussed in the context of their respective markets, as well as their potential impact on energy efficiency. Finally, considering future bottlenecks in raw materials, options for the recycling of rare-earth intermetallics for hard magnets will be discussed. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. The motivation to diet in young women : Fear is stronger than hope

    NARCIS (Netherlands)

    Dalley, Simon E.; Buunk, Abraham P.

    This research examined the relative impact of a hoped-for, thin body and a feared, overweight body on weight-loss dieting (WLD) motivation. We hypothesised that the women most motivated to engage in WLD would report a higher similarity to, and a higher cognitive availability of, a feared, overweight

  9. Factors Favouring or Impeding Building a Stronger Higher Education System in the United Arab Emirates

    Science.gov (United States)

    Ashour, Sanaa; Fatima, Syeda Kauser

    2016-01-01

    The paper examines the inherent strengths and weaknesses of the higher education system in the United Arab Emirates (UAE). Using a literature review, three elements were examined: its development and structure, quality, and research capacity. The findings reveal that the UAE's higher education sector has witnessed remarkable growth since 1997,…

  10. Meditation has stronger relationships with mindfulness, kundalini, and mystical experiences than yoga or prayer.

    Science.gov (United States)

    de Castro, John M

    2015-09-01

    Contemplative practices can have profound effects on mindfulness and on physical and sensory and mystical experiences. Individuals who self-reported meditation, yoga, contemplative prayer, or a combination of practices and their patterns of practice were compared for mindfulness, kundalini effects, and mystical experiences. The results suggest that the amount of practice but not the pattern and social conditions of practice influences mindfulness and possibly mystical experiences. Meditation, yoga, contemplative prayer, or a combination of practices all were found to be associated with enhancements of mindfulness, kundalini effects, and mystical experiences, but meditation had particularly strong associations and may be the basis of the associations of yoga and prayer with these outcomes. The results further suggest that the primary association of contemplative practices is with the real time awareness and appreciation of sensory and perceptual experiences which may be the intermediary between disparate practices and mindfulness, kundalini effects, and mystical experiences. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Better Jobs, Brighter Futures, a Stronger Washington. Washington's Community and Technical Colleges

    Science.gov (United States)

    Washington State Board for Community and Technical Colleges, 2015

    2015-01-01

    The world is changing rapidly. With changes in technology, demographics, and workforce trends, Washington needs colleges to not only keep pace, but lead the way. Washington's 34 community and technical colleges answer that call. The community and technical colleges have proven uniquely positioned to adapt to, embrace, and ignite change. Community…

  12. Stronger Federal Efforts Needed for Providing Employment Opportunities and Enforcing Labor Standards in Sheltered Workshops.

    Science.gov (United States)

    1981-09-28

    assistance, through loans or 1/Mental retardation, cerebral palsy, epilepsy, autism, and severe dyslexia were conditions generally accepted as constituting...SUBMINIMUM WAGE GUARANTEE Special treatment of the handicapped was recognized because many individuals cannot successfully compete for jobs at the statu...employing the blind preferential treatment in Government contracting, second only to the Federal Prison Industries, Inc., to provide employment and

  13. Split-localized orbitals can yield stronger configuration interaction convergence than natural orbitals

    Science.gov (United States)

    Bytautas, Laimutis; Ivanic, Joseph; Ruedenberg, Klaus

    2003-10-01

    The convergence of configuration interaction (CI) expansions depends upon the orbitals from which the configurations are formed. Since their introduction half a century ago, natural orbitals have gained an increasing popularity for generating rapidly converging CI expansions and the notion has become widespread that they always yield the fastest CI convergence. It is shown here that, in fact, certain localized orbitals often yield a better CI convergence than natural orbitals, as measured by a wave function criterion as well as by an energy criterion.

  14. Mice lacking SIGNR1 have stronger T helper 1 responses to Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Wieland, Catharina W.; Koppel, Estella A.; den Dunnen, Jeroen; Florquin, Sandrine; McKenzie, Andrew N. J.; van Kooyk, Yvette; van der Poll, Tom; Geijtenbeek, Teunis B. H.

    2007-01-01

    Mycobacterium tuberculosis and the associated disease tuberculosis are health risks causing many deaths worldwide each year in humans. M. tuberculosis targets dendritic cell (DC)-specific intercellular adhesion molecule-3 grabbing non-integrin (DC-SIGN) to induce immunosuppression, since interaction

  15. Stronger communities? Changing prospects for community-led strategic planning in New Zealand

    Directory of Open Access Journals (Sweden)

    Bruno Brosnan

    2010-12-01

    Full Text Available New Zealand’s Local Government Act 2002 ushered in a new phase in local government, a phase that is best characterised by the term ‘empowerment’. Not only were councils empowered to promote social, economic, environmental and cultural well-being, in contrast with previous more prescriptive legislation, but citizens were empowered to engage in community-led strategic planning. In many respects the new statute reflected contemporary international public management trends in which governance is increasingly being conducted via networks of public and private actors. However, with the change of government from a centre-left Labour-led coalition to a centre-right National-led government following the November 2008 general election, it is less certain that local government and communities will continue to experience a strengthening of the pluralisation of governance that has been a feature of the past decade. This article argues that the potential disempowerment of local government, and possible attenuation of community-led strategic planning in New Zealand, comes at a time when the momentum for devolution to local government and other communities is increasing elsewhere.

  16. GPE 2020: Improving Learning and Equity through Stronger Education Systems. Strategic Plan 2016-2020

    Science.gov (United States)

    Global Partnership for Education, 2016

    2016-01-01

    The Global Partnership for Education (GPE) addresses the most significant education challenges faced by developing countries through supporting governments to improve equity and learning by strengthening their education systems. GPE is a global fund and a partnership focused entirely on education in developing countries. The partnership has a…

  17. Geographical Constraints Are Stronger than Invasion Patterns for European Urban Floras

    OpenAIRE

    Ricotta, Carlo; Celesti-Grapow, Laura; Kühn, Ingolf; Rapson, Gillian; Pyšek, Petr; La Sorte, Frank A.; Thompson, Ken

    2014-01-01

    Understanding the mechanisms that affect invasion success of alien species is an important prerequisite for the effective management of present and future aliens. To gain insight into this matter we asked the following questions: Are the geographical patterns of species distributions in urban floras different for native compared with alien plant species? Does the introduction of alien species contribute to the homogenization of urban floras? We used a Mantel test on Jaccard dissimilarity matr...

  18. Geographical constraints are stronger than invasion patterns for European urban floras.

    Science.gov (United States)

    Ricotta, Carlo; Celesti-Grapow, Laura; Kühn, Ingolf; Rapson, Gillian; Pyšek, Petr; La Sorte, Frank A; Thompson, Ken

    2014-01-01

    Understanding the mechanisms that affect invasion success of alien species is an important prerequisite for the effective management of present and future aliens. To gain insight into this matter we asked the following questions: Are the geographical patterns of species distributions in urban floras different for native compared with alien plant species? Does the introduction of alien species contribute to the homogenization of urban floras? We used a Mantel test on Jaccard dissimilarity matrices of 30 urban floras across the British Isles, Italy and central Europe to compare the spatial distribution of native species with four classes of alien species: archaeophytes, all neophytes, non-invasive neophytes, and invasive neophytes. Archaeophytes and neophytes are species that were introduced into Europe before and after 1500 AD, respectively. To analyze the homogenizing effect of alien species on the native urban floras, we tested for differences in the average dissimilarity of individual cities from their group centroid in ordination space. Our results show that the compositional patterns of native and alien species seem to respond to the same environmental drivers, such that all four classes of alien species were significantly related to native species across urban floras. In this framework, alien species may have an impact on biogeographic patterns of urban floras in ways that reflect their history of introduction and expansion: archaeophytes and invasive neophytes tended to homogenize, while non-invasive neophytes tended to differentiate urban floras.

  19. Functional Bell inequalities can serve as a stronger entanglement witness than conventional Bell inequalities

    International Nuclear Information System (INIS)

    Sen, Aditi; Sen, Ujjwal; Zukowski, Marek

    2002-01-01

    We consider a Bell inequality for a continuous range of settings of the apparatus at each site. This 'functional' Bell inequality gives a better range of violation for generalized Greenberger, Horne, and Zeilinger states. Also a family of N-qubit bound entangled states violate this inequality for N>5

  20. Diversity has stronger top-down than bottom-up effects on decomposition.

    Science.gov (United States)

    Srivastava, Diane S; Cardinale, Bradley J; Downing, Amy L; Duffy, J Emmett; Jouseau, Claire; Sankaran, Mahesh; Wright, Justin P

    2009-04-01

    The flow of energy and nutrients between trophic levels is affected by both the trophic structure of food webs and the diversity of species within trophic levels. However, the combined effects of trophic structure and diversity on trophic transfer remain largely unknown. Here we ask whether changes in consumer diversity have the same effect as changes in resource diversity on rates of resource consumption. We address this question by focusing on consumer-resource dynamics for the ecologically important process of decomposition. This study compares the top-down effect of consumer (detritivore) diversity on the consumption of dead organic matter (decomposition) with the bottom-up effect of resource (detrital) diversity, based on a compilation of 90 observations reported in 28 studies. We did not detect effects of either detrital or consumer diversity on measures of detrital standing stock, and effects on consumer standing stock were equivocal. However, our meta-analysis indicates that reductions in detritivore diversity result in significant reductions in the rate of decomposition. Detrital diversity has both positive and negative effects on decomposition, with no overall trend. This difference between top-down and bottom-up effects of diversity is robust to different effect size metrics and could not be explained by differences in experimental systems or designs between detritivore and detrital manipulations. Our finding that resource diversity has no net effect on consumption in "brown" (detritus-consumer) food webs contrasts with previous findings from "green" (plant-herbivore) food webs and suggests that effects of plant diversity on consumption may fundamentally change after plant death.

  1. Sweeter and stronger: enhancing sweetness and stability of the single chain monellin MNEI through molecular design

    Science.gov (United States)

    Leone, Serena; Pica, Andrea; Merlino, Antonello; Sannino, Filomena; Temussi, Piero Andrea; Picone, Delia

    2016-09-01

    Sweet proteins are a family of proteins with no structure or sequence homology, able to elicit a sweet sensation in humans through their interaction with the dimeric T1R2-T1R3 sweet receptor. In particular, monellin and its single chain derivative (MNEI) are among the sweetest proteins known to men. Starting from a careful analysis of the surface electrostatic potentials, we have designed new mutants of MNEI with enhanced sweetness. Then, we have included in the most promising variant the stabilising mutation E23Q, obtaining a construct with enhanced performances, which combines extreme sweetness to high, pH-independent, thermal stability. The resulting mutant, with a sweetness threshold of only 0.28 mg/L (25 nM) is the strongest sweetener known to date. All the new proteins have been produced and purified and the structures of the most powerful mutants have been solved by X-ray crystallography. Docking studies have then confirmed the rationale of their interaction with the human sweet receptor, hinting at a previously unpredicted role of plasticity in said interaction.

  2. Smarter Power, Stronger Partners, Volume 1: Exploiting U.S. Advantages to Prevent Aggression

    Science.gov (United States)

    2016-01-01

    the future-years defense program and wrestle with big problems that will materialize in the medium term. Without this office’s sponsorship and...Annual Aviation Inventory and Funding Plan: Fiscal Years (FY) 2015–2044, April 2014b. Navy projection data from Naval History and Heritage ...instruments as diplomacy, foreign aid, democracy promotion, and cultural exchanges to persuade other soci- eties to seek what Americans seek and act as

  3. Does academic performance or personal growth share a stronger association with learning environment perception?

    OpenAIRE

    Colbert-Getz, Jorie M.; Tackett, Sean; Wright, Scott M.; Shochet, Robert S.

    2016-01-01

    Objectives This study was conducted to characterize the relative strength of associations of learning environment perception with academic performance and with personal growth. Methods In 2012-2014 second and third year students at Johns Hopkins University School of Medicine completed a learning environment survey and personal growth scale. Hierarchical linear regression analysis was employed to determine if the proportion of variance in learning environment scores accounted for by personal g...

  4. Implicit and Explicit Gender Beliefs in Spatial Ability : Stronger Stereotyping in Boys than Girls

    NARCIS (Netherlands)

    Vander Heyden, Karin M; van Atteveldt, Nienke M; Huizinga, Mariette; Jolles, Jelle

    2016-01-01

    Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering, and mathematics (STEM) and girls' underrepresentation in these domains. In the current study we investigated the presence of

  5. Corporate Leadership and Governance for Increasing Stakeholder Involvement and Developing Stronger Connections

    OpenAIRE

    Coulson-Thomas, Colin

    2018-01-01

    Many organisations and their supply chains are networks of relationships, but greater connectivity, additional connections and more intimate relationships can involve costs and risks as well as confer benefits, while inappropriate relationships can be harmful. Aspects of company law and regulation and contemporary corporate leadership and governance codes, priorities and practices favour some stakeholders over others and can hinder rather than help the building of relationships with a wider r...

  6. Faster, higher, stronger? : disability sport, the paralympic games and the politics of disability

    OpenAIRE

    Quinn, Brook

    2017-01-01

    This thesis argues that disabled people experience marginalisation (beyond any disadvantage stemming from physical, mental or sensory impairment) due to material and discursive structures within contemporary capitalist society that define disability as an ‘individual phenomenon’, treatable by medical intervention and strategies of ‘normalisation’ into mainstream economic, social and cultural values and institutions. Drawing on the work of the critical ‘social model of disabi...

  7. Global dimming and urbanization: did stronger negative SSR trends collocate with regions of population growth?

    Directory of Open Access Journals (Sweden)

    A. Imamovic

    2016-03-01

    Full Text Available Global dimming refers to the decrease in surface solar radiation (SSR observed from the 1960s to the 1980s at different measurement sites all around the world. It is under debate whether anthropogenic aerosols emitted from urban areas close to the measurement sites are mainly responsible for the dimming. In order to assess this urbanization impact on SSR, we use spatially explicit population density data of 0.08° resolution to construct population indices (PI at 157 high data quality sites. Our study extends previous population-based studies by incorporating distance-weighting as a simple aerosol diffusion model. We measured urbanization in the surrounding of a site as the PI change from 1960 to 1990 and found no negative correlation with the corresponding SSR trends from 1964 to 1989 for the 92 sites in Europe and Japan. For the 39 sites in China the correlation coefficients are significant at the 5 % level and reach around −0.35, while for the 26 remaining Asian, mostly Russian sites the correlation coefficients reach around −0.55 at the 1 % significance level. Results are similar, when the absolute levels of PIs are taken as an indicator for urbanization. Our findings call into question the existence of an urbanization effect for the sites in Europe and Japan, while such an effect cannot be ruled out for the sites in Asia, especially in Russia.

  8. Alien plants invade more phylogenetically clustered community types and cause even stronger clustering

    Czech Academy of Sciences Publication Activity Database

    Lososová, Z.; de Bello, Francesco; Chytrý, M.; Kühn, I.; Pyšek, Petr; Sádlo, Jiří; Winter, M.; Zelený, D.

    2015-01-01

    Roč. 24, č. 7 (2015), s. 786-794 ISSN 1466-822X R&D Projects: GA ČR GAP505/12/1296; GA ČR GB14-36079G Institutional support: RVO:67985939 Keywords : biological invasions * phylogenetic diversity * vegetation type Subject RIV: EH - Ecology, Behaviour Impact factor: 5.840, year: 2015

  9. Growing season carries stronger contributions to albedo dynamics on the Tibetan plateau.

    Directory of Open Access Journals (Sweden)

    Li Tian

    Full Text Available The Tibetan Plateau has experienced higher-than-global-average climate warming in recent decades, resulting in many significant changes in ecosystem structure and function. Among them is albedo, which bridges the causes and consequences of land surface processes and climate. The plateau is covered by snow/ice and vegetation in the non-growing season (nGS and growing season (GS, respectively. Based on the MODIS products, we investigated snow/ice cover and vegetation greenness in relation to the spatiotemporal changes of albedo on the Tibetan Plateau from 2000 through 2013. A synchronous relationship was found between the change in GSNDVI and GSalbedo over time and across the Tibetan landscapes. We found that the annual average albedo had a decreasing trend, but that the albedo had slightly increased during the nGS and decreased during the GS. Across the landscapes, the nGSalbedo fluctuated in a synchronous pattern with snow/ice cover. Temporally, monthly snow/ice coverage also had a high correspondence with albedo, except in April and October. We detected clear dependencies of albedo on elevation. With the rise in altitude, the nGSalbedo decreased below 4000 m, but increased for elevations of 4500-5500 m. Above 5500 m, the nGSalbedo decreased, which was in accordance with the decreased amount of snow/ice coverage and the increased soil moisture on the plateau. More importantly, the decreasing albedo in the most recent decade appeared to be caused primarily by lowered growing season albedo.

  10. World Bank: Management Controls Stronger, But Challenges in Fighting Corruption Remain

    National Research Council Canada - National Science Library

    2000-01-01

    ... by deterring investment and growth and exacerbating poverty Although no Bank-wide estimates of the magnitude of this problem have been developed, levels of corruption vary from country to country...

  11. Achievement differences and self-concept differences: stronger associations for above or below average students?

    Science.gov (United States)

    Möller, Jens; Pohlmann, Britta

    2010-09-01

    On the one hand, achievement indicators like grades or standardized test results are strongly associated with students' domain-specific self-concepts. On the other hand, self-evaluation processes seem to be triggered by a self-enhancing means of information processing. As a consequence, above average students have more positive self-concepts than average students whereas below average students have lower self-concepts than average students. Imagine that two students, one above average, the other below average, have identical achievement differences to an average student. Will their self-concepts also share identical differences with the average students' self-concept? Our hypothesis is that students who achieve above average develop self-concepts that are more distinct from average achieving students' self-concepts than are below average achieving students' self-concepts. In Study 1, N=382 7th-10th graders (62.2% female) from several academic track (Gymnasium) schools in Germany served as participants. Students' ages ranged between 12 and 16 years (M=14.76, SD=6.24). In Study 2, the sample comprised N=1,349 students (49% girls) with a mean age of M=10.87 (SD=0.56) from 60 primary schools that were drawn representatively from a federal German state. In an experimental Study 3, N=81 German teacher education students (76.5% female) aged between 18 and 40 years (M=22.38, SD=3.80) served as participants. Two field studies and one experimental study were conducted. In all three studies, achievement differences between above average and average students were identical to those between average and below average students. However, self-concept differences between above average and average achieving students were greater than those identified between average and below average students. As our studies show, self-enhancement and self-protection processes lead above average students to develop self-concepts that are more distinct from average students' self-concepts than those of below average students' self-concepts.

  12. Wiki government: how technology can make government better, democracy stronger, and citizens more powerful

    National Research Council Canada - National Science Library

    Noveck, Beth Simone

    2009-01-01

    ... examiners to volunteer scientists and technologists via the web. These dedicated but overtaxed officials decide which of the million-plus patent applications currently in the pipeline to approve. Their decisions help determine which start-up pioneers a new industry and which disappears without a trace. Patent examiners have traditionally worked in sec...

  13. Growing season carries stronger contributions to albedo dynamics on the Tibetan plateau.

    Science.gov (United States)

    Tian, Li; Chen, Jiquan; Zhang, Yangjian

    2017-01-01

    The Tibetan Plateau has experienced higher-than-global-average climate warming in recent decades, resulting in many significant changes in ecosystem structure and function. Among them is albedo, which bridges the causes and consequences of land surface processes and climate. The plateau is covered by snow/ice and vegetation in the non-growing season (nGS) and growing season (GS), respectively. Based on the MODIS products, we investigated snow/ice cover and vegetation greenness in relation to the spatiotemporal changes of albedo on the Tibetan Plateau from 2000 through 2013. A synchronous relationship was found between the change in GSNDVI and GSalbedo over time and across the Tibetan landscapes. We found that the annual average albedo had a decreasing trend, but that the albedo had slightly increased during the nGS and decreased during the GS. Across the landscapes, the nGSalbedo fluctuated in a synchronous pattern with snow/ice cover. Temporally, monthly snow/ice coverage also had a high correspondence with albedo, except in April and October. We detected clear dependencies of albedo on elevation. With the rise in altitude, the nGSalbedo decreased below 4000 m, but increased for elevations of 4500-5500 m. Above 5500 m, the nGSalbedo decreased, which was in accordance with the decreased amount of snow/ice coverage and the increased soil moisture on the plateau. More importantly, the decreasing albedo in the most recent decade appeared to be caused primarily by lowered growing season albedo.

  14. Geographical constraints are stronger than invasion patterns for European urban floras.

    Directory of Open Access Journals (Sweden)

    Carlo Ricotta

    Full Text Available Understanding the mechanisms that affect invasion success of alien species is an important prerequisite for the effective management of present and future aliens. To gain insight into this matter we asked the following questions: Are the geographical patterns of species distributions in urban floras different for native compared with alien plant species? Does the introduction of alien species contribute to the homogenization of urban floras? We used a Mantel test on Jaccard dissimilarity matrices of 30 urban floras across the British Isles, Italy and central Europe to compare the spatial distribution of native species with four classes of alien species: archaeophytes, all neophytes, non-invasive neophytes, and invasive neophytes. Archaeophytes and neophytes are species that were introduced into Europe before and after 1500 AD, respectively. To analyze the homogenizing effect of alien species on the native urban floras, we tested for differences in the average dissimilarity of individual cities from their group centroid in ordination space. Our results show that the compositional patterns of native and alien species seem to respond to the same environmental drivers, such that all four classes of alien species were significantly related to native species across urban floras. In this framework, alien species may have an impact on biogeographic patterns of urban floras in ways that reflect their history of introduction and expansion: archaeophytes and invasive neophytes tended to homogenize, while non-invasive neophytes tended to differentiate urban floras.

  15. Long-term perspective underscores need for stronger near-term policies on climate change

    Science.gov (United States)

    Marcott, S. A.; Shakun, J. D.; Clark, P. U.; Mix, A. C.; Pierrehumbert, R.; Goldner, A. P.

    2014-12-01

    Despite scientific consensus that substantial anthropogenic climate change will occur during the 21st century and beyond, the social, economic and political will to address this global challenge remains mired in uncertainty and indecisiveness. One contributor to this situation may be that scientific findings are often couched in technical detail focusing on near-term changes and uncertainties and often lack a relatable long-term context. We argue that viewing near-term changes from a long-term perspective provides a clear demonstration that policy decisions made in the next few decades will affect the Earth's climate, and with it our socio-economic well-being, for the next ten millennia or more. To provide a broader perspective, we present a graphical representation of Earth's long-term climate history that clearly identifies the connection between near-term policy options and the geological scale of future climate change. This long view is based on a combination of recently developed global proxy temperature reconstructions of the last 20,000 years and model projections of surface temperature for the next 10,000 years. Our synthesis places the 20th and 21st centuries, when most emissions are likely to occur, into the context of the last twenty millennia over which time the last Ice Age ended and human civilization developed, and the next ten millennia, over which time the projected impacts will occur. This long-term perspective raises important questions about the most effective adaptation and mitigation policies. For example, although some consider it economically viable to raise seawalls and dikes in response to 21st century sea level change, such a strategy does not account for the need for continuously building much higher defenses in the 22nd century and beyond. Likewise, avoiding tipping points in the climate system in the short term does not necessarily imply that such thresholds will not still be crossed in the more distant future as slower components respond. Policies regarding conservation of ecosystems and biodiversity similarly must address contentious issues about the need for environmental triage so that societies invest resources where they are most likely to succeed when faced with an unavoidable trajectory of long-term change.

  16. Distributed computing and data storage in proteomics: many hands make light work, and a stronger memory.

    Science.gov (United States)

    Verheggen, Kenneth; Barsnes, Harald; Martens, Lennart

    2014-03-01

    Modern day proteomics generates ever more complex data, causing the requirements on the storage and processing of such data to outgrow the capacity of most desktop computers. To cope with the increased computational demands, distributed architectures have gained substantial popularity in the recent years. In this review, we provide an overview of the current techniques for distributed computing, along with examples of how the techniques are currently being employed in the field of proteomics. We thus underline the benefits of distributed computing in proteomics, while also pointing out the potential issues and pitfalls involved. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations

    NARCIS (Netherlands)

    Hoogeveen, Heleen R.; Jolij, Jacob; Horst, ter Gert; Lorist, Monicque M.

    2016-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the

  18. Brain potentials highlight stronger implicit food memory for taste than context associations

    NARCIS (Netherlands)

    Hoogeveen, Heleen R.; Jolij, Jacob; ter Horst, Gert J.; Lorist, Monicque M.

    2015-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the

  19. Industrial hemp decreases intestinal motility stronger than indian hemp in mice.

    Science.gov (United States)

    Sabo, A; Horvat, O; Stilinovic, N; Berenji, J; Vukmirovic, S

    2013-02-01

    Indian hemp has shown beneficial effects in various gastrointestinal conditions but it is not widely accepted due to high content of tetrahydrocannabinol resulting in unwanted psychotropic effects. Since industrial hemp rich in cannabidiol lacks psychotropic effects the aim of research was to study the effects of industrial hemp on intestinal motility. Animals were randomly divided in six groups (each group consisting of 6 animals): Control group, Cind group - receiving indian hemp infuse for 20 days, Cids group-receiving industrial hemp infuse for 20 days, M group - treated with single dose of morphine (5 mg/kg i.m.) Cind+M group - treated with indian hemp infuse and single dose of morphine (5 mg/kg i.m.), Cids+M - treated with industrial hemp infuse and single dose of morphine (5 mg/kg i.m.). On the 20th day of the study animals were administered charcoal meal, and were sacrificed 35 minutes after administration. Intestinal motility was estimated according to distance between carbo medicinalis and cecum in centimeters. Decrease of intestinal motility in animals treated with indian hemp infuse was not significant compared to controls and it was smaller compared to animals treated with morphine (Indian hemp =15.43±10.5 cm, morphine = 20.14±5.87 cm). Strongest decrease of intestinal motility was recorded in animals treated with industrial hemp infuse, and it was significant compared to controls and morphine (industrial hemp = 26.5±9.90 cm, morphine = 20.14±5.87 cm; p hemp infuse rich in cannabidiol reduces intestinal motility in healthy mice cannabidiol should be further evaluated for the treatment of intestinal hypermotility.

  20. Alternative Processing Method Leads to Stronger Sapphire-Reinforced Alumina Composites

    Science.gov (United States)

    Jaskowiak, Martha H.

    1997-01-01

    The development of advanced engines for aerospace applications depends on the availability of strong, tough materials that can withstand increasingly higher temperatures under oxidizing conditions. The need for such materials led to the study of an oxide-based composite composed of an alumina matrix reinforced with zirconia-coated sapphire fibers. Because the nonbrittle behavior of this system depends on the interface and its ability to prevent fiber-to-matrix bonding and reduce interfacial shear stress, the microstructure of the zirconia must be carefully controlled during both coating application and composite processing. When it was both porous and unstabilized, zirconia (which does not react easily with alumina) was found to be the most effective material tested in reducing interfacial shear strength between the fiber and matrix.

  1. Habit doesn't make the predictions stronger: implicit alcohol associations and habitualness predict drinking uniquely.

    Science.gov (United States)

    Lindgren, Kristen P; Neighbors, Clayton; Teachman, Bethany A; Gasser, Melissa L; Kaysen, Debra; Norris, Jeanette; Wiers, Reinout W

    2015-06-01

    As research on implicit (in the sense of fast/reflexive/impulsive) alcohol associations and alcohol advances, there is increasing emphasis on understanding the circumstances under which implicit alcohol associations predict drinking. In this study, we investigated habitualness of drinking (i.e., the extent to which drinking is automatic or occurs without thinking) as a moderator of the relations between several measures of implicit alcohol associations and key drinking outcomes. A sample of 506 participants (57% female) completed web-based measures of implicit alcohol associations (drinking identity, alcohol approach, and alcohol excitement), along with indicators of habitualness, and typical alcohol consumption, alcohol problems, and risk of alcohol use disorders. As expected, implicit alcohol associations, especially drinking identity, were positively associated with, and predicted unique variance in, drinking outcomes. Further, habitualness emerged as a consistent, positive predictor of drinking outcomes. Contrary to expectations, habitualness rarely moderated the relation between implicit alcohol associations and drinking outcomes. Although moderation was rarely observed, findings indicated that even mild levels of habitualness are risky. Findings also continue to support implicit alcohol associations, particularly drinking identity, as a risk factor for hazardous drinking. Collectively, this suggests the importance of targeting both in prevention and intervention efforts. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Habit doesn't make the predictions stronger: Implicit alcohol associations and habitualness predict drinking uniquely

    NARCIS (Netherlands)

    Lindgren, K.P.; Neighbors, C.; Teachman, B.A.; Gasser, M.L.; Kaysen, D.; Norris, J.; Wiers, R.W.

    2015-01-01

    Introduction: As research on implicit (in the sense of fast/reflexive/impulsive) alcohol associations and alcohol advances, there is increasing emphasis on understanding the circumstances under which implicit alcohol associations predict drinking. In this study, we investigated habitualness of

  3. "Stronger in Their Presence": Being and Becoming a Teacher of Color.

    Science.gov (United States)

    Toppin, Reeda; Levine, Linda

    This paper is based on open-ended group interviews with 11 graduate students of color who had tried and rejected other occupations (such as journalism, marketing, nutrition, social work, youth counseling, secretarial work, waitressing, fashion merchandising, theater, medical claims examiner, and public relations) for teaching. The study examined:…

  4. Global dimming and urbanization: did stronger negative SSR trends collocate with regions of population growth?

    Science.gov (United States)

    Imamovic, Adel; Tanaka, Katsumasa; Folini, Doris; Wild, Martin

    2016-04-01

    Global dimming refers to the decrease in surface solar radiation (SSR) observed from the 1960s to the 1980s at different measurement sites all around the world. It is under debate whether anthropogenic aerosols emitted from urban areas close to the measurement sites are mainly responsible for the dimming. In order to assess this urbanization impact on SSR, we use spatially explicit population density data of 0.08° resolution to construct population indices (PI) at 157 high data quality sites. Our study extends previous population-based studies by incorporating distance-weighting as a simple aerosol diffusion model. We measured urbanization in the surrounding of a site as the PI change form 1960 to 1990 and found no negative correlation with the corresponding SSR trends from 1964 to 1989 for the 92 sites in Europe and Japan. For the 39 sites in China the correlation coefficients are significant at the 5 % level and reach around -0.35, while for the 26 remaining Asian, mostly Russian sites the correlation coefficients reach around -0.55 at the 1 % significance level. Results are similar, when the absolute levels of PIs are taken as an indicator for urbanization. Our findings call into question the existence of an urbanization effect for the sites in Europe and Japan, while such an effect cannot be ruled out for the sites in Asia, especially in Russia.

  5. New Voices Ancient Words: Language Immersion Produces Fluent Speakers, Stronger Personal and Cultural Identities

    Science.gov (United States)

    Pease, Janine

    2004-01-01

    Across Indian Country, people can hear voices speaking ancient words, in a Cochiti extended family in New Mexico, a Navajo community school on the Arizona desert, a Native Hawaiian kindergarten, a Salish/Kootenai summertime ceremony, on the North Dakota plains, and in a Blackfeet math classroom in Montana. Unlike other language instruction…

  6. Histone Acetylation is Recruited in Consolidation as a Molecular Feature of Stronger Memories

    Science.gov (United States)

    Federman, Noel; Fustinana, Maria Sol; Romano, Arturo

    2009-01-01

    Gene expression is a key process for memory consolidation. Recently, the participation of epigenetic mechanisms like histone acetylation was evidenced in long-term memories. However, until now the training strength required and the persistence of the chromatin acetylation recruited are not well characterized. Here we studied whether histone…

  7. Implementing a stronger patient safety program using the Internet takes step-by-step planning.

    Science.gov (United States)

    Atherton, T

    2001-11-01

    Just over a year ago at the 104-bed Baylor Medical Center at Grapevine in Texas, supporting patient safety meant mostly relying on paper to get the job done. Now, it means going online to report adverse events and close calls--and promote patient safety.

  8. MDs, medical organizations urged to take stronger stand on human-rights abuses

    OpenAIRE

    Sullivan, Patrick

    1996-01-01

    At its recent annual meeting the CMA protested the imprisonment of a physician by the Nigerian government, which also cancelled the annual meeting of the Nigerian Medical Association. A Toronto psychiatrist wants medical organizations and individual physicians to make such protests routine.

  9. Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations

    OpenAIRE

    Hoogeveen, Heleen R.; Jolij, Jacob; ter Horst, Gert J.; Lorist, Monicque M.

    2016-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the actual perception of a food's sensory properties, and therefore highly rely on previous experiences of similar consumptions stored in memory. In this study we assessed the differential strength of...

  10. "This one is stronger" : Spotlights on the lifelong learning professional-in-action

    NARCIS (Netherlands)

    van der Linden, Josje

    2016-01-01

    Om te kunnen omgaan met de veranderende realiteit in leven en werk, wordt wereldwijd een leven lang leren aangemoedigd. Het vierde duurzame ontwikkelingsdoel, vastgesteld in september 2015, weerspiegelt dit: “het verzekeren van kwalitatief goed onderwijs en het bevorderen van de mogelijkheden om een

  11. Command and Control of the Second Infantry Division - Route to a Stronger Alliance

    National Research Council Canada - National Science Library

    Stackpole, Patrick

    2004-01-01

    .... From the standpoint of peacetime maneuver and training in the increasingly restricted terrain command and control links and procedures the all-important personal ties necessary to function in Korean...

  12. Harder, Better, Faster, Stronger Convergence Rates for Least-Squares Regression

    OpenAIRE

    Dieuleveut, Aymeric; Flammarion, Nicolas; Bach, Francis

    2017-01-01

    International audience; We consider the optimization of a quadratic objective function whose gradients are only accessible through a stochastic oracle that returns the gradient at any given point plus a zero-mean finite variance random error. We present the first algorithm that achieves jointly the optimal prediction error rates for least-squares regression, both in terms of forgetting of initial conditions in O(1/n 2), and in terms of dependence on the noise and dimension d of the problem, a...

  13. Does academic performance or personal growth share a stronger association with learning environment perception?

    Science.gov (United States)

    Colbert-Getz, Jorie M; Tackett, Sean; Wright, Scott M; Shochet, Robert S

    2016-08-28

    This study was conducted to characterize the relative strength of associations of learning environment perception with academic performance and with personal growth. In 2012-2014 second and third year students at Johns Hopkins University School of Medicine completed a learning environment survey and personal growth scale. Hierarchical linear regression analysis was employed to determine if the proportion of variance in learning environment scores accounted for by personal growth was significantly larger than the proportion accounted for by academic performance (course/clerkship grades). The proportion of variance in learning environment scores accounted for by personal growth was larger than the proportion accounted for by academic performance in year 2 [R(2)Δ of 0.09, F(1,175) = 14.99,  p Learning environment scores shared a small amount of variance with academic performance in years 2 and 3.  The amount of variance between learning environment scores and personal growth was small in year 2 and large in year 3. Since supportive learning environments are essential for medical education, future work must determine if enhancing personal growth prior to and during the clerkship year will increase learning environment perception.

  14. Stronger evidence for own-age effects in memory for older as compared to younger adults

    Czech Academy of Sciences Publication Activity Database

    Freund, A.M.; Kouřilová, Sylvie; Kuhl, P.

    2011-01-01

    Roč. 19, č. 5 (2011), s. 429-448 ISSN 0965-8211 Institutional research plan: CEZ:AV0Z70250504 Keywords : own- age effect * memory bias * age relevance * age ing Subject RIV: AN - Psychology Impact factor: 2.089, year: 2011

  15. Climate change threatens endangered plant species by stronger and interacting water-related stresses

    NARCIS (Netherlands)

    Bartholomeus, R.P.; Witte, J.P.M.; Bodegom, van P.M.; Dam, van J.C.; Aerts, R.

    2011-01-01

    Atmospheric CO2-concentration, temperature and rainfall variability are all expected to increase in the near future. The resulting increased dynamics of soil moisture contents, together with increased plant physiological demands for both oxygen and water, will lead to an increased occurrence of wet

  16. Stronger than the sum of its parts? The performance implications of peer control combinations in teams

    NARCIS (Netherlands)

    de Jong, Bart A.; Bijlsma-Frankema, Katinka M.; Cardinal, Laura B.

    2014-01-01

    Integrating theorizing on situational strength and complementarity with control theory, we investigate the mediating processes that transmit peer control combination effects to team performance. We argue that two critical peer control mechanisms-norm strength and peer pressure-complement each other

  17. Stream habitat or water quality - what influences stronger fish and macrozoobenthos biodiversity?

    Czech Academy of Sciences Publication Activity Database

    Adámek, Z.; Jurajda, Pavel

    2001-01-01

    Roč. 1, č. 3 (2001), s. 305-311 ISSN 1642-3593. [Ecohydrology as a tool for restoration of physically degraded fish habitats. Warsaw, 11.06.2001-13.06.2001] Institutional research plan: CEZ:AV0Z6093917 Keywords : stream ecology * water quality * fish communities Subject RIV: EH - Ecology, Behaviour

  18. Oxytocin's impact on social face processing is stronger in homosexual than heterosexual men.

    Science.gov (United States)

    Thienel, Matthias; Heinrichs, Markus; Fischer, Stefan; Ott, Volker; Born, Jan; Hallschmid, Manfred

    2014-01-01

    Oxytocin is an evolutionarily highly preserved neuropeptide that contributes to the regulation of social interactions including the processing of facial stimuli. We hypothesized that its improving effect on social approach behavior depends on perceived sexual features and, consequently, on sexual orientation. In 19 homosexual and 18 heterosexual healthy young men, we investigated the acute effect of intranasal oxytocin (24IU) and placebo, respectively, on the processing of social stimuli as assessed by ratings of trustworthiness, attractiveness and approachability for male and female faces. Faces were each presented with a neutral, a happy, and an angry expression, respectively. In heterosexual subjects, the effect of oxytocin administration was restricted to a decrease in ratings of trustworthiness for angry female faces (poxytocin administration robustly increased ratings of attractiveness and approachability for male faces regardless of the facial expression (all p ≤ 0.05), as well as ratings of approachability for happy female faces (poxytocin's enhancing impact on social approach tendencies, suggesting that differences in sexual orientation imply differential oxytocinergic signaling. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Geographical constraints are stronger than invasion patterns for European urban floras

    Czech Academy of Sciences Publication Activity Database

    Ricotta, C.; Celesti-Grapow, L.; Kühn, I.; Rapson, G.; Pyšek, Petr; La Sorte, F. A.; Thompson, K.

    2014-01-01

    Roč. 9, č. 1 (2014), s. 1-6, e85661 E-ISSN 1932-6203 Institutional support: RVO:67985939 Keywords : urban floras * plant invasions * Europe Subject RIV: EF - Botanics Impact factor: 3.234, year: 2014