Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

DEFF Research Database (Denmark)

Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

2008-01-01

  TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

Directory of Open Access Journals (Sweden)

Siyun Xu

2014-10-01

Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

Science.gov (United States)

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-04-12

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

Exercise training raises daily activity stronger than predicted from exercise capacity in patients with COPD.

Science.gov (United States)

Behnke, Michaela; Wewel, Alexandra R; Kirsten, Detlef; Jörres, Rudolf A; Magnussen, Helgo

2005-06-01

The 6-min walking (6MWD) and 6-min treadmill distance (6MTD) are often used as measures of exercise performance in patients with COPD. The aim of our study was to assess their relationship to daily activity in the course of an exercise training program. Eighty-eight patients with stable COPD (71m/17f; mean +/- SD age, 60 +/-8 year; FEV1, 43+/-14% pred) were recruited, 66 of whom performed a hospital-based 10-day walking training, whereas 22 were treated as control. On day 16MTD, and on days 8 and 10, 6MTD and 6MWD were determined. In addition, patients used an accelerometer (TriTrac-R3D) to record 24 h-activity, whereby training sessions were excluded. In both groups there was a linear relationship (r > or = 0.84 and P daily activity did not markedly vary with exercise capacity under baseline conditions. Participation in a training program increased activity significantly stronger than predicted from the gain in exercise capacity. This underlines the importance of non-physiological, patient-centered factors associated with training in COPD.

Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

Directory of Open Access Journals (Sweden)

Pham PV

2012-05-01

Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

Directory of Open Access Journals (Sweden)

Glen John McIntyre

Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

Stronger Schrödinger-like uncertainty relations

International Nuclear Information System (INIS)

Song, Qiu-Cheng; Qiao, Cong-Feng

2016-01-01

Highlights: • A stronger Schrödinger-like uncertainty relation in the sum of variances of two observables is obtained. • An improved Schrödinger-like uncertainty relation in the product of variances of two observables is obtained. • A stronger uncertainty relation in the sum of variances of three observables is proposed. - Abstract: Uncertainty relation is one of the fundamental building blocks of quantum theory. Nevertheless, the traditional uncertainty relations do not fully capture the concept of incompatible observables. Here we present a stronger Schrödinger-like uncertainty relation, which is stronger than the relation recently derived by Maccone and Pati (2014) [11]. Furthermore, we give an additive uncertainty relation which holds for three incompatible observables, which is stronger than the relation newly obtained by Kechrimparis and Weigert (2014) [12] and the simple extension of the Schrödinger uncertainty relation.

In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

Directory of Open Access Journals (Sweden)

Che-Ming Liu

Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

Science.gov (United States)

Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

2018-01-01

Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

Female Psychology in August Strindberg's the Stronger

OpenAIRE

Sutandio, Anton; Apriliani, Erica

2017-01-01

This research aimed to offer interpretations of August Strindberg's The Stronger through the lens of female psychology. The Stronger is unique as it seemed very simple yet so intense and powerful with layers of interpretations. Written during 1888-1889, The Stronger, which only had two characters and only one speaking character, had become one of Strindberg's shortest yet important plays during his career. The female psychology approach used in the analysis would cover the discussion of gende...

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Stronger Fire-Resistant Epoxies

Science.gov (United States)

Fohlen, George M.; Parker, John A.; Kumar, Devendra

1988-01-01

New curing agent improves mechanical properties and works at lower temperature. Use of aminophenoxycyclotriphosphazene curing agents yields stronger, more heat- and fire-resistant epoxy resins. Used with solvent if necessary for coating fabrics or casting films.

Prospects for stronger calandria tubes

International Nuclear Information System (INIS)

Ells, C.E.; Coleman, C.E.; Hosbons, R.R.; Ibrahim, E.F.; Doubt, G.L.

1990-12-01

The CANDU calandria tubes, made of seam welded and annealed Zircaloy-2, have given exemplary service in-reactor. Although not designed as a system pressure containment, calandria tubes may remain intact even in the face of pressure tube rupture. One such incident at Pickering Unit 2 demonstrated the economic advantage of such an outcome, and a case can be made for increasing the probability that other calandria tubes would perform in a similar fashion. Various methods of obtaining stronger calandria tubes are available, and reviewed here. When the tubes are internally pressurized, the weld is the weak section of the tube. Increasing the oxygen concentration in the starting sheet, and thickening the weld, are promising routes to a stronger tube

Bactericidal activity of LFchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides.

Science.gov (United States)

Bolscher, Jan G M; Adão, Regina; Nazmi, Kamran; van den Keybus, Petra A M; van 't Hof, Wim; Nieuw Amerongen, Arie V; Bastos, Margarida; Veerman, Enno C I

2009-01-01

The innate immunity factor lactoferrin harbours two antimicrobial moieties, lactoferricin and lactoferrampin, situated in close proximity in the N1 domain of the molecule. Most likely they cooperate in many of the beneficial activities of lactoferrin. To investigate whether chimerization of both peptides forms a functional unit we designed a chimerical structure containing lactoferricin amino acids 17-30 and lactoferrampin amino acids 265-284. The bactericidal activity of this LFchimera was found to be drastically stronger than that of the constituent peptides, as was demonstrated by the need for lower dose, shorter incubation time and less ionic strength dependency. Likewise, strongly enhanced interaction with negatively charged model membranes was found for the LFchimera relative to the constituent peptides. Thus, chimerization of the two antimicrobial peptides resembling their structural orientation in the native molecule strikingly improves their biological activity.

Female Psychology in August Strindberg’s The Stronger

Directory of Open Access Journals (Sweden)

Anton Sutandio

2017-11-01

Full Text Available This research aimed to offer interpretations of August Strindberg’s The Stronger through the lens of female psychology. The Stronger is unique as it seemed very simple yet so intense and powerful with layers of interpretations. Written during 1888-1889, The Stronger, which only had two characters and only one speaking character, had become one of Strindberg’s shortest yet important plays during his career. The female psychology approach used in the analysis would cover the discussion of gender role, women’s self-esteem, competition for males, women’s friendships, ego style, and female psychology. It was an interdisciplinary research that combined structuralist, historical, biographical, and feminist approach to gain a better interpretation on the play. By referring to three different sources on the concept of female psychology, the analysis offered different and interesting interpretations on the nature and dynamics of the two female characters’ relationship. The Stronger has shown an enigmatic attraction in Strindberg’s authorship in which the readers could see the co-existence, collision, conflict, and merge of different paradigms concerning sex, gender, and sexuality.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

Science.gov (United States)

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

BUILDING STRONGER STATE ENERGY PARTNERSHIPS WITH THE U.S. DEPARTMENT OF ENERGY

Energy Technology Data Exchange (ETDEWEB)

Kate Burke

2002-11-01

This technical progress report includes an update of the progress during the second year of cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. The report also describes the barriers in conduct of the effort, and our assessment of future progress and activities.

The Educational Program "Zajedno Jaci" (Stronger Together) in Croatia

Science.gov (United States)

Spanja, Sanja

2011-01-01

In this paper, we explore intercultural learning undertaken through the educational program "Stronger Together." The program "Stronger Together" was created in 1998 in order to support and educate teachers working with children in post-war regions of Croatia using intercultural education and cooperative learning as tools for…

Stronger synergies

CERN Multimedia

Antonella Del Rosso

2012-01-01

CERN was founded 58 years ago under the auspices of UNESCO. Since then, both organisations have grown to become world leaders in their respective fields. The links between the two have always existed but today they are even stronger, with new projects under way to develop a more efficient way of exchanging information and devise a common strategy on topics of mutual interest.   CERN and UNESCO are a perfect example of natural partners: their common field is science and education is one of the pillars on which both are built. Historically, they share a common heritage. Both UNESCO and CERN were born of the desire to use scientific cooperation to rebuild peace and security in the aftermath of the Second World War. "Recently, building on our common roots and in close collaboration with UNESCO, we have been developing more structured links to ensure the continuity of the actions taken over the years," says Maurizio Bona, who is in charge of CERN relations with international orga...

Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

Directory of Open Access Journals (Sweden)

Bojie Hu

2014-01-01

Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

Science.gov (United States)

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

Science.gov (United States)

Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

2010-02-01

Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

Science.gov (United States)

van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

2018-01-01

To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

When surging seas meet stronger rain: Nuclear techniques in flood management

International Nuclear Information System (INIS)

Quevenco, Rodolfo

2015-01-01

Unusually high rainfall in many parts of the world is a result of climate change, scientists say. Since warmer air can hold more water, the rationale goes, increased temperatures will increase the chances of stronger rainfall events. And when surging seas combine with stronger rain, the outcome is almost certain: floods. Floods are the most frequently occurring natural disasters, and south-east Asia is particularly vulnerable. Climate change and variability are expected to bring about increased typhoon activities, rising sea levels and off-season monsoon rains in southeast Asia and other regions. These can cause devastating floods in countries like Cambodia, Laos, Pakistan, the Philippines, Thailand and Viet Nam. For the residents of these countries who have survived the ravages of major floods, the road to recovery can be long and arduous. As the flood water recedes, they have to contend with new forms of flood: floods of concern and worries as to how to rebuild their houses, their lives and their cities. Governments, too, face huge challenges in rebuilding roads, public buildings, infrastructure and natural resources destroyed or polluted by the flood.

Predatory blue crabs induce stronger nonconsumptive effects in eastern oysters Crassostrea virginica than scavenging blue crabs

Directory of Open Access Journals (Sweden)

Avery E. Scherer

2017-02-01

Full Text Available By influencing critical prey traits such as foraging or habitat selection, predators can affect entire ecosystems, but the nature of cues that trigger prey reactions to predators are not well understood. Predators may scavenge to supplement their energetic needs and scavenging frequency may vary among individuals within a species due to preferences and prey availability. Yet prey reactions to consumers that are primarily scavengers versus those that are active foragers have not been investigated, even though variation in prey reactions to scavengers or predators might influence cascading nonconsumptive effects in food webs. Oysters Crassostrea virginica react to crab predators by growing stronger shells. We exposed oysters to exudates from crabs fed live oysters or fed aged oyster tissue to simulate scavenging, and to controls without crab cues. Oysters grew stronger shells when exposed to either crab exudate, but their shells were significantly stronger when crabs were fed live oysters. The stronger response to predators than scavengers could be due to inherent differences in diet cues representative of reduced risk in the presence of scavengers or to degradation of conspecific alarm cues in aged treatments, which may mask risk from potential predators subsisting by scavenging.

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

Science.gov (United States)

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

Women's political participation leads to stronger local economies ...

International Development Research Centre (IDRC) Digital Library (Canada)

2016-06-08

Jun 8, 2016 ... Under changes to India's constitution, Indian women are gaining a stronger ... Legal reforms are encouraging women to contribute to economic growth ... on a panel on empowering women entrepreneurs at IDRC in Ottawa.

Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

Science.gov (United States)

Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

2013-01-01

Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

The right of the stronger: The play Sisyphus and critias

Directory of Open Access Journals (Sweden)

Jordović Ivan

2004-01-01

Full Text Available The Focus of this study is the standpoint of the play Sisyphus and critias the leader of the thirty towards the right of the stronger. this is a question of constant interest in scientific circles, since its answer can serve as the indicator of the influence this famous theory has had. this interest has been encouraged by the fact that critias’ authorship of the play is questionable. however, the question of the author is not of primary importance for this article, because there are some arguments, among some well known ones, which were not considered and which Show that in this satire, regardless of the author and the purpose of this fragment, the right of the stronger is actually non-existant. the first argument to support this theory is that nomosphysis antithesis is nowhere explicitly mentioned although it is the crucial element of the right of the stronger. in addition there is no claim in the play that the exploitation of the strong by the week or by law accrued. the second argument is that despite the incapability of laws to prevent the secret injustice, they and their importance for the human society are depicted in a positive light. it should also be noted that, unlike callicles and glaucon, laws are created to stop the bad and not the good. the third argument is that the invention of religion is accepted as a positive achievement, which finally enables the overcoming of primeval times and lawlessness. the reflection of this argument is a positive characterization of the individual who invented the fear of gods. the fourth argument, which has not been taken into consideration so far is the way the supporters and opponents of lawlessness are described and marked as κακοί and έσξλοί in the satire only physically strong are considered as strong as opposed to callicles, where they are also spiritually superior. intelectually superior in Sisyphus is the inventor of the fear of gods who is also in favor of law and order. the fact

Women's political participation leads to stronger local economies ...

International Development Research Centre (IDRC) Digital Library (Canada)

Edgard Rodriguez - IDRC. Women attend a self-help group meeting near Hyderabad, India. Keenara Khanderia. Under changes to India's constitution, Indian women are gaining a stronger political voice. Legal reforms are encouraging women to contribute to economic growth and investments in community growth.

Building Stronger State Energy Partnerships with the U.S. Department of Energy

Energy Technology Data Exchange (ETDEWEB)

Marks, Kate

2011-09-30

This final technical report details the results of total work efforts and progress made from October 2007 – September 2011 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-07NT43264, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Energy Assurance and Critical Infrastructure, State and Regional Technical Assistance, Regional Initiative, Regional Coordination and Technical Assistance, and International Activities in China. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-02-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

Directory of Open Access Journals (Sweden)

Shin-ichiro Kojima

2014-05-01

Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

Kaempferol induces autophagic cell death of hepatocellular carcinoma cells via activating AMPK signaling.

Science.gov (United States)

Han, Bing; Yu, Yi-Qun; Yang, Qi-Lian; Shen, Chun-Ying; Wang, Xiao-Juan

2017-10-17

In the present study, we demonstrate that Kaempferol inhibited survival and proliferation of established human hepatocellular carcinoma (HCC) cell lines (HepG2, Huh-7, BEL7402, and SMMC) and primary human HCC cells. Kaempferol treatment in HCC cells induced profound AMP-activated protein kinase (AMPK) activation, which led to Ulk1 phosphorylation, mTOR complex 1 inhibition and cell autophagy. Autophagy induction was reflected by Beclin-1/autophagy gene 5 upregulation and p62 degradation as well as light chain 3B (LC3B)-I to LC3B-II conversion and LC3B puncta formation. Inhibition of AMPK, via AMPKα1 shRNA or dominant negative mutation, reversed above signaling changes. AMPK inhibition also largely inhibited Kaempferol-induced cytotoxicity in HCC cells. Autophagy inhibition, by 3-methyaldenine or Beclin-1 shRNA, also protected HCC cells from Kaempferol. Kaempferol downregulated melanoma antigen 6, the AMPK ubiquitin ligase, causing AMPKα1 stabilization and accumulation. We conclude that Kaempferol inhibits human HCC cells via activating AMPK signaling.

Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

Energy Technology Data Exchange (ETDEWEB)

Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

2016-01-15

Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

LHC Season 2: A stronger machine

CERN Multimedia

Dominguez, Daniel

2015-01-01

1) New magnets / De nouveaux aimants 2) Stronger connections / Des jonctions électriques renforcées 3) Safer magnets / Des aimants plus sûrs 4) Higher energy beams / Des faisceaux d’énergie plus élevée 5) Narrower beams / Des faisceaux plus serrés 6) Smaller but closer proton packets / Des groupes de protons plus petits mais plus rapprochés 7) Higher voltage / Une tension plus haute 8) Superior cryogenics / Un système cryogénique amélioré 9) Radiation-resistant electronics / Une électronique qui résiste aux radiations 10) More secure vacuum / Un vide plus sûr

Lower-Body Muscle Structure and Jump Performance of Stronger and Weaker Surfing Athletes.

Science.gov (United States)

Secomb, Josh L; Nimphius, Sophia; Farley, Oliver R; Lundgren, Lina; Tran, Tai T; Sheppard, Jeremy M

2016-07-01

To identify whether there are any significant differences in the lower-body muscle structure and countermovement-jump (CMJ) and squat-jump (SJ) performance between stronger and weaker surfing athletes. Twenty elite male surfers had their lower-body muscle structure assessed with ultrasonography and completed a series of lower-body strength and jump tests including isometric midthigh pull (IMTP), CMJ, and SJ. Athletes were separated into stronger (n = 10) and weaker (n = 10) groups based on IMTP performance. Large significant differences were identified between the groups for vastus lateralis (VL) thickness (P = .02, ES = 1.22) and lateral gastrocnemius (LG) pennation angle (P = .01, ES = 1.20), and a large nonsignificant difference was identified in LG thickness (P = .08, ES = 0.89). Furthermore, significant differences were present between the groups for peak force, relative peak force, and jump height in the CMJ and SJ (P Stronger surfing athletes in this study had greater VL and LG thickness and LG pennation angle. These muscle structures may explain their better performance in the CMJ and SJ. A unique finding in this study was that the stronger group appeared to better use their strength and muscle structure for braking as they had significantly higher eccentric peak velocity and vertical displacement during the CMJ. This enhanced eccentric phase may have resulted in a greater production and subsequent utilization of stored elastic strain energy that led to the significantly better CMJ performance in the stronger group.

A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

Science.gov (United States)

Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

2008-11-01

Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

Science.gov (United States)

Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

2017-01-03

Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

Science.gov (United States)

Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

2017-09-09

Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

Physical activity, obesity and mortality: does pattern of physical activity have stronger epidemiological associations?

DEFF Research Database (Denmark)

Bauman, Adrian E.; Grunseit, Anne C.; Rangul, Vegar

2017-01-01

Background: Most studies of physical activity (PA) epidemiology use behaviour measured at a single time-point. We examined whether 'PA patterns' (consistently low, consistently high or inconsistent PA levels over time) showed different epidemiological relationships for anthropometric and mortality...... and time 3, and sport and active travel at times 1 and 2 with BMI, waist, hip circumference and mortality (death from coronary heart disease (CHD) and cardiovascular disease (CVD)) were compared to 'PA patterns' spanning multiple time points. PA pattern classified participants' PA as either 1) inactive......: The moderately and highly active groups for PA at times 1 and 3 had up to 1.7 cm lower increase in waist circumference compared with the inactive/low active group. Across 'PA patterns', 'active maintainers' had a 2.0 cm lower waist circumference than 'inactive/low maintainers'. Waist circumference was inversely...

Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

Directory of Open Access Journals (Sweden)

Peng Cheng

2015-05-01

Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

A Stronger Reason for the Right to Sign Languages

Science.gov (United States)

Trovato, Sara

2013-01-01

Is the right to sign language only the right to a minority language? Holding a capability (not a disability) approach, and building on the psycholinguistic literature on sign language acquisition, I make the point that this right is of a stronger nature, since only sign languages can guarantee that each deaf child will properly develop the…

[Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

Science.gov (United States)

Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

2018-02-01

Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

Stronger vection in junior high school children than in adults.

Science.gov (United States)

Shirai, Nobu; Imura, Tomoko; Tamura, Rio; Seno, Takeharu

2014-01-01

Previous studies have shown that even elementary school-aged children (7 and 11 years old) experience visually induced perception of illusory self-motion (vection) (Lepecq et al., 1995, Perception, 24, 435-449) and that children of a similar age (mean age = 9.2 years) experience more rapid and stronger vection than do adults (Shirai et al., 2012, Perception, 41, 1399-1402). These findings imply that although elementary school-aged children experience vection, this ability is subject to further development. To examine the subsequent development of vection, we compared junior high school students' (N = 11, mean age = 14.4 years) and adults' (N = 10, mean age = 22.2 years) experiences of vection. Junior high school students reported significantly stronger vection than did adults, suggesting that the perceptual experience of junior high school students differs from that of adults with regard to vection and that this ability undergoes gradual changes over a relatively long period of development.

Regular exercisers have stronger pelvic floor muscles than nonregular exercisers at midpregnancy.

Science.gov (United States)

Bø, Kari; Ellstrøm Engh, Marie; Hilde, Gunvor

2018-04-01

Today all healthy pregnant women are encouraged to be physically active throughout pregnancy, with recommendations to participate in at least 30 minutes of aerobic activity on most days of the week in addition to performing strength training of the major muscle groups 2-3 days per week and also pelvic floor muscle training. There is, however, an ongoing debate whether general physical activity enhances or declines pelvic floor muscle function. The objectives of the study were to compare vaginal resting pressure, pelvic floor muscle strength, and endurance in regular exercisers (exercise ≥30 minutes 3 or more times per week) and nonexercisers at midpregnancy. Furthermore, another objective was to assess whether regular general exercise or pelvic floor muscle strength was associated with urinary incontinence. This was a cross-sectional study at mean gestational week 20.9 (±1.4) including 218 nulliparous pregnant women, with a mean age of 28.6 years (range, 19-40 years) and prepregnancy body mass index of 23.9 kg/m 2 (SD, 4.0). Vaginal resting pressure, pelvic floor muscle strength, and pelvic floor muscle endurance were measured by a high-precision pressure transducer connected to a vaginal balloon. The International Consultation on Incontinence Questionnaire Urinary Incontinence Short Form was used to assess urinary incontinence. Differences between groups were analyzed using an independent-sample Student t test. Linear regression analysis was conducted to adjust for prepregnancy body mass index, age, smoking during pregnancy, and regular pelvic floor muscle training during pregnancy. The significance value was set to P ≤ .05. Regular exercisers had statistically significant stronger (mean 6.4 cm H 2 O [95% confidence interval, 1.7-11.2]) and more enduring (mean 39.9 cm H 2 Osec [95% confidence interval, 42.2-75.7]) pelvic floor muscles. Only pelvic floor muscle strength remained statistically significant, when adjusting for possible confounders. Pelvic floor

Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

Science.gov (United States)

Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

2016-01-01

Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

States agree on stronger physical protection regime

International Nuclear Information System (INIS)

2005-01-01

Full text: Delegates from 89 countries agreed on 8 July to fundamental changes that will substantially strengthen the Convention on the Physical Protection of Nuclear Material (CPPNM). IAEA Director General Mohamed ElBaradei welcomed the agreement in saying 'This new and stronger treaty is an important step towards greater nuclear security by combating, preventing, and ultimately punishing those who would engage in nuclear theft, sabotage or even terrorism. It demonstrates that there is indeed a global commitment to remedy weaknesses in our nuclear security regime.' The amended CPPNM makes it legally binding for States Parties to protect nuclear facilities and material in peaceful domestic use, storage as well as transport. It will also provide for expanded cooperation between and among States regarding rapid measures to locate and recover stolen or smuggled nuclear material, mitigate any radiological consequences of sabotage, and prevent and combat related offences. The original CPPNM applied only to nuclear material in international transport. Conference President Dr. Alec Baer said 'All 89 delegations demonstrated real unity of purpose. They put aside some very genuine national concerns in favour of the global interest and the result is a much improved convention that is better suited to addressing the nuclear security challenges we currently face.' The new rules will come into effect once they have been ratified by two-thirds of the 112 States Parties of the Convention, expected to take several years. 'But concrete actions are already taking place around the world. For more than 3 years, the IAEA has been implementing a systematic Nuclear Security plan, including physical protection activities designed to prevent, detect and respond to malicious acts,' said Anita Nillson, Director of the IAEA's Office of Nuclear Security. The Agency's Nuclear Security Fund, set up after the events of 9/11, has delivered $19.5 million in practical assistance to 121 countries

In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

Science.gov (United States)

Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

2018-01-01

The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Stronger misdirection in curved than in straight motion

Directory of Open Access Journals (Sweden)

Jorge eOtero-Millan

2011-11-01

Full Text Available Illusions developed by magicians are a rich and largely untapped source of insight into perception and cognition. Here we show that curved motion, as employed by the magician in a classic sleight of hand trick, generates stronger misdirection than rectilinear motion, and that this difference can be explained by the differential engagement of the smooth pursuit and the saccadic oculomotor systems. This research moreover exemplifies how the magician’s intuitive understanding of the spectator’s mindset can surpass that of the cognitive scientist in specific instances, and that observation-based behavioral insights developed by magicians are worthy of quantitative investigation in the neuroscience laboratory.

Bell inequalities stronger than the Clauser-Horne-Shimony-Holt inequality for three-level isotropic states

International Nuclear Information System (INIS)

Ito, Tsuyoshi; Imai, Hiroshi; Avis, David

2006-01-01

We show that some two-party Bell inequalities with two-valued observables are stronger than the CHSH inequality for 3x3 isotropic states in the sense that they are violated by some isotropic states in the 3x3 system that do not violate the CHSH inequality. These Bell inequalities are obtained by applying triangular elimination to the list of known facet inequalities of the cut polytope on nine points. This gives a partial solution to an open problem posed by Collins and Gisin. The results of numerical optimization suggest that they are candidates for being stronger than the I 3322 Bell inequality for 3x3 isotropic states. On the other hand, we found no Bell inequalities stronger than the CHSH inequality for 2x2 isotropic states. In addition, we illustrate an inclusion relation among some Bell inequalities derived by triangular elimination

Stronger interference from distractors in the right hemifield during visual search.

Science.gov (United States)

Carlei, Christophe; Kerzel, Dirk

2018-03-01

The orientation-bias hypothesis states that there is a bias to attend to the right visual hemifield (RVF) when there is spatial competition between stimuli in the left and right hemifield [Pollmann, S. (1996). A pop-out induced extinction-like phenomenon in neurologically intact subjects. Neuropsychologia, 34(5), 413-425. doi: 10.1016/0028-3932(95)00125-5 ]. In support of this hypothesis, stronger interference was reported for RVF distractors with contralateral targets. In contrast, previous studies using rapid serial visual presentation (RSVP) found stronger interference from distractors in the left visual hemifield (LVF). We used the additional singleton paradigm to test whether this discrepancy was due to the different distractor features that were employed (colour vs. orientation). Interference from the colour distractor with contralateral targets was larger in the RVF than in the LVF. However, the asymmetrical interference disappeared when observers had to search for an inconspicuous colour target instead of the inconspicuous shape target. We suggest that the LVF orienting-bias is limited to situations where search is driven by bottom-up saliency (singleton search) instead of top-down search goals (feature search). In contrast, analysis of the literature suggests the opposite for the LVF bias in RSVP tasks. Thus, the attentional asymmetry may depend on whether the task involves temporal or spatial competition, and whether search is based on bottom-up or top-down signals.

The Integration Role of European Defense Procurement in Achieving a More Competitive and Stronger European Defense Equipment Market

Science.gov (United States)

2015-06-01

and systems, even monopolistic ) essence of the supply side of the defense market . There are only a few suppliers that can meet today’s complex...DEFENSE PROCUREMENT IN ACHIEVING A MORE COMPETITIVE AND STRONGER EUROPEAN DEFENSE EQUIPMENT MARKET by Kiril O. Angelov June 2015 Thesis Advisor...COMPETITIVE AND STRONGER EUROPEAN DEFENSE EQUIPMENT MARKET 5. FUNDING NUMBERS 6. AUTHOR(S) Kiril O. Angelov 7. PERFORMING ORGANIZATION NAME(S) AND

Kindlins, integrin activation and the regulation of talin recruitment to αIIbβ3.

Directory of Open Access Journals (Sweden)

Bryan N Kahner

Full Text Available Talins and kindlins bind to the integrin β3 cytoplasmic tail and both are required for effective activation of integrin αIIbβ3 and resulting high-affinity ligand binding in platelets. However, binding of the talin head domain alone to β3 is sufficient to activate purified integrin αIIbβ3 in vitro. Since talin is localized to the cytoplasm of unstimulated platelets, its re-localization to the plasma membrane and to the integrin is required for activation. Here we explored the mechanism whereby kindlins function as integrin co-activators. To test whether kindlins regulate talin recruitment to plasma membranes and to αIIbβ3, full-length talin and kindlin recruitment to β3 was studied using a reconstructed CHO cell model system that recapitulates agonist-induced αIIbβ3 activation. Over-expression of kindlin-2, the endogenous kindlin isoform in CHO cells, promoted PAR1-mediated and talin-dependent ligand binding. In contrast, shRNA knockdown of kindlin-2 inhibited ligand binding. However, depletion of kindlin-2 by shRNA did not affect talin recruitment to the plasma membrane, as assessed by sub-cellular fractionation, and neither over-expression of kindlins nor depletion of kindlin-2 affected talin interaction with αIIbβ3 in living cells, as monitored by bimolecular fluorescence complementation. Furthermore, talin failed to promote kindlin-2 association with αIIbβ3 in CHO cells. In addition, purified talin and kindlin-3, the kindlin isoform expressed in platelets, failed to promote each other's binding to the β3 cytoplasmic tail in vitro. Thus, kindlins do not promote initial talin recruitment to αIIbβ3, suggesting that they co-activate integrin through a mechanism independent of recruitment.

Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

Directory of Open Access Journals (Sweden)

Sylvie Rato

2010-02-01

Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

Gas Marbles: Much Stronger than Liquid Marbles

Science.gov (United States)

Timounay, Yousra; Pitois, Olivier; Rouyer, Florence

2017-06-01

Enwrapping liquid droplets with hydrophobic particles allows the manufacture of so-called "liquid marbles" [Aussillous and Quéré Nature (London) 411, 924 (2001); , 10.1038/35082026Mahadevan Nature (London)411, 895 (2001), 10.1038/35082164]. The recent intensive research devoted to liquid marbles is justified by their very unusual physical and chemical properties and by their potential for various applications, from microreactors to water storage, including water pollution sensors [Bormashenko Curr. Opin. Colloid Interface Sci. 16, 266 (2011), 10.1016/j.cocis.2010.12.002]. Here we demonstrate that this concept can be successfully applied for encapsulating and protecting small gas pockets within an air environment. Similarly to their liquid counterparts, those new soft-matter objects, that we call "gas marbles," can sustain external forces. We show that gas marbles are surprisingly tenfold stronger than liquid marbles and, more importantly, they can sustain both positive and negative pressure differences. This magnified strength is shown to originate from the strong cohesive nature of the shell. Those interesting properties could be exploited for imprisoning valuable or polluted gases or for designing new aerated materials.

EWS Knockdown and Taxifolin Treatment Induced Differentiation and Removed DNA Methylation from p53 Promoter to Promote Expression of Puma and Noxa for Apoptosis in Ewing's Sarcoma.

Science.gov (United States)

Hossain, Mohammad Motarab; Ray, Swapan Kumar

2014-10-01

Ewing's sarcoma is a pediatric tumor that mainly occurs in soft tissues and bones. Malignant characteristics of Ewing's sarcoma are correlated with expression of EWS oncogene. We achieved knockdown of EWS expression using a plasmid vector encoding EWS short hairpin RNA (shRNA) to increase anti-tumor mechanisms of taxifolin (TFL), a new flavonoid, in human Ewing's sarcoma cells in culture and animal models. Immunofluorescence microscopy and flow cytometric analysis showed high expression of EWS in human Ewing's sarcoma SK-N-MC and RD-ES cell lines. EWS shRNA plus TFL inhibited 80% cell viability and caused the highest decreases in EWS expression at mRNA and protein levels in both cell lines. Knockdown of EWS expression induced morphological features of differentiation. EWS shRNA plus TFL caused more alterations in molecular markers of differentiation than either agent alone. EWS shRNA plus TFL caused the highest decreases in cell migration with inhibition of survival, angiogenic and invasive factors. Knockdown of EWS expression was associated with removal of DNA methylation from p53 promoter, promoting expression of p53, Puma, and Noxa. EWS shRNA plus TFL induced the highest amounts of apoptosis with activation of extrinsic and intrinsic pathways in both cell lines in culture. EWS shRNA plus TFL also inhibited growth of Ewing's sarcoma tumors in animal models due to inhibition of differentiation inhibitors and angiogenic and invasive factors and also induction of activation of caspase-3 for apoptosis. Collectively, knockdown of EWS expression increased various anti-tumor mechanisms of TFL in human Ewing's sarcoma in cell culture and animal models.

Analogues of the Frog-skin Antimicrobial Peptide Temporin 1Tb Exhibit a Wider Spectrum of Activity and a Stronger Antibiofilm Potential as Compared to the Parental Peptide

Science.gov (United States)

Grassi, Lucia; Maisetta, Giuseppantonio; Maccari, Giuseppe; Esin, Semih; Batoni, Giovanna

2017-04-01

The frog skin-derived peptide Temporin 1Tb (TB) has gained increasing attention as novel antimicrobial agent for the treatment of antibiotic-resistant and/or biofilm-mediated infections. Nevertheless, such a peptide possesses a preferential spectrum of action against Gram-positive bacteria. In order to improve the therapeutic potential of TB, the present study evaluated the antibacterial and antibiofilm activities of two TB analogues against medically relevant bacterial species. Of the two analogues, TB_KKG6A has been previously described in the literature, while TB_L1FK is a new analogue designed by us through statistical-based computational strategies. Both TB analogues displayed a faster and stronger bactericidal activity than the parental peptide, especially against Gram-negative bacteria in planktonic form. Differently from the parental peptide, TB_KKG6A and TB_L1FK were able to inhibit the formation of Staphylococcus aureus biofilms by more than 50% at 12 μM, while only TB_KKG6A prevented the formation of Pseudomonas aeruginosa biofilms at 24 μM. A marked antibiofilm activity against preformed biofilms of both bacterial species was observed for the two TB analogues when used in combination with EDTA. Analysis of synergism at the cellular level suggested that the antibiofilm activity exerted by the peptide-EDTA combinations against mature biofilms might be due mainly to a disaggregating effect on the extracellular matrix in the case of S. aureus, and to a direct activity on biofilm-embedded cells in the case of P. aeruginosa. Both analogues displayed a low hemolytic effect at the active concentrations and, overall, TB_L1FK resulted less cytotoxic towards mammalian cells. Collectively, the results obtained demonstrated that subtle changes in the primary sequence of TB may provide TB analogues that, used alone or in combination with adjuvant molecules such as EDTA, exhibit promising features against both planktonic and biofilm cells of medically relevant

Stronger effects of Roundup than its active ingredient glyphosate in damselfly larvae.

Science.gov (United States)

Janssens, Lizanne; Stoks, Robby

2017-12-01

Pesticides are causing strong decreases in aquatic biodiversity at concentrations assumed safe by legislation. One reason for the failing risk assessment may be strong differences in the toxicity of the active ingredient of pesticides and their commercial formulations. Sublethal effects, especially those on behaviour, have been largely ignored in this context, yet can be equally important as lethal effects at the population and ecosystem levels. Here, we compared the toxicity of the herbicide Roundup and its active ingredient glyphosate on survival, but also on ecologically relevant sublethal traits (life history, behaviour and physiology) in damselfly larvae. Roundup was more toxic than glyphosate with negative effects on survival, behaviour and most of the physiological traits being present at lower concentrations (food intake, escape swimming speed) or even only present (survival, sugar and total energy content and muscle mass) following Roundup exposure. This confirms the toxicity of the surfactant POEA. Notably, also glyphosate was not harmless: a realistic concentration of 2mg/l resulted in reduced growth rate, escape swimming speed and fat content. Our results therefore indicate that the toxicity of Roundup cannot be fully attributed to its surfactant, thereby suggesting that also the new generation of glyphosate-based herbicides with other mixtures of surfactants likely will have adverse effects on non-target aquatic organisms. Ecotoxicological studies comparing the toxicity of active ingredients and their commercial formulations typically ignore behaviour while the here observed differential effects on behaviour likely will negatively impact damselfly populations. Our data highlight that risk assessment of pesticides ignoring sublethal effects may contribute to the negative effects of pesticides on aquatic biodiversity. Copyright © 2017 Elsevier B.V. All rights reserved.

Crosstalk in concurrent repeated games impedes direct reciprocity and requires stronger levels of forgiveness.

Science.gov (United States)

Reiter, Johannes G; Hilbe, Christian; Rand, David G; Chatterjee, Krishnendu; Nowak, Martin A

2018-02-07

Direct reciprocity is a mechanism for cooperation among humans. Many of our daily interactions are repeated. We interact repeatedly with our family, friends, colleagues, members of the local and even global community. In the theory of repeated games, it is a tacit assumption that the various games that a person plays simultaneously have no effect on each other. Here we introduce a general framework that allows us to analyze "crosstalk" between a player's concurrent games. In the presence of crosstalk, the action a person experiences in one game can alter the person's decision in another. We find that crosstalk impedes the maintenance of cooperation and requires stronger levels of forgiveness. The magnitude of the effect depends on the population structure. In more densely connected social groups, crosstalk has a stronger effect. A harsh retaliator, such as Tit-for-Tat, is unable to counteract crosstalk. The crosstalk framework provides a unified interpretation of direct and upstream reciprocity in the context of repeated games.

[Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

Science.gov (United States)

Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

2008-06-01

To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

Directory of Open Access Journals (Sweden)

Yong Wang

Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

Directory of Open Access Journals (Sweden)

Yang Xing

2009-07-01

Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

Stronger multilayer acrylic dielectric elastomer actuators with silicone gel coatings

Science.gov (United States)

Lau, Gih-Keong; La, Thanh-Giang; Sheng-Wei Foong, Ervin; Shrestha, Milan

2016-12-01

Multilayer dielectric elastomer actuators (DEA) perform worst off than single-layer DEAs due to higher susceptibility to electro-thermal breakdown. This paper presents a hot-spot model to predict the electro-thermal breakdown field of DEAs and its dependence on thermal insulation. To inhibit the electrothermal breakdown, silicone gel coating was applied as barrier coating to multilayer acrylic DEA. The gel coating helps suppress the electro-thermally induced puncturing of DEA membrane at the hot spot. As a result, the gel-coated DEAs, in either a single layer or a multilayer stack, can produce 30% more isometric stress change as compared to those none-coated. These gel-coated acrylic DEAs show great potential to make stronger artificial muscles.

Spectral intensity dependence an isotropy of sources stronger than 0.1 Jy at 2700 MHz

International Nuclear Information System (INIS)

Balonek, T.J.; Broderick, J.J.; Condon, J.J.; Crawford, D.F.; Jauncey, D.L.

1975-01-01

The 1000-foot (305 m) telescope of the National Astronomy and Ionosphere Center was used to measure 430 MHz flux densities of sources stronger than 0.1 Jy at 2700 MHz. Distributions of the resulting two-point spectral indices α (430, 2700) of sources in the intensity range 0.1less than or equal toS<0.35 Jy were compared with α (318, 2700) distributions of sources stronger than 0.35 Jy at 2700 MHz. The median normal-component spectral index and fraction of flat-spectrum sources in the faintest sample do not continue the previously discovered trend toward increased spectral steepening of faint sources. This result differs from the prediction of simple evolutionary cosmological models and therefore favors the alternative explanation that local source-density inhomogeneities are responsible for the observed intensity dependence of spectral indices

Strategy and your stronger hand.

Science.gov (United States)

Moore, Geoffrey A

2005-12-01

There are two kinds of businesses in the world, says the author. Knowing what they are--and which one your company is--will guide you to the right strategic moves. One kind includes businesses that compete on a complex-systems model. These companies have large enterprises as their primary customers. They seek to grow a customer base in the thousands, with no more than a handful of transactions per customer per year (indeed, in some years there may be none), and the average price per transaction ranges from six to seven figures. In this model, 1,000 enterprises each paying dollar 1 million per year would generate dollar 1 billion in annual revenue. The other kind of business competes on a volume-operations model. Here, vendors seek to acquire millions of customers, with tens or even hundreds of transactions per customer per year, at an average price of relatively few dollars per transaction. Under this model, it would take 10 million customers each spending dollar 8 per month to generate nearly dollar 1 billion in revenue. An examination of both models shows that they could not be further apart in their approach to every step along the classic value chain. The problem, though, is that companies in one camp often attempt to create new value by venturing into the other. In doing so, they fail to realize how their managerial habits have been shaped by the model they've grown up with. By analogy, they have a "handedness"--the equivalent of a person's right- or left-hand dominance--that makes them as adroit in one mode as they are awkward in the other. Unless you are in an industry whose structure forces you to attempt ambidexterity (in which case, special efforts are required to manage the inevitable dropped balls), you'll be far more successful making moves that favor your stronger hand.

Towards Antiviral shRNAs Based on the AgoshRNA Design.

Directory of Open Access Journals (Sweden)

Ying Poi Liu

Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

International Nuclear Information System (INIS)

Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan; Kim, Hyung Sik; Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung; Oh, Seon-Hee; Jun, Dae Won; Lee, Byung-Hoon

2017-01-01

Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

Energy Technology Data Exchange (ETDEWEB)

Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Hyung Sik [School of Pharmacy, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Oh, Seon-Hee [The Division of Natural Medical Sciences, College of Health Science, Chosun University, Gwangju 501-759 (Korea, Republic of); Jun, Dae Won [Internal Medicine, Hanyang University School of Medicine, Seoul 133-791 (Korea, Republic of); Lee, Byung-Hoon, E-mail: lee@snu.ac.kr [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of)

2017-02-01

Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

Adeno-Associated Viral Vector-Mediated mTOR Inhibition by Short Hairpin RNA Suppresses Laser-Induced Choroidal Neovascularization

Directory of Open Access Journals (Sweden)

Tae Kwann Park

2017-09-01

Full Text Available Choroidal neovascularization (CNV is the defining characteristic feature of the wet subtype of age-related macular degeneration (AMD and may result in irreversible blindness. Based on anti-vascular endothelial growth factor (anti-VEGF, the current therapeutic approaches to CNV are fraught with difficulties, and mammalian target of rapamycin (mTOR has recently been proposed as a possible therapeutic target, although few studies have been conducted. Here, we show that a recombinant adeno-associated virus-delivered mTOR-inhibiting short hairpin RNA (rAAV-mTOR shRNA, which blocks the activity of both mTOR complex 1 and 2, represents a promising therapeutic approach for the treatment of CNV. Eight-week-old male C57/B6 mice were treated with the short hairpin RNA (shRNA after generating CNV lesions in the eyes via laser photocoagulation. The recombinant adeno-associated virus (rAAV delivery vehicle was able to effectively transduce cells in the inner retina, and significantly fewer inflammatory cells and less extensive CNV were observed in the animals treated with rAAV-mTOR shRNA when compared with control- and rAAV-scrambled shRNA-treated groups. Presumably related to the reduction of CNV, increased autophagy was detected in CNV lesions treated with rAAV-mTOR shRNA, whereas significantly fewer apoptotic cells detected in the outer nuclear layer around the CNV indicate that mTOR inhibition may also have neuroprotective effects. Taken together, these results demonstrate the therapeutic potential of mTOR inhibition, resulting from rAAV-mTOR shRNA activity, in the treatment of AMD-related CNV. Keywords: retinal neovascularization, choroidal neovascularization, adeno-associated virus, mTOR, RNA interference, mTOR shRNA, autophagy

Sexual harassment and emotional and behavioural symptoms in adolescence: stronger associations among boys than girls.

Science.gov (United States)

Kaltiala-Heino, Riittakerttu; Fröjd, Sari; Marttunen, Mauri

2016-08-01

To study the associations between subjection to sexual harassment and emotional (depression) and behavioural (delinquency) symptoms among 14-to-18-year-old adolescents, and gender differences within these associations. 90,953 boys and 91,746 girls aged 14-18 participated in the School Health Promotion Study (SHPS), a school-based survey designed to examine the health, health behaviours, and school experiences of teenagers. Experiences of sexual harassment were elicited with five questions addressing five separate forms of harassment. Depression was measured by the 13-item Beck Depression Inventory and delinquency with a modified version of the International Self-Report Delinquency Study (ISRD) instrument. Data were analysed using cross-tabulations with Chi-square statistics and logistic regression. All sexual harassment experiences studied were associated with both depression (adjusted odds ratios varied from 2.2 to 2.7 in girls and from 2.0 to 5.1 in boys) and delinquency (adjusted odds ratios 3.1-5.0 in girls and 1.7-6.9 in boys). Sexual name-calling had a stronger association with depression and with delinquency in girls (adjusted odds ratios, respectively, 2.4 and 4.2), than in boys (adjusted odds ratios, respectively, 2.0 and 1.7), but otherwise stronger associations with emotional and behavioural symptoms were seen in boys. Subjection to sexual harassment is associated with both emotional and behavioural symptoms in both girls and boys. The associations are mostly stronger for boys. Boys subjected to sexual harassment may feel particularly threatened regarding their masculinity, and there may be less support available for boys traumatised due to sexual harassment.

Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus

Science.gov (United States)

Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

2015-01-01

Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA (shRNA) to suppress expression of the enzyme CYP46A1. This protein hydroxylates cholesterol and so facilitates trans-membrane extrusion. A sh-RNA CYP46A1construction coupled to an adeno-associated virus (AAV5) was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the CA3a region. Cytoplasmic and membrane cholesterol increased, neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, inter-ictal EEG events occurred during exploration and non-REM sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low amplitude, high-frequency oscillations of peak power at ~300Hz and a range of 250-350 Hz. While episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behavior PMID:25847620

Inhibition of STAT-3 results in radiosensitization of human squamous cell carcinoma

International Nuclear Information System (INIS)

Bonner, James A.; Trummell, Hoa Q.; Willey, Christopher D.; Plants, Brian A.; Raisch, Kevin P.

2009-01-01

Background: Signal transducer and activator of transcription-3 (STAT-3) is a downstream component of the Epidermal Growth Factor Receptor (EGFr) signaling process that may facilitate the resistance of tumor cells to conventional cancer treatments. Studies were performed to determine if inhibition of this downstream protein produces radiosensitization. Methods/Results: A431 cells (human squamous cell carcinoma cells with EGFr overexpression) were found to be sensitized to radiation after treatment with STAT-3 small interfering RNA (siRNA). Therefore, a short hairpin RNA (shRNA) against STAT-3 was designed and cloned into a pBABE vector system modified for shRNA expression. Following transfection, clone 2.1 was selected for further study as it showed a dramatic reduction of STAT-3 protein (and mRNA) when compared to A431 parental cells or a negative control shRNA cell line (transfected with STAT-3 shRNA with 2 base pairs mutated). A431 2.1 showed doubling times of 25-31 h as compared to 18-24 h for the parental cell line. The A431 shRNA knockdown STAT-3 cells A431 were more sensitive to radiation than A431 parental or negative STAT-3 control cells. Conclusion: A431 cells stably transfected with shRNA against STAT-3 resulted in enhanced radiosensitivity. Further work will be necessary to determine whether the inhibition of STAT-3 phosphorylation is a necessary step for the radiosensitization that is induced by the inhibition of EGFr.

Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors

Directory of Open Access Journals (Sweden)

Kruithof Egbert KO

2004-08-01

Full Text Available Abstract Background RNA interference (RNAi can potently reduce target gene expression in mammalian cells and is in wide use for loss-of-function studies. Several recent reports have demonstrated that short double-stranded RNAs (dsRNAs, used to mediate RNAi, can also induce an interferon-based response resulting in changes in the expression of many interferon-responsive genes. Off-target gene silencing has also been described, bringing into question the validity of certain RNAi-based approaches for studying gene function. We have targeted the plasminogen activator inhibitor-2 (PAI-2 or SERPINB2 mRNA using lentiviral vectors for delivery of U6 promoter-driven PAI-2-targeted short hairpin RNA (shRNA expression. PAI-2 is reported to have anti-apoptotic activity, thus reduction of endogenous expression may be expected to make cells more sensitive to programmed cell death. Results As expected, we encountered a cytotoxic phenotype when targeting the PAI-2 mRNA with vector-derived shRNA. However, this predicted phenotype was a potent non-specific effect of shRNA expression, as functional overexpression of the target protein failed to rescue the phenotype. By decreasing the shRNA length or modifying its sequence we maintained PAI-2 silencing and reduced, but did not eliminate, cytotoxicity. ShRNA of 21 complementary nucleotides (21 mers or more increased expression of the oligoadenylate synthase-1 (OAS1 interferon-responsive gene. 19 mer shRNA had no effect on OAS1 expression but long-term selective pressure on cell growth was observed. By lowering lentiviral vector titre we were able to reduce both expression of shRNA and induction of OAS1, without a major impact on the efficacy of gene silencing. Conclusions Our data demonstrate a rapid cytotoxic effect of shRNAs expressed in human tumor cell lines. There appears to be a cut-off of 21 complementary nucleotides below which there is no interferon response while target gene silencing is maintained

Daytime warming has stronger negative effects on soil nematodes than night-time warming

OpenAIRE

Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

2017-01-01

Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatmen...

A Human Capital Framework for a Stronger Teacher Workforce. Advancing Teaching--Improving Learning. White Paper

Science.gov (United States)

Myung, Jeannie; Martinez, Krissia; Nordstrum, Lee

2013-01-01

Building a stronger teacher workforce requires the thoughtful orchestration of multiple processes working together in a human capital system. This white paper presents a framework that can be used to take stock of current efforts to enhance the teacher workforce in school districts or educational organizations, as well as their underlying theories…

A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

DEFF Research Database (Denmark)

Heydorn, S; Andersen, K E; Johansen, J D

2003-01-01

Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...

Fathers see stronger family resemblances than non-fathers in unrelated children's faces.

Science.gov (United States)

Bressan, Paola; Dal Pos, Stefania

2012-12-01

Even after they have taken all reasonable measures to decrease the probability that their spouses cheat on them, men still face paternal uncertainty. Such uncertainty can lead to paternal disinvestment, which reduces the children's probability to survive and reproduce, and thus the reproductive success of the fathers themselves. A theoretical model shows that, other things being equal, men who feel confident that they have fathered their spouses' offspring tend to enjoy greater fitness (i.e., leave a larger number of surviving progeny) than men who do not. This implies that fathers should benefit from exaggerating paternal resemblance. We argue that the self-deceiving component of this bias could be concealed by generalizing this resemblance estimation boost to (1) family pairs other than father-child and (2) strangers. Here, we tested the prediction that fathers may see, in unrelated children's faces, stronger family resemblances than non-fathers. In Study 1, 70 men and 70 women estimated facial resemblances between children paired, at three different ages (as infants, children, and adolescents), either to themselves or to their parents. In Study 2, 70 men and 70 women guessed the true parents of the same children among a set of adults. Men who were fathers reported stronger similarities between faces than non-fathers, mothers, and non-mothers did, but were no better at identifying childrens' real parents. We suggest that, in fathers, processing of facial resemblances is biased in a manner that reflects their (adaptive) wishful thinking that fathers and children are related.

Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

Science.gov (United States)

Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

2017-03-01

In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

Do External or Internal Technology Spillovers Have a Stronger Influence on Innovation Efficiency in China?

Directory of Open Access Journals (Sweden)

Xionghe Qin

2017-09-01

Full Text Available In this study, we bridge an important gap in the literature by comparing the extent to which external technology spillovers, as indicated by foreign direct investment (FDI, and internal technology spillovers, as indicated by university-institute-industry cooperation (UIC, influence innovation efficiency in China. We divide the innovation process into two sequential stages, namely the knowledge creation and technology commercialization stages, and employ a network data envelopment analysis approach to measure innovation efficiency at each stage. The spatial analysis of the distribution of knowledge creation efficiency and technology commercialization efficiency reveals the heterogeneity of innovation efficiency at the provincial level. Then, a panel data regression is used to analyze the effect of FDI and UIC on innovation efficiency at each stage, using data from 2009 to 2015 for 30 provinces in China. By comparing FDI with UIC, we find that FDI has a higher coefficient and stronger significance level at the knowledge creation stage, while only industry-institute linkages exhibit a stronger association with innovation efficiency at the technology commercialization stage.

Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

Science.gov (United States)

Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

2014-01-01

Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

Directory of Open Access Journals (Sweden)

Ami Cohen

Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

DEFF Research Database (Denmark)

Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

2012-01-01

Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological Seq...... al., 2007. J. Immunol. 178, 7890–7901. doi:10.1016/j.molimm.2012.02.025...

Enforcement costs: some humanitarian alternatives to stronger patent rights.

Science.gov (United States)

Trotter, Andrew

2012-01-01

Diseases that cause comparatively few problems in developed countries kill millions of people in the Third World each year. In many cases, people die because they cannot afford the medication needed to save their lives. In others, there are simply no drugs available because there are no wealthy western patients to justify pharmaceutical companies investing in a cure. This reveals a deep-seated problem within the patent system and the pharmaceutical industry that emphasises markets and profits at the expense of health and global welfare. Global efforts have seen substantial improvements in access to medicines in isolated areas, but with international agreements driving towards stronger patent protection and the expiry date for the TRIPS grace period fast approaching, it is time to consider alternatives which will allow the patent system to work for the humanitarian cause rather than against it. This paper considers two such problems in the patent system and pharmaceutical industry - prohibitive pricing and misdirected incentives - to offer a mode of regulation and enforcement that will support both a viable pharmaceutical industry and the human right to health and medication.

Becoming Stronger at Broken Places: A Model for Group Work with Young Adult from Divorced Families.

Science.gov (United States)

Hage, Sally M.; Nosanow, Mia

2000-01-01

Describes a model for group work with young adults from divorced families using an 8-session psychoeducational group intervention. Goals include reducing isolation, establishing connectedness, and building a stronger sense of identify. By educating young adults on topics such as assertiveness, communication skills, and self-esteem, it will give…

Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

Science.gov (United States)

Wajih, Nadeem; Owen, John; Wallin, Reidar

2008-01-01

Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

In roots of Arabidopsis thaliana, the damage-associated molecular pattern AtPep1 is a stronger elicitor of immune signalling than flg22 or the chitin heptamer.

Directory of Open Access Journals (Sweden)

Lorenzo Poncini

Full Text Available Plants interpret their immediate environment through perception of small molecules. Microbe-associated molecular patterns (MAMPs such as flagellin and chitin are likely to be more abundant in the rhizosphere than plant-derived damage-associated molecular patterns (DAMPs. We investigated how the Arabidopsis thaliana root interprets MAMPs and DAMPs as danger signals. We monitored root development during exposure to increasing concentrations of the MAMPs flg22 and the chitin heptamer as well as of the DAMP AtPep1. The tissue-specific expression of defence-related genes in roots was analysed using a toolkit of promoter::YFPN lines reporting jasmonic acid (JA-, salicylic acid (SA-, ethylene (ET- and reactive oxygen species (ROS- dependent signalling. Finally, marker responses were analysed during invasion by the root pathogen Fusarium oxysporum. The DAMP AtPep1 triggered a stronger activation of the defence markers compared to flg22 and the chitin heptamer. In contrast to the tested MAMPs, AtPep1 induced SA- and JA-signalling markers in the root and caused a severe inhibition of root growth. Fungal attack resulted in a strong activation of defence genes in tissues close to the invading fungal hyphae. The results collectively suggest that AtPep1 presents a stronger danger signal to the Arabidopsis root than the MAMPs flg22 and chitin heptamer.

Activation of the TXNIP/NLRP3 inflammasome pathway contributes to inflammation in diabetic retinopathy: a novel inhibitory effect of minocycline.

Science.gov (United States)

Chen, Wei; Zhao, Minjie; Zhao, Shuzhi; Lu, Qianyi; Ni, Lisha; Zou, Chen; Lu, Li; Xu, Xun; Guan, Huaijin; Zheng, Zhi; Qiu, Qinghua

2017-02-01

Chronic low-grade inflammation occurs in diabetic retinopathy (DR), but the underlying mechanism(s) remains (remain) unclear. NLRP3 inflammasome activation is involved in several other inflammatory diseases. Thus, we investigated the role of the NLRP3 inflammasome signaling pathway in the pathogenesis of DR. Diabetes was induced in rats by streptozotocin treatment for 8 weeks. They were treated with NLRP3 shRNA or minocycline during the last 4 weeks. High glucose-exposed human retinal microvascular endothelial cells (HRMECs) were co-incubated with antioxidants or subjected to TXNIP or NLRP3 shRNA interference. In high glucose-exposed HRMECs and retinas of diabetic rats, mRNA and protein expression of NLRP3, ASC, and proinflammatory cytokines were induced significantly by hyperglycemia. Upregulated interleukin (IL)-1β maturation, IL-18 secretion, and caspase-1 cleavage were also observed with increased cell apoptosis and retinal vascular permeability, compared with the control group. NLRP3 silencing blocked these effects in the rat model and HRMECs, confirming that inflammasome activation contributed to inflammation in DR. TXNIP expression was increased by reactive oxygen species (ROS) overproduction in animal and cell models, whereas antioxidant addition or TXNIP silencing blocked IL-1β and IL-18 secretion in high glucose-exposed HRMECs, indicating that the ROS-TXNIP pathway mediates NLRP3 inflammasome activation. Minocycline significantly downregulated ROS generation and reduced TXNIP expression, subsequently inhibited NLRP3 activation, and further decreased inflammatory factors, which were associated with a decrease in retinal vascular permeability and cell apoptosis. Together, our data suggest that the TXNIP/NLRP3 pathway is a potential therapeutic target for the treatment of DR, and the use of minocycline specifically for such therapy may be a new avenue of investigation in inflammatory disease.

In vitro activity of flomoxef in comparison to other cephalosporins.

Science.gov (United States)

Simon, C; Simon, M; Plieth, C

1988-01-01

Flomoxef and cefazolin had nearly the same activity against staphylococci, which was stronger than that of other cephalosporins. Against Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae, cefotaxime and cefazolin were more active than flomoxef, but the other cephamycins were less active than flomoxef. In comparison to the other cephalosporins, latamoxef and flomoxef had higher activity against Branhamella catarrhalis, whereas cefotaxime, latamoxef and cefotetan were more active against Haemophilus influenzae. Flomoxef was the only drug exhibiting activity against Clostridium difficile. The activity of flomoxef and latamoxef against Bacteroides fragilis was stronger than that of the other cephalosporins, but Bacteroides bivius was resistant to each of these antibiotics.

The bigger, the stronger? Insights from muscle architecture and nervous characteristics in obese adolescent girls.

Science.gov (United States)

Garcia-Vicencio, S; Coudeyre, E; Kluka, V; Cardenoux, C; Jegu, A-G; Fourot, A-V; Ratel, S; Martin, V

2016-02-01

Young obese youth are generally stronger than lean youth. This has been linked to the loading effect of excess body mass, acting as a training stimulus comparable to strength training. Whether this triggers specific adaptations of the muscle architecture (MA) and voluntary activation (VA) that could account for the higher strength of obese subjects remains unknown. MA characteristics (that is, pennation angle (PA), fascicle length (FL) and muscle thickness (MT)) and muscle size (that is, anatomical cross-sectional area (ACSA)) of the knee extensor (KE) and plantar flexor (PF) muscles were evaluated in 12 obese and 12 non-obese adolescent girls (12-15 years). Maximal isometric torque and VA of the KE and PF muscles were also assessed. Results revealed higher PA (Pmuscles in obese girls. Moreover, obese individuals produced a higher absolute torque than their lean counterparts on the KE (224.6±39.5 vs 135.7±32.7 N m, respectively; Pmuscles (73.3±16.5 vs 44.5±6.2 N m; Pmuscles (r=0.45-0.55, P<0.05-0.01). MVC was also correlated with VA (KE: r=0.44, P<0.05; PF: r=0.65, P<0.001) and segmental lean mass (KE: r=0.48, P<0.05; PF: r=0.57, P<0.01). This study highlighted favorable muscular and nervous adaptations to obesity that account for the higher strength of obese youth. The excess of body mass supported during daily activities could act as a chronic training stimulus responsible for these adaptations.

Why is the radial flow in central pA collisions stronger than in AA?

International Nuclear Information System (INIS)

Kalaydzhyan, Tigran; Shuryak, Edward

2014-01-01

Both the transverse size and entropy density per area in central pA collisions is smaller than in central AA, and yet the radial flow is stronger. We propose an explanation to this puzzle. Using a weak attraction between strings through the σ-meson exchange, fitted to the lattice data, we find collective implosion of the “spaghetti” multi-string state. Collectivization of the sigma field of the strings is the QCD analog of the black hole formation occurring in holographic models

Cultural differences in human brain activity: a quantitative meta-analysis.

Science.gov (United States)

Han, Shihui; Ma, Yina

2014-10-01

Psychologists have been trying to understand differences in cognition and behavior between East Asian and Western cultures within a single cognitive framework such as holistic versus analytic or interdependent versus independent processes. However, it remains unclear whether cultural differences in multiple psychological processes correspond to the same or different neural networks. We conducted a quantitative meta-analysis of 35 functional MRI studies to examine cultural differences in brain activity engaged in social and non-social processes. We showed that social cognitive processes are characterized by stronger activity in the dorsal medial prefrontal cortex, lateral frontal cortex and temporoparietal junction in East Asians but stronger activity in the anterior cingulate, ventral medial prefrontal cortex and bilateral insula in Westerners. Social affective processes are associated with stronger activity in the right dorsal lateral frontal cortex in East Asians but greater activity in the left insula and right temporal pole in Westerners. Non-social processes induce stronger activity in the left inferior parietal cortex, left middle occipital and left superior parietal cortex in East Asians but greater activations in the right lingual gyrus, right inferior parietal cortex and precuneus in Westerners. The results suggest that cultural differences in social and non-social processes are mediated by distinct neural networks. Moreover, East Asian cultures are associated with increased neural activity in the brain regions related to inference of others' mind and emotion regulation whereas Western cultures are associated with enhanced neural activity in the brain areas related to self-relevance encoding and emotional responses during social cognitive/affective processes. Copyright © 2014 Elsevier Inc. All rights reserved.

The Fanconi anemia pathway sensitizes to DNA alkylating agents by inducing JNK-p53-dependent mitochondrial apoptosis in breast cancer cells.

Science.gov (United States)

Zhao, Lin; Li, Yanlin; He, Miao; Song, Zhiguo; Lin, Shu; Yu, Zhaojin; Bai, Xuefeng; Wang, Enhua; Wei, Minjie

2014-07-01

The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received limited attention. In the present study, we investigated the effect of Fanconi anemia complementation group F protein (FANCF), a critical factor of the FA/BRCA pathway, on cancer cell apoptosis induced by DNA alkylating agents such as mitomycin c (MMC). We found that FANCF shRNA potentiated MMC-induced cytotoxicity and apoptosis in MCF-7 and MDA-MB-231 breast cancer cells. At a mechanistic level, FANCF shRNA downregulated the anti-apoptotic protein Bcl-2 and upregulated the pro-apoptotic protein Bax, accompanied by release of cyt-c and smac into the cytosol in MMC-treated cells. Furthermore, activation of caspase-3 and -9, other than caspase-8, cleavage of poly(ADP ribose) polymerase (PARP), and a decrease of mitochondrial membrane potential (MMP) indicated that involvement of the mitochondrial apoptotic pathway in FANCF silencing of MMC-treated breast cancer cells. A decrease in IAP family proteins XIAP and survivin were also observed following FANCF silencing in MMC-treated breast cancer cells. Notably, FANCF shRNA was able to increase p53 levels through activation of the JNK pathway in MMC-treated breast cancer cells. Furthermore, p53 inhibition using pifithrin-α abolished the induction of caspase-3 and PARP by FANCF shRNA and MMC, indicating that MMC-induced apoptosis is substantially enhanced by FANCF shRNA via p53-dependent mechanisms. To our knowledge, we provide new evidence for the potential application of FANCF as a chemosensitizer in breast cancer therapy.

The C-type lectin OCILRP2 costimulates EL4 T cell activation via the DAP12-Raf-MAP kinase pathway.

Science.gov (United States)

Lou, Qiang; Zhang, Wei; Liu, Guangchao; Ma, Yuanfang

2014-01-01

OCILRP2 is a typical Type-II transmembrane protein that is selectively expressed in activated T lymphocytes, dendritic cells, and B cells and functions as a novel co-stimulator of T cell activation. However, the signaling pathways underlying OCILRP2 in T cell activation are still not completely understood. In this study, we found that the knockdown of OCILRP2 expression with shRNA or the blockage of its activity by an anti-OCILRP2 antagonist antibody reduced CD3/CD28-costimulated EL4 T cell viability and IL-2 production, inhibit Raf1, MAPK3, and MAPK8 activation, and impair NFAT and NF-κB transcriptional activities. Furthermore, immunoprecipitation results indicated that OCILRP2 could interact with the DAP12 protein, an adaptor containing an intracellular ITAM motif that can transduce signals to induce MAP kinase activation for T cell activation. Our data reveal that after binding with DAP12, OCILRP2 activates the Raf-MAP kinase pathways, resulting in T cell activation.

BAS-drive trait modulates dorsomedial striatum activity during reward response-outcome associations.

Science.gov (United States)

Costumero, Víctor; Barrós-Loscertales, Alfonso; Fuentes, Paola; Rosell-Negre, Patricia; Bustamante, Juan Carlos; Ávila, César

2016-09-01

According to the Reinforcement Sensitivity Theory, behavioral studies have found that individuals with stronger reward sensitivity easily detect cues of reward and establish faster associations between instrumental responses and reward. Neuroimaging studies have shown that processing anticipatory cues of reward is accompanied by stronger ventral striatum activity in individuals with stronger reward sensitivity. Even though establishing response-outcome contingencies has been consistently associated with dorsal striatum, individual differences in this process are poorly understood. Here, we aimed to study the relation between reward sensitivity and brain activity while processing response-reward contingencies. Forty-five participants completed the BIS/BAS questionnaire and performed a gambling task paradigm in which they received monetary rewards or punishments. Overall, our task replicated previous results that have related processing high reward outcomes with activation of striatum and medial frontal areas, whereas processing high punishment outcomes was associated with stronger activity in insula and middle cingulate. As expected, the individual differences in the activity of dorsomedial striatum correlated positively with BAS-Drive. Our results agree with previous studies that have related the dorsomedial striatum with instrumental performance, and suggest that the individual differences in this area may form part of the neural substrate responsible for modulating instrumental conditioning by reward sensitivity.

Which global stock indices trigger stronger contagion risk in the Vietnamese stock market? Evidence using a bivariate analysis

Directory of Open Access Journals (Sweden)

Wang Kuan-Min

2013-01-01

Full Text Available This paper extends recent investigations into risk contagion effects on stock markets to the Vietnamese stock market. Daily data spanning October 9, 2006 to May 3, 2012 are sourced to empirically validate the contagion effects between stock markets in Vietnam, and China, Japan, Singapore, and the US. To facilitate the validation of contagion effects with market-related coefficients, this paper constructs a bivariate EGARCH model of dynamic conditional correlation coefficients. Using the correlation contagion test and Dungey et al.’s (2005 contagion test, we find contagion effects between the Vietnamese and four other stock markets, namely Japan, Singapore, China, and the US. Second, we show that the Japanese stock market causes stronger contagion risk in the Vietnamese stock market compared to the stock markets of China, Singapore, and the US. Finally, we show that the Chinese and US stock markets cause weaker contagion effects in the Vietnamese stock market because of stronger interdependence effects between the former two markets.

A configural dominant account of contextual cueing: Configural cues are stronger than colour cues.

Science.gov (United States)

Kunar, Melina A; John, Rebecca; Sweetman, Hollie

2014-01-01

Previous work has shown that reaction times to find a target in displays that have been repeated are faster than those for displays that have never been seen before. This learning effect, termed "contextual cueing" (CC), has been shown using contexts such as the configuration of the distractors in the display and the background colour. However, it is not clear how these two contexts interact to facilitate search. We investigated this here by comparing the strengths of these two cues when they appeared together. In Experiment 1, participants searched for a target that was cued by both colour and distractor configural cues, compared with when the target was only predicted by configural information. The results showed that the addition of a colour cue did not increase contextual cueing. In Experiment 2, participants searched for a target that was cued by both colour and distractor configuration compared with when the target was only cued by colour. The results showed that adding a predictive configural cue led to a stronger CC benefit. Experiments 3 and 4 tested the disruptive effects of removing either a learned colour cue or a learned configural cue and whether there was cue competition when colour and configural cues were presented together. Removing the configural cue was more disruptive to CC than removing colour, and configural learning was shown to overshadow the learning of colour cues. The data support a configural dominant account of CC, where configural cues act as the stronger cue in comparison to colour when they are presented together.

Suppression of the lipopolysaccharide-induced expression of MARCKS-related protein (MRP) affects transmigration in activated RAW264.7 cells.

Science.gov (United States)

Chun, Kwang-Rok; Bae, Eun Mi; Kim, Jae-Kwan; Suk, Kyoungho; Lee, Won-Ha

2009-01-01

The molecular action mechanism of MRP, one of the protein kinase C (PKC) substrates, has been under intense investigation, but reports on its role in macrophage function remain controversial. The treatment of macrophage cell lines with bacterial lipopolysaccharide (LPS) induced a high level of MRP expression suggesting that MRP plays a role in the function of activated macrophages. In order to investigate the role of MRP in activated RAW264.7 cells, we stably transfected MRP-specific shRNA expression constructs and tested for alterations in macrophage-related functions. The down-regulation of MRP expression resulted in a marked reduction in chemotaxis toward MCP-1 or extracellular matrix proteins. Furthermore, pharmacological inhibitors of PKC significantly inhibited the chemotaxis in RAW264.7 cells. These data reveals the pivotal role of MRP in the transmigration of activated RAW264.7 cells.

Conservatives Anticipate and Experience Stronger Emotional Reactions to Negative Outcomes.

Science.gov (United States)

Joel, Samantha; Burton, Caitlin M; Plaks, Jason E

2014-02-01

The present work examined whether conservatives and liberals differ in their anticipation of their own emotional reactions to negative events. In two studies, participants imagined experiencing positive or negative outcomes in domains that do not directly concern politics. In Study 1, 190 American participants recruited online (64 male, Mage  = 32 years) anticipated their emotional responses to romantic relationship outcomes. In Study 2, 97 Canadian undergraduate students (26 male, Mage  = 21 years) reported on their anticipated and experienced emotional responses to academic outcomes. In both studies, more conservative participants predicted they would feel stronger negative emotions following negative outcomes than did more liberal participants. Furthermore, a longitudinal follow-up of Study 2 participants revealed that more conservative participants actually felt worse than more liberal participants after receiving a lower-than-desired exam grade. These effects remained even when controlling for the Big Five traits, prevention focus, and attachment style (Study 1), and optimism (Study 2). We discuss how the relationship between political orientation and anticipated affect likely contributes to differences between conservatives and liberals in styles of decision and policy choices. © 2013 Wiley Periodicals, Inc.

Ni2P Makes Application of the PtRu Catalyst Much Stronger in Direct Methanol Fuel Cells.

Science.gov (United States)

Chang, Jinfa; Feng, Ligang; Liu, Changpeng; Xing, Wei

2015-10-12

PtRu is regarded as the best catalyst for direct methanol fuel cells, but the performance decay resulting from the loss of Ru seriously hinders commercial applications. Herein, we demonstrated that the presence of Ni2 P largely reduces Ru loss, which thus makes the application of PtRu much stronger in direct methanol fuel cells. Outstanding catalytic activity and stability were observed by cyclic voltammetry. Upon integrating the catalyst material into a practical direct methanol fuel cell, the highest maximum power density was achieved on the PtRu-Ni2P/C catalyst among the reference catalysts at different temperatures. A maximum power density of 69.9 mW cm(-2) at 30 °C was obtained on PtRu-Ni2P/C, which is even higher than the power density of the state-of-the-art commercial PtRu catalyst at 70 °C (63.1 mW cm(-2)). Moreover, decay in the performance resulting from Ru loss was greatly reduced owing to the presence of Ni2 P, which is indicative of very promising applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

Directory of Open Access Journals (Sweden)

Nicosia Alfredo

2010-04-01

Full Text Available Abstract Background Prostate stem cell antigen (PSCA is a glycosylphosphatidylinositol (GPI anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. Methods A bladder cell line was engineered to express a doxycycline (dox regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Results Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. Conclusions These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response.

Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

International Nuclear Information System (INIS)

Marra, Emanuele; Ciliberto, Gennaro; Palombo, Fabio; Uva, Paolo; Viti, Valentina; Simonelli, Valeria; Dogliotti, Eugenia; De Rinaldis, Emanuele; Lahm, Armin; La Monica, Nicola; Nicosia, Alfredo

2010-01-01

Prostate stem cell antigen (PSCA) is a glycosylphosphatidylinositol (GPI) anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. A bladder cell line was engineered to express a doxycycline (dox) regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response

Novel chemokine-like activities of histones in tumor metastasis.

Science.gov (United States)

Chen, Ruochan; Xie, Yangchun; Zhong, Xiao; Fu, Yongmin; Huang, Yan; Zhen, Yixiang; Pan, Pinhua; Wang, Haichao; Bartlett, David L; Billiar, Timothy R; Lotze, Michael T; Zeh, Herbert J; Fan, Xue-Gong; Tang, Daolin; Kang, Rui

2016-09-20

Histones are intracellular nucleosomal components and extracellular damage-associated molecular pattern molecules that modulate chromatin remodeling, as well as the immune response. However, their extracellular roles in cell migration and invasion remain undefined. Here, we demonstrate that histones are novel regulators of tumor metastasis with chemokine-like activities. Indeed, exogenous histones promote both hepatocellular carcinoma (HCC) cell migration and invasion through toll-like receptor (TLR)4, but not TLR2 or the receptor for advanced glycosylation end product. TLR4-mediated activation of nuclear factor-κB (NF-κB) by extracellular signal-regulated kinase (ERK) is required for histone-induced chemokine (e.g., C-C motif ligand 9/10) production. Pharmacological and genetic inhibition of TLR4-ERK-NF-κB signaling impairs histone-induced chemokine production and HCC cell migration. Additionally, TLR4 depletion (by using TLR4-/- mice and TLR4-shRNA) or inhibition of histone release/activity (by administration of heparin and H3 neutralizing antibody) attenuates lung metastasis of HCC cells injected via the tail vein of mice. Thus, histones promote tumor metastasis of HCC cells through the TLR4-NF-κB pathway and represent novel targets for treating patients with HCC.

The C-type lectin OCILRP2 costimulates EL4 T cell activation via the DAP12-Raf-MAP kinase pathway.

Directory of Open Access Journals (Sweden)

Qiang Lou

Full Text Available OCILRP2 is a typical Type-II transmembrane protein that is selectively expressed in activated T lymphocytes, dendritic cells, and B cells and functions as a novel co-stimulator of T cell activation. However, the signaling pathways underlying OCILRP2 in T cell activation are still not completely understood. In this study, we found that the knockdown of OCILRP2 expression with shRNA or the blockage of its activity by an anti-OCILRP2 antagonist antibody reduced CD3/CD28-costimulated EL4 T cell viability and IL-2 production, inhibit Raf1, MAPK3, and MAPK8 activation, and impair NFAT and NF-κB transcriptional activities. Furthermore, immunoprecipitation results indicated that OCILRP2 could interact with the DAP12 protein, an adaptor containing an intracellular ITAM motif that can transduce signals to induce MAP kinase activation for T cell activation. Our data reveal that after binding with DAP12, OCILRP2 activates the Raf-MAP kinase pathways, resulting in T cell activation.

Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

Directory of Open Access Journals (Sweden)

Yuan-xing Gu

2014-01-01

Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

Increases in Use and Activity Due to Urban Renewal

DEFF Research Database (Denmark)

Andersen, Henriette Bondo; Christiansen, Lars Breum; Klinker, Charlotte Demant

2017-01-01

Introduction Urban green space and other recreational facilities are associated with physical activity. For adolescents living in multistory housing, public outdoor spaces that support physical activity may play an important role in activity promotion strategies. However, stronger evidence for a ...

Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

International Nuclear Information System (INIS)

Zhu, Zhuoli; Gan, Xueqi; Fan, Hongyi; Yu, Haiyang

2015-01-01

Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

Energy Technology Data Exchange (ETDEWEB)

Zhu, Zhuoli; Gan, Xueqi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Fan, Hongyi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Department of Applied Mechanics, College of Architecture and Environment, Sichuan University, Chengdu 610065 (China); Yu, Haiyang, E-mail: yhyang6812@foxmail.com [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China)

2015-12-25

Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

Protein kinase C-α signals P115RhoGEF phosphorylation and RhoA activation in TNF-α-induced mouse brain microvascular endothelial cell barrier dysfunction

Directory of Open Access Journals (Sweden)

Deng Xiaolu

2011-04-01

Full Text Available Abstract Background Tumor necrosis factor-α (TNF-α, a proinflammatory cytokine, is capable of activating the small GTPase RhoA, which in turn contributes to endothelial barrier dysfunction. However, the underlying signaling mechanisms remained undefined. Therefore, we aimed to determine the role of protein kinase C (PKC isozymes in the mechanism of RhoA activation and in signaling TNF-α-induced mouse brain microvascular endothelial cell (BMEC barrier dysfunction. Methods Bend.3 cells, an immortalized mouse brain endothelial cell line, were exposed to TNF-α (10 ng/mL. RhoA activity was assessed by pull down assay. PKC-α activity was measured using enzyme assasy. BMEC barrier function was measured by transendothelial electrical resistance (TER. p115RhoGEF phosphorylation was detected by autoradiography followed by western blotting. F-actin organization was observed by rhodamine-phalloidin staining. Both pharmacological inhibitors and knockdown approaches were employed to investigate the role of PKC and p115RhoGEF in TNF-α-induced RhoA activation and BMEC permeability. Results We observed that TNF-α induces a rapid phosphorylation of p115RhoGEF, activation of PKC and RhoA in BMECs. Inhibition of conventional PKC by Gö6976 mitigated the TNF-α-induced p115RhoGEF phosphorylation and RhoA activation. Subsequently, we found that these events are regulated by PKC-α rather than PKC-β by using shRNA. In addition, P115-shRNA and n19RhoA (dominant negative mutant of RhoA transfections had no effect on mediating TNF-α-induced PKC-α activation. These data suggest that PKC-α but not PKC-β acts as an upstream regulator of p115RhoGEF phosphorylation and RhoA activation in response to TNF-α. Moreover, depletion of PKC-α, of p115RhoGEF, and inhibition of RhoA activation also prevented TNF-α-induced stress fiber formation and a decrease in TER. Conclusions Taken together, our results show that PKC-α phosphorylation of p115RhoGEF mediates TNF

Activation of PPARd and RXRa stimulates fatty acid oxidatin and insulin secretion inpancreatic beta-cells

DEFF Research Database (Denmark)

Børgesen, Michael; Ravnskjær, Kim; Frigerio, Francesca

as a central effector of unsaturated fatty acids in pancreatic ß-cells. Interestingly, activation of PPARd increases basal as well as glucose-stimulated insulin secretion of INS-1E cells. This increase is further potentiated by RXR agonists. This observation suggests that PPARd may mediate some of the positive......ACTIVATION OF PPARd AND RXRa STIMULATES FATTY ACID OXIDATION AND INSULIN SECRETION IN PANCREATIC b-CELLS Michael Boergesen1, Kim Ravnskjaer2, Francesca Frigerio3, Allan E. Karlsen4, Pierre Maechler3 and Susanne Mandrup1 1 Department of Biochemistry and Molecular Biology, University of Southern...... of genes as PPARd specific agonists and stimulates ß-oxidation. Importantly, oleate-induction of gene expression and ß-oxidation in INS-1E cells is abolished by knock-down of PPARd using adenoviral transfer of shRNA. Thus, PPARd appears to be a central regulator of fatty acid metabolism as well...

Epac activation sensitizes rat sensory neurons via activation of Ras

Science.gov (United States)

Shariati, Behzad; Thompson, Eric L.; Nicol, Grant D.; Vasko, Michael R.

2015-01-01

Guanine nucleotide exchange factors directly activated by cAMP (Epacs) have emerged as important signaling molecules mediating persistent hypersensitivity in animal models of inflammation, by augmenting the excitability of sensory neurons. Although Epacs activate numerous downstream signaling cascades, the intracellular signaling which mediates Epac-induced sensitization of capsaicin-sensitive sensory neurons remains unknown. Here, we demonstrate that selective activation of Epacs with 8-CPT-2′-O-Me-cAMP-AM (8CPT-AM) increases the number of action potentials (APs) generated by a ramp of depolarizing current and augments the evoked release of calcitonin gene-related peptide (CGRP) from isolated rat sensory neurons. Internal perfusion of capsaicin-sensitive sensory neurons with GDP-βS, substituted for GTP, blocks the ability of 8CPT-AM to increase AP firing, demonstrating that Epac-induced sensitization is G-protein dependent. Treatment with 8CPT-AM activates the small G-proteins Rap1 and Ras in cultures of sensory neurons. Inhibition of Rap1, by internal perfusion of a Rap1-neutralizing antibody or through a reduction in the expression of the protein using shRNA does not alter the Epac-induced enhancement of AP generation or CGRP release, despite the fact that in most other cell types, Epacs act as Rap-GEFs. In contrast, inhibition of Ras through expression of a dominant negative Ras (DN-Ras) or through internal perfusion of a Ras-neutralizing antibody blocks the increase in AP firing and attenuates the increase in the evoked release of CGRP induced by Epac activation. Thus, in this subpopulation of nociceptive sensory neurons, it is the novel interplay between Epacs and Ras, rather than the canonical Epacs and Rap1 pathway, that is critical for mediating Epac-induced sensitization. PMID:26596174

Epac activation sensitizes rat sensory neurons through activation of Ras.

Science.gov (United States)

Shariati, Behzad; Thompson, Eric L; Nicol, Grant D; Vasko, Michael R

2016-01-01

Guanine nucleotide exchange factors directly activated by cAMP (Epacs) have emerged as important signaling molecules mediating persistent hypersensitivity in animal models of inflammation, by augmenting the excitability of sensory neurons. Although Epacs activate numerous downstream signaling cascades, the intracellular signaling which mediates Epac-induced sensitization of capsaicin-sensitive sensory neurons remains unknown. Here, we demonstrate that selective activation of Epacs with 8-CPT-2'-O-Me-cAMP-AM (8CPT-AM) increases the number of action potentials (APs) generated by a ramp of depolarizing current and augments the evoked release of calcitonin gene-related peptide (CGRP) from isolated rat sensory neurons. Internal perfusion of capsaicin-sensitive sensory neurons with GDP-βS, substituted for GTP, blocks the ability of 8CPT-AM to increase AP firing, demonstrating that Epac-induced sensitization is G-protein dependent. Treatment with 8CPT-AM activates the small G-proteins Rap1 and Ras in cultures of sensory neurons. Inhibition of Rap1, by internal perfusion of a Rap1-neutralizing antibody or through a reduction in the expression of the protein using shRNA does not alter the Epac-induced enhancement of AP generation or CGRP release, despite the fact that in most other cell types, Epacs act as Rap-GEFs. In contrast, inhibition of Ras through expression of a dominant negative Ras (DN-Ras) or through internal perfusion of a Ras-neutralizing antibody blocks the increase in AP firing and attenuates the increase in the evoked release of CGRP induced by Epac activation. Thus, in this subpopulation of nociceptive sensory neurons, it is the novel interplay between Epacs and Ras, rather than the canonical Epacs and Rap1 pathway, that is critical for mediating Epac-induced sensitization. Copyright © 2015 Elsevier Inc. All rights reserved.

Stronger relationship of serum apolipoprotein A-1 and B with diabetic retinopathy than traditional lipids

Directory of Open Access Journals (Sweden)

B S Ankit

2017-01-01

Full Text Available Aim: Diabetic retinopathy (DR is the most common preventable cause of blindness where early detection and treatment can be sight-saving. Search for biomarkers of the disease has been relentless. We aimed to determine whether lipoproteins apolipoproteins A1 and B1 (Apo-A1 and Apo-B1 have stronger associations with DR in contrast to conventionally measured low-density lipoprotein (LDL and high-density lipoprotein cholesterol levels. Materials and Methods: We performed a cross-sectional study and studied 117 patients. Serum lipid profile was assessed by autoanalyzer. Serum Apo-A1 and Apo-B were measured using immunoturbidimetric kit on an autoanalyzer. Apo-B/A1 ratio was calculated. Retinopathy was graded from the digital retinal photographs, taken with nonmydriatic auto fundus camera and classified according to International Clinical DR Disease Severity Scale. Results: Mean Apo-A1 for mild, moderate, severe retinopathy, and proliferative DR (PDR shows a significant negative correlation (P = 0.001 with severity of retinopathy. Mean Apo-B for mild, moderate, severe, PDR displayed a significant positive correlation with severity of retinopathy (P = 0.001. Mean Apo-B/A1 for mild, moderate, severe, PDR showed highly significant positive correlation with severity of retinopathy (P < 0.001. In contrast, mean LDL for mild, moderate, severe, PDR showed insignificant association with severity of DR (P = 0.081. Conclusion: Apo-A1 and Apo-B have a stronger association with the development of DR than traditional lipids and can thus facilitate early detection and treatment of the disease.

Stronger Association Between Valence- and Arousal Ratings of Affective Pictures with Older Age: Evidence for Variation Across Emotion Categories

DEFF Research Database (Denmark)

Mikkelsen, Mai Bjørnskov; Mehlsen, Mimi Yung; Lyby, Marlene Skovgaard

A sample of older and younger adults rated affective pictures according to valence, arousal and emotion category (happiness, sadness and disgust). Results indicate that older age is associated with a stronger linear association between ratings of arousal and valence. Further, the strength...... of the association vary according to emotion category....

Strategies of Building a Stronger Sense of Community for Sustainable Neighborhoods: Comparing Neighborhood Accessibility with Community Empowerment Programs

Directory of Open Access Journals (Sweden)

Te-I Albert Tsai

2014-05-01

Full Text Available New Urbanist development in the U.S. aims at enhancing a sense of community and seeks to return to the design of early transitional neighborhoods which have pedestrian-oriented environments with retail shops and services within walking distances of housing. Meanwhile, 6000 of Taiwan’s community associations have been running community empowerment programs supported by the Council for Cultural Affairs that have helped many neighborhoods to rebuild so-called community cohesion. This research attempts to evaluate whether neighborhoods with facilities near housing and shorter travel distances within a neighborhood would promote stronger social interactions and form a better community attachment than neighborhoods that have various opportunities for residents to participate in either formal or informal social gatherings. After interviewing and surveying residents from 19 neighborhoods in Taipei’s Beitou District, and correlating the psychological sense of community with inner neighborhood’s daily travel distances and numbers of participatory activities held by community organizations under empowerment programs together with frequencies of regular individual visits and casual meetings, statistical evidence yielded that placing public facilities near residential locations is more effective than providing various programs for elevating a sense of community.

Selection is stronger in early-versus-late stages of divergence in a Neotropical livebearing fish.

Science.gov (United States)

Ingley, Spencer J; Johnson, Jerald B

2016-03-01

How selection acts to drive trait evolution at different stages of divergence is of fundamental importance in our understanding of the origins of biodiversity. Yet, most studies have focused on a single point along an evolutionary trajectory. Here, we provide a case study evaluating the strength of divergent selection acting on life-history traits at early-versus-late stages of divergence in Brachyrhaphis fishes. We find that the difference in selection is stronger in the early-diverged population than the late-diverged population, and that trait differences acquired early are maintained over time. © 2016 The Author(s).

Stable replication of the EBNA1/OriP-mediated baculovirus vector and its application to anti-HCV gene therapy

Directory of Open Access Journals (Sweden)

Chang Myint OO

2009-10-01

Full Text Available Abstract Background Hepatitis C virus (HCV is one of the main causes of liver-related morbidity and mortality. Although combined interferon-α-ribavirin therapy is effective for about 50% of the patients with HCV, better therapies are needed and preventative vaccines have yet to be developed. Short-hairpin RNAs (shRNAs inhibit gene expression by RNA interference. The application of transient shRNA expression is limited, however, due to the inability of the shRNA to replicate in mammalian cells and its inefficient transduction. The duration of transgene (shRNA expression in mammalian cells can be significantly extended using baculovirus-based shRNA-expressing vectors that contain the latent viral protein Epstein-Barr nuclear antigen 1 (EBNA1 and the origin of latent viral DNA replication (OriP sequences. These recombinant vectors contain compatible promoters and are highly effective for infecting primary hepatocyte and hepatoma cell lines, making them very useful tools for studies of hepatitis B and hepatitis C viruses. Here, we report the use of these baculovirus-based vector-derived shRNAs to inhibit core-protein expression in full-length hepatitis C virus (HCV replicon cells. Results We constructed a long-term transgene shRNA expression vector that contains the EBV EBNA1 and OriP sequences. We also designed baculovirus vector-mediated shRNAs against the highly conserved core-protein region of HCV. HCV core protein expression was inhibited by the EBNA1/OriP baculovirus vector for at least 14 days, which was considerably longer than the 3 days of inhibition produced by the wild-type baculovirus vector. Conclusion These findings indicate that we successfully constructed a long-term transgene (shRNA expression vector (Ac-EP-shRNA452 using the EBNA1/OriP system, which was propagated in Escherichia coli and converted into mammalian cells. The potential anti-HCV activity of the long-term transgene (shRNA expression vector was evaluated with the view

Effects of PKM2 Gene Silencing on the Proliferation and Apoptosis of Colorectal Cancer LS-147T and SW620 Cells

Directory of Open Access Journals (Sweden)

Ran Ao

2017-07-01

Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.

TNF-α receptor 1 knockdown in the subfornical organ ameliorates sympathetic excitation and cardiac hemodynamics in heart failure rats.

Science.gov (United States)

Yu, Yang; Wei, Shun-Guang; Weiss, Robert M; Felder, Robert B

2017-10-01

In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ that lacks an effective blood-brain barrier and senses circulating humors. We hypothesized that the tumor necrosis factor-α (TNF-α) receptor 1 (TNFR1) in the SFO contributes to sympathetic excitation and cardiac dysfunction in HF rats. Rats received SFO microinjections of a TNFR1 shRNA or a scrambled shRNA lentiviral vector carrying green fluorescent protein, or vehicle. One week later, some rats were euthanized to confirm the accuracy of the SFO microinjections and the transfection potential of the lentiviral vector. Other rats underwent coronary artery ligation (CL) to induce HF or a sham operation. Four weeks after CL, vehicle- and scrambled shRNA-treated HF rats had significant increases in TNFR1 mRNA and protein, NF-κB activity, and mRNA for inflammatory mediators, RAS components and c-Fos protein in the SFO and downstream in the hypothalamic paraventricular nucleus, along with increased plasma norepinephrine levels and impaired cardiac function, compared with vehicle-treated sham-operated rats. In HF rats treated with TNFR1 shRNA, TNFR1 was reduced in the SFO but not paraventricular nucleus, and the central and peripheral manifestations of HF were ameliorated. In sham-operated rats treated with TNFR1 shRNA, TNFR1 expression was also reduced in the SFO but there were no other effects. These results suggest a key role for TNFR1 in the SFO in the pathophysiology of systolic HF. NEW & NOTEWORTHY Activation of TNF-α receptor 1 in the subfornical organ (SFO) contributes to sympathetic excitation in heart failure rats by increasing inflammation and renin-angiotensin system activity in the SFO and downstream in the hypothalamic

Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ

Directory of Open Access Journals (Sweden)

Pingping Xia

2018-03-01

Full Text Available Background/Aims: Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. Methods: The cerebral injury was established by middle cerebral artery occlusion (MCAO. in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD. ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. Results: We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO. Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. Conclusion: The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling

Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ.

Science.gov (United States)

Xia, Pingping; Pan, Yundan; Zhang, Fan; Wang, Na; Wang, E; Guo, Qulian; Ye, Zhi

2018-01-01

Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. The cerebral injury was established by middle cerebral artery occlusion (MCAO). in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD). ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO). Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH) release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA) could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling pathway. Moreover, the inhibition of Rac1 promoted this function

Faster and stronger manifestation of mitochondrial diseases in skeletal muscle than in heart related to cytosolic inorganic phosphate (Pi) accumulation.

Science.gov (United States)

Korzeniewski, Bernard

2016-08-01

A model of the cell bioenergetic system was used to compare the effect of oxidative phosphorylation (OXPHOS) deficiencies in a broad range of moderate ATP demand in skeletal muscle and heart. Computer simulations revealed that kinetic properties of the system are similar in both cases despite the much higher mitochondria content and "basic" OXPHOS activity in heart than in skeletal muscle, because of a much higher each-step activation (ESA) of OXPHOS in skeletal muscle than in heart. Large OXPHOS deficiencies lead in both tissues to a significant decrease in oxygen consumption (V̇o2) and phosphocreatine (PCr) and increase in cytosolic ADP, Pi, and H(+) The main difference between skeletal muscle and heart is a much higher cytosolic Pi concentration in healthy tissue and much higher cytosolic Pi accumulation (level) at low OXPHOS activities in the former, caused by a higher PCr level in healthy tissue (and higher total phosphate pool) and smaller Pi redistribution between cytosol and mitochondria at OXPHOS deficiency. This difference does not depend on ATP demand in a broad range. A much greater Pi increase and PCr decrease during rest-to-moderate work transition in skeletal muscle at OXPHOS deficiencies than at normal OXPHOS activity significantly slows down the V̇o2 on-kinetics. Because high cytosolic Pi concentrations cause fatigue in skeletal muscle and can compromise force generation in skeletal muscle and heart, this system property can contribute to the faster and stronger manifestation of mitochondrial diseases in skeletal muscle than in heart. Shortly, skeletal muscle with large OXPHOS deficiencies becomes fatigued already during low/moderate exercise. Copyright © 2016 the American Physiological Society.

Removal of proprioception by BCI raises a stronger body ownership illusion in control of a humanlike robot.

Science.gov (United States)

Alimardani, Maryam; Nishio, Shuichi; Ishiguro, Hiroshi

2016-09-22

Body ownership illusions provide evidence that our sense of self is not coherent and can be extended to non-body objects. Studying about these illusions gives us practical tools to understand the brain mechanisms that underlie body recognition and the experience of self. We previously introduced an illusion of body ownership transfer (BOT) for operators of a very humanlike robot. This sensation of owning the robot's body was confirmed when operators controlled the robot either by performing the desired motion with their body (motion-control) or by employing a brain-computer interface (BCI) that translated motor imagery commands to robot movement (BCI-control). The interesting observation during BCI-control was that the illusion could be induced even with a noticeable delay in the BCI system. Temporal discrepancy has always shown critical weakening effects on body ownership illusions. However the delay-robustness of BOT during BCI-control raised a question about the interaction between the proprioceptive inputs and delayed visual feedback in agency-driven illusions. In this work, we compared the intensity of BOT illusion for operators in two conditions; motion-control and BCI-control. Our results revealed a significantly stronger BOT illusion for the case of BCI-control. This finding highlights BCI's potential in inducing stronger agency-driven illusions by building a direct communication between the brain and controlled body, and therefore removing awareness from the subject's own body.

Saharan Dust, Transport Processes, and Possible Impacts on Hurricane Activities

Science.gov (United States)

Lau, William K. M.; Kim, K. M.

2010-01-01

In this paper, we present observational evidence of significant relationships between Saharan dust outbreak, and African Easterly wave activities and hurricane activities. We found two dominant paths of transport of Saharan dust: a northern path, centered at 25degN associated with eastward propagating 6-19 days waves over northern Africa, and a southern path centered at 15degN, associated with the AEW, and the Atlantic ITCZ. Seasons with stronger dust outbreak from the southern path are associated with a drier atmosphere over the Maximum Development Region (MDR) and reduction in tropical cyclone and hurricane activities in the MDR. Seasons with stronger outbreak from the northern path are associated with a cooler N. Atlantic, and suppressed hurricane in the western Atlantic basin.

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

Science.gov (United States)

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Role of FAT/CD36 in fatty acid sensing, energy, and glucose homeostasis regulation in DIO and DR rats.

Science.gov (United States)

Le Foll, Christelle; Dunn-Meynell, Ambrose A; Levin, Barry E

2015-02-01

Hypothalamic fatty acid (FA) sensing neurons alter their activity utilizing the FA translocator/receptor, FAT/CD36. Depletion of ventromedial hypothalamus (VMH) CD36 with adeno-associated viral vector expressing CD36 shRNA (AAV CD36 shRNA) leads to redistribution of adipose stores and insulin resistance in outbred rats. This study assessed the requirement of VMH CD36-mediated FA sensing for the regulation of energy and glucose homeostasis in postnatal day 5 (P5) and P21 selectively bred diet-induced obese (DIO) and diet-resistant (DR) rats using VMH AAV CD36 shRNA injections. P5 CD36 depletion altered VMH neuronal FA sensing predominantly in DIO rats. After 10 wk on a 45% fat diet, DIO rats injected with VMH AAV CD36 shRNA at P21 ate more and gained more weight than DIO AAV controls, while DR AAV CD36 shRNA-injected rats gained less weight than DR AAV controls. VMH CD36 depletion increased inguinal fat pad weights and leptin levels in DIO and DR rats. Although DR AAV CD36 shRNA-injected rats became as obese as DIO AAV controls, only DIO control and CD36 depleted rats became insulin-resistant on a 45% fat diet. VMH CD36 depletion stunted linear growth in DIO and DR rats. DIO rats injected with AAV CD36 shRNA at P5 had increased fat mass, mostly due to a 45% increase in subcutaneous fat. They were also insulin-resistant with an associated 71% increase of liver triglycerides. These results demonstrate that VMH CD36-mediated FA sensing is a critical factor in the regulation of energy and glucose homeostasis and fat deposition in DIO and DR rats.

Activation mechanism of ammonium ions on sulfidation of malachite (-201) surface by DFT study

Science.gov (United States)

Wu, Dandan; Mao, Yingbo; Deng, Jiushuai; Wen, Shuming

2017-07-01

The activation mechanism of ammonium ions on the sulfidation of malachite (-201) was determined by density functional theory (DFT) calculations. Results of DFT calculations indicated that interlayer sulfidation occurs during the sulfidation process of malachite (-201). The absorption of both the ammonium ion and sulfide ion on the malachite (-201) surface is stronger than that of sulfur ion. After sulfidation was activated with ammonium ion, the Cu 3d orbital peak is closer to the Fermi level and characterized by a stronger peak value. Therefore, the addition of ammonium ions activated the sulfidation of malachite (-201), thereby improving the flotation performance.

Production of plastified wood with stronger static bending strength means of polymerization induced by gamma radiation

International Nuclear Information System (INIS)

Silva Filho, Elias

1999-01-01

The use of gamma radiation to obtain wood-polymer composites is one of the applications of radiation that presents the most commercial interest. The process, denominated radiopolymerization, comprises the impregnation of monomers into the completely dried wood followed by exposure to gamma radiation to induce polymerization of the impregnated monomers. I this context, the present work aimed the application of this process to seven kinds of wood existing in the brazilian forests. The considered monomer is styrene and the gamma source is Cobalt-60. The obtained wood-polystyrene composites were found to have stronger static bending strength. (author)

UGC galaxies stronger than 25 mJy at 4.85 GHz

International Nuclear Information System (INIS)

Condon, J.J.; Frayer, D.T.; Broderick, J.J.

1991-01-01

UGC galaxies in the declination band +5 to +75 deg were identified by position coincidence with radio sources stronger than 25 mJy on the Green Bank 4.85 GHz sky maps. Candidate identifications were confirmed or rejected with the aid of published aperture-synthesis maps and new 4.86 GHz VLA maps having 15 or 18 arcsec resolution, resulting in a sample of 347 nearby radio galaxies plus five new quasar-galaxy pairs. The radio energy sources in UGC galaxies were classified as starbursts or monsters on the basis of their infrared-radio flux ratios, infrared spectral indices, and radio morphologies. The rms scatter in the logarithmic infrared-radio ratio q is not more than 0.16 for starburst galaxies selected at 4.85 GHz. Radio spectral indices were obtained for nearly all of the UGC galaxies, and S0 galaxies account for a disproportionate share of the compact flat-spectrum (alpha less than 0.5) radio sources. The extended radio jets and lobes produced by monsters are preferentially, but not exclusively, aligned within about 30 deg of the optical minor axes of their host galaxies. The tendency toward minor-axis ejection appears to be independent of radio-source size and is strongest for elliptical galaxies. 230 refs

Inhibition of osteoclastogenesis by RNA interference targeting RANK

Directory of Open Access Journals (Sweden)

Ma Ruofan

2012-08-01

Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.

Cleaved CD147 shed from the surface of malignant melanoma cells activates MMP2 produced by fibroblasts.

Science.gov (United States)

Hatanaka, Miho; Higashi, Yuko; Fukushige, Tomoko; Baba, Naoko; Kawai, Kazuhiro; Hashiguchi, Teruto; Su, Juan; Zeng, Weiqi; Chen, Xiang; Kanekura, Takuro

2014-12-01

Cluster of differentiation 147 (CD147)/basigin on the malignant tumor cell surface is critical for tumor proliferation, invasiveness, metastasis, and angiogenesis. CD147 expressed on malignant melanoma cells can induce tumor cell invasion by stimulating the production of matrix metalloproteinases (MMPs) by surrounding fibroblasts. Membrane vesicles, microvesicles and exosomes have attracted attention, as vehicles of functional molecules and their association with CD147 has been reported. Cleaved CD147 fragments released from tumor cells were reported to interact with fibroblasts. We investigated the intercellular mechanisms by which CD147 stimulates fibroblasts to induce MMP2 activity. CD147 was knocked-down using short hairpin RNA (shRNA). The stimulatory effect of CD147 in cell culture supernatants, microvesicles, and exosomes on the enzymatic activity of MMP2 was examined by gelatin zymography. Supernatants from A375 control cells induced increased enzymatic activity of fibroblasts; such activity was significantly lower in CD147 knock-down cells. Cleaved CD147 plays a pivotal role in stimulating fibroblasts to induce MMP2 activity. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The impact of gambling advertising: Problem gamblers report stronger impacts on involvement, knowledge, and awareness than recreational gamblers.

Science.gov (United States)

Hanss, Daniel; Mentzoni, Rune A; Griffiths, Mark D; Pallesen, Ståle

2015-06-01

Although there is a general lack of empirical evidence that advertising influences gambling participation, the regulation of gambling advertising is hotly debated among academic researchers, treatment specialists, lobby groups, regulators, and policymakers. This study contributes to the ongoing debate by investigating perceived impacts of gambling advertising in a sample of gamblers drawn from the general population in Norway (n = 6,034). Three dimensions of advertising impacts were identified, representing perceived impacts on (a) gambling-related attitudes, interest, and behavior ("involvement"); (b) knowledge about gambling options and providers ("knowledge"); and (c) the degree to which people are aware of gambling advertising ("awareness"). Overall, impacts were strongest for the knowledge dimension, and, for all 3 dimensions, the impact increased with level of advertising exposure. Those identified as problem gamblers in the sample (n = 57) reported advertising impacts concerning involvement more than recreational gamblers, and this finding was not attributable to differences in advertising exposure. Additionally, younger gamblers reported stronger impacts on involvement and knowledge but were less likely to agree that they were aware of gambling advertising than older gamblers. Male gamblers were more likely than female gamblers to report stronger impacts on both involvement and knowledge. These findings are discussed with regard to existing research on gambling advertising as well as their implications for future research and policy-making. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

Constructivist Learning Environment During Virtual and Real Laboratory Activities

Directory of Open Access Journals (Sweden)

Ari Widodo

2017-04-01

Full Text Available Laboratory activities and constructivism are two notions that have been playing significant roles in science education. Despite common beliefs about the importance of laboratory activities, reviews reported inconsistent results about the effectiveness of laboratory activities. Since laboratory activities can be expensive and take more time, there is an effort to introduce virtual laboratory activities. This study aims at exploring the learning environment created by a virtual laboratory and a real laboratory. A quasi experimental study was conducted at two grade ten classes at a state high school in Bandung, Indonesia. Data were collected using a questionnaire called Constructivist Learning Environment Survey (CLES before and after the laboratory activities. The results show that both types of laboratories can create constructivist learning environments. Each type of laboratory activity, however, may be stronger in improving certain aspects compared to the other. While a virtual laboratory is stronger in improving critical voice and personal relevance, real laboratory activities promote aspects of personal relevance, uncertainty and student negotiation. This study suggests that instead of setting one type of laboratory against the other, lessons and follow up studies should focus on how to combine both types of laboratories to support better learning.

GSK621 activates AMPK signaling to inhibit LPS-induced TNFα production

International Nuclear Information System (INIS)

Wu, Yong-hong; Li, Quan; Li, Ping; Liu, Bei

2016-01-01

LPS stimulation in macrophages/monocytes induces TNFα production. We here tested the potential effect of GSK621, a novel AMP-activated protein kinase (AMPK) activator, against the process. In RAW264.7 macrophages, murine bone marrow-derived macrophages (BMDMs), and chronic obstructive pulmonary disease (COPD) patients' monocytes, GSK621 significantly inhibited LPS-induced TNFα protein secretion and mRNA synthesis. Inhibition of AMPK, through AMPKα shRNA knockdown or dominant negative mutation (T172A), almost abolished GSK621's suppression on TNFα in RAW264.7 cells. Reversely, forced-expression of a constitutively-active AMPKα (T172D) mimicked GSK621 actions and reduced LPS-induced TNFα production. Molecularly, GSK621 suppressed LPS-induced reactive oxygen species (ROS) production and nuclear factor kappa B (NFκB) activation. In vivo, GSK621 oral administration inhibited LPS-induced TNFα production and endotoxin shock in mice. In summary, GSK621 activates AMPK signaling to inhibit LPS-induced TNFα production in macrophages/monocytes. - Highlights: • GSK621 inhibits LPS-induced TNFα production/expression in RAW264.7 cells and BMDMs. • GSK621 inhibits LPS-induced TNFα production/expression in COPD patients' PBMCs. • GSK621's inhibition on TNFα production by LPS requires AMPK activation. • GSK621 inhibits LPS-induced ROS production and NFκB activation, dependent on AMPK. • GSK621 oral administration inhibits LPS-induced TNFα production and endotoxin shock in mice.

Sex Differences in Neural Activation to Facial Expressions Denoting Contempt and Disgust

Science.gov (United States)

Aleman, André; Swart, Marte

2008-01-01

The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt) than women. We performed an experiment using functional magnetic resonance imaging (fMRI), in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus), anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions), in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our results suggest a

Sex differences in neural activation to facial expressions denoting contempt and disgust.

Science.gov (United States)

Aleman, André; Swart, Marte

2008-01-01

The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt) than women. We performed an experiment using functional magnetic resonance imaging (fMRI), in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus), anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions), in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our results suggest a

Sex differences in neural activation to facial expressions denoting contempt and disgust.

Directory of Open Access Journals (Sweden)

André Aleman

Full Text Available The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt than women. We performed an experiment using functional magnetic resonance imaging (fMRI, in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus, anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions, in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our

Effects of short-hairpin RNA-inhibited {beta}-catenin expression on the growth of human multiple myeloma cells in vitro and in vivo

Energy Technology Data Exchange (ETDEWEB)

Liang, Wenqing, E-mail: liangwenqing_1234@126.com [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Yang, Chengwei [Department of Spinal Surgery, Lanzhou General Hospital, Lanzhou Military Area Command, 333 Nanbinhe Road, Lanzhou 730050 (China); Qian, Yu [Department of Orthopaedics, Shaoxing People' s Hospital, 568 Zhongxing North Road, Shaoxing 312000 (China); Fu, Qiang, E-mail: chyygklwq@hotmail.com [Department of Orthopaedics, Changhai Hospital, Second Military Medical University, 168 Changhai Road, Shanghai 200433 (China)

2012-06-15

Highlights: Black-Right-Pointing-Pointer {beta}-Catenin expression were markedly down-regulated by CTNNB1 shRNA. Black-Right-Pointing-Pointer CTNNB1 shRNA could inhibit the proliferation of RPMI8226 cells. Black-Right-Pointing-Pointer Significantly profound apoptotic cell death in CTNNB1 shRNA cells. Black-Right-Pointing-Pointer In vivo, CTNNB1 silence led to a growth inhibition of myeloma growth. Black-Right-Pointing-Pointer c-myc and {beta}-catenin in the expression cells of cleaved caspase-3 were increased. -- Abstract: Multiple myeloma (MM) is thrombogenic as a consequence of multiple hemostatic effects. Overexpression of {beta}-catenin has been observed in several types of malignant tumors, including MM. However, the relationship between {beta}-catenin expression and MM remains unclear. In the present study, RNA interference was used to inhibit {beta}-catenin expression in RPMI8226 cells. RT-PCR and Western blotting analyses showed that {beta}-catenin mRNA and protein expression were markedly down-regulated by CTNNB1 shRNA. Western blotting showed that the protein levels of cyclin D1 and glutamine synthetase were downregulated and supported the transcriptional regulatory function of {beta}-catenin. The MTT assay showed that CTNNB1 shRNA could have significant inhibitory effects on the proliferation of RPMI8226 cells. The TOPflash reporter assay demonstrated significant downregulation after CTNNB1 shRNA transfection in RPMI8226 cells. Flow cytometric analyses also showed significantly profound apoptosis in CTNNB1 shRNA cells. We found CTNNB1 silence led to growth inhibition of MM growth in vivo. Immunohistochemical analyses showed that c-myc and {beta}-catenin were reduced in CTNNB1 shRNA tumor tissues, but that expression of cleaved caspase-3 was increased. These results show that {beta}-catenin could be a new therapeutic agent that targets the biology of MM cells.

Structure-activity relationships of rosiglitazone for peroxisome proliferator-activated receptor gamma transrepression.

Science.gov (United States)

Toyota, Yosuke; Nomura, Sayaka; Makishima, Makoto; Hashimoto, Yuichi; Ishikawa, Minoru

2017-06-15

Anti-inflammatory effects of peroxisome proliferator-activated receptor gamma (PPRAγ) ligands are thought to be largely due to PPARγ-mediated transrepression. Thus, transrepression-selective PPARγ ligands without agonistic activity or with only partial agonistic activity should exhibit anti-inflammatory properties with reduced side effects. Here, we investigated the structure-activity relationships (SARs) of PPARγ agonist rosiglitazone, focusing on transrepression activity. Alkenic analogs showed slightly more potent transrepression with reduced efficacy of transactivating agonistic activity. Removal of the alkyl group on the nitrogen atom improved selectivity for transrepression over transactivation. Among the synthesized compounds, 3l exhibited stronger transrepressional activity (IC 50 : 14μM) and weaker agonistic efficacy (11%) than rosiglitazone or pioglitazone. Copyright © 2017 Elsevier Ltd. All rights reserved.

mTOR inhibition sensitizes ONC201-induced anti-colorectal cancer cell activity.

Science.gov (United States)

Jin, Zhe-Zhu; Wang, Wei; Fang, Di-Long; Jin, Yong-Jun

2016-09-30

We here tested the anti-colorectal cancer (CRC) activity by a first-in-class small molecule TRAIL inducer ONC201. The potential effect of mTOR on ONC201's actions was also examined. ONC201 induced moderate cytotoxicity against CRC cell lines (HT-29, HCT-116 and DLD-1) and primary human CRC cells. Significantly, AZD-8055, a mTOR kinase inhibitor, sensitized ONC201-induced cytotoxicity in CRC cells. Meanwhile, ONC201-induced TRAIL/death receptor-5 (DR-5) expression, caspase-8 activation and CRC cell apoptosis were also potentiated with AZD-8055 co-treatment. Reversely, TRAIL sequestering antibody RIK-2 or the caspase-8 specific inhibitor z-IETD-fmk attenuated AZD-8055 plus ONC201-induced CRC cell death. Further, mTOR kinase-dead mutation (Asp-2338-Ala) or shRNA knockdown significantly sensitized ONC201's activity in CRC cells, leading to profound cell death and apoptosis. On the other hand, expression of a constitutively-active S6K1 (T389E) attenuated ONC201-induced CRC cell apoptosis. For the mechanism study, we showed that ONC201 blocked Akt, but only slightly inhibited mTOR in CRC cells. Co-treatment with AZD-8055 also concurrently blocked mTOR activation. These results suggest that mTOR could be a primary resistance factor of ONC201 in CRC cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Income inequality is associated with stronger social comparison effects: The effect of relative income on life satisfaction.

Science.gov (United States)

Cheung, Felix; Lucas, Richard E

2016-02-01

Previous research has shown that having rich neighbors is associated with reduced levels of subjective well-being, an effect that is likely due to social comparison. The current study examined the role of income inequality as a moderator of this relative income effect. Multilevel analyses were conducted on a sample of more than 1.7 million people from 2,425 counties in the United States. Results showed that higher income inequality was associated with stronger relative income effects. In other words, people were more strongly influenced by the income of their neighbors when income inequality was high. (c) 2016 APA, all rights reserved).

Income Inequality Is Associated with Stronger Social Comparison Effects: The Effect of Relative Income on Life Satisfaction

Science.gov (United States)

Cheung, Felix; Lucas, Richard E.

2015-01-01

Previous research has shown that having rich neighbors is associated with reduced levels of subjective well-being, an effect that is likely due to social comparison. The current study examined the role of income inequality as a moderator of this relative income effect. Multilevel analyses were conducted on a sample of over 1.7 million people from 2,425 counties in the United States. Results showed that higher income inequality was associated with stronger relative income effects. In other words, people were more strongly influenced by the income of their neighbors when income inequality was high. PMID:26191957

Inhibitors of MyD88-dependent proinflammatory cytokine production identified utilizing a novel RNA interference screening approach.

Directory of Open Access Journals (Sweden)

John S Cho

2009-09-01

Full Text Available The events required to initiate host defenses against invading pathogens involve complex signaling cascades comprised of numerous adaptor molecules, kinases, and transcriptional elements, ultimately leading to the production of proinflammatory cytokines, such as tumor necrosis factor alpha (TNF-alpha. How these signaling cascades are regulated, and the proteins and regulatory elements participating are still poorly understood.We report here the development a completely random short-hairpin RNA (shRNA library coupled with a novel forward genetic screening strategy to identify inhibitors of Toll-like receptor (TLR dependent proinflammatory responses. We developed a murine macrophage reporter cell line stably transfected with a construct expressing diphtheria toxin-A (DT-A under the control of the TNF-alpha-promoter. Stimulation of the reporter cell line with the TLR ligand lipopolysaccharide (LPS resulted in DT-A induced cell death, which could be prevented by the addition of an shRNA targeting the TLR adaptor molecule MyD88. Utilizing this cell line, we screened a completely random lentiviral short hairpin RNA (shRNA library for sequences that inhibited TLR-mediated TNF-alpha production. Recovery of shRNA sequences from surviving cells led to the identification of unique shRNA sequences that significantly inhibited TLR4-dependent TNF-alpha gene expression. Furthermore, these shRNA sequences specifically blocked TLR2 but not TLR3-dependent TNF-alpha production.Thus, we describe the generation of novel tools to facilitate large-scale forward genetic screens in mammalian cells and the identification of potent shRNA inhibitors of TLR2 and TLR4- dependent proinflammatory responses.

Enhanced osteogenesis of adipose derived stem cells with Noggin suppression and delivery of BMP-2.

Directory of Open Access Journals (Sweden)

Jiabing Fan

Full Text Available Bone morphogenetic proteins (BMPs are believed to be the most potent osteoinductive factors. However, BMPs are highly pleiotropic molecules and their supra-physiological high dose requirement leads to adverse side effects and inefficient bone formation. Thus, there is a need to develop alternative osteoinductive growth factor strategies that can effectively complement BMP activity. In this study, we intrinsically stimulated BMP signaling in adipose derived stem cells (ASCs by downregulating noggin, a potent BMP antagonist, using an RNAi strategy. ASCs transduced with noggin shRNA significantly enhanced osteogenic differentiation of cells. The potency of endogenous BMPs was subsequently enhanced by stimulating ASCs with exogenous BMPs at a significantly reduced dose. The level of mineralization in noggin shRNA treated ASCs when treated with BMP-2 was comparable to that of control shRNA treated cell treated with 10-fold more BMP-2. The complementary strategy of noggin suppression + BMP-2 to enhance osteogenesis was further confirmed in 3D in vitro environments using scaffolds consisting of chitosan (CH, chondroitin sulfate (CS, and apatite layer on their surfaces designed to slowly release BMP-2. This finding supports the novel therapeutic potential of this complementary strategy in bone regeneration.

Daytime warming has stronger negative effects on soil nematodes than night-time warming

Science.gov (United States)

Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

2017-03-01

Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatment significantly decreased soil nematodes density, and night-time warming treatment marginally affected the density. The response of bacterivorous nematode and fungivorous nematode to experimental warming showed the same trend with the total density. Redundancy analysis revealed an opposite effect of soil moisture and soil temperature, and the most important of soil moisture and temperature in night-time among the measured environment factors, affecting soil nematode community. Our findings suggested that daily minimum temperature and warming induced drying are most important factors affecting soil nematode community under the current global asymmetric warming.

Bilingual recognition memory: stronger performance but weaker levels-of-processing effects in the less fluent language.

Science.gov (United States)

Francis, Wendy S; Gutiérrez, Marisela

2012-04-01

The effects of bilingual proficiency on recognition memory were examined in an experiment with Spanish-English bilinguals. Participants learned lists of words in English and Spanish under shallow- and deep-encoding conditions. Overall, hit rates were higher, discrimination greater, and response times shorter in the nondominant language, consistent with effects previously observed for lower frequency words. Levels-of-processing effects in hit rates, discrimination, and response time were stronger in the dominant language. Specifically, with shallow encoding, the advantage for the nondominant language was larger than with deep encoding. The results support the idea that memory performance in the nondominant language is impacted by both the greater demand for cognitive resources and the lower familiarity of the words.

M3 receptor is involved in the effect of penehyclidine hydrochloride reduced endothelial injury in LPS-stimulated human pulmonary microvascular endothelial cell.

Science.gov (United States)

Yuan, Qinghong; Xiao, Fei; Liu, Qiangsheng; Zheng, Fei; Shen, Shiwen; He, Qianwen; Chen, Kai; Wang, Yanlin; Zhang, Zongze; Zhan, Jia

2018-02-01

LPS has been recently shown to induce muscarinic acetylcholine 3 receptor (M 3 receptor) expression and penehyclidine hydrochloride (PHC) is an anticholinergic drug which could block the expression of M 3 receptor. PHC has been demonstrated to perform protective effect on cell injury. This study is to investigate whether the effect of PHC on microvascular endothelial injury is related to its inhibition of M 3 receptor or not. HPMVECs were treated with specific M 3 receptor shRNA or PBS, and randomly divided into LPS group (A group), LPS+PHC group (B group), LPS + M 3 shRNA group (C group) and LPS + PHC + M 3 shRNA group (D group). Cells were collected at 60 min after LPS treatment to measure levels of LDH, endothelial permeability, TNF-α and IL-6 levels, NF-κB p65 activation, I-κB protein expression, p38MAPK, and ERK1/2 activations as well as M 3 mRNA expression. PHC could decrease LDH levels, cell permeability, TNF-α and IL-6 levels, p38 MAPK, ERK1/2, NF-κB p65 activations and M 3 mRNA expressions compared with LPS group. When M 3 receptor was silence, the changes of these indices were much more obvious. These findings suggest that M 3 receptor plays an important role in LPS-induced pulmonary microvascular endothelial injury, which is regulated through NF-κB p65 and MAPK activation. And knockout of M 3 receptor could attenuate LPS-induced pulmonary microvascular endothelial injury. Regulative effects of PHC on pulmonary microvascular permeability and NF-κB p65 as well as MAPK activations are including but not limited to inhibition of M 3 receptor. Copyright © 2017 Elsevier Ltd. All rights reserved.

Antioxidant activity of Vitex agnus-castus L. extracts.

Science.gov (United States)

Sağlam, Hüsniye; Pabuçcuoğlu, Aysun; Kivçak, Bijen

2007-11-01

The ethanol, n-hexane and water extracts of Vitex agnus-castus L. leaves and fruits were screened for antioxidant activity. The antioxidant activity of plant extracts was determined by an improved assay based on the decolorization of the radical monocation of 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS.+). The water and ethanol extracts showed stronger antioxidant activity than the n-hexane extracts. Copyright (c) 2007 John Wiley & Sons, Ltd.

[Knockdown of indoleamine 2, 3-dioxygenase 2 (IDO2)gene inhibits tumor growth and enhances immune function in mice bearing melanoma].

Science.gov (United States)

Liu, Yanling; Liu, Huan; Xiang, Yingqing; Chen, Xiaoyan; Xu, Ping; Min, Weiping

2017-12-01

Objective To study the role of indoleamine 2, 3-dioxygenase 2 (IDO2) in anti-tumor therapy and its effect on the immune response when using IDO2 as therapeutic target. Methods B16-BL6 cells were used to construct mouse xenografted melanoma model. IDO2-shRNA that contained IDO2-siRNA or control shRNA (scrambled-shRNA) was injected hydrodynamically via the tail vein to treat melanoma. The tumor size was measured by vernier caliper. Flow cytometry was performed to analyze the percentage of regulatory T cells (Tregs), T cell apoptosis rate in draining lymph nodes and the expressions of co-stimulatory molecules on splenic dendritic cells (DCs) from different treatment groups. The lactate dehydrogenase (LDH) assay was used to determine the CD8 + cytotoxic T lymphocyte (CTL) activity. The serum levels of tumor necrosis factor α (TNF-α) and interferon γ (IFN-γ) were detected by ELISA. Results In the IDO2-shRNA treated group, the tumor formation time was delayed, tumor grew slowly, and excised tumor mass was significantly reduced. IDO2-shRNA treatment also decreased the percentage of Tregs and T cell apoptosis in draining lymph nodes and increased the expressions of co-stimulatory molecules CD80 and CD86 on splenic DCs. The capacity of CD8 + T cells to kill B16-BL6 cells was enhanced and the serum levels of TNF-α and IFN-γ were upregulated. Conclusion Silencing IDO2 can effectively inhibit the growth of melanoma and improve the anti-tumor immune response in vivo.

Which cue to ‘want’? Opioid stimulation of central amygdala makes goal-trackers show stronger goal-tracking, just as sign-trackers show stronger sign-tracking

Science.gov (United States)

DiFeliceantonio, Alexandra G.; Berridge, Kent C.

2012-01-01

Pavlovian cues that have been paired with reward can gain incentive salience. Drug addicts find drug cues motivationally attractive and binge eaters are attracted by food cues. But the level of incentive salience elicited by a cue re-encounter still varies across time and brain states. In an animal model, cues become attractive and ‘wanted’ in an ‘autoshaping’ paradigm, where different targets of incentive salience emerge for different individuals. Some individuals (sign-trackers) find a predictive discrete cue attractive while others find a reward contiguous and goal cue more attractive (location where reward arrives: goal-trackers). Here we assessed whether central amygdala mu opioid receptor stimulation enhances the phasic incentive salience of the goal-cue for goal-trackers during moments of predictive cue presence (expressed in both approach and consummatory behaviors to goal cue), just as it enhances the attractiveness of the predictive cue target for sign-trackers. Using detailed video analysis we measured the approaches, nibbles, sniffs, and bites directed at their preferred target for both sign-trackers and goal-trackers. We report that DAMGO microinjections in central amygdala made goal-trackers, like sign-trackers, show phasic increases in appetitive nibbles and sniffs directed at the goal-cue expressed selectively whenever the predictive cue was present. This indicates enhancement of incentive salience attributed by both goal trackers and sign-trackers, but attributed in different directions: each to their own target cue. For both phenotypes, amygdala opioid stimulation makes the individual’s prepotent cue into a stronger motivational magnet at phasic moments triggered by a CS that predicts the reward UCS. PMID:22391118

Activation of the PI3K/AKT pathway in Merkel cell carcinoma.

Directory of Open Access Journals (Sweden)

Christian Hafner

Full Text Available Merkel cell carcinoma (MCC is a highly aggressive skin cancer with an increasing incidence. The understanding of the molecular carcinogenesis of MCC is limited. Here, we scrutinized the PI3K/AKT pathway, one of the major pathways activated in human cancer, in MCC. Immunohistochemical analysis of 41 tumor tissues and 9 MCC cell lines revealed high levels of AKT phosphorylation at threonine 308 in 88% of samples. Notably, the AKT phosphorylation was not correlated with the presence or absence of the Merkel cell polyoma virus (MCV. Accordingly, knock-down of the large and small T antigen by shRNA in MCV positive MCC cells did not affect phosphorylation of AKT. We also analyzed 46 MCC samples for activating PIK3CA and AKT1 mutations. Oncogenic PIK3CA mutations were found in 2/46 (4% MCCs whereas mutations in exon 4 of AKT1 were absent. MCC cell lines demonstrated a high sensitivity towards the PI3K inhibitor LY-294002. This finding together with our observation that the PI3K/AKT pathway is activated in the majority of human MCCs identifies PI3K/AKT as a potential new therapeutic target for MCC patients.

Detection of Extracellular Enzyme Activities in Ganoderma neo-japonicum

OpenAIRE

Jo, Woo-Sik; Park, Ha-Na; Cho, Doo-Hyun; Yoo, Young-Bok; Park, Seung-Chun

2011-01-01

The ability of Ganoderma to produce extracellular enzymes, including β-glucosidase, cellulase, avicelase, pectinase, xylanase, protease, amylase, and ligninase was tested in chromogenic media. β-glucosidase showed the highest activity, among the eight tested enzymes. In particular, Ganoderma neo-japonicum showed significantly stronger activity for β-glucosidase than that of the other enzymes. Two Ganoderma lucidum isolates showed moderate activity for avicelase; however, Ganoderma neo-japonic...

Physical Activity and Adiposity Markers at Older Ages: Accelerometer Vs Questionnaire Data

Science.gov (United States)

Sabia, Séverine; Cogranne, Pol; van Hees, Vincent T.; Bell, Joshua A.; Elbaz, Alexis; Kivimaki, Mika; Singh-Manoux, Archana

2015-01-01

Objective Physical activity is critically important for successful aging, but its effect on adiposity markers at older ages is unclear as much of the evidence comes from self-reported data on physical activity. We assessed the associations of questionnaire-assessed and accelerometer-assessed physical activity with adiposity markers in older adults. Design/Setting/Participants This was a cross-sectional study on 3940 participants (age range 60-83 years) of the Whitehall II study who completed a 20-item physical activity questionnaire and wore a wrist-mounted accelerometer for 9 days in 2012 and 2013. Measurements Total physical activity was estimated using metabolic equivalent hours/week for the questionnaire and mean acceleration for the accelerometer. Time spent in moderate-and-vigorous physical activity (MVPA) was also assessed by questionnaire and accelerometer. Adiposity assessment included body mass index, waist circumference, and fat mass index. Fat mass index was calculated as fat mass/height² (kg/m²), with fat mass estimated using bioimpedance. Results Greater total physical activity was associated with lower adiposity for all adiposity markers in a dose-response manner. In men, the strength of this association was 2.4 to 2.8 times stronger with the accelerometer than with questionnaire data. In women, it was 1.9 to 2.3 times stronger. For MVPA, questionnaire data in men suggested no further benefit for adiposity markers past 1 hour/week of activity. This was not the case for accelerometer-assessed MVPA where, for example, compared with men undertaking physical activity with adiposity markers in older adults was stronger when physical activity was assessed by accelerometer compared with questionnaire, suggesting that physical activity might be more important for adiposity than previously estimated. PMID:25752539

The polar 2e/12c bond in phenalenyl-azaphenalenyl hetero-dimers: Stronger stacking interaction and fascinating interlayer charge transfer

Energy Technology Data Exchange (ETDEWEB)

Zhong, Rong-Lin; Li, Zhi-Ru, E-mail: hlxu@nenu.edu.cn, E-mail: lzr@jlu.edu.cn [Institute of Theoretical Chemistry, Jilin University, Changchun 130023 (China); Xu, Hong-Liang, E-mail: hlxu@nenu.edu.cn, E-mail: lzr@jlu.edu.cn [Institute of Functional Material Chemistry, Faculty of Chemistry, Northeast Normal University, Changchun, Jilin 130024 (China)

2016-08-07

An increasing number of chemists have focused on the two-electron/multicenter bond (2e/mc) that was first introduced to interpret the bonding mechanism of radical dimers. Herein, we report the polar two-electron/twelve center (2e/12c) bonding character in a series of phenalenyl-azaphenalenyl radical hetero-dimers. Interestingly, the bonding energy of weaker polar hetero-dimer (P-TAP) is dominated by the overlap of the two different singly occupied molecular orbital of radicals, while that of stronger polar hetero-dimer (P-HAP) is dominated by the electrostatic attraction. Results show that the difference between the electronegativity of the monomers plays a prominent role in the essential attribution of the polar 2e/12c bond. Correspondingly, a stronger stacking interaction in the hetero-dimer could be effectively achieved by increasing the difference of nitrogen atoms number between the monomers. It is worthy of note that an interesting interlayer charge transfer character is induced in the polar hetero-dimers, which is dependent on the difference between the electronegativity of the monomers. It is our expectation that the new knowledge about the bonding nature of radical hetero-dimers might provide important information for designing radical based functional materials with various applications.

Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

International Nuclear Information System (INIS)

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

2012-01-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

Ebselen inhibits QSOX1 enzymatic activity and suppresses invasion of pancreatic and renal cancer cell lines.

Science.gov (United States)

Hanavan, Paul D; Borges, Chad R; Katchman, Benjamin A; Faigel, Douglas O; Ho, Thai H; Ma, Chen-Ting; Sergienko, Eduard A; Meurice, Nathalie; Petit, Joachim L; Lake, Douglas F

2015-07-30

Quiescin sulfhydryl oxidase 1 (QSOX1) is a highly conserved disulfide bond-generating enzyme that is overexpressed in diverse tumor types. Its enzymatic activity promotes the growth and invasion of tumor cells and alters extracellular matrix composition. In a nude mouse-human tumor xenograft model, tumors containing shRNA for QSOX1 grew significantly more slowly than controls, suggesting that QSOX1 supports a proliferative phenotype in vivo. High throughput screening experiments identified ebselen as an in vitro inhibitor of QSOX1 enzymatic activity. Ebselen treatment of pancreatic and renal cancer cell lines stalled tumor growth and inhibited invasion through Matrigel in vitro. Daily oral treatment with ebselen resulted in a 58% reduction in tumor growth in mice bearing human pancreatic tumor xenografts compared to controls. Mass spectrometric analysis of ebselen-treated QSOX1 mechanistically revealed that C165 and C237 of QSOX1 covalently bound to ebselen. This report details the anti-neoplastic properties of ebselen in pancreatic and renal cancer cell lines. The results here offer a "proof-of-principle" that enzymatic inhibition of QSOX1 may have clinical relevancy.

Elite level rhythmic gymnasts have significantly more and stronger pain than peers of similar age: a prospective study.

Science.gov (United States)

Sabeti, Manuel; Jeremian, Lusine; Graf, Alexandra; Kandelhart, Robert

2015-01-01

Rhythmic gymnastics (RG) unites aesthetic, ballet-like motion, and all aspects of gymnastics. To reach elite level, girls begin at early age the intensive training. To date it is unclear if such demanding training influences the incidence and intensity of painful overuse injuries. The purpose of this study is to analyze anatomical painful regions and pain intensity in elite level rhythmic gymnasts (elRG) and compare results with an age-matched control group (CG). This prospective field study was carried out at the European Championship in RG 2013 (218 participating athletes, Vienna, Austria). Volunteering athletes were interviewed according to a preformed questionnaire. As CG secondary school pupils without any competitive sports experience were analyzed accordingly. Overall, 243 young females (144 elRG/66 % of all participants and 99 CG) were observed. ElRGs were significantly (s.) smaller, lighter, and had s. stronger pain (p < 0.001). A total of 72 % of athletes reported to have at least one painful body region compared with 52 % of CG (p < 0.001). ElRG had nearly three times more serious injuries than the CG. In all 23 % off all elRG reported to have had no access to professional medical care. ElRGs were s. more frequently (25 vs 9 %) affected at the lumbar spine and the ankle joint (17.4 vs 7 %). To our knowledge, this trial analyzes the largest cohort of elRG to date. Hence, it is clearly alluded that intensive training in RG is a significant factor causing more and stronger pain than in a CG.

Short hairpin RNA interference therapy for ischemic heart disease

Science.gov (United States)

Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

2013-01-01

Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

Directory of Open Access Journals (Sweden)

You Mie Lee

Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

Adenoviral short hairpin RNA therapy targeting phosphodiesterase 5a relieves cardiac remodeling and dysfunction following myocardial infarction

Science.gov (United States)

Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang

2012-01-01

We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941

Dicer-independent processing of short hairpin RNAs

NARCIS (Netherlands)

Liu, Ying Poi; Schopman, Nick C. T.; Berkhout, Ben

2013-01-01

Short hairpin RNAs (shRNAs) are widely used to induce RNA interference (RNAi). We tested a variety of shRNAs that differed in stem length and terminal loop size and revealed strikingly different RNAi activities and shRNA-processing patterns. Interestingly, we identified a specific shRNA design that

The role of integrin-α5 in the proliferation and odontogenic differentiation of human dental pulp stem cells.

Science.gov (United States)

Cui, Li; Xu, Shuaimei; Ma, Dandan; Gao, Jie; Liu, Ying; Yue, Jing; Wu, Buling

2014-02-01

It has been reported that integrin-α5 (ITGA5) activity is related to cell proliferation, differentiation, migration, and organ development. However, the involvement of ITGA5 in the biological functions of human dental pulp stem cells (hDPSCs) has not been explored. The aim of this study was to investigate the role of ITGA5 in the proliferation and odontogenic differentiation of hDPSCs. We knocked down ITGA5 in hDPSCs using lentivirus-mediated ITGA5 short hairpin RNA (shRNA). Changes in the proliferation in hDPSCs infected with lentiviruses expressing ITGA5-specific shRNA or negative control shRNA were examined using the 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and 5-ethynyl-2'-deoxyuridine labeling. Both ITGA5 knockdown cells and shMock cells were cultured in mineralization medium for 3 weeks, and the differentiation of cells was detected with alizarin red S staining. The expression of odontogenic differentiation-related molecular markers was assessed using real-time polymerase chain reaction and Western blot assays. The knockdown of ITGA5 decreased the proliferation capacity of hDPSCs. ITGA5 shRNA promoted odontogenic differentiation of hDPSCs with the enhanced formation of mineralized nodules. It also up-regulated the messenger RNA expression of multiple markers of odontogenesis and the expression of dentin sialophosphoprotein protein. These findings suggest that ITGA5 plays an important role in maintaining hDPSCs in a proliferative state. The inhibition of ITGA5 signaling promotes the odontogenic differentiation of hDPSCs. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Females have stronger neurogenic response than males after non-specific nasal challenge in patients with seasonal allergic rhinitis.

Science.gov (United States)

Tomljenovic, Dejan; Baudoin, Tomislav; Megla, Zeljka Bukovec; Geber, Goran; Scadding, Glenis; Kalogjera, Livije

2018-07-01

Epidemiological studies show female predominance in the prevalence of non- allergic rhinitis (NAR) and local allergic rhinitis (LAR). Experimental studies show female patients with allergic rhinitis (AR) demonstrate higher levels of sensitivity to irritants and airway hyperresponsiveness than males. Bronchial asthma shows female predominance in post-puberty patients, and gender interaction with severe asthma endotypes. Fibromyalgia, chronic fatigue syndrome, migraine and chronic cough, syndromes, which are commonly related to neurokinin substance P (SP) in the literature, also show strong female predominance. Studies have demonstrated that sex hormones, primarily oestrogens, affect mast cell activation. Mast cell proteases can amplify neurogenic inflammatory responses including the release of SP. Based on human epidemiological data and animal experimental data we hypothesized that female patients have different interaction between mast cell activation and neurogenic inflammation, i.e. substance P release, resulting in a different nasal symptom profile. To test the hypothesis we performed allergen and non-specific nasal challenges in patients with seasonal allergic rhinitis (SAR) out of season and looked for gender differences in subjective and objective responses. The interaction between subjective and objective reactivity was evaluated through the comparison of subjective symptom scores, concentrations of neurokinin substance P (SP) and cellular markers in nasal lavages after low doses of nasal allergen challenges. Female allergic subjects tended to have higher substance P (SP) concentrations both before and after non-specific challenges. The difference between post-allergen and post - hypertonic saline (HTS) challenge was highly significant in female patients (p = 0.001), while insignificant in male subjects (p = 0.14). Female patients had significantly stronger burning sensation after HTS challenge than male. These data indicate difference in the

Alteration of a recombinant protein N-glycan structure in silkworms by partial suppression of N-acetylglucosaminidase gene expression.

Science.gov (United States)

Kato, Tatsuya; Kikuta, Kotaro; Kanematsu, Ayumi; Kondo, Sachiko; Yagi, Hirokazu; Kato, Koichi; Park, Enoch Y

2017-09-01

To synthesize complex type N-glycans in silkworms, shRNAs against the fused lobe from Bombyx mori (BmFDL), which codes N-acetylglucosaminidase (GlcNAcase) in the Golgi, was expressed by recombinant B. mori nucleopolyhedrovirus (BmNPV) in silkworm larvae. Expression was under the control of the actin promoter of B. mori or the U6-2 and i.e.-2 promoters from Orgyia pseudotsugata multiple nucleopolyhedrovirus (OpMNPV). The reduction of specific GlcNAcase activity was observed in Bm5 cells and silkworm larvae using the U6-2 promoter. In silkworm larvae, the partial suppression of BmFDL gene expression was observed. When shRNA against BmFDL was expressed under the control of U6-2 promoter, the Man 3 GlcNAc(Fuc)GlcNAc structure appeared in a main N-glycans of recombinant human IgG. These results suggested that the control of BmFDL expression by its shRNA in silkworms caused the modification of its N-glycan synthetic pathway, which may lead to the alteration of N-glycans in the expressed recombinant proteins. Suppression of BmFDL gene expression by shRNA is not sufficient to synthesize complex N-glycans in silkworm larvae but can modify the N-glycan synthetic pathway.

Cooperation of decay-accelerating factor and membrane cofactor protein in regulating survival of human cervical cancer cells

International Nuclear Information System (INIS)

Gao, Ling-Juan; Guo, Shu-Yu; Cai, You-Qun; Gu, Ping-Qing; Su, Ya-Juan; Gong, Hui; Liu, Yun; Chen, Chen

2009-01-01

Decay-accelerating factor (DAF) and membrane cofactor protein (MCP) are the key molecules involved in cell protection against autologus complement, which restricts the action of complement at critical stages of the cascade reaction. The cooperative effect of DAF and MCP on the survival of human cervical cancer cell (ME180) has not been demonstrated. In this study we applied, for the first time, short hairpin RNA (shRNA) to knock down the expression of the DAF and MCP with the aim of exploiting complement more effectively for tumor cell damage. Meanwhile, we investigated the cooperative effects of DAF and MCP on the viability and migration, moreover the proliferation of ME180 cell. The results showed that shRNA inhibition of DAF and MCP expression enhanced complement-dependent cytolysis (CDC) up to 39% for MCP and up to 36% for DAF, and the combined inhibition of both regulators yielded further additive effects in ME180 cells. Thus, the activities of DAF and MCP, when present together, are greater than the sum of the two protein individually. These data indicated that combined DAF and MCP shRNA described in this study may offer an additional alternative to improve the efficacy of antibody-and complement-based cancer immunotherapy

Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

International Nuclear Information System (INIS)

Wang, Bing; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

2013-01-01

Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells

Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

Energy Technology Data Exchange (ETDEWEB)

Wang, Bing, E-mail: wangbin69@yahoo.com; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

2013-07-19

Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells.

Antioxidant, Antibacterial activity and Brine shrimp toxicity test of some Mountainous Lichens from Nepal

Directory of Open Access Journals (Sweden)

Babita Paudel

2012-01-01

Full Text Available A total of twenty four lichen species belonging to six families were collected from mountainous region of Nepal. The methanol extracts of each species were tested for antimicrobial and antioxidant activitiesin vitro. It was found that extracts of twenty one lichen species were active againstB. subtilis and seven species were active againstS. aureus. Similarly, in DPPH assay, three speciesPeltigera sp.,Cladonia sp., andCanoparmelia sp. showed comparable activity with commercial standard, BHA. In ABTS+ assay, extracts ofParmoterma sp.,Ramalina sp.,Peltigera sp. andCladonia sp. showed stronger activity than ascorbic acid. The observed data after comparison with previously published reports indicated that the high altitude lichens contain stronger antioxidant and antibacterial constituents. Similarly, the methanol extracts ofHeterodermia sp. andRamalina sp. showed comparable toxicity effect with commercial standard berberine chloride indicating a potent source of anticancer drugs.

Culture but not gender modulates amygdala activation during explicit emotion recognition.

Science.gov (United States)

Derntl, Birgit; Habel, Ute; Robinson, Simon; Windischberger, Christian; Kryspin-Exner, Ilse; Gur, Ruben C; Moser, Ewald

2012-05-29

Mounting evidence indicates that humans have significant difficulties in understanding emotional expressions from individuals of different ethnic backgrounds, leading to reduced recognition accuracy and stronger amygdala activation. However, the impact of gender on the behavioral and neural reactions during the initial phase of cultural assimilation has not been addressed. Therefore, we investigated 24 Asians students (12 females) and 24 age-matched European students (12 females) during an explicit emotion recognition task, using Caucasian facial expressions only, on a high-field MRI scanner. Analysis of functional data revealed bilateral amygdala activation to emotional expressions in Asian and European subjects. However, in the Asian sample, a stronger response of the amygdala emerged and was paralleled by reduced recognition accuracy, particularly for angry male faces. Moreover, no significant gender difference emerged. We also observed a significant inverse correlation between duration of stay and amygdala activation. In this study we investigated the "alien-effect" as an initial problem during cultural assimilation and examined this effect on a behavioral and neural level. This study has revealed bilateral amygdala activation to emotional expressions in Asian and European females and males. In the Asian sample, a stronger response of the amygdala bilaterally was observed and this was paralleled by reduced performance, especially for anger and disgust depicted by male expressions. However, no gender difference occurred. Taken together, while gender exerts only a subtle effect, culture and duration of stay as well as gender of poser are shown to be relevant factors for emotion processing, influencing not only behavioral but also neural responses in female and male immigrants.

Responding to the Challenge of Providing Stronger Research Base for Teacher Education: Research Discourses in the Norwegian National Research School for Teacher Education

Science.gov (United States)

Østern, Anna-Lena

2016-01-01

Background and purpose: The purpose of this article is to shed light on how the research projects of 140 PhD candidates in the National Research School for Teacher Education in Norway (NAFOL) respond to the challenges faced by Norwegian teacher education regarding the demand for higher competence and a stronger research base. The concept of NAFOL…

Brain activations to emotional pictures are differentially associated with valence and arousal ratings

Directory of Open Access Journals (Sweden)

Antje B M Gerdes

2010-10-01

Full Text Available Several studies have investigated the neural responses triggered by emotional pictures, but the specificity of the involved structures such as the amygdala or the ventral striatum is still under debate. Furthermore, only few studies examined the association of stimuli’s valence and arousal and the underlying brain responses. Therefore, we investigated brain responses with functional magnetic resonance imaging of 17 healthy subjects to pleasant and unpleasant affective pictures with comparable arousal levels and afterwards assessed ratings of valence and arousal. As expected, unpleasant pictures strongly activated the right and left amygdala, the right hippocampus, and the medial occipital lobe, whereas pleasant pictures elicited significant activations in left occipital regions, and in parts of the medial temporal lobe. The direct comparison of unpleasant and pleasant pictures which were comparable in arousal clearly indicated stronger amygdala activation in response to the unpleasant pictures. Most important, correlational analyses revealed on the one hand that the arousal of unpleasant pictures was significantly associated with activations in the right amygdala and the left caudate body. On the other hand, valence of pleasant pictures was significantly correlated with activations in the right caudate head, extending to the nucleus accumbens (NAcc and the left dorso-lateral prefrontal cortex. These findings support the notion that the amygdala is primarily involved in processing of unpleasant stimuli, and the stronger the more arousing the stimuli are, whereas reward-related structures like the NAcc primarily responds to pleasant stimuli, the stronger the more positive the valence of these stimuli is.

More concerns and stronger beliefs about the necessity of medication in patients with acromegaly are associated with negative illness perceptions and impairment in quality of life.

Science.gov (United States)

Andela, Cornelie D; Biermasz, Nienke R; Kaptein, Adrian A; Pereira, Alberto M; Tiemensma, Jitske

2015-10-01

Patients with acromegaly can be treated with surgery, radiotherapy and/or medical treatment. In general, patients' beliefs about medication are associated with illness perceptions, a contributory factor of Quality of Life (QoL). At present, there are no quantitative studies on medication beliefs in patients with acromegaly. Here, we aimed to examine possible associations between medication beliefs, illness perceptions, and QoL. Furthermore we aimed to explore whether illness perceptions of patients with remission of acromegaly receiving medical treatment differ from patients without medical treatment. Cross-sectional evaluation of 73 patients with remission of acromegaly (n = 28 patients with medication, n = 45 without medication). The Beliefs about Medicines Questionnaire (BMQ), Illness Perception Questionnaire-Revised (IPQ-R), EuroQoL-5D, and AcroQoL were used for the assessment. Stronger beliefs about the necessity of medical treatment and stronger concerns about the adverse effects were associated with attributing more symptoms to acromegaly, perceiving more negative consequences, and having a stronger belief in a cyclical timeline (BMQ, all P Negative medication beliefs were related to more negative illness perceptions and worse disease-specific QoL. Patients receiving medical treatment for acromegaly tend to perceive a more chronic timeline of their disease, compared to patients with remission without medical treatment. These psychological factors need to be taken into account when treating patients and developing a psychosocial education program aiming to improve QoL. Copyright © 2015 Elsevier Ltd. All rights reserved.

Targeting PRMT5 as a Novel Radiosensitization Approach for Primary and Recurrent Prostate Cancer Treatment

Science.gov (United States)

2015-08-01

primary and recurrent prostate cancer cells toRT During the third grant period. we generated stable cell liens to indue bly express PRMT5 shRNA using...significant impact on the reporter gene activity (data not shown). Taken together, these results suggest that these SNPs have negligible effect on the 1.8 kb

Protein phosphatase 5 promotes hepatocarcinogenesis through interaction with AMP-activated protein kinase.

Science.gov (United States)

Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng

2017-08-15

The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.

Antimalarial Activity of C-10 Substituted Triazolyl Artemisinin.

Science.gov (United States)

Park, Gab-Man; Park, Hyun; Oh, Sangtae; Lee, Seokjoon

2017-12-01

We synthesized C-10 substituted triazolyl artemisinins by the Huisgen cycloaddition reaction between dihydroartemisinins (2) and variously substituted 1, 2, 3-triazoles (8a-8h). The antimalarial activities of 32 novel artemisinin derivatives were screened against a chloroquine-resistant parasite. Among them, triazolyl artemisinins with electron-withdrawing groups showed stronger antimalarial activities than those shown by the derivatives having electron-donating groups. In particularly, m-chlorotriazolyl artemisinin (9d-12d) showed antimalarial activity equivalent to that of artemisinin and could be a strong drug candidate.

Making muscles "stronger": exercise, nutrition, drugs.

Science.gov (United States)

Aagaard, P

2004-06-01

As described in this review, maximal muscle strength is strongly influenced by resistive-types of exercise, which induce adaptive changes in both neuromuscular function and muscle morphology. Further, timed intake of protein in conjunction with resistance training elicit greater strength and muscle size gains than resistance training alone. Creatine supplementation amplifies the hypertrophic response to resistance training, although some individuals may not respond positively. Locally produced muscle growth factors are upregulated during creatine supplementation, which contributes to increase the responsiveness of muscle cells to intensive training stimuli. Usage of anabolic steroids boosts muscle hypertrophy beyond inherent genetical limits, not only by increasing the DNA transcription rate for myofibrillar proteins but also by increasing the nucleus-to-cytoplasm ratio due to accelerated activation of myogenic satellite cells. However, severe tissue damaging effects exist with anabolic steroids, some of which are irreversible.

Do associations between objectively-assessed physical activity and neighbourhood environment attributes vary by time of the day and day of the week?

DEFF Research Database (Denmark)

Cerin, Ester; Mitáš, Josef; Cain, Kelli L

2017-01-01

, intersection density and land use mix were stronger in the mornings of weekdays and the afternoon/evening periods of both weekdays and weekend days. Associations between number of parks and MVPA were stronger in the mornings and afternoon/evenings irrespective of day of the week. Public transport density...... showed consistent positive associations with MVPA during weekends, while stronger effects on weekdays were observed in the morning and early evenings. CONCLUSIONS: This study suggests that space and time constraints in adults' daily activities are important factors that determine the impact...

Age differences in autobiographical memory across the adult lifespan: older adults report stronger phenomenology.

Science.gov (United States)

Luchetti, Martina; Sutin, Angelina R

2018-01-01

As an individual's life story evolves across adulthood, the subjective experience (phenomenology) of autobiographical memory likely changes. In addition to age at retrieval, both the recency of the memory and the age when a memory is formed may be particularly important to its phenomenology. The present work examines the effect of three temporal factors on phenomenology ratings: (a) age of the participant, (b) age at the event reported in the memory, and (c) memory age (recency). A large sample of Americans (N = 1120), stratified by chronological age, recalled and rated two meaningful memories, a Turning Point and an Early Childhood Memory. Ratings of phenomenology (e.g., vividness of turning points) were higher among older adults compared to younger adults. Memories of events from the reminiscence bump were more positive in valence than events from other time periods but did not differ on other phenomenological dimensions; recent memories had stronger phenomenology than remote memories. In contrast to phenomenology, narrative content was generally unrelated to participant age, age at the event, or memory age. Overall, the findings indicate age-related differences in how meaningful memories are re-experienced.

Synthesis and anti-inflammatory activity of phenylbutenoid dimer analogs

International Nuclear Information System (INIS)

Kim, Sung Soo; Fang, Yuan Ying; Park, Hae Eil

2015-01-01

Several phenylbutenoid dimer (PBD) analogs were synthesized and evaluated for their inhibitory activities against nitric oxide (NO) production and TNF-α release. The PBD analogs were synthesized via Diels–Alder and subsequent Schlosser reactions as key steps. Among the tested compounds, two analogs (8c, 8f) exhibited much stronger inhibitory activity against LPS-stimulated NO production and TNF-α release in RAW 264.7 cells than that of wogonin

JNK1 protects against glucolipotoxicity-mediated beta-cell apoptosis

DEFF Research Database (Denmark)

Prause, Michala; Christensen, Dan Ploug; Billestrup, Nils

2014-01-01

Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity. Endoplas......Pancreatic β-cell dysfunction is central to type 2 diabetes pathogenesis. Prolonged elevated levels of circulating free-fatty acids and hyperglycemia, also termed glucolipotoxicity, mediate β-cell dysfunction and apoptosis associated with increased c-Jun N-terminal Kinase (JNK) activity....... Endoplasmic reticulum (ER) and oxidative stress are elicited by palmitate and high glucose concentrations further potentiating JNK activity. Our aim was to determine the role of the JNK subtypes JNK1, JNK2 and JNK3 in palmitate and high glucose-induced β-cell apoptosis. We established insulin-producing INS1...... INS1 cells showed increased apoptosis and cleaved caspase 9 and 3 compared to non-sense shRNA expressing control INS1 cells when exposed to palmitate and high glucose associated with increased CHOP expression, ROS formation and Puma mRNA expression. JNK2 shRNA expressing INS1 cells did not affect...

Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells

Energy Technology Data Exchange (ETDEWEB)

Hossain, Md. Motarab [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States); Banik, Naren L. [Department of Neurosciences, Medical University of South Carolina, Charleston, SC (United States); Ray, Swapan K., E-mail: swapan.ray@uscmed.sc.edu [Department of Pathology, Microbiology, and Immunology, University of South Carolina School of Medicine, Columbia, SC (United States)

2012-08-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-{kappa}B), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

Culture but not gender modulates amygdala activation during explicit emotion recognition

Directory of Open Access Journals (Sweden)

Derntl Birgit

2012-05-01

Full Text Available Abstract Background Mounting evidence indicates that humans have significant difficulties in understanding emotional expressions from individuals of different ethnic backgrounds, leading to reduced recognition accuracy and stronger amygdala activation. However, the impact of gender on the behavioral and neural reactions during the initial phase of cultural assimilation has not been addressed. Therefore, we investigated 24 Asians students (12 females and 24 age-matched European students (12 females during an explicit emotion recognition task, using Caucasian facial expressions only, on a high-field MRI scanner. Results Analysis of functional data revealed bilateral amygdala activation to emotional expressions in Asian and European subjects. However, in the Asian sample, a stronger response of the amygdala emerged and was paralleled by reduced recognition accuracy, particularly for angry male faces. Moreover, no significant gender difference emerged. We also observed a significant inverse correlation between duration of stay and amygdala activation. Conclusion In this study we investigated the “alien-effect” as an initial problem during cultural assimilation and examined this effect on a behavioral and neural level. This study has revealed bilateral amygdala activation to emotional expressions in Asian and European females and males. In the Asian sample, a stronger response of the amygdala bilaterally was observed and this was paralleled by reduced performance, especially for anger and disgust depicted by male expressions. However, no gender difference occurred. Taken together, while gender exerts only a subtle effect, culture and duration of stay as well as gender of poser are shown to be relevant factors for emotion processing, influencing not only behavioral but also neural responses in female and male immigrants.

The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

International Nuclear Information System (INIS)

Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

2015-01-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

Energy Technology Data Exchange (ETDEWEB)

Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

2015-05-01

The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

Pasture v. standard dairy cream in high-fat diet-fed mice: improved metabolic outcomes and stronger intestinal barrier.

Science.gov (United States)

Benoit, Bérengère; Plaisancié, Pascale; Géloën, Alain; Estienne, Monique; Debard, Cyrille; Meugnier, Emmanuelle; Loizon, Emmanuelle; Daira, Patricia; Bodennec, Jacques; Cousin, Olivier; Vidal, Hubert; Laugerette, Fabienne; Michalski, Marie-Caroline

2014-08-28

Dairy products derived from the milk of cows fed in pastures are characterised by higher amounts of conjugated linoleic acid and α-linolenic acid (ALA), and several studies have shown their ability to reduce cardiovascular risk. However, their specific metabolic effects compared with standard dairy in a high-fat diet (HFD) context remain largely unknown; this is what we determined in the present study with a focus on the metabolic and intestinal parameters. The experimental animals were fed for 12 weeks a HFD containing 20 % fat in the form of a pasture dairy cream (PDC) or a standard dairy cream (SDC). Samples of plasma, liver, white adipose tissue, duodenum, jejunum and colon were analysed. The PDC mice, despite a higher food intake, exhibited lower fat mass, plasma and hepatic TAG concentrations, and inflammation in the adipose tissue than the SDC mice. Furthermore, they exhibited a higher expression of hepatic PPARα mRNA and adipose tissue uncoupling protein 2 mRNA, suggesting an enhanced oxidative activity of the tissues. These results might be explained, in part, by the higher amounts of ALA in the PDC diet and in the liver and adipose tissue of the PDC mice. Moreover, the PDC diet was found to increase the proportions of two strategic cell populations involved in the protective function of the intestinal epithelium, namely Paneth and goblet cells in the small intestine and colon, compared with the SDC diet. In conclusion, a PDC HFD leads to improved metabolic outcomes and to a stronger gut barrier compared with a SDC HFD. This may be due, at least in part, to the protective mechanisms induced by specific lipids.

Enabling nucleophilic substitution reactions of activated alkyl fluorides through hydrogen bonding.

Science.gov (United States)

Champagne, Pier Alexandre; Pomarole, Julien; Thérien, Marie-Ève; Benhassine, Yasmine; Beaulieu, Samuel; Legault, Claude Y; Paquin, Jean-François

2013-05-03

It was discovered that the presence of water as a cosolvent enables the reaction of activated alkyl fluorides for bimolecular nucleophilic substitution reactions. DFT calculations show that activation proceeds through stabilization of the transition structure by a stronger F···H2O interaction and diminishing C-F bond elongation, and not simple transition state electrostatic stabilization. Overall, the findings put forward a distinct strategy for C-F bond activation through H-bonding.

Bactericidal activity of LFchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides

NARCIS (Netherlands)

Bolscher, J.G.M.; Adão, R.; Nazmi, K.; van den Keijbus, P.A.M.; van 't Hof, W.; van Nieuw Amerongen, A.; Bastos, M.; Veerman, E.C.I.

2009-01-01

The innate immunity factor lactoferrin harbours two antimicrobial moieties, lactoferricin and lactoferrampin, situated in close proximity in the N1 domain of the molecule. Most likely they cooperate in many of the beneficial activities of lactoferrin. To investigate whether chimerization of both

Fluorescence measurements show stronger cold inhibition of photosynthetic light reactions in Scots pine compared to Norway spruce as well as during spring compared to autumn.

Science.gov (United States)

Linkosalo, Tapio; Heikkinen, Juha; Pulkkinen, Pertti; Mäkipää, Raisa

2014-01-01

We studied the photosynthetic activity of Scots pine (Pinus sylvestris L.) and Norway spruce (Picea abies [L.] Karst) in relation to air temperature changes from March 2013 to February 2014. We measured the chlorophyll fluorescence of approximately 50 trees of each species growing in southern Finland. Fluorescence was measured 1-3 times per week. We began by measuring shoots present in late winter (i.e., March 2013) before including new shoots once they started to elongate in spring. By July, when the spring shoots had achieved similar fluorescence levels to the older ones, we proceeded to measure the new shoots only. We analyzed the data by fitting a sigmoidal model containing four parameters to link sliding averages of temperature and fluorescence. A parameter defining the temperature range over which predicted fluorescence increased most rapidly was the most informative with in describing temperature dependence of fluorescence. The model generated similar fluorescence patterns for both species, but differences were observed for critical temperature and needle age. Down regulation of the light reaction was stronger in spring than in autumn. Pine showed more conservative control of the photosynthetic light reactions, which were activated later in spring and more readily attenuated in autumn. Under the assumption of a close correlation of fluorescence and photosynthesis, spruce should therefore benefit more than pine from the increased photosynthetic potential during warmer springs, but be more likely to suffer frost damage with a sudden cooling following a warm period. The winter of 2013-2014 was unusually mild and similar to future conditions predicted by global climate models. During the mild winter, the activity of photosynthetic light reactions of both conifers, especially spruce, remained high. Because light levels during winter are too low for photosynthesis, this activity may translate to a net carbon loss due to respiration.

Fluorescence measurements show stronger cold inhibition of photosynthetic light reactions in Scots pine compared to Norway spruce as well as during spring compared to autumn

Directory of Open Access Journals (Sweden)

Tapio eLinkosalo

2014-06-01

Full Text Available We studied the photosynthetic activity of Scots pine (Pinus sylvestris L. and Norway spruce (Picea abies [L.] Karst in relation to air temperature changes from March 2013 to February 2014. We measured the chlorophyll fluorescence of approximately 50 trees of each species growing in southern Finland. Fluorescence was measured 13 times per week. We began by measuring shoots present in late winter (i.e., March 2013 before including new shoots once they started to elongate in spring. By July, when the spring shoots had achieved similar fluorescence levels to the older ones, we proceeded to measure the new shoots only.We analysed the data by fitting a sigmoidal model containing four parameters to link sliding averages of temperature and fluorescence. A parameter defining the temperature range over which predicted fluorescence increased most rapidly was the most informative with in describing temperature dependence of fluorescence.The model generated similar fluorescence patterns for both species, but differences were observed for critical temperature and needle age. Down regulation of the light reaction was stronger in spring than in autumn. Pine showed more conservative control of the photosynthetic light reactions, which were activated later in spring and more readily attenuated in autumn. Under the assumption of a close correlation of fluorescence and photosynthesis, spruce should therefore benefit more than pine from the increased photosynthetic potential during warmer springs, but be more likely to suffer frost damage with a sudden cooling following a warm period. The winter of 20132014 was unusually mild and similar to future conditions predicted by global warming models. During the mild winter, the activity of photosynthetic light reactions of both conifers, especially spruce, remained high. Because light levels during winter are too low for photosynthesis, this activity may translate to a net carbon loss due to respiration.

Serotonin transporter genotype (5-HTTLPR): effects of neutral and undefined conditions on amygdala activation.

Science.gov (United States)

Heinz, Andreas; Smolka, Michael N; Braus, Dieter F; Wrase, Jana; Beck, Anne; Flor, Herta; Mann, Karl; Schumann, Gunter; Büchel, Christian; Hariri, Ahmad R; Weinberger, Daniel R

2007-04-15

A polymorphism of the human serotonin transporter gene (SCL6A4) has been associated with serotonin transporter expression and with processing of aversive stimuli in the amygdala. Functional imaging studies show that during the presentation of aversive versus neutral cues, healthy carriers of the short (s) allele showed stronger amygdala activation than long (l) carriers. However, a recent report suggested that this interaction is driven by amygdala deactivation during presentation of neutral stimuli in s carriers. Functional MRI was used to assess amygdala activation during the presentation of a fixation cross or affectively aversive or neutral visual stimuli in 29 healthy men. Amygdala activation was increased in s carriers during undefined states such as the presentation of a fixation cross compared with emotionally neutral conditions. This finding suggests that s carriers show stronger amygdala reactivity to stimuli and contexts that are relatively uncertain, which we propose are stressful.

What doesn't kill you makes you stronger

DEFF Research Database (Denmark)

Borregaard, Niels

2014-01-01

In this issue of Immunity, Campbell et al. (2014) demonstrate that hypoxia caused by the respiratory burst of infiltrating neutrophils activates hypoxia inducible factor (HIF) in epithelial cells and protects the mucosa cells in an experimental model of inflammatory bowel disease....

The impact of the neurodevelopmental traction technique on activation of lateral abdominal muscles in children aged 11-13 years.

Science.gov (United States)

Gogola, Anna; Gnat, Rafał; Dziub, Dorota; Gwóźdź, Michalina; Zaborowska, Małgorzata

2016-06-27

The aim of the study was to evaluate the activation of lateral abdominal muscles (LAM) in response to neurodevelopmental traction technique as assessed by ultrasounds as well as to compare the effects of different traction forces. An experiment with repeated measurements of the dependent variables was conducted. Thirty-seven children (22 girls) participated. Measurements of LAM thickness (indicating LAM activation) were performed bilaterally during traction of 5% body weight: 1) in neutral position, 2) in 20° posterior trunk inclination; during traction of 15% body weight: 3) in neutral position, 4) in 20° posterior trunk inclination. The ultrasound technology was employed. When applying the lighter traction the superficial LAM (external and internal oblique muscles) showed significant changes. The mean thickness of both muscles during traction increased (both p  0.05). Stronger traction elicited smaller changes. External and internal oblique muscles showed significant increases (p stronger traction (p Stronger traction induces smaller LAM thickness changes than lighter traction.

Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

Science.gov (United States)

Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

2016-07-27

Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

Troglitazone suppresses telomerase activity independently of PPARγ in estrogen-receptor negative breast cancer cells

International Nuclear Information System (INIS)

Rashid-Kolvear, Fariborz; Taboski, Michael AS; Nguyen, Johnny; Wang, Dong-Yu; Harrington, Lea A; Done, Susan J

2010-01-01

Breast cancer is one the highest causes of female cancer death worldwide. Many standard chemotherapeutic agents currently used to treat breast cancer are relatively non-specific and act on all rapidly dividing cells. In recent years, more specific targeted therapies have been introduced. It is known that telomerase is active in over 90% of breast cancer tumors but inactive in adjacent normal tissues. The prevalence of active telomerase in breast cancer patients makes telomerase an attractive therapeutic target. Recent evidence suggests that telomerase activity can be suppressed by peroxisome proliferator activated receptor gamma (PPARγ). However, its effect on telomerase regulation in breast cancer has not been investigated. In this study, we investigated the effect of the PPARγ ligand, troglitazone, on telomerase activity in the MDA-MB-231 breast cancer cell line. Real time RT-PCR and telomerase activity assays were used to evaluate the effect of troglitazone. MDA-MB-231 cells had PPARγ expression silenced using shRNA interference. We demonstrated that troglitazone reduced the mRNA expression of hTERT and telomerase activity in the MDA-MB-231 breast cancer cell line. Troglitazone reduced telomerase activity even in the absence of PPARγ. In agreement with this result, we found no correlation between PPARγ and hTERT mRNA transcript levels in breast cancer patients. Statistical significance was determined using Pearson correlation and the paired Student's t test. To our knowledge, this is the first time that the effect of troglitazone on telomerase activity in breast cancer cells has been investigated. Our data suggest that troglitazone may be used as an anti-telomerase agent; however, the mechanism underlying this inhibitory effect remains to be determined

“Environmental Psychology” the mental benefits of physical activities in natural settings

DEFF Research Database (Denmark)

De Dominicis, Stefano

2017-01-01

Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising...

Collective Nostalgia Is Associated With Stronger Outgroup-Directed Anger and Participation in Ingroup-Favoring Collective Action

Directory of Open Access Journals (Sweden)

Wing-Yee Cheung

2017-08-01

Full Text Available Collective nostalgia refers to longing for the way society used to be. We tested whether collective nostalgia is associated with ingroup-favoring collective action and whether this association is mediated by outgroup-directed anger and outgroup-directed contempt. We conducted an online study of Hong Kong residents (N = 111 during a large-scale democratic social movement, the Umbrella Movement, that took place in Hong Kong in 2014 in response to proposed electoral reforms by the Chinese government in Mainland China. Reported collective nostalgia for Hong Kong’s past was high in our sample and collective nostalgia predicted stronger involvement in ingroup-favoring collective action, and it did so indirectly via higher intensity of outgroup-directed anger (but not through outgroup-directed contempt. We argue that collective nostalgia has implications for strengthening ingroup-serving collective action, and we highlight the importance of arousal of group-based emotions in this process.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

Science.gov (United States)

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

Activation of mPTP-dependent mitochondrial apoptosis pathway by a novel pan HDAC inhibitor resminostat in hepatocellular carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Fu, Meili [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Shi, Wenhong [Department of Radiotherapy, Linyi Tumor Hospital, Linyi (China); Li, Zhengling [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, No. 27 Jiefang Road, Linyi 276000, Shandong (China)

2016-09-02

Over-expression and aberrant activation of histone deacetylases (HDACs) are often associated with poor prognosis of hepatocellular carcinoma (HCC). Here, we evaluated the potential anti-hepatocellular carcinoma (HCC) cell activity by resminostat, a novel pan HDAC inhibitor (HDACi). We demonstrated that resminostat induced potent cytotoxic and anti-proliferative activity against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, resminostat treatment in HCC cells activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway, which was evidenced by physical association of cyclophilin-D and adenine nucleotide translocator 1 (ANT-1), mitochondrial depolarization, cytochrome C release and caspase-9 activation. Intriguingly, the mPTP blockers (sanglifehrin A and cyclosporine A), shRNA knockdown of cyclophilin-D or the caspase-9 inhibitor dramatically attenuated resminostat-induced HCC cell apoptosis and cytotoxicity. Reversely, HCC cells with exogenous cyclophilin-D over-expression were hyper-sensitive to resminostat. Intriguingly, a low concentration of resminostat remarkably potentiated sorafenib-induced mitochondrial apoptosis pathway activation, leading to a profound cytotoxicity in HCC cells. The results of this preclinical study indicate that resminostat (or plus sorafenib) could be further investigated as a valuable anti-HCC strategy. - Highlights: • Resminostat inhibits human HCC cell survival and proliferation. • Resminostat activates mPTP-dependent mitochondrial apoptosis pathway in HCC cells. • Resminostat potentiates sorafenib-induced mitochondrial apoptosis pathway activation. • mPTP or caspase-9 inhibition attenuates apoptosis by resminostat or plus sorafenib.

Healthy hearts--and the universal benefits of being physically active: physical activity and health.

Science.gov (United States)

Blair, Steven N; Morris, Jeremy N

2009-04-01

Although ancient thinkers suggested that physical activity is good for health, systematic research on the topic did not begin until the middle of the 20th century. Early reports showed that individuals in active occupations had lower rates of heart disease than individuals in sedentary occupations. Investigators then began to evaluate leisure-time physical activity and health and found similar results. Later research used objective measures of cardiorespiratory fitness as the exposure, and found even stronger associations with health outcomes. Recent research has extended the earlier findings on activity or fitness and heart disease to a wide variety of health outcomes. We now know that regular physical activity of 150 minutes/week of moderate intensity physical activity reduces the risk of numerous chronic diseases, preserves health and function (both physical and mental) into old age, and extends longevity. The current challenge is to develop programs and interventions to promote physical activity for all in our increasingly sedentary societies.

Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations.

Science.gov (United States)

Hoogeveen, Heleen R; Jolij, Jacob; Ter Horst, Gert J; Lorist, Monicque M

2016-01-01

Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the actual perception of a food's sensory properties, and therefore highly rely on previous experiences of similar consumptions stored in memory. In this study we assessed the differential strength of food associations implicitly stored in memory, using an associative priming paradigm. Participants (N = 30) were exposed to a forced-choice picture-categorization task, in which the food or non-food target images were primed with either non-sensory or sensory related words. We observed a smaller N400 amplitude at the parietal electrodes when categorizing food as compared to non-food images. While this effect was enhanced by the presentation of a food-related word prime during food trials, the primes had no effect in the non-food trials. More specifically, we found that sensory associations are stronger implicitly represented in memory as compared to non-sensory associations. Thus, this study highlights the neuronal mechanisms underlying previous observations that sensory associations are important features of food memory, and therefore a primary motive in food choice.

Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

Science.gov (United States)

de Goeij, Moniek C M; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E

2017-06-01

This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were used to define episodic drinking (≥6 glasses on 1 day ≥1/week) and chronic drinking (≥14 glasses/week for women and ≥21 for men). These data were linked to longitudinal data from tax registries, to measure the experience and duration of job loss during a 5-year working history. Before the crisis, job loss experience and duration were not associated with harmful drinking. During the crisis, job loss for more than 6 months was associated with episodic drinking [OR 1.40 (95% CI 1.01; 1.94)], while current job loss was associated with chronic drinking [OR 1.43 (95% CI 1.03; 1.98)]. These associations were most clear in men and different between the pre-crisis and crisis period (p interaction = 0.023 and 0.035, respectively). The results suggest that economic crises strengthen the potential impact of job loss on harmful drinking, predominately among men.

Attenuated food anticipatory activity and abnormal circadian locomotor rhythms in Rgs16 knockdown mice.

Directory of Open Access Journals (Sweden)

Naoto Hayasaka

Full Text Available Regulators of G protein signaling (RGS are a multi-functional protein family, which functions in part as GTPase-activating proteins (GAPs of G protein α-subunits to terminate G protein signaling. Previous studies have demonstrated that the Rgs16 transcripts exhibit robust circadian rhythms both in the suprachiasmatic nucleus (SCN, the master circadian light-entrainable oscillator (LEO of the hypothalamus, and in the liver. To investigate the role of RGS16 in the circadian clock in vivo, we generated two independent transgenic mouse lines using lentiviral vectors expressing short hairpin RNA (shRNA targeting the Rgs16 mRNA. The knockdown mice demonstrated significantly shorter free-running period of locomotor activity rhythms and reduced total activity as compared to the wild-type siblings. In addition, when feeding was restricted during the daytime, food-entrainable oscillator (FEO-driven elevated food-anticipatory activity (FAA observed prior to the scheduled feeding time was significantly attenuated in the knockdown mice. Whereas the restricted feeding phase-advanced the rhythmic expression of the Per2 clock gene in liver and thalamus in the wild-type animals, the above phase shift was not observed in the knockdown mice. This is the first in vivo demonstration that a common regulator of G protein signaling is involved in the two separate, but interactive circadian timing systems, LEO and FEO. The present study also suggests that liver and/or thalamus regulate the food-entrained circadian behavior through G protein-mediated signal transduction pathway(s.

Using social capital to construct a conceptual International Classification of Functioning, Disability, and Health Children and Youth version-based framework for stronger inclusive education policies in Europe.

Science.gov (United States)

Maxwell, Gregor; Koutsogeorgou, Eleni

2012-02-01

Inclusive education is part of social inclusion; therefore, social capital can be linked to an inclusive education policy and practice. This association is explored in this article, and a practical measure is proposed. Specifically, the World Health Organization's International Classification of Functioning, Disability and Health Children and Youth Version (ICF-CY) is proposed as the link between social capital and inclusive education. By mapping participation and trust indicators of social capital to the ICF-CY and by using the Matrix to Analyse Functioning in Education Systems (MAFES) to analyze the functioning of inclusive education policies and systems, a measure for stronger inclusive education policies is proposed. Such a tool can be used for policy planning and monitoring to ensure better inclusive education environments. In conclusion, combining enhanced social capital linked to stronger inclusive education policies, by using the ICF-CY, can lead to better health and well-being for all.

Conserved features of cancer cells define their sensitivity to HAMLET-induced death; c-Myc and glycolysis.

Science.gov (United States)

Storm, P; Aits, S; Puthia, M K; Urbano, A; Northen, T; Powers, S; Bowen, B; Chao, Y; Reindl, W; Lee, D Y; Sullivan, N L; Zhang, J; Trulsson, M; Yang, H; Watson, J D; Svanborg, C

2011-12-01

HAMLET is the first member of a new family of tumoricidal protein-lipid complexes that kill cancer cells broadly, while sparing healthy, differentiated cells. Many and diverse tumor cell types are sensitive to the lethal effect, suggesting that HAMLET identifies and activates conserved death pathways in cancer cells. Here, we investigated the molecular basis for the difference in sensitivity between cancer cells and healthy cells. Using a combination of small-hairpin RNA (shRNA) inhibition, proteomic and metabolomic technology, we identified the c-Myc oncogene as one essential determinant of HAMLET sensitivity. Increased c-Myc expression levels promoted sensitivity to HAMLET and shRNA knockdown of c-Myc suppressed the lethal response, suggesting that oncogenic transformation with c-Myc creates a HAMLET-sensitive phenotype. Furthermore, HAMLET sensitivity was modified by the glycolytic state of tumor cells. Glucose deprivation sensitized tumor cells to HAMLET-induced cell death and in the shRNA screen, hexokinase 1 (HK1), 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 and hypoxia-inducible factor 1α modified HAMLET sensitivity. HK1 was shown to bind HAMLET in a protein array containing ∼8000 targets, and HK activity decreased within 15 min of HAMLET treatment, before morphological signs of tumor cell death. In parallel, HAMLET triggered rapid metabolic paralysis in carcinoma cells. Tumor cells were also shown to contain large amounts of oleic acid and its derivatives already after 15 min. The results identify HAMLET as a novel anti-cancer agent that kills tumor cells by exploiting unifying features of cancer cells such as oncogene addiction or the Warburg effect.

Neuropilin-1 interacts with the second branchial arch microenvironment to mediate chick neural crest cell dynamics

Science.gov (United States)

McLennan, Rebecca; Kulesa, Paul M.

2011-01-01

Cranial neural crest cells (NCCs) require neuropilin signaling to reach and invade the branchial arches. Here, we use an in vivo chick model to investigate whether the neuropilin-1 knockdown phenotype is specific to the second branchial arch (ba2), changes in NCC behaviors and phenotypic consequences, and whether neuropilins work together to facilitate entry into and invasion of ba2. We find that cranial NCCs with reduced neuropilin-1 expression displayed shorter protrusions and decreased cell body and nuclear length-to-width ratios characteristic of a loss in polarity and motility, after specific interaction with ba2. Directed NCC migration was rescued by transplantation of transfected cells into rhombomere 4 of younger hosts. Lastly, reduction of neuropilin-2 expression by shRNA either solely or with reduction of neuropilin-1 expression did not lead to a stronger head phenotype. Thus, NCCs, independent of rhombomere origin, require neuropilin-1, but not neuropilin-2 to maintain polarity and directed migration into ba2. PMID:20503363

Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

Energy Technology Data Exchange (ETDEWEB)

Frampton, Gabriel; Coufal, Monique [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Li, Huang [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Department of Hepatobiliary Surgery, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou (China); Ramirez, Jonathan [Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States); DeMorrow, Sharon, E-mail: demorrow@medicine.tamhsc.edu [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States)

2010-05-15

The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the {gamma}-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-{gamma}-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the {gamma}-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.

Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

International Nuclear Information System (INIS)

Frampton, Gabriel; Coufal, Monique; Li, Huang; Ramirez, Jonathan; DeMorrow, Sharon

2010-01-01

The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the γ-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-γ-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the γ-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.

Strategic Factors Influencing National and Regional Systems of Innovation: A Case of Weaker NSI with Stronger RSI

Directory of Open Access Journals (Sweden)

Pir Roshanuddin Shah Rashdi

2015-04-01

Full Text Available The issues of relationship between NSI ((National System of Innovation and RSI (Regional System of Innovation are not well reported with innovation policy research. That is, whether the NSI is the system on top of RSI, or the importance of regions make stronger NSIs. Therefore, it raises concern regarding development of strategic relationship between these two. For this, two cases ? Catalonia (Spain and N Ireland (the UK, have been selected based on theoretical sampling. Key economic indicators have been identified and have been quantitatively analyzed. The evidence suggests that strong NSI has positive influence on RSI. In addition to that, the concentration of knowledge and promotion of institutions may be strategically established and then needed resources may be injected to produce high quality human resources. There is, however, need for more comprehensive studies to be conducted in order to validate the results of this research

Targeting Werner syndrome protein sensitizes U-2 OS osteosarcoma cells to selenium-induced DNA damage response and necrotic death

DEFF Research Database (Denmark)

Cheng, Wen-Hsing; Wu, Ryan T Y; Wu, Min

2012-01-01

to MSeA-induced necrotic death. Co-treatment with the ataxia-telangiectasia mutated (ATM) kinase inhibitor KU55933 desensitized the control shRNA cells, but not WRN shRNA cells, to MSeA treatment. WRN did not affect MSeA-induced ATM phosphorylation on Ser-1981 or H2A.X phosphorylation on Ser-139...

Stronger back muscles reduce the incidence of vertebral fractures: a prospective 10 year follow-up of postmenopausal women.

Science.gov (United States)

Sinaki, M; Itoi, E; Wahner, H W; Wollan, P; Gelzcer, R; Mullan, B P; Collins, D A; Hodgson, S F

2002-06-01

The long-term protective effect of stronger back muscles on the spine was determined in 50 healthy white postmenopausal women, aged 58-75 years, 8 years after they had completed a 2 year randomized, controlled trial. Twenty-seven subjects had performed progressive, resistive back-strengthening exercises for 2 years and 23 had served as controls. Bone mineral density, spine radiographs, back extensor strength, biochemical marker values, and level of physical activity were obtained for all subjects at baseline, 2 years, and 10 years. Mean back extensor strength (BES) in the back-exercise (BE) group was 39.4 kg at baseline, 66.8 kg at 2 years (after 2 years of prescribed exercises), and 32.9 kg at 10 years (8 years after cessation of the prescribed exercises). Mean BES in the control (C) group was 36.9 kg at baseline, 49.0 kg at 2 years, and 26.9 kg at 10 years. The difference between the two groups was still statistically significant at 10 year follow-up (p = 0.001). The difference in bone mineral density, which was not significant between the two groups at baseline and 2 year follow-up, was significant at 10 year follow-up (p = 0.0004). The incidence of vertebral compression fracture was 14 fractures in 322 vertebral bodies examined (4.3%) in the C group and 6 fractures in 378 vertebral bodies examined (1.6%) in the BE group (chi-square test, p = 0.0290). The relative risk for compression fracture was 2.7 times greater in the C group than in the BE group. To our knowledge, this is the first study reported in the literature demonstrating the long-term effect of strong back muscles on the reduction of vertebral fractures in estrogen-deficient women.

On two alternative mechanisms of ethane activation over ZSM-5 zeolite modified by Zn2+ and Ga1+ cations

NARCIS (Netherlands)

Kazansky, V.B.; Subbotina, I.R.; Rane, N.J.; Santen, van R.A.; Hensen, E.J.M.

2005-01-01

The activation of ethane over zinc- and gallium-modified HZSM-5 dehydrogenation catalysts was studied by diffuse reflectance infrared spectroscopy. Hydrocarbon activation on HZSM-5 modified by bivalent Zn and univalent Ga cations proceeds via two distinctly different mechanisms. The stronger

Mental health benefits of neighbourhood green space are stronger among physically active adults in middle-to-older age: evidence from 260,061 Australians.

Science.gov (United States)

Astell-Burt, Thomas; Feng, Xiaoqi; Kolt, Gregory S

2013-11-01

While many studies report that green spaces promote mental health, some suggest the psychological benefits of physical activity are amplified if participation occurs within greener environs. We investigated whether this relationship could be observed among adults in middle-to-older age. Multilevel logit regression was used to investigate association between green space and psychological distress (Kessler scores of 22+) among 260,061 Australians over 45 years old living in New South Wales (2006-2009). Physical activity was measured using the Active Australia survey. Percentage green space was estimated within a 1-kilometre of residence. In comparison to residents of the least green areas, those in the greenest neighbourhoods were at a lower risk of psychological distress (Odds Ratio 0.83, 95% CI: 0.76, 0.92) and were less sedentary (0.81: 0.77, 0.87). An interaction was observed between physical activity and green space (p=0.0028). More green space did not appear to benefit mental health among the least active (0.99: 0.85, 1.15), but there was a protective association for the more physically active (0.82: 0.67, 0.99). For adults in middle-to-older age, green spaces are not only important for promoting physical activity, but the mental health benefits of greener environs appear contingent upon those active lifestyles. © 2013.

Multifunctional PLGA Nanobubbles as Theranostic Agents: Combining Doxorubicin and P-gp siRNA Co-Delivery Into Human Breast Cancer Cells and Ultrasound Cellular Imaging.

Science.gov (United States)

Yang, Hong; Deng, Liwei; Li, Tingting; Shen, Xue; Yan, Jie; Zuo, Liangming; Wu, Chunhui; Liu, Yiyao

2015-12-01

Multidrug resistance (MDR) is a major impediment to the success of cancer chemotherapy. One of the effective approaches to overcome MDR is to use nanoparticle-mediated the gene silence of chemotherapeutic export proteins by RNA interference to increase drug accumulation in drug resistant cancer cells. In this work, a new co-delivery system, DOX-PLGA/PEI/P-gp shRNA nanobubbles (NBs) around 327 nm, to overcome doxorubicin (DOX) resistance in MCF-7 human breast cancer was designed and developed. Positively charged polyethylenimine (PEI) were modified onto the surface of DOX-PLGA NBs through DCC/NHS crosslinking, and could efficiently condense P-gp shRNA into DOX-PLGA/PEI NBs at vector/shRNA weight ratios of 70:1 and above. An in vitro release profile demonstrated an efficient DOX release (more than 80%) from DOX-PLGA/PEI NBs at pH 4.4, suggesting a pH-responsive drug release for the multifunctionalized NBs. Cellular experimental results further showed that DOX-PLGA/PEI/P-gp shRNA NBs could facilitate cellular uptake of DOX into cells and increase the cell proliferation suppression effect of DOX against MCF-7/ADR cells (a DOX-resistant and P-glycoprotein (P-gp) over-expression cancer cell line). The IC50 of DOX-PLGA NBs against MCF-7/ADR cells was 2-fold lower than that of free DOX. The increased cellular uptake and nuclear accumulation of DOX delivered by DOX-PLGA/PEI/P-gp shRNA NBs in MCF-7/ADR cells was confirmed by fluorescence microscopy and fluorescence spectrophotometry, and might be owning to the down-regulation of P-gp and reduced the efflux of DOX. The cellular uptake mechanism of DOX-PLGA/PEI/P-gp shRNA NBs indicated that the macropinocytosis was one of the pathways for the uptake of NBs by MCF-7/ADR cells, which was also an energy-dependent process. Furthermore, the in vitro cellular ultrasound imaging suggested that the employment of the DOX-PLGA/PEI/P-gp shRNA NBs could efficiently enhance ultrasound imaging of cancer cells. These results demonstrated

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

Young Children's Screen Activities, Sweet Drink Consumption and Anthropometry

DEFF Research Database (Denmark)

Olafsdottir, Steingerdur; Ahrens, Wolfgang; Siani, Alfonso

2014-01-01

Background/Objectives: This longitudinal study describes the relationship between young children’s screen time, dietary habits and anthropometric measures. The hypothesis was that television viewing and other screen activities at baseline result in increased consumption of sugar-sweetened beverages...... children, both on their consumption of sugary drinks and on an increase in BMI and central obesity. Our findings suggest that television viewing seems to have a stronger effect on food habits and anthropometry than other screen activities in this age group....

Distortion of maximal elevator activity by unilateral premature tooth contact

DEFF Research Database (Denmark)

Bakke, Merete; Møller, Eigild

1980-01-01

In four subjects the electrical activity in the anterior and posterior temporal and masseter muscles during maximal bite was recorded bilaterally with and without premature unilateral contact. Muscle activity was measured as the average level and the peak of the mean voltage with layers of strips...... of 0.05, 0.10, 0.15 and 2.0 mm, placed between first molars either on the left or the right side, and compared with the level of activity with undistrubed occlusion. Unilateral premature contact caused a significant asymmetry of action in all muscles under study with stronger activity ipsilaterally...

[Effect of DOT1L gene silence on proliferation of acute monocytic leukemia cell line THP-1].

Science.gov (United States)

Zhang, Yu-Juan; Li, Hua-Wen; Chang, Guo-Qiang; Zhang, Hong-Ju; Wang, Jian; Lin, Ya-Ni; Zhou, Jia-Xi; Li, Qing-Hua; Pang, Tian-Xiang

2013-08-01

This study was aimed to investigate the influence of short hairpin RNA (shRNA) on proliferation of human leukemia cell line THP-1. The shRNA targeting the site 732-752 of DOT1L mRNA was designed and chemically synthesized, then a single-vector lentiviral, tet-inducible shRNA-DOT1L system (Plko-Tet-On) was generated. Thereafter, the THP-1 cells with lentivirus were infected to create stable cell line with regulatable shRNA expression. The expression of DOT1L in the THP-1 cell line was assayed by RT-PCR. Effect of shRNA-DOT1L on the proliferation of THP-1 cells was detected with MTT method,and the change of colony forming potential of THP-1 cells was analyzed by colony forming unit test. Cell cycle distribution was tested by flow cytometry. The results indicated that the expression of DOT1L was statistically lower than that in the control groups. The proliferation and colony forming capacity of THP-1 cells were significantly inhibited. The percentage of cells at G0/G1 phase increased in THP-1/shRNA cells treated with Dox while the percentage of cells at S phase significantly decreased as compared with that in the control group. It is concluded that the shRNA targeting DOT1L can effectively inhibit the proliferation of acute monocytic leukemia cell line THP-1.

Openness as a predictor of political orientation and conventional and unconventional political activism in Western and Eastern Europe.

Science.gov (United States)

Roets, Arne; Cornelis, Ilse; Van Hiel, Alain

2014-01-01

This study provides a comprehensive investigation of the relationship between Openness and political orientation and activism in Europe. Analyses were conducted on the 4 waves of the European Social Survey, including large representative samples in up to 26 European countries (total N > 175,000). In line with previous studies, a robust, positive relationship between Openness and left-wing political orientation was obtained in Western Europe. However, in Eastern Europe, the relationship between Openness and political orientation was weaker, and reversed in 3 out of 4 waves. Moreover, Openness yielded significant positive relationships with unconventional activism and to a lesser degree with conventional activism. The magnitude of the relationship between Openness and activism was dependent on political orientation and region. Stronger associations between Openness and activism were found for those having a left-wing orientation in Western Europe, whereas in Eastern Europe, Openness was somewhat stronger related to activism for those having a right-wing orientation. In the discussion we elaborate on the role of the geopolitical context in the relationship between Openness and political variables.

Effects of a sour bolus on the intramuscular electromyographic (EMG) activity of muscles in the submental region.

Science.gov (United States)

Palmer, Phyllis M; McCulloch, Timothy M; Jaffe, Debra; Neel, Amy T

2005-01-01

A sour bolus has been used as a modality in the treatment of oropharyngeal dysphagia based on the hypothesis that this stimulus provides an effective preswallow sensory input that lowers the threshold required to trigger a pharyngeal swallow. The result is a more immediate swallow onset time. Additionally, the sour bolus may invigorate the oral muscles resulting in stronger contractions during the swallow. The purpose of this investigation was to compare the intramuscular electromyographic activity of the mylohyoid, geniohyoid, and anterior belly of the digastric muscles during sour and water boluses with regard to duration, strength, and timing of muscle activation. Muscle duration, swallow onset time, and pattern of muscle activation did not differ for the two bolus types. Muscle activation time was more tightly approximated across the onsets of the three muscles when a sour bolus was used. A sour bolus also resulted in a stronger muscle contraction as evidenced by greater electromyographic activity. These data support the use of a sour bolus as part of a treatment paradigm.

Age-specific activation of cerebral areas in motor imagery - a fMRI study

Energy Technology Data Exchange (ETDEWEB)

Wang, Li [Chongqing University, Key Laboratory of Biorheological Science and Technology of Ministry of Education, Bioengineering College, Chongqing (China); Third Military Medical University, Department of Medical Image, College of Biomedical Engineering, Chongqing (China); Qiu, Mingguo; Zhang, Jingna; Zhang, Ye; Sang, Linqiong [Third Military Medical University, Department of Medical Image, College of Biomedical Engineering, Chongqing (China); Liu, Chen; Yang, Jun [Third Military Medical University, Department of Radiology, Southwest Hospital, Chongqing (China); Yan, Rubing [Third Military Medical University, Department of Rehabilitation, Southwest Hospital, Chongqing (China); Zheng, Xiaolin [Chongqing University, Key Laboratory of Biorheological Science and Technology of Ministry of Education, Bioengineering College, Chongqing (China)

2014-04-15

The objectives of this study were to study the age-specific activation patterns of cerebral areas during motor execution (ME) and motor imaging (MI) of the upper extremities and to discuss the age-related neural mechanisms associated with ME or MI. The functional magnetic resonance imaging technique was used to monitor the pattern and intensity of brain activation during the ME and MI of the upper extremities in 20 elderly (>50 years) and 19 young healthy subjects (<25 years). No major differences were identified regarding the activated brain areas during ME or MI between the two groups; however, a minor difference was noted. The intensity of the activated brain area during ME was stronger in the older group than in the younger group, while the results with MI were the opposite. The posterior central gyrus and supplementary motor area during MI were more active in the younger group than in the older group. The putamen, lingual, and so on demonstrated stronger activation during dominant hand MI in the older group. The results of this study revealed that the brain structure was altered and that neuronal activity was attenuated with age, and the cerebral cortex and subcortical tissues were found to be over-activated to achieve the same level of ME and MI, indicating that the activating effects of the left hemisphere enhanced with age, whereas the inhibitory effects declined during ME, and activation of the right hemisphere became more difficult during MI. (orig.)

Age-specific activation of cerebral areas in motor imagery - a fMRI study

International Nuclear Information System (INIS)

Wang, Li; Qiu, Mingguo; Zhang, Jingna; Zhang, Ye; Sang, Linqiong; Liu, Chen; Yang, Jun; Yan, Rubing; Zheng, Xiaolin

2014-01-01

The objectives of this study were to study the age-specific activation patterns of cerebral areas during motor execution (ME) and motor imaging (MI) of the upper extremities and to discuss the age-related neural mechanisms associated with ME or MI. The functional magnetic resonance imaging technique was used to monitor the pattern and intensity of brain activation during the ME and MI of the upper extremities in 20 elderly (>50 years) and 19 young healthy subjects (<25 years). No major differences were identified regarding the activated brain areas during ME or MI between the two groups; however, a minor difference was noted. The intensity of the activated brain area during ME was stronger in the older group than in the younger group, while the results with MI were the opposite. The posterior central gyrus and supplementary motor area during MI were more active in the younger group than in the older group. The putamen, lingual, and so on demonstrated stronger activation during dominant hand MI in the older group. The results of this study revealed that the brain structure was altered and that neuronal activity was attenuated with age, and the cerebral cortex and subcortical tissues were found to be over-activated to achieve the same level of ME and MI, indicating that the activating effects of the left hemisphere enhanced with age, whereas the inhibitory effects declined during ME, and activation of the right hemisphere became more difficult during MI. (orig.)

Hepatitis C virus core protein potentiates proangiogenic activity of hepatocellular carcinoma cells.

Science.gov (United States)

Shao, Yu-Yun; Hsieh, Min-Shu; Wang, Han-Yu; Li, Yong-Shi; Lin, Hang; Hsu, Hung-Wei; Huang, Chung-Yi; Hsu, Chih-Hung; Cheng, Ann-Lii

2017-10-17

Increased angiogenic activity has been demonstrated in hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC), but the mechanism was unclear. To study the role of HCV core protein, we used tube formation and Matrigel plug assays to assess the proangiogenic activity of an HCC cell line, HuH7, and 2 of its stable clones-HuH7-core-high and HuH7-core-low, with high and low HCV core protein expression, respectively. In both assays, HuH7-core-high and HuH7-core-low cells dose-dependently induced stronger angiogenesis than control cells. HuH7 cells with HCV core protein expression showed increased mRNA and protein expression of vascular endothelial growth factor (VEGF). VEGF inhibition by bevacizumab reduced the proangiogenic activity of HuH7-core-high cells. The promotor region of VEGF contains the binding site of activator protein-1 (AP-1). Compared with controls, HuH7-core-high cells had an increased AP-1 activity and nuclear localization of phospho-c-jun. AP-1 inhibition using either RNA knockdown or AP-1 inhibitors reduced the VEGF mRNA expression and the proangiogenic activity of HuH7-core-high cells. Among 131 tissue samples from HCC patients, HCV-related HCC revealed stronger VEGF expression than did hepatitis B virus-related HCC. In conclusion, increased VEGF expression through AP-1 activation is a crucial mechanism underlying the proangiogenic activity of the HCV core protein in HCC cells.

Effects of nitrogen enrichment on phosphatase activity and nitrogen : phosphorus relationships in Cladonia portentosa.

Science.gov (United States)

Hogan, E J; Minnullina, G; Smith, R I; Crittenden, P D

2010-06-01

*Relationships between nitrogen deposition in the UK and phosphomonoesterase (PME) activity and nitrogen (N) and phosphorus (P) concentrations in Cladonia portentosa were quantified to understand factors limiting lichen growth and to further develop biomarkers for N pollution. *Lichen was collected from sites differing either in rates of wet N (NH(4)(+) + NO(3)(-)) deposition or in annual mean N concentration in rainfall based on both measured and modelled data sets. The PME activity, and total N and P concentrations were measured in specific horizontal strata in lichen mats and PME activity in the thallus was located using an enzyme-labelled fluorescent phosphatase substrate. *With an increase in modelled N deposition from 4.1 to 32.8 kg N ha(-1) yr(-1), PME activity, thallus N and N : P ratio increased by factors of 2.3, 1.4 and 1.8, respectively. Correlations with modelled data were generally stronger than with measured data and those with N deposition were stronger than those with N concentration in rainfall. The PME activity was located solely in the lichen fungus in outer regions of the thallus. *Nitrogen enrichment changes lichen N : P ratios from values typical of N limitation (for example, 10) to those indicative of P limitation (for example, 26) driving upregulation of PME activity.

Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

Directory of Open Access Journals (Sweden)

Jong-nam Oh

2018-04-01

Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

Safety activities in small businesses

Science.gov (United States)

Sinclair, Raymond C.; Cunningham, Thomas R.

2015-01-01

Background Workplace injuries occur at higher rates in smaller firms than in larger firms, and the number of workplace safety activities appear to be inversely associated with those rates. Predictors of safety activities are rarely studied. Methods This study uses data from a national random survey of firms (n = 722) with less than 250 employees conducted in 2002. Results We found that, regardless of firm size or industry, safety activities were more common in 2002 than they were in a similar 1983 study. Having had an OSHA inspection in the last five years and firm size were stronger predictors of safety activities than industry hazardousness and manager’s perceptions of hazardousness. All four variables were significant predictors (β range .19 to .28; R2 = .27). Conclusions Further progress in the prevention of injuries in small firms will require attention to factors likely subsumed within the firm size variable, especially the relative lack of slack resources that might be devoted to safety activities. PMID:26339124

Earlier adolescent substance use onset predicts stronger connectivity between reward and cognitive control brain networks.

Science.gov (United States)

Weissman, David G; Schriber, Roberta A; Fassbender, Catherine; Atherton, Olivia; Krafft, Cynthia; Robins, Richard W; Hastings, Paul D; Guyer, Amanda E

2015-12-01

Early adolescent onset of substance use is a robust predictor of future substance use disorders. We examined the relation between age of substance use initiation and resting state functional connectivity (RSFC) of the core reward processing (nucleus accumbens; NAcc) to cognitive control (prefrontal cortex; PFC) brain networks. Adolescents in a longitudinal study of Mexican-origin youth reported their substance use annually from ages 10 to 16 years. At age 16, 69 adolescents participated in a resting state functional magnetic resonance imaging scan. Seed-based correlational analyses were conducted using regions of interest in bilateral NAcc. The earlier that adolescents initiated substance use, the stronger the connectivity between bilateral NAcc and right dorsolateral PFC, right dorsomedial PFC, right pre-supplementary motor area, right inferior parietal lobule, and left medial temporal gyrus. The regions that demonstrated significant positive linear relationships between the number of adolescent years using substances and connectivity with NAcc are nodes in the right frontoparietal network, which is central to cognitive control. The coupling of reward and cognitive control networks may be a mechanism through which earlier onset of substance use is related to brain function over time, a trajectory that may be implicated in subsequent substance use disorders. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

"The Heart That Trusts Another Is Stronger than Anything."

Science.gov (United States)

Witkin, Mitzi

1992-01-01

Describes how an English teacher incorporates the native languages of her internationally born students into her English lessons. Relates how these activities helped foreign students feel accepted into the class and their new environment. (PRA)

Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

Directory of Open Access Journals (Sweden)

Klingelhoeffer Christoph

2012-05-01

Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

One Year After Fukushima, Nuclear Safety Is Stronger

International Nuclear Information System (INIS)

2012-01-01

Full text: Nuclear power is safer than it was a year ago as the nuclear industry, regulators and governments act on the lessons of Fukushima, but that safety must never be taken for granted, said Yukiya Amano, Director General of the International Atomic Energy Agency (IAEA). Speaking ahead of the first anniversary of the Fukushima Daiichi nuclear accident on 11 March, Amano said a culture of constant vigilance and improvement was vital to ensure that the benefits of nuclear power could be harnessed as safely as humanly possible. 'Nuclear safety is stronger than it was a year ago', he said. 'Fukushima Daiichi was a very serious accident, but we know what went wrong and we have a clear course of action to tackle those causes - not only in Japan, but anywhere in the world. 'Now we have to keep up the momentum. Complacency can kill'. On 11 March 2011 a huge earthquake and tsunami left more than 20 000 people dead or missing in eastern Japan. Amidst widespread destruction, the tsunami slammed into the Fukushima Daiichi Nuclear Power Station, disabling cooling systems and leading to fuel meltdowns in three of the six Units. The accident was a jolt to the nuclear industry, regulators and governments. It was triggered by a massive force of nature, but it was existing weaknesses of design regarding defence against natural hazards, regulatory oversight, accident management and emergency response that allowed it to unfold as it did. For example: The nuclear regulator was not sufficiently independent, allowing weak oversight of the operator, TEPCO, and regulatory requirements fell short of international best practice; Not enough attention was paid to guarding against possible extreme events at the Fukushima Daiichi site, leaving critical safety functions such as cooling systems vulnerable to the tsunami; Training to respond to serious accidents was inadequate, as were mitigation measures to prevent hydrogen explosions and protect the venting system; and Accident command lines

Epigenetic mediated transcriptional activation of WNT5A participates in arsenical-associated malignant transformation

International Nuclear Information System (INIS)

Jensen, Taylor J.; Wozniak, Ryan J.; Eblin, Kylee E.; Wnek, Sean M.; Gandolfi, A. Jay; Futscher, Bernard W.

2009-01-01

Arsenic is a human carcinogen with exposure associated with cancer of the lung, skin, and bladder. Many potential mechanisms have been implicated as playing a role in the process of arsenical-induced malignancy including the perturbation of signaling pathways and aberrant epigenetic regulation. We initiated studies to examine the role of a member of the non-canonical WNT signaling pathway, WNT5A, in UROtsa cells and arsenite [URO-ASSC] and monomethylarsonous acid [URO-MSC] malignantly transformed variants. We present data herein that suggest that WNT5A is transcriptionally activated during arsenical-induced malignant transformation. This WNT5A transcriptional activation is correlated with the enrichment of permissive histone modifications and the reduction of repressive modifications in the WNT5A promoter region. The epigenetic activation of WNT5A expression and acetylation of its promoter remain after the removal of the arsenical, consistent with the maintenance of an anchorage independent growth phenotype in these cells. Additionally, treatment with epigenetic modifying drugs supports a functional role for these epigenetic marks in controlling gene expression. Reduction of WNT5A using lentiviral shRNA greatly attenuated the ability of these cells to grow in an anchorage independent fashion. Extension of our model into human bladder cancer cell lines indicates that each of the cell lines examined also express WNT5A. Taken together, these data suggest that the epigenetic remodeling of the WNT5A promoter is correlated with its transcriptional activation and this upregulation likely participates in arsenical-induced malignant transformation

The sigh of the oppressed: The palliative effects of ideology are stronger for people living in highly unequal neighbourhoods.

Science.gov (United States)

Sengupta, Nikhil K; Greaves, Lara M; Osborne, Danny; Sibley, Chris G

2017-09-01

Ideologies that legitimize status hierarchies are associated with increased well-being. However, which ideologies have 'palliative effects', why they have these effects, and whether these effects extend to low-status groups remain unresolved issues. This study aimed to address these issues by testing the effects of the ideology of Symbolic Prejudice on well-being among low- and high-status ethnic groups (4,519 Europeans and 1,091 Māori) nested within 1,437 regions in New Zealand. Results showed that Symbolic Prejudice predicted increased well-being for both groups, but that this relationship was stronger for those living in highly unequal neighbourhoods. This suggests that it is precisely those who have the strongest need to justify inequality that accrue the most psychological benefit from subscribing to legitimizing ideologies. © 2017 The British Psychological Society.

Examining the relationship between psychosocial working conditions, physical work demands, and leisure time physical activity in Canada.

Science.gov (United States)

Morassaei, Sara; Smith, Peter M

2011-10-01

To examine the effects of psychosocial working conditions and physical work demands on leisure time physical activity (LTPA). Using path analysis, direct and indirect effects of self-reported working conditions on LTPA levels were assessed in a representative sample of 4167 workers from the 2000 to 2001 Canadian National Population Health Survey. Higher levels of skill discretion and decision latitude were associated with higher LTPA. Physical work demands had opposite effects among men versus women, and skill discretion had a stronger effect among women than among men. Job security had a stronger effect on older workers and those without children younger than 13 years. The results support the influence of the work environment on LTPA and suggest that certain work conditions should be targeted in future interventions seeking to impact participation in physical activity.

Stable suppression of myostatin gene expression in goat fetal fibroblast cells by lentiviral vector-mediated RNAi.

Science.gov (United States)

Patel, Utsav A; Patel, Amrutlal K; Joshi, Chaitanya G

2015-01-01

Myostatin (MSTN) is a secreted growth factor that negatively regulates skeletal muscle mass, and therefore, strategies to block myostatin-signaling pathway have been extensively pursued to increase the muscle mass in livestock. Here, we report a lentiviral vector-based delivery of shRNA to disrupt myostatin expression into goat fetal fibroblasts (GFFs) that were commonly used as karyoplast donors in somatic-cell nuclear transfer (SCNT) studies. Sh-RNA positive cells were screened by puromycin selection. Using real-time polymerase chain reaction (PCR), we demonstrated efficient knockdown of endogenous myostatin mRNA with 64% down-regulation in sh2 shRNA-treated GFF cells compared to GFF cells treated by control lentivirus without shRNA. Moreover, we have also demonstrated both the induction of interferon response and the expression of genes regulating myogenesis in GFF cells. The results indicate that myostatin-targeting siRNA produced endogenously could efficiently down-regulate myostatin expression. Therefore, targeted knockdown of the MSTN gene using lentivirus-mediated shRNA transgenics would facilitate customized cell engineering, allowing potential use in the establishment of stable cell lines to produce genetically engineered animals. © 2014 American Institute of Chemical Engineers.

Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

International Nuclear Information System (INIS)

Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

2006-01-01

Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

Serum albumin coating of demineralized bone matrix results in stronger new bone formation.

Science.gov (United States)

Horváthy, Dénes B; Vácz, Gabriella; Szabó, Tamás; Szigyártó, Imola C; Toró, Ildikó; Vámos, Boglárka; Hornyák, István; Renner, Károly; Klára, Tamás; Szabó, Bence T; Dobó-Nagy, Csaba; Doros, Attila; Lacza, Zsombor

2016-01-01

Blood serum fractions are hotly debated adjuvants in bone replacement therapies. In the present experiment, we coated demineralized bone matrices (DBM) with serum albumin and investigated stem cell attachment in vitro and bone formation in a rat calvaria defect model. In the in vitro experiments, we observed that significantly more cells adhere to the serum albumin coated DBMs at every time point. In vivo bone formation with albumin coated and uncoated DBM was monitored biweekly by computed tomography until 11 weeks postoperatively while empty defects served as controls. By the seventh week, the bone defect in the albumin group was almost completely closed (remaining defect 3.0 ± 2.3%), while uncoated DBM and unfilled control groups still had significant defects (uncoated: 40.2 ± 9.1%, control: 52.4 ± 8.9%). Higher density values were also observed in the albumin coated DBM group. In addition, the serum albumin enhanced group showed significantly higher volume of newly formed bone in the microCT analysis and produced significantly higher breaking force and stiffness compared to the uncoated grafts (peak breaking force: uncoated: 15.7 ± 4 N, albumin 46.1 ± 11 N). In conclusion, this investigation shows that implanting serum albumin coated DBM significantly reduces healing period in nonhealing defects and results in mechanically stronger bone. These results also support the idea that serum albumin coating provides a convenient milieu for stem cell function, and a much improved bone grafting success can be achieved without the use of exogenous stem cells. © 2015 Wiley Periodicals, Inc.

Inhibitory effect of burdock leaves on elastase and tyrosinase activity

Science.gov (United States)

Horng, Chi-Ting; Wu, Hsing-Chen; Chiang, Ni-Na; Lee, Chiu-Fang; Huang, Yu-Syuan; Wang, Hui-Yun; Yang, Jai-Sing; Chen, Fu-An

2017-01-01

Burdock (Arctium lappa L.) leaves generate a considerable amount of waste following burdock root harvest in Taiwan. To increase the use of burdock leaves, the present study investigated the optimal methods for producing burdock leaf extract (BLE) with high antioxidant polyphenolic content, including drying methods and solvent extraction concentration. In addition, the elastase and tyrosinase inhibitory activity of BLE was examined. Burdock leaves were dried by four methods: Shadow drying, oven drying, sun drying and freeze-drying. The extract solution was then subjected to total polyphenol content analysis and the method that produced BLE with the highest amount of total antioxidant components was taken forward for further analysis. The 1,1-diphenyl-2-pycrylhydrazyl scavenging, antielastase and antityrosinase activity of the BLE were measured to enable the evaluation of the antioxidant and skin aging-associated enzyme inhibitory activities of BLE. The results indicated that the total polyphenolic content following extraction with ethanol (EtOH) was highest using the freeze-drying method, followed by the oven drying, shadow drying and sun drying methods. BLE yielded a higher polyphenol content and stronger antioxidant activity as the ratio of the aqueous content of the extraction solvent used increased. BLE possesses marked tyrosinase and elastase inhibitory activities, with its antielastase activity notably stronger compared with its antityrosinase activity. These results indicate that the concentration of the extraction solvent was associated with the antioxidant and skin aging-associated enzyme inhibitory activity of BLE. The reactive oxygen species scavenging theory of skin aging may explain the tyrosinase and elastase inhibitory activity of BLE. In conclusion, the optimal method for obtaining BLE with a high antioxidant polyphenolic content was freeze-drying followed by 30–50% EtOH extraction. In addition, the antielastase and antityrosinase activities of the

Alcoholism and dampened temporal limbic activation to emotional faces.

Science.gov (United States)

Marinkovic, Ksenija; Oscar-Berman, Marlene; Urban, Trinity; O'Reilly, Cara E; Howard, Julie A; Sawyer, Kayle; Harris, Gordon J

2009-11-01

Excessive chronic drinking is accompanied by a broad spectrum of emotional changes ranging from apathy and emotional flatness to deficits in comprehending emotional information, but their neural bases are poorly understood. Emotional abnormalities associated with alcoholism were examined with functional magnetic resonance imaging in abstinent long-term alcoholic men in comparison to healthy demographically matched controls. Participants were presented with emotionally valenced words and photographs of faces during deep (semantic) and shallow (perceptual) encoding tasks followed by recognition. Overall, faces evoked stronger activation than words, with the expected material-specific laterality (left hemisphere for words, and right for faces) and depth of processing effects. However, whereas control participants showed stronger activation in the amygdala and hippocampus when viewing faces with emotional (relative to neutral) expressions, the alcoholics responded in an undifferentiated manner to all facial expressions. In the alcoholic participants, amygdala activity was inversely correlated with an increase in lateral prefrontal activity as a function of their behavioral deficits. Prefrontal modulation of emotional function as a compensation for the blunted amygdala activity during a socially relevant face appraisal task is in agreement with a distributed network engagement during emotional face processing. Deficient activation of amygdala and hippocampus may underlie impaired processing of emotional faces associated with long-term alcoholism and may be a part of the wide array of behavioral problems including disinhibition, concurring with previously documented interpersonal difficulties in this population. Furthermore, the results suggest that alcoholics may rely on prefrontal rather than temporal limbic areas in order to compensate for reduced limbic responsivity and to maintain behavioral adequacy when faced with emotionally or socially challenging situations.

Structural studies of some activated carbons with different radon adsorption ability by X-ray diffraction techniques

International Nuclear Information System (INIS)

Wang Qingbo; Qu Jingyuan; Zhu Wenkai; Cheng Jinxing; Zhou Baichang

2010-01-01

Four different activated carbons with different radon adsorption ability were analyzed by X-ray diffraction techniques. Micro crystal parameters were calculated by Scherrer and Hirsch equations. The results show that the activated carbon with micro crystal parameters at =1.7 nm, =1.9 nm, average layers =4 has the stronger adsorption ability in the for carbon samples, which can be referred when developing activated carbons for radon adsorption. (authors)

STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis

Science.gov (United States)

Li, Ping; Harris, David; Liu, Zhiming; Rozovski, Uri; Ferrajoli, Alessandra; Wang, Yongtao; Bueso-Ramos, Carlos; Hazan-Halevy, Inbal; Grgurevic, Srdana; Wierda, William; Burger, Jan; O'Brien, Susan; Faderl, Stefan; Keating, Michael; Estrov, Zeev

2014-01-01

Here it was determined that Chronic Lymphocytic Leukemia (CLL) cells express the α-subunit but not the β-subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR/CSF3R). GM-CSFRα was detected on the surface, in the cytosol, and the nucleus of CLL cells via confocal microscopy, cell fractionation, and GM-CSFRα antibody epitope mapping. Because STAT3 is frequently activated in CLL and the GM-CSFRα promoter harbors putative STAT3 consensus binding sites, MM1 cells were transfected with truncated forms of the GM-CSFRα promoter, then stimulated with IL-6 to activate STAT3 to identify STAT3 binding sites. Chromatin immunoprecipitation (ChIP) and an electoromobility shift assay (EMSA) confirmed STAT3 occupancy to those promoter regions in both IL-6 stimulated MM1 and CLL cells. Transfection of MM1 cells with STAT3 siRNA or CLL cells with STAT3 shRNA significantly down-regulated GM-CSFRα mRNA and protein levels. RNA transcripts, involved in regulating cell-survival pathways, and the proteins KAP1 (TRIM28) and ISG15 co-immunoprecipitated with GM-CSFRα. GM-CSFRα-bound KAP1 enhanced the transcriptional activity of STAT3, whereas ISG15 inhibited the NF-κB pathway. Nevertheless, overexpression of GM-CSFRα protected MM1 cells from dexamethasone-induced apoptosis, and GM-CSFRα knockdown induced apoptosis in CLL cells, suggesting that GM-CSFRα provides a ligand-independent survival advantage. PMID:24836891

Types of Physical Activity

Science.gov (United States)

... do more work than usual, which makes them stronger. How do I do it? That depends on which muscles you want to work. Examples include doing push- ... do more work than usual, which makes them stronger. How do I do it? That depends on which muscles you want to work. Examples include doing push- ...

Comparative evaluation of the medicinal activities of methanolic extract of seeds, fruit pulps and fresh juice of Syzygium cumini in vitro

Directory of Open Access Journals (Sweden)

Repon Kumer Saha

2013-11-01

Full Text Available Objective: To establish the health benefits of Syzgium cumin to discover functional components present in the seeds, fruit pulps and fresh juice of this fruit grown in Bangladesh. Methods: Thin layer chromatography and ultra-violet spectroscopy were used to detect the presence of various types of compound in seeds and juice. Antioxidant effects were measured by DPPH scavenging assay and total reducing assay. Receptor binding activities was performed by hemagglutination inhibition assay. Anti-inflammatory assay and hydrogen peroxide induced hemolysis assay was also investigated. Disc diffusion assay was performed to show the antibacterial effect using Gram positive, Gram negative strains of bacteria and fungi. Results: Methanolic extract of the seeds showed stronger antioxidant, hydrogen peroxide induced hemolysis activities, hemagglutination inhibition activities and membrane stabilization activities than those of fresh juice. However, fresh juice showed stronger antibacterial and antifungal activities than those of methanolic seed extract. The seed contains higher amount of polyphenols and flavanoids than those of fruit juice. Conclusions: Therefore, fruit juice, fruit pulp and seed of Syzygium cumini contain medicinal active components in different ratios.

[Effects of transient receptor potential melastatin 8 cation channels on inflammatory reaction induced by cold temperatures in human airway epithelial cells].

Science.gov (United States)

Li, Min-chao; Perelman, Juliy M; Kolosov, Victor P; Zhou, Xiang-dong

2011-10-01

/L, (68 ± 11) ng/L] and cold stimulation + calphostin C group [0.40 ± 0.07, 0.44 ± 0.09, 0.47 ± 0.08 and (69 ± 9) ng/L, (86 ± 15) ng/L, (61 ± 10) ng/L] were significantly lower than those in cold stimulation group (t = 2.47 - 4.21, all P cold stimulation + control shRNA group [0.61 ± 0.10, 0.69 ± 0.11, 0.64 ± 0.13 and (89 ± 13) ng/L, (118 ± 20) ng/L, (79 ± 13) ng/L] showed no significant change, compared with cold stimulation group (t = 0.35 - 1.12, all P > 0.05). Cold temperature may induce Ca(2+) influx and up-regulate IL-6, IL-8, and TNF-α expression in 16HBE cells by activating the TRPM8 ion channels, and this is via a signaling pathway involving PKC.

Social reward improves the voluntary control over localized brain activity in fMRI-based neurofeedback training

Directory of Open Access Journals (Sweden)

Krystyna Anna Mathiak

2015-06-01

Full Text Available Neurofeedback (NF based on real-time functional magnetic resonance imaging (rt-fMRI allows voluntary regulation of the activity in a selected brain region. For the training of this regulation, a well-designed feedback system is required. Social reward may serve as an effective incentive in NF paradigms, but its efficiency has not yet been tested. Therefore, we developed a social reward NF paradigm and assessed it in comparison with a typical visual NF paradigm (moving bar.We trained 24 healthy participants, on three consecutive days, to control activation in dorsal anterior cingulate cortex (ACC with fMRI-based NF. In the social feedback group, an avatar gradually smiled when ACC activity increased, whereas in the standard feedback group, a moving bar indicated the activation level. To assess a transfer of the NF training both groups were asked to up-regulate their brain activity without receiving feedback immediately before and after the NF training (pre- and post-test. Finally, the effect of the acquired NF training on ACC function was evaluated in a cognitive interference task (Simon task during the pre- and post-test.Social reward led to stronger activity in the ACC and reward-related areas during the NF training when compared to standard feedback. After the training, both groups were able to regulate ACC without receiving feedback, with a trend for stronger responses in the social feedback group. Moreover, despite a lack of behavioral differences, significant higher ACC activations emerged in the cognitive interference task, reflecting a stronger generalization of the NF training on cognitive interference processing after social feedback.Social reward can increase self-regulation in fMRI-based NF and strengthen its effects on neural processing in related tasks, such as cognitive interference. An advantage of social feedback is that a direct external reward is provided as in natural social interactions, opening perspectives for implicit

Determinants of sexual activity in four birth cohorts of Swedish 70-year-olds examined 1971-2001.

Science.gov (United States)

Beckman, Nils; Waern, Margda; Östling, Svante; Sundh, Valter; Skoog, Ingmar

2014-02-01

Knowledge about determinants of sexual activity in older adults in the general population is limited. Human senescence has been delayed by a decade, and people are reaching old age in better health. The aim of this study was to investigate determinants of sexual activity in four birth cohorts of non-demented 70-year-olds examined in 1971-1977 and 1992-2001. The main outcome measure was sexual activity (defined as intercourse) during the past year. The study is based on cross-sectional data from four population samples of 70-year-olds from Gothenburg, Sweden (N = 1,407) systematically sampled from the Swedish population register. In the time periods 1971-1972 and 2000-2001, sexual activity among men increased from 47% to 66%, and in women from 12% to 34%. Sexual activity was related to positive attitude toward sexuality, sexual debut before age 20, having a very happy relationship, having a physically and mentally healthy partner, self-reported good global health, interviewer-rated good mental health, being married/cohabiting, satisfaction with sleep, and drinking alcohol more than three times a week. Having an older partner, diabetes mellitus, coronary heart disease, higher physical health-sum score, and depression were related to less sexual activity. Interaction effects for birth cohort, with stronger positive associations in 1971-1972, were found for positive attitude toward sexuality, strong desire at age 20-30, premarital sexuality, having a younger partner, self-reported good global health, interviewer-rated good global mental health, overweight, and satisfaction with sleep. Having an older partner and depression showed stronger negative associations in the 1970s. Physical health-sum score showed a stronger negative association in 1992-2001. We found that determinants of sexual activity in older people are numerous and varied, and change over time. It is thus important that health professionals and others take a holistic approach when dealing with sexual

Immunomodulating Activity of Aronia melanocarpa Polyphenols

Directory of Open Access Journals (Sweden)

Giang T. T. Ho

2014-06-01

Full Text Available The immunomodulating effects of isolated proanthocyanidin-rich fractions, procyanidins C1, B5 and B2 and anthocyanins of Aronia melanocarpa were investigated. In this work, the complement-modulating activities, the inhibitory activities on nitric oxide (NO production in LPS-induced RAW 264.7 macrophages and effects on cell viability of these polyphenols were studied. Several of the proanthocyanidin-rich fractions, the procyanidins C1, B5 and B2 and the cyanidin aglycone possessed strong complement-fixing activities. Cyanidin 3-glucoside possessed stronger activity than the other anthocyanins. Procyanidins C1, B5 and B2 and proanthocyanidin-rich fractions having an average degree of polymerization (PD of 7 and 34 showed inhibitory activities on NO production in LPS-stimulated RAW 264.7 mouse macrophages. All, except for the fraction containing proanthocyanidins with PD 34, showed inhibitory effects without affecting cell viability. This study suggests that polyphenolic compounds of A. melanocarpa may have beneficial effects as immunomodulators and anti-inflammatory agents.

Different activation of opercular and posterior cingulate cortex (PCC) in patients with complex regional pain syndrome (CRPS I) compared with healthy controls during perception of electrically induced pain: a functional MRI study.

Science.gov (United States)

Freund, Wolfgang; Wunderlich, Arthur P; Stuber, Gregor; Mayer, Florian; Steffen, Peter; Mentzel, Martin; Weber, Frank; Schmitz, Bernd

2010-05-01

Although the etiology of complex regional pain syndrome type 1 (CRPS 1) is still debated, many arguments favor central maladaptive changes in pain processing as an important causative factor. To look for the suspected alterations, 10 patients with CRPS affecting the left hand were explored with functional magnetic resonance imaging during graded electrical painful stimulation of both hands subsequently and compared with healthy participants. Activation of the anterior insula, posterior cingulate cortex (PCC), and caudate nucleus was seen in patients during painful stimulation. Compared with controls, CRPS patients had stronger activation of the PCC during painful stimulation of the symptomatic hand. The comparison of insular/opercular activation between controls and patients with CRPS I during painful stimulation showed stronger (posterior) opercular activation in controls than in patients. Stronger PCC activation during painful stimulation may be interpreted as a correlate of motor inhibition during painful stimuli different from controls. Also, the decreased opercular activation in CRPS patients shows less sensory-discriminative processing of painful stimuli.These results show that changed cerebral pain processing in CRPS patients is less sensory-discriminative but more motor inhibition during painful stimuli. These changes are not limited to the diseased side but show generalized alterations of cerebral pain processing in chronic pain patients.

Induction of Non-Apoptotic Cell Death by Activated Ras Requires Inverse Regulation of Rac1 and Arf6

Science.gov (United States)

Bhanot, Haymanti; Young, Ashley M.; Overmeyer, Jean H.; Maltese, William A.

2010-01-01

Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Methuosis can be induced in glioblastoma cells by expression of constitutively active Ras. This study identifies the small GTPases, Rac1 and Arf6, and the Arf6 GTPase-activating-protein, GIT1, as key downstream components of the signaling pathway underlying Ras-induced methuosis. The extent to which graded expression of active H-Ras(G12V) triggers cytoplasmic vacuolization correlates with the amount of endogenous Rac1 in the active GTP state. Blocking Rac1 activation with the specific Rac inhibitor, EHT 1864, or co-expression of dominant-negative Rac1(T17N), prevents the accumulation of vacuoles induced by H-Ras(G12V). Coincident with Rac1 activation, H-Ras(G12V) causes a decrease in the amount of active Arf6, a GTPase that functions in recycling of clathrin-independent endosomes. The effect of H-Ras(G12V) on Arf6 is blocked by EHT 1864, indicating that the decrease in Arf6-GTP is directly linked to activation of Rac1. Constitutively active Rac1(G12V) interacts with GIT1 in immunoprecipitation assays. Ablation of GIT1 by shRNA prevents the decrease in active Arf6, inhibits vacuolization, and prevents loss of cell viability in cells expressing Rac1(G12V). Together the results suggest that perturbations of endosome morphology associated with Ras-induced methuosis are due to downstream activation of Rac1, combined with reciprocal inactivation of Arf6. The latter appears to be mediated through Rac1 stimulation of GIT1. Further insights into this pathway could suggest opportunities for induction of methuosis in cancers that are resistant to apoptotic cell death. PMID:20713492

Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

Science.gov (United States)

Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

2017-04-01

The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

Goal conflict and the moderating effects of intention stability in intention-behavior relations: physical activity among Hong Kong chinese.

Science.gov (United States)

Li, Kin-Kit; Chan, Darius K S

2008-02-01

This study examined how goal conflict influences the pattern of the moderating effects of intention stability on the intention-behavior relations in the context of physical activity participation. A longitudinal study of 136 young adult students with three waves of data collection (a 2-week interval between waves) was conducted. Results showed a significant three-way interaction among intention, goal conflict,& intention stability in explaining vigorous-intensity physical activity (Beta = -.25, p goal conflict was low, the intention-behavior relations were stronger with stable intentions and weaker with unstable intentions. However, when the level of goal conflict was high, the intention-behavior relations were weaker with stable intentions and stronger with unstable intentions. Possible underlying processes of goal conflict and intention stability on the intention-behavior relations are discussed.

The neural coding of expected and unexpected monetary performance outcomes: dissociations between active and observational learning.

Science.gov (United States)

Bellebaum, C; Jokisch, D; Gizewski, E R; Forsting, M; Daum, I

2012-02-01

Successful adaptation to the environment requires the learning of stimulus-response-outcome associations. Such associations can be learned actively by trial and error or by observing the behaviour and accompanying outcomes in other persons. The present study investigated similarities and differences in the neural mechanisms of active and observational learning from monetary feedback using functional magnetic resonance imaging. Two groups of 15 subjects each - active and observational learners - participated in the experiment. On every trial, active learners chose between two stimuli and received monetary feedback. Each observational learner observed the choices and outcomes of one active learner. Learning performance as assessed via active test trials without feedback was comparable between groups. Different activation patterns were observed for the processing of unexpected vs. expected monetary feedback in active and observational learners, particularly for positive outcomes. Activity for unexpected vs. expected reward was stronger in the right striatum in active learning, while activity in the hippocampus was bilaterally enhanced in observational and reduced in active learning. Modulation of activity by prediction error (PE) magnitude was observed in the right putamen in both types of learning, whereas PE related activations in the right anterior caudate nucleus and in the medial orbitofrontal cortex were stronger for active learning. The striatum and orbitofrontal cortex thus appear to link reward stimuli to own behavioural reactions and are less strongly involved when the behavioural outcome refers to another person's action. Alternative explanations such as differences in reward value between active and observational learning are also discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

Protein kinase C-delta inactivation inhibits the proliferation and survival of cancer stem cells in culture and in vivo

International Nuclear Information System (INIS)

Chen, Zhihong; Forman, Lora W; Williams, Robert M; Faller, Douglas V

2014-01-01

A subpopulation of tumor cells with distinct stem-like properties (cancer stem-like cells, CSCs) may be responsible for tumor initiation, invasive growth, and possibly dissemination to distant organ sites. CSCs exhibit a spectrum of biological, biochemical, and molecular features that are consistent with a stem-like phenotype, including growth as non-adherent spheres (clonogenic potential), ability to form a new tumor in xenograft assays, unlimited self-renewal, and the capacity for multipotency and lineage-specific differentiation. PKCδ is a novel class serine/threonine kinase of the PKC family, and functions in a number of cellular activities including cell proliferation, survival or apoptosis. PKCδ has previously been validated as a synthetic lethal target in cancer cells of multiple types with aberrant activation of Ras signaling, using both genetic (shRNA and dominant-negative PKCδ mutants) and small molecule inhibitors. In contrast, PKCδ is not required for the proliferation or survival of normal cells, suggesting the potential tumor-specificity of a PKCδ-targeted approach. shRNA knockdown was used validate PKCδ as a target in primary cancer stem cell lines and stem-like cells derived from human tumor cell lines, including breast, pancreatic, prostate and melanoma tumor cells. Novel and potent small molecule PKCδ inhibitors were employed in assays monitoring apoptosis, proliferation and clonogenic capacity of these cancer stem-like populations. Significant differences among data sets were determined using two-tailed Student’s t tests or ANOVA. We demonstrate that CSC-like populations derived from multiple types of human primary tumors, from human cancer cell lines, and from transformed human cells, require PKCδ activity and are susceptible to agents which deplete PKCδ protein or activity. Inhibition of PKCδ by specific genetic strategies (shRNA) or by novel small molecule inhibitors is growth inhibitory and cytotoxic to multiple types of human

ERK1/2 signalling pathway is involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion.

Science.gov (United States)

Chen, Liping; Pan, Yuqin; Gu, Ling; Nie, Zhenlin; He, Bangshun; Song, Guoqi; Li, Rui; Xu, Yeqiong; Gao, Tianyi; Wang, Shukui

2013-08-01

This study aimed to investigate the role of CD147 in the progression of gastric cancer and the signalling pathway involved in CD147-mediated gastric cancer cell line SGC7901 proliferation and invasion. Short hairpin RNA (shRNA) expression vectors targeting CD147 were constructed to silence CD147, and the expression of CD147 was monitored by quantitative realtime reverse transcriptase polymerase chain reaction and Western blot and further confirmed by immunohistochemistry in vivo. Cell proliferation was determined by Cell Counting Kit-8 assay, the activities of matrix metalloproteinase (MMP)-2 and MMP-9 were determined by gelatin zymography, and the invasion of SGC7901 was determined by invasion assay. The phosphorylation and non-phosphorylation of the mitogen-activated protein kinases, extracellular signal-regulated kinase1/2 (ERK1/2), P38 and c-Jun NH2-terminal kinase were examined by Western blot. Additionally, the ERK1/2 inhibitor U0126 were used to confirm the signalling pathway involved in CD147-mediated SGC7901 progression. The BALB/c nude mice were used to study tumour progression in vivo. The results revealed that CD147 silencing inhibited the proliferation and invasion of SGC7901 cells, and down-regulated the activities of MMP-2 and MMP-9 and the phosphorylation of the ERK1/2 in SGC7901 cells. ERK1/2 inhibitor U0126 decreased the proliferation, and invasion of SGC7901 cells, and down-regulated the MMP-2 and MMP-9 activities. In a nude mouse model of subcutaneous xenografts, the tumour volume was significantly smaller in the SGC7901/shRNA group compared to the SGC7901 and SGC7901/snc-RNA group. Immunohistochemistry analysis showed that CD147 and p-ERK1/2 protein expressions were down-regulated in the SGC7901/shRNA2 group compared to the SGC7901 and SGC7901/snc-RNA group. These results suggest that ERK1/2 pathway involves in CD147-mediated gastric cancer growth and invasion. These findings further highlight the importance of CD147 in cancer progression

An essential role of Nrf2 in American ginseng-mediated anti-oxidative actions in cardiomyocytes.

Science.gov (United States)

Li, Jinqing; Ichikawa, Tomonaga; Jin, Yu; Hofseth, Lorne J; Nagarkatti, Prakash; Nagarkatti, Mitzi; Windust, Anthony; Cui, Taixing

2010-07-20

Ginseng has been used as a folk medicine for thousands of years in Asia, and has become a popular herbal medicine world-wide. Recent studies have revealed that ginseng, including American ginseng, exerts antioxidant effects in the cardiovascular system; however, the underlying mechanisms are not fully understood. Thus, we investigated role of Nrf2, a master transcription factor of endogenous anti-oxidative defense systems, in the regulation of American ginseng-mediated anti-oxidative actions in cardiomyocytes. A standardized crude extract of American ginseng was supplied by the National Research Council of Canada, Institute for National Measurement Standards. H9C2 cells, a rat cardiomyocyte cell line, were exposed to angiotensin II (Ang II) or tumor necrosis factor alpha (TNFalpha) to induce oxidative stress that was examined by measuring formation of reactive oxygen and nitrogen species. Oxidative stress-induced cell death was induced by exogenous addition of hydrogen peroxide (H(2)O(2)). Proteins were measured by Western blot and mRNA expression was determined by quantitative real time PCR. Nrf2-driven transcriptional activity was assessed by antioxidant response element (ARE)-luciferase reporter assay. Direct Nrf2 binding to its target gene promoters was determined by chromatin immunoprecipitation assay. Adenoviral over-expression of Nrf2 shRNA was utilized to knock down Nrf2 in H9C2 cells. Immunochemical staining was applied for Nrf2 expression in the heart. American ginseng induced dramatic increases in Nrf2 protein expression, Nrf2 nuclear translocation, Nrf2 transcriptional activity, direct Nrf2 binding to its target gene promoters, and expression of a group of anti-oxidative genes driven by Nrf2 in H9C2 cells. In addition, American ginseng inhibited Ang II- or TNFalpha-induced free radical formation and H(2)O(2)-induced cell death in H9C2 cells over-expressed with control shRNA but not in the cells over-expressed with Nrf2 shRNA. Finally, oral

Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

International Nuclear Information System (INIS)

Ding, L.; Wu, J.P.; Xu, G.; Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W.

2014-01-01

Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis

Recent Findings Concerning PAMAM Dendrimer Conjugates with Cyclodextrins as Carriers of DNA and RNA

Directory of Open Access Journals (Sweden)

Keiichi Motoyama

2009-08-01

Full Text Available We have evaluated the potential use of various polyamidoamine (PAMAM dendrimer [dendrimer, generation (G 2-4] conjugates with cyclodextrins (CyDs as novel DNA and RNA carriers. Among the various dendrimer conjugates with CyDs, the dendrimer (G3 conjugate with α-CyD having an average degree of substitution (DS of 2.4 [α-CDE (G3, DS2] displayed remarkable properties as DNA, shRNA and siRNA delivery carriers through the sensor function of α-CDEs toward nucleic acid drugs, cell surface and endosomal membranes. In an attempt to develop cell-specific gene transfer carriers, we prepared sugar-appended α-CDEs. Of the various sugar-appended α-CDEs prepared, galactose- or mannose-appended α-CDEs provided superior gene transfer activity to α-CDE in various cells, but not cell-specific gene delivery ability. However, lactose-appended α-CDE [Lac-α-CDE (G2] was found to possess asialoglycoprotein receptor (AgpR-mediated hepatocyte-selective gene transfer activity, both in vitro and in vivo. Most recently, we prepared folate-poly(ethylene glycol-appended α-CDE [Fol-PαC (G3] and revealed that Fol-PαC (G3 imparted folate receptor (FR-mediated cancer cell-selective gene transfer activity. Consequently, α-CDEs bearing integrated, multifunctional molecules may possess the potential to be novel carriers for DNA, shRNA and siRNA.

Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

Energy Technology Data Exchange (ETDEWEB)

Ding, L.; Wu, J.P. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China); Xu, G. [Fudan University, Jinshan Hospital, Center Laboratory, Shanghai, China, Center Laboratory, Jinshan Hospital, Fudan University, Shanghai (China); Zhu, B.; Zeng, Q.M.; Li, D.F.; Lu, W. [Fudan University, Jinshan Hospital, Department of Orthopaedics, Shanghai, China, Department of Orthopaedics, Jinshan Hospital, Fudan University, Shanghai (China)

2014-05-09

Current studies find that degenerated cartilage endplates (CEP) of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA) was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

Lentiviral-mediated RNAi targeting caspase-3 inhibits apoptosis induced by serum deprivation in rat endplate chondrocytes in vitro

Directory of Open Access Journals (Sweden)

L. Ding

2014-06-01

Full Text Available Current studies find that degenerated cartilage endplates (CEP of vertebrae, with fewer diffusion areas, decrease nutrient supply and accelerate intervertebral disc degeneration. Many more apoptotic cells have been identified in degenerated than in normal endplates, and may be responsible for the degenerated grade. Previous findings suggest that inhibition of apoptosis is one possible approach to improve disc regeneration. It is postulated that inhibition of CEP cell apoptosis may be responsible for the regeneration of endplates. Caspase-3, involved in the execution phase of apoptosis, is a candidate for regulating the apoptotic process. In the present study, CEP cells were incubated in 1% fetal bovine serum. Activated caspases were detected to identify the apoptotic pathway, and apoptosis was quantified by flow cytometry. Lentiviral caspase-3 short hairpin RNA (shRNA was employed to study its protective effects against serum deprivation. Silencing of caspase-3 expression was quantified by reverse transcription-polymerase chain reaction and Western blots, and inhibition of apoptosis was quantified by flow cytometry. Serum deprivation increased apoptosis of rat CEP cells through activation of a caspase cascade. Lentiviral caspase-3 shRNA was successfully transduced into CEP cells, and specifically silenced endogenous caspase-3 expression. Surviving cells were protected by the downregulation of caspase-3 expression and activation. Thus, lentiviral caspase-3 shRNA-mediated RNAi successfully silenced endogenous caspase-3 expression, preventing inappropriate or premature apoptosis.

Activation of GSK3β by Sirt2 is required for early lineage commitment of mouse embryonic stem cell.

Directory of Open Access Journals (Sweden)

Xiaoxing Si

Full Text Available Sirt2, a member of the NAD(+-dependent protein deacetylase family, is increasingly recognized as a critical regulator of the cell cycle, cellular necrosis and cytoskeleton organization. However, its role in embryonic stem cells (ESCs remains unclear. Here we demonstrate that Sirt2 is up-regulated during RA (retinoic acid-induced and embryoid body (EB differentiation of mouse ESCs. Using lentivirus-mediated shRNA methods, we found that knockdown of Sirt2 compromises the differentiation of mouse ESCs into ectoderm while promoting mesoderm and endoderm differentiation. Knockdown of Sirt2 expression also leads to the activation of GSK3β through decreased phosphorylation of the serine at position 9 (Ser9 but not tyrosine at position 216 (Tyr216. Moreover, the constitutive activation of GSK3β during EB differentiation mimics the effect of Sirt2 knockdown, while down-regulation of GSK3β rescues the effect of Sirt2 knockdown on differentiation. In contrast to the effect on lineage differentiation, Sirt2 knockdown and GSK3β up-regulation do not change the self-renewal state of mouse ESCs. Overall, our report reveals a new function for Sirt2 in regulating the proper lineage commitment of mouse ESCs.

Female directors and real activities manipulation: Evidence from China

Directory of Open Access Journals (Sweden)

Jin-hui Luo

2017-06-01

Full Text Available Unlike previous studies that focus on accrual-based earnings management, this study analyzes real activities manipulation and investigates whether female directors on boards of directors (BoDs affect managers’ real activities manipulation. Using a large sample of 11,831 firm-year observations from Chinese listed companies from the 2000 to 2011 period, we find that higher female participation on BoDs is associated with lower levels of real activities manipulation, and that this negative relationship is stronger when female directors have higher ownership. These results hold for a battery of robustness checks. Overall, our findings indicate that board gender diversity may serve as a substitute mechanism for corporate governance to curb real activities manipulation and thus provide interested stakeholders with higher quality earnings reports.

The critical role of myostatin in differentiation of sheep myoblasts

Energy Technology Data Exchange (ETDEWEB)

Liu, Chenxi [College of Life Science and Technology, Xinjiang University, Urumqi (China); Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China); Ge, Yubin [The State Engineering Laboratory of AIDS Vaccine, College of Life Science, Jilin University, Changchun (China); Liu, Mingjun, E-mail: xjlmj2004@yahoo.com.cn [Xinjiang Laboratory of Animal Biotechnology, Urumqi (China); Laboratory of Grass-fed Animal Genetics, Breeding and Reproduction of Ministry of Agriculture, Urumqi (China); Animal Biotechnological Research Center, Xinjiang Academy of Animal Science, Urumqi (China)

2012-06-08

Highlights: Black-Right-Pointing-Pointer Identification of the effective and specific shRNA to knockdown MSTN. Black-Right-Pointing-Pointer Overexpression of MSTN reversibly suppressed myogenic differentiation. Black-Right-Pointing-Pointer shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. Black-Right-Pointing-Pointer MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. Black-Right-Pointing-Pointer Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

The critical role of myostatin in differentiation of sheep myoblasts

International Nuclear Information System (INIS)

Liu, Chenxi; Li, Wenrong; Zhang, Xuemei; Zhang, Ning; He, Sangang; Huang, Juncheng; Ge, Yubin; Liu, Mingjun

2012-01-01

Highlights: ► Identification of the effective and specific shRNA to knockdown MSTN. ► Overexpression of MSTN reversibly suppressed myogenic differentiation. ► shRNA knockdown of endogenous MSTN promoted ovine myoblast differentiation. ► MSTN inhibits myogenic differentiation through down-regulation of MyoD and Myogenin and up-regulation of Smad3. ► Provides a promise for the generation of transgenic sheep to improve meat productivity. -- Abstract: Myostatin [MSTN, also known as growth differentiation factor 8 (GDF8)], is an inhibitor of skeletal muscle growth. Blockade of MSTN function has been reported to result in increased muscle mass in mice. However, its role in myoblast differentiation in farm animals has not been determined. In the present study, we sought to determine the role of MSTN in the differentiation of primary sheep myoblasts. We found that ectopic overexpression of MSTN resulted in lower fusion index in sheep myoblasts, which indicated the repression of myoblast differentiation. This phenotypic change was reversed by shRNA knockdown of the ectopically expressed MSTN in the cells. In contrast, shRNA knockdown of the endogenous MSTN resulted in induction of myogenic differentiation. Additional studies revealed that the induction of differentiation by knocking down the ectopically or endogenously expressed MSTN was accompanied by up-regulation of MyoD and myogenin, and down-regulation of Smad3. Our results demonstrate that MSTN plays critical role in myoblast differentiation in sheep, analogous to that in mice. This study also suggests that shRNA knockdown of MSTN could be a potentially promising approach to improve sheep muscle growth, so as to increase meat productivity.

Gritty people try harder: grit and effort-related cardiac autonomic activity during an active coping challenge.

Science.gov (United States)

Silvia, Paul J; Eddington, Kari M; Beaty, Roger E; Nusbaum, Emily C; Kwapil, Thomas R

2013-05-01

Grit, a recently proposed personality trait associated with persistence for long-range goals, predicts achievement in a wide range of important life outcomes. Using motivational intensity theory, the present research examined the physiological underpinnings of grit during an active coping task. Forty young adults completed the Short Grit Scale and worked on a self-paced mental effort task. Effort-related autonomic nervous system (ANS) activity was assessed using impedance cardiography, which yielded measures of sympathetic activity (pre-ejection period; PEP) and parasympathetic activity (respiratory sinus arrhythmia; RSA). Multilevel models revealed that people high on the Perseverance of Effort subscale showed autonomic coactivation: both PEP and RSA became stronger during the task, reflecting higher activity of both ANS divisions. The Consistency of Interest subscale, in contrast, predicted only weaker sympathetic activity (slower PEP). Taken together, the findings illuminate autonomic processes associated with how "gritty" people pursue goals, and they suggest that more attention should be paid to the facets' distinct effects. Copyright © 2013 Elsevier B.V. All rights reserved.

Short hairpin RNA targeting 2B gene of coxsackievirus B3 exhibits potential antiviral effects both in vitro and in vivo

Directory of Open Access Journals (Sweden)

Yao Hailan

2012-08-01

Full Text Available Abstract Background Coxsackievirus B3 is an important infectious agent of viral myocarditis, pancreatitis and aseptic meningitis, but there are no specific antiviral therapeutic reagents in clinical use. RNA interference-based technology has been developed to prevent the viral infection. Methods To evaluate the impact of RNA interference on viral replication, cytopathogenicity and animal survival, short hairpin RNAs targeting the viral 2B region (shRNA-2B expressed by a recombinant vector (pGCL-2B or a recombinant lentivirus (Lenti-2B were tansfected in HeLa cells or transduced in mice infected with CVB3. Results ShRNA-2B exhibited a significant effect on inhibition of viral production in HeLa cells. Furthermore, shRNA-2B improved mouse survival rate, reduced the viral tissues titers and attenuated tissue damage compared with those of the shRNA-NC treated control group. Lenti-2B displayed more effective role in inhibition of viral replication than pGCL-2B in vivo. Conclusions Coxsackievirus B3 2B is an effective target of gene silencing against coxsackievirus B3 infection, suggesting that shRNA-2B is a potential agent for further development into a treatment for enterviral diseases.

Stronger Dopamine D1 Receptor-Mediated Neurotransmission in Dyskinesia.

Science.gov (United States)

Farré, Daniel; Muñoz, Ana; Moreno, Estefanía; Reyes-Resina, Irene; Canet-Pons, Júlia; Dopeso-Reyes, Iria G; Rico, Alberto J; Lluís, Carme; Mallol, Josefa; Navarro, Gemma; Canela, Enric I; Cortés, Antonio; Labandeira-García, José L; Casadó, Vicent; Lanciego, José L; Franco, Rafael

2015-12-01

Radioligand binding assays to rat striatal dopamine D1 receptors showed that brain lateralization of the dopaminergic system were not due to changes in expression but in agonist affinity. D1 receptor-mediated striatal imbalance resulted from a significantly higher agonist affinity in the left striatum. D1 receptors heteromerize with dopamine D3 receptors, which are considered therapeutic targets for dyskinesia in parkinsonian patients. Expression of both D3 and D1-D3 receptor heteromers were increased in samples from 6-hydroxy-dopamine-hemilesioned rats rendered dyskinetic by treatment with 3, 4-dihydroxyphenyl-L-alanine (L-DOPA). Similar findings were obtained using striatal samples from primates. Radioligand binding studies in the presence of a D3 agonist led in dyskinetic, but not in lesioned or L-DOPA-treated rats, to a higher dopamine sensitivity. Upon D3-receptor activation, the affinity of agonists for binding to the right striatal D1 receptor increased. Excess dopamine coming from L-DOPA medication likely activates D3 receptors thus making right and left striatal D1 receptors equally responsive to dopamine. These results show that dyskinesia occurs concurrently with a right/left striatal balance in D1 receptor-mediated neurotransmission.

Adaptor protein GRB2 promotes Src tyrosine kinase activation and podosomal organization by protein-tyrosine phosphatase ϵ in osteoclasts.

Science.gov (United States)

Levy-Apter, Einat; Finkelshtein, Eynat; Vemulapalli, Vidyasiri; Li, Shawn S-C; Bedford, Mark T; Elson, Ari

2014-12-26

The non-receptor isoform of protein-tyrosine phosphatase ϵ (cyt-PTPe) supports adhesion of bone-resorbing osteoclasts by activating Src downstream of integrins. Loss of cyt-PTPe reduces Src activity in osteoclasts, reduces resorption of mineralized matrix both in vivo and in cell culture, and induces mild osteopetrosis in young female PTPe KO mice. Activation of Src by cyt-PTPe is dependent upon this phosphatase undergoing phosphorylation at its C-terminal Tyr-638 by partially active Src. To understand how cyt-PTPe activates Src, we screened 73 Src homology 2 (SH2) domains for binding to Tyr(P)-638 of cyt-PTPe. The SH2 domain of GRB2 bound Tyr(P)-638 of cyt-PTPe most prominently, whereas the Src SH2 domain did not bind at all, suggesting that GRB2 may link PTPe with downstream molecules. Further studies indicated that GRB2 is required for activation of Src by cyt-PTPe in osteoclast-like cells (OCLs) in culture. Overexpression of GRB2 in OCLs increased activating phosphorylation of Src at Tyr-416 and of cyt-PTPe at Tyr-638; opposite results were obtained when GRB2 expression was reduced by shRNA or by gene inactivation. Phosphorylation of cyt-PTPe at Tyr-683 and its association with GRB2 are integrin-driven processes in OCLs, and cyt-PTPe undergoes autodephosphorylation at Tyr-683, thus limiting Src activation by integrins. Reduced GRB2 expression also reduced the ability of bone marrow precursors to differentiate into OCLs and reduced the fraction of OCLs in which podosomal adhesion structures assume organization typical of active, resorbing cells. We conclude that GRB2 physically links cyt-PTPe with Src and enables cyt-PTPe to activate Src downstream of activated integrins in OCLs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Distinct patterns of brain activity characterise lexical activation and competition in spoken word production.

Directory of Open Access Journals (Sweden)

Vitória Piai

Full Text Available According to a prominent theory of language production, concepts activate multiple associated words in memory, which enter into competition for selection. However, only a few electrophysiological studies have identified brain responses reflecting competition. Here, we report a magnetoencephalography study in which the activation of competing words was manipulated by presenting pictures (e.g., dog with distractor words. The distractor and picture name were semantically related (cat, unrelated (pin, or identical (dog. Related distractors are stronger competitors to the picture name because they receive additional activation from the picture relative to other distractors. Picture naming times were longer with related than unrelated and identical distractors. Phase-locked and non-phase-locked activity were distinct but temporally related. Phase-locked activity in left temporal cortex, peaking at 400 ms, was larger on unrelated than related and identical trials, suggesting differential activation of alternative words by the picture-word stimuli. Non-phase-locked activity between roughly 350-650 ms (4-10 Hz in left superior frontal gyrus was larger on related than unrelated and identical trials, suggesting differential resolution of the competition among the alternatives, as reflected in the naming times. These findings characterise distinct patterns of activity associated with lexical activation and competition, supporting the theory that words are selected by competition.

mTOR inhibition sensitizes human hepatocellular carcinoma cells to resminostat

Energy Technology Data Exchange (ETDEWEB)

Peng, Xingang, E-mail: pengxinggang26@sina.com [Department of Emergency General Surgery, The Affiliated Hospital of Qingdao University, Qingdao (China); Zhang, Donghui, E-mail: zhangdonghuiyx@sina.com [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Li, Zhengling, E-mail: lizhenglingzz@sina.com [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Fu, Meili, E-mail: fumeilidrlinyi@tom.com [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, Linyi (China)

2016-09-02

Histone deacetylases (HDACs) hyper-activity in hepatocellular carcinoma (HCC) is often associated with patients’ poor prognosis. Our previous study has shown that resminostat, a novel HDAC inhibitor (HDACi), activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway in HCC cells. Here we explored the potential resminostat resistance factor by focusing on mammalian target of rapamycin (mTOR). We showed that AZD-2014, a novel mTOR kinase inhibitor, potentiated resminostat-induced cytotoxicity and proliferation inhibition in HCC cells. Molecularly, AZD-2014 enhanced resminostat-induced mPTP apoptosis pathway activation in HCC cells. Inhibition of this apoptosis pathway, by the caspase-9 specific inhibitor Ac-LEHD-CHO, the mPTP blockers (sanglifehrin A/cyclosporine A), or by shRNA-mediated knockdown of mPTP component cyclophilin-D (Cyp-D), significantly attenuated resminostat plus AZD-2014-induced cytotoxicity and apoptosis in HCC cells. Significantly, mTOR shRNA knockdown or kinase-dead mutation (Asp-2338-Ala) also sensitized HCC cells to resminostat, causing profound cytotoxicity and apoptosis induction. Together, these results suggest that mTOR could be a primary resistance factor of resminostat. Targeted inhibition of mTOR may thus significantly sensitize HCC cells to resminostat. - Highlights: • AZD-2014 potentiates resminostat’s cytotoxicity against HCC cells. • AZD-2014 facilitates resminostat-induced HCC cell apoptosis. • AZD-2014 augments resminostat-induced mitochondrial apoptosis pathway activation. • mTOR shRNA or kinase-dead mutation significantly sensitizes HCC cells to resminostat.

PTP-PEST targets a novel tyrosine site in p120 catenin to control epithelial cell motility and Rho GTPase activity

Science.gov (United States)

Espejo, Rosario; Jeng, Yowjiun; Paulucci-Holthauzen, Adriana; Rengifo-Cam, William; Honkus, Krysta; Anastasiadis, Panos Z.; Sastry, Sarita K.

2014-01-01

ABSTRACT Tyrosine phosphorylation is implicated in regulating the adherens junction protein, p120 catenin (p120), however, the mechanisms are not well defined. Here, we show, using substrate trapping, that p120 is a direct target of the protein tyrosine phosphatase, PTP-PEST, in epithelial cells. Stable shRNA knockdown of PTP-PEST in colon carcinoma cells results in an increased cytosolic pool of p120 concomitant with its enhanced tyrosine phosphorylation and decreased association with E-cadherin. Consistent with this, PTP-PEST knockdown cells exhibit increased motility, enhanced Rac1 and decreased RhoA activity on a collagen substrate. Furthermore, p120 localization is enhanced at actin-rich protrusions and lamellipodia and has an increased association with the guanine nucleotide exchange factor, VAV2, and cortactin. Exchange factor activity of VAV2 is enhanced by PTP-PEST knockdown whereas overexpression of a VAV2 C-terminal domain or DH domain mutant blocks cell motility. Analysis of point mutations identified tyrosine 335 in the N-terminal domain of p120 as the site of PTP-PEST dephosphorylation. A Y335F mutant of p120 failed to induce the ‘p120 phenotype’, interact with VAV2, stimulate cell motility or activate Rac1. Together, these data suggest that PTP-PEST affects epithelial cell motility by controlling the distribution and phosphorylation of p120 and its availability to control Rho GTPase activity. PMID:24284071

Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

International Nuclear Information System (INIS)

Li, Yi; Cui, Jiang-Tao

2016-01-01

Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

Energy Technology Data Exchange (ETDEWEB)

Li, Yi; Cui, Jiang-Tao, E-mail: cuijingtaopaper@126.com

2016-09-02

Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

As tears go by : Baby tears trigger more brain activity than adult tears in nulliparous women

NARCIS (Netherlands)

Hendricx-Riem, M.M.E.; De Carli, P.; van IJzendoorn, M.H.; Vingerhoets, A.J.J.M.; Bakermans-Kranenburg, M.J.

2017-01-01

The current functional magnetic resonance imaging study examines brain activity during the perception of infant and adult tears. Infant tears evoke stronger responses in the visual cortex than adult tears, indicating that infant tears are highly salient. In addition, our study shows that infant

Reframing the Irish activation debate; Accommodating care and safeguarding social rights and choices

OpenAIRE

Murphy, Mary

2008-01-01

Work activation is a phrase used to describe a policy objective of moving people of working age from a social welfare payment into paid employment. It uses the social welfare system proactively to support, encourage or oblige claimants to participate in work, education or training. In this context a recent government publication - Proposals for Supporting Lone Parents - signals the introduction of a stronger form of work activation for lone parents and low-income mothers, including the introd...

Impact of repeated insecticide application on soil microbial activity

International Nuclear Information System (INIS)

Xu Bujin; Zhang Yongxi; Chen Meici; Zhu Nanwen; Ming Hong

2001-01-01

The effects of repeated insecticide application on soil microbial activity were studied both in a cotton field and in the laboratory. The results of experiment show that there are some effects on soil microbial activities, such as the population of soil microorganisms, soil respiration, dehydrogenase activity and nitrogen fixation. The degree of effects depends on the chemical dosage. Within the range of 0.5-10.0 μg/g air-dry-soil, the higher the concentration, the stronger effect. In this experiment, the effect disappeared within 4, 8 or 16 days after treatment, depending on the dose applied. In field conditions, the situation is more complex and the data of field experiment show greater fluctuation. (author)

Hypoxic activation of the unfolded protein response (UPR) induces expression of the metastasis-associated gene LAMP3

International Nuclear Information System (INIS)

Mujcic, Hilda; Rzymski, Tomasz; Rouschop, Kasper M.A.; Koritzinsky, Marianne; Milani, Manuela; Harris, Adrian L.; Wouters, Bradly G.

2009-01-01

Background and purpose: Tumour hypoxia contributes to failure of cancer treatment through its ability to protect against therapy and adversely influence tumour biology. In particular, several studies suggest that hypoxia promotes metastasis. Hypoxia-induced cellular changes are mediated by oxygen-sensitive signaling pathways that activate downstream transcription factors. We have investigated the induction and transcriptional regulation of a novel metastasis-associated gene, LAMP3 during hypoxia. Materials and methods: Microarray, quantitative PCR, Western blot analysis and immunohistochemistry were used to investigate hypoxic regulation of LAMP3. The mechanism for LAMP3 induction was investigated using transient RNAi and stable shRNA targeting components of the hypoxic response. Endoplasmic reticulum stress inducing agents, including proteasome inhibitors were assessed for their ability to regulate LAMP3. Results: LAMP3 is strongly induced by hypoxia at both the mRNA and protein levels in a large panel of human tumour cell lines. Induction of LAMP3 occurs as a consequence of the activation of the PERK/eIF2α/ATF4 arm of the unfolded protein response (UPR) and is independent of HIF-1α. LAMP3 is expressed heterogeneously within the microenvironment of tumours, overexpressed in breast cancer, and increases in tumours treated with avastin. Conclusions: These data identify LAMP3 as a novel hypoxia-inducible gene regulated by the UPR. LAMP3 is a new candidate biomarker of UPR activation by hypoxia in tumours and is a potential mediator of hypoxia-induced metastasis.

Supporting young people living with cancer to tell their stories in ways that make them stronger: The Beads of Life approach.

Science.gov (United States)

Portnoy, Sara; Girling, Isabella; Fredman, Glenda

2016-04-01

This article describes the 'Beads of Life' approach--a five-part methodology informed by narrative therapy to enable children and young people to make sense of their cancer journey in ways that make them stronger. Young people are invited to use beads as prompts to tell preferred stories of their identity to create a safe place to stand from which to story their cancer journey. The approach positions young people as experts in their lives. It aims to change their relationship with cancer to reduce its negative impact on life by lessening isolation. By enabling medical staff to get to know the young person apart from the cancer, this approach aims to create hope for the future and improve quality of care. © The Author(s) 2015.

Structural Requirements of Alkylglyceryl-l-Ascorbic Acid Derivatives for Melanogenesis Inhibitory Activity.

Science.gov (United States)

Taira, Norihisa; Katsuyama, Yushi; Yoshioka, Masato; Muraoka, Osamu; Morikawa, Toshio

2018-04-10

l-Ascorbic acid has multifunctional benefits on skin aesthetics, including inhibition of melanin production, and is widely used in cosmetics. It, however, has low stability and poor skin penetration. We hypothesize that alkylglyceryl-l-ascorbic acid derivatives, highly stable vitamin C-alkylglycerol conjugates, would have similar anti-melanogenic activity with better stability and penetration. We test 28 alkylglyceryl-l-ascorbic acid derivatives ( 1 - 28 ) on theophylline-stimulated B16 melanoma 4A5 cells to determine if they inhibit melanogenesis and establish any structure-function relationships. Although not the most potent inhibitors, 3- O -(2,3-dihydroxypropyl)-2- O -hexyl-l-ascorbic acid ( 6 , IC 50 = 81.4 µM) and 2- O -(2,3-dihydroxypropyl)-3- O -hexyl-l-ascorbic acid ( 20 , IC 50 = 117 µM) are deemed the best candidate derivatives based on their inhibitory activities and low toxicities. These derivatives are also found to be more stable than l-ascorbic acid and to have favorable characteristics for skin penetration. The following structural requirements for inhibitory activity of alkylglyceryl-l-ascorbic acid derivatives are also determined: (i) alkylation of glyceryl-l-ascorbic acid is essential for inhibitory activity; (ii) the 3- O -alkyl-derivatives ( 2 - 14 ) exhibit stronger inhibitory activity than the corresponding 2- O -alkyl-derivatives ( 16 - 28 ); and (iii) derivatives with longer alkyl chains have stronger inhibitory activities. Mechanistically, our studies suggest that l-ascorbic acid derivatives exert their effects by suppressing the mRNA expression of tyrosinase and tyrosine-related protein-1.

Histochemical demonstration of activity of acid phosphatase and beta-glucuronidase in bovine incisor tooth germs

DEFF Research Database (Denmark)

Kirkeby, S; Salling, E; Moe, D

1983-01-01

. After initiation of enamel formation, a change in localization and intensity of the colored reaction product was observed in the ameloblasts. The activity appeared stronger and was restricted to a narrow zone just apical to the nucleus. It is proposed that the acid hydrolases in the tooth forming cells...

Effects of the preparation method on the structure and the visible-light photocatalytic activity of Ag2CrO4

Directory of Open Access Journals (Sweden)

Difa Xu

2014-05-01

Full Text Available Silver chromate (Ag2CrO4 photocatalysts are prepared by microemulsion, precipitation, and hydrothermal methods, in order to investigate the effect of preparation methods on the structure and the visible-light photocatalytic activity. It is found that the photocatalytic activity of the prepared Ag2CrO4was highly dependent on the preparation methods. The sample prepared by microemulsion method exhibits the highest photocatalytic efficiency on the degradation of methylene blue (MB under visible-light irradiation. The enhanced photocatalytic activity could be ascribed to the smaller particle size, higher surface area, relatively stronger light absorption, and blue-shift absorption edge, which result in the adsorption of more MB molecules, a shorter diffusion process of more photogenerated excitons, and a stronger oxidation ability of the photogenerated holes. Considering the universalities of microemulsion, precipitation, and hydrothermal methods, this work may also provide a prototype for the comparative study of semiconductor based photocatalysis for water purification and environmental remediation.

Synergistic effect of intervention of glypican-3 gene transcription combined with antitumor drugs in inhibiting hepatoma cell proliferation

Directory of Open Access Journals (Sweden)

YANG Jie

2016-12-01

Full Text Available ObjectiveTo investigate the inhibitory effect of intervention of glypican-3 (GPC3 gene transcription combined with antitumor drugs on hepatoma cell proliferation. MethodsFour types of GPC3-shRNA plasmids were established and transfected into HepG2 hepatoma cells. Quantitative real-time PCR and Western blot were used to measure the mRNA and protein expression of GPC3 to analyze its association with hepatoma cell proliferation and apoptosis. The independent samples t-test was used for comparison of continuous data between any two groups, and a one-way analysis of variance was used for comparison between multiple groups. ResultsAmong these four plasmids, shRNA1 had a transfection efficiency of ＞85% in the transfection of HepG2 cells and a silence efficiency of 89.3% at the mRNA level, and the protein expression of GPC3 was significantly inhibited(P＜0.01）. At 72 hours, the GPC3-shRNA1 co-intervention group had an HepG2 cell inhibition rate of 71.1%, significantly different from that in the negative group (t=18.092, P＜0.001, an inhibition rate of migration of 89.1%, significantly lower than that in the negative group (t=8.326, P＜0.001, and inhibition rates of HepG2 cell movement and invasion of 53.6% and 60.1%, which were significantly different from those in the negative group (t=52.400 and 48.245, both P＜0.001. The GPC3-shRNA1 co-intervention group had a β-catenin mRNA inhibition rate of 46.9% and a Gli1 mRNA upregulation rate of 7.4%, significantly different from those in the negative group (t=30.108 and -3.551, P＜0.001 and P=0.009. At 24 hours, 10 μmol/L sorafenib combined with shRNA1 had an inhibition rate of tumor cells of 52.6% and 100 μmol/L sorafenib combined with shRNA1 had an inhibition rate of tumor cells of 79.5%, which were significantly different from that in the control group (t=23.314 and 50.352, both P＜0.001. The half-maximal inhibitory concentrations of sorafenib, rapamycin, and erlotinib for HepG2 were 4.67±1

Physical activity: The importance of the extended theory of planned behavior, in type 2 diabetes patients.

Science.gov (United States)

Ferreira, Gabriela; Pereira, M Graça

2017-09-01

This study focused on the contribution of the extended theory of planned behavior regarding intention to perform physical activity, adherence to physical activity, and its mediator role in the relationship between trust in the physician and adherence to physical activity, in a sample of 120 patients with type 2 diabetes. The results revealed that positive attitudes and perception of control predicted a stronger intention to do physical activity. The intention to do physical activity was the only predictor of adherence to physical activity. Planning mediated the relationship between trust in the physician and adherence. Implications for patients with type 2 diabetes are discussed.

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

Science.gov (United States)

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

MEK-ERK inhibition potentiates WAY-600-induced anti-cancer efficiency in preclinical hepatocellular carcinoma (HCC) models

Energy Technology Data Exchange (ETDEWEB)

Wang, Kaifeng, E-mail: kaifeng_wangdr@sina.com [Cancer center, the Affiliated Hospital of Hangzhou Normal University, Hangzhou (China); Fan, Yaohua [Oncology Department, No. 1 Hospital of Jiaxing, Zhejiang Province, Jiaxing (China); Chen, Gongying [Oncology Department, The Affiliated Hospital Hangzhou Normal University, Hangzhou (China); Wang, Zhengrong [Taizhou Hospital, Zhejiang Province, Taizhou (China); Kong, Dexin; Zhang, Peng [Oncology Department, Sir Run Run Shaw Hospital, Medical School, Zhejiang University, Hangzhou (China)

2016-05-27

The search for novel anti-hepatocellular carcinoma (HCC) agents is important. Mammalian target of rapamycin (mTOR) hyper-activation plays a pivotal role in promoting HCC tumorigenesis and chemoresistance. The current preclinical study evaluated the potential anti-HCC activity by a potent mTOR kinase inhibitor, WAY-600. We showed that WAY-600 inhibited survival and proliferation of HCC cell lines (HepG2 and Huh7) and primary human HCC cells. Caspase-dependent apoptosis was activated by WAY-600 in above HCC cells. Reversely, caspase inhibitors largely attenuated WAY-600's lethality against HCC cells. At the signaling level, WAY-600 blocked mTOR complex 1/2 (mTORC1/2) assemble and activation, yet activated MEK-ERK pathway in HCC cells. MEK-ERK inhibitors, PD-98059 and MEK-162, or MEK1/2 shRNA significantly potentiated WAY-600's cytotoxicity in HCC cells. Further studies showed that WAY-600 intraperitoneal (i.p.) administration in nude mice inhibited p-AKT Ser-473 and displayed significant anti-cancer activity against HepG2 xenografts. Remarkably, co-administration of MEK-162 further potentiated WAY-600's anti-HCC activity in vivo. These preclinical results demonstrate the potent anti-HCC activity by WAY-600, either alone or with MEK-ERK inhibitors. -- Highlights: •WAY-600 inhibits HCC cell survival and proliferation in vitro. •WAY-600 activates caspase-dependent apoptosis in HCC cells. •WAY-600 blocks mTORC1/2 activation, but activates MEK-ERK in HCC cells. •MEK-ERK inhibitors or MEK1/2 shRNA enhances WAY-600's cytotoxicity against HCC cells. •MEK-162 co-administration potentiates WAY-600-induced the anti-HepG2 tumor efficacy.

MMP-9 directed shRNAs as relevant inhibitors of matrix metalloproteinase 9 activity and signaling

Directory of Open Access Journals (Sweden)

Ewa Nowak

2013-08-01

Full Text Available Introduction: The main function of matrix metalloproteinases is the degradation of extracellular matrix components, which is related to changes in the proliferation of cells, their differentiation, motility, and death. MMPs play an important role in physiological processes such as embryogenesis, angiogenesis and tissue remodeling. The increase of MMPs activity is also observed in pathological conditions including tumorigenesis where MMP-2 (gelatinase A and MMP-9 (gelatinase B show the ability to degrade the basement membrane of vessels and they are involved in metastasis. The aim of our study was to verify the changes of MMP-9 enzymatic activity and the mobility of cells after inhibition of MMP-9 gene expression.Material and Methods: The oligonucleotide shRNA insert had been designed to silence MMP-9 gene expression and was cloned into the pSUPER.neo expression vector. The construct was introduced into the HeLa (CCL-2 cervical cancer cells by lipotransfection. Simultaneously in control cells MMP-9 were inhibited by doxycycline. Changes in activity of MMP-9 were analyzed by gelatin zymography and wound-healing assay.Results/Conclusions: Gelatin zymography allowed us to confirm that activity of MMP-9 in cells transfected by shRNA-MMP-9 and treated by doxycycline were similar and significantly lower in comparison with control cells. Phenotypic tests of migration in vitro confirm statistically significant (P<0.05 changes in cell migration – control cells healed 3 to 5 times faster in comparison with transfected or doxycycline treated cells. Our studies show the significant role of MMP-9 in mobility and invasiveness of tumor cells, thus indicating a potential target point of interest for gene therapy.

Preparation and Characterization of Activated Carbon Fibers from Liquefied Wood by ZnCl2 Activation

Directory of Open Access Journals (Sweden)

Zhigao Liu

2016-02-01

Full Text Available In this study, activated carbon fibers (ACFs were prepared from liquefied wood by chemical activation with ZnCl2, with a particular focus on the effects of temperature and ZnCl2: liquefied wood-based fiber (LWF ratio on yield, porous texture, and surface chemistry. The characterization and properties of these ACFs were investigated by nitrogen adsorption/desorption, Fourier transform infrared (FTIR spectroscopy, and X-ray photoelectron spectroscopy (XPS. When using a 6:1 impregnation ratio, the specific surface area (SBET of the resultant ACFs was as high as 1423 m2/g. The effect of an increase in impregnation ratio on the porosity of ACFs was stronger than that of an increase in the activation temperature. However, the former had a weaker impact on the surface chemistry and structure. It was also found that the yields of ACFs obtained by ZnCl2 activation were higher than those obtained by physical activation. Besides, the prepared ACFs presented higher adsorption than other raw materials in the adsorption test, indicating that ACFs prepared from LWF by ZnCl2 activation could be used as an adsorbent for the adsorption of medium size organic compounds.

The Importance of Leisure Activities in the Relationship between Physical Health and Well-Being in a Life Span Sample.

Science.gov (United States)

Paggi, Michelle E; Jopp, Daniela; Hertzog, Christopher

2016-01-01

Previous studies have examined the relationships between physical health and leisure activities and between leisure activities and well-being, but, to our knowledge, none has examined these relationships simultaneously. This study investigated the relationships between leisure activities, health and well-being considering the role of age, and whether leisure activities mediate the relationship between physical health and well-being. Utilizing a cross-sectional database of 259 adults (ages 18-81 years) who completed several questionnaires, linear regression models and mediation models were tested. Regression analyses indicated that physical health was related to leisure activities and leisure activities were related to well-being. When physical health was measured by subjective ratings, age had a stronger relationship with leisure activities. However, when physical health was indicated by health restrictions, physical health had a stronger relationship with leisure activities than did age. Leisure activities were a partial mediator of the relationship between physical health and well-being. The results demonstrated that the reduction in leisure activities with age has more to do with physical health limitations than with older age itself. In addition, regardless of age, the benefits of physical health for well-being are due in part to the level of leisure activity participation. These results highlight the importance of leisure activities for successful aging throughout the adult life span. Interventions designed to improve well-being through increasing leisure activity participation should take physical health into consideration, particularly for older adults. © 2016 S. Karger AG, Basel.

A comprehensive platform for highly multiplexed mammalian functional genetic screens

Directory of Open Access Journals (Sweden)

Cheung-Ong Kahlin

2011-05-01

Full Text Available Abstract Background Genome-wide screening in human and mouse cells using RNA interference and open reading frame over-expression libraries is rapidly becoming a viable experimental approach for many research labs. There are a variety of gene expression modulation libraries commercially available, however, detailed and validated protocols as well as the reagents necessary for deconvolving genome-scale gene screens using these libraries are lacking. As a solution, we designed a comprehensive platform for highly multiplexed functional genetic screens in human, mouse and yeast cells using popular, commercially available gene modulation libraries. The Gene Modulation Array Platform (GMAP is a single microarray-based detection solution for deconvolution of loss and gain-of-function pooled screens. Results Experiments with specially constructed lentiviral-based plasmid pools containing ~78,000 shRNAs demonstrated that the GMAP is capable of deconvolving genome-wide shRNA "dropout" screens. Further experiments with a larger, ~90,000 shRNA pool demonstrate that equivalent results are obtained from plasmid pools and from genomic DNA derived from lentivirus infected cells. Parallel testing of large shRNA pools using GMAP and next-generation sequencing methods revealed that the two methods provide valid and complementary approaches to deconvolution of genome-wide shRNA screens. Additional experiments demonstrated that GMAP is equivalent to similar microarray-based products when used for deconvolution of open reading frame over-expression screens. Conclusion Herein, we demonstrate four major applications for the GMAP resource, including deconvolution of pooled RNAi screens in cells with at least 90,000 distinct shRNAs. We also provide detailed methodologies for pooled shRNA screen readout using GMAP and compare next-generation sequencing to GMAP (i.e. microarray based deconvolution methods.

How the biotin–streptavidin interaction was made even stronger: investigation via crystallography and a chimaeric tetramer

Science.gov (United States)

Chivers, Claire E.; Koner, Apurba L.; Lowe, Edward D.; Howarth, Mark

2011-01-01

The interaction between SA (streptavidin) and biotin is one of the strongest non-covalent interactions in Nature. SA is a widely used tool and a paradigm for protein–ligand interactions. We previously developed a SA mutant, termed Tr (traptavidin), possessing a 10-fold lower off-rate for biotin, with increased mechanical and thermal stability. In the present study, we determined the crystal structures of apo-Tr and biotin–Tr at 1.5 Å resolution. In apo-SA the loop (L3/4), near biotin's valeryl tail, is typically disordered and open, but closes upon biotin binding. In contrast, L3/4 was shut in both apo-Tr and biotin–Tr. The reduced flexibility of L3/4 and decreased conformational change on biotin binding provide an explanation for Tr's reduced biotin off- and on-rates. L3/4 includes Ser45, which forms a hydrogen bond to biotin consistently in Tr, but erratically in SA. Reduced breakage of the biotin–Ser45 hydrogen bond in Tr is likely to inhibit the initiating event in biotin's dissociation pathway. We generated a Tr with a single biotin-binding site rather than four, which showed a simi-larly low off-rate, demonstrating that Tr's low off-rate was governed by intrasubunit effects. Understanding the structural features of this tenacious interaction may assist the design of even stronger affinity tags and inhibitors. PMID:21241253

Income is a stronger predictor of mortality than education in a national sample of US adults.

Science.gov (United States)

Sabanayagam, Charumathi; Shankar, Anoop

2012-03-01

Low socioeconomic status (SES) is associated with mortality in several populations. SES measures, such as education and income, may operate through different pathways. However, the independent effect of each measure mutually adjusting for the effect of other SES measures is not clear. The association between poverty-income ratio (PIR) and education and all-cause mortality among 15,646 adults, aged >20 years, who participated in the Third National Health and Nutrition Examination Survey in the USA, was examined. The lower PIR quartiles and less than high school education were positively associated with all-cause mortality in initial models adjusting for the demographic, lifestyle and clinical risk factors. After additional adjustment for education, the lower PIR quartiles were still significantly associated with all-cause mortality. The multivariable odds ratio (OR) [95% confidence interval (CI)] of all-cause mortality comparing the lowest to the highest quartile of PIR was 2.11 (1.52-2.95, p trend education was no longer associated with all-cause mortality [multivariable OR (95% CI) of all-cause mortality comparing less than high school to more than high school education was 1.05 (0.85-1.31, p trend=0.57)]. The results suggest that income may be a stronger predictor of mortality than education, and narrowing the income differentials may reduce the health disparities.

CDC'S Testing Makes Us Stronger (TMUS) Campaign: Was Campaign Exposure Associated With HIV Testing Behavior Among Black Gay and Bisexual Men?

Science.gov (United States)

Habarta, Nancy; Boudewyns, Vanessa; Badal, Hannah; Johnston, Jennie; Uhrig, Jennifer; Green, Donata; Ruddle, Paul; Rosenthal, Jacqueline; Stryker, Jo Ellen

2017-06-01

This study assessed exposure among Black gay, bisexual, and other men who have sex with men (BMSM) to a communication campaign, Testing Makes Us Stronger (TMUS), and its association with HIV testing to determine campaign effectiveness. Data from an online survey (N = 3,105) were analyzed using propensity score weight-adjusted logistic regression to examine the effect of exposure on HIV testing. Among BMSM aged 18-44 (n = 702), 43.2% reported TMUS exposure. The majority of those exposed were aged 25-34 (54%), HIV-negative (65%), and had some college education (87%). TMUS exposure was associated with reported increased HIV testing behaviors at 6- and 12-month frequencies. Communication campaigns with clear implementation strategies, focused objectives, and online and event presence can be associated with longer-term outcomes such as HIV testing.

Using open source accelerometer analysis to assess physical activity and sedentary behaviour in overweight and obese adults.

Science.gov (United States)

Innerd, Paul; Harrison, Rory; Coulson, Morc

2018-04-23

Physical activity and sedentary behaviour are difficult to assess in overweight and obese adults. However, the use of open-source, raw accelerometer data analysis could overcome this. This study compared raw accelerometer and questionnaire-assessed moderate-to-vigorous physical activity (MVPA), walking and sedentary behaviour in normal, overweight and obese adults, and determined the effect of using different methods to categorise overweight and obesity, namely body mass index (BMI), bioelectrical impedance analysis (BIA) and waist-to-hip ratio (WHR). One hundred twenty adults, aged 24-60 years, wore a raw, tri-axial accelerometer (Actigraph GT3X+), for 3 days and completed a physical activity questionnaire (IPAQ-S). We used open-source accelerometer analyses to estimate MVPA, walking and sedentary behaviour from a single raw accelerometer signal. Accelerometer and questionnaire-assessed measures were compared in normal, overweight and obese adults categorised using BMI, BIA and WHR. Relationships between accelerometer and questionnaire-assessed MVPA (Rs = 0.30 to 0.48) and walking (Rs = 0.43 to 0.58) were stronger in normal and overweight groups whilst sedentary behaviour were modest (Rs = 0.22 to 0.38) in normal, overweight and obese groups. The use of WHR resulted in stronger agreement between the questionnaire and accelerometer than BMI and BIA. Finally, accelerometer data showed stronger associations with BMI, BIA and WHR (Rs = 0.40 to 0.77) than questionnaire data (Rs = 0.24 to 0.37). Open-source, raw accelerometer data analysis can be used to estimate MVPA, walking and sedentary behaviour from a single acceleration signal in normal, overweight and obese adults. Our data supports the use of WHR to categorise overweight and obese adults. This evidence helps researchers obtain more accurate measures of physical activity and sedentary behaviour in overweight and obese populations.

[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].

Science.gov (United States)

Yu, Yanping; Zhang, Song; Kong, Weijia

2010-09-01

To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.

Comparison of the Microbicidal activity of monochloramine and iodine.

Science.gov (United States)

Arnitz, R; Nagl, M; Gottardi, W

2015-12-01

Recently, we showed that monochloramine (NH2 Cl) has a significantly stronger bactericidal and fungicidal activity than chloramine T despite its lower oxidizing power. This phenomenon was explained by increased penetration because of the higher lipophilicity and smaller bulk of NH2 Cl. As iodine (I2 ) has an even fivefold higher bulk than NH2 Cl, a comparison of both compounds regarding their microbicidal activity became the aim of this study. Aqueous solutions of I2 at a concentration of 10·7 μmol l(-1) killed 10(6) colony forming units per millilitre (CFU ml(-1) ) of Escherichia coli, Staphylococcus aureus or Pseudomonas aeruginosa to the detection limit of 10(2) CFU ml(-1) within 1 min at 20°C and pH 7·1, while a concentration of 36-355 μmol l(-1) of NH2 Cl was needed to achieve the same effect. Aspergillus fumigatus was inactivated within 5 min by 36 μmol l(-1) I2 and by 355 μmol l(-1) NH2 Cl, Candida albicans within 1 min by 10·7 μmol l(-1) I2 and by 355 μmol l(-1) NH2 Cl. The lipophilicity of I2 , determined with the octanol/water method, was three powers of 10 higher than that of NH2 Cl. The at least 10-fold stronger microbicidal activity of iodine suggests that the hindrance of penetration of the bulky molecule is outweighed by enhanced lipophilicity. The microbicidal activity of active halogen compounds increases not only with their reactivity, but also with higher lipophilicity and lower bulk, as shown recently. In this study, iodine showed a higher microbicidal activity than monochloramine and a 1000-fold higher lipophilicity. Therefore, the lipophilicity of a disinfectant may be more important than the bulk for bactericidal activity. These facts should be considered upon the design of new antiseptics and their clinical application. © 2015 The Society for Applied Microbiology.

Intrinsic resting-state activity predicts working memory brain activation and behavioral performance.

Science.gov (United States)

Zou, Qihong; Ross, Thomas J; Gu, Hong; Geng, Xiujuan; Zuo, Xi-Nian; Hong, L Elliot; Gao, Jia-Hong; Stein, Elliot A; Zang, Yu-Feng; Yang, Yihong

2013-12-01

Although resting-state brain activity has been demonstrated to correspond with task-evoked brain activation, the relationship between intrinsic and evoked brain activity has not been fully characterized. For example, it is unclear whether intrinsic activity can also predict task-evoked deactivation and whether the rest-task relationship is dependent on task load. In this study, we addressed these issues on 40 healthy control subjects using resting-state and task-driven [N-back working memory (WM) task] functional magnetic resonance imaging data collected in the same session. Using amplitude of low-frequency fluctuation (ALFF) as an index of intrinsic resting-state activity, we found that ALFF in the middle frontal gyrus and inferior/superior parietal lobules was positively correlated with WM task-evoked activation, while ALFF in the medial prefrontal cortex, posterior cingulate cortex, superior frontal gyrus, superior temporal gyrus, and fusiform gyrus was negatively correlated with WM task-evoked deactivation. Further, the relationship between the intrinsic resting-state activity and task-evoked activation in lateral/superior frontal gyri, inferior/superior parietal lobules, superior temporal gyrus, and midline regions was stronger at higher WM task loads. In addition, both resting-state activity and the task-evoked activation in the superior parietal lobule/precuneus were significantly correlated with the WM task behavioral performance, explaining similar portions of intersubject performance variance. Together, these findings suggest that intrinsic resting-state activity facilitates or is permissive of specific brain circuit engagement to perform a cognitive task, and that resting activity can predict subsequent task-evoked brain responses and behavioral performance. Copyright © 2012 Wiley Periodicals, Inc.

Active Commuting: Workplace Health Promotion for Improved Employee Well-Being and Organizational Behavior.

Science.gov (United States)

Page, Nadine C; Nilsson, Viktor O

2016-01-01

Objective: This paper describes a behavior change intervention that encourages active commuting using electrically assisted bikes (e-bikes) for health promotion in the workplace. This paper presents the preliminary findings of the intervention's impact on improving employee well-being and organizational behavior, as an indicator of potential business success. Method: Employees of a UK-based organization participated in a workplace travel behavior change intervention and used e-bikes as an active commuting mode; this was a change to their usual passive commuting behavior. The purpose of the intervention was to develop employee well-being and organizational behavior for improved business success. We explored the personal benefits and organizational co-benefits of active commuting and compared these to a travel-as-usual group of employees who did not change their behavior and continued taking non-active commutes. Results: Employees who changed their behavior to active commuting reported more positive affect, better physical health and more productive organizational behavior outcomes compared with passive commuters. In addition, there was an interactive effect of commuting mode and commuting distance: a more frequent active commute was positively associated with more productive organizational behavior and stronger overall positive employee well-being whereas a longer passive commute was associated with poorer well-being, although there was no impact on organizational behavior. Conclusion: This research provides emerging evidence of the value of an innovative workplace health promotion initiative focused on active commuting in protecting and improving employee well-being and organizational behavior for stronger business performance. It considers the significant opportunities for organizations pursuing improved workforce well-being, both in terms of employee health, and for improved organizational behavior and business success.

“Environmental Psychology” the mental benefits of physical activities in natural settings

OpenAIRE

De Dominicis, Stefano

2017-01-01

Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising and playing sports in natural environments. Specifically, given their intrinsic characteristics, such contexts are more prone then urban environments to foster positive emotions, controlled cognition...

The time-course of activation in the dorsal and ventral visual streams during landmark cueing and perceptual discrimination tasks.

Science.gov (United States)

Lambert, Anthony J; Wootton, Adrienne

2017-08-01

Different patterns of high density EEG activity were elicited by the same peripheral stimuli, in the context of Landmark Cueing and Perceptual Discrimination tasks. The C1 component of the visual event-related potential (ERP) at parietal - occipital electrode sites was larger in the Landmark Cueing task, and source localisation suggested greater activation in the superior parietal lobule (SPL) in this task, compared to the Perceptual Discrimination task, indicating stronger early recruitment of the dorsal visual stream. In the Perceptual Discrimination task, source localisation suggested widespread activation of the inferior temporal gyrus (ITG) and fusiform gyrus (FFG), structures associated with the ventral visual stream, during the early phase of the P1 ERP component. Moreover, during a later epoch (171-270ms after stimulus onset) increased temporal-occipital negativity, and stronger recruitment of ITG and FFG were observed in the Perceptual Discrimination task. These findings illuminate the contrasting functions of the dorsal and ventral visual streams, to support rapid shifts of attention in response to contextual landmarks, and conscious discrimination, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

Regulation of DNA repair mechanism in human glioma xenograft cells both in vitro and in vivo in nude mice.

Science.gov (United States)

Ponnala, Shivani; Veeravalli, Krishna Kumar; Chetty, Chandramu; Dinh, Dzung H; Rao, Jasti S

2011-01-01

Glioblastoma Multiforme (GBM) is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR) are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ) repair mechanism plays a major role in double strand break (DSB) repair in mammalian cells. Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU) and MMP9-cathepsin B (pMC) shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls. Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from clinical stand

Regulation of DNA repair mechanism in human glioma xenograft cells both in vitro and in vivo in nude mice.

Directory of Open Access Journals (Sweden)

Shivani Ponnala

Full Text Available Glioblastoma Multiforme (GBM is the most lethal form of brain tumor. Efficient DNA repair and anti-apoptotic mechanisms are making glioma treatment difficult. Proteases such as MMP9, cathepsin B and urokinase plasminogen activator receptor (uPAR are over expressed in gliomas and contribute to enhanced cancer cell proliferation. Non-homologous end joining (NHEJ repair mechanism plays a major role in double strand break (DSB repair in mammalian cells.Here we show that silencing MMP9 in combination with uPAR/cathepsin B effects NHEJ repair machinery. Expression of DNA PKcs and Ku70/80 at both mRNA and protein levels in MMP9-uPAR (pMU and MMP9-cathepsin B (pMC shRNA-treated glioma xenograft cells were reduced. FACS analysis showed an increase in apoptotic peak and proliferation assays revealed a significant reduction in the cell population in pMU- and pMC-treated cells compared to untreated cells. We hypothesized that reduced NHEJ repair led to DSBs accumulation in pMU- and pMC-treated cells, thereby initiating cell death. This hypothesis was confirmed by reduced Ku70/Ku80 protein binding to DSB, increased comet tail length and elevated γH2AX expression in treated cells compared to control. Immunoprecipitation analysis showed that EGFR-mediated lowered DNA PK activity in treated cells compared to controls. Treatment with pMU and pMC shRNA reduced the expression of DNA PKcs and ATM, and elevated γH2AX levels in xenograft implanted nude mice. Glioma cells exposed to hypoxia and irradiation showed DSB accumulation and apoptosis after pMU and pMC treatments compared to respective controls.Our results suggest that pMU and pMC shRNA reduce glioma proliferation by DSB accumulation and increase apoptosis under normoxia, hypoxia and in combination with irradiation. Considering the radio- and chemo-resistant cancers favored by hypoxia, our study provides important therapeutic potential of MMP9, uPAR and cathepsin B shRNA in the treatment of glioma from

Inhibiting trophoblast PAR-1 overexpression suppresses sFlt-1-induced anti-angiogenesis and abnormal vascular remodeling: a possible therapeutic approach for preeclampsia.

Science.gov (United States)

Zhao, Yin; Zheng, YanFang; Liu, XiaoXia; Luo, QingQing; Wu, Di; Liu, XiaoPing; Zou, Li

2018-03-01

Is it possible to improve vascular remodeling by inhibiting the excessive expression of protease-activated receptor 1 (PAR-1) in trophoblast of abnormal placenta? Inhibition of trophoblast PAR-1 overexpression may promote placental angiogenesis and vascular remodeling, offering an alternative therapeutic approach for preeclampsia. PAR-1 is high-affinity receptor of thrombin. Thrombin increases sFlt-1 secretion in trophoblast via the activation of PAR-1. It is reported that the expression of both thrombin and PAR-1 expression are increased in placentas of preeclampsia patients compared with normal placentas. Trophoblast cells were transfected with PAR-1 short hairpin RNA (shRNA) or PAR-1 overexpression plasmids in vitro. Tube formation assays and a villus-decidua co-culture system were used to study the effect of PAR-1 inhibition on placental angiogenesis and vascular remodeling, respectively. Placentas from rats with preeclampsia were transfected with PAR-1 shRNA to confirm the effect of inhibiting PAR-1 overexpression in placenta. The trophoblast cell line HTR-8/SVneo was transfected with PAR-1 shRNA or PAR-1 overexpression plasmids. After 48 h, supernatant was collected and the level of sFlt-1 secretion was measured by ELISA. Human umbilical cord epithelial cells and a villus-decidua co-culture system were treated with conditioned media to study the effect of PAR-1 inhibition on tube formation and villi vascular remodeling. A preeclampsia rat model was established by intraperitoneal injection of L-NAME. Plasmids were injected into the placenta of the preeclampsia rats and systolic blood pressure was measured on Days 15 and 19. The effect of different treatments was evaluated by proteinuria, placental weights, fetal weights and fetal numbers in study and control groups. The level of serum sFlt-1 in rats with preeclampsia was also measured. Changes in the placenta microvessels were studied by histopathological staining. PAR-1 shRNA inhibited PAR-1 expression and

Activity of upper limb muscles during human walking.

Science.gov (United States)

Kuhtz-Buschbeck, Johann P; Jing, Bo

2012-04-01

The EMG activity of upper limb muscles during human gait has rarely been studied previously. It was examined in 20 normal volunteers in four conditions: walking on a treadmill (1) with unrestrained natural arm swing (Normal), (2) while volitionally holding the arms still (Held), (3) with the arms immobilized (Bound), and (4) with the arms swinging in phase with the ipsilateral legs, i.e. opposite-to-normal phasing (Anti-Normal). Normal arm swing involved weak rhythmical lengthening and shortening contractions of arm and shoulder muscles. Phasic muscle activity was needed to keep the unrestricted arms still during walking (Held), indicating a passive component of arm swing. An active component, possibly programmed centrally, existed as well, because some EMG signals persisted when the arms were immobilized during walking (Bound). Anti-Normal gait involved stronger EMG activity than Normal walking and was uneconomical. The present results indicate that normal arm swing has both passive and active components. Copyright © 2011 Elsevier Ltd. All rights reserved.

Composition and antioxidant activities of four polysaccharides extracted from Herba Lophatheri.

Science.gov (United States)

Ge, Qing; Mao, Jian-wei; Guo, Xiao-qing; Zhou, Yi-feng; Gong, Jing-yan; Mao, Shuang-rong

2013-09-01

Four polysaccharides (BLF80-A, BLF80-B, BLF80-C and BLF80-D) were isolated by hot-water extraction and purified from the leaves of Herba Lophatheri by DEAE-Sepharose fast flow. Their chemical and physical characteristics were determined and antioxidant activities were investigated on the basis of DPPH radical assay, hydroxyl radical assay and superoxide radical assay. The results showed that four polysaccharides exhibited antioxidant activities in a concentration-dependent manner, and the higher molecular weight, the stronger antioxidant activities of polysaccharides. Besides, the monosaccharide compositions of polysaccharides also influence their antioxidant activities. BLP80-D showed the strongest scavenging ability, followed by BLP80-C, BLP80-B and BLP80-A. Copyright © 2013 Elsevier B.V. All rights reserved.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

Science.gov (United States)

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

Reduce Fraud Risk in Your District with Stronger Internal Controls

Science.gov (United States)

Okrzesik, Daryl J.; Nuehring, Bert G.

2011-01-01

Internal accounts offer schools a faster, more convenient way to handle the income and expenses that result from student fees, school clubs and organizations, field trips, fund-raising, and similar activities. But this convenience also incurs the added risk of fraud. Fortunately, there are proven ways to strengthen internal controls and reduce…

Short-chain C6 ceramide sensitizes AT406-induced anti-pancreatic cancer cell activity

International Nuclear Information System (INIS)

Zhao, Xiaoguang; Sun, Baoyou; Zhang, Jingjing; Zhang, Ruishen; Zhang, Qing

2016-01-01

Our previous study has shown that AT406, a first-in-class small molecular antagonist of IAPs (inhibitor of apoptosis proteins), inhibits pancreatic cancer cell proliferation in vitro and in vivo. The aim of this research is to increase AT406's sensitivity by adding short-chain C6 ceramide. We show that co-treatment of C6 ceramide dramatically potentiated AT406-induced caspase/apoptosis activation and cytotoxicity in established (Panc-1 and Mia-PaCa-2 lines) and primary human pancreatic cancer cells. Reversely, caspase inhibitors largely attenuated C6 ceramide plus AT406-induced above cancer cell death. Molecularly, C6 ceramide downregulated Bcl-2 to increase AT406's sensitivity in pancreatic cancer cells. Intriguingly, C6 ceramide-mediated AT406 sensitization was nullified with Bcl-2 shRNA knockdown or pretreatment of the Bcl-2 inhibitor ABT-737. In vivo, liposomal C6 ceramide plus AT406 co-administration dramatically inhibited Panc-1 xenograft tumor growth in severe combined immunodeficient (SCID) mice. The combined anti-tumor activity was significantly more potent than either single treatment. Expressions of IAPs (cIAP1/XIAP) and Bcl-2 were downregulated in Panc-1 xenografts with the co-administration. Together, we demonstrate that C6 ceramide sensitizes AT406-mediated anti-pancreatic cancer cell activity possibly via downregulating Bcl-2. - Highlights: • C6 ceramide dramatically potentiates AT406-induced pancreatic cancer cell death. • C6 ceramide facilitates AT406-induced pancreatic cancer cell apoptosis. • C6 ceramide downregulates Bcl-2 to increase AT406's sensitivity in pancreatic cancer cells. • Liposomal C6 ceramide enhances AT406-induced anti-pancreatic cancer activity in vivo.

The gender differences in the inhibitory action of UVB-induced melanocyte activation by the administration of tranexamic acid.

Science.gov (United States)

Hiramoto, Keiichi; Yamate, Yurika; Sugiyama, Daijiro; Takahashi, Yumi; Mafune, Eiichi

2016-05-01

Tranexamic acid has an inhibitory action on ultraviolet (UV) B-induced melanocyte activation. This study examined the sex differences in the inhibitory action of tranexamic acid on UVB-induced melanocyte activation. We irradiated the eye and ear of male and female mice with UVB at a dose of 1.0 kJ/m(2) using a 20SE sunlamp. We orally administered tranexamic acid (750 mg/kg/day) at 30 min before UVB exposure. Tranexamic acid inhibited the UVB-induced epidermal melanocyte activation, and the effect was more remarkable under UVB eye irradiation than under UVB ear irradiation. Furthermore, the melanocyte activity suppression effect was stronger in female mice than in male mice. Following the administration of tranexamic acid, the female displayed increased blood levels of β-endorphin and μ-opioid receptor and estradiol receptor β expression in comparison with the male. Furthermore, the effect of melanocyte activity suppression in the female mice was decreased by the administration of tamoxifen (antagonist of estrogen receptor) or naltrexone (antagonist of μ-opioid receptor). These results suggest that the suppression by tranexamic acid of the UVB-induced melanocyte activation (UVB sensitivity) is stronger in female mice than in male mice and that female hormones and β-endorphin play an important role in this sex difference. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

RNA polymerase II mediated transcription from the polymerase III promoters in short hairpin RNA expression vector

International Nuclear Information System (INIS)

Rumi, Mohammad; Ishihara, Shunji; Aziz, Monowar; Kazumori, Hideaki; Ishimura, Norihisa; Yuki, Takafumi; Kadota, Chikara; Kadowaki, Yasunori; Kinoshita, Yoshikazu

2006-01-01

RNA polymerase III promoters of human ribonuclease P RNA component H1, human U6, and mouse U6 small nuclear RNA genes are commonly used in short hairpin RNA (shRNA) expression vectors due their precise initiation and termination sites. During transient transfection of shRNA vectors, we observed that H1 or U6 promoters also express longer transcripts enough to express several reporter genes including firefly luciferase, green fluorescent protein EGFP, and red fluorescent protein JRed. Expression of such longer transcripts was augmented by upstream RNA polymerase II enhancers and completely inhibited by downstream polyA signal sequences. Moreover, the transcription of firefly luciferase from human H1 promoter was sensitive to RNA polymerase II inhibitor α-amanitin. Our findings suggest that commonly used polymerase III promoters in shRNA vectors are also prone to RNA polymerase II mediated transcription, which may have negative impacts on their targeted use

Targeting RNA transcription and translation in ovarian cancer cells with pharmacological inhibitor CDKI-73.

Science.gov (United States)

Lam, Frankie; Abbas, Abdullahi Y; Shao, Hao; Teo, Theodosia; Adams, Julian; Li, Peng; Bradshaw, Tracey D; Fischer, Peter M; Walsby, Elisabeth; Pepper, Chris; Chen, Yi; Ding, Jian; Wang, Shudong

2014-09-15

Dysregulation of cellular transcription and translation is a fundamental hallmark of cancer. As CDK9 and Mnks play pivotal roles in the regulation of RNA transcription and protein synthesis, respectively, they are important targets for drug development. We herein report the cellular mechanism of a novel CDK9 inhibitor CDKI-73 in an ovarian cancer cell line (A2780). We also used shRNA-mediated CDK9 knockdown to investigate the importance of CDK9 in the maintenance of A2780 cells. This study revealed that CDKI-73 rapidly inhibited cellular CDK9 kinase activity and down-regulated the RNAPII phosphorylation. This subsequently caused a decrease in the eIF4E phosphorylation by blocking Mnk1 kinase activity. Consistently, CDK9 shRNA was also found to down-regulate the Mnk1 expression. Both CDKI-73 and CDK9 shRNA decreased anti-apoptotic proteins Mcl-1 and Bcl-2 and induced apoptosis. The study confirmed that CDK9 is required for cell survival and that ovarian cancer may be susceptible to CDK9 inhibition strategy. The data also implied a role of CDK9 in eIF4E-mediated translational control, suggesting that CDK9 may have important implication in the Mnk-eIF4E axis, the key determinants of PI3K/Akt/mTOR- and Ras/Raf/MAPK-mediated tumorigenic activity. As such, CDK9 inhibitor drug candidate CDKI-73 should have a major impact on these pathways in human cancers.

Responding to the Challenges of Active Citizenship through the Revised UK Early Years Foundation Stage Curriculum

Science.gov (United States)

Baker, Fiona S.

2013-01-01

The revised UK Early Years Foundation Stage (EYFS) now places a stronger emphasis on personal, social and emotional development (PSED) as one of its three prime areas. PSED has three characteristics of learning: active learning, creating and thinking critically, and playing and exploring. These aspects of the revised EYFS closely align with the…

SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

OpenAIRE

Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

2015-01-01

Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

Characterization of two MODY2 mutations with different susceptibility to activation

Energy Technology Data Exchange (ETDEWEB)

Langer, Sara; Platz, Christian; Waterstradt, Rica; Baltrusch, Simone, E-mail: simone.baltrusch@med.uni-rostock.de

2015-09-04

Glucokinase plays a key role in glucose sensing in pancreatic beta cells and in liver metabolism. Heterozygous inactivating glucokinase mutations cause the autosomal dominantly inherited MODY2 subtype of maturity-onset diabetes of the young. The goal of this study was to elucidate the pathogenicity of the recently described glucokinase mutants L304P and L315H, located in an alpha-helix and connecting region, respectively, at the outer region of the large domain of glucokinase. Both mutants showed wild-type-like cytosolic localization, but faster protein degradation in insulin-secreting MIN6 cells. However, strongly reduced nuclear/cytoplasmic localization of the mutants was observed in primary hepatocytes suggesting reduced interaction with the liver specific glucokinase regulatory protein. Both mutants displayed a significantly lowered glucokinase activity compared to the wild-type protein. Even though the L315H protein showed the lowest enzymatic activity, this mutant was very sensitive to allosteric activation. The endogenous activator fructose-2,6-bisphosphatase evoked an increase in glucokinase activity for both mutants, but much stronger for L315H compared to L304P. The synthetic activator RO281675 was ineffective against the L304P mutant. Expression of the mutant proteins evoked loss of glucose-induced insulin secretion in MIN6 cells. Administration of RO281675 increased insulin secretion, however, only for the L315H mutant. Thus, a glucokinase activator drug therapy may help MODY2 patients not in general, but seems to be a useful strategy for carriers of the L315H glucokinase mutation. - Highlights: • The GK mutants L304P and L315H display a highly reduced enzymatic activity. • In hepatocytes both mutations lower the nuclear/cytoplasmic localization ratio of GK. • Both mutants inhibit stimulus-secretion coupling in insulin-producing cells. • Activation by fructose-2,6-bisphosphatase and by RO281675 is stronger for L315H. • RO281675 stimulates

Identification of NDRG1-regulated genes associated with invasive potential in cervical and ovarian cancer cells

International Nuclear Information System (INIS)

Zhao, Gang; Chen, Jiawei; Deng, Yanqiu; Gao, Feng; Zhu, Jiwei; Feng, Zhenzhong; Lv, Xiuhong; Zhao, Zheng

2011-01-01

Highlights: → NDRG1 was knockdown in cervical and ovarian cancer cell lines by shRNA technology. → NDRG1 knockdown resulted in increased cell invasion activities. → Ninety-six common deregulated genes in both cell lines were identified by cDNA microarray. → Eleven common NDRG1-regulated genes might enhance cell invasive activity. → Regulation of invasion by NDRG1 is an indirect and complicated process. -- Abstract: N-myc downstream regulated gene 1 (NDRG1) is an important gene regulating tumor invasion. In this study, shRNA technology was used to suppress NDRG1 expression in CaSki (a cervical cancer cell line) and HO-8910PM (an ovarian cancer cell line). In vitro assays showed that NDRG1 knockdown enhanced tumor cell adhesion, migration and invasion activities without affecting cell proliferation. cDNA microarray analysis revealed 96 deregulated genes with more than 2-fold changes in both cell lines after NDRG1 knockdown. Ten common upregulated genes (LPXN, DDR2, COL6A1, IL6, IL8, FYN, PTP4A3, PAPPA, ETV5 and CYGB) and one common downregulated gene (CLCA2) were considered to enhance tumor cell invasive activity. BisoGenet network analysis indicated that NDRG1 regulated these invasion effector genes/proteins in an indirect manner. Moreover, NDRG1 knockdown also reduced pro-invasion genes expression such as MMP7, TMPRSS4 and CTSK. These results suggest that regulation of invasion and metastasis by NDRG1 is a highly complicated process.

Relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis.

Science.gov (United States)

Ehrlich-Jones, Linda; Lee, Jungwha; Semanik, Pamela; Cox, Cheryl; Dunlop, Dorothy; Chang, Rowland W

2011-12-01

To determine the relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis (RA). A cross-sectional study used baseline data from 185 adults with RA enrolled in a randomized clinical trial assessing the effectiveness of an intervention to promote physical activity. Data included patients' self-reported beliefs that physical activity can be beneficial for their disease, motivation for physical activity participation, worries about physical activity participation, and average daily accelerometer counts of activity over a week's time. Body mass index (BMI), sex, age, race, and disease activity were measured as potential statistical moderators of physical activity. Physical activity participation was greater for those with higher scores on scales measuring beliefs that physical activity is beneficial for their disease (P for trend = 0.032) and motivation for physical activity participation (P for trend = 0.007) when adjusted for age, sex, BMI, race, and disease activity. There was a positive but nonsignificant trend in physical activity participation in relation to worries. Stronger beliefs that physical activity can be helpful for managing disease and increased motivation to engage in physical activity are related to higher levels of physical activity participation. These data provide a preliminary empirical rationale for why interventions targeting these concepts should lead to improved physical activity participation in adults with RA. Copyright © 2011 by the American College of Rheumatology.

Future role and significance of space activities in reflection of global social, technological and economic trends

Science.gov (United States)

Diekmann, Andreas; Richarz, Hans.-Peter

The paper describes the interrelation of space activities and global socio-economic trends like "globalisation of markets" and "renaissance of fine arts". The interrelation reveals the economic strategic, technological and scientific dimension of space activities and their benefits to mankind. Then, the significance and perspectives of space activities in these dimensions are examined in more detail. The paper calls (1) for a more visible initiative to employ space activities to tackle urgent questions of global change and development, and (2) for a stronger impetus to secure European economic position in space sector as a key industry of the 21st century.

The comparison of antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide (CP) and sulfated CP.

Science.gov (United States)

Liu, Cui; Chen, Jin; Li, Entao; Fan, Qiang; Wang, Deyun; Li, Peng; Li, Xiuping; Chen, Xingying; Qiu, Shulei; Gao, Zhenzhen; Li, Hongquan; Hu, Yuanliang

2015-02-01

Codonopsis pilosula polysaccharide (CP) was extracted, purified and modified by chlorosulfonic acid-pyridine method to obtain a sulfated CP (sCP). Their antioxidative activities in vitro were compared through the free radical-scavenging test. The results demonstrated that the scavenging capabilities of sCP were significantly stronger than those of CP. In vivo test, the mice hepatic injury model was prepared by BCG/LPS method, then administrated respectively with sCP and CP at three dosages, the biochemical indexes in serum, antioxidative indexes in liver homogenate and histopathological change in liver of the mice were compared. The results showed that in high (200mg/kg) and middle (150mg/kg) dosages of sCP groups, the contents of ALT, AST and TNF-α in serum and MDA in liver homogenate were significantly lower than those in the model group and numerically lower than those in the CP groups, the activities of SOD and GSH-Px in liver homogenate were significantly higher than those in the model group and numerically higher than those in the CP groups. In the model group there were obvious pathological changes in the liver, while in the sCP groups were near normal. These results indicate that sCP and CP possess antioxidative activity in vitro and in vivo, the activity of sCP is stronger than that of CP and sulfation modification can enhance the antioxidative and hepatoprotective activities of Codonopsis pilosula polysaccharide. Copyright © 2014 Elsevier B.V. All rights reserved.

Association Between Self-Esteem and Depressive Symptoms Is Stronger Among Black than White Older Adults.

Science.gov (United States)

Assari, Shervin

2017-08-01

Although poor self-esteem is a core component of depression, we still do not know if racial and ethnic groups differ in the magnitude of this link. This study compared Black and White older adults on the association between self-esteem and depressive symptoms. With a cross-sectional design, this study enrolled 1493 older individuals (age 66 or more) from the 2001 Religion, Aging, and Health Survey, a nationally representative study in the United States. Participants were either Blacks (n = 734) or Whites (n = 759). Depressive symptoms and self-esteem were measured using brief measures of the Center for Epidemiological Studies-Depression scale (CES-D) and the Rosenberg Self-Esteem Scale, respectively. Demographics, socioeconomics, and self-rated health (SRH) were covariates and self-identified race was the moderator. Linear regression models were used for data analysis. Low self-esteem was associated with more depressive symptoms (B = 0.17, 95 % CI 0.15-0.28), above and beyond all covariates. We found a significant and positive interaction between race (Black) and poor self-esteem on depressive symptoms (B = 0.34, 95 % CI 0.17-0.36), suggesting a stronger association between self-esteem and depressive symptoms among Blacks compared to Whites. Although low self-esteem is associated with higher depressive symptoms in both Whites and Blacks (p self-esteem and high depressive symptoms are more closely associated among Blacks than Whites. It is not clear whether depression leaves a larger scar on self-esteem for Blacks, or Blacks are more vulnerable to the effect of low self-esteem on depression.

Impact of a physical activity intervention program on cognitive predictors of behaviour among adults at risk of Type 2 diabetes (ProActive randomised controlled trial

Directory of Open Access Journals (Sweden)

Sutton Stephen

2009-03-01

Full Text Available Abstract Background In the ProActive Trial an intensive theory-based intervention program was no more effective than theory-based brief advice in increasing objectively measured physical activity among adults at risk of Type 2 diabetes. We aimed to illuminate these findings by assessing whether the intervention program changed cognitions about increasing activity, defined by the Theory of Planned Behaviour, in ways consistent with the theory. Methods N = 365 sedentary participants aged 30–50 years with a parental history of Type 2 diabetes were randomised to brief advice alone or to brief advice plus the intervention program delivered face-to-face or by telephone. Questionnaires at baseline, 6 and 12 months assessed cognitions about becoming more physically active. Analysis of covariance was used to test intervention impact. Bootstrapping was used to test multiple mediation of intervention impact. Results At 6 months, combined intervention groups (face-to-face and telephone reported that they found increasing activity more enjoyable (affective attitude, d = .25, and they perceived more instrumental benefits (e.g., improving health (d = .23 and more control (d = .32 over increasing activity than participants receiving brief advice alone. Stronger intentions (d = .50 in the intervention groups than the brief advice group at 6 months were partially explained by affective attitude and perceived control. At 12 months, intervention groups perceived more positive instrumental (d = .21 and affective benefits (d = .29 than brief advice participants. The intervention did not change perceived social pressure to increase activity. Conclusion Lack of effect of the intervention program on physical activity over and above brief advice was consistent with limited and mostly small short-term effects on cognitions. Targeting affective benefits (e.g., enjoyment, social interaction and addressing barriers to physical activity may strengthen intentions, but

Relationship of physical activity to fundamental movement skills among adolescents.

Science.gov (United States)

Okely, A D; Booth, M L; Patterson, J W

2001-11-01

To determine the relationship of participation in organized and nonorganized physical activity with fundamental movement skills among adolescents. Male and female children in Grade 8 (mean age, 13.3 yr) and Grade 10 (mean age, 15.3 yr) were assessed on six fundamental movement skills (run, vertical jump, catch, overhand throw, forehand strike, and kick). Physical activity was assessed using a self-report recall measure where students reported the type, duration, and frequency of participation in organized physical activity and nonorganized physical activity during a usual week. Multiple regression analysis indicated that fundamental movement skills significantly predicted time in organized physical activity, although the percentage of variance it could explain was small. This prediction was stronger for girls than for boys. Multiple regression analysis showed no relationship between time in nonorganized physical activity and fundamental movement skills. Fundamental movement skills are significantly associated with adolescents' participation in organized physical activity, but predict only a small portion of it.

Neuronal Orphan G-Protein Coupled Receptor Proteins Mediate Plasmalogens-Induced Activation of ERK and Akt Signaling.

Directory of Open Access Journals (Sweden)

Md Shamim Hossain

Full Text Available The special glycerophospholipids plasmalogens (Pls are enriched in the brain and reported to prevent neuronal cell death by enhancing phosphorylation of Akt and ERK signaling in neuronal cells. Though the activation of Akt and ERK was found to be necessary for the neuronal cells survival, it was not known how Pls enhanced cellular signaling. To answer this question, we searched for neuronal specific orphan GPCR (G-protein coupled receptor proteins, since these proteins were believed to play a role in cellular signal transduction through the lipid rafts, where both Pls and some GPCRs were found to be enriched. In the present study, pan GPCR inhibitor significantly reduced Pls-induced ERK signaling in neuronal cells, suggesting that Pls could activate GPCRs to induce signaling. We then checked mRNA expression of 19 orphan GPCRs and 10 of them were found to be highly expressed in neuronal cells. The knockdown of these 10 neuronal specific GPCRs by short hairpin (sh-RNA lentiviral particles revealed that the Pls-mediated phosphorylation of ERK was inhibited in GPR1, GPR19, GPR21, GPR27 and GPR61 knockdown cells. We further found that the overexpression of these GPCRs enhanced Pls-mediated phosphorylation of ERK and Akt in cells. Most interestingly, the GPCRs-mediated cellular signaling was reduced significantly when the endogenous Pls were reduced. Our cumulative data, for the first time, suggest a possible mechanism for Pls-induced cellular signaling in the nervous system.

Theory of corticothalamic brain activity in a spherical geometry: Spectra, coherence, and correlation

Science.gov (United States)

Mukta, K. N.; MacLaurin, J. N.; Robinson, P. A.

2017-11-01

Corticothalamic neural field theory is applied to a spherical geometry to better model neural activity in the human brain and is also compared with planar approximations. The frequency power spectrum, correlation, and coherence functions are computed analytically and numerically. The effects of cortical boundary conditions and resulting modal aspects of spherical corticothalamic dynamics are explored, showing that the results of spherical and finite planar geometries converge to those for the infinite planar geometry in the limit of large brain size. Estimates are made of the point at which modal series can be truncated and it is found that for physiologically plausible parameters only the lowest few spatial eigenmodes are needed for an accurate representation of macroscopic brain activity. A difference between the geometries is that there is a low-frequency 1 /f spectrum in the infinite planar geometry, whereas in the spherical geometry it is 1 /f2 . Another difference is that the alpha peak in the spherical geometry is sharper and stronger than in the planar geometry. Cortical modal effects can lead to a double alpha peak structure in the power spectrum, although the main determinant of the alpha peak is corticothalamic feedback. In the spherical geometry, the cross spectrum between two points is found to only depend on their relative distance apart. At small spatial separations the low-frequency cross spectrum is stronger than for an infinite planar geometry and the alpha peak is sharper and stronger due to the partitioning of the energy into discrete modes. In the spherical geometry, the coherence function between points decays monotonically as their separation increases at a fixed frequency, but persists further at resonant frequencies. The correlation between two points is found to be positive, regardless of the time lag and spatial separation, but decays monotonically as the separation increases at fixed time lag. At fixed distance the correlation has peaks

ELANE mutant-specific activation of different UPR pathways in congenital neutropenia.

Science.gov (United States)

Nustede, Rainer; Klimiankou, Maksim; Klimenkova, Olga; Kuznetsova, Inna; Zeidler, Cornelia; Welte, Karl; Skokowa, Julia

2016-01-01

A number of studies have demonstrated induction of the unfolded protein response (UPR) in patients with severe congenital neutropenia (CN) harbouring mutations of ELANE, encoding neutrophil elastase. Why UPR is not activated in patients with cyclic neutropenia (CyN) carrying the same ELANE mutations is unclear. We evaluated the effects of ELANE mutants on UPR induction in myeloid cells from CN and CyN patients, and analysed whether additional CN-specific defects contribute to the differences in UPR induction between CN and CyN patients harbouring identical ELANE mutations. We investigated CN-specific p.C71R and p.V174_C181del (NP_001963.1) and CN/CyN-shared p.S126L (NP_001963.1) ELANE mutants. We found that transduction of haematopoietic cells with p.C71R, but not with p.V174_C181del or p.S126L ELANE mutants induced expression of ATF6, and the ATF6 target genes PPP1R15A, DDIT3 and HSPA5. Recently, we found that levels of secretory leucocyte protease inhibitor (SLPI), a natural ELANE inhibitor, are diminished in myeloid cells from CN patients, but not CyN patients. Combined knockdown of SLPI by shRNA and transduction of ELANE p.S126L in myeloid cells led to elevated levels of ATF6, PPP1R15A and HSPA5 RNA, suggesting that normal levels of SLPI in CyN patients might protect them from the UPR induced by mutant ELANE. In summary, different ELANE mutants have different effects on UPR activation, and SLPI regulates the extent of ELANE-triggered UPR. © 2015 John Wiley & Sons Ltd.

Verbal Short-Term Memory Deficits in Chinese Children with Dyslexia may not be a Problem with the Activation of Phonological Representations.

Science.gov (United States)

Zhao, Jing; Yang, Yang; Song, Yao-Wu; Bi, Hong-Yan

2015-11-01

This study explored the underlying mechanism of the verbal short-term memory deficit in Chinese children with developmental dyslexia. Twenty-four children with dyslexia and 28 age-matched normal readers participated in the study. They were required to memorize a visually presented series of six Chinese characters and identify them from a list also including code-specific distracters and non-code-specific distracters. Error rates were recorded and were higher for code-specific distracters in all three conditions, revealing phonological, visual, and semantic similarity effects respectively. Group comparisons showed a stronger phonological similarity effect in dyslexic group, suggesting intact activation of phonological representations of target characters. Children with dyslexia also exhibited a greater semantic similarity effect, revealing stronger activation of semantic representations, while visual similarity effects were equivalent to controls. These results suggest that the verbal short-term memory deficit in Chinese dyslexics might not stem from insufficient activation of phonological information. Based the semantic activation of target characters in dyslexics is greater than in controls, it is possible that the memory deficit of dyslexia is related with deficient inhibition of target semantic representations in short-term memory. Copyright © 2015 John Wiley & Sons, Ltd.

Plasticizers May Activate Human Hepatic Peroxisome Proliferator-Activated Receptor α Less Than That of a Mouse but May Activate Constitutive Androstane Receptor in Liver

Science.gov (United States)

Ito, Yuki; Nakamura, Toshiki; Yanagiba, Yukie; Ramdhan, Doni Hikmat; Yamagishi, Nozomi; Naito, Hisao; Kamijima, Michihiro; Gonzalez, Frank J.; Nakajima, Tamie

2012-01-01

Dibutylphthalate (DBP), di(2-ethylhexyl)phthalate (DEHP), and di(2-ethylhexyl)adipate (DEHA) are used as plasticizers. Their metabolites activate peroxisome proliferator-activated receptor (PPAR) α, which may be related to their toxicities. However, species differences in the receptor functions between rodents and human make it difficult to precisely extrapolate their toxicity from animal studies to human. In this paper, we compared the species differences in the activation of mouse and human hepatic PPARα by these plasticizers using wild-type (mPPARα) and humanized PPARα (hPPARα) mice. At 12 weeks old, each genotyped male mouse was classified into three groups, and fed daily for 2 weeks per os with corn oil (vehicle control), 2.5 or 5.0 mmol/kg DBP (696, 1392 mg/kg), DEHP (977, 1953 mg/kg), and DEHA (926, 1853 mg/kg), respectively. Generally, hepatic PPARα of mPPARα mice was more strongly activated than that of hPPARα mice when several target genes involving β-oxidation of fatty acids were evaluated. Interestingly, all plasticizers also activated hepatic constitutive androstane receptor (CAR) more in hPPARα mice than in mPPARα mice. Taken together, these plasticizers activated mouse and human hepatic PPARα as well as CAR. The activation of PPARα was stronger in mPPARα mice than in hPPARα mice, while the opposite was true of CAR. PMID:22792086

Plasticizers May Activate Human Hepatic Peroxisome Proliferator-Activated Receptor α Less Than That of a Mouse but May Activate Constitutive Androstane Receptor in Liver

Directory of Open Access Journals (Sweden)

Yuki Ito

2012-01-01

Full Text Available Dibutylphthalate (DBP, di(2-ethylhexylphthalate (DEHP, and di(2-ethylhexyladipate (DEHA are used as plasticizers. Their metabolites activate peroxisome proliferator-activated receptor (PPAR α, which may be related to their toxicities. However, species differences in the receptor functions between rodents and human make it difficult to precisely extrapolate their toxicity from animal studies to human. In this paper, we compared the species differences in the activation of mouse and human hepatic PPARα by these plasticizers using wild-type (mPPARα and humanized PPARα (hPPARα mice. At 12 weeks old, each genotyped male mouse was classified into three groups, and fed daily for 2 weeks per os with corn oil (vehicle control, 2.5 or 5.0 mmol/kg DBP (696, 1392 mg/kg, DEHP (977, 1953 mg/kg, and DEHA (926, 1853 mg/kg, respectively. Generally, hepatic PPARα of mPPARα mice was more strongly activated than that of hPPARα mice when several target genes involving β-oxidation of fatty acids were evaluated. Interestingly, all plasticizers also activated hepatic constitutive androstane receptor (CAR more in hPPARα mice than in mPPARα mice. Taken together, these plasticizers activated mouse and human hepatic PPARα as well as CAR. The activation of PPARα was stronger in mPPARα mice than in hPPARα mice, while the opposite was true of CAR.

Nitrogen fertilization has a stronger effect on soil nitrogen-fixing bacterial communities than elevated atmospheric CO2.

Science.gov (United States)

Berthrong, Sean T; Yeager, Chris M; Gallegos-Graves, Laverne; Steven, Blaire; Eichorst, Stephanie A; Jackson, Robert B; Kuske, Cheryl R

2014-05-01

Biological nitrogen fixation is the primary supply of N to most ecosystems, yet there is considerable uncertainty about how N-fixing bacteria will respond to global change factors such as increasing atmospheric CO2 and N deposition. Using the nifH gene as a molecular marker, we studied how the community structure of N-fixing soil bacteria from temperate pine, aspen, and sweet gum stands and a brackish tidal marsh responded to multiyear elevated CO2 conditions. We also examined how N availability, specifically, N fertilization, interacted with elevated CO2 to affect these communities in the temperate pine forest. Based on data from Sanger sequencing and quantitative PCR, the soil nifH composition in the three forest systems was dominated by species in the Geobacteraceae and, to a lesser extent, Alphaproteobacteria. The N-fixing-bacterial-community structure was subtly altered after 10 or more years of elevated atmospheric CO2, and the observed shifts differed in each biome. In the pine forest, N fertilization had a stronger effect on nifH community structure than elevated CO2 and suppressed the diversity and abundance of N-fixing bacteria under elevated atmospheric CO2 conditions. These results indicate that N-fixing bacteria have complex, interacting responses that will be important for understanding ecosystem productivity in a changing climate.

Activating the Wnt/β-Catenin Pathway for the Treatment of Melanoma--Application of LY2090314, a Novel Selective Inhibitor of Glycogen Synthase Kinase-3.

Directory of Open Access Journals (Sweden)

Jennifer M Atkinson

Full Text Available It has previously been observed that a loss of β-catenin expression occurs with melanoma progression and that nuclear β-catenin levels are inversely proportional to cellular proliferation, suggesting that activation of the Wnt/β-catenin pathway may provide benefit for melanoma patients. In order to further probe this concept we tested LY2090314, a potent and selective small-molecule inhibitor with activity against GSK3α and GSK3β isoforms. In a panel of melanoma cell lines, nM concentrations of LY2090314 stimulated TCF/LEF TOPFlash reporter activity, stabilized β-catenin and elevated the expression of Axin2, a Wnt responsive gene and marker of pathway activation. Cytotoxicity assays revealed that melanoma cell lines are very sensitive to LY2090314 in vitro (IC50 ~10 nM after 72hr of treatment in contrast to other solid tumor cell lines (IC50 >10 uM as evidenced by caspase activation and PARP cleavage. Cell lines harboring mutant B-RAF or N-RAS were equally sensitive to LY2090314 as were those with acquired resistance to the BRAF inhibitor Vemurafenib. shRNA studies demonstrated that β-catenin stabilization is required for apoptosis following treatment with the GSK3 inhibitor since the sensitivity of melanoma cell lines to LY290314 could be overcome by β-catenin knockdown. We further demonstrate that in vivo, LY2090314 elevates Axin2 gene expression after a single dose and produces tumor growth delay in A375 melanoma xenografts with repeat dosing. The activity of LY2090314 in preclinical models suggests that the role of Wnt activators for the treatment of melanoma should be further explored.

Population activity structure of excitatory and inhibitory neurons.

Science.gov (United States)

Bittner, Sean R; Williamson, Ryan C; Snyder, Adam C; Litwin-Kumar, Ashok; Doiron, Brent; Chase, Steven M; Smith, Matthew A; Yu, Byron M

2017-01-01

Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

Population activity structure of excitatory and inhibitory neurons.

Directory of Open Access Journals (Sweden)

Sean R Bittner

Full Text Available Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

Population activity structure of excitatory and inhibitory neurons

Science.gov (United States)

Doiron, Brent

2017-01-01

Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure. PMID:28817581

Esterase activities of intracellular extracts of wild strains of lactic acid bacteria isolated from Serra da Estrela cheese

OpenAIRE

Macedo, Angela C.; Tavares, Tânia G.; Malcata, F. Xavier

2003-01-01

Lactococcus lactis subsp. lactis strain ESB110019 and Lactobacillus plantarum strain ESB5004, novel strains that were previously isolated from the wild adventitious microflora of certified Serra da Estrela cheeses, were assayed for esterase activity using, as substrates, ortho- and para-nitrophenyl derivatives of fatty acids. Both strains preferentially hydrolyzed short-chain fatty acids; L. lactis ESB110019 exhibited a stronger esterase activity than Lb. plantarum ESB5004 and cleaved the p-n...

Chemical composition, antioxidative and anti-inflammatory activity of extracts prepared from aerial parts of Oenothera biennis L. and Oenothera paradoxa Hudziok obtained after seeds cultivation.

Science.gov (United States)

Granica, Sebastian; Czerwińska, Monika E; Piwowarski, Jakub P; Ziaja, Maria; Kiss, Anna K

2013-01-30

In the present study we investigated the chemical composition of extracts prepared from aerial parts of Oenothera paradoxa Hudziok and Oenothera biennis L. and their antioxidative and anti-inflammatory activities. Ultra high pressure liquid chromatography (UHPLC)-DAD-MS/MS studies showed that both extracts contain a wide variety of polyphenols (39 identified constituents) among which macrocyclic ellagitannin turned out to be the main constituent. During the in vitro studies, using noncellular models, both extracts scavenged reactive oxygen species (ROS) in a concentration-dependent manner, and the lowest SC(50) values were obtained for O(2)(-) and H(2)O(2). Both extracts inhibited ROS production by stimulated human neutrophils. The stronger activity in the case of formyl-met-leu-phenylalanine stimulation suggests that both extracts may act through the receptor-dependent pathway. O. paradoxa extract and O. biennis extract exhibited anti-inflammatory activity by the inhibition of hyaluronidase and lipoxygenase in a concentration-dependent manner. The stronger activity of O.biennis extract toward lipoxygenase may be explained by its higher oenothein B content.

Oncogenic S1P signalling in EBV-associated nasopharyngeal carcinoma activates AKT and promotes cell migration through S1P receptor 3.

Science.gov (United States)

Lee, Hui Min; Lo, Kwok-Wai; Wei, Wenbin; Tsao, Sai Wah; Chung, Grace Tin Yun; Ibrahim, Maha Hafez; Dawson, Christopher W; Murray, Paul G; Paterson, Ian C; Yap, Lee Fah

2017-05-01

Undifferentiated nasopharyngeal carcinoma (NPC) is a cancer with high metastatic potential that is consistently associated with Epstein-Barr virus (EBV) infection. In this study, we have investigated the functional contribution of sphingosine-1-phosphate (S1P) signalling to the pathogenesis of NPC. We show that EBV infection or ectopic expression of the EBV-encoded latent genes (EBNA1, LMP1, and LMP2A) can up-regulate sphingosine kinase 1 (SPHK1), the key enzyme that produces S1P, in NPC cell lines. Exogenous addition of S1P promotes the migration of NPC cells through the activation of AKT; shRNA knockdown of SPHK1 resulted in a reduction in the levels of activated AKT and inhibition of cell migration. We also show that S1P receptor 3 (S1PR3) mRNA is overexpressed in EBV-positive NPC patient-derived xenografts and a subset of primary NPC tissues, and that knockdown of S1PR3 suppressed the activation of AKT and the S1P-induced migration of NPC cells. Taken together, our data point to a central role for EBV in mediating the oncogenic effects of S1P in NPC and identify S1P signalling as a potential therapeutic target in this disease. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Identification of Chloride Channels CLCN3 and CLCN5 Mediating the Excitatory Cl− Currents Activated by Sphingosine-1-Phosphate in Sensory Neurons

Science.gov (United States)

Qi, Yanmei; Mair, Norbert; Kummer, Kai K.; Leitner, Michael G.; Camprubí-Robles, María; Langeslag, Michiel; Kress, Michaela

2018-01-01

Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception. PMID:29479306

Identification of Chloride Channels CLCN3 and CLCN5 Mediating the Excitatory Cl− Currents Activated by Sphingosine-1-Phosphate in Sensory Neurons

Directory of Open Access Journals (Sweden)

Yanmei Qi

2018-02-01

Full Text Available Sphingosine-1-phosphate (S1P is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception.

TRPP2 and TRPV4 form an EGF-activated calcium permeable channel at the apical membrane of renal collecting duct cells.

Directory of Open Access Journals (Sweden)

Zhi-Ren Zhang

Full Text Available Regulation of apical calcium entry is important for the function of principal cells of the collecting duct. However, the molecular identity and the regulators of the transporter/channel, which is responsible for apical calcium entry and what factors regulate the calcium conduction remain unclear.We report that endogenous TRPP2 and TRPV4 assemble to form a 23-pS divalent cation-permeable non-selective ion channel at the apical membrane of renal principal cells of the collecting duct. TRPP2\\TRPV4 channel complex was identified by patch-clamp, immunofluorescence and co-immunprecipitation studies in both principal cells that either possess normal cilia (cilia (+ or in which cilia are absent (cilia (-. This channel has distinct biophysical and pharmacological and regulatory profiles compared to either TRPP2 or TRPV4 channels. The rate of occurrence detected by patch clamp was higher in cilia (- compared to cilia (+ cells. In addition, shRNA knockdown of TRPP2 increased the prevalence of TRPV4 channel activity while knockdown of TRPV4 resulted in TRPP2 activity and knockdown of both proteins vastly decreased the 23-pS channel activity. Epidermal growth factor (EGF stimulated TRPP2\\TRPV4 channel through the EGF receptor (EGFR tyrosine kinase-dependent signaling. With loss of cilia, apical EGF treatment resulted in 64-fold increase in channel activity in cilia (- but not cilia (+ cells. In addition EGF increased cell proliferation in cilia (- cell that was dependent upon TRPP2\\TRPV4 channel mediated increase in intracellular calcium.We conclude that in the absence of cilia, an EGF activated TRPP2\\TRPV4 channel may play an important role in increased cell proliferation and cystogenesis.

Parkinson-related changes of activation in visuomotor brain regions during perceived forward self-motion.

Directory of Open Access Journals (Sweden)

Anouk van der Hoorn

Full Text Available Radial expanding optic flow is a visual consequence of forward locomotion. Presented on screen, it generates illusionary forward self-motion, pointing at a close vision-gait interrelation. As particularly parkinsonian gait is vulnerable to external stimuli, effects of optic flow on motor-related cerebral circuitry were explored with functional magnetic resonance imaging in healthy controls (HC and patients with Parkinson's disease (PD. Fifteen HC and 22 PD patients, of which 7 experienced freezing of gait (FOG, watched wide-field flow, interruptions by narrowing or deceleration and equivalent control conditions with static dots. Statistical parametric mapping revealed that wide-field flow interruption evoked activation of the (pre-supplementary motor area (SMA in HC, which was decreased in PD. During wide-field flow, dorsal occipito-parietal activations were reduced in PD relative to HC, with stronger functional connectivity between right visual motion area V5, pre-SMA and cerebellum (in PD without FOG. Non-specific 'changes' in stimulus patterns activated dorsolateral fronto-parietal regions and the fusiform gyrus. This attention-associated network was stronger activated in HC than in PD. PD patients thus appeared compromised in recruiting medial frontal regions facilitating internally generated virtual locomotion when visual motion support falls away. Reduced dorsal visual and parietal activations during wide-field optic flow in PD were explained by impaired feedforward visual and visuomotor processing within a magnocellular (visual motion functional chain. Compensation of impaired feedforward processing by distant fronto-cerebellar circuitry in PD is consistent with motor responses to visual motion stimuli being either too strong or too weak. The 'change'-related activations pointed at covert (stimulus-driven attention.

Plant Identity Exerts Stronger Effect than Fertilization on Soil Arbuscular Mycorrhizal Fungi in a Sown Pasture.

Science.gov (United States)

Zheng, Yong; Chen, Liang; Luo, Cai-Yun; Zhang, Zhen-Hua; Wang, Shi-Ping; Guo, Liang-Dong

2016-10-01

Arbuscular mycorrhizal (AM) fungi play key roles in plant nutrition and plant productivity. AM fungal responses to either plant identity or fertilization have been investigated. However, the interactive effects of different plant species and fertilizer types on these symbiotic fungi remain poorly understood. We evaluated the effects of the factorial combinations of plant identity (grasses Avena sativa and Elymus nutans and legume Vicia sativa) and fertilization (urea and sheep manure) on AM fungi following 2-year monocultures in a sown pasture field study. AM fungal extraradical hyphal density was significantly higher in E. nutans than that in A. sativa and V. sativa in the unfertilized control and was significantly increased by urea and manure in A. sativa and by manure only in E. nutans, but not by either fertilizers in V. sativa. AM fungal spore density was not significantly affected by plant identity or fertilization. Forty-eight operational taxonomic units (OTUs) of AM fungi were obtained through 454 pyrosequencing of 18S rDNA. The OTU richness and Shannon diversity index of AM fungi were significantly higher in E. nutans than those in V. sativa and/or A. sativa, but not significantly affected by any fertilizer in all of the three plant species. AM fungal community composition was significantly structured directly by plant identity only and indirectly by both urea addition and plant identity through soil total nitrogen content. Our findings highlight that plant identity has stronger influence than fertilization on belowground AM fungal community in this converted pastureland from an alpine meadow.

ERK1/2 signaling plays an important role in topoisomerase II poison-induced G2/M checkpoint activation.

Science.gov (United States)

Kolb, Ryan H; Greer, Patrick M; Cao, Phu T; Cowan, Kenneth H; Yan, Ying

2012-01-01

Topo II poisons, which target topoisomerase II (topo II) to generate enzyme mediated DNA damage, have been commonly used for anti-cancer treatment. While clinical evidence demonstrate a capability of topo II poisons in inducing apoptosis in cancer cells, accumulating evidence also show that topo II poison treatment frequently results in cell cycle arrest in cancer cells, which was associated with subsequent resistance to these treatments. Results in this report indicate that treatment of MCF-7 and T47D breast cancer cells with topo II poisons resulted in an increased phosphorylation of extracellular signal-regulated kinase 1 and 2 (ERK1/2) and an subsequent induction of G2/M cell cycle arrest. Furthermore, inhibition of ERK1/2 activation using specific inhibitors markedly attenuated the topo II poison-induced G2/M arrest and diminished the topo II poison-induced activation of ATR and Chk1 kinases. Moreover, decreased expression of ATR by specific shRNA diminished topo II poison-induced G2/M arrest but had no effect on topo II poison-induced ERK1/2 activation. In contrast, inhibition of ERK1/2 signaling had little, if any, effect on topo II poison-induced ATM activation. In addition, ATM inhibition by either incubation of cells with ATM specific inhibitor or transfection of cells with ATM specific siRNA did not block topo II poison-induced G2/M arrest. Ultimately, inhibition of ERK1/2 signaling greatly enhanced topo II poison-induced apoptosis. These results implicate a critical role for ERK1/2 signaling in the activation of G2/M checkpoint response following topo II poison treatment, which protects cells from topo II poison-induced apoptosis.

Resveratrol induces growth arrest and apoptosis through activation of FOXO transcription factors in prostate cancer cells.

Directory of Open Access Journals (Sweden)

Qinghe Chen

2010-12-01

Full Text Available Resveratrol, a naturally occurring phytopolyphenol compound, has attracted extensive interest in recent years because of its diverse pharmacological characteristics. Although resveratrol possesses chemopreventive properties against several cancers, the molecular mechanisms by which it inhibits cell growth and induces apoptosis have not been clearly understood. The present study was carried out to examine whether PI3K/AKT/FOXO pathway mediates the biological effects of resveratrol.Resveratrol inhibited the phosphorylation of PI3K, AKT and mTOR. Resveratrol, PI3K inhibitors (LY294002 and Wortmannin and AKT inhibitor alone slightly induced apoptosis in LNCaP cells. These inhibitors further enhanced the apoptosis-inducing potential of resveratrol. Overexpression of wild-type PTEN slightly induced apoptosis. Wild type PTEN and PTEN-G129E enhanced resveratrol-induced apoptosis, whereas PTEN-G129R had no effect on proapoptotic effects of resveratrol. Furthermore, apoptosis-inducing potential of resveratrol was enhanced by dominant negative AKT, and inhibited by wild-type AKT and constitutively active AKT. Resveratrol has no effect on the expression of FKHR, FKHRL1 and AFX genes. The inhibition of FOXO phosphorylation by resveratrol resulted in its nuclear translocation, DNA binding and transcriptional activity. The inhibition of PI3K/AKT pathway induced FOXO transcriptional activity resulting in induction of Bim, TRAIL, p27/KIP1, DR4 and DR5, and inhibition of cyclin D1. Similarly, resveratrol-induced FOXO transcriptional activity was further enhanced when activation of PI3K/AKT pathway was blocked. Over-expression of phosphorylation deficient mutants of FOXO proteins (FOXO1-TM, FOXO3A-TM and FOXO4-TM induced FOXO transcriptional activity, which was further enhanced by resveratrol. Inhibition of FOXO transcription factors by shRNA blocked resveratrol-induced upregulation of Bim, TRAIL, DR4, DR5, p27/KIP1 and apoptosis, and inhibition of cyclin D1 by

Habit strength is predicted by activity dynamics in goal-directed brain systems during training.

Science.gov (United States)

Zwosta, Katharina; Ruge, Hannes; Goschke, Thomas; Wolfensteller, Uta

2018-01-15

Previous neuroscientific research revealed insights into the brain networks supporting goal-directed and habitual behavior, respectively. However, it remains unclear how these contribute to inter-individual differences in habit strength which is relevant for understanding not only normal behavior but also more severe dysregulations between these types of action control, such as in addiction. In the present fMRI study, we trained subjects on approach and avoidance behavior for an extended period of time before testing the habit strength of the acquired stimulus-response associations. We found that stronger habits were associated with a stronger decrease in inferior parietal lobule activity for approach and avoidance behavior and weaker vmPFC activity at the end of training for avoidance behavior, areas associated with the anticipation of outcome identity and value. VmPFC in particular showed markedly different activity dynamics during the training of approach and avoidance behavior. Furthermore, while ongoing training was accompanied by increasing functional connectivity between posterior putamen and premotor cortex, consistent with previous assumptions about the neural basis of increasing habitualization, this was not predictive of later habit strength. Together, our findings suggest that inter-individual differences in habitual behavior are driven by differences in the persistent involvement of brain areas supporting goal-directed behavior during training. Copyright © 2017. Published by Elsevier Inc.

Controlling radioactive sources. Stronger 'cradle-to-grave' security needed, IAEA says

International Nuclear Information System (INIS)

2002-01-01

This article highlights the IAEA activities in the field of radiation safety and security of radiation sources and other radioactive materials in its Member States. The IAEA has been active in lending its expertise to search out and secure orphaned sources in several countries. Additionally more than 70 States have joined with the IAEA to collect and share information on trafficking incidents and other unauthorized movements of radioactive sources and other radioactive materials. In March 2002 the IAEA Board of Governors approved a multi-faceted Action plan to Combat Nuclear Terrorism that includes upgrading radiation safety and security. One programme is designed to ensure that significant, uncontrolled radioactive sources are brought under regulatory control and properly secured by providing assistance to Member States in their efforts to identify, locate and secure or dispose of orphan sources

Faster-higher-stronger -- greener

International Nuclear Information System (INIS)

Burgess, A.

2000-01-01

The Toronto Olympic Bid Committee is reported to have adopted a strong environmental orientation in its bid to bring the 2008 Olympic Games to Toronto. In a recent address, the President of the Committee outlined details of the bid's environmental component which emphasizes the role of sustainable development within the Olympics and the consequences of this orientation on the design, construction and operation of facilities. The Toronto Bid Committee has gained inspiration and momentum for its 'green bid' from the host city of the 2000 Olympic Games, Sidney, Australia, which has won widespread praise for its efforts to clean up Homebush Bay, a brownfield site long seen as a liability for the city. The Toronto Bid Committee is making itself accountable for: creating the healthiest possible conditions for the athletes, visitors and residents; designing for sustainability; protecting, restoring and enhancing human and natural habitats; conserving resources and minimizing the ecological impact of the Games; promoting innovative, technically proven Canadian environmental technology; and fostering environmental awareness and education. The Committee intends to make the environment a priority and not just an afterthought in the bidding process. It hopes to develop specific goals and where possible, quantifiable targets in non-polluting designs for all Olympic housing and sports facilities. Wherever possible renewable power such as wind, solar and fuel cells will be used, and cleaner fuels such as natural gas where green power is not a viable option

Bioactive leptin is stronger related to parameters of fat mass and distribution than conventionally measured leptin: Findings from a longitudinal study in obese children participating in a lifestyle intervention.

Science.gov (United States)

Niklowitz, Petra; Rothermel, Juliane; Lass, Nina; Barth, Andre; Reinehr, Thomas

2018-05-01

This study analyzed the relationships between bioactive leptin, conventionally measured leptin, and parameters of fat mass and distribution in obese children before and after weight reduction. We determined bioactive leptin (bioLep), conventional measured leptin (conLep), weight, height, body fat based on skinfold measurements and bioimpedance analyses, waist circumference (wc), and pubertal stage in 88 obese children participating in a lifestyle intervention at baseline and one year later. We identified no child with homozygous or heterozygous status for bioinactive leptin mutations. The baseline associations between bioLep and BMI (r = 0.53), BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.61, skinfold thickness: r = 0.49), wc (r = 0.42), and waist to height ratio (whr) (r = 0.39) were stronger than the associations between conLep and BMI (r = 0.50), BMI-SDS (r = 0.44), body fat (bioimpedance: r = 0.57, skinfold thickness: r = 0.41), wc (r = 0.41), and whr (r = 0.37). The changes of bioLep were stronger related to changes of BMI-SDS (r = 0.54), body fat (bioimpedance r = 0.59, skinfold thickness: r = 0.37), wc (r = 0.22), and whr (r = 0.21) than the associations between changes of conLep and changes of BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.56, skinfold thickness: r = 0.43), wc (r = 0.20), and whr (r = 0.20). The same findings were observed in multiple linear regression analyses adjusted to multiple confounders. In contrast to changes of conLep (r = 0.22), the changes of bioLep during intervention were not related to weight regain after the end of intervention. BioLep concentrations did not differ between prepubertal girls and boys, but were higher in pubertal girls compared to pubertal boys (p = 0.031). Bioactive leptin was stronger related to fat mass and distribution compared to conventionally measured leptin. Copyright © 2018 Elsevier B.V. All rights

Slow Activity in Focal Epilepsy During Sleep and Wakefulness

DEFF Research Database (Denmark)

Pellegrino, Giovanni; Tombini, Mario; Curcio, Giuseppe

2017-01-01

Introduction We aimed to test differences between healthy subjects and patients with respect to slow wave activity during wakefulness and sleep. Methods Fifteen patients affected by nonlesional focal epilepsy originating within temporal areas and fourteen matched controls underwent a 24-hour EEG....... The effect was widespread for alpha band and above, while localized over the affected hemisphere for delta (sleep cycle 1, P = .006; sleep cycle 2, P = .008; sleep cycle 3, P = .017). The analysis of interhemispheric differences showed that the only frequency band stronger over the affected regions...

New amides from seeds of Silybum marianum with potential antioxidant and antidiabetic activities.

Science.gov (United States)

Qin, Ning-Bo; Jia, Cui-Cui; Xu, Jun; Li, Da-Hong; Xu, Fan-Xing; Bai, Jiao; Li, Zhan-Lin; Hua, Hui-Ming

2017-06-01

Two new amide compounds, mariamides A and B (1-2), were obtained together with fourteen known compounds from the seeds of milk thistle (Silybum marianum). Their structures were established on the basis of extensive 1D and 2D NMR analyses, as well as HR-ESI-MS data. Most of the compounds showed significant antioxidant activities than positive control in ABTS and FRAP assays. However, only amide compounds 1-4 showed moderate DPPH radical scavenging activity and compounds 7 and 16 showed the most potent activity against DPPH. Most of the compounds showed moderate to stronger α-glucosidase inhibitory activities. Nevertheless, only flavonoids showed strong PTP1B inhibitory activities. These results indicate a use of milk thistle seed extracts as promising antioxidant and antidiabetic agents. Copyright © 2017 Elsevier B.V. All rights reserved.

Down-regulation of human endogenous retrovirus type K (HERV-K) viral env RNA in pancreatic cancer cells decreases cell proliferation and tumor growth

Science.gov (United States)

Li, Ming; Radvanyi, Laszlo; Yin, Bingnan; Li, Jia; Chivukula, Raghavender; Lin, Kevin; Lu, Yue; Shen, JianJun; Chang, David Z.; Li, Donghui; Johanning, Gary L.; Wang-Johanning, Feng

2017-01-01

Purpose We investigated the role of the human endogenous retrovirus type K (HERV-K) envelope (env) gene in pancreatic cancer (PC). Experimental Design shRNA was employed to knockdown (KD) the expression of HERV-K in PC cells. Results HERV-K env expression was detected in seven PC cell lines and in 80% of PC patient biopsies, but not in two normal pancreatic cell lines or uninvolved normal tissues. A new HERV-K splice variant was discovered in several PC cell lines. RT activity and virus-like particles were observed in culture media supernatant obtained from Panc-1 and Panc-2 cells. HERV-K viral RNA levels and anti-HERV-K antibody titers were significantly higher in PC patient sera (N=106) than in normal donor sera (N=40). Importantly, the in vitro and in vivo growth rates of three PC cell lines were significantly reduced after HERV-K KD by shRNA targeting HERV-K env, and there was reduced metastasis to lung after treatment. RNA-seq results revealed changes in gene expression after HERV-K env KD, including RAS and TP53. Furthermore, downregulation of HERV-K Env protein expression by shRNA also resulted in decreased expression of RAS, p-ERK, p-RSK, and p-AKT in several PC cells or tumors. Conclusion These results demonstrate that HERV-K influences signal transduction via the RAS-ERK-RSK pathway in PC. Our data highlight the potentially important role of HERV-K in tumorigenesis and progression of PC, and indicate that HERV-K viral proteins may be attractive biomarkers and/or tumor-associated antigens, as well as potentially useful targets for detection, diagnosis and immunotherapy of PC. PMID:28679769

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

International Nuclear Information System (INIS)

Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

2010-01-01

Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis.

Science.gov (United States)

Uygur, Berna; Wu, Wen-Shu

2011-11-10

SLUG is a zinc-finger transcription factor of the Snail/Slug zinc-finger family that plays a role in migration and invasion of tumor cells. Mechanisms by which SLUG promotes migration and invasion in prostate cancers remain elusive. Expression level of CXCR4 and CXCL12 was examined by Western blot, RT-PCR, and qPCR analyses. Forced expression of SLUG was mediated by retroviruses, and SLUG and CXCL12 was downregulated by shRNAs-expressing lentiviruses. Migration and invasion of prostate cancer were measured by scratch-wound assay and invasion assay, respectively. We demonstrated that forced expression of SLUG elevated CXCR4 and CXCL12 expression in human prostate cancer cell lines PC3, DU145, 22RV1, and LNCaP; conversely, reduced expression of SLUG by shRNA downregulated CXCR4 and CXCL12 expression at RNA and protein levels in prostate cancer cells. Furthermore, ectopic expression of SLUG increased MMP9 expression and activity in PC3, 22RV1, and DU-145 cells, and SLUG knockdown by shRNA downregulated MMP9 expression. We showed that CXCL12 is required for SLUG-mediated MMP9 expression in prostate cancer cells. Moreover, we found that migration and invasion of prostate cancer cells was increased by ectopic expression of SLUG and decreased by SLUG knockdown. Notably, knockdown of CXCL12 by shRNA impaired SLUG-mediated migration and invasion in prostate cancer cells. Lastly, our data suggest that CXCL12 and SLUG regulate migration and invasion of prostate cancer cells independent of cell growth. We provide the first compelling evidence that upregulation of autocrine CXCL12 is a major mechanism underlying SLUG-mediated migration and invasion of prostate cancer cells. Our findings suggest that CXCL12 is a therapeutic target for prostate cancer metastasis.

R-spondin3-LGR4 signaling protects hepatocytes against DMOG-induced hypoxia/reoxygenation injury through activating β-catenin.

Science.gov (United States)

Liu, Shiying; Yin, Yue; Yu, Ruili; Li, Yin; Zhang, Weizhen

2018-04-30

Leucine-rich repeat G-protein-coupled receptor 4 (LGR4) and its ligands R-spondin1-4 (Rspos) have been vastly investigated in embryonic development. The biological functions of Rspos-LGR4 system in liver remains largely unknown. Here, we explored whether it protects hepatocytes against hypoxia/reoxygenation (H/R) induced damage. H/R injury was induced by dimethyloxalylglycine (DMOG) in AML12 cells and the effects of Rspo3 on cell proliferation and apoptosis were assessed. Specific shRNAs were used to interfere LGR4 or β-catenin. DMOG caused hepatocytes damage evidenced by increase in HIF-1α, cell death and apoptosis genes p27 and Bax, with concurrent decrease of cell proliferation genes PCNA and CyclinD1. Of all the Rspos, Rspo3 is predominantly expressed in AML12 hepatocytes. Importantly, Rspo3 demonstrated an alteration in a manner similar to proliferation-related genes during H/R injury. Rspo3 pretreatment rendered hepatocytes less vulnerable to DMOG induced H/R injury. Ablation of LGR4 using shRNA attenuated the protective effects of Rspo3. Wnt3a also protected AML12 cells from damages caused by H/R, showing enhanced proliferation activity. Notably, knockdown of β-catenin in hepatocytes completely abolished the effect of Rspo3 pretreatment on the expression levels of PCNA and CyclinD1. Rspo3-LGR4 axis protects hepatocytes from H/R injury via activating β-catenin. Copyright © 2018. Published by Elsevier Inc.

Longitudinal examination of social and environmental influences on motivation for physical activity.

Science.gov (United States)

Richards, Elizabeth A; McDonough, Meghan; Fu, Rong

2017-10-01

Physical activity behavior is influenced by numerous factors including motivation, social interactions, and the walkability of the environment. To examine how social contexts and environmental features affect physical activity motivational processes across time. Participants (N=104) completed 3 monthly online surveys assessing self-determination theory constructs, social partners in physical activity, neighborhood walkability, and weekly physical activity. Longitudinal path analysis examined the degree to which physical activity was predicted by individual goals, orientation, and autonomy support and whether these associations were meditated by motivation and moderated by the social and environmental contexts of physical activity. The effect of controlled exercise orientations on physical activity was mediated by autonomous motivation. This association was stronger among those who perceived less crime in their neighborhoods. To improve the ability to tailor physical activity counseling it is important to understand how each person views exercise situations and to understand his/her social and neighborhood environments. Copyright © 2017 Elsevier Inc. All rights reserved.

DNA-binding activity of TNF-α inducing protein from Helicobacter pylori

International Nuclear Information System (INIS)

Kuzuhara, T.; Suganuma, M.; Oka, K.; Fujiki, H.

2007-01-01

Tumor necrosis factor-α (TNF-α) inducing protein (Tipα) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-α and chemokine genes and activation of nuclear factor-κB. Since Tipα enters gastric cancer cells, the Tipα binding molecules in the cells should be investigated. The direct DNA-binding activity of Tipα was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tipα and DNA, revealed that the affinity of Tipα for (dGdC)10 is 2400 times stronger than that of del-Tipα, an inactive Tipα. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tipα. And the DNA-binding activity of Tipα was first demonstrated with a molecule secreted from H. pylori

CLDN6 promotes chemoresistance through GSTP1 in human breast cancer

Directory of Open Access Journals (Sweden)

Minlan Yang

2017-11-01

Full Text Available Abstract Background Claudin-6 (CLDN6, a member of CLDN family and a key component of tight junction, has been reported to function as a tumor suppressor in breast cancer. However, whether CLDN6 plays any role in breast cancer chemoresistance remains unclear. In this study, we investigated the role of CLDN6 in the acquisition of chemoresistance in breast cancer cells. Methods We manipulated the expression of CLDN6 in MCF-7 and MCF-7/MDR cells with lv-CLDN6 and CLDN6-shRNA and investigated whether CLDN6 manipulation lead to different susceptibilities to several chemotherapeutic agents in these cells. The cytotoxicity of adriamycin (ADM, 5-fluorouracil (5-FU, and cisplatin (DDP was tested by cck-8 assay. Cell death was determined by DAPI nuclear staining. The enzyme activity of glutanthione S-transferase-p1 (GSTP1 was detected by a GST activity kit. Then lv-GSTP1 and GSTP1-shRNA plasmids were constructed to investigate the potential of GSTP1 in regulating chemoresistance of breast cancer. The TP53-shRNA was adopted to explore the regulation mechanism of GSTP1. Finally, immunohistochemistry was used to explore the relationship between CLDN6 and GSTP1 expression in breast cancer tissues. Results Silencing CLDN6 increased the cytotoxicity of ADM, 5-FU, and DDP in MCF-7/MDR cells. Whereas overexpression of CLDN6 in MCF-7, the parental cell line of MCF-7/MDR expressing low level of CLDN6, increased the resistance to the above drugs. GSTP1 was upregulated in CLDN6-overexpressed MCF-7 cells. RNAi –mediated silencing of CLDN6 downregulated both GSTP1 expression and GST enzyme activity in MCF-7/MDR cells. Overexpresssion of GSTP1 in CLDN6 silenced MCF-7/MDR cells restored chemoresistance, whereas silencing GSTP1 reduced the chemoresistance due to ectopic overexpressed of CLDN6 in MCF-7 cells. These observations were also repeated in TNBC cells Hs578t. We further confirmed that CLDN6 interacted with p53 and promoted translocation of p53 from nucleus to

CD166/ALCAM expression is characteristic of tumorigenicity and invasive and migratory activities of pancreatic cancer cells.

Directory of Open Access Journals (Sweden)

Kenji Fujiwara

Full Text Available CD166, also known as activated leukocyte cell adhesion molecule (ALCAM, is expressed by various cells in several tissues including cancer. However, the role of CD166 in malignant tumors is controversial, especially in pancreatic cancer. This study aimed to clarify the role and significance of CD166 expression in pancreatic cancer.We performed immunohistochemistry and flow cytometry to analyze the expression of CD166 in surgical pancreatic tissues and pancreatic cancer cell lines. The differences between isolated CD166+ and CD166- pancreatic cancer cells were analyzed by invasion and migration assays, and in mouse xenograft models. We also performed quantitative RT-PCR and microarray analyses to evaluate the expression levels of CD166 and related genes in cultured cells.Immunohistochemistry revealed high expression of CD166 in pancreatic cancer tissues (12.2%; 12/98 compared with that in normal pancreas controls (0%; 0/17 (p = 0.0435. Flow cytometry indicated that CD166 was expressed in 33.8-70.2% of cells in surgical pancreatic tissues and 0-99.5% of pancreatic cancer cell lines. Invasion and migration assays demonstrated that CD166- pancreatic cancer cells showed stronger invasive and migratory activities than those of CD166+ cancer cells (p<0.05. On the other hand, CD166+ Panc-1 cells showed a significantly stronger colony formation activity than that of CD166- Panc-1 cells (p<0.05. In vivo analysis revealed that CD166+ cells elicited significantly greater tumor growth than that of CD166- cells (p<0.05 in both subcutaneous and orthotopic mouse tumor models. mRNA expression of the epithelial-mesenchymal transition activator Zeb1 was over-expressed in CD166- cells (p<0.001. Microarray analysis showed that TSPAN8 and BST2 were over-expressed in CD166+ cells, while BMP7 and Col6A1 were over-expressed in CD166- cells.CD166+ pancreatic cancer cells are strongly tumorigenic, while CD166- pancreatic cancer cells exhibit comparatively stronger

Interleukin-6-driven progranulin expression increases cholangiocarcinoma growth by an Akt-dependent mechanism.

Science.gov (United States)

Frampton, Gabriel; Invernizzi, Pietro; Bernuzzi, Francesca; Pae, Hae Yong; Quinn, Matthew; Horvat, Darijana; Galindo, Cheryl; Huang, Li; McMillin, Matthew; Cooper, Brandon; Rimassa, Lorenza; DeMorrow, Sharon

2012-02-01

Cholangiocarcinoma is a devastating cancer of biliary origin with limited treatment options. The growth factor, progranulin, is overexpressed in a number of tumours. The study aims were to assess the expression of progranulin in cholangiocarcinoma and to determine its effects on tumour growth. The expression and secretion of progranulin were evaluated in multiple cholangiocarcinoma cell lines and in clinical samples from patients with cholangiocarcinoma. The role of interleukin 6 (IL-6)-mediated signalling in the expression of progranulin was assessed using a combination of specific inhibitors and shRNA knockdown techniques. The effect of progranulin on proliferation and Akt activation and subsequent effects of FOXO1 phosphorylation were assessed in vitro. Progranulin knockdown cell lines were established, and the effects on cholangiocarcinoma growth were determined. Progranulin expression and secretion were upregulated in cholangiocarcinoma cell lines and tissue, which were in part via IL-6-mediated activation of the ERK1/2/RSK1/C/EBPβ pathway. Blocking any of these signalling molecules, by either pharmacological inhibitors or shRNA, prevented the IL-6-dependent activation of progranulin expression. Treatment of cholangiocarcinoma cells with recombinant progranulin increased cell proliferation in vitro by a mechanism involving Akt phosphorylation leading to phosphorylation and nuclear extrusion of FOXO1. Knockdown of progranulin expression in cholangiocarcinoma cells decreased the expression of proliferating cellular nuclear antigen, a marker of proliferative capacity, and slowed tumour growth in vivo. Evidence is presented for a role for progranulin as a novel growth factor regulating cholangiocarcinoma growth. Specific targeting of progranulin may represent an alternative for the development of therapeutic strategies.

Suppression of autophagy enhances the cytotoxicity of the DNA-damaging aromatic amine p-anilinoaniline

International Nuclear Information System (INIS)

Elliott, Althea; Reiners, John J.

2008-01-01

p-Anilinoaniline (pAA) is an aromatic amine that is widely used in hair dying applications. It is also a metabolite of metanil yellow, an azo dye that is commonly used as a food coloring agent. Concentrations of pAA between 10 and 25 μM were cytostatic to cultures of the normal human mammary epithelia cell line MCF10A. Concentrations ≥ 50 μM were cytotoxic. Cytostatic concentrations induced transient G 1 and S cell cycle phase arrests; whereas cytotoxic concentrations induced protracted arrests. Cytotoxic concentrations of pAA caused DNA damage, as monitored by the alkaline single-cell gel electrophoresis (Comet) assay, and morphological changes consistent with cells undergoing apoptosis and/or autophagy. Enzymatic and western blot analyses, and binding analyses of fluorescent labeled VAD-FMK, suggested that caspase family members were activated by pAA. Western blot analyses documented the conversion of LC3-I to LC3-II, a post-translational modification involved in the development of the autophagosome. Suppression of autophagosome formation, via knockdown of ATG7 with shRNA, prevented pAA-induced vacuolization, enhanced the activation of pro-caspase-3, and increased susceptibility of ATG7-deficient cells to the cytostatic and cytotoxic activities of markedly lower concentrations of pAA. Cells stably transfected with a nonsense shRNA behaved like parental MCF10A cells. Collectively, these data suggest that MCF10A cultures undergo autophagy as a pro-survival response to concentrations of pAA sufficient to induce DNA damage

Inhibition of Ape1 Redox Activity Promotes Odonto/osteogenic Differentiation of Dental Papilla Cells.

Science.gov (United States)

Chen, Tian; Liu, Zhi; Sun, Wenhua; Li, Jingyu; Liang, Yan; Yang, Xianrui; Xu, Yang; Yu, Mei; Tian, Weidong; Chen, Guoqing; Bai, Ding

2015-12-07

Dentinogenesis is the formation of dentin, a substance that forms the majority of teeth, and this process is performed by odontoblasts. Dental papilla cells (DPCs), as the progenitor cells of odontoblasts, undergo the odontogenic differentiation regulated by multiple cytokines and paracrine signal molecules. Ape1 is a perfect paradigm of the function complexity of a biological macromolecule with two major functional regions for DNA repair and redox regulation, respectively. To date, it remains unclear whether Ape1 can regulate the dentinogenesis in DPCs. In the present study, we firstly examed the spatio-temporal expression of Ape1 during tooth germ developmental process, and found the Ape1 expression was initially high and then gradually reduced along with the tooth development. Secondly, the osteo/odontogenic differentiation capacity of DPCs was up-regulated when treated with either Ape1-shRNA or E3330 (a specific inhibitor of the Ape1 redox function), respectively. Moreover, we found that the canonical Wnt signaling pathway was activated in this process, and E3330 reinforced-osteo/odontogenic differentiation capacity was suppressed by Dickkopf1 (DKK1), a potent antagonist of canonical Wnt signaling pathway. Taken together, we for the first time showed that inhibition of Ape1 redox regulation could promote the osteo/odontogenic differentiation capacity of DPCs via canonical Wnt signaling pathway.

Targeting Sulfotransferase (SULT) 2B1b as a Regulator of Cholesterol Metabolism in Prostate Cancer

Science.gov (United States)

2015-10-01

next  subtask.       Subtask 2: Production of infective Lentivirus using co-transfection of HEK293 (pCa cells LNCaP, PC3, DU145, and VCaP...PCa lines. We determined that the level of shRNA expression from a stably intergrated transgene gene delivered by lentivirus was too low...effects  on  SULT2B1b  enzyme  activity  of   cholesterol  sulfate   production  in  vitro.     We  developed  a

Dyslexic Children Show Atypical Cerebellar Activation and Cerebro-Cerebellar Functional Connectivity in Orthographic and Phonological Processing.

Science.gov (United States)

Feng, Xiaoxia; Li, Le; Zhang, Manli; Yang, Xiujie; Tian, Mengyu; Xie, Weiyi; Lu, Yao; Liu, Li; Bélanger, Nathalie N; Meng, Xiangzhi; Ding, Guosheng

2017-04-01

Previous neuroimaging studies have found atypical cerebellar activation in individuals with dyslexia in either motor-related tasks or language tasks. However, studies investigating atypical cerebellar activation in individuals with dyslexia have mostly used tasks tapping phonological processing. A question that is yet unanswered is whether the cerebellum in individuals with dyslexia functions properly during orthographic processing of words, as growing evidence shows that the cerebellum is also involved in visual and spatial processing. Here, we investigated cerebellar activation and cerebro-cerebellar functional connectivity during word processing in dyslexic readers and typically developing readers using tasks that tap orthographic and phonological codes. In children with dyslexia, we observed an abnormally higher engagement of the bilateral cerebellum for the orthographic task, which was negatively correlated with literacy measures. The greater the reading impairment was for young dyslexic readers, the stronger the cerebellar activation was. This suggests a compensatory role of the cerebellum in reading for children with dyslexia. In addition, a tendency for higher cerebellar activation in dyslexic readers was found in the phonological task. Moreover, the functional connectivity was stronger for dyslexic readers relative to typically developing readers between the lobule VI of the right cerebellum and the left fusiform gyrus during the orthographic task and between the lobule VI of the left cerebellum and the left supramarginal gyrus during the phonological task. This pattern of results suggests that the cerebellum compensates for reading impairment through the connections with specific brain regions responsible for the ongoing reading task. These findings enhance our understanding of the cerebellum's involvement in reading and reading impairment.

The new economy is stronger than you think.

Science.gov (United States)

Sahlman, W A

1999-01-01

Many policy makers at the Fed contend that the new economy is a fragile bubble--and that with the "irrational exuberance" of the capital markets, the sky is going to fall on the U.S. economy. That couldn't be further from the truth, according to William Sahlman. As long as the government doesn't interfere, he argues, the economy is sturdy, resilient, and raring to grow. The new economy is strong for several reasons. First, it is based on a business model that works. Any business system that relentlessly drives out inefficiency, forces intelligent business-process reengineering, and gives customers more of what they want will be sustainable. Second, it is built on America's admiration for entrepreneurs and its tolerance for failure, not to mention its easy access to capital. Third, the new economy is attracting the best and brightest minds in the country. And finally, says Sahlman, the new economy is strong because it is spreading. It may be primarily an American phenomenon now, but in a few short years it will start to show its effects everywhere, making the whole world a more productive place. Still, Sahlman believes, the road ahead is not without potholes and sharp curves. But that is what the new economy is all about, he maintains--companies attacking the status quo and entrenched players, companies experimenting to find new technologies that improve or replace earlier ones. Such activity presents no cause for alarm. The economic, social, and cultural factors undergirding the new economy are rock solid. It's simply a matter of letting them stand.

Antioxidant activities of Physalis peruviana.

Science.gov (United States)

Wu, Sue-Jing; Ng, Lean-Teik; Huang, Yuan-Man; Lin, Doung-Liang; Wang, Shyh-Shyan; Huang, Shan-Ney; Lin, Chun-Ching

2005-06-01

Physalis peruviana (PP) is a widely used medicinal herb for treating cancer, malaria, asthma, hepatitis, dermatitis and rheumatism. In this study, the hot water extract (HWEPP) and extracts prepared from different concentrations of ethanol (20, 40, 60, 80 and 95% EtOH) from the whole plant were evaluated for antioxidant activities. Results displayed that at 100 mug/ml, the extract prepared from 95% EtOH exhibited the most potent inhibition rate (82.3%) on FeCl2-ascorbic acid induced lipid peroxidation in rat liver homogenate. At concentrations 10-100 microg/ml, this extract also demonstrated the strongest superoxide anion scavenging and inhibitory effect on xanthine oxidase activities. In general, the ethanol extracts revealed a stronger antioxidant activity than alpha-tocopherol and HWEPP. Compared to alpha-tocopherol, the IC50 value of 95% EtOH PP extract was lower in thiobarbituric acid test (IC50=23.74 microg/ml vs. 26.71 microg/ml), in cytochrome c test (IC50=10.40 microg/ml vs. 13.39 microg/ml) and in xanthine oxidase inhibition test (IC50=8.97 microg/ml vs. 20.68 microg/ml). The present study concludes that ethanol extracts of PP possess good antioxidant activities, and the highest antioxidant properties were obtained from the 95% EtOH PP.

Biosynthesis of Silver Nanoparticles Using Taxus yunnanensis Callus and Their Antibacterial Activity and Cytotoxicity in Human Cancer Cells

Directory of Open Access Journals (Sweden)

Qian Hua Xia

2016-09-01

Full Text Available Plant constituents could act as chelating/reducing or capping agents for synthesis of silver nanoparticles (AgNPs. The green synthesis of AgNPs has been considered as an environmental friendly and cost-effective alternative to other fabrication methods. The present work described the biosynthesis of AgNPs using callus extracts from Taxus yunnanensis and evaluated their antibacterial activities in vitro and potential cytotoxicity in cancer cells. Callus extracts were able to reduce silver nitrate at 1 mM in 10 min. Transmission electron microscope (TEM indicated the synthesized AgNPs were spherical with the size range from 6.4 to 27.2 nm. X-ray diffraction (XRD confirmed the AgNPs were in the form of nanocrystals. Fourier transform infrared spectroscopy (FTIR suggested phytochemicals in callus extracts were possible reducing and capping agents. The AgNPs exhibited effective inhibitory activity against all tested human pathogen bacteria and the inhibition against Gram-positive bacteria was stronger than that of Gram-negative bacteria. Furthermore, they exhibited stronger cytotoxic activity against human hepatoma SMMC-7721 cells and induced noticeable apoptosis in SMMC-7721 cells, but showed lower cytotoxic against normal human liver cells (HL-7702. Our results suggested that biosynthesized AgNPs could be an alternative measure in the field of antibacterial and anticancer therapeutics.

PKR-like endoplasmic reticulum kinase is necessary for lipogenic activation during HCMV infection.

Directory of Open Access Journals (Sweden)

Yongjun Yu

Full Text Available PKR-like endoplasmic reticulum (ER kinase (PERK is an ER-associated stress sensor protein which phosphorylates eukaryotic initiation factor 2α (eIF2α to induce translation attenuation in response to ER stress. PERK is also a regulator of lipogenesis during adipocyte differentiation through activation of the cleavage of sterol regulatory element binding protein 1 (SREBP1, resulting in the upregulation of lipogenic enzymes. Our recent studies have shown that human cytomegalovirus (HCMV infection in human fibroblasts (HF induces adipocyte-like lipogenesis through the activation of SREBP1. Here, we report that PERK expression is highly increased in HCMV-infected cells and is necessary for HCMV growth. Depletion of PERK, using short hairpin RNA (shRNA, resulted in attenuation of HCMV growth, inhibition of lipid synthesis and reduction of lipogenic gene expression. Examination of the cleavage of SREBP proteins showed PERK depletion inhibited the cleavage of SREBP1, but not SREBP2, in HCMV-infected cells, suggesting different cleavage regulatory mechanisms for SREBP1 and 2. Further studies showed that the depletion of SREBP1, but not SREBP2, reduced lipid synthesis in HCMV infection, suggesting that activation of SREBP1 is sufficient to induce lipogenesis in HCMV infection. The reduction of lipid synthesis by PERK depletion can be partially restored by expressing a Flag-tagged nuclear form of SREBP1a. Our studies also suggest that the induction of PERK in HCMV-infected cells stimulates SREBP1 cleavage by reducing levels of Insig1 (Insulin inducible gene 1 protein; this occurs independent of the phosphorylation of eIF2α. Introduction of an exogenous Insig1-Myc into HCMV infected cells significantly reduced HCMV growth and lipid synthesis. Our data demonstrate that the induction of PERK during HCMV infection is necessary for full activation of lipogenesis; this effect appears to be mediated by limiting the levels of Insig1 thus freeing SREBP1-SCAP

Androgen receptor activity modulates responses to cisplatin treatment in bladder cancer.

Science.gov (United States)

Kashiwagi, Eiji; Ide, Hiroki; Inoue, Satoshi; Kawahara, Takashi; Zheng, Yichun; Reis, Leonardo O; Baras, Alexander S; Miyamoto, Hiroshi

2016-08-02

Cisplatin (CDDP)-based combination chemotherapy remains the mainstream treatment for advanced bladder cancer. However, its efficacy is often limited due to the development of resistance for which underlying mechanisms are poorly understood. Meanwhile, emerging evidence has indicated the involvement of androgen-mediated androgen receptor (AR) signals in bladder cancer progression. In this study, we aimed to investigate whether AR signals have an impact on sensitivity to CDDP in bladder cancer cells. UMUC3-control-short hairpin RNA (shRNA) cells with endogenous AR and AR-negative 647V/5637 cells stably expressing AR were significantly more resistant to CDDP treatment at its pharmacological concentrations, compared with UMUC3-AR-shRNA and 647V-vector/5637-vector control cells, respectively. A synthetic androgen R1881 significantly reduced CDDP sensitivity in UMUC3, 647V-AR, or 5637-AR cells, and the addition of an anti-androgen hydroxyflutamide inhibited the effect of R1881. In these AR-positive cells, R1881 treatment also induced the expression levels of NF-κB, which is known to involve CDDP resistance, and its phosphorylated form, as well as nuclear translocation of NF-κB. In CDDP-resistant bladder cancer sublines established following long-term culture with CDDP, the expression levels of AR as well as NF-κB and phospho-NF-κB were considerably elevated, compared with respective control sublines. In bladder cancer specimens, there was a strong trend to correlate between AR positivity and chemoresistance. These results suggest that AR activation correlates with CDDP resistance presumably via modulating NF-κB activity in bladder cancer cells. Targeting AR during chemotherapy may thus be a useful strategy to overcome CDDP resistance in patients with AR-positive bladder cancer.

The Activity of Carbohydrate-Degrading Enzymes in the Development of Brood and Newly Emerged workers and Drones of the Carniolan Honeybee, Apis mellifera carnica

OpenAIRE

Żółtowska, Krystyna; Lipiński, Zbigniew; Łopieńska-Biernat, Elżbieta; Farjan, Marek; Dmitryjuk, Małgorzata

2012-01-01

The activity of glycogen Phosphorylase and carbohydrate hydrolyzing enzymes α-amylase, glucoamylase, trehalase, and sucrase was studied in the development of the Carniolan honey bee, Apis mellifera carnica Pollman (Hymenoptera: Apidae), from newly hatched larva to freshly emerged imago of worker and drone. Phosphorolytic degradation of glycogen was significantly stronger than hydrolytic degradation in all developmental stages. Developmental profiles of hydrolase activity were similar in both ...

Differential Links Between Leisure Activities and Depressive Symptoms in Unemployed Individuals.

Science.gov (United States)

Goodman, William K; Geiger, Ashley M; Wolf, Jutta M

2016-01-01

Unemployment has consistently been linked to an elevated risk for depression. Exercise, specifically leisure-based physical activities, has received increasing attention as alternative treatment options. However, because leisure activities are pursued during discretionary time, it is unclear if the mental health benefits of physical and leisure activities apply during times of unemployment as well. Depressive symptoms and participation in recreational activities were assessed in 142 employed and 158 unemployed participants (age = 34 ± 11 years; male = 150). Independent of employment status, all recreational activities were inversely associated with depressive symptoms. However, social (employed: ηp (2) = .21; unemployed: ηp (2) = .11) and self-focused (employed: ηp (2) = .19; unemployed: ηp (2) = .10) recreational activities were more strongly related to depressive symptoms than exercise (employed: ηp (2) = .12; unemployed: ηp (2) > .05). These findings highlight the strong mental health associations of recreational activities and suggest that, particularly for unemployed individuals, promoting recreational activities, rather than exercise, may leverage the stronger negative relationship with risk of depression. © 2015 Wiley Periodicals, Inc.

A preliminary study on radiation treatment of chitosan for enhancement of antifungal activity tested on fruit - spoiling strains

International Nuclear Information System (INIS)

Nguyen Duy Lam; Tran Bang Diep

2003-01-01

Chitosan samples were irradiated at doses ranging from 20 to 200 kGy, and then were supplemented to liquid medium for growth of fungi. Method of fungal cultivation using liquid medium showed that it has higher sensitivity compared with the cultivation on agar plate. Our study indicated that degree of deacetylation of chitosan clearly affects its antifungal activity, the higher the deacetylation of chitosan, stronger antifungal activity can be observed. Radiation treatment at doses higher than 20 kGy increased clearly the antifungal activity of chitosan. In addition, dose of 60-75 kGy where the viscosity-average molecular weight reduced to 110,000, expressed the highest activity. (author)

Comparative study on the antioxidant activity of peptides from pearl oyster ( Pinctada martensii) mantle type V collagen and tilapia ( Oreochromis niloticus) scale type I collagen

Science.gov (United States)

Xia, Guanghua; Zhang, Xueying; Dong, Zhenghua; Shen, Xuanri

2017-12-01

In this study, Pearl oyster mantle type V collagen (POMC) and tilapia scale type I collagen (TSC) were extracted and hydrolyzed by various proteases in order to obtain peptides. The antioxidant activity of the peptides was investigated by DPPH, hydroxyl radical scavenging experiments and a dynamic digestion model in vitro. The results show that there are significant differences in amino acid composition between POMC and TSC. The collagen peptides obtained from pearl oyster mantle (POMCP) by treating with alkaline protease exhibited higher antioxidant activity than that from tilapia scale (TSCP) treated with papaya protease, and both of them showed greater DPPH and hydroxyl radical scavenging activity than other peptides. After being separated via Sephadex G-25 chromatography, the M1 fraction isolated from POMCP, and the S1 fraction from TSCP with which both had higher molecular weights showed the strongest antioxidant activity than other fractions, and the M1 fraction exhibited stronger antioxidant activity than the S1 fraction in scavenging free-radicals and protecting cells from the oxidation damage. Furthermore, after treating the dynamic digestion system model in vitro, the DPPH and hydroxyl radical scavenging activity of the M1 fraction increased slightly. These results suggest that POMCP exhibits stronger antioxidant activity than TSCP, which means that PMOP may be a good candidate to be a potential natural antioxidant in the food-processing industry.

Dextromethorphan mediated bitter taste receptor activation in the pulmonary circuit causes vasoconstriction.

Science.gov (United States)

Upadhyaya, Jasbir D; Singh, Nisha; Sikarwar, Anurag S; Chakraborty, Raja; Pydi, Sai P; Bhullar, Rajinder P; Dakshinamurti, Shyamala; Chelikani, Prashen

2014-01-01

Activation of bitter taste receptors (T2Rs) in human airway smooth muscle cells leads to muscle relaxation and bronchodilation. This finding led to our hypothesis that T2Rs are expressed in human pulmonary artery smooth muscle cells and might be involved in regulating the vascular tone. RT-PCR was performed to reveal the expression of T2Rs in human pulmonary artery smooth muscle cells. Of the 25 T2Rs, 21 were expressed in these cells. Functional characterization was done by calcium imaging after stimulating the cells with different bitter agonists. Increased calcium responses were observed with most of the agonists, the largest increase seen for dextromethorphan. Previously in site-directed mutational studies, we have characterized the response of T2R1 to dextromethorphan, therefore, T2R1 was selected for further analysis in this study. Knockdown with T2R1 specific shRNA decreased mRNA levels, protein levels and dextromethorphan-induced calcium responses in pulmonary artery smooth muscle cells by up to 50%. To analyze if T2Rs are involved in regulating the pulmonary vascular tone, ex vivo studies using pulmonary arterial and airway rings were pursued. Myographic studies using porcine pulmonary arterial and airway rings showed that stimulation with dextromethorphan led to contraction of the pulmonary arterial and relaxation of the airway rings. This study shows that dextromethorphan, acting through T2R1, causes vasoconstrictor responses in the pulmonary circuit and relaxation in the airways.

[Antibacterial and anti-hemolysin activities of tea catechins and their structural relatives].

Science.gov (United States)

Toda, M; Okubo, S; Ikigai, H; Shimamura, T

1990-03-01

Among catechins tested, (-)epigallocatechin (EGC), (-)epicatechin gallate (ECg), (-) epigallocatechin gallate (EGCg) inhibited the growth of Staphylococcus aureus, Vibrio cholerae O1 classical Inaba 569B and El Tor Inaba V86. S. aureus was more sensitive than V. cholerae O1 to these compounds. EGCg showed also a bactericidal activity against V. cholerae O1 569B. Pyrogallol showed a stronger antibacterial activity against S. aureus and V. cholerae O1 than tannic and gallic acid. Rutin or caffein had no effect on them. ECg and EGCg showed the most potent anti-hemolysin activity against S. aureus alpha-toxin, Vibrio parahaemolyticus thermostable direct hemolysin (Vp-TDH) and cholera hemolysin. Among catechin relatives, only tannic acid had a potent anti-hemolysin activity against alpha-toxin. These results suggest that the catechol and pyrogallol groups are responsible for the antibacterial and bactericidal activities, while the conformation of catechins might play an important role in the anti-hemolysin activity.

Reduced SHARPIN and LUBAC Formation May Contribute to CCl4- or Acetaminophen-Induced Liver Cirrhosis in Mice

Directory of Open Access Journals (Sweden)

Takeshi Yamamotoya

2017-02-01

Full Text Available Linear ubiquitin chain assembly complex (LUBAC, composed of SHARPIN (SHANK-associated RH domain-interacting protein, HOIL-1L (longer isoform of heme-oxidized iron-regulatory protein 2 ubiquitin ligase-1, and HOIP (HOIL-1L interacting protein, forms linear ubiquitin on nuclear factor-κB (NF-κB essential modulator (NEMO and induces NF-κB pathway activation. SHARPIN expression and LUBAC formation were significantly reduced in the livers of mice 24 h after the injection of either carbon tetrachloride (CCl4 or acetaminophen (APAP, both of which produced the fulminant hepatitis phenotype. To elucidate its pathological significance, hepatic SHARPIN expression was suppressed in mice by injecting shRNA adenovirus via the tail vein. Seven days after this transduction, without additional inflammatory stimuli, substantial inflammation and fibrosis with enhanced hepatocyte apoptosis occurred in the livers. A similar but more severe phenotype was observed with suppression of HOIP, which is responsible for the E3 ligase activity of LUBAC. Furthermore, in good agreement with these in vivo results, transduction of Hepa1-6 hepatoma cells with SHARPIN, HOIL-1L, or HOIP shRNA adenovirus induced apoptosis of these cells in response to tumor necrosis factor-α (TNFα stimulation. Thus, LUBAC is essential for the survival of hepatocytes, and it is likely that reduction of LUBAC is a factor promoting hepatocyte death in addition to the direct effect of drug toxicity.

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

Science.gov (United States)

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Fine time course expression analysis identifies cascades of activation and repression and maps a putative regulator of mammalian sex determination.

Directory of Open Access Journals (Sweden)

Steven C Munger

Full Text Available In vertebrates, primary sex determination refers to the decision within a bipotential organ precursor to differentiate as a testis or ovary. Bifurcation of organ fate begins between embryonic day (E 11.0-E12.0 in mice and likely involves a dynamic transcription network that is poorly understood. To elucidate the first steps of sexual fate specification, we profiled the XX and XY gonad transcriptomes at fine granularity during this period and resolved cascades of gene activation and repression. C57BL/6J (B6 XY gonads showed a consistent ~5-hour delay in the activation of most male pathway genes and repression of female pathway genes relative to 129S1/SvImJ, which likely explains the sensitivity of the B6 strain to male-to-female sex reversal. Using this fine time course data, we predicted novel regulatory genes underlying expression QTLs (eQTLs mapped in a previous study. To test predictions, we developed an in vitro gonad primary cell assay and optimized a lentivirus-based shRNA delivery method to silence candidate genes and quantify effects on putative targets. We provide strong evidence that Lmo4 (Lim-domain only 4 is a novel regulator of sex determination upstream of SF1 (Nr5a1, Sox9, Fgf9, and Col9a3. This approach can be readily applied to identify regulatory interactions in other systems.

Survivin knockdown increased anti-cancer effects of (−)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N- BE2 and SH-SY5Y cells

Science.gov (United States)

Hossain, Md. Motarab; Banik, Naren L.; Ray, Swapan K.

2012-01-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (−)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in expression of NFP, NSE, and e-cadherin and also decreases in expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro network

Survivin knockdown increased anti-cancer effects of (-)-epigallocatechin-3-gallate in human malignant neuroblastoma SK-N-BE2 and SH-SY5Y cells.

Science.gov (United States)

Hossain, Md Motarab; Banik, Naren L; Ray, Swapan K

2012-08-01

Neuroblastoma is a solid tumor that mostly occurs in children. Malignant neuroblastomas have poor prognosis because conventional chemotherapeutic agents are hardly effective. Survivin, which is highly expressed in some malignant neuroblastomas, plays a significant role in inhibiting differentiation and apoptosis and promoting cell proliferation, invasion, and angiogenesis. We examined consequences of survivin knockdown by survivin short hairpin RNA (shRNA) plasmid and then treatment with (-)-epigallocatechin-3-gallate (EGCG), a green tea flavonoid, in malignant neuroblastoma cells. Our Western blotting and laser scanning confocal immunofluorescence microscopy showed that survivin was highly expressed in malignant neuroblastoma SK-N-BE2 and SH-SY5Y cell lines and slightly in SK-N-DZ cell line. Expression of survivin was very faint in malignant neuroblastoma IMR32 cell line. We transfected SK-N-BE2 and SH-SY-5Y cells with survivin shRNA, treated with EGCG, and confirmed knockdown of survivin at mRNA and protein levels. Survivin knockdown induced morphological features of neuronal differentiation, as we observed following in situ methylene blue staining. Combination of survivin shRNA and EGCG promoted neuronal differentiation biochemically by increases in the expression of NFP, NSE, and e-cadherin and also decreases in the expression of Notch-1, ID2, hTERT, and PCNA. Our in situ Wright staining and Annexin V-FITC/PI staining showed that combination therapy was highly effective in inducing, respectively, morphological and biochemical features of apoptosis. Apoptosis occurred with activation of caspase-8 and cleavage of Bid to tBid, increase in Bax:Bcl-2 ratio, mitochondrial release of cytochrome c, and increases in the expression and activity of calpain and caspase-3. Combination therapy decreased migration of cells through matrigel and inhibited proliferative (p-Akt and NF-κB), invasive (MMP-2 and MMP-9), and angiogenic (VEGF and b-FGF) factors. Also, in vitro

New Biflavonoids with α-Glucosidase and Pancreatic Lipase Inhibitory Activities from Boesenbergia rotunda

Directory of Open Access Journals (Sweden)

Nutputsorn Chatsumpun

2017-10-01

Full Text Available Roots of Boesenbergia rotunda (L. Mansf. are prominent ingredients in the cuisine of several Asian countries, including Thailand, Malaysia, Indonesia, India, and China. An extract prepared from the roots of this plant showed strong inhibitory activity against enzymes α-glucosidase and pancreatic lipase and was subjected to chromatographic separation to identify the active components. Three new biflavonoids of the flavanone-chalcone type (9, 12, and 13 were isolated, along with 12 known compounds. Among the 15 isolates, the three new compounds showed stronger inhibitory activity against α-glucosidase than the drug acarbose but displayed lower pancreatic lipase inhibitory effect than the drug orlistat. The results indicated the potential of B. rotunda roots as a functional food for controlling after-meal blood glucose levels.

mTOR inhibition in macrophages of asymptomatic HIV+ persons reverses the decrease in TLR4-mediated TNFα release through prolongation of MAPK pathway activation1

Science.gov (United States)

Li, Xin; Han, Xinbing; Llano, Juliana; Bole, Medhavi; Zhou, Xiuqin; Swan, Katharine; Anandaiah, Asha; Nelson, Benjamin; Patel, Naimish R.; Reinach, Peter S.; Koziel, Henry; Tachado, Souvenir D.

2011-01-01

Toll-like receptor 4 (TLR4) mediated signaling is significantly impaired in macrophages from HIV+ persons predominantly due to altered MyD88-dependent pathway signaling caused in part by constitutive activation of PI3K. Here we assessed in these macrophages if the blunted increase in TLR4-mediated TNFα release induced by lipid A are associated with PI3K-induced upregulation of mammalian target of rapamycin (mTOR) activity. mTOR inhibition with rapamycin enhanced TLR4-mediated TNFα release, but instead suppressed anti-inflammatory IL-10 release. Targeted gene silencing of mTOR in macrophages resulted in lipid A-induced TNFα and IL-10 release patterns similar to those induced by rapamycin. Rapamycin restored MyD88-IRAK interaction in a dose-dependent manner. Targeted gene silencing of MyD88 (shRNA) and mTOR (RNAi) inhibition resulted in TLR4-mediated p70s6K activation and enhanced TNFα release, whereas IL-10 release was inhibited in both silenced and non-silenced HIV+ macrophages. Furthermore, mTOR inhibition augmented lipid A-induced TNFα release through enhanced and prolonged phosphorylation of ERK1/2 and JNK1/2 MAP kinases, which was associated with time-dependent MKP-1 destabilization. Taken together, impaired TLR4-mediated TNFα release in HIV+ macrophages is attributable in part to mTOR activation by constitutive PI3K expression in a MyD88-dependent signaling pathway. These changes result in MKP-1 stabilization, which shortens and blunts MAP kinase activation. mTOR inhibition may serve as a potential therapeutic target to upregulate macrophage innate immune host defense responsiveness in HIV+ persons. PMID:22025552

Transient and sustained cortical activity elicited by connected speech of varying intelligibility

Directory of Open Access Journals (Sweden)

Tiitinen Hannu

2012-12-01

Full Text Available Abstract Background The robustness of speech perception in the face of acoustic variation is founded on the ability of the auditory system to integrate the acoustic features of speech and to segregate them from background noise. This auditory scene analysis process is facilitated by top-down mechanisms, such as recognition memory for speech content. However, the cortical processes underlying these facilitatory mechanisms remain unclear. The present magnetoencephalography (MEG study examined how the activity of auditory cortical areas is modulated by acoustic degradation and intelligibility of connected speech. The experimental design allowed for the comparison of cortical activity patterns elicited by acoustically identical stimuli which were perceived as either intelligible or unintelligible. Results In the experiment, a set of sentences was presented to the subject in distorted, undistorted, and again in distorted form. The intervening exposure to undistorted versions of sentences rendered the initially unintelligible, distorted sentences intelligible, as evidenced by an increase from 30% to 80% in the proportion of sentences reported as intelligible. These perceptual changes were reflected in the activity of the auditory cortex, with the auditory N1m response (~100 ms being more prominent for the distorted stimuli than for the intact ones. In the time range of auditory P2m response (>200 ms, auditory cortex as well as regions anterior and posterior to this area generated a stronger response to sentences which were intelligible than unintelligible. During the sustained field (>300 ms, stronger activity was elicited by degraded stimuli in auditory cortex and by intelligible sentences in areas posterior to auditory cortex. Conclusions The current findings suggest that the auditory system comprises bottom-up and top-down processes which are reflected in transient and sustained brain activity. It appears that analysis of acoustic features occurs

The increase in medial prefrontal glutamate/glutamine concentration during memory encoding is associated with better memory performance and stronger functional connectivity in the human medial prefrontal-thalamus-hippocampus network.

Science.gov (United States)

Thielen, Jan-Willem; Hong, Donghyun; Rohani Rankouhi, Seyedmorteza; Wiltfang, Jens; Fernández, Guillén; Norris, David G; Tendolkar, Indira

2018-06-01

The classical model of the declarative memory system describes the hippocampus and its interactions with representational brain areas in posterior neocortex as being essential for the formation of long-term episodic memories. However, new evidence suggests an extension of this classical model by assigning the medial prefrontal cortex (mPFC) a specific, yet not fully defined role in episodic memory. In this study, we utilized 1H magnetic resonance spectroscopy (MRS) and psychophysiological interaction (PPI) analysis to lend further support for the idea of a mnemonic role of the mPFC in humans. By using MRS, we measured mPFC γ-aminobutyric acid (GABA) and glutamate/glutamine (GLx) concentrations before and after volunteers memorized face-name association. We demonstrate that mPFC GLx but not GABA levels increased during the memory task, which appeared to be related to memory performance. Regarding functional connectivity, we used the subsequent memory paradigm and found that the GLx increase was associated with stronger mPFC connectivity to thalamus and hippocampus for associations subsequently recognized with high confidence as opposed to subsequently recognized with low confidence/forgotten. Taken together, we provide new evidence for an mPFC involvement in episodic memory by showing a memory-related increase in mPFC excitatory neurotransmitter levels that was associated with better memory and stronger memory-related functional connectivity in a medial prefrontal-thalamus-hippocampus network. © 2018 The Authors Human Brain Mapping Published by Wiley Periodicals, Inc.

Seasonal distribution of active systemic lupus erythematosus and its correlation with meteorological factors

Directory of Open Access Journals (Sweden)

Zhang Hua-Li

2011-01-01

Full Text Available OBJECTIVE: To explore the characteristics of seasonal distribution of active systemic lupus erythematosus (SLE and the influences of meteorological factors including temperature and humidity on active systemic lupus erythematosus. METHODS: The characteristics of seasonal distribution of active SLE and its correlation with meteorological factors were retrospectively analyzed in 640 patients living in the city of Zhanjiang, China and had active SLE between January 1997 and December 2006. RESULTS: In winter, when there are weaker ultraviolet (UV rays, the ratio of patients with active SLE to total inpatients was 3.89 %o, which is significantly higher than in other seasons with stronger UV rays, including 2.17 %o in spring, 1.87 0 in summer and 2.12 0 in autumn. The number of patients with active SLE had significant negative correlation with mean temperature and was not significantly related to mean humidity. CONCLUSION: Active SLE has the characteristics of seasonal distribution and is associated with temperature. The mechanism remains to be further studied.

Stronger influence of maternal than paternal obesity on infant and early childhood body mass index: the Fels Longitudinal Study.

Science.gov (United States)

Linabery, A M; Nahhas, R W; Johnson, W; Choh, A C; Towne, B; Odegaard, A O; Czerwinski, S A; Demerath, E W

2013-06-01

Excessive early childhood adiposity is a prevalent and increasing concern in many parts of the world. Parental obesity is one of the several factors previously associated with infant and early childhood weight, length and adiposity. Parental obesity represents a surrogate marker of the complex interplay among genetic, epigenetic and shared environmental factors, and is potentially modifiable. The relative contributions of maternal and paternal body mass index (BMI) to infant and early childhood growth, as well as the timing of such effects, have not been firmly established. Utilizing serial infant measurements and growth curve modelling, this is the largest study to fully characterize and formally compare associations between maternal and paternal BMI and offspring growth across the entire infancy and early childhood period. Maternal obesity is a stronger determinant of offspring BMI than paternal obesity at birth and from 2 to 3 years of age, suggesting that prevention efforts focused particularly on maternal lifestyle and BMI may be important in reducing excess infant BMI. The observation that maternal BMI effects are not constant, but rather present at birth, wane and re-emerge during late infancy, suggests that there is a window of opportunity in early infancy when targeted interventions on children of obese mothers may be most effective. Parental obesity influences infant body size. To fully characterize their relative effects on infant adiposity, associations between maternal and paternal body mass index (BMI) category (normal: ≤25 kg m(-2) , overweight: 25 - obese: ≥30 kg m(-2) ) and infant BMI were compared in Fels Longitudinal Study participants. A median of 9 serial weight and length measures from birth to 3.5 years were obtained from 912 European American children born in 1928-2008. Using multivariable mixed effects regression, contributions of maternal vs. paternal BMI status to infant BMI growth curves were evaluated. Cubic spline models

Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells

Directory of Open Access Journals (Sweden)

Lin JF

2017-05-01

Full Text Available Ji-Fan Lin,1 Yi-Chia Lin,2 Te-Fu Tsai,2,3 Hung-En Chen,2 Kuang-Yu Chou,2,3 Thomas I-Sheng Hwang2–4 1Central Laboratory, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Division of Urology, School of Medicine, Fu-Jen Catholic University, New Taipei, 3Division of Urology, Department of Surgery, Shin Kong Wu Ho-Su Memorial Hospital, 4Department of Urology, Taipei Medical University, Taipei, Taiwan Purpose: Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC. Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines.Materials and methods: Human BC cells (5637 and T24 were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1, chloroquine (CQ, and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12 were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation.Results: Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose- and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of

Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System.

Directory of Open Access Journals (Sweden)

Urs M Nater

Full Text Available Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies.In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies.Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest.Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals.

Polyetherimide-grafted Fe3O4@SiO2 nanoparticles as theranostic agents for simultaneous VEGF siRNA delivery and magnetic resonance cell imaging

Directory of Open Access Journals (Sweden)

Li T

2015-07-01

Full Text Available Tingting Li,1 Xue Shen,1 Yin Chen,1 Chengchen Zhang,1 Jie Yan,1 Hong Yang,1 Chunhui Wu,1,2 Hongjun Zeng,1,2 Yiyao Liu1,21Department of Biophysics, School of Life Science and Technology, 2Center for Information in Biomedicine, University of Electronic Science and Technology of China, Chengdu, Sichuan, People’s Republic of ChinaAbstract: Engineering a safe and high-efficiency delivery system for efficient RNA interference is critical for successful gene therapy. In this study, we designed a novel nanocarrier system of polyethyleneimine (PEI-modified Fe3O4@SiO2, which allows high efficient loading of VEGF small hairpin (shRNA to form Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites for VEGF gene silencing as well as magnetic resonance (MR imaging. The size, morphology, particle stability, magnetic properties, and gene-binding capacity and protection were determined. Low cytotoxicity and hemolyticity against human red blood cells showed the excellent biocompatibility of the multifunctional nanocomposites, and also no significant coagulation was observed. The nanocomposites maintain their superparamagnetic property at room temperature and no appreciable change in magnetism, even after PEI modification. The qualitative and quantitative analysis of cellular internalization into MCF-7 human breast cancer cells by Prussian blue staining and inductively coupled plasma atomic emission spectroscopy analysis, respectively, demonstrated that the Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could be easily internalized by MCF-7 cells, and they exhibited significant inhibition of VEGF gene expression. Furthermore, the MR cellular images showed that the superparamagnetic iron oxide core of our Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites could also act as a T2-weighted contrast agent for cancer MR imaging. Our data highlight multifunctional Fe3O4@SiO2/PEI/VEGF shRNA nanocomposites as a potential platform for simultaneous gene delivery and MR cell imaging, which are promising

Tracing How Normative Messages May Influence Physical Activity Intention.

Science.gov (United States)

van Bavel, René; Esposito, Gabriele; Baranowski, Tom; Duch-Brown, Néstor

2017-04-01

Normative messages have been shown to increase intention to do physical activity. We traced how "positive" and "negative" normative messages influenced physical activity intention by comparing constructs of the model of goal-directed behavior with descriptive norms (MGDB + DNs) across control and treatment groups in an experiment. For this purpose, 16-24-year-old respondents (n = 1,200) in Bulgaria, Croatia, and Romania were asked about their age, sex, and levels of physical activity before being exposed to positive and negative normative messages and completing a questionnaire with MGDB + DNs scales. Different MGDB + DNs constructs were influenced by the normative messages: compared with the control, the negative message group showed stronger attitudes (p = .003) and the positive message group showed higher positive anticipated emotions (p = .005). The positive message's effect is consistent with the literature on conformity to social norms. The negative message's effect lends itself to interpretations based on social identity and deviance regulation theories.

Evaluation of Depigmenting Activity by 8-Hydroxydaidzein in Mouse B16 Melanoma Cells and Human Volunteers

Directory of Open Access Journals (Sweden)

Ching-Gong Lin

2009-09-01

Full Text Available In our previous study, 8-hydroxydaidzein (8-OHDe was demonstrated to be a potent and unique suicide substrate of mushroom tyrosinase. In this study, the compound was evaluated for in vitro cellular tyrosinase and melanogenesis inhibitory activities in mouse B16 melanoma cells and for in vivo skin-whitening activity in human volunteers. Tyrosinase activity and melanogenesis in the cell culture incubated with 10 µM of 8-OHDe were decreased to 20.1% and 51.8% of control, respectively, while no obvious cytotoxicity was observed in this concentration. In contrast, a standard tyrosinase inhibitor, kojic acid, showed 69.9% and 71.3% of control in cellular tyrosinase and melanogenesis activity, respectively, at a concentration as high as 100 µM. Hence, 8-OHDe exhibited more than an inhibitory effects on melanin production in B16 cells 10-fold stronger than kojic acid. In addition, when a cream containing 4% 8-OHDe was applied to human skin in an in vivo study, significant increases in the dL*-values were observed after three weeks. Moreover, the increase in the dL*-values after 8-week treatment with 4% 8-OHDe (from -0.57 to 1.94 is stronger than those of 2% 8-OHDe treatment (from 0.26 to 0.94 and 2% ascorbic acid-2-glucoside treatment (from 0.07 to 1.54. From the results of the study, it was concluded that 8-OHDe, the potent suicide substrate of mushroom tyrosinase, has depigmenting activities in both mouse melanoma cells and in human volunteers. Thus, the compound has significant potential for use in cosmetics as a skin-whitening ingredient.

Transcription factor Runx2 knockdown regulates colon cancer transplantation tumor growth in vitro: an experimental study

Directory of Open Access Journals (Sweden)

Bin Xu1

2017-05-01

Full Text Available Objective: To study the effect of transcription factor Runx2 knockdown on colon cancer transplantation tumor growth in vitro. Methods: Colon cancer cell lines HT29 were cultured and transfected with negative control (NC - shRNA plasmids and Runx2-shRNA plasmids respectively, the colon cancer cells transfected with shRNA were subcutaneously injected into C57 nude mice, and they were included in NC group and Runx2 knockdown group respectively. 1 week, 2 weeks and 3 weeks after model establishment, serum was collected to determine the contents of tumor markers, and tumor lesions were collected to determine proliferation and apoptosis gene expression. Results: CCSA-2, CEA and CA19-9 levels in serum as well as Rac1, Wnt3a, PLD2 and FAM96B protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly lower than those of NC group while MS4A12, ASPP2 and Fas protein expression in transplantation tumor lesions of Runx2 knockdown group were significantly higher than those of NC group. Conclusion: Transcription factor Runx2 knockdown could inhibit the colon cancer transplantation tumor growth in vitro.

Structure-activity relationships of diverse xanthones against multidrug resistant human tumor cells.

Science.gov (United States)

Wang, Qiwen; Ma, Chenyao; Ma, Yun; Li, Xiang; Chen, Yong; Chen, Jianwei

2017-02-01

Thirteen xanthones were isolated naturally from the stem of Securidaca inappendiculata Hassk, and structure-activity relationships (SARs) of these compounds were comparatively predicted for their cytotoxic activity against three human multidrug resistant (MDR) cell lines MCF-7/ADR, SMMC-7721/Taxol, and A549/Taxol cells. The results showed that the selected xanthones exhibited different potent cytotoxic activity against the growth of different human tumor cell lines, and most of the xanthones exhibited selective cytotoxicity against SMMC-7721/Taxol cells. Furthermore, some tested xanthones showed stronger cytotoxicity than Cisplatin, which has been used in clinical application extensively. The SARs analysis revealed that the cytotoxic activities of diverse xanthones were affected mostly by the number and position of methoxyl and hydroxyl groups. Xanthones with more free hydroxyl and methoxyl groups increased the cytotoxic activity significantly, especially for those with the presence of C-3 hydroxyl and C-4 methoxyl groups. Copyright © 2016 Elsevier Ltd. All rights reserved.

A Critical Analysis of the Role of SNARE Protein SEC22B in Antigen Cross-Presentation

Directory of Open Access Journals (Sweden)

S. Julia Wu

2017-06-01

Full Text Available Cross-presentation initiates immune responses against tumors and viral infections by presenting extracellular antigen on MHC I to activate CD8+ T cell-mediated cytotoxicity. In vitro studies in dendritic cells (DCs established SNARE protein SEC22B as a specific regulator of cross-presentation. However, the in vivo contribution of SEC22B to cross-presentation has not been tested. To address this, we generated DC-specific Sec22b knockout (CD11c-Cre Sec22bfl/fl mice. Contrary to the paradigm, SEC22B-deficient DCs efficiently cross-present both in vivo and in vitro. Although in vitro small hairpin RNA (shRNA-mediated Sec22b silencing in bone-marrow-derived dendritic cells (BMDCs reduced cross-presentation, treatment of SEC22B-deficient BMDCs with the same shRNA produced a similar defect, suggesting the Sec22b shRNA modulates cross-presentation through off-target effects. RNA sequencing of Sec22b shRNA-treated SEC22B-deficient BMDCs demonstrated several changes in the transcriptome. Our data demonstrate that contrary to the accepted model, SEC22B is not necessary for cross-presentation, cautioning against extrapolating phenotypes from knockdown studies alone.

RNAi reduces expression and intracellular retention of mutant cartilage oligomeric matrix protein.

Directory of Open Access Journals (Sweden)

Karen L Posey

2010-04-01

Full Text Available Mutations in cartilage oligomeric matrix protein (COMP, a large extracellular glycoprotein expressed in musculoskeletal tissues, cause two skeletal dysplasias, pseudoachondroplasia and multiple epiphyseal dysplasia. These mutations lead to massive intracellular retention of COMP, chondrocyte death and loss of growth plate chondrocytes that are necessary for linear growth. In contrast, COMP null mice have only minor growth plate abnormalities, normal growth and longevity. This suggests that reducing mutant and wild-type COMP expression in chondrocytes may prevent the toxic cellular phenotype causing the skeletal dysplasias. We tested this hypothesis using RNA interference to reduce steady state levels of COMP mRNA. A panel of shRNAs directed against COMP was tested. One shRNA (3B reduced endogenous and recombinant COMP mRNA dramatically, regardless of expression levels. The activity of the shRNA against COMP mRNA was maintained for up to 10 weeks. We also demonstrate that this treatment reduced ER stress. Moreover, we show that reducing steady state levels of COMP mRNA alleviates intracellular retention of other extracellular matrix proteins associated with the pseudoachondroplasia cellular pathology. These findings are a proof of principle and the foundation for the development of a therapeutic intervention based on reduction of COMP expression.

SPAG6 regulates cell apoptosis through the TRAIL signal pathway in myelodysplastic syndromes.

Science.gov (United States)

Li, Xinxin; Yang, Bihui; Wang, Li; Chen, Liping; Luo, Xiaohua; Liu, Lin

2017-05-01

Myelodysplastic syndromes (MDSs) are a group of malignant clone hematopoietic stem-cell diseases, and the evolution and progression of MDS depend on the abnormal apoptosis of bone marrow cells. Our previous studies have indicated that sperm-associated antigen 6 (SPAG6), located in the uniparental disomy regions of myeloid cells, is overexpressed in patients with MDS as compared to controls, and SPAG6 can inhibit apoptosis of SKM-1. However, the concrete mechanism is still unclear. In the present study, it was found that the TNF-related apoptosis-inducing ligand (TRAIL)signal pathway was activated when the expression of SPAG6 was inhibited by SPAG6-shRNA lentivirus in SKM-1 cells. Additionally, the results of flow cytometry, Cell Counting Kit-8 assay and western blot analysis implied that the TRAIL signal pathway could be inhibited by a high expression of SPAG6. However, SPAG6 cannot influence the expression of TRAIL death receptors, except for FADD. Additionally the interaction between FADD and TRAIL death receptors also increased in SKM-1 cells infected with SPAG6-shRNA lentivirus. Thus, our study demonstrates that SPAG6 may regulate apoptosis in SKM-1 through the TRAIL signal pathway, indicating that SPAG6 could be a potential therapeutic target.

Position in Educational Activity and Empathy Ability in Adolescence and Teenage Years

Directory of Open Access Journals (Sweden)

Klimenkova E.N.

2017-11-01

Full Text Available The article is devoted to the study of the relationship between empathy and learning activity position in adolescence and young. We present the results of empirical research of 78 assisting professions students (psychologists and teachers and 42 Polytechnic College students with the techniques of studying empathic abilities (questionnaire of the Interpersonal Reactivity Index of M. Davis in the adaptation of TD Karyagina, projective technique "Consolation Strategies" Vasiluk and EV Sheryagina, processing in the modification of AB Kholmogorova, and the the subject position (the questionnaire "Subject Position in studying activity" by Yu.V. Zaretsky and V.K. Zaretsky. Students less likely to use emotional support, the objective position is more clearly expressed and less subjective in relation to learning activity. Subjects with a subjective learning activity position have stronger empathy, perspective taking and the ability to provide support. Subjects with a subject position often use emotional support.

Marital status, labour force activity and mortality: a study in the USA and six European countries.

Science.gov (United States)

Van Hedel, Karen; Van Lenthe, Frank J; Avendano, Mauricio; Bopp, Matthias; Esnaola, Santiago; Kovács, Katalin; Martikainen, Pekka; Regidor, Enrique; Mackenbach, Johan P

2015-07-01

Labour force activity and marriage share some pathways through which they potentially influence health. In this paper, we examine whether marriage and labour force participation interact in the way they influence mortality in the USA and six European countries. We used data from the US National Health Interview Survey linked to the National Death Index, and national mortality registry data for Austria, England/Wales, Finland, Hungary, Norway and Spain (specifically, the Basque country) during 1999-2007, for men and women aged 30-59 years at baseline. We used Poisson regression to estimate both the additive (relative excess risk due to interaction) and multiplicative interactions between marriage and labour force activity on mortality. Labour force inactivity was associated with higher mortality, but this association was stronger for unmarried, rather than married, individuals. Likewise, being unmarried was associated with higher mortality, but this association was stronger for inactive than for active individuals. To illustrate, among US women out of the labour force, being unmarried was associated with a 3.98 times (95%CI 3.28-4.82) higher risk of dying than being married; whereas the relative risk (RR) was 2.49 (95%CI 2.10-2.94), for women who were active in the labour market. Although this interaction between marriage and labour force activity was only significant for women on a multiplicative scale, there was a significant additive interaction for both men and women. The pattern was similar across all countries. Marriage attenuated the increased mortality risk associated with labour force inactivity; while labour force activity attenuated the mortality risk associated with being unmarried. Our study emphasizes the importance of public health and social policies that improve the health and well-being of unmarried and inactive men and women. © 2015 the Nordic Societies of Public Health.

Oridonin stabilizes retinoic acid receptor alpha through ROS-activated NF-κB signaling.

Science.gov (United States)

Cao, Yang; Wei, Wei; Zhang, Nan; Yu, Qing; Xu, Wen-Bin; Yu, Wen-Jun; Chen, Guo-Qiang; Wu, Ying-Li; Yan, Hua

2015-04-10

Retinoic acid receptor alpha (RARα) plays an essential role in the regulation of many biological processes, such as hematopoietic cell differentiation, while abnormal RARα function contributes to the pathogenesis of certain diseases including cancers, especially acute promyelocytic leukemia (APL). Recently, oridonin, a natural diterpenoid isolated from Rabdosia rubescens, was demonstrated to regulate RARα by increasing its protein level. However, the underlying molecular mechanism for this action has not been fully elucidated. In the APL cell line, NB4, the effect of oridonin on RARα protein was analyzed by western blot and real-time quantitative RT-PCR analyses. Flow cytometry was performed to detect intracellular levels of reactive oxygen species (ROS). The association between nuclear factor-kappa B (NF-κB) signaling and the effect of oridonin was assessed using specific inhibitors, shRNA gene knockdown, and immunofluorescence assays. In addition, primary leukemia cells were treated with oridonin and analyzed by western blot in this study. RARα possesses transcriptional activity in the presence of its ligand, all-trans retinoic acid (ATRA). Oridonin remarkably stabilized the RARα protein, which retained transcriptional activity. Oridonin also moderately increased intracellular ROS levels, while pretreatment with the ROS scavenger, N-acetyl-l-cysteine (NAC), dramatically abrogated RARα stabilization by oridonin. More intriguingly, direct exposure to low concentrations of H2O2 also increased RARα protein but not mRNA levels, suggesting a role for ROS in oridonin stabilization of RARα protein. Further investigations showed that NAC antagonized oridonin-induced activation of NF-κB signaling, while the NF-κB signaling inhibitor, Bay 11-7082, effectively blocked the oridonin increase in RARα protein levels. In line with this, over-expression of IκΒα (A32/36), a super-repressor form of IκΒα, or NF-κB-p65 knockdown inhibited oridonin or H2O2-induced

Sorption of PAHs and PCBs to activated carbon: coal versus biomass-based quality.

Science.gov (United States)

Amstaetter, Katja; Eek, Espen; Cornelissen, Gerard

2012-04-01

The addition of activated carbon (AC) is an increasingly popular method for pollutant immobilization, and the AC material can be made of biomass or coal/fossil feedstock. The aim of the present study was to investigate whether there are differences between pollutant sorption to biomass and coal-based AC in the presence and absence of sediment. Through N(2) and CO(2) adsorption to probe surface area and pore size it was shown that the biomass-based AC had a stronger dominance of narrow pores in the size range 3.5-15Šthan the anthracite-based material. In the absence of sediment, sorption isotherms for the probe compounds pyrene and PCB-101 showed stronger sorption for the biomass-based AC (logarithmic Freundlich coefficients 8.15 for pyrene; 9.91 for PCB-101) than for the anthracite-based one (logarithmic Freundlich coefficients 7.20 and 9.70, respectively). In the presence of sediment, the opposite trend was observed, with the stronger sorption for anthracite-based AC. Thus, the presence of competing and/or pore-blocking sediment constituents reduces sorption to a larger extent for biomass-derived AC (factor of 5 for pyrene to almost 100 for PCB-101) than for anthracite-based AC (no reduction for pyrene to factor of 5 for PCB-101). This difference is tentatively attributed to the difference in pore size distribution, narrow pores being more prone to clogging, and could have implications for remediation feasibility with AC from different sources. Copyright © 2012 Elsevier Ltd. All rights reserved.

The New Bail-in Regime and the Need for Stronger Market Discipline: What Can We Learn From the Greek Case?

Directory of Open Access Journals (Sweden)

Evangelos Vasileiou

2014-01-01

Full Text Available Effective Market Discipline (MD puzzles financial economists and regulators for decades, while the recent bail-in legislation for European banks extremely raises the need for even stronger MD. It may not be exaggeration to say that a new regime for the European banking market is born after the aforementioned decision. This paper’s objective is the broader MD examination, using variables that are not usually included in MD studies, but concern the European Union (EU and the European Monetary Union (EMU in the last years. In particular, apart from banking, deposit insurance and pure macroeconomic indicators, we also include governance and sovereign debt indices. The new regime may need a new MD approach. We choose Greece to implement our assumptions, because it is the country with the most severe economic, sovereign and governance problems in the EU. We employ data for the period 2002-10. The empirical evidence supports that market discipline is superficial, while there is ample evidence that MD is directly influenced by the poor governance performance and the excessive government debt. Greek authorities have to make major structural reforms in order to create the conditions for long-term stability, while our analysis points out some EMU’s shortfalls. 

Aryl hydrocarbon receptor signaling modulates antiviral immune responses: ligand metabolism rather than chemical source is the stronger predictor of outcome.

Science.gov (United States)

Boule, Lisbeth A; Burke, Catherine G; Jin, Guang-Bi; Lawrence, B Paige

2018-01-29

The aryl hydrocarbon receptor (AHR) offers a compelling target to modulate the immune system. AHR agonists alter adaptive immune responses, but the consequences differ across studies. We report here the comparison of four agents representing different sources of AHR ligands in mice infected with influenza A virus (IAV): TCDD, prototype exogenous AHR agonist; PCB126, pollutant with documented human exposure; ITE, novel pharmaceutical; and FICZ, degradation product of tryptophan. All four compounds diminished virus-specific IgM levels and increased the proportion of regulatory T cells. TCDD, PCB126 and ITE, but not FICZ, reduced virus-specific IgG levels and CD8 + T cell responses. Similarly, ITE, PCB126, and TCDD reduced Th1 and Tfh cells, whereas FICZ increased their frequency. In Cyp1a1-deficient mice, all compounds, including FICZ, reduced the response to IAV. Conditional Ahr knockout mice revealed that all four compounds require AHR within hematopoietic cells. Thus, differences in the immune response to IAV likely reflect variances in quality, magnitude, and duration of AHR signaling. This indicates that binding affinity and metabolism may be stronger predictors of immune effects than a compound's source of origin, and that harnessing AHR will require finding a balance between dampening immune-mediated pathologies and maintaining sufficient host defenses against infection.

ANCCLI. 2014 activity report

International Nuclear Information System (INIS)

2015-01-01

After a presentation of some key figures regarding the ANCCLI (the national association of local information committees) activities for 2014, and a speech made by its chairman during the 2014 CLIs' conference, this report proposes an overview of main actions undertaken in 2014: a new communication strategy, proposals for the bill project on energy transition, audit and hearing by the French Parliament, action for the development of CLIs' citizen expertise). It gives an overview of works performed by its different bodies (its scientific committee, the task officers' club, and the different permanent groups). It presents the different partnerships: participation to initiatives launched by the ASN, a stronger collaboration with the IRSN, partnership with ministries and with the HCTISN or High committee for transparency and information on nuclear safety. Meetings, publications and communication actions are indicated, as well as the participation to European initiatives (notably the ACN process)

Culture modulates brain activity during empathy with anger.

Science.gov (United States)

de Greck, Moritz; Shi, Zhenhao; Wang, Gang; Zuo, Xiangyu; Yang, Xuedong; Wang, Xiaoying; Northoff, Georg; Han, Shihui

2012-02-01

Interdependent cultures (such as the Chinese) and independent cultures (such as the German) differ in their attitude towards harmony that is more valued in interdependent cultures. Interdependent and independent cultures also differ in their appreciation of anger--an emotion that implies the disruption of harmony. The present study investigated if interdependent and independent cultures foster distinct brain activity associated with empathic processing of familiar angry, familiar neutral, and unfamiliar neutral faces. Using functional MRI, we scanned Chinese and German healthy subjects during an intentional empathy task, a control task (the evaluation of skin color), and a baseline condition. The subject groups were matched with regard to age, gender, and education. Behaviorally, Chinese subjects described themselves as significantly more interdependent compared to German subjects. The contrast 'intentional empathy for familiar angry'>'baseline' revealed several regions, including the left inferior frontal cortex, the left supplementary motor area, and the left insula, that showed comparable hemodynamic responses in both groups. However, the left dorsolateral prefrontal cortex had stronger hemodynamic responses in Chinese subjects in the contrast 'intentional empathy for familiar angry'>'baseline'. Germans, in contrast, showed stronger hemodynamic responses in the right temporo-parietal junction, right inferior and superior temporal gyrus, and left middle insula for the same contrast. Hemodynamic responses in the latter three brain regions correlated with interdependences scores over all subjects. Our results suggest that enhanced emotion regulation during empathy with anger in the interdependent lifestyle is mediated by the left dorsolateral prefrontal cortex. Increased tolerance towards the expression of anger in the independent lifestyle, in contrast, is associated with increased activity of the right inferior and superior temporal gyrus and the left middle

Ministers at IAEA Conference Call for Stronger Nuclear Security

International Nuclear Information System (INIS)

2013-01-01

Full text: Despite substantial progress in strengthening nuclear security in recent years, more needs to be done worldwide to defend against the threat of nuclear terrorism and other malicious acts involving nuclear or radiological material, a Ministerial Declaration at the IAEA's International Conference on Nuclear Security: Enhancing Global Efforts stated today. More than 1 300 participants at the Conference, which is open to all 159 IAEA Member States, will analyse past and current efforts and consider how future challenges can best be met to ensure effective and sustainable nuclear security worldwide. The Conference, which started in Vienna today and ends on Friday, includes representatives from 123 countries and 21 governmental and non-governmental organizations. The Ministerial Declaration, adopted at a plenary session attended by 34 government ministers and other Heads of Delegation including the Conference President, Hungarian Foreign Affairs Minister Janos Martonyi, says they ''remain concerned about the threat of nuclear and radiological terrorism and of other malicious acts or sabotage related to facilities and activities involving nuclear and other radioactive material.'' The Declaration - the first of its kind for nuclear security - notes that all States are responsible for their own nuclear security, but that international cooperation is important in supporting States' efforts to fulfil their responsibilities. It affirms the central role of the IAEA in strengthening nuclear security globally, and leading coordination of international activities in this field. ''We encourage all States to maintain highly effective nuclear security, including physical protection, for all nuclear and other radioactive material, their transport, use and storage and their associated facilities, as well as protecting sensitive information and maintaining the necessary nuclear security systems and measures to assess and manage their nuclear security effectively,'' the

Cholesterol negatively regulates IL-9-producing CD8+ T cell differentiation and antitumor activity.

Science.gov (United States)

Ma, Xingzhe; Bi, Enguang; Huang, Chunjian; Lu, Yong; Xue, Gang; Guo, Xing; Wang, Aibo; Yang, Maojie; Qian, Jianfei; Dong, Chen; Yi, Qing

2018-05-09

CD8 + T cells can be polarized into IL-9-secreting (Tc9) cells. We previously showed that adoptive therapy using tumor-specific Tc9 cells generated stronger antitumor responses in mouse melanoma than classical Tc1 cells. To understand why Tc9 cells exert stronger antitumor responses, we used gene profiling to compare Tc9 and Tc1 cells. Tc9 cells expressed different levels of cholesterol synthesis and efflux genes and possessed significantly lower cholesterol content than Tc1 cells. Unique to Tc9, but not other CD8 + or CD4 + T cell subsets, manipulating cholesterol content in polarizing Tc9 cells significantly affected IL-9 expression and Tc9 differentiation and antitumor response in vivo. Mechanistic studies showed that IL-9 was indispensable for Tc9 cell persistence and antitumor effects, and cholesterol or its derivatives inhibited IL-9 expression by activating liver X receptors (LXRs), leading to LXR Sumoylation and reduced p65 binding to Il9 promoter. Our study identifies cholesterol as a critical regulator of Tc9 cell differentiation and function. © 2018 Ma et al.

Activation of c-MET induces a stem-like phenotype in human prostate cancer.

Directory of Open Access Journals (Sweden)

Geert J L H van Leenders

Full Text Available Prostate cancer consists of secretory cells and a population of immature cells. The function of immature cells and their mutual relation with secretory cells are still poorly understood. Immature cells either have a hierarchical relation to secretory cells (stem cell model or represent an inducible population emerging upon appropriate stimulation of differentiated cells. Hepatocyte Growth Factor (HGF receptor c-MET is specifically expressed in immature prostate cells. Our objective is to determine the role of immature cells in prostate cancer by analysis of the HGF/c-MET pathway.Gene-expression profiling of DU145 prostate cancer cells stimulated with HGF revealed induction of a molecular signature associated with stem cells, characterized by up-regulation of CD49b, CD49f, CD44 and SOX9, and down-regulation of CD24 ('stem-like signature'. We confirmed the acquisition of a stem-like phenotype by quantitative PCR, FACS analysis and Western blotting. Further, HGF led to activation of the stem cell related Notch pathway by up-regulation of its ligands Jagged-1 and Delta-like 4. Small molecules SU11274 and PHA665752 targeting c-MET activity were both able to block the molecular and biologic effects of HGF. Knock-down of c-MET by shRNA infection resulted in significant reduction and delay of orthotopic tumour-formation in male NMRI mice. Immunohistochemical analysis in prostatectomies revealed significant enrichment of c-MET positive cells at the invasive front, and demonstrated co-expression of c-MET with stem-like markers CD49b and CD49f.In conclusion, activation of c-MET in prostate cancer cells induced a stem-like phenotype, indicating a dynamic relation between differentiated and stem-like cells in this malignancy. Its mediation of efficient tumour-formation in vivo and predominant receptor expression at the invasive front implicate that c-MET regulates tumour infiltration in surrounding tissues putatively by acquisition of a stem-like phenotype.

Marital status, labour force activity and mortality: A study of the United States and 6 European countries

Science.gov (United States)

van Hedel, Karen; van Lenthe, Frank J; Avendano, Mauricio; Bopp, Matthias; Esnaola, Santiago; Kovács, Katalin; Martikainen, Pekka; Regidor, Enrique; Mackenbach, Johan P

2015-01-01

Aims Labour force activity and marriage share some of the pathways through which they potentially influence health. In this paper, we examine whether marriage and labour force participation interact in the way they influence mortality in the United States and six European countries. Methods We used data from the US National Health Interview Survey linked to the National Death Index, and national mortality registry data for Austria, England/Wales, Finland, Hungary, Norway and Spain (Basque country) during 1999-2007 for men and women aged 30-59 at baseline. Poisson regression was used to estimate both additive (the relative excess risk due to interaction) and multiplicative interactions between marriage and labour force activity on mortality. Results Labour force inactivity was associated with higher mortality, but this association was stronger for unmarried than married individuals. Likewise, being unmarried was associated with higher mortality, but this association was stronger for inactive than for active individuals. To illustrate, among US women out of the labour force, being unmarried was associated with a 3.98 (95%CI:3.28-4.82) times higher risk of dying than being married, whereas the relative risk was 2.49 (95%CI:2.10-2.94) for women active in the labour market. Although this interaction between marriage and labour force activity was only significant for women on a multiplicative scale, there was a significant additive interaction for both men and women. The pattern was similar across all countries. Conclusions Marriage attenuates the increased mortality risk associated with labour force inactivity, while labour force activity attenuates the mortality risk associated with being unmarried. Our study emphasizes the importance of public health and social policies that improve the health and well-being of men and women who are both unmarried and inactive. PMID:25868643

Eugenol-loaded chitosan nanoparticles: II. Application in bio-based plastics for active packaging.

Science.gov (United States)

Woranuch, Sarekha; Yoksan, Rangrong

2013-07-25

The aim of the present research was to study the possibility of using eugenol-loaded chitosan nanoparticles as antioxidants for active bio-based packaging material. Eugenol-loaded chitosan nanoparticles were incorporated into thermoplastic flour (TPF) - a model bio-based plastic - through an extrusion process at temperatures above 150°C. The influences of eugenol-loaded chitosan nanoparticles on crystallinity, morphology, thermal properties, radical scavenging activity, reducing power, tensile properties and barrier properties of TPF were investigated. Although the incorporation of 3% (w/w) of eugenol-loaded chitosan nanoparticles significantly reduced the extensibility and the oxygen barrier property of TPF, it provided antioxidant activity and improved the water vapor barrier property. In addition, TPF containing eugenol-loaded chitosan nanoparticles exhibited superior radical scavenging activity and stronger reducing power compared with TPF containing naked eugenol. The results suggest the applicability of TPF containing eugenol-loaded chitosan nanoparticles as an antioxidant active packaging material. Copyright © 2012 Elsevier Ltd. All rights reserved.

Complex active travel bout motivations: Gender, place, and social context associations.

Science.gov (United States)

Brown, Barbara B; Smith, Ken R

2017-09-01

Active travel bouts are healthy, but bout-specific motives, social, and physical contexts have been poorly characterized. Adults (n= 421 in 2012, 436 in 2013) described their moderate activity bouts over the past week, aided by accelerometry/GPS data integration. Participants viewed maps indicating date, time, and starting and ending locations of their past week moderate-to-vigorous active travel bouts of 3 or more minutes. These prompts helped participants recall their social and physical contexts and motives for the bouts. Three bout motivations were modeled: leisure, transportation, and their "T-L" difference scores (transportation minus leisure scores). Blends of leisure and transportation motives characterized most bouts, even though most studies do not allow participants to endorse multiple motives for their active travel. Bouts were often neighborhood-based. Leisure motives were related to pleasant place perceptions, homes, and exercise places; workplaces were associated with stronger transportation and T-L bout motives. Women's bout motives were more closely associated with place than men's. Our novel method of individual bout assessment can illuminate the social-ecological contexts and experiences of everyday healthy bouts of activity.

A Stronger EU in Cosmos: Embracing the Concept of Space Security

Directory of Open Access Journals (Sweden)

Peter PINDJÁK

2016-09-01

Full Text Available The recently unveiled EU Global Strategy for Foreign and Security Policy presents bold and ambitious plans in several increasingly important domains for Europe, including outer space. The EU has committed itself to securing an autonomous access to space, providing security for its space-based assets, and promoting the adoption of a voluntary code of conduct in space. With the evolving dynamics in astropolitics, space security has become an ever more important aspect of space activities. Clearly, the EU has a vested interest in space security, whereas space-enabled services form an important part of European economy and contribute to effective implementation of its energy policy, migration, border control as well as domestic and international crisis management. Since the EU is currently in the process of drafting a European Space Strategy, it should seize the opportunity to take stock of its existing space programs and lay out a promising way forward. Besides reinforcing the existing Copernicus and Galileo programs and further developing the Governmental Satellite Communications (GOVSATCOM project, the EU should make a significant investment in space security, particularly through boosting its Space Surveillance and Tracking (SST capabilities and actively working on the international fora to promote a responsible behavior in outer space that could be eventually transformed into a voluntary international code of conduct. Through a comprehensive space policy and by reinforcing its autonomy in outer space, the EU will not only strengthen its foreign and security policy, but also reconfirm its relevant role in global affairs.

The reinforcing value and liking of resistance training and aerobic exercise as predictors of adult's physical activity.

Science.gov (United States)

Flack, Kyle D; Johnson, LuAnn; Roemmich, James N

2017-10-01

Reinforcing value (motivating value) is a stronger predictor than hedonic value (liking) for engaging in drug use, gambling, and eating. The associations of reinforcing value and liking with physical activity of adults have not yet been studied and may depend on the modes of exercise (e.g., aerobic/cardiovascular exercise, resistance training) under consideration. The purpose of this study was to test associations of the reinforcing value and liking of aerobic exercise training (AT) and resistance exercise training (RT) modes of exercise with usual participation in aerobic and resistance exercise in adults. Men (n=38) and women (n=50) were measured for their liking and relative reinforcing value (RRV) of AT and RT, for their usual vigorous physical activity (VPA) participation, and for usual resistance exercise behavior (Yale physical activity questionnaire). The RRV of AT (RRVAT) and liking of AT were correlated, (r=0.22, pvalue for, but not the liking of, a mode of exercise predicted how much an individual engaged in that mode of exercise. RRVAT (p˂0.01) was positively associated with usual VPA. RRVRT (p˂0.01) was positively associated with RT behavior. The hedonic value of AT and of RT were not associated (p>0.30) with VPA or RT behavior. Reinforcing value of a mode of exercise is a stronger predictor than the liking of that mode of exercise for usual amount of participation in the exercise. Published by Elsevier Inc.

Just watching the game ain't enough: striatal fMRI reward responses to successes and failures in a video game during active and vicarious playing.

Science.gov (United States)

Kätsyri, Jari; Hari, Riitta; Ravaja, Niklas; Nummenmaa, Lauri

2013-01-01

Although the multimodal stimulation provided by modern audiovisual video games is pleasing by itself, the rewarding nature of video game playing depends critically also on the players' active engagement in the gameplay. The extent to which active engagement influences dopaminergic brain reward circuit responses remains unsettled. Here we show that striatal reward circuit responses elicited by successes (wins) and failures (losses) in a video game are stronger during active than vicarious gameplay. Eleven healthy males both played a competitive first-person tank shooter game (active playing) and watched a pre-recorded gameplay video (vicarious playing) while their hemodynamic brain activation was measured with 3-tesla functional magnetic resonance imaging (fMRI). Wins and losses were paired with symmetrical monetary rewards and punishments during active and vicarious playing so that the external reward context remained identical during both conditions. Brain activation was stronger in the orbitomedial prefrontal cortex (omPFC) during winning than losing, both during active and vicarious playing. In contrast, both wins and losses suppressed activations in the midbrain and striatum during active playing; however, the striatal suppression, particularly in the anterior putamen, was more pronounced during loss than win events. Sensorimotor confounds related to joystick movements did not account for the results. Self-ratings indicated losing to be more unpleasant during active than vicarious playing. Our findings demonstrate striatum to be selectively sensitive to self-acquired rewards, in contrast to frontal components of the reward circuit that process both self-acquired and passively received rewards. We propose that the striatal responses to repeated acquisition of rewards that are contingent on game related successes contribute to the motivational pull of video-game playing.

Just watching the game ain’t enough: Striatal fMRI reward responses to successes and failures in a video game during active and vicarious playing

Directory of Open Access Journals (Sweden)

Jari eKätsyri

2013-06-01

Full Text Available Although the multimodal stimulation provided by modern audiovisual video games is pleasing by itself, the rewarding nature of video game playing depends critically also on the players’ active engagement in the gameplay. The extent to which active engagement influences dopaminergic brain reward circuit responses remains unsettled. Here we show that striatal reward circuit responses elicited by successes (wins and failures (losses in a video game are stronger during active than vicarious gameplay. Eleven healthy males both played a competitive first-person tank shooter game (active playing and watched a pre-recorded gameplay video (vicarious playing while their hemodynamic brain activation was measured with 3-tesla functional magnetic resonance imaging (fMRI. Wins and losses were paired with symmetrical monetary rewards and punishments during active and vicarious playing so that the external reward context remained identical during both conditions. Brain activation was stronger in the orbitomedial prefrontal cortex (omPFC during winning than losing, both during active and vicarious playing conditions. In contrast, both wins and losses suppressed activations in the midbrain and striatum during active playing; however, the striatal suppression, particularly in the anterior putamen, was more pronounced during loss than win events. Sensorimotor confounds related to joystick movements did not account for the results. Self-ratings indicated losing to be more unpleasant during active than vicarious playing. Our findings demonstrate striatum to be selectively sensitive to self-acquired rewards, in contrast to frontal components of the reward circuit that process both self-acquired and passively received rewards. We propose that the striatal responses to repeated acquisition of rewards that are contingent on game related successes contribute to the motivational pull of video-game playing.

Oscillatory theta activity during memory formation and its impact on overnight consolidation: a missing link?

Science.gov (United States)

Heib, Dominik P J; Hoedlmoser, Kerstin; Anderer, Peter; Gruber, Georg; Zeitlhofer, Josef; Schabus, Manuel

2015-08-01

Sleep has been shown to promote memory consolidation driven by certain oscillatory patterns, such as sleep spindles. However, sleep does not consolidate all newly encoded information uniformly but rather "selects" certain memories for consolidation. It is assumed that such selection depends on salience tags attached to the new memories before sleep. However, little is known about the underlying neuronal processes reflecting presleep memory tagging. The current study sought to address the question of whether event-related changes in spectral theta power (theta ERSP) during presleep memory formation could reflect memory tagging that influences subsequent consolidation during sleep. Twenty-four participants memorized 160 word pairs before sleep; in a separate laboratory visit, they performed a nonlearning control task. Memory performance was tested twice, directly before and after 8 hr of sleep. Results indicate that participants who improved their memory performance overnight displayed stronger theta ERSP during the memory task in comparison with the control task. They also displayed stronger memory task-related increases in fast sleep spindle activity. Furthermore, presleep theta activity was directly linked to fast sleep spindle activity, indicating that processes during memory formation might indeed reflect memory tagging that influences subsequent consolidation during sleep. Interestingly, our results further indicate that the suggested relation between sleep spindles and overnight performance change is not as direct as once believed. Rather, it appears to be mediated by processes beginning during presleep memory formation. We conclude that theta ERSP during presleep memory formation reflects cortico-hippocampal interactions that lead to a better long-term accessibility by tagging memories for sleep spindle-related reprocessing.

Dextromethorphan mediated bitter taste receptor activation in the pulmonary circuit causes vasoconstriction.

Directory of Open Access Journals (Sweden)

Jasbir D Upadhyaya

Full Text Available Activation of bitter taste receptors (T2Rs in human airway smooth muscle cells leads to muscle relaxation and bronchodilation. This finding led to our hypothesis that T2Rs are expressed in human pulmonary artery smooth muscle cells and might be involved in regulating the vascular tone. RT-PCR was performed to reveal the expression of T2Rs in human pulmonary artery smooth muscle cells. Of the 25 T2Rs, 21 were expressed in these cells. Functional characterization was done by calcium imaging after stimulating the cells with different bitter agonists. Increased calcium responses were observed with most of the agonists, the largest increase seen for dextromethorphan. Previously in site-directed mutational studies, we have characterized the response of T2R1 to dextromethorphan, therefore, T2R1 was selected for further analysis in this study. Knockdown with T2R1 specific shRNA decreased mRNA levels, protein levels and dextromethorphan-induced calcium responses in pulmonary artery smooth muscle cells by up to 50%. To analyze if T2Rs are involved in regulating the pulmonary vascular tone, ex vivo studies using pulmonary arterial and airway rings were pursued. Myographic studies using porcine pulmonary arterial and airway rings showed that stimulation with dextromethorphan led to contraction of the pulmonary arterial and relaxation of the airway rings. This study shows that dextromethorphan, acting through T2R1, causes vasoconstrictor responses in the pulmonary circuit and relaxation in the airways.

Associations between physical activity and physical and mental health--a HUNT 3 study.

Science.gov (United States)

Bertheussen, Gro F; Romundstad, Pål R; Landmark, Tormod; Kaasa, Stein; Dale, Ola; Helbostad, Jorunn L

2011-07-01

Health-related quality of life (HRQoL) has been characterized as the ultimate goal for health interventions such as physical activity (PA). We assessed how frequency, duration, and intensity of PA were related to HRQoL in younger (physical and mental health. HRQoL was measured by SF-8 Health Survey. Frequency and duration were assessed by items validated in a previous HUNT study, and intensity was assessed by Borg RPE scale. Associations between PA and physical and mental health were estimated using general linear modeling. A total of 4500 participants (56% females), age 19-91 yr, with mean age of 53±15 yr, were included. Of these, 40% were less active than recommended by international guidelines. In general, mean physical health (PCS-8) in females and males was 47.4±9.7 and 48.8±8.9, and mental health (MCS-8) was 50.5±8.0 and 51.9±7.3, respectively. Age-adjusted association between PA and HRQoL was stronger for physical than mental health in both genders and age groups. The largest differences were between no exercise and exercise groups at any level for frequency, duration, and intensity of PA. We found no substantial gender differences in association between PA and HRQoL, but association was stronger in older (≥65 yr) than younger (physical and mental health in both genders compared with no exercise, particularly among the older individuals.

Anterior/posterior competitive deactivation/activation dichotomy in the human hippocampus as revealed by a 3D navigation task.

Directory of Open Access Journals (Sweden)

Isabel Catarina Duarte

Full Text Available Anterior/posterior long axis specialization is thought to underlie the organization of the hippocampus. However it remains unclear whether antagonistic mechanisms differentially modulate processing of spatial information within the hippocampus. We used fMRI and a virtual reality 3D paradigm to study encoding and retrieval of spatial memory during active visuospatial navigation, requiring positional encoding and retrieval of object landmarks during the path. Both encoding and retrieval elicited BOLD activation of the posterior most portion of hippocampus, while concurrent deactivations (recently shown to reflect decreases in neural responses were found in the most anterior regions. Encoding elicited stronger activity in the posterior right than the left hippocampus. The former structure also showed significantly stronger activity for allocentric vs. egocentric processing during retrieval. The anterior vs. posterior pattern mimics, from a functional point, although at much distinct temporal scales, the previous anatomical findings in London taxi drivers, whereby posterior enlargement was found at the cost of an anterior decrease, and the mirror symmetric findings observed in blind people, in whom the right anterior hippocampus was found to be larger, at the cost of a smaller posterior hippocampus, as compared with sighted people. In sum, we found a functional dichotomy whereby the anterior/posterior hippocampus shows antagonistic processing patterns for spatial encoding and retrieval of 3D spatial information. To our knowledge, this is the first study reporting such a dynamical pattern in a functional study, which suggests that differential modulation of neural responses within the human hippocampus reflects distinct roles in spatial memory processing.

MicroRNA-129-5p inhibits the development of autoimmune encephalomyelitis-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway.

Science.gov (United States)

Liu, Ai-Hua; Wu, Ya-Ting; Wang, Yu-Ping

2017-06-01

The study aimed to explore the effects of microRNA-129-5p (miR-129-5p) on the development of autoimmune encephalomyelitis (AE)-related epilepsy by targeting HMGB1 through the TLR4/NF-kB signaling pathway in a rat model. AE-related epilepsy models were established. Sprague-Dawley (SD) rats were randomly divided into control, model, miR-129-5p mimics, miR-129-5p inhibitor, HMGB1 shRNA, TLR4/NF-kB (TLR4/NF-kB signaling pathway was inhibited) and miR-129-5p mimics+HMGB1 shRNA groups respectively. Latency to a first epilepsy seizure attack was recorded. Neuronal injuries in the hippocampus regions were detected using HE, Nissl and FJB staining methods 24h following model establishment. Microglial cells were detected by OX-42 immunohistochemistry. Expressions of miR-129-5p, HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by qRT-PCR. Protein expressions of HMGB1 and TLR4/NF-kB signaling pathway-related proteins were detected by Western blotting. Dual luciferase reporter gene assay showed that miR-129-5p was negatively targeting HMGB1. Neurons of hippocampal tissues in rats were heavily injured by an injection of lithium chloride. Compared with the model and control groups, neuronal injury of the hippocampus and AE-related epilepsy decreased and microglial cells increased in the miR-129-5p mimics, HMGB1 shRNA and TLR4/NF-kB groups; however, in the miR-129-5p inhibitor group, miR-129-5p expression decreased, HMGB1 expression increased, TLR4/NF-kB signaling pathway was activated, latency to a first epilepsy seizure attack was shortened, and neuronal injury increased. This study provides evidence that miR-129-5p inhibits the development of AE-related epilepsy by suppressing HMGB1 expression and inhibiting TLR4/NF-kB signaling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Activation of human stearoyl-coenzyme A desaturase 1 contributes to the lipogenic effect of PXR in HepG2 cells.

Directory of Open Access Journals (Sweden)

Jun Zhang

Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.

A stronger perfume for LPG

International Nuclear Information System (INIS)

Willcox, C.K.

1996-01-01

The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

Bad is stronger than good

NARCIS (Netherlands)

Baumeister, R.F.; Bratslavsky, E.; Finkenauer, C.; Vohs, K.D.

2001-01-01

The greater power of bad events over good ones is found in everyday events, major life events (e.g., trauma), close relationship outcomes, social network patterns, interpersonal interactions, and learning processes. Bad emotions, bad parents, and bad feedback have more impact than good ones, and bad

Are melanized feather barbs stronger?

Science.gov (United States)

Butler, Michael; Johnson, Amy S

2004-01-01

Melanin has been associated with increased resistance to abrasion, decreased wear and lowered barb breakage in feathers. But, this association was inferred without considering barb position along the rachis as a potentially confounding variable. We examined the cross-sectional area, breaking force, breaking stress, breaking strain and toughness of melanized and unmelanized barbs along the entire rachis of a primary feather from an osprey (Pandion haliaetus). Although breaking force was higher for melanized barbs, breaking stress (force divided by cross-sectional area) was greater for unmelanized barbs. But when position was considered, all mechanical differences between melanized and unmelanized barbs disappeared. Barb breaking stress, breaking strain and toughness decreased, and breaking stiffness increased, distally along the rachis. These proximal-distal material property changes are small and seem unlikely to affect flight performance of barbs. Our observations of barb bending, breaking and morphology, however, lead us to propose a design principle for barbs. We propose that, by being thicker-walled dorso-ventrally, the barb's flexural stiffness is increased during flight; but, by allowing for twisting when loaded with dangerously high forces, barbs firstly avoid failure by bending and secondly avoid complete failure by buckling rather than rupturing.

A stronger perfume for LPG

Energy Technology Data Exchange (ETDEWEB)

Willcox, C.K.

1996-11-01

The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

Working Longer Makes Students Stronger?

DEFF Research Database (Denmark)

Jensen, Vibeke Myrup

Abstract: Despite much discussion on the role of education policy on school and student performance, we know little about the effects of school spending at the margin on student cognitive achievement beyond the effects of class size. Thus this paper examines the effects of annual ninth grade...... classroom hours in literacy and maths on ninth grade (aged 16) student performance in writing and maths, respectively. Using population data for Denmark in 2003-2006, I exploit unique policy-induced variation in classroom hours.On average, the reform changed classroom hours by 2.2-3.3% in literacy and maths...

Metabolic remodeling precedes mitochondrial outer membrane permeabilization in human glioma xenograft cells.

Science.gov (United States)

Ponnala, Shivani; Chetty, Chandramu; Veeravalli, Krishna Kumar; Dinh, Dzung H; Klopfenstein, Jeffrey D; Rao, Jasti S

2012-02-01

Glioma cancer cells adapt to changing microenvironment and shift from mitochondrial oxidative phosphorylation to aerobic glycolysis for their metabolic needs irrespective of oxygen availability. In the present study, we show that silencing MMP-9 in combination with uPAR/cathepsin B switch the glycolytic metabolism of glioma cells to oxidative phosphorylation (OXPHOS) and generate reactive oxygen species (ROS) to predispose glioma cells to mitochondrial outer membrane permeabilization. shRNA for MMP-9 and uPAR (pMU) as well as shRNA for MMP-9 and cathepsin B (pMC) activated complexes of mitochondria involved in OXPHOS and inhibited glycolytic hexokinase expression. The decreased interaction of hexokinase 2 with mitochondria in the treated cells indicated the inhibition of glycolysis activation. Overexpression of Akt reversed the pMU- and pMC-mediated OXPHOS to glycolysis switch. The OXPHOS un-coupler oligomycin A altered the expression levels of the Bcl-2 family of proteins; treatment with pMU or pMC reversed this effect and induced mitochondrial outer membrane permeabilization. In addition, our results show changes in mitochondrial pore transition to release cytochrome c due to changes in the VDAC-Bcl-XL and BAX-BAK interaction with pMU and pMC treatments. Taken together, our results suggest that pMU and pMC treatments switch glioma cells from the glycolytic to the OXPHOS pathway through an inhibitory effect on Akt, ROS induction and an increase of cytosolic cytochrome c accumulation. These results demonstrate the potential of pMU and pMC as therapeutic candidates for the treatment of glioma.

Von Hippel-Lindau tumor suppressor gene loss in renal cell carcinoma promotes oncogenic epidermal growth factor receptor signaling via Akt-1 and MEK-1.

Science.gov (United States)

Lee, S Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W Marston; Bottaro, Donald P; Vasselli, James R

2008-10-01

Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-alpha (TGF-alpha), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knock-down cells had escaped shRNA suppression. EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen.

Von Hippel-Lindau Tumor Suppressor Gene Loss in Renal Cell Carcinoma Promotes Oncogenic Epidermal Growth Factor Receptor Signaling via Akt-1 and MEK1

Science.gov (United States)

Lee, S. Justin; Lattouf, Jean-Baptiste; Xanthopoulos, Julie; Linehan, W. Marston; Bottaro, Donald P.; Vasselli, James R.

2008-01-01

Objectives Clear-cell renal cell carcinoma (RCC) is the most prevalent form of kidney cancer and is frequently associated with loss of von Hippel-Lindau (VHL) gene function, resulting in the aberrant transcriptional activation of genes that contribute to tumor growth and metastasis, including transforming growth factor-α (TGF-α), a ligand of the epidermal growth factor receptor (EGFR) tyrosine kinase. To determine the functional impact of EGFR activation on RCC, we suppressed critical components of this pathway: EGFR, Akt-1, and MEK-1. Methods Stable transfection of RCC cells with plasmids bearing shRNA directed against each of these genes was used to individually suppress their expression. Transfectants were characterized for growth and invasiveness in vitro and tumorigenesis in vivo. Results RCC cell transfectants displayed significantly reduced growth rate and matrix invasion in vitro and RCC tumor xenograft growth rate in vivo. Analysis of tumor cells that emerged after extended periods in each model showed that significant EGFR suppression was sustained, whereas Akt-1 and MEK-1 knockdown cells had escaped shRNA suppression. Conclusions EGFR, Akt-1, and MEK-1 are individually critical for RCC cell invasiveness in vitro and tumorigenicity in vivo, and even partial suppression of each can have a significant impact on tumor progression. The emergence of transfectants that had escaped Akt-1 and MEK-1 suppression during tumorigenicity experiments suggests that these effectors may each be more critical than EGFR for RCC tumorigenesis, consistent with results from clinical trials of EGFR inhibitors for RCC, where durable clinical responses have not been seen. PMID:18243508

Faster, Stronger, Healthier: Adolescent-Stated Reasons for Dietary Supplementation.

Science.gov (United States)

Zdešar Kotnik, Katja; Jurak, Gregor; Starc, Gregor; Golja, Petra

Examine the underlying reasons and sources of recommendation for dietary supplement (DS) use among adolescents. Cross-sectional analysis of children's development in Slovenia in September to October, 2014. Nationally recruited sample. Adolescents aged 14-19 years enrolled in 15 high schools (n = 1,463). Reasons for and sources of recommendation for DS use, sports club membership, sports discipline, and extent of physical activity (PA) were self-reported data. Chi-square test of independence was performed to compare the prevalence of DS use between groups with different extents of PA and nonathletes/athletes, referring to 11 different reasons and 9 different sources of recommendation for DS use. Use of DS was widespread among adolescents (69%), athletes (76%), and nonathletes (66%). Higher prevalence of supplementation was observed in males, who justified it use for sports performance enhancement and better development and function of muscles. In contrast, females emphasized immune system improvement. Higher extent of PA was associated with a higher prevalence of DS use. This was especially evident in males, who participated in team sports. A high percentage of adolescents (41%) decided on their own to use DS and because of advice from parents or relatives (30%). Several reasons for the widespread use of DS in adolescents were associated with sports participation. Therefore, educational programs regarding DS use should be targeted primarily to adolescents and their parents who are involved in sports, and especially team sports. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

Science.gov (United States)

Lam, Sonia Y; Yeung, Rachel C Y; Yu, Tsz-Ha; Sze, Kong-Hung; Wong, Kam-Bo

2011-03-01

Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity. Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy. Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

Directory of Open Access Journals (Sweden)

Sonia Y Lam

2011-03-01

Full Text Available Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity.Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy.Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

Using perturbations to identify the brain circuits underlying active vision.

Science.gov (United States)

Wurtz, Robert H

2015-09-19

The visual and oculomotor systems in the brain have been studied extensively in the primate. Together, they can be regarded as a single brain system that underlies active vision--the normal vision that begins with visual processing in the retina and extends through the brain to the generation of eye movement by the brainstem. The system is probably one of the most thoroughly studied brain systems in the primate, and it offers an ideal opportunity to evaluate the advantages and disadvantages of the series of perturbation techniques that have been used to study it. The perturbations have been critical in moving from correlations between neuronal activity and behaviour closer to a causal relation between neuronal activity and behaviour. The same perturbation techniques have also been used to tease out neuronal circuits that are related to active vision that in turn are driving behaviour. The evolution of perturbation techniques includes ablation of both cortical and subcortical targets, punctate chemical lesions, reversible inactivations, electrical stimulation, and finally the expanding optogenetic techniques. The evolution of perturbation techniques has supported progressively stronger conclusions about what neuronal circuits in the brain underlie active vision and how the circuits themselves might be organized.

RNAi Knockdown of Hypoxia-Inducible Factor-1α Decreased the Proliferation, Migration, and Invasion of Hypoxic Hepatocellular Carcinoma Cells.

Science.gov (United States)

Chen, ChengShi; Liu, Rong; Wang, JianHua; Yan, ZhiPing; Qian, Sheng; Zhang, Wei

2015-04-01

The obstruction of hepatic arterial blood flow results in tumor tissue hypoxia and elevated expression of hypoxia-inducible factor-1alpha (HIF-1α). Our study evaluated whether lentivirus-mediated short interference RNA against HIF-1α inhibits proliferation, invasion, and migration of hepatocellular carcinoma (HCC) cells under hypoxia. RNA interference knockdown of HIF-1α was achieved by HIF-1α-directed lentiviral shRNA, in a rat HCC cell line cultured under hypoxia condition for varying length of times. The expression levels of HIF-1α and vascular endothelial growth factor were examined using reverse transcription polymerase chain reaction and western blot analyses. Cell proliferation, migration, and invasion were measured by cell viability, transwell migration, and invasion assays, respectively. Inhibition of HIF-1α expression by shRNA suppressed vascular endothelial growth factor mRNA and protein levels under both normoxia and hypoxia. It also suppressed cell migration and invasion, which were enhanced under hypoxic conditions. RNAi knockdown of HIF-1α further suppressed hypoxia-mediated inhibition of the cell proliferation. These data suggest that shRNA of HIF-1α could antagonize the hypoxia-mediated increase in hepatic cancer cell migration and invasion, and synergize with hypoxia to inhibit the cell proliferation in HCC cells.

Acute stress-induced cortisol elevations mediate reward system activity during subconscious processing of sexual stimuli.

Science.gov (United States)

Oei, Nicole Y L; Both, Stephanie; van Heemst, Diana; van der Grond, Jeroen

2014-01-01

Stress is thought to alter motivational processes by increasing dopamine (DA) secretion in the brain's "reward system", and its key region, the nucleus accumbens (NAcc). However, stress studies using functional magnetic resonance imaging (fMRI), mainly found evidence for stress-induced decreases in NAcc responsiveness toward reward cues. Results from both animal and human PET studies indicate that the stress hormone cortisol may be crucial in the interaction between stress and dopaminergic actions. In the present study we therefore investigated whether cortisol mediated the effect of stress on DA-related responses to -subliminal-presentation of reward cues using the Trier Social Stress Test (TSST), which is known to reliably enhance cortisol levels. Young healthy males (n = 37) were randomly assigned to the TSST or control condition. After stress induction, brain activation was assessed using fMRI during a backward-masking paradigm in which potentially rewarding (sexual), emotionally negative and neutral stimuli were presented subliminally, masked by pictures of inanimate objects. A region of interest analysis showed that stress decreased activation in the NAcc in response to masked sexual cues (voxel-corrected, pcortisol levels were related to stronger NAcc activation, showing that cortisol acted as a suppressor variable in the negative relation between stress and NAcc activation. The present findings indicate that cortisol is crucially involved in the relation between stress and the responsiveness of the reward system. Although generally stress decreases activation in the NAcc in response to rewarding stimuli, high stress-induced cortisol levels suppress this relation, and are associated with stronger NAcc activation. Individuals with a high cortisol response to stress might on one hand be protected against reductions in reward sensitivity, which has been linked to anhedonia and depression, but they may ultimately be more vulnerable to increased reward

[Characteristics of fugitive dust emission from paved road near construction activities].

Science.gov (United States)

Tian, Gang; Fan, Shou-Bin; Li, Gang; Qin, Jian-Ping

2007-11-01

Because of the mud/dirt carryout from construction activities, the silt loading of paved road nearby is higher and the fugitive dust emission is stronger. By sampling and laboratory analysis of the road surface dust samples, we obtain the silt loading (mass of material equal to or less than 75 micromaters in physical diameter per unit area of travel surface) of paved roads near construction activities. The result show that silt loading of road near construction activities is higher than "normal road", and silt loading is negatively correlated with length from construction's door. According to AP-42 emission factor model of fugitive dust from roads, the emission factor of influenced road is 2 - 10 times bigger than "normal road", and the amount of fugitive dust emission influenced by one construction activity is "equivalent" to an additional road length of approximately 422 - 3 800 m with the baseline silt loading. Based on the spatial and temporal distribution of construction activities, in 2002 the amount of PM10 emission influenced by construction activities in Beijing city areas account of for 59% of fugitive dust from roads.

Calpastatin is regulated by protein never in mitosis gene A interacting-1 (PIN1) in endothelial cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Tongzheng, E-mail: liu.tongzheng@mayo.edu [Division of Oncology Research, Department of Oncology, Mayo Clinic, Rochester, MN 55905 (United States); Schneider, Ryan A., E-mail: schneiderr@findlay.edu [College of Pharmacy, The University of Findlay, Findlay, OH 45840 (United States); Hoyt, Dale G., E-mail: hoyt.27@osu.edu [The Dorothy M. Davis Heart and Lung Research Institute, and the Division of Pharmacology, College of Pharmacy, The Ohio State University, 500 West Twelfth Avenue, Columbus, OH 43210 (United States)

2011-10-28

Highlights: Black-Right-Pointing-Pointer Depletion of PIN1 increases inhibitory effect of calpastatin against calpain in endothelial cells. Black-Right-Pointing-Pointer PIN1 associates with calpastatin. Black-Right-Pointing-Pointer PIN1, but not mutants, reduces the inhibitory activity of calpastatin in vitro. Black-Right-Pointing-Pointer Depletion of calpastatin shows that it is required for PIN1 depletion to reduce calpain activity. -- Abstract: The peptidyl-proline isomerase, protein never in mitosis gene A interacting-1 (PIN1) binds and isomerizes proteins phosphorylated on serine/threonine before a proline. It was previously found that depletion of PIN1 greatly increased induction of cyclooxygenase-2 and inducible nitric oxide synthase by lowering calpain activity in murine aortic endothelial cells (MAEC). Here we investigated the effect of PIN1 on the endogenous inhibitor of heterodimeric {mu}- and m-calpains, calpastatin. MAEC were transduced with small hairpin (sh) RNA to knock down PIN1 (KD) or an inactive Control shRNA. Cells were also treated with non-targeted double stranded small inhibitory RNA (siRNA) or siRNA designed to deplete calpastatin. Despite reducing calpain activity, PIN1 KD did not significantly affect the expression of {mu}- and m-calpains, or calpastatin, compared to Control shRNA. Instead, depletion of PIN1 increased the inhibitory activity of calpastatin. Calpastatin co-immunoprecipitated with endogenous PIN1 and was pulled down with glutathione-S-transferase (GST)-PIN1 fusion protein. Adding GST-PIN1 to KD cell extracts lacking PIN1 reduced calpastatin inhibitory activity. Substrate binding and catalytic domain mutants of PIN1 failed to do so. These results suggest that protein interaction and the proline isomerase functions of PIN1 are required for it to inhibit calpastatin. Furthermore, depletion of calpastatin raised calpain activity and reduced calpain inhibitory activity to similar levels in KD and Control MAEC, indicating that

Calpastatin is regulated by protein never in mitosis gene A interacting-1 (PIN1) in endothelial cells

International Nuclear Information System (INIS)

Liu, Tongzheng; Schneider, Ryan A.; Hoyt, Dale G.

2011-01-01

Highlights: ► Depletion of PIN1 increases inhibitory effect of calpastatin against calpain in endothelial cells. ► PIN1 associates with calpastatin. ► PIN1, but not mutants, reduces the inhibitory activity of calpastatin in vitro. ► Depletion of calpastatin shows that it is required for PIN1 depletion to reduce calpain activity. -- Abstract: The peptidyl-proline isomerase, protein never in mitosis gene A interacting-1 (PIN1) binds and isomerizes proteins phosphorylated on serine/threonine before a proline. It was previously found that depletion of PIN1 greatly increased induction of cyclooxygenase-2 and inducible nitric oxide synthase by lowering calpain activity in murine aortic endothelial cells (MAEC). Here we investigated the effect of PIN1 on the endogenous inhibitor of heterodimeric μ- and m-calpains, calpastatin. MAEC were transduced with small hairpin (sh) RNA to knock down PIN1 (KD) or an inactive Control shRNA. Cells were also treated with non-targeted double stranded small inhibitory RNA (siRNA) or siRNA designed to deplete calpastatin. Despite reducing calpain activity, PIN1 KD did not significantly affect the expression of μ- and m-calpains, or calpastatin, compared to Control shRNA. Instead, depletion of PIN1 increased the inhibitory activity of calpastatin. Calpastatin co-immunoprecipitated with endogenous PIN1 and was pulled down with glutathione-S-transferase (GST)–PIN1 fusion protein. Adding GST–PIN1 to KD cell extracts lacking PIN1 reduced calpastatin inhibitory activity. Substrate binding and catalytic domain mutants of PIN1 failed to do so. These results suggest that protein interaction and the proline isomerase functions of PIN1 are required for it to inhibit calpastatin. Furthermore, depletion of calpastatin raised calpain activity and reduced calpain inhibitory activity to similar levels in KD and Control MAEC, indicating that calpastatin is required for PIN1 depletion to lower calpain activity. Thus, PIN1 apparently restrains

Antimicrobial activity and some phytochemical analysis of two extracts Vinca minor L.

Directory of Open Access Journals (Sweden)

Grujić Sandra M.

2014-01-01

Full Text Available This study investigated the antimicrobial activity as well as some phytochemical analysis of ethanol and diethyl ether extracts from plant species Vinca minor L. In vitro antimicrobial activity of extracts was studied on 20 strains of microorganisms (16 bacteria and four yeasts. Testing was performed by microdilution method and minimum inhibitory concentration (MIC and minimum microbicidal concentration (MMC were determined. The strongest antimicrobial activity was detected on G+ bacteria of the genus Bacillus. Tested G- bacteria and yeasts were not sensitive to the action of the extracts or the sensitivity was insignificant. Phytochemical analysis involved determining the amount of total phenolics, flavonoids and tannins, as well as the determination of antioxidant activity monitoring capability to neutralize free radicals (DPPH and the reductive potential. Phytochemical examination indicates that the total phenolic compounds were more in the ethanolic extract and the content of flavonoids and tannins marginally higher in the diethyl ether extract. The antioxidant activity (DPPH of the ethanolic extract of V. minor was significantly stronger as compared to the diethyl ether extract, and the reduction potential was approximately the same.

Antioxidant and immunological activities of polysaccharides from Gentiana scabra Bunge roots.

Science.gov (United States)

Wang, Zhanyong; Wang, Chenyu; Su, Tingting; Zhang, Jing

2014-11-04

Two polysaccharide fractions, GSP I-a and GSP II-b, were isolated from Gentiana scabra Bunge roots. Both GSP I-a and GSP II-b comprised seven monosaccharides: fructose, mannose, rhamnose, galacturonic acid, glucose, galactose, and fucose. Ultraviolet and infrared analyses show that GSP I-a and GSP II-b are proteoglycans. In vitro evaluation of the antioxidant activity suggests that GSP I-a and GSP II-b scavenge 1,1-diphenyl-2-picrylhydrazyl radicals. However, the scavenging activity of the latter is stronger than that of the former. GSP I-a and GSP II-b have relatively low reducing powers and scavenging activities toward superoxide anions and hydroxyls. GSP I-a and GSP II-b significantly increase lymphocyte proliferation when lipopolysaccharide is used as a mitogen for lymphocytes, but only GSP I-a can significantly increase lymphocyte proliferation within the test-dosage range when concanavalin A is used as a mitogen. Copyright © 2014 Elsevier Ltd. All rights reserved.

Atmospheric mass-loss of extrasolar planets orbiting magnetically active host stars

Science.gov (United States)

Lalitha, Sairam; Schmitt, J. H. M. M.; Dash, Spandan

2018-06-01

Magnetic stellar activity of exoplanet hosts can lead to the production of large amounts of high-energy emission, which irradiates extrasolar planets, located in the immediate vicinity of such stars. This radiation is absorbed in the planets' upper atmospheres, which consequently heat up and evaporate, possibly leading to an irradiation-induced mass-loss. We present a study of the high-energy emission in the four magnetically active planet-bearing host stars, Kepler-63, Kepler-210, WASP-19, and HAT-P-11, based on new XMM-Newton observations. We find that the X-ray luminosities of these stars are rather high with orders of magnitude above the level of the active Sun. The total XUV irradiation of these planets is expected to be stronger than that of well-studied hot Jupiters. Using the estimated XUV luminosities as the energy input to the planetary atmospheres, we obtain upper limits for the total mass- loss in these hot Jupiters.

The relevance of cultural activities in ethnic identity among California Native American youth.

Science.gov (United States)

Schweigman, Kurt; Soto, Claradina; Wright, Serena; Unger, Jennifer

2011-01-01

This study analyzed data from a large statewide sample of Native American adolescents throughout California to determine whether participation in cultural practices was associated with stronger ethnic identity. The Multigroup Ethnic Identity Measure (MEIM) scale was used to measure the ethnic identity of 945 Native American adolescents (416 male, 529 female) aged 13 - 19 across California. Respondents who participated in cultural activities including pow-wows, sweat lodge, drum group and roundhouse dance reported significantly higher Native American ethnic identity than their counterparts who did not take part in cultural activities. The association between cultural activities and ethnic identity was only significant among urban youth and not among reservation youth. Higher grades in school were associated with ethnic identity among females but not among males. Findings from this study show a strong association between cultural activities and traditional practices with tribal enculturation among Native American youth in California. Cultural-based practices to enhance Native identity could be useful to improve mental and behavioral health among Native American youth.

Active-Reactive Additional Damping Control of a Doubly-Fed Induction Generator Based on Active Disturbance Rejection Control

Directory of Open Access Journals (Sweden)

Yanfeng Ma

2018-05-01

Full Text Available Large-scale wind power interfacing to the power grid has an impact on the stability of the power system. However, with an additional damping controller of the wind generator, new ways for improving system damping and suppressing the low frequency oscillation (LFO of power systems can be put forward. In this paper, an active-reactive power additional damping controller based on active disturbance rejection control (ADRC is proposed. In order to improve the precision of the controller, the theory of data driven control is adopted, using the numerical algorithms for subspace state space system identification (N4SID to obtain the two order model of the ADRC controlled object. Based on the identification model, the ADRC additional damping controller is designed. Taking a 2-area 4-machine system containing the doubly fed induction generator (DFIG wind farm as an example, it is verified that the active-reactive additional damping controller designed in this paper performs well in suppressing negative-damping LFO and forced power oscillation. When the operation state of the power system changes, it can still restrain the LFO effectively, showing stronger robustness and better effectiveness compared to the traditional proportional–integral–derivative (PID additional damping controller.

Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

Science.gov (United States)

Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

2016-01-01

Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

Structure-dependent binding and activation of perfluorinated compounds on human peroxisome proliferator-activated receptor γ

Energy Technology Data Exchange (ETDEWEB)

Zhang, Lianying [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China); College of Life Science, Dezhou University, Dezhou 253023 (China); Ren, Xiao-Min; Wan, Bin [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China); Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn [State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, 18 Shuangqing Road, Beijing 100085 (China)

2014-09-15

Perfluorinated compounds (PFCs) have been shown to disrupt lipid metabolism and even induce cancer in rodents through activation of peroxisome proliferator-activated receptors (PPARs). Lines of evidence showed that PPARα was activated by PFCs. However, the information on the binding interactions between PPARγ and PFCs and subsequent alteration of PPARγ activity is still limited and sometimes inconsistent. In the present study, in vitro binding of 16 PFCs to human PPARγ ligand binding domain (hPPARγ-LBD) and their activity on the receptor in cells were investigated. The results showed that the binding affinity was strongly dependent on their carbon number and functional group. For the eleven perfluorinated carboxylic acids (PFCAs), the binding affinity increased with their carbon number from 4 to 11, and then decreased slightly. The binding affinity of the three perfluorinated sulfonic acids (PFSAs) was stronger than their PFCA counterparts. No binding was detected for the two fluorotelomer alcohols (FTOHs). Circular dichroim spectroscopy showed that PFC binding induced distinctive structural change of the receptor. In dual luciferase reporter assays using transiently transfected Hep G2 cells, PFCs acted as hPPARγ agonists, and their potency correlated with their binding affinity with hPPARγ-LBD. Molecular docking showed that PFCs with different chain length bind with the receptor in different geometry, which may contribute to their differences in binding affinity and transcriptional activity. - Highlights: • Binding affinity between PFCs and PPARγ was evaluated for the first time. • The binding strength was dependent on fluorinated carbon chain and functional group. • PFC binding induced distinctive structural change of the receptor. • PFCs could act as hPPARγ agonists in Hep G2 cells.

Developmental patterns and parental correlates of youth leisure-time physical activity.

Science.gov (United States)

Lam, Chun Bun; McHale, Susan M

2015-02-01

This study examined the developmental patterns and parental correlates of youth leisure-time physical activity from middle childhood through adolescence. On 5 occasions across 7 years, fathers, mothers, and children who were first- and second born from 201 European American, working- and middle-class families participated in home and multiple nightly phone interviews. Multilevel modeling revealed that, controlling for family socioeconomic status, neighborhood characteristics, and youth overweight status and physical health, leisure-time physical activity increased during middle childhood and declined across adolescence, and the decline was more pronounced for girls than for boys. Moreover, controlling for time-varying, parental work hours and youth interest in sports and outdoor activities, on occasions when fathers and mothers spent proportionally more time on these activities with youth than usual, youth also spent more total time on these activities than usual. The within-person association between mother-youth joint involvement and youth's total involvement in leisure-time physical activity reached statistical significance at the transition to adolescence, and became stronger over time. Findings highlight the importance of maintaining adolescents', especially girls', physical activity levels and targeting both fathers' and mothers' involvement to promote youth's physical activity. PsycINFO Database Record (c) 2015 APA, all rights reserved.

Cyclooxygenase-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 in breast cancer cells.

Science.gov (United States)

Chuang, Chun-Wei; Pan, Mei-Ren; Hou, Ming-Feng; Hung, Wen-Chun

2013-02-01

Up-regulation of cyclooxygenase-2 (COX-2) is frequently found in human cancers and is significantly associated with tumor metastasis. Our previous results demonstrate that COX-2 and its metabolite prostaglandin E2 (PGE2) stimulate the expression of CCR7 chemokine receptor via EP2/EP4 receptors to promote lymphatic invasion in breast cancer cells. In this study, we address the underlying mechanism of COX-2/PGE2-induced CCR7 expression. We find that COX-2/PGE2 increase CCR7 expression via the AKT signaling pathway in breast cancer cells. Promoter deletion and mutation assays identify the Sp1 site located at the -60/-57 region of CCR7 gene promoter is critical for stimulation. Chromatin immunoprecipitation (ChIP) assay confirms that in vivo binding of Sp1 to human CCR7 promoter is increased by COX-2 and PGE2. Knockdown of Sp1 by shRNA reduces the induction of CCR7 by PGE2. We demonstrate for the first time that AKT may directly phosphorylate Sp1 at S42, T679, and S698. Phosphorylation-mimic Sp1 protein harboring S42D, T679D, and S698D mutation strongly activates CCR7 expression. In contrast, change of these three residues to alanine completely blocks the induction of CCR7 by PGE2. Pathological investigation demonstrates that CCR7 expression is strongly associated with phospho-AKT and Sp1 in 120 breast cancer tissues. Collectively, our results demonstrate that COX-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 and this pathway is highly activated in metastatic breast cancer. Copyright © 2012 Wiley Periodicals, Inc.

Variations in Essential Oil Yield, Composition, and Antioxidant Activity of Different Plant Organs from Blumea balsamifera (L.) DC. at Different Growth Times.

Science.gov (United States)

Yuan, Yuan; Huang, Mei; Pang, Yu-Xin; Yu, Fu-Lai; Chen, Ce; Liu, Li-Wei; Chen, Zhen-Xia; Zhang, Ying-Bo; Chen, Xiao-Lu; Hu, Xuan

2016-08-05

Blumea balsamifera, also named Ainaxiang, is widely used as an ancient medicinal herb in tropical and subtropical Asia. It is rich in essential oils. In this work the essential oils of B. balsamifera from different plant organs and in different months were extracted, and then analyzed by gas chromatography-mass spectrometry. The results showed that essential oil yield of young leaves was the highest (0.65 mL/100 g), followed by mature leaves (0.57 mL/100 g), and the oil yield was higher in October (0.47 mL/100 g) than other months. A total of 44 compounds were identified, representing 92.64%-96.71% of the oil. Eighteen common chemical components were found among the six plant organs, representing >80% of the oil constituents. l-borneol was the main ingredient in leaves, and its content was the highest in senescent leaves and in December. In the essential oils of young shoots and young stems, the main component was dimethoxydurene. Antioxidant activity was also determined using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and β-carotene bleaching (BCB) assays. The results indicated that the β-carotene bleaching activity was far stronger than the DPPH radical-scavenging capacity, and the young leaves and young shoots showed stronger antioxidant activity. Dimethoxydurene, β-caryophyllene, and α-caryophyllene play a positive role in good antioxidant activity, while β-eudesmol, phytol, and tetradecanal play a negative role. The antioxidant activity revealed in this study might help in developing this promising bioresource for use in the medicinal and cosmetic industries.

Superantigen and HLA-DR ligation induce phospholipase-C gamma 1 activation in class II+ T cells

DEFF Research Database (Denmark)

Kanner, S B; Odum, Niels; Grosmaire, L

1992-01-01

Bacterial enterotoxin superantigens bind directly to HLA class II molecules (HLA-DR) expressed on both APC and activated human T cells, and simultaneously bind to certain V beta chains of the TCR. In this report, we compared early T cell signaling events in human alloantigen-stimulated T cells when...... activated by HLA-DR ligation through antibody cross-linking or by direct enterotoxin superantigen binding. Both types of stimuli induced tyrosine phosphorylation of phosphatidylinositol-specific phospholipase C gamma 1 (PLC gamma 1) and an increase in intracellular calcium concentration; however......, superantigen-induced signaling was stronger than class II ligation alone. Antibody-mediated ligation of HLA-DR with CD3 resulted in augmented PLC gamma 1 activation and increased calcium mobilization, consistent with a mechanism of superantigen activity through a combination of class II and CD3/Ti signals...

Antioxidant Activity of Mulberry Fruit Extracts

Science.gov (United States)

Arfan, Muhammad; Khan, Rasool; Rybarczyk, Anna; Amarowicz, Ryszard

2012-01-01

Phenolic compounds were extracted from the fruits of Morus nigra and Morus alba using methanol and acetone. The sugar-free extracts (SFEs) were prepared using Amberlite XAD-16 column chromatography. All of the SFEs exhibited antioxidant potential as determined by ABTS (0.75–1.25 mmol Trolox/g), DPPH (2,2-diphenyl-1-picrylhydrazyl) (EC50 from 48 μg/mL to 79 μg/mL), and reducing power assays. However, a stronger activity was noted for the SFEs obtained from Morus nigra fruits. These extracts also possessed the highest contents of total phenolics: 164 mg/g (methanolic SFE) and 173 mg/g (acetonic SFE). The presence of phenolic acids and flavonoids in the extracts was confirmed using HPLC method and chlorogenic acid and rutin were found as the dominant phenolic constituents in the SFEs. PMID:22408465

Antioxidant Activity of Mulberry Fruit Extracts

Directory of Open Access Journals (Sweden)

Ryszard Amarowicz

2012-02-01

Full Text Available Phenolic compounds were extracted from the fruits of Morus nigra and Morus alba using methanol and acetone. The sugar-free extracts (SFEs were prepared using Amberlite XAD-16 column chromatography. All of the SFEs exhibited antioxidant potential as determined by ABTS (0.75–1.25 mmol Trolox/g, DPPH (2,2-diphenyl-1-picrylhydrazyl (EC50 from 48 μg/mL to 79 μg/mL, and reducing power assays. However, a stronger activity was noted for the SFEs obtained from Morus nigra fruits. These extracts also possessed the highest contents of total phenolics: 164 mg/g (methanolic SFE and 173 mg/g (acetonic SFE. The presence of phenolic acids and flavonoids in the extracts was confirmed using HPLC method and chlorogenic acid and rutin were found as the dominant phenolic constituents in the SFEs.

Optical limiting properties of optically active phthalocyanine derivatives

Science.gov (United States)

Wang, Peng; Zhang, Shuang; Wu, Peiji; Ye, Cheng; Liu, Hongwei; Xi, Fu

2001-06-01

The optical limiting properties of four optically active phthalocyanine derivatives in chloroform solutions and epoxy resin thin plates were measured at 532 nm with 10 ns pulses. The excited state absorption cross-section σex and refractive-index cross-section σr were determined with the Z-scan technique. These chromophores possess larger σex than the ground state absorption cross-section σ0, indicating that they are the potential materials for reverse saturable absorption (RSA). The negative σr values of these chromophores add to the thermal contribution, producing a larger defocusing effect, which may be helpful in further enhancing their optical limiting performance. The optical limiting responses of the thin plate samples are stronger than those of the chloroform solutions.

Emission activity of the Be star 60 Cygni

Directory of Open Access Journals (Sweden)

Šejnová K.

2017-01-01

Full Text Available In this paper we present results of spectroscopic analysis of the H® line profile of the Be star 60 Cygni. We present time evolution of the equivalent width of the H® line profiles during years 1992 - 2016 and V=R variation during years 1995 - 2016. We analyzed data from Ondřejov Observatory and from BeSS Database. The circumstellar disk of the star was present twice during years 1992 - 2016 and the second cycle shows stronger emission activity. We found out that the formation of the disk takes longer time than the disk extinction (the extinction is much steeper than the formation and that there is no evident period of changes in the V=R variation.

Inhibition of Rac1 ameliorates neuronal oxidative stress damage via reducing Bcl-2/Rac1 complex formation in mitochondria through PI3K/Akt/mTOR pathway.

Science.gov (United States)

Pan, Yundan; Wang, Na; Xia, Pingping; Wang, E; Guo, Qulian; Ye, Zhi

2018-02-01

Although the neuroprotective effects of Rac1 inhibition have been reported in various cerebral ischemic models, the molecular mechanisms of action have not yet been fully elucidated. In this study, we investigated whether the inhibition of Rac1 provided neuroprotection in a diabetic rat model of focal cerebral ischemia and hyperglycemia-exposed PC-12 cells. Intracerebroventricular administration of lentivirus expressing the Rac1 small hairpin RNA (shRNA) and specific Rac1 inhibitor NSC23766 not only decreased the infarct volumes and improved neurologic deficits with a correlated significant activation of mitochondrial DNA specific proteins, such as OGG1 and POLG, but also elevated Bcl-2 S70 phosphorylation in mitochondria. Furthermore, the levels of p-PI3K, p-Akt and p-mTOR increased, while 8-OHdG, ROS production and Bcl-2/Rac1 complex formation in mitochondria reduced in both Rac1-shRNA- and NSC23766-treated rats. Moreover, to confirm our in vivo observations, inhibition of Rac1 activity by NSC23766 suppressed the interactions between Bcl-2 and Rac1 in the mitochondria of PC-12 cells cultured in high glucose conditions and protected PC-12 cells from high glucose-induced neurotoxicity. More importantly, these beneficial effects of Rac1 inhibition were abolished by PI3K inhibitor LY294002. In contrast to NSC23766 treatment, LY294002 had little effect on the decrement of p-PTEN level. Taken together, these findings revealed novel neuroprotective roles of Rac1 inhibition against cerebral ischemic reperfusion injury in vivo and high glucose-induced neurotoxicity in PC-12 cells in vitro, by reducing Bcl-2/Rac1 complex formation in mitochondria through the activation of PI3K/Akt/mTOR survival pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

IKKα/CHUK regulates extracellular matrix remodeling independent of its kinase activity to facilitate articular chondrocyte differentiation.

Directory of Open Access Journals (Sweden)

Eleonora Olivotto

Full Text Available BACKGROUND: The non-canonical NF-κB activating kinase IKKα, encoded by CHUK (conserved-helix-loop-helix-ubiquitous-kinase, has been reported to modulate pro- or anti- inflammatory responses, cellular survival and cellular differentiation. Here, we have investigated the mechanism of action of IKKα as a novel effector of human and murine chondrocyte extracellular matrix (ECM homeostasis and differentiation towards hypertrophy. METHODOLOGY/PRINCIPAL FINDINGS: IKKα expression was ablated in primary human osteoarthritic (OA chondrocytes and in immature murine articular chondrocytes (iMACs derived from IKKα(f/f:CreERT2 mice by retroviral-mediated stable shRNA transduction and Cre recombinase-dependent Lox P site recombination, respectively. MMP-10 was identified as a major target of IKKα in chondrocytes by mRNA profiling, quantitative RT-PCR analysis, immunohistochemistry and immunoblotting. ECM integrity, as assessed by type II collagen (COL2 deposition and the lack of MMP-dependent COL2 degradation products, was enhanced by IKKα ablation in mice. MMP-13 and total collagenase activities were significantly reduced, while TIMP-3 (tissue inhibitor of metalloproteinase-3 protein levels were enhanced in IKKα-deficient chondrocytes. IKKα deficiency suppressed chondrocyte differentiation, as shown by the quantitative inhibition of.Alizarin red staining and the reduced expression of multiple chondrocyte differentiation effectors, including Runx2, Col10a1 and Vegfa,. Importantly, the differentiation of IKKα-deficient chondrocytes was rescued by a kinase-dead IKKα protein mutant. CONCLUSIONS/SIGNIFICANCE: IKKα acts independent of its kinase activity to help drive chondrocyte differentiation towards a hypertrophic-like state. IKKα positively modulates ECM remodeling via multiple downstream targets (including MMP-10 and TIMP-3 at the mRNA and post-transcriptional levels, respectively to maintain maximal MMP-13 activity, which is required for ECM

Autophagy downregulation contributes to insulin resistance mediated injury in insulin receptor knockout podocytes in vitro

Directory of Open Access Journals (Sweden)

Ying Xu

2016-04-01

Full Text Available It is unknown whether autophagy activity is altered in insulin resistant podocytes and whether autophagy could be a therapeutic target for diabetic nephropathy (DN. Here we used shRNA transfection to knockdown the insulin receptor (IR gene in cultured human immortalized podocytes as an in vitro insulin resistant model. Autophagy related proteins LC3, Beclin, and p62 as well as nephrin, a podocyte injury marker, were assessed using western blot and immunofluorescence staining. Our results show that autophagy is suppressed when podocytes lose insulin sensitivity and that treatment of rapamycin, an mTOR specific inhibitor, could attenuate insulin resistance induced podocytes injury via autophagy activation. The present study deepens our understanding of the role of autophagy in the pathogenesis of DN.

Upregulation of EMMPRIN (OX47 in Rat Dorsal Root Ganglion Contributes to the Development of Mechanical Allodynia after Nerve Injury

Directory of Open Access Journals (Sweden)

Qun Wang

2015-01-01

Full Text Available Matrix metalloproteinases (MMPs are widely implicated in inflammation and tissue remodeling associated with various neurodegenerative diseases and play an important role in nociception and allodynia. Extracellular Matrix Metalloproteinase Inducer (EMMPRIN plays a key regulatory role for MMP activities. However, the role of EMMPRIN in the development of neuropathic pain is not clear. Western blotting, real-time quantitative RT-PCR (qRT-PCR, and immunofluorescence were performed to determine the changes of messenger RNA and protein of EMMPRIN/OX47 and their cellular localization in the rat dorsal root ganglion (DRG after nerve injury. Paw withdrawal threshold test was examined to evaluate the pain behavior in spinal nerve ligation (SNL model. The lentivirus containing OX47 shRNA was injected into the DRG one day before SNL. The expression level of both mRNA and protein of OX47 was markedly upregulated in ipsilateral DRG after SNL. OX47 was mainly expressed in the extracellular matrix of DRG. Administration of shRNA targeted against OX47 in vivo remarkably attenuated mechanical allodynia induced by SNL. In conclusion, peripheral nerve injury induced upregulation of OX47 in the extracellular matrix of DRG. RNA interference against OX47 significantly suppressed the expression of OX47 mRNA and the development of mechanical allodynia. The altered expression of OX47 may contribute to the development of neuropathic pain after nerve injury.

Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

Science.gov (United States)

Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

2015-01-01

Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

Dual oxidase maturation factor 1 (DUOXA1) overexpression increases reactive oxygen species production and inhibits murine muscle satellite cell differentiation.

Science.gov (United States)

Sandiford, Shelley D E; Kennedy, Karen A M; Xie, Xiaojun; Pickering, J Geoffrey; Li, Shawn S C

2014-01-11

Dual oxidase maturation factor 1 (DUOXA1) has been associated with the maturation of the reactive oxygen species (ROS) producing enzyme, dual oxidase 1 (DUOX1) in the adult thyroid. However, ROS have also been implicated in the development of several tissues. We found that activated muscle satellite cells and primary myoblasts isolated from mice express robust levels of DUOXA1 and that its levels are altered as cells differentiate. To determine whether DUOXA1 levels affect muscle differentiation, we used an adenoviral construct (pCMV5-DUOXA1-GFP) to drive constitutive overexpression of this protein in primary myoblasts. High levels of DUOXA1 throughout myogenesis resulted in enhanced H2O2 production, fusion defects, reduced expression of early (myogenin) and late (myosin heavy chain) markers of differentiation, and elevated levels of apoptosis compared to control cells infected with an empty adenoviral vector (pCMV5-GFP). DUOXA1 knockdown (using a DUOXA1 shRNA construct) resulted in enhanced differentiation compared to cells subjected to a control shRNA, and subjecting DUOXA1 overexpressing cells to siRNAs targeting DUOX1 or apoptosis signal-regulating kinase 1 (ASK1) rescued the phenotype. This study represents the first to demonstrate the importance of DUOXA1 in skeletal muscle myoblasts and that DUOXA1 overexpression in muscle stem cells induces apoptosis and inhibits differentiation through DUOX1 and ASK1.

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

Science.gov (United States)

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

Structural Characterization and Evaluation of the Antioxidant Activity of Phenolic Compounds from Astragalus taipaishanensis and Their Structure-Activity Relationship

Science.gov (United States)

Pu, Wenjun; Wang, Dongmei; Zhou, Dan

2015-09-01

Eight phenolic compounds were isolated using bio-guided isolation and purified from the roots of Astragalus taipaishanensis Y. C. Ho et S. B. Ho (A. taipaishanensis) for the first time. Their structures were elucidated by ESI-MS, HR-ESI-MS, 1D-NMR and 2D-NMR as 7,2‧-dihydroxy-3‧,4‧-dimethoxy isoflavan (1), formononetin (2), isoliquiritigenin (3), quercetin (4), kaempferol (5), ononin (6), p-hydroxybenzoic acid (7) and vanillic acid (8). Six flavonoids (compounds 1-6) exhibited stronger antioxidant activities (determined by DPPH, ABTS, FRAP and lipid peroxidation inhibition assays) than those of BHA and TBHQ and also demonstrated noticeable protective effects (particularly quercetin and kaempferol) on Escherichia coli under oxidative stress. Additionally, the chemical constituents compared with those of Astragalus membranaceus and the structure-activity relationship of the isolated compounds were both analyzed. The results clearly demonstrated that A. taipaishanensis has the potential to be selected as an alternative medicinal and food plant that can be utilized in health food products, functional tea and pharmaceutical products.

Enhanced anti-tumor activity of a new curcumin-related compound against melanoma and neuroblastoma cells

Directory of Open Access Journals (Sweden)

Pastorino Fabio

2010-06-01

Full Text Available Abstract Background Sharing the common neuroectodermal origin, melanoma and neuroblastoma are tumors widely diffused among adult and children, respectively. Clinical prognosis of aggressive neuroectodermal cancers remains dismal, therefore the search for novel therapies against such tumors is warranted. Curcumin is a phytochemical compound widely studied for its antioxidant, anti-inflammatory and anti-cancer properties. Recently, we have synthesized and tested in vitro various curcumin-related compounds in order to select new anti-tumor agents displaying stronger and selective growth inhibition activity on neuroectodermal tumors. Results In this work, we have demonstrated that the new α,β-unsaturated ketone D6 was more effective in inhibiting tumor cells growth when compared to curcumin. Normal fibroblasts proliferation was not affected by this treatment. Clonogenic assay showed a significant dose-dependent reduction in both melanoma and neuroblastoma colony formation only after D6 treatment. TUNEL assay, Annexin-V staining, caspases activation and PARP cleavage unveiled the ability of D6 to cause tumor cell death by triggering apoptosis, similarly to curcumin, but with a stronger and quicker extent. These apoptotic features appear to be associated with loss of mitochondrial membrane potential and cytochrome c release. In vivo anti-tumor activity of curcumin and D6 was surveyed using sub-cutaneous melanoma and orthotopic neuroblastoma xenograft models. D6 treated mice exhibited significantly reduced tumor growth compared to both control and curcumin treated ones (Melanoma: D6 vs control: P and D6 vs curcumin P Neuroblastoma: D6 vs both control and curcumin: P . Conclusions Our data indicate D6 as a good candidate to develop new therapies against neural crest-derived tumors.

Small molecule activators of the Nrf2-HO-1 antioxidant axis modulate heme metabolism and inflammation in BV2 microglia cells.

Science.gov (United States)

Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto

2013-10-01

The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

Density regulation in Northeast Atlantic fish populations: Density dependence is stronger in recruitment than in somatic growth.

Science.gov (United States)

Zimmermann, Fabian; Ricard, Daniel; Heino, Mikko

2018-05-01

Population regulation is a central concept in ecology, yet in many cases its presence and the underlying mechanisms are difficult to demonstrate. The current paradigm maintains that marine fish populations are predominantly regulated by density-dependent recruitment. While it is known that density-dependent somatic growth can be present too, its general importance remains unknown and most practical applications neglect it. This study aimed to close this gap by for the first time quantifying and comparing density dependence in growth and recruitment over a large set of fish populations. We fitted density-dependent models to time-series data on population size, recruitment and age-specific weight from commercially exploited fish populations in the Northeast Atlantic Ocean and the Baltic Sea. Data were standardized to enable a direct comparison within and among populations, and estimated parameters were used to quantify the impact of density regulation on population biomass. Statistically significant density dependence in recruitment was detected in a large proportion of populations (70%), whereas for density dependence in somatic growth the prevalence of density dependence depended heavily on the method (26% and 69%). Despite age-dependent variability, the density dependence in recruitment was consistently stronger among age groups and between alternative approaches that use weight-at-age or weight increments to assess growth. Estimates of density-dependent reduction in biomass underlined these results: 97% of populations with statistically significant parameters for growth and recruitment showed a larger impact of density-dependent recruitment on population biomass. The results reaffirm the importance of density-dependent recruitment in marine fishes, yet they also show that density dependence in somatic growth is not uncommon. Furthermore, the results are important from an applied perspective because density dependence in somatic growth affects productivity and

Effects of muscle activation on shear between human soleus and gastrocnemius muscles.

Science.gov (United States)

Finni, T; Cronin, N J; Mayfield, D; Lichtwark, G A; Cresswell, A G

2017-01-01

Lateral connections between muscles provide pathways for myofascial force transmission. To elucidate whether these pathways have functional roles in vivo, we examined whether activation could alter the shear between the soleus (SOL) and lateral gastrocnemius (LG) muscles. We hypothesized that selective activation of LG would decrease the stretch-induced shear between LG and SOL. Eleven volunteers underwent a series of knee joint manipulations where plantar flexion force, LG, and SOL muscle fascicle lengths and relative displacement of aponeuroses between the muscles were obtained. Data during a passive full range of motion were recorded, followed by 20° knee extension stretches in both passive conditions and with selective electrical stimulation of LG. During active stretch, plantar flexion force was 22% greater (P stronger (stiffer) connectivity between the two muscles, at least at flexed knee joint angles, which may serve to facilitate myofascial force transmission. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Rheological behavior of alkali-activated metakaolin during geo-polymerization

International Nuclear Information System (INIS)

Poulesquen, A.; Frizon, F.; Lambertin, D.

2011-01-01

The dynamic rheological behavior of geo-polymers, inorganic materials synthesized by activation of an aluminosilicate source by an alkaline solution, is described. The pastes studied were mixtures of an activation solution (alkali + silica) and metakaolin. The influence of the activation solution (NaOH vs. KOH), the silica (Aerosil vs. Tixosil), and the temperature on the evolution of the elastic modulus (G') and viscous modulus (G') over time were studied in the linear viscoelastic range. The results show that the nature of the silica has little influence on the viscous and elastic moduli when the geo-polymer is activated by KOH, and that the setting time is faster with sodium hydroxide and at higher temperatures regardless of the geo-polymer. In addition, during geo-polymerization the stepwise variation of the modulus values indicates that the formation of the 3D network occurs in several steps. Moreover, geo-polymers activated by potassium hydroxide exhibit slower kinetics but the interactions between constituents are stronger, as the loss tangent (tanδ = G''/G') is lower. Finally, the maximum loss tangent, tanδ, was also used as a criterion to determine the temperature dependence of the geo-polymers synthesized. This criterion is a precursor of the transition to the glassy state. The activation energies could thus be determined for the geo-polymers synthesized with potassium hydroxide or sodium hydroxide. (authors)

Effect of activated carbon and electrolyte on properties of supercapacitor

Institute of Scientific and Technical Information of China (English)

无

2007-01-01

Effect of activated carbon and electrolyte on electrochemical properties of organic supercapacitor was investigated. The results show that specific surface area and mesoporosity of activated carbon influence specific capacitance. If specific surface area is larger and mesoporosity is higher, the specific capacitance will become bigger. Specific surface area influences resistance of carbon electrode and consequently influences power property and pore size distribution. If specific surface area is smaller and mesoporosity is higher, the power property will become better. Ash influences leakage current and electrochemical cycling stability. If ash content is lower, the performance will become better. The properties of supercapacitor highly depend on the electrolyte. The compatibility of electrolyte and activated carbon is a determining factor of supercapacitor's working voltage. LiPF6/(EC+EMC+DMC) is inappropriate for double layer capacitor. MeEt3NPF4/PC has higher specific capacitance than EtnNPFn/PC because methyl's electronegativity value is lower than ethyl and MeEt3N+ has more positive charges and stronger polarizability than Et4N+ when an ethyl is substituted by methyl.

Comparative study of the hemolytic and cytotoxic activities of nematocyst venoms from the jellyfish Cyanea nozakii Kishinouye and Nemopilema nomurai Kishinouye

Science.gov (United States)

Pang, Min; Xu, Jintao; Liu, Yunlong; Zhang, Xuelei

2017-10-01

Two species of jellyfish, Cyanea nozakii Kishinouye and Nemopilema nomurai Kishinouye, have occurred off coastal areas of the northeastern China Sea, Yellow Sea, and Bohai Sea in recent years. They influence marine ecosystem safety and fishery production, and also pose a risk to human health. The current study examined the hemolytic and cytotoxic activities of crude venoms extracted from the nematocysts of C. nozakii and N. nomurai. The results showed that there were more nematocysts on tentacles from C. nozakii than on tentacles of the same length from N. nomurai. The protein concentration per nematocyst extracted from N. nomurai was higher than that from C. nozakii. Both nematocyst venoms showed dose- and time-dependent hemolytic activity on erythrocytes from chicken, pigeon, and sheep, with sheep erythrocytes being the most sensitive, with EC50 values of 69.69 and 63.62 μg/mL over a 30-min exposure with N. nomurai and C. nozakii nematocyst venoms, respectively. A cytotoxic assay of both jellyfish venoms on A431 human epidermal carcinoma cells resulted in IC50 values of 68.6 and 40.9 μg/mL after 24-h incubation, respectively, with venom from C. nozakii showing stronger cytotoxic activity than that from N. nomurai. The results of current study indicate that nematocyst venom from C. nozakii had stronger hemolytic and cytotoxic activities than that from N. nomurai and, thus, C. nozakii might be more harmful to the health of humans and other species than are N. nomurai when they appear in coastal waters.

Chitosan/Carboxymethylcellulose/Ionic Liquid/Ag(0) Nanoparticles Form a Membrane with Antimicrobial Activity

International Nuclear Information System (INIS)

Quadros, C.; Faria, V.W.; Scheeren, C.W.; Klein, M.P.; Hertz, P.F.

2013-01-01

Silver metal nanoparticles were immobilized in chitosan/carboxymethylcellulose/BMI.BF4(1-n-butyl-3-methylimidazolium tetrafluoroborate ionic liquid) (CS/CMC/IL) to form polymeric membrane with 20 μm thickness. The CS/CMC/IL polymeric membrane was prepared using a simple solution blending method. Irregularly shaped Ag(0) nanoparticles with monomodal size distributions of nm Ag(0) were immobilized in the membrane. The presence of small Ag(0) nanoparticles induced an augmentation in the CS/CMC/IL film surface areas. The CS/CMC/IL membrane containing Ag(0) showed increase antimicrobial activity the Ag(0) concentration increased up to saturation at 10 mg. CS/CMC/IL membrane that contains Ag(0) nanoparticles has enhanced durability of the membrane and exhibited stronger antimicrobial activity against Escherichia coli and Staphylococcus aureus.

Areva. Group dynamics and activities. Competitive environment and strategic perspectives. Release - October 2016

International Nuclear Information System (INIS)

2016-10-01

After a synthesis which notably proposes a SWOT analysis of the Areva group, this report proposes a presentation of the Areva Group (general overview, mining, upstream and downstream poles, shareholder structure and stock market data, competitive environment). It gives an overview of the Areva group dynamics and of its activities through a presentation of an environment analysis (world electric power production, uranium production and consumption, operated nuclear plants in the world), a presentation of the group activity (turnover and order backlog, turnover per segment and per geographical area, operational and net income). It indicates important events and comments development axes: strategic orientations, new partnership with EDF, stronger presence in China, asset disposal, and organisation optimisation. Financial data are presented along with the main economic and financial indicators. Important statistical data are provided

Associations between gross motor skills and physical activity in Australian toddlers.

Science.gov (United States)

Veldman, Sanne L C; Jones, Rachel A; Santos, Rute; Sousa-Sá, Eduarda; Pereira, João R; Zhang, Zhiguang; Okely, Anthony D

2018-08-01

Physical activity can be promoted by high levels of gross motor skills. A systematic review found a positive relationship in children (3-18 years) but only few studies examined this in younger children. The aim of this study was to examine the association between gross motor skills and physical activity in children aged 11-29 months. Cross-sectional study. This study involved 284 children from 30 childcare services in NSW, Australia (Mean age=19.77±4.18months, 53.2% boys). Physical activity was measured using accelerometers (Actigraph GT3X+). Gross motor skills were assessed using the Peabody Developmental Motor Scales Second Edition (PDMS-2). Multilevel linear regression analyses were computed to assess associations between gross motor skills and physical activity, adjusting for sex, age and BMI. Children spent 53.08% of their time in physical activity and 10.39% in moderate to vigorous physical activity (MVPA). Boys had higher total physical activity (pskills score was 96.16. Boys scored higher than girls in object manipulation (pskills and total physical activity or MVPA. Although gross motor skills were not associated with physical activity in this sample, stronger associations are apparent in older children. This study therefore highlights a potential important age to promote gross motor skills. Copyright © 2017 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.