WorldWideScience

Sample records for stronger shrna activity

  1. Stronger activation of SREBP-1a by nucleus-localized HBx

    International Nuclear Information System (INIS)

    Wu, Qi; Qiao, Ling; Yang, Jian; Zhou, Yan; Liu, Qiang

    2015-01-01

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication

  2. Stronger activation of SREBP-1a by nucleus-localized HBx

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Qi [VIDO-InterVac, Veterinary Microbiology, University of Saskatchewan, Saskatoon (Canada); Qiao, Ling [VIDO-InterVac, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Yang, Jian [Drug Discovery Group, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Zhou, Yan [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [VIDO-InterVac, Veterinary Microbiology, Vaccinology and Immunotherapeutics, University of Saskatchewan, Saskatoon, Saskatchewan (Canada)

    2015-05-08

    We previously showed that hepatitis B virus (HBV) X protein activates the sterol regulatory element-binding protein-1a (SREBP-1a). Here we examined the role of nuclear localization of HBx in this process. In comparison to the wild-type and cytoplasmic HBx, nuclear HBx had stronger effects on SREBP-1a and fatty acid synthase transcription activation, intracellular lipid accumulation and cell proliferation. Furthermore, nuclear HBx could activate HBV enhancer I/X promoter and was more effective on up-regulating HBV mRNA level in the context of HBV replication than the wild-type HBx, while the cytoplasmic HBx had no effect. Our results demonstrate the functional significance of the nucleus-localized HBx in regulating host lipogenic pathway and HBV replication. - Highlights: • Nuclear HBx is more effective on activating SREBP-1a and FASN transcription. • Nuclear HBx is more effective on enhancing intracellular lipid accumulation. • Nuclear HBx is more effective on enhancing cell proliferation. • Nuclear HBx up-regulates HBV enhancer I/X promoter activity. • Nuclear HBx increases HBV mRNA level in the context of HBV replication.

  3. Exercise training raises daily activity stronger than predicted from exercise capacity in patients with COPD.

    Science.gov (United States)

    Behnke, Michaela; Wewel, Alexandra R; Kirsten, Detlef; Jörres, Rudolf A; Magnussen, Helgo

    2005-06-01

    The 6-min walking (6MWD) and 6-min treadmill distance (6MTD) are often used as measures of exercise performance in patients with COPD. The aim of our study was to assess their relationship to daily activity in the course of an exercise training program. Eighty-eight patients with stable COPD (71m/17f; mean +/- SD age, 60 +/-8 year; FEV1, 43+/-14% pred) were recruited, 66 of whom performed a hospital-based 10-day walking training, whereas 22 were treated as control. On day 16MTD, and on days 8 and 10, 6MTD and 6MWD were determined. In addition, patients used an accelerometer (TriTrac-R3D) to record 24 h-activity, whereby training sessions were excluded. In both groups there was a linear relationship (r > or = 0.84 and P daily activity did not markedly vary with exercise capacity under baseline conditions. Participation in a training program increased activity significantly stronger than predicted from the gain in exercise capacity. This underlines the importance of non-physiological, patient-centered factors associated with training in COPD.

  4. Physical activity, obesity and mortality: does pattern of physical activity have stronger epidemiological associations?

    DEFF Research Database (Denmark)

    Bauman, Adrian E.; Grunseit, Anne C.; Rangul, Vegar

    2017-01-01

    Background: Most studies of physical activity (PA) epidemiology use behaviour measured at a single time-point. We examined whether 'PA patterns' (consistently low, consistently high or inconsistent PA levels over time) showed different epidemiological relationships for anthropometric and mortality...... and time 3, and sport and active travel at times 1 and 2 with BMI, waist, hip circumference and mortality (death from coronary heart disease (CHD) and cardiovascular disease (CVD)) were compared to 'PA patterns' spanning multiple time points. PA pattern classified participants' PA as either 1) inactive......: The moderately and highly active groups for PA at times 1 and 3 had up to 1.7 cm lower increase in waist circumference compared with the inactive/low active group. Across 'PA patterns', 'active maintainers' had a 2.0 cm lower waist circumference than 'inactive/low maintainers'. Waist circumference was inversely...

  5. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    ajl yemi

    2011-10-26

    Oct 26, 2011 ... was then selected, while the titer of lentiviral packing PLD2-shRNA was 3.47 × 104 TU/ml and the virus was successfully ... MATERIALS AND METHODS .... such as: transfecting cells not only in mitotic active phase but also in ...

  6. Stronger synergies

    CERN Multimedia

    Antonella Del Rosso

    2012-01-01

    CERN was founded 58 years ago under the auspices of UNESCO. Since then, both organisations have grown to become world leaders in their respective fields. The links between the two have always existed but today they are even stronger, with new projects under way to develop a more efficient way of exchanging information and devise a common strategy on topics of mutual interest.   CERN and UNESCO are a perfect example of natural partners: their common field is science and education is one of the pillars on which both are built. Historically, they share a common heritage. Both UNESCO and CERN were born of the desire to use scientific cooperation to rebuild peace and security in the aftermath of the Second World War. "Recently, building on our common roots and in close collaboration with UNESCO, we have been developing more structured links to ensure the continuity of the actions taken over the years," says Maurizio Bona, who is in charge of CERN relations with international orga...

  7. Stronger effects of Roundup than its active ingredient glyphosate in damselfly larvae.

    Science.gov (United States)

    Janssens, Lizanne; Stoks, Robby

    2017-12-01

    Pesticides are causing strong decreases in aquatic biodiversity at concentrations assumed safe by legislation. One reason for the failing risk assessment may be strong differences in the toxicity of the active ingredient of pesticides and their commercial formulations. Sublethal effects, especially those on behaviour, have been largely ignored in this context, yet can be equally important as lethal effects at the population and ecosystem levels. Here, we compared the toxicity of the herbicide Roundup and its active ingredient glyphosate on survival, but also on ecologically relevant sublethal traits (life history, behaviour and physiology) in damselfly larvae. Roundup was more toxic than glyphosate with negative effects on survival, behaviour and most of the physiological traits being present at lower concentrations (food intake, escape swimming speed) or even only present (survival, sugar and total energy content and muscle mass) following Roundup exposure. This confirms the toxicity of the surfactant POEA. Notably, also glyphosate was not harmless: a realistic concentration of 2mg/l resulted in reduced growth rate, escape swimming speed and fat content. Our results therefore indicate that the toxicity of Roundup cannot be fully attributed to its surfactant, thereby suggesting that also the new generation of glyphosate-based herbicides with other mixtures of surfactants likely will have adverse effects on non-target aquatic organisms. Ecotoxicological studies comparing the toxicity of active ingredients and their commercial formulations typically ignore behaviour while the here observed differential effects on behaviour likely will negatively impact damselfly populations. Our data highlight that risk assessment of pesticides ignoring sublethal effects may contribute to the negative effects of pesticides on aquatic biodiversity. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Bactericidal activity of LFchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides.

    Science.gov (United States)

    Bolscher, Jan G M; Adão, Regina; Nazmi, Kamran; van den Keybus, Petra A M; van 't Hof, Wim; Nieuw Amerongen, Arie V; Bastos, Margarida; Veerman, Enno C I

    2009-01-01

    The innate immunity factor lactoferrin harbours two antimicrobial moieties, lactoferricin and lactoferrampin, situated in close proximity in the N1 domain of the molecule. Most likely they cooperate in many of the beneficial activities of lactoferrin. To investigate whether chimerization of both peptides forms a functional unit we designed a chimerical structure containing lactoferricin amino acids 17-30 and lactoferrampin amino acids 265-284. The bactericidal activity of this LFchimera was found to be drastically stronger than that of the constituent peptides, as was demonstrated by the need for lower dose, shorter incubation time and less ionic strength dependency. Likewise, strongly enhanced interaction with negatively charged model membranes was found for the LFchimera relative to the constituent peptides. Thus, chimerization of the two antimicrobial peptides resembling their structural orientation in the native molecule strikingly improves their biological activity.

  9. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  10. Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

    Science.gov (United States)

    Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

    2014-01-01

    RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

  11. Bactericidal activity of LFchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides

    NARCIS (Netherlands)

    Bolscher, J.G.M.; Adão, R.; Nazmi, K.; van den Keijbus, P.A.M.; van 't Hof, W.; van Nieuw Amerongen, A.; Bastos, M.; Veerman, E.C.I.

    2009-01-01

    The innate immunity factor lactoferrin harbours two antimicrobial moieties, lactoferricin and lactoferrampin, situated in close proximity in the N1 domain of the molecule. Most likely they cooperate in many of the beneficial activities of lactoferrin. To investigate whether chimerization of both

  12. Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

    International Nuclear Information System (INIS)

    Zhu, Zhuoli; Gan, Xueqi; Fan, Hongyi; Yu, Haiyang

    2015-01-01

    Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

  13. Mechanical stretch endows mesenchymal stem cells stronger angiogenic and anti-apoptotic capacities via NFκB activation

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Zhuoli; Gan, Xueqi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Fan, Hongyi [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China); Department of Applied Mechanics, College of Architecture and Environment, Sichuan University, Chengdu 610065 (China); Yu, Haiyang, E-mail: yhyang6812@foxmail.com [State Key Laboratory of Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu 610041 (China)

    2015-12-25

    Mesenchymal stem cells (MSCs) have been broadly used for tissue regeneration and repair due to their broad differentiation potential and potent paracrine properties such as angiogenic capacity. Strategies to increase their survival rate after transplantation and the angiogenic ability are of priority for the utility of MSCs. In this study, we found that mechanical stretch (10% extension, 30 cycles/min cyclic stretch) preconditioning increase the angiogenic capacity via VEGFA induction. In addition, mechanical stretch also increases the survival rate of mesenchymal stem cells under nutrients deprivation. Consistent with the increase VEGFA expression and resistance to apoptosis, nuclear localization of NFκB activity p65 increased upon mechanical stretch. Inhibition of NFκB activity by BAY 11-708 blocks the pro-angiogenesis and anti-apoptosis function of mechanical stretch. Taken together, our findings here raise the possibility that mechanical stretch preconditioning might enhance the therapeutic efficacy of mesenchymal stem cells. - Highlights: • Mechanical stretch increases the angiogenic capacity via VEGFA induction in MSCs. • Mechanical stretch increases the survival rate of MSCs under nutrients deprivation. • Mechanical stretch manipulates MSCs via the activation of NFκB.

  14. Construction of lentiviral shRNA expression vector targeting ...

    African Journals Online (AJOL)

    DNA oligo was cloned into lentiviral expression vector, and then polymerase chain reaction (PCR) and sequencing analyses were conducted to verify the constructs. The verified vectors were co-transfected into 293FT cells that could produce lentiviral. shRNA lentiviruses from the selected constructs were propagated and ...

  15. Stable shRNA Silencing of Lactate Dehydrogenase A (LDHA) in Human MDA-MB-231 Breast Cancer Cells Fails to Alter Lactic Acid Production, Glycolytic Activity, ATP or Survival.

    Science.gov (United States)

    Mack, Nzinga; Mazzio, Elizabeth A; Bauer, David; Flores-Rozas, Hernan; Soliman, Karam F A

    2017-03-01

    In the US, African Americans have a high death rate from triple-negative breast cancer (TNBC), characterized by lack of hormone receptors (ER, PR, HER2/ERRB2) which are otherwise valuable targets of chemotherapy. There is a need to identify novel targets that negatively impact TNBC tumorigenesis. TNBCs release an abundance of lactic acid, under normoxic, hypoxic and hyperoxic conditions; this referred to as the Warburg effect. Accumulated lactic acid sustains peri-cellular acidity which propels metastatic invasion and malignant aggressive transformation. The source of lactic acid is believed to be via conversion of pyruvate by lactate dehydrogenase (LDH) in the last step of glycolysis, with most studies focusing on the LDHA isoform. In this study, LDHA was silenced using long-term MISSION® shRNA lentivirus in human breast cancer MDA-MB-231 cells. Down-regulation of LDHA transcription and protein expression was confirmed by western blot, immunocytochemistry and qPCR. A number of parameters were measured in fully viable vector controls versus knock-down (KD) clones, including levels of lactic acid produced, glucose consumed, ATP and basic metabolic rates. The data show that lentivirus V-165 generated a knock-down clone most effective in reducing both gene and protein levels to less than 1% of vector controls. Stable KD showed absolutely no changes in cell viability, lactic acid production, ATP, glucose consumption or basic metabolic rate. Given the complete absence of impact on any observed parameter by LDH-A KD and this being somewhat contrary to findings in the literature, further analysis was required to determine why. Whole-transcriptome analytic profile on MDA-MB-231 for LDH subtypes using Agilent Human Genome 4×44k microarrays, where the data show the following component breakdown. Transcripts: 30.47 % LDHA, 69.36% LDHB, 0.12% LDHC and 0.05% LDHD. These findings underscore the importance of alternative isoforms of LDH in cancer cells to produce lactic acid

  16. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  17. Analogues of the Frog-skin Antimicrobial Peptide Temporin 1Tb Exhibit a Wider Spectrum of Activity and a Stronger Antibiofilm Potential as Compared to the Parental Peptide

    Science.gov (United States)

    Grassi, Lucia; Maisetta, Giuseppantonio; Maccari, Giuseppe; Esin, Semih; Batoni, Giovanna

    2017-04-01

    The frog skin-derived peptide Temporin 1Tb (TB) has gained increasing attention as novel antimicrobial agent for the treatment of antibiotic-resistant and/or biofilm-mediated infections. Nevertheless, such a peptide possesses a preferential spectrum of action against Gram-positive bacteria. In order to improve the therapeutic potential of TB, the present study evaluated the antibacterial and antibiofilm activities of two TB analogues against medically relevant bacterial species. Of the two analogues, TB_KKG6A has been previously described in the literature, while TB_L1FK is a new analogue designed by us through statistical-based computational strategies. Both TB analogues displayed a faster and stronger bactericidal activity than the parental peptide, especially against Gram-negative bacteria in planktonic form. Differently from the parental peptide, TB_KKG6A and TB_L1FK were able to inhibit the formation of Staphylococcus aureus biofilms by more than 50% at 12 μM, while only TB_KKG6A prevented the formation of Pseudomonas aeruginosa biofilms at 24 μM. A marked antibiofilm activity against preformed biofilms of both bacterial species was observed for the two TB analogues when used in combination with EDTA. Analysis of synergism at the cellular level suggested that the antibiofilm activity exerted by the peptide-EDTA combinations against mature biofilms might be due mainly to a disaggregating effect on the extracellular matrix in the case of S. aureus, and to a direct activity on biofilm-embedded cells in the case of P. aeruginosa. Both analogues displayed a low hemolytic effect at the active concentrations and, overall, TB_L1FK resulted less cytotoxic towards mammalian cells. Collectively, the results obtained demonstrated that subtle changes in the primary sequence of TB may provide TB analogues that, used alone or in combination with adjuvant molecules such as EDTA, exhibit promising features against both planktonic and biofilm cells of medically relevant

  18. Stronger Fire-Resistant Epoxies

    Science.gov (United States)

    Fohlen, George M.; Parker, John A.; Kumar, Devendra

    1988-01-01

    New curing agent improves mechanical properties and works at lower temperature. Use of aminophenoxycyclotriphosphazene curing agents yields stronger, more heat- and fire-resistant epoxy resins. Used with solvent if necessary for coating fabrics or casting films.

  19. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    The origin of a chemical reaction between two reactant atoms is associated with the activation energy, on the assumption that, high-energy collisions between these atoms, are the ones that overcome the activation energy. Here, we show that a stronger attractive van der Waals (vdW) and electron-ion Coulomb interactions ...

  20. Prospects for stronger calandria tubes

    International Nuclear Information System (INIS)

    Ells, C.E.; Coleman, C.E.; Hosbons, R.R.; Ibrahim, E.F.; Doubt, G.L.

    1990-12-01

    The CANDU calandria tubes, made of seam welded and annealed Zircaloy-2, have given exemplary service in-reactor. Although not designed as a system pressure containment, calandria tubes may remain intact even in the face of pressure tube rupture. One such incident at Pickering Unit 2 demonstrated the economic advantage of such an outcome, and a case can be made for increasing the probability that other calandria tubes would perform in a similar fashion. Various methods of obtaining stronger calandria tubes are available, and reviewed here. When the tubes are internally pressurized, the weld is the weak section of the tube. Increasing the oxygen concentration in the starting sheet, and thickening the weld, are promising routes to a stronger tube

  1. Mental health benefits of neighbourhood green space are stronger among physically active adults in middle-to-older age: evidence from 260,061 Australians.

    Science.gov (United States)

    Astell-Burt, Thomas; Feng, Xiaoqi; Kolt, Gregory S

    2013-11-01

    While many studies report that green spaces promote mental health, some suggest the psychological benefits of physical activity are amplified if participation occurs within greener environs. We investigated whether this relationship could be observed among adults in middle-to-older age. Multilevel logit regression was used to investigate association between green space and psychological distress (Kessler scores of 22+) among 260,061 Australians over 45 years old living in New South Wales (2006-2009). Physical activity was measured using the Active Australia survey. Percentage green space was estimated within a 1-kilometre of residence. In comparison to residents of the least green areas, those in the greenest neighbourhoods were at a lower risk of psychological distress (Odds Ratio 0.83, 95% CI: 0.76, 0.92) and were less sedentary (0.81: 0.77, 0.87). An interaction was observed between physical activity and green space (p=0.0028). More green space did not appear to benefit mental health among the least active (0.99: 0.85, 1.15), but there was a protective association for the more physically active (0.82: 0.67, 0.99). For adults in middle-to-older age, green spaces are not only important for promoting physical activity, but the mental health benefits of greener environs appear contingent upon those active lifestyles. © 2013.

  2. Stronger enhancer II/core promoter activities of hepatitis B virus isolates of B2 subgenotype than those of C2 subgenotype.

    Science.gov (United States)

    Qin, Yanli; Zhou, Xueshi; Jia, Haodi; Chen, Chaoyang; Zhao, Weifeng; Zhang, Jiming; Tong, Shuping

    2016-07-27

    Hepatitis B virus (HBV) genotype C causes prolonged chronic infection and increased risk for liver cancer than genotype B. Our previous work revealed lower replication capacity of wild-type genotype C2 than B2 isolates. HBV DNA replication is driven by pregenomic RNA, which is controlled by core promoter (CP) and further augmented by enhancer I (ENI) and enhancer II (ENII). DNA fragments covering these regulatory elements were amplified from B2 and C2 isolates to generate luciferase reporter constructs. As ENII is fully embedded in CP, we inserted HBV DNA fragments in the sense orientation to determine their combined activities, and in the antisense orientation to measure enhancer activities alone. Genotype B2 isolates displayed higher ENI+ENII+CP, ENII+CP, and ENII activities, but not ENI or ENI+ENII activity, than C2 isolates. The higher ENII+CP activity was partly attributable to 4 positions displaying genotype-specific variability. Exchanging CP region was sufficient to revert the replication phenotypes of several B2 and C2 clones tested. These results suggest that a weaker ENII and/or CP at least partly accounts for the lower replication capacities of wild-type C2 isolates, which could drive the subsequent acquisition of CP mutations. Such mutations increase genome replication and are implicated in liver cancer development.

  3. Hypoxia-response plasmid vector producing bcl-2 shRNA enhances the apoptotic cell death of mouse rectum carcinoma.

    Science.gov (United States)

    Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-01-01

    Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].

  4. Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown

    Science.gov (United States)

    Moore, Chris B.; Guthrie, Elizabeth H.; Huang, Max Tze-Han; Taxman, Debra J.

    2013-01-01

    Shortly after the cellular mechanism of RNA interference (RNAi) was first described, scientists began using this powerful technique to study gene function. This included designing better methods for the successful delivery of small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) into mammalian cells. While the simplest method for RNAi is the cytosolic delivery of siRNA oligonucleotides, this technique is limited to cells capable of transfection and is primarily utilized during transient in vitro studies. The introduction of shRNA into mammalian cells through infection with viral vectors allows for stable integration of shRNA and long-term knockdown of the targeted gene; however, several challenges exist with the implementation of this technology. Here we describe some well-tested protocols which should increase the chances of successful design, delivery, and assessment of gene knockdown by shRNA. We provide suggestions for designing shRNA targets and controls, a protocol for sequencing through the secondary structure of the shRNA hairpin structure, and protocols for packaging and delivery of shRNA lentiviral particles. Using real-time PCR and functional assays we demonstrate the successful knockdown of ASC, an inflammatory adaptor molecule. These studies demonstrate the practicality of including two shRNAs with different efficacies of knockdown to provide an additional level of control and to verify dose dependency of functional effects. Along with the methods described here, as new techniques and algorithms are designed in the future, shRNA is likely to include further promising application and continue to be a critical component of gene discovery. PMID:20387148

  5. Strategy and your stronger hand.

    Science.gov (United States)

    Moore, Geoffrey A

    2005-12-01

    There are two kinds of businesses in the world, says the author. Knowing what they are--and which one your company is--will guide you to the right strategic moves. One kind includes businesses that compete on a complex-systems model. These companies have large enterprises as their primary customers. They seek to grow a customer base in the thousands, with no more than a handful of transactions per customer per year (indeed, in some years there may be none), and the average price per transaction ranges from six to seven figures. In this model, 1,000 enterprises each paying dollar 1 million per year would generate dollar 1 billion in annual revenue. The other kind of business competes on a volume-operations model. Here, vendors seek to acquire millions of customers, with tens or even hundreds of transactions per customer per year, at an average price of relatively few dollars per transaction. Under this model, it would take 10 million customers each spending dollar 8 per month to generate nearly dollar 1 billion in revenue. An examination of both models shows that they could not be further apart in their approach to every step along the classic value chain. The problem, though, is that companies in one camp often attempt to create new value by venturing into the other. In doing so, they fail to realize how their managerial habits have been shaped by the model they've grown up with. By analogy, they have a "handedness"--the equivalent of a person's right- or left-hand dominance--that makes them as adroit in one mode as they are awkward in the other. Unless you are in an industry whose structure forces you to attempt ambidexterity (in which case, special efforts are required to manage the inevitable dropped balls), you'll be far more successful making moves that favor your stronger hand.

  6. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  7. Female Psychology in August Strindberg's the Stronger

    OpenAIRE

    Sutandio, Anton; Apriliani, Erica

    2017-01-01

    This research aimed to offer interpretations of August Strindberg's The Stronger through the lens of female psychology. The Stronger is unique as it seemed very simple yet so intense and powerful with layers of interpretations. Written during 1888-1889, The Stronger, which only had two characters and only one speaking character, had become one of Strindberg's shortest yet important plays during his career. The female psychology approach used in the analysis would cover the discussion of gende...

  8. Three new shRNA expression vectors targeting the CYP3A4 coding sequence to inhibit its expression

    Directory of Open Access Journals (Sweden)

    Siyun Xu

    2014-10-01

    Full Text Available RNA interference (RNAi is useful for selective gene silencing. Cytochrome P450 3A4 (CYP3A4, which metabolizes approximately 50% of drugs in clinical use, plays an important role in drug metabolism. In this study, we aimed to develop a short hairpin RNA (shRNA to modulate CYP3A4 expression. Three new shRNAs (S1, S2 and S3 were designed to target the coding sequence (CDS of CYP3A4, cloned into a shRNA expression vector, and tested in different cells. The mixture of three shRNAs produced optimal reduction (55% in CYP3A4 CDS-luciferase activity in both CHL and HEK293 cells. Endogenous CYP3A4 expression in HepG2 cells was decreased about 50% at both mRNA and protein level after transfection of the mixture of three shRNAs. In contrast, CYP3A5 gene expression was not altered by the shRNAs, supporting the selectivity of CYP3A4 shRNAs. In addition, HepG2 cells transfected with CYP3A4 shRNAs were less sensitive to Ginkgolic acids, whose toxic metabolites are produced by CYP3A4. These results demonstrate that vector-based shRNAs could modulate CYP3A4 expression in cells through their actions on CYP3A4 CDS, and CYP3A4 shRNAs may be utilized to define the role of CYP3A4 in drug metabolism and toxicity.

  9. Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Hai-Bo Xing

    2018-01-01

    Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

  10. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  11. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  12. States agree on stronger physical protection regime

    International Nuclear Information System (INIS)

    2005-01-01

    Full text: Delegates from 89 countries agreed on 8 July to fundamental changes that will substantially strengthen the Convention on the Physical Protection of Nuclear Material (CPPNM). IAEA Director General Mohamed ElBaradei welcomed the agreement in saying 'This new and stronger treaty is an important step towards greater nuclear security by combating, preventing, and ultimately punishing those who would engage in nuclear theft, sabotage or even terrorism. It demonstrates that there is indeed a global commitment to remedy weaknesses in our nuclear security regime.' The amended CPPNM makes it legally binding for States Parties to protect nuclear facilities and material in peaceful domestic use, storage as well as transport. It will also provide for expanded cooperation between and among States regarding rapid measures to locate and recover stolen or smuggled nuclear material, mitigate any radiological consequences of sabotage, and prevent and combat related offences. The original CPPNM applied only to nuclear material in international transport. Conference President Dr. Alec Baer said 'All 89 delegations demonstrated real unity of purpose. They put aside some very genuine national concerns in favour of the global interest and the result is a much improved convention that is better suited to addressing the nuclear security challenges we currently face.' The new rules will come into effect once they have been ratified by two-thirds of the 112 States Parties of the Convention, expected to take several years. 'But concrete actions are already taking place around the world. For more than 3 years, the IAEA has been implementing a systematic Nuclear Security plan, including physical protection activities designed to prevent, detect and respond to malicious acts,' said Anita Nillson, Director of the IAEA's Office of Nuclear Security. The Agency's Nuclear Security Fund, set up after the events of 9/11, has delivered $19.5 million in practical assistance to 121 countries

  13. In vivo targeting of ADAM9 gene expression using lentivirus-delivered shRNA suppresses prostate cancer growth by regulating REG4 dependent cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Che-Ming Liu

    Full Text Available Cancer cells respond to stress by activating a variety of survival signaling pathways. A disintegrin and metalloproteinase (ADAM 9 is upregulated during cancer progression and hormone therapy, functioning in part through an increase in reactive oxygen species. Here, we present in vitro and in vivo evidence that therapeutic targeting of ADAM9 gene expression by lentivirus-delivered small hairpin RNA (shRNA significantly inhibited proliferation of human prostate cancer cell lines and blocked tumor growth in a murine model of prostate cancer bone metastasis. Cell cycle studies confirmed an increase in the G1-phase and decrease in the S-phase population of cancer cells under starvation stress conditions, which correlated with elevated intracellular superoxide levels. Microarray data showed significantly decreased levels of regenerating islet-derived family member 4 (REG4 expression in prostate cancer cells with knockdown of ADAM9 gene expression. This REG4 downregulation also resulted in induction of expression of p21(Cip1/WAF1, which negatively regulates cyclin D1 and blocks the G1/S transition. Our data reveal a novel molecular mechanism of ADAM9 in the regulation of prostate cancer cell proliferation, and suggests a combined modality of ADAM9 shRNA gene therapy and cytotoxic agents for hormone refractory and bone metastatic prostate cancer.

  14. LHC Season 2: A stronger machine

    CERN Multimedia

    Dominguez, Daniel

    2015-01-01

    1) New magnets / De nouveaux aimants 2) Stronger connections / Des jonctions électriques renforcées 3) Safer magnets / Des aimants plus sûrs 4) Higher energy beams / Des faisceaux d’énergie plus élevée 5) Narrower beams / Des faisceaux plus serrés 6) Smaller but closer proton packets / Des groupes de protons plus petits mais plus rapprochés 7) Higher voltage / Une tension plus haute 8) Superior cryogenics / Un système cryogénique amélioré 9) Radiation-resistant electronics / Une électronique qui résiste aux radiations 10) More secure vacuum / Un vide plus sûr

  15. Therapeutic effects of lentivirus-mediated shRNA targeting of cyclin D1 in human gastric cancer

    International Nuclear Information System (INIS)

    Seo, Jin-Hee; Jeong, Eui-Suk; Choi, Yang-Kyu

    2014-01-01

    Gastric cancer is the second most common cause of cancer-related death in males and the fourth in females. Traditional treatment has poor prognosis because of recurrence and systemic side effects. Therefore, the development of new therapeutic strategies is an important issue. Lentivirus-mediated shRNA stably inhibits target genes and can efficiently transduce most cells. Since overexpressed cyclin D1 is closely related to human gastric cancer progression, inhibition of cyclin D1 using specific targeting could be an effective treatment method of human gastric cancer. The therapeutic effect of lentivirus-mediated shRNA targeting of cyclin D1 (ShCCND1) was analyzed both in vitro and in vivo experiments. In vitro, NCI-N87 cells with downregulation of cyclin D1 by ShCCND1 showed significant inhibition of cell proliferation, cell motility, and clonogenicity. Downregulation of cyclin D1 in NCI-N87 cells also resulted in significantly increased G1 arrest and apoptosis. In vivo, stable NCI-N87 cells expressing ShCCND1 were engrafted into nude mice. Then, the cancer-growth inhibition effect of lentivirus was confirmed. To assess lentivirus including ShCCND1 as a therapeutic agent, intratumoral injection was conducted. Tumor growth of the lentivirus-treated group was significantly inhibited compared to growth of the control group. These results are in accordance with the in vitro data and lend support to the mitotic figure count and apoptosis analysis of the tumor mass. The lentivirus-mediated ShCCND1 was constructed, which effectively inhibited growth of NCI-N87-derived cancer both in vitro and in vivo. The efficiency of shRNA knockdown and variation in the degree of inhibition is mediated by different shRNA sequences and cancer cell lines. These experimental results suggest the possibility of developing new gastric cancer therapies using lentivirus-mediated shRNA

  16. Gas Marbles: Much Stronger than Liquid Marbles

    Science.gov (United States)

    Timounay, Yousra; Pitois, Olivier; Rouyer, Florence

    2017-06-01

    Enwrapping liquid droplets with hydrophobic particles allows the manufacture of so-called "liquid marbles" [Aussillous and Quéré Nature (London) 411, 924 (2001); , 10.1038/35082026Mahadevan Nature (London)411, 895 (2001), 10.1038/35082164]. The recent intensive research devoted to liquid marbles is justified by their very unusual physical and chemical properties and by their potential for various applications, from microreactors to water storage, including water pollution sensors [Bormashenko Curr. Opin. Colloid Interface Sci. 16, 266 (2011), 10.1016/j.cocis.2010.12.002]. Here we demonstrate that this concept can be successfully applied for encapsulating and protecting small gas pockets within an air environment. Similarly to their liquid counterparts, those new soft-matter objects, that we call "gas marbles," can sustain external forces. We show that gas marbles are surprisingly tenfold stronger than liquid marbles and, more importantly, they can sustain both positive and negative pressure differences. This magnified strength is shown to originate from the strong cohesive nature of the shell. Those interesting properties could be exploited for imprisoning valuable or polluted gases or for designing new aerated materials.

  17. Quantitative Evaluation of Myostatin Gene in Stably Transfected Caprine Fibroblast Cells by Anti-Myostatin shRNA.

    Science.gov (United States)

    Jain, Sudhir Kumar; Jain, Hemlata; Kumar, Dharmendra; Bedekar, Megha Kadam; Pandey, Akhilesh Kumar; Sarkhel, Bikash Chandra

    2015-09-01

    Skeletal muscle is the major component of lean tissue that is used for consumption, and myostatin is a negative regulator of skeletal muscle growth. Downregulation of this gene therefore offers a strategy for developing superior animals with enhanced muscle growth. Knockdown of myostatin was achieved by RNA interference technology. The anti-myostatin shRNA were designed and stably transfected in caprine fibroblast cells. The reduced expression of target gene was achieved and measured in clonal fibroblast cells by real-time PCR. Two single-cell clones induced significant decrease of myostatin gene expression by 73.96 and 72.66 %, respectively (P < 0.05). To ensure the appropriate growth of transfected cell, seven media were tested. The best suited media was used for transfected fibroblast cell proliferation. The findings suggest that shRNA provides a novel potential tool for gene knockdown and these stably transfected cells can be used as the donor cells for animal cloning.

  18. Insulin-like growth factor-1 (IGF-1) enhances the osteogenic activity of bone morphogenetic protein-6 (BMP-6) in vitro and in vivo, and together have a stronger osteogenic effect than when IGF-1 is combined with BMP-2.

    Science.gov (United States)

    Rico-Llanos, Gustavo A; Becerra, Jose; Visser, Rick

    2017-07-01

    Bone morphogenetic protein-2 (BMP-2) is widely used in orthopedic surgery and bone tissue engineering because of its strong osteogenic activity. However, BMP-2 treatments have several drawbacks and many groups are actively exploring alternatives. Since BMP-6 has been demonstrated to be more osteoinductive, its use, either alone or together with other growth factors, might be an interesting option. In this work, we have compared the effect of BMP-2, BMP-6, or insulin-like growth factor-1 (IGF-1), either alone or in combination. Murine preosteoblasts were treated with 15 nM IGF-1 and/or 6 nM BMP-2 or -6 and the expression of osteogenic marker genes, proliferation, and alkaline phosphatase (ALP) activity in vitro were analyzed. The results showed that IGF-1 greatly enhanced the BMP-induced osteogenic differentiation of these cells in general and that the ALP activity in the cultures was higher when the combination was made with BMP-6 than with BMP-2. Furthermore, we tested the osteogenic potential of these treatments in vivo by loading 25 pmoles of IGF-1 and/or 10 pmoles of BMP-2 or -6 onto absorbable collagen sponges and implanting them into an ectopic bone formation model in rats. This study revealed that only BMP-6 was able to induce bone formation at the used dose and that the addition of IGF-1 contributed to an increase of the mineralization in the implants. Hence, the combination of BMP-6 with IGF-1 might be a better alternative than BMP-2 for orthopedic surgery or bone tissue engineering approaches. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1867-1875, 2017. © 2017 Wiley Periodicals, Inc.

  19. Making muscles "stronger": exercise, nutrition, drugs.

    Science.gov (United States)

    Aagaard, P

    2004-06-01

    As described in this review, maximal muscle strength is strongly influenced by resistive-types of exercise, which induce adaptive changes in both neuromuscular function and muscle morphology. Further, timed intake of protein in conjunction with resistance training elicit greater strength and muscle size gains than resistance training alone. Creatine supplementation amplifies the hypertrophic response to resistance training, although some individuals may not respond positively. Locally produced muscle growth factors are upregulated during creatine supplementation, which contributes to increase the responsiveness of muscle cells to intensive training stimuli. Usage of anabolic steroids boosts muscle hypertrophy beyond inherent genetical limits, not only by increasing the DNA transcription rate for myofibrillar proteins but also by increasing the nucleus-to-cytoplasm ratio due to accelerated activation of myogenic satellite cells. However, severe tissue damaging effects exist with anabolic steroids, some of which are irreversible.

  20. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  1. The Educational Program "Zajedno Jaci" (Stronger Together) in Croatia

    Science.gov (United States)

    Spanja, Sanja

    2011-01-01

    In this paper, we explore intercultural learning undertaken through the educational program "Stronger Together." The program "Stronger Together" was created in 1998 in order to support and educate teachers working with children in post-war regions of Croatia using intercultural education and cooperative learning as tools for…

  2. Stronger Schrödinger-like uncertainty relations

    International Nuclear Information System (INIS)

    Song, Qiu-Cheng; Qiao, Cong-Feng

    2016-01-01

    Highlights: • A stronger Schrödinger-like uncertainty relation in the sum of variances of two observables is obtained. • An improved Schrödinger-like uncertainty relation in the product of variances of two observables is obtained. • A stronger uncertainty relation in the sum of variances of three observables is proposed. - Abstract: Uncertainty relation is one of the fundamental building blocks of quantum theory. Nevertheless, the traditional uncertainty relations do not fully capture the concept of incompatible observables. Here we present a stronger Schrödinger-like uncertainty relation, which is stronger than the relation recently derived by Maccone and Pati (2014) [11]. Furthermore, we give an additive uncertainty relation which holds for three incompatible observables, which is stronger than the relation newly obtained by Kechrimparis and Weigert (2014) [12] and the simple extension of the Schrödinger uncertainty relation.

  3. Is TNF-a-targeted short hairpin RNA (shRNA) a novel potential therapeutic tool in psoriasis treatment?

    DEFF Research Database (Denmark)

    Stenderup, Karin; Jakobsen, Maria; Rosada, Cecilia

    2008-01-01

      TNF-α is a well known target in psoriasis treatment and biological treatments targeting TNF-a are already clinically used against psoriasis and psoriasis arthritis. Attention is however given to a novel therapeutic tool: RNA interference that controls gene silencing. This study investigates...... the efficiency of targeting TNF-a with specific short hairpin RNA (shRNA) and explores its potential in treating psoriasis. ShRNAs targeting human TNF-α mRNA were generated. Their efficiency in down-regulating TNF-a protein expression was evaluated using a Renilla luciferase screening-assay and a transient co...... TNF-a shRNA was used to transduce HEK293 cells and verify vector-derived TNF-a knockdown in vitro. In vivo, psoriasis skin was exposed to lentiviral TNF-a shRNAs by a single intra-dermal injection. Psoriasis skin for the in vivo study was obtained from psoriatic plaque skin biopsies that were...

  4. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  5. Women's political participation leads to stronger local economies ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    2016-06-08

    Jun 8, 2016 ... Under changes to India's constitution, Indian women are gaining a stronger ... Legal reforms are encouraging women to contribute to economic growth ... on a panel on empowering women entrepreneurs at IDRC in Ottawa.

  6. Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

    Science.gov (United States)

    Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

    2006-12-01

    Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

  7. An infinitely expandable cloning strategy plus repeat-proof PCR for working with multiple shRNA.

    Directory of Open Access Journals (Sweden)

    Glen John McIntyre

    Full Text Available Vector construction with restriction enzymes (REs typically involves the ligation of a digested donor fragment (insert to a reciprocally digested recipient fragment (vector backbone. Creating a suitable cloning plan becomes increasingly difficult for complex strategies requiring repeated insertions such as constructing multiple short hairpin RNA (shRNA expression vectors for RNA interference (RNAi studies. The problem lies in the reduced availability of suitable RE recognition sites with an increasing number of cloning events and or vector size. This report details a technically simple, directional cloning solution using REs with compatible cohesive ends that are repeatedly destroyed and simultaneously re-introduced with each round of cloning. Donor fragments can be made by PCR or sub-cloned from pre-existing vectors and inserted ad infinitum in any combination. The design incorporates several cloning cores in order to be compatible with as many donor sequences as possible. We show that joining sub-combinations made in parallel is more time-efficient than sequential construction (of one cassette at a time for any combination of 4 or more insertions. Screening for the successful construction of combinations using Taq polymerase based PCR became increasingly difficult with increasing number of repeated sequence elements. A Pfu polymerase based PCR was developed and successfully used to amplify combinations of up to eleven consecutive hairpin expression cassettes. The identified PCR conditions can be beneficial to others working with multiple shRNA or other repeated sequences, and the infinitely expandable cloning strategy serves as a general solution applicable to many cloning scenarios.

  8. BUILDING STRONGER STATE ENERGY PARTNERSHIPS WITH THE U.S. DEPARTMENT OF ENERGY

    Energy Technology Data Exchange (ETDEWEB)

    Kate Burke

    2002-11-01

    This technical progress report includes an update of the progress during the second year of cooperative agreement DE-FC26-00NT40802, Building Stronger State Energy Partnerships with the U.S. Department of Energy. The report also describes the barriers in conduct of the effort, and our assessment of future progress and activities.

  9. Effects and mechanism of integrin-β1 gene expression inhibited by shRNA in invasion of pancreatic carcinoma PANC-1 cells.

    Science.gov (United States)

    Yu, Feng; Li, Hua; Bu, Xuefeng; Zhang, Yongjun

    2012-01-01

    To investigate the effects of integrin-β1 gene expression inhibited by shRNA on invasion of pancreatic carcinoma PANC-1 cells in vitro. The eukaryotic expression plasmid of short hairpin RNA (shRNA) targeting integrin-β1 gene (integrin-β1-shRNA) was constructed and transfected into PANC-1 cells. The expressions of integrin-β1 mRNA and protein were detected by real-time quantitative polymerase chain reaction (PCR) and western blot assay, respectively. The invasive ability of PANC-1 cells was observed with a transwell cell culture chamber and the expressions of MMP-2 and MMP-9 were assayed. Compared to the untransfected group, recombinant expression plasmid integrin-β1-shRNA resulted in reduction of integrin-β1 mRNA and protein by 78.58%±7.24% and 92.88%±3.18%, respectively and the average number of invading PANC-1 cells were decreased from 52±5 to 21±4 (pPANC-1 cells in vitro significantly.

  10. The influence of survivin shRNA on the cell cycle and the invasion of SW480 cells of colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Yu Jin

    2008-07-01

    Full Text Available Abstract Background The objective was to understand the influence of Survivin plasmid with short hairpin RNA (shRNA on the cell cycle, invasion, and the silencing effect of Survivin gene in the SW480 cell of colorectal carcinoma. Methods A eukaryotic expression vector, PGCH1/Survivin shRNA, a segment sequence of Survivin as target, was created and transfected into colorectal carcinoma cell line SW480 by the non-lipid method. The influence on the Survivin protein was analyzed by Western blotting, while the cell cycle, cell apoptosis were analyzed by flow cytometry, and invasion of the cell was analyzed by Transwell's chamber method. Results After the transfection of PGCH1/Survivin shRNA, the expression of Survivin protein in SW480 cells was dramatically decreased by 60.68%, in which the cells were stopped at G2/M phase, even though no apoptosis was detected. The number of transmembranous cells of the experimental group, negative control group, and blank control group were 14.46 ± 2.11, 25.12 ± 8.37, and 25.86 ± 7.45, respectively (P 0.05. Conclusion Survivin shRNA could significantly reduce the expression of Survivin protein and invasion of SW480 cells. Changes in cell cycle were observed, but no apoptosis was induced.

  11. A Stronger Reason for the Right to Sign Languages

    Science.gov (United States)

    Trovato, Sara

    2013-01-01

    Is the right to sign language only the right to a minority language? Holding a capability (not a disability) approach, and building on the psycholinguistic literature on sign language acquisition, I make the point that this right is of a stronger nature, since only sign languages can guarantee that each deaf child will properly develop the…

  12. Female Psychology in August Strindberg’s The Stronger

    Directory of Open Access Journals (Sweden)

    Anton Sutandio

    2017-11-01

    Full Text Available This research aimed to offer interpretations of August Strindberg’s The Stronger through the lens of female psychology. The Stronger is unique as it seemed very simple yet so intense and powerful with layers of interpretations. Written during 1888-1889, The Stronger, which only had two characters and only one speaking character, had become one of Strindberg’s shortest yet important plays during his career. The female psychology approach used in the analysis would cover the discussion of gender role, women’s self-esteem, competition for males, women’s friendships, ego style, and female psychology. It was an interdisciplinary research that combined structuralist, historical, biographical, and feminist approach to gain a better interpretation on the play. By referring to three different sources on the concept of female psychology, the analysis offered different and interesting interpretations on the nature and dynamics of the two female characters’ relationship. The Stronger has shown an enigmatic attraction in Strindberg’s authorship in which the readers could see the co-existence, collision, conflict, and merge of different paradigms concerning sex, gender, and sexuality.

  13. Women's political participation leads to stronger local economies ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Edgard Rodriguez - IDRC. Women attend a self-help group meeting near Hyderabad, India. Keenara Khanderia. Under changes to India's constitution, Indian women are gaining a stronger political voice. Legal reforms are encouraging women to contribute to economic growth and investments in community growth.

  14. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  15. Stronger vection in junior high school children than in adults.

    Science.gov (United States)

    Shirai, Nobu; Imura, Tomoko; Tamura, Rio; Seno, Takeharu

    2014-01-01

    Previous studies have shown that even elementary school-aged children (7 and 11 years old) experience visually induced perception of illusory self-motion (vection) (Lepecq et al., 1995, Perception, 24, 435-449) and that children of a similar age (mean age = 9.2 years) experience more rapid and stronger vection than do adults (Shirai et al., 2012, Perception, 41, 1399-1402). These findings imply that although elementary school-aged children experience vection, this ability is subject to further development. To examine the subsequent development of vection, we compared junior high school students' (N = 11, mean age = 14.4 years) and adults' (N = 10, mean age = 22.2 years) experiences of vection. Junior high school students reported significantly stronger vection than did adults, suggesting that the perceptual experience of junior high school students differs from that of adults with regard to vection and that this ability undergoes gradual changes over a relatively long period of development.

  16. A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

    Science.gov (United States)

    Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

    2008-11-01

    Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

  17. Predatory blue crabs induce stronger nonconsumptive effects in eastern oysters Crassostrea virginica than scavenging blue crabs

    Directory of Open Access Journals (Sweden)

    Avery E. Scherer

    2017-02-01

    Full Text Available By influencing critical prey traits such as foraging or habitat selection, predators can affect entire ecosystems, but the nature of cues that trigger prey reactions to predators are not well understood. Predators may scavenge to supplement their energetic needs and scavenging frequency may vary among individuals within a species due to preferences and prey availability. Yet prey reactions to consumers that are primarily scavengers versus those that are active foragers have not been investigated, even though variation in prey reactions to scavengers or predators might influence cascading nonconsumptive effects in food webs. Oysters Crassostrea virginica react to crab predators by growing stronger shells. We exposed oysters to exudates from crabs fed live oysters or fed aged oyster tissue to simulate scavenging, and to controls without crab cues. Oysters grew stronger shells when exposed to either crab exudate, but their shells were significantly stronger when crabs were fed live oysters. The stronger response to predators than scavengers could be due to inherent differences in diet cues representative of reduced risk in the presence of scavengers or to degradation of conspecific alarm cues in aged treatments, which may mask risk from potential predators subsisting by scavenging.

  18. Stronger misdirection in curved than in straight motion

    Directory of Open Access Journals (Sweden)

    Jorge eOtero-Millan

    2011-11-01

    Full Text Available Illusions developed by magicians are a rich and largely untapped source of insight into perception and cognition. Here we show that curved motion, as employed by the magician in a classic sleight of hand trick, generates stronger misdirection than rectilinear motion, and that this difference can be explained by the differential engagement of the smooth pursuit and the saccadic oculomotor systems. This research moreover exemplifies how the magician’s intuitive understanding of the spectator’s mindset can surpass that of the cognitive scientist in specific instances, and that observation-based behavioral insights developed by magicians are worthy of quantitative investigation in the neuroscience laboratory.

  19. The right of the stronger: The play Sisyphus and critias

    Directory of Open Access Journals (Sweden)

    Jordović Ivan

    2004-01-01

    Full Text Available The Focus of this study is the standpoint of the play Sisyphus and critias the leader of the thirty towards the right of the stronger. this is a question of constant interest in scientific circles, since its answer can serve as the indicator of the influence this famous theory has had. this interest has been encouraged by the fact that critias’ authorship of the play is questionable. however, the question of the author is not of primary importance for this article, because there are some arguments, among some well known ones, which were not considered and which Show that in this satire, regardless of the author and the purpose of this fragment, the right of the stronger is actually non-existant. the first argument to support this theory is that nomosphysis antithesis is nowhere explicitly mentioned although it is the crucial element of the right of the stronger. in addition there is no claim in the play that the exploitation of the strong by the week or by law accrued. the second argument is that despite the incapability of laws to prevent the secret injustice, they and their importance for the human society are depicted in a positive light. it should also be noted that, unlike callicles and glaucon, laws are created to stop the bad and not the good. the third argument is that the invention of religion is accepted as a positive achievement, which finally enables the overcoming of primeval times and lawlessness. the reflection of this argument is a positive characterization of the individual who invented the fear of gods. the fourth argument, which has not been taken into consideration so far is the way the supporters and opponents of lawlessness are described and marked as κακοί and έσξλοί in the satire only physically strong are considered as strong as opposed to callicles, where they are also spiritually superior. intelectually superior in Sisyphus is the inventor of the fear of gods who is also in favor of law and order. the fact

  20. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  1. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  2. Stronger multilayer acrylic dielectric elastomer actuators with silicone gel coatings

    Science.gov (United States)

    Lau, Gih-Keong; La, Thanh-Giang; Sheng-Wei Foong, Ervin; Shrestha, Milan

    2016-12-01

    Multilayer dielectric elastomer actuators (DEA) perform worst off than single-layer DEAs due to higher susceptibility to electro-thermal breakdown. This paper presents a hot-spot model to predict the electro-thermal breakdown field of DEAs and its dependence on thermal insulation. To inhibit the electrothermal breakdown, silicone gel coating was applied as barrier coating to multilayer acrylic DEA. The gel coating helps suppress the electro-thermally induced puncturing of DEA membrane at the hot spot. As a result, the gel-coated DEAs, in either a single layer or a multilayer stack, can produce 30% more isometric stress change as compared to those none-coated. These gel-coated acrylic DEAs show great potential to make stronger artificial muscles.

  3. Conservatives Anticipate and Experience Stronger Emotional Reactions to Negative Outcomes.

    Science.gov (United States)

    Joel, Samantha; Burton, Caitlin M; Plaks, Jason E

    2014-02-01

    The present work examined whether conservatives and liberals differ in their anticipation of their own emotional reactions to negative events. In two studies, participants imagined experiencing positive or negative outcomes in domains that do not directly concern politics. In Study 1, 190 American participants recruited online (64 male, Mage  = 32 years) anticipated their emotional responses to romantic relationship outcomes. In Study 2, 97 Canadian undergraduate students (26 male, Mage  = 21 years) reported on their anticipated and experienced emotional responses to academic outcomes. In both studies, more conservative participants predicted they would feel stronger negative emotions following negative outcomes than did more liberal participants. Furthermore, a longitudinal follow-up of Study 2 participants revealed that more conservative participants actually felt worse than more liberal participants after receiving a lower-than-desired exam grade. These effects remained even when controlling for the Big Five traits, prevention focus, and attachment style (Study 1), and optimism (Study 2). We discuss how the relationship between political orientation and anticipated affect likely contributes to differences between conservatives and liberals in styles of decision and policy choices. © 2013 Wiley Periodicals, Inc.

  4. Enforcement costs: some humanitarian alternatives to stronger patent rights.

    Science.gov (United States)

    Trotter, Andrew

    2012-01-01

    Diseases that cause comparatively few problems in developed countries kill millions of people in the Third World each year. In many cases, people die because they cannot afford the medication needed to save their lives. In others, there are simply no drugs available because there are no wealthy western patients to justify pharmaceutical companies investing in a cure. This reveals a deep-seated problem within the patent system and the pharmaceutical industry that emphasises markets and profits at the expense of health and global welfare. Global efforts have seen substantial improvements in access to medicines in isolated areas, but with international agreements driving towards stronger patent protection and the expiry date for the TRIPS grace period fast approaching, it is time to consider alternatives which will allow the patent system to work for the humanitarian cause rather than against it. This paper considers two such problems in the patent system and pharmaceutical industry - prohibitive pricing and misdirected incentives - to offer a mode of regulation and enforcement that will support both a viable pharmaceutical industry and the human right to health and medication.

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

    Science.gov (United States)

    Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

    2018-04-12

    This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

  7. Suppression of human breast tumors in NOD/SCID mice by CD44 shRNA gene therapy combined with doxorubicin treatment

    Directory of Open Access Journals (Sweden)

    Pham PV

    2012-05-01

    Full Text Available Phuc Van Pham1, Ngoc Bich Vu1, Thuy Thanh Duong1, Tam Thanh Nguyen1, Nhung Hai Truong1, Nhan Lu Chinh Phan1, Tue Gia Vuong1, Viet Quoc Pham1, Hoang Minh Nguyen1, Kha The Nguyen1, Nhung Thi Nguyen1, Khue Gia Nguyen1, Lam Tan Khat1, Dong Van Le2, Kiet Dinh Truong1, Ngoc Kim Phan11Laboratory of Stem Cell Research and Application, University of Science, Vietnam National University, HCM City, 2Military Medical University, Ha Noi, VietnamBackground: Breast cancer stem cells with a CD44+CD24- phenotype are the origin of breast tumors. Strong CD44 expression in this population indicates its important role in maintaining the stem cell phenotype. Previous studies show that CD44 down-regulation causes CD44+CD24- breast cancer stem cells to differentiate into non-stem cells that are sensitive to antitumor drugs and lose many characteristics of the original cells. In this study, we determined tumor suppression in non-obese severe combined immunodeficiency mice using CD44 shRNA therapy combined with doxorubicin treatment.Methods: Tumor-bearing non-obese severe combined immunodeficiency mice were established by injection of CD44+CD24- cells. To track CD44+CD24- cells, green fluorescence protein was stably transduced using a lentiviral vector prior to injection into mice. The amount of CD44 shRNA lentiviral vector used for transduction was based on CD44 down-regulation by in vitro CD44 shRNA transduction. Mice were treated with direct injection of CD44 shRNA lentiviral vector into tumors followed by doxorubicin administration after 48 hours. The effect was evaluated by changes in the size and weight of tumors compared with that of the control.Results: The combination of CD44 down-regulation and doxorubicin strongly suppressed tumor growth with significant differences in tumor sizes and weights compared with that of CD44 down-regulation or doxorubicin treatment alone. In the combination of CD44 down-regulation and doxorubicin group, the tumor weight was

  8. Building Stronger State Energy Partnerships with the U.S. Department of Energy

    Energy Technology Data Exchange (ETDEWEB)

    Marks, Kate

    2011-09-30

    This final technical report details the results of total work efforts and progress made from October 2007 – September 2011 under the National Association of State Energy Officials (NASEO) cooperative agreement DE-FC26-07NT43264, Building Stronger State Energy Partnerships with the U.S. Department of Energy. Major topical project areas in this final report include work efforts in the following areas: Energy Assurance and Critical Infrastructure, State and Regional Technical Assistance, Regional Initiative, Regional Coordination and Technical Assistance, and International Activities in China. All required deliverables have been provided to the National Energy Technology Laboratory and DOE program officials.

  9. One Year After Fukushima, Nuclear Safety Is Stronger

    International Nuclear Information System (INIS)

    2012-01-01

    Full text: Nuclear power is safer than it was a year ago as the nuclear industry, regulators and governments act on the lessons of Fukushima, but that safety must never be taken for granted, said Yukiya Amano, Director General of the International Atomic Energy Agency (IAEA). Speaking ahead of the first anniversary of the Fukushima Daiichi nuclear accident on 11 March, Amano said a culture of constant vigilance and improvement was vital to ensure that the benefits of nuclear power could be harnessed as safely as humanly possible. 'Nuclear safety is stronger than it was a year ago', he said. 'Fukushima Daiichi was a very serious accident, but we know what went wrong and we have a clear course of action to tackle those causes - not only in Japan, but anywhere in the world. 'Now we have to keep up the momentum. Complacency can kill'. On 11 March 2011 a huge earthquake and tsunami left more than 20 000 people dead or missing in eastern Japan. Amidst widespread destruction, the tsunami slammed into the Fukushima Daiichi Nuclear Power Station, disabling cooling systems and leading to fuel meltdowns in three of the six Units. The accident was a jolt to the nuclear industry, regulators and governments. It was triggered by a massive force of nature, but it was existing weaknesses of design regarding defence against natural hazards, regulatory oversight, accident management and emergency response that allowed it to unfold as it did. For example: The nuclear regulator was not sufficiently independent, allowing weak oversight of the operator, TEPCO, and regulatory requirements fell short of international best practice; Not enough attention was paid to guarding against possible extreme events at the Fukushima Daiichi site, leaving critical safety functions such as cooling systems vulnerable to the tsunami; Training to respond to serious accidents was inadequate, as were mitigation measures to prevent hydrogen explosions and protect the venting system; and Accident command lines

  10. "The Heart That Trusts Another Is Stronger than Anything."

    Science.gov (United States)

    Witkin, Mitzi

    1992-01-01

    Describes how an English teacher incorporates the native languages of her internationally born students into her English lessons. Relates how these activities helped foreign students feel accepted into the class and their new environment. (PRA)

  11. Reduce Fraud Risk in Your District with Stronger Internal Controls

    Science.gov (United States)

    Okrzesik, Daryl J.; Nuehring, Bert G.

    2011-01-01

    Internal accounts offer schools a faster, more convenient way to handle the income and expenses that result from student fees, school clubs and organizations, field trips, fund-raising, and similar activities. But this convenience also incurs the added risk of fraud. Fortunately, there are proven ways to strengthen internal controls and reduce…

  12. What doesn't kill you makes you stronger

    DEFF Research Database (Denmark)

    Borregaard, Niels

    2014-01-01

    In this issue of Immunity, Campbell et al. (2014) demonstrate that hypoxia caused by the respiratory burst of infiltrating neutrophils activates hypoxia inducible factor (HIF) in epithelial cells and protects the mucosa cells in an experimental model of inflammatory bowel disease....

  13. Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

    Science.gov (United States)

    Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

    2015-01-01

    In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior

  14. When surging seas meet stronger rain: Nuclear techniques in flood management

    International Nuclear Information System (INIS)

    Quevenco, Rodolfo

    2015-01-01

    Unusually high rainfall in many parts of the world is a result of climate change, scientists say. Since warmer air can hold more water, the rationale goes, increased temperatures will increase the chances of stronger rainfall events. And when surging seas combine with stronger rain, the outcome is almost certain: floods. Floods are the most frequently occurring natural disasters, and south-east Asia is particularly vulnerable. Climate change and variability are expected to bring about increased typhoon activities, rising sea levels and off-season monsoon rains in southeast Asia and other regions. These can cause devastating floods in countries like Cambodia, Laos, Pakistan, the Philippines, Thailand and Viet Nam. For the residents of these countries who have survived the ravages of major floods, the road to recovery can be long and arduous. As the flood water recedes, they have to contend with new forms of flood: floods of concern and worries as to how to rebuild their houses, their lives and their cities. Governments, too, face huge challenges in rebuilding roads, public buildings, infrastructure and natural resources destroyed or polluted by the flood.

  15. Stronger Dopamine D1 Receptor-Mediated Neurotransmission in Dyskinesia.

    Science.gov (United States)

    Farré, Daniel; Muñoz, Ana; Moreno, Estefanía; Reyes-Resina, Irene; Canet-Pons, Júlia; Dopeso-Reyes, Iria G; Rico, Alberto J; Lluís, Carme; Mallol, Josefa; Navarro, Gemma; Canela, Enric I; Cortés, Antonio; Labandeira-García, José L; Casadó, Vicent; Lanciego, José L; Franco, Rafael

    2015-12-01

    Radioligand binding assays to rat striatal dopamine D1 receptors showed that brain lateralization of the dopaminergic system were not due to changes in expression but in agonist affinity. D1 receptor-mediated striatal imbalance resulted from a significantly higher agonist affinity in the left striatum. D1 receptors heteromerize with dopamine D3 receptors, which are considered therapeutic targets for dyskinesia in parkinsonian patients. Expression of both D3 and D1-D3 receptor heteromers were increased in samples from 6-hydroxy-dopamine-hemilesioned rats rendered dyskinetic by treatment with 3, 4-dihydroxyphenyl-L-alanine (L-DOPA). Similar findings were obtained using striatal samples from primates. Radioligand binding studies in the presence of a D3 agonist led in dyskinetic, but not in lesioned or L-DOPA-treated rats, to a higher dopamine sensitivity. Upon D3-receptor activation, the affinity of agonists for binding to the right striatal D1 receptor increased. Excess dopamine coming from L-DOPA medication likely activates D3 receptors thus making right and left striatal D1 receptors equally responsive to dopamine. These results show that dyskinesia occurs concurrently with a right/left striatal balance in D1 receptor-mediated neurotransmission.

  16. Intravitreal Injection of Ranibizumab and CTGF shRNA Improves Retinal Gene Expression and Microvessel Ultrastructure in a Rodent Model of Diabetes

    Directory of Open Access Journals (Sweden)

    Bojie Hu

    2014-01-01

    Full Text Available Therapeutic modalities targeting vascular endothelial growth factor (VEGF have been used to treat neovascularization and macular edema. However, anti-VEGF treatment alone may cause up-regulation of connective tissue growth factor (CTGF in the retina, increasing the risk of fibrosis and tractional retinal detachment. Therefore, in this study, we employ a novel dual-target intervention that involves intravitreal injection of the VEGF inhibitor ranibizumab and a transfection reagent-treated non-viral vector carrying anti-CTGF short hairpin RNA (shRNA driven by human RNA polymerase III promoter U6. The effects of the dual-target intervention on the expression of VEGF and CTGF and on microvessel ultrastructure were examined in retina of streptozocin-induced diabetic rats. CTGF was significantly up-regulated at week 8 after diabetic induction, whereas VEGF was not up-regulated until week 10. The high expression of both genes was maintained at week 12. Transmission electron microscopy also revealed progressive exacerbation of microvessel ultrastructure during the same period. In addition, ranibizumab significantly lowered VEGF but elevated CTGF mRNA, whereas CTGF shRNA significantly reduced the mRNA levels of both CTGF and VEGF in diabetic retinas. Importantly, dual-target intervention normalized the transcript levels of both target genes and ameliorated retinal microvessel ultrastructural damage better than either single-target intervention. These results suggest the advantages of dual-target over single-target interventions in diabetic retina and reveal a novel therapeutic modality for diabetic retinopathy.

  17. Ministers at IAEA Conference Call for Stronger Nuclear Security

    International Nuclear Information System (INIS)

    2013-01-01

    Full text: Despite substantial progress in strengthening nuclear security in recent years, more needs to be done worldwide to defend against the threat of nuclear terrorism and other malicious acts involving nuclear or radiological material, a Ministerial Declaration at the IAEA's International Conference on Nuclear Security: Enhancing Global Efforts stated today. More than 1 300 participants at the Conference, which is open to all 159 IAEA Member States, will analyse past and current efforts and consider how future challenges can best be met to ensure effective and sustainable nuclear security worldwide. The Conference, which started in Vienna today and ends on Friday, includes representatives from 123 countries and 21 governmental and non-governmental organizations. The Ministerial Declaration, adopted at a plenary session attended by 34 government ministers and other Heads of Delegation including the Conference President, Hungarian Foreign Affairs Minister Janos Martonyi, says they ''remain concerned about the threat of nuclear and radiological terrorism and of other malicious acts or sabotage related to facilities and activities involving nuclear and other radioactive material.'' The Declaration - the first of its kind for nuclear security - notes that all States are responsible for their own nuclear security, but that international cooperation is important in supporting States' efforts to fulfil their responsibilities. It affirms the central role of the IAEA in strengthening nuclear security globally, and leading coordination of international activities in this field. ''We encourage all States to maintain highly effective nuclear security, including physical protection, for all nuclear and other radioactive material, their transport, use and storage and their associated facilities, as well as protecting sensitive information and maintaining the necessary nuclear security systems and measures to assess and manage their nuclear security effectively,'' the

  18. The new economy is stronger than you think.

    Science.gov (United States)

    Sahlman, W A

    1999-01-01

    Many policy makers at the Fed contend that the new economy is a fragile bubble--and that with the "irrational exuberance" of the capital markets, the sky is going to fall on the U.S. economy. That couldn't be further from the truth, according to William Sahlman. As long as the government doesn't interfere, he argues, the economy is sturdy, resilient, and raring to grow. The new economy is strong for several reasons. First, it is based on a business model that works. Any business system that relentlessly drives out inefficiency, forces intelligent business-process reengineering, and gives customers more of what they want will be sustainable. Second, it is built on America's admiration for entrepreneurs and its tolerance for failure, not to mention its easy access to capital. Third, the new economy is attracting the best and brightest minds in the country. And finally, says Sahlman, the new economy is strong because it is spreading. It may be primarily an American phenomenon now, but in a few short years it will start to show its effects everywhere, making the whole world a more productive place. Still, Sahlman believes, the road ahead is not without potholes and sharp curves. But that is what the new economy is all about, he maintains--companies attacking the status quo and entrenched players, companies experimenting to find new technologies that improve or replace earlier ones. Such activity presents no cause for alarm. The economic, social, and cultural factors undergirding the new economy are rock solid. It's simply a matter of letting them stand.

  19. Faster, Stronger, Healthier: Adolescent-Stated Reasons for Dietary Supplementation.

    Science.gov (United States)

    Zdešar Kotnik, Katja; Jurak, Gregor; Starc, Gregor; Golja, Petra

    Examine the underlying reasons and sources of recommendation for dietary supplement (DS) use among adolescents. Cross-sectional analysis of children's development in Slovenia in September to October, 2014. Nationally recruited sample. Adolescents aged 14-19 years enrolled in 15 high schools (n = 1,463). Reasons for and sources of recommendation for DS use, sports club membership, sports discipline, and extent of physical activity (PA) were self-reported data. Chi-square test of independence was performed to compare the prevalence of DS use between groups with different extents of PA and nonathletes/athletes, referring to 11 different reasons and 9 different sources of recommendation for DS use. Use of DS was widespread among adolescents (69%), athletes (76%), and nonathletes (66%). Higher prevalence of supplementation was observed in males, who justified it use for sports performance enhancement and better development and function of muscles. In contrast, females emphasized immune system improvement. Higher extent of PA was associated with a higher prevalence of DS use. This was especially evident in males, who participated in team sports. A high percentage of adolescents (41%) decided on their own to use DS and because of advice from parents or relatives (30%). Several reasons for the widespread use of DS in adolescents were associated with sports participation. Therefore, educational programs regarding DS use should be targeted primarily to adolescents and their parents who are involved in sports, and especially team sports. Copyright © 2017 Society for Nutrition Education and Behavior. Published by Elsevier Inc. All rights reserved.

  20. Regular exercisers have stronger pelvic floor muscles than nonregular exercisers at midpregnancy.

    Science.gov (United States)

    Bø, Kari; Ellstrøm Engh, Marie; Hilde, Gunvor

    2018-04-01

    Today all healthy pregnant women are encouraged to be physically active throughout pregnancy, with recommendations to participate in at least 30 minutes of aerobic activity on most days of the week in addition to performing strength training of the major muscle groups 2-3 days per week and also pelvic floor muscle training. There is, however, an ongoing debate whether general physical activity enhances or declines pelvic floor muscle function. The objectives of the study were to compare vaginal resting pressure, pelvic floor muscle strength, and endurance in regular exercisers (exercise ≥30 minutes 3 or more times per week) and nonexercisers at midpregnancy. Furthermore, another objective was to assess whether regular general exercise or pelvic floor muscle strength was associated with urinary incontinence. This was a cross-sectional study at mean gestational week 20.9 (±1.4) including 218 nulliparous pregnant women, with a mean age of 28.6 years (range, 19-40 years) and prepregnancy body mass index of 23.9 kg/m 2 (SD, 4.0). Vaginal resting pressure, pelvic floor muscle strength, and pelvic floor muscle endurance were measured by a high-precision pressure transducer connected to a vaginal balloon. The International Consultation on Incontinence Questionnaire Urinary Incontinence Short Form was used to assess urinary incontinence. Differences between groups were analyzed using an independent-sample Student t test. Linear regression analysis was conducted to adjust for prepregnancy body mass index, age, smoking during pregnancy, and regular pelvic floor muscle training during pregnancy. The significance value was set to P ≤ .05. Regular exercisers had statistically significant stronger (mean 6.4 cm H 2 O [95% confidence interval, 1.7-11.2]) and more enduring (mean 39.9 cm H 2 Osec [95% confidence interval, 42.2-75.7]) pelvic floor muscles. Only pelvic floor muscle strength remained statistically significant, when adjusting for possible confounders. Pelvic floor

  1. Kinome-wide shRNA Screen Identifies the Receptor Tyrosine Kinase AXL as a Key Regulator for Mesenchymal Glioblastoma Stem-like Cells

    Directory of Open Access Journals (Sweden)

    Peng Cheng

    2015-05-01

    Full Text Available Glioblastoma is a highly lethal cancer for which novel therapeutics are urgently needed. Two distinct subtypes of glioblastoma stem-like cells (GSCs were recently identified: mesenchymal (MES and proneural (PN. To identify mechanisms to target the more aggressive MES GSCs, we combined transcriptomic expression analysis and kinome-wide short hairpin RNA screening of MES and PN GSCs. In comparison to PN GSCs, we found significant upregulation and phosphorylation of the receptor tyrosine kinase AXL in MES GSCs. Knockdown of AXL significantly decreased MES GSC self-renewal capacity in vitro and inhibited the growth of glioblastoma patient-derived xenografts. Moreover, inhibition of AXL with shRNA or pharmacologic inhibitors also increased cell death significantly more in MES GSCs. Clinically, AXL expression was elevated in the MES GBM subtype and significantly correlated with poor prognosis in multiple cancers. In conclusion, we identified AXL as a potential molecular target for novel approaches to treat glioblastoma and other solid cancers.

  2. Novel HIV-1 knockdown targets identified by an enriched kinases/phosphatases shRNA library using a long-term iterative screen in Jurkat T-cells.

    Directory of Open Access Journals (Sweden)

    Sylvie Rato

    2010-02-01

    Full Text Available HIV-1 is a complex retrovirus that uses host machinery to promote its replication. Understanding cellular proteins involved in the multistep process of HIV-1 infection may result in the discovery of more adapted and effective therapeutic targets. Kinases and phosphatases are a druggable class of proteins critically involved in regulation of signal pathways of eukaryotic cells. Here, we focused on the discovery of kinases and phosphatases that are essential for HIV-1 replication but dispensable for cell viability. We performed an iterative screen in Jurkat T-cells with a short-hairpin-RNA (shRNA library highly enriched for human kinases and phosphatases. We identified 14 new proteins essential for HIV-1 replication that do not affect cell viability. These proteins are described to be involved in MAPK, JNK and ERK pathways, vesicular traffic and DNA repair. Moreover, we show that the proteins under study are important in an early step of HIV-1 infection before viral integration, whereas some of them affect viral transcription/translation. This study brings new insights for the complex interplay of HIV-1/host cell and opens new possibilities for antiviral strategies.

  3. In vivo knockdown of antisense non-coding mitochondrial RNAs by a lentiviral-encoded shRNA inhibits melanoma tumor growth and lung colonization.

    Science.gov (United States)

    Varas-Godoy, Manuel; Lladser, Alvaro; Farfan, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C; Burzio, Luis O; Burzio, Veronica A; Valenzuela, Pablo D T

    2018-01-01

    The family of non-coding mitochondrial RNAs (ncmtRNA) is differentially expressed according to proliferative status. Normal proliferating cells express sense (SncmtRNA) and antisense ncmtRNAs (ASncmtRNAs), whereas tumor cells express SncmtRNA and downregulate ASncmtRNAs. Knockdown of ASncmtRNAs with oligonucleotides induces apoptotic cell death of tumor cells, leaving normal cells unaffected, suggesting a potential application for developing a novel cancer therapy. In this study, we knocked down the ASncmtRNAs in melanoma cell lines with a lentiviral-encoded shRNA approach. Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. Moreover, the treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls. These results provide additional proof of concept to the knockdown of ncmtRNAs for cancer therapy and validate lentiviral-shRNA vectors for gene therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. The bigger, the stronger? Insights from muscle architecture and nervous characteristics in obese adolescent girls.

    Science.gov (United States)

    Garcia-Vicencio, S; Coudeyre, E; Kluka, V; Cardenoux, C; Jegu, A-G; Fourot, A-V; Ratel, S; Martin, V

    2016-02-01

    Young obese youth are generally stronger than lean youth. This has been linked to the loading effect of excess body mass, acting as a training stimulus comparable to strength training. Whether this triggers specific adaptations of the muscle architecture (MA) and voluntary activation (VA) that could account for the higher strength of obese subjects remains unknown. MA characteristics (that is, pennation angle (PA), fascicle length (FL) and muscle thickness (MT)) and muscle size (that is, anatomical cross-sectional area (ACSA)) of the knee extensor (KE) and plantar flexor (PF) muscles were evaluated in 12 obese and 12 non-obese adolescent girls (12-15 years). Maximal isometric torque and VA of the KE and PF muscles were also assessed. Results revealed higher PA (Pmuscles in obese girls. Moreover, obese individuals produced a higher absolute torque than their lean counterparts on the KE (224.6±39.5 vs 135.7±32.7 N m, respectively; Pmuscles (73.3±16.5 vs 44.5±6.2 N m; Pmuscles (r=0.45-0.55, P<0.05-0.01). MVC was also correlated with VA (KE: r=0.44, P<0.05; PF: r=0.65, P<0.001) and segmental lean mass (KE: r=0.48, P<0.05; PF: r=0.57, P<0.01). This study highlighted favorable muscular and nervous adaptations to obesity that account for the higher strength of obese youth. The excess of body mass supported during daily activities could act as a chronic training stimulus responsible for these adaptations.

  6. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Science.gov (United States)

    Cohen, Ami; Whitfield, Timothy W; Kreifeldt, Max; Koebel, Pascale; Kieffer, Brigitte L; Contet, Candice; George, Olivier; Koob, George F

    2014-01-01

    Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn), are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc) mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV) vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn) or a scrambled shRNA (AAV-shScr) as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST). Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p.), followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  7. [Selection and construction of cell line stably expressing survivin gene in lower level through eukaryotic plasmid vector of shRNA].

    Science.gov (United States)

    Wang, Wen-Xia; Sun, Shan-Zhen; Song, Ying

    2008-06-01

    To construct a short hairpin RNA(shRNA) interference expression plasmid vector of survivin gene, transfect tongue squamous cell carcinoma line Tca8113 which expressed survivin gene in a high level, and choose the cells whose survivin gene were suppressed significantly. Two pairs of oligonucleotide sequences specific for survivin gene were designed and synthesized, and cloned into pSilencer-2.1U6-neo plasmid. The recombinant plasmids (named PS1 and PS2) were amplified in Ecoli. DH5alpha was identified by restriction digestion, PCR and sequencing. The vectors were transfected into Tca8113 cells with lipofectamine 2000. After selection with G418, the stable cell clones were attained. Survivn expression was assayed with real-time quantitative PCR and Western blotting. SAS8.0 software package was used for Student t test. Two vectors were constructed successfully and stable cell clones with PS1 or PS2 plasmid were obtained. As compared with those of control, survivin expression of transfected cell with PS1 or PS2 in mRNA level was significantly suppressed (P<0.05). In protein level, only those of transfected cell with PS2 was significantly suppressed (P<0.01). The shRNA interference expression plasmid vectors of survivin gene are successfully constructed, and Tca8113 cells which express survivin gene in a stable lower level are attained, which enable us to carry out further research on gene therapy of oral squamous cell carcinoma. Supported by National Natural Science Foundation of China (Grant No.30572056).

  8. Virus-mediated shRNA knockdown of prodynorphin in the rat nucleus accumbens attenuates depression-like behavior and cocaine locomotor sensitization.

    Directory of Open Access Journals (Sweden)

    Ami Cohen

    Full Text Available Dynorphins, endogenous opioid peptides that arise from the precursor protein prodynorphin (Pdyn, are hypothesized to be involved in the regulation of mood states and the neuroplasticity associated with addiction. The current study tested the hypothesis that dynorphin in the nucleus accumbens (NAcc mediates such effects. More specifically, we examined whether knockdown of Pdyn within the NAcc in rats would alter the expression of depressive-like and anxiety-like behavior, as well as cocaine locomotor sensitization. Wistar rats were injected with adeno-associated viral (AAV vectors encoding either a Pdyn-specific short hairpin RNA (AAV-shPdyn or a scrambled shRNA (AAV-shScr as control. Four weeks later, rats were tested for anxiety-like behavior in the elevated plus maze test and depressive-like behavior in the forced swim test (FST. Finally, rats received one daily injection of saline or cocaine (20 mg/kg, i.p., followed by assessment of locomotion for 4 consecutive days. Following 3 days of abstinence, the rats completed 2 additional daily cocaine/saline locomotor trials. Pdyn knockdown in the NAcc led to a significant reduction in depressive-like behavior in the FST, but had no effect on anxiety-like behavior in the elevated plus maze. Pdyn knockdown did not alter baseline locomotor behavior, the locomotor response to acute cocaine, or the initial sensitization of the locomotor response to cocaine over the first 4 cocaine treatment days. However, following 3 days abstinence the locomotor response to the cocaine challenge returned to their original levels in the AAV-shPdyn rats while remaining heightened in the AAV-shScr rats. These results suggest that dynorphin in a very specific area of the nucleus accumbens contributes to depressive-like states and may be involved in neuroadaptations in the NAcc that contribute to the development of cocaine addiction as a persistent and lasting condition.

  9. Lower-Body Muscle Structure and Jump Performance of Stronger and Weaker Surfing Athletes.

    Science.gov (United States)

    Secomb, Josh L; Nimphius, Sophia; Farley, Oliver R; Lundgren, Lina; Tran, Tai T; Sheppard, Jeremy M

    2016-07-01

    To identify whether there are any significant differences in the lower-body muscle structure and countermovement-jump (CMJ) and squat-jump (SJ) performance between stronger and weaker surfing athletes. Twenty elite male surfers had their lower-body muscle structure assessed with ultrasonography and completed a series of lower-body strength and jump tests including isometric midthigh pull (IMTP), CMJ, and SJ. Athletes were separated into stronger (n = 10) and weaker (n = 10) groups based on IMTP performance. Large significant differences were identified between the groups for vastus lateralis (VL) thickness (P = .02, ES = 1.22) and lateral gastrocnemius (LG) pennation angle (P = .01, ES = 1.20), and a large nonsignificant difference was identified in LG thickness (P = .08, ES = 0.89). Furthermore, significant differences were present between the groups for peak force, relative peak force, and jump height in the CMJ and SJ (P Stronger surfing athletes in this study had greater VL and LG thickness and LG pennation angle. These muscle structures may explain their better performance in the CMJ and SJ. A unique finding in this study was that the stronger group appeared to better use their strength and muscle structure for braking as they had significantly higher eccentric peak velocity and vertical displacement during the CMJ. This enhanced eccentric phase may have resulted in a greater production and subsequent utilization of stored elastic strain energy that led to the significantly better CMJ performance in the stronger group.

  10. A stronger patch test elicitation reaction to the allergen hydroxycitronellal plus the irritant sodium lauryl sulfate

    DEFF Research Database (Denmark)

    Heydorn, S; Andersen, K E; Johansen, J D

    2003-01-01

    Household and cleaning products often contain both allergens and irritants. The aim of this double-blinded, randomized, paired study was to determine whether patch testing with an allergen (hydroxycitronellal) combined with an irritant [sodium lauryl sulfate (SLS)] cause a stronger patch test...

  11. Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity

    DEFF Research Database (Denmark)

    Harndahl, Mikkel Nors; Rasmussen, Michael; Nielsen, Morten

    2012-01-01

    Peptide-MHC class I stability is a stronger predictor of CTL immunogenicity than peptide affinity Mikkel Harndahla, Michael Rasmussena, Morten Nielsenb, Soren Buusa,∗ a Laboratory of Experimental Immunology, Faculty of Health Sciences, University of Copenhagen, Denmark b Center for Biological Seq...... al., 2007. J. Immunol. 178, 7890–7901. doi:10.1016/j.molimm.2012.02.025...

  12. Becoming Stronger at Broken Places: A Model for Group Work with Young Adult from Divorced Families.

    Science.gov (United States)

    Hage, Sally M.; Nosanow, Mia

    2000-01-01

    Describes a model for group work with young adults from divorced families using an 8-session psychoeducational group intervention. Goals include reducing isolation, establishing connectedness, and building a stronger sense of identify. By educating young adults on topics such as assertiveness, communication skills, and self-esteem, it will give…

  13. A Human Capital Framework for a Stronger Teacher Workforce. Advancing Teaching--Improving Learning. White Paper

    Science.gov (United States)

    Myung, Jeannie; Martinez, Krissia; Nordstrum, Lee

    2013-01-01

    Building a stronger teacher workforce requires the thoughtful orchestration of multiple processes working together in a human capital system. This white paper presents a framework that can be used to take stock of current efforts to enhance the teacher workforce in school districts or educational organizations, as well as their underlying theories…

  14. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v1; ref status: indexed, http://f1000r.es/2tt

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-02-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  15. An image-based, dual fluorescence reporter assay to evaluate the efficacy of shRNA for gene silencing at the single-cell level [v2; ref status: indexed, http://f1000r.es/39j

    Directory of Open Access Journals (Sweden)

    Shin-ichiro Kojima

    2014-05-01

    Full Text Available RNA interference (RNAi is widely used to suppress gene expression in a specific manner. The efficacy of RNAi is mainly dependent on the sequence of small interfering RNA (siRNA in relation to the target mRNA. Although several algorithms have been developed for the design of siRNA, it is still difficult to choose a really effective siRNA from among multiple candidates. In this article, we report the development of an image-based, quantitative, ratiometric fluorescence reporter assay to evaluate the efficacy of RNAi at the single-cell level. Two fluorescence reporter constructs are used. One expresses the candidate small hairpin RNA (shRNA together with an enhanced green fluorescent protein (EGFP; the other expresses a 19-nt target sequence inserted into a cassette expressing a red fluorescent protein (either DsRed or mCherry. Effectiveness of the candidate shRNA is evaluated as the extent to which it knocks down expression of the red fluorescent protein. Thus, the red-to-green fluorescence intensity ratio (appropriately normalized to controls is used as the read-out for quantifying the siRNA efficacy at the individual cell level. We tested this dual fluorescence assay and compared predictions to actual endogenous knockdown levels for three different genes (vimentin, lamin A/C and Arp3 and twenty different shRNAs. For each of the genes, our assay successfully predicted the target sequences for effective RNAi. To further facilitate testing of RNAi efficacy, we developed a negative selection marker (ccdB method for construction of shRNA and red fluorescent reporter plasmids that allowed us to purify these plasmids directly from transformed bacteria without the need for colony selection and DNA sequencing verification.

  16. Spectral intensity dependence an isotropy of sources stronger than 0.1 Jy at 2700 MHz

    International Nuclear Information System (INIS)

    Balonek, T.J.; Broderick, J.J.; Condon, J.J.; Crawford, D.F.; Jauncey, D.L.

    1975-01-01

    The 1000-foot (305 m) telescope of the National Astronomy and Ionosphere Center was used to measure 430 MHz flux densities of sources stronger than 0.1 Jy at 2700 MHz. Distributions of the resulting two-point spectral indices α (430, 2700) of sources in the intensity range 0.1less than or equal toS<0.35 Jy were compared with α (318, 2700) distributions of sources stronger than 0.35 Jy at 2700 MHz. The median normal-component spectral index and fraction of flat-spectrum sources in the faintest sample do not continue the previously discovered trend toward increased spectral steepening of faint sources. This result differs from the prediction of simple evolutionary cosmological models and therefore favors the alternative explanation that local source-density inhomogeneities are responsible for the observed intensity dependence of spectral indices

  17. Crosstalk in concurrent repeated games impedes direct reciprocity and requires stronger levels of forgiveness.

    Science.gov (United States)

    Reiter, Johannes G; Hilbe, Christian; Rand, David G; Chatterjee, Krishnendu; Nowak, Martin A

    2018-02-07

    Direct reciprocity is a mechanism for cooperation among humans. Many of our daily interactions are repeated. We interact repeatedly with our family, friends, colleagues, members of the local and even global community. In the theory of repeated games, it is a tacit assumption that the various games that a person plays simultaneously have no effect on each other. Here we introduce a general framework that allows us to analyze "crosstalk" between a player's concurrent games. In the presence of crosstalk, the action a person experiences in one game can alter the person's decision in another. We find that crosstalk impedes the maintenance of cooperation and requires stronger levels of forgiveness. The magnitude of the effect depends on the population structure. In more densely connected social groups, crosstalk has a stronger effect. A harsh retaliator, such as Tit-for-Tat, is unable to counteract crosstalk. The crosstalk framework provides a unified interpretation of direct and upstream reciprocity in the context of repeated games.

  18. Daytime warming has stronger negative effects on soil nematodes than night-time warming

    OpenAIRE

    Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

    2017-01-01

    Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatmen...

  19. Sexual harassment and emotional and behavioural symptoms in adolescence: stronger associations among boys than girls.

    Science.gov (United States)

    Kaltiala-Heino, Riittakerttu; Fröjd, Sari; Marttunen, Mauri

    2016-08-01

    To study the associations between subjection to sexual harassment and emotional (depression) and behavioural (delinquency) symptoms among 14-to-18-year-old adolescents, and gender differences within these associations. 90,953 boys and 91,746 girls aged 14-18 participated in the School Health Promotion Study (SHPS), a school-based survey designed to examine the health, health behaviours, and school experiences of teenagers. Experiences of sexual harassment were elicited with five questions addressing five separate forms of harassment. Depression was measured by the 13-item Beck Depression Inventory and delinquency with a modified version of the International Self-Report Delinquency Study (ISRD) instrument. Data were analysed using cross-tabulations with Chi-square statistics and logistic regression. All sexual harassment experiences studied were associated with both depression (adjusted odds ratios varied from 2.2 to 2.7 in girls and from 2.0 to 5.1 in boys) and delinquency (adjusted odds ratios 3.1-5.0 in girls and 1.7-6.9 in boys). Sexual name-calling had a stronger association with depression and with delinquency in girls (adjusted odds ratios, respectively, 2.4 and 4.2), than in boys (adjusted odds ratios, respectively, 2.0 and 1.7), but otherwise stronger associations with emotional and behavioural symptoms were seen in boys. Subjection to sexual harassment is associated with both emotional and behavioural symptoms in both girls and boys. The associations are mostly stronger for boys. Boys subjected to sexual harassment may feel particularly threatened regarding their masculinity, and there may be less support available for boys traumatised due to sexual harassment.

  20. Production of plastified wood with stronger static bending strength means of polymerization induced by gamma radiation

    International Nuclear Information System (INIS)

    Silva Filho, Elias

    1999-01-01

    The use of gamma radiation to obtain wood-polymer composites is one of the applications of radiation that presents the most commercial interest. The process, denominated radiopolymerization, comprises the impregnation of monomers into the completely dried wood followed by exposure to gamma radiation to induce polymerization of the impregnated monomers. I this context, the present work aimed the application of this process to seven kinds of wood existing in the brazilian forests. The considered monomer is styrene and the gamma source is Cobalt-60. The obtained wood-polystyrene composites were found to have stronger static bending strength. (author)

  1. Why is the radial flow in central pA collisions stronger than in AA?

    International Nuclear Information System (INIS)

    Kalaydzhyan, Tigran; Shuryak, Edward

    2014-01-01

    Both the transverse size and entropy density per area in central pA collisions is smaller than in central AA, and yet the radial flow is stronger. We propose an explanation to this puzzle. Using a weak attraction between strings through the σ-meson exchange, fitted to the lattice data, we find collective implosion of the “spaghetti” multi-string state. Collectivization of the sigma field of the strings is the QCD analog of the black hole formation occurring in holographic models

  2. Selection is stronger in early-versus-late stages of divergence in a Neotropical livebearing fish.

    Science.gov (United States)

    Ingley, Spencer J; Johnson, Jerald B

    2016-03-01

    How selection acts to drive trait evolution at different stages of divergence is of fundamental importance in our understanding of the origins of biodiversity. Yet, most studies have focused on a single point along an evolutionary trajectory. Here, we provide a case study evaluating the strength of divergent selection acting on life-history traits at early-versus-late stages of divergence in Brachyrhaphis fishes. We find that the difference in selection is stronger in the early-diverged population than the late-diverged population, and that trait differences acquired early are maintained over time. © 2016 The Author(s).

  3. Stronger interference from distractors in the right hemifield during visual search.

    Science.gov (United States)

    Carlei, Christophe; Kerzel, Dirk

    2018-03-01

    The orientation-bias hypothesis states that there is a bias to attend to the right visual hemifield (RVF) when there is spatial competition between stimuli in the left and right hemifield [Pollmann, S. (1996). A pop-out induced extinction-like phenomenon in neurologically intact subjects. Neuropsychologia, 34(5), 413-425. doi: 10.1016/0028-3932(95)00125-5 ]. In support of this hypothesis, stronger interference was reported for RVF distractors with contralateral targets. In contrast, previous studies using rapid serial visual presentation (RSVP) found stronger interference from distractors in the left visual hemifield (LVF). We used the additional singleton paradigm to test whether this discrepancy was due to the different distractor features that were employed (colour vs. orientation). Interference from the colour distractor with contralateral targets was larger in the RVF than in the LVF. However, the asymmetrical interference disappeared when observers had to search for an inconspicuous colour target instead of the inconspicuous shape target. We suggest that the LVF orienting-bias is limited to situations where search is driven by bottom-up saliency (singleton search) instead of top-down search goals (feature search). In contrast, analysis of the literature suggests the opposite for the LVF bias in RSVP tasks. Thus, the attentional asymmetry may depend on whether the task involves temporal or spatial competition, and whether search is based on bottom-up or top-down signals.

  4. Fathers see stronger family resemblances than non-fathers in unrelated children's faces.

    Science.gov (United States)

    Bressan, Paola; Dal Pos, Stefania

    2012-12-01

    Even after they have taken all reasonable measures to decrease the probability that their spouses cheat on them, men still face paternal uncertainty. Such uncertainty can lead to paternal disinvestment, which reduces the children's probability to survive and reproduce, and thus the reproductive success of the fathers themselves. A theoretical model shows that, other things being equal, men who feel confident that they have fathered their spouses' offspring tend to enjoy greater fitness (i.e., leave a larger number of surviving progeny) than men who do not. This implies that fathers should benefit from exaggerating paternal resemblance. We argue that the self-deceiving component of this bias could be concealed by generalizing this resemblance estimation boost to (1) family pairs other than father-child and (2) strangers. Here, we tested the prediction that fathers may see, in unrelated children's faces, stronger family resemblances than non-fathers. In Study 1, 70 men and 70 women estimated facial resemblances between children paired, at three different ages (as infants, children, and adolescents), either to themselves or to their parents. In Study 2, 70 men and 70 women guessed the true parents of the same children among a set of adults. Men who were fathers reported stronger similarities between faces than non-fathers, mothers, and non-mothers did, but were no better at identifying childrens' real parents. We suggest that, in fathers, processing of facial resemblances is biased in a manner that reflects their (adaptive) wishful thinking that fathers and children are related.

  5. Do External or Internal Technology Spillovers Have a Stronger Influence on Innovation Efficiency in China?

    Directory of Open Access Journals (Sweden)

    Xionghe Qin

    2017-09-01

    Full Text Available In this study, we bridge an important gap in the literature by comparing the extent to which external technology spillovers, as indicated by foreign direct investment (FDI, and internal technology spillovers, as indicated by university-institute-industry cooperation (UIC, influence innovation efficiency in China. We divide the innovation process into two sequential stages, namely the knowledge creation and technology commercialization stages, and employ a network data envelopment analysis approach to measure innovation efficiency at each stage. The spatial analysis of the distribution of knowledge creation efficiency and technology commercialization efficiency reveals the heterogeneity of innovation efficiency at the provincial level. Then, a panel data regression is used to analyze the effect of FDI and UIC on innovation efficiency at each stage, using data from 2009 to 2015 for 30 provinces in China. By comparing FDI with UIC, we find that FDI has a higher coefficient and stronger significance level at the knowledge creation stage, while only industry-institute linkages exhibit a stronger association with innovation efficiency at the technology commercialization stage.

  6. A configural dominant account of contextual cueing: Configural cues are stronger than colour cues.

    Science.gov (United States)

    Kunar, Melina A; John, Rebecca; Sweetman, Hollie

    2014-01-01

    Previous work has shown that reaction times to find a target in displays that have been repeated are faster than those for displays that have never been seen before. This learning effect, termed "contextual cueing" (CC), has been shown using contexts such as the configuration of the distractors in the display and the background colour. However, it is not clear how these two contexts interact to facilitate search. We investigated this here by comparing the strengths of these two cues when they appeared together. In Experiment 1, participants searched for a target that was cued by both colour and distractor configural cues, compared with when the target was only predicted by configural information. The results showed that the addition of a colour cue did not increase contextual cueing. In Experiment 2, participants searched for a target that was cued by both colour and distractor configuration compared with when the target was only cued by colour. The results showed that adding a predictive configural cue led to a stronger CC benefit. Experiments 3 and 4 tested the disruptive effects of removing either a learned colour cue or a learned configural cue and whether there was cue competition when colour and configural cues were presented together. Removing the configural cue was more disruptive to CC than removing colour, and configural learning was shown to overshadow the learning of colour cues. The data support a configural dominant account of CC, where configural cues act as the stronger cue in comparison to colour when they are presented together.

  7. RNAi screening of subtracted transcriptomes reveals tumor suppression by taurine-activated GABAA receptors involved in volume regulation

    Science.gov (United States)

    van Nierop, Pim; Vormer, Tinke L.; Foijer, Floris; Verheij, Joanne; Lodder, Johannes C.; Andersen, Jesper B.; Mansvelder, Huibert D.; te Riele, Hein

    2018-01-01

    To identify coding and non-coding suppressor genes of anchorage-independent proliferation by efficient loss-of-function screening, we have developed a method for enzymatic production of low complexity shRNA libraries from subtracted transcriptomes. We produced and screened two LEGO (Low-complexity by Enrichment for Genes shut Off) shRNA libraries that were enriched for shRNA vectors targeting coding and non-coding polyadenylated transcripts that were reduced in transformed Mouse Embryonic Fibroblasts (MEFs). The LEGO shRNA libraries included ~25 shRNA vectors per transcript which limited off-target artifacts. Our method identified 79 coding and non-coding suppressor transcripts. We found that taurine-responsive GABAA receptor subunits, including GABRA5 and GABRB3, were induced during the arrest of non-transformed anchor-deprived MEFs and prevented anchorless proliferation. We show that taurine activates chloride currents through GABAA receptors on MEFs, causing seclusion of cell volume in large membrane protrusions. Volume seclusion from cells by taurine correlated with reduced proliferation and, conversely, suppression of this pathway allowed anchorage-independent proliferation. In human cholangiocarcinomas, we found that several proteins involved in taurine signaling via GABAA receptors were repressed. Low GABRA5 expression typified hyperproliferative tumors, and loss of taurine signaling correlated with reduced patient survival, suggesting this tumor suppressive mechanism operates in vivo. PMID:29787571

  8. Stronger relationship of serum apolipoprotein A-1 and B with diabetic retinopathy than traditional lipids

    Directory of Open Access Journals (Sweden)

    B S Ankit

    2017-01-01

    Full Text Available Aim: Diabetic retinopathy (DR is the most common preventable cause of blindness where early detection and treatment can be sight-saving. Search for biomarkers of the disease has been relentless. We aimed to determine whether lipoproteins apolipoproteins A1 and B1 (Apo-A1 and Apo-B1 have stronger associations with DR in contrast to conventionally measured low-density lipoprotein (LDL and high-density lipoprotein cholesterol levels. Materials and Methods: We performed a cross-sectional study and studied 117 patients. Serum lipid profile was assessed by autoanalyzer. Serum Apo-A1 and Apo-B were measured using immunoturbidimetric kit on an autoanalyzer. Apo-B/A1 ratio was calculated. Retinopathy was graded from the digital retinal photographs, taken with nonmydriatic auto fundus camera and classified according to International Clinical DR Disease Severity Scale. Results: Mean Apo-A1 for mild, moderate, severe retinopathy, and proliferative DR (PDR shows a significant negative correlation (P = 0.001 with severity of retinopathy. Mean Apo-B for mild, moderate, severe, PDR displayed a significant positive correlation with severity of retinopathy (P = 0.001. Mean Apo-B/A1 for mild, moderate, severe, PDR showed highly significant positive correlation with severity of retinopathy (P < 0.001. In contrast, mean LDL for mild, moderate, severe, PDR showed insignificant association with severity of DR (P = 0.081. Conclusion: Apo-A1 and Apo-B have a stronger association with the development of DR than traditional lipids and can thus facilitate early detection and treatment of the disease.

  9. Faster and stronger manifestation of mitochondrial diseases in skeletal muscle than in heart related to cytosolic inorganic phosphate (Pi) accumulation.

    Science.gov (United States)

    Korzeniewski, Bernard

    2016-08-01

    A model of the cell bioenergetic system was used to compare the effect of oxidative phosphorylation (OXPHOS) deficiencies in a broad range of moderate ATP demand in skeletal muscle and heart. Computer simulations revealed that kinetic properties of the system are similar in both cases despite the much higher mitochondria content and "basic" OXPHOS activity in heart than in skeletal muscle, because of a much higher each-step activation (ESA) of OXPHOS in skeletal muscle than in heart. Large OXPHOS deficiencies lead in both tissues to a significant decrease in oxygen consumption (V̇o2) and phosphocreatine (PCr) and increase in cytosolic ADP, Pi, and H(+) The main difference between skeletal muscle and heart is a much higher cytosolic Pi concentration in healthy tissue and much higher cytosolic Pi accumulation (level) at low OXPHOS activities in the former, caused by a higher PCr level in healthy tissue (and higher total phosphate pool) and smaller Pi redistribution between cytosol and mitochondria at OXPHOS deficiency. This difference does not depend on ATP demand in a broad range. A much greater Pi increase and PCr decrease during rest-to-moderate work transition in skeletal muscle at OXPHOS deficiencies than at normal OXPHOS activity significantly slows down the V̇o2 on-kinetics. Because high cytosolic Pi concentrations cause fatigue in skeletal muscle and can compromise force generation in skeletal muscle and heart, this system property can contribute to the faster and stronger manifestation of mitochondrial diseases in skeletal muscle than in heart. Shortly, skeletal muscle with large OXPHOS deficiencies becomes fatigued already during low/moderate exercise. Copyright © 2016 the American Physiological Society.

  10. Strategies of Building a Stronger Sense of Community for Sustainable Neighborhoods: Comparing Neighborhood Accessibility with Community Empowerment Programs

    Directory of Open Access Journals (Sweden)

    Te-I Albert Tsai

    2014-05-01

    Full Text Available New Urbanist development in the U.S. aims at enhancing a sense of community and seeks to return to the design of early transitional neighborhoods which have pedestrian-oriented environments with retail shops and services within walking distances of housing. Meanwhile, 6000 of Taiwan’s community associations have been running community empowerment programs supported by the Council for Cultural Affairs that have helped many neighborhoods to rebuild so-called community cohesion. This research attempts to evaluate whether neighborhoods with facilities near housing and shorter travel distances within a neighborhood would promote stronger social interactions and form a better community attachment than neighborhoods that have various opportunities for residents to participate in either formal or informal social gatherings. After interviewing and surveying residents from 19 neighborhoods in Taipei’s Beitou District, and correlating the psychological sense of community with inner neighborhood’s daily travel distances and numbers of participatory activities held by community organizations under empowerment programs together with frequencies of regular individual visits and casual meetings, statistical evidence yielded that placing public facilities near residential locations is more effective than providing various programs for elevating a sense of community.

  11. Ni2P Makes Application of the PtRu Catalyst Much Stronger in Direct Methanol Fuel Cells.

    Science.gov (United States)

    Chang, Jinfa; Feng, Ligang; Liu, Changpeng; Xing, Wei

    2015-10-12

    PtRu is regarded as the best catalyst for direct methanol fuel cells, but the performance decay resulting from the loss of Ru seriously hinders commercial applications. Herein, we demonstrated that the presence of Ni2 P largely reduces Ru loss, which thus makes the application of PtRu much stronger in direct methanol fuel cells. Outstanding catalytic activity and stability were observed by cyclic voltammetry. Upon integrating the catalyst material into a practical direct methanol fuel cell, the highest maximum power density was achieved on the PtRu-Ni2P/C catalyst among the reference catalysts at different temperatures. A maximum power density of 69.9 mW cm(-2) at 30 °C was obtained on PtRu-Ni2P/C, which is even higher than the power density of the state-of-the-art commercial PtRu catalyst at 70 °C (63.1 mW cm(-2)). Moreover, decay in the performance resulting from Ru loss was greatly reduced owing to the presence of Ni2 P, which is indicative of very promising applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. The Integration Role of European Defense Procurement in Achieving a More Competitive and Stronger European Defense Equipment Market

    Science.gov (United States)

    2015-06-01

    and systems, even monopolistic ) essence of the supply side of the defense market . There are only a few suppliers that can meet today’s complex...DEFENSE PROCUREMENT IN ACHIEVING A MORE COMPETITIVE AND STRONGER EUROPEAN DEFENSE EQUIPMENT MARKET by Kiril O. Angelov June 2015 Thesis Advisor...COMPETITIVE AND STRONGER EUROPEAN DEFENSE EQUIPMENT MARKET 5. FUNDING NUMBERS 6. AUTHOR(S) Kiril O. Angelov 7. PERFORMING ORGANIZATION NAME(S) AND

  13. Age differences in autobiographical memory across the adult lifespan: older adults report stronger phenomenology.

    Science.gov (United States)

    Luchetti, Martina; Sutin, Angelina R

    2018-01-01

    As an individual's life story evolves across adulthood, the subjective experience (phenomenology) of autobiographical memory likely changes. In addition to age at retrieval, both the recency of the memory and the age when a memory is formed may be particularly important to its phenomenology. The present work examines the effect of three temporal factors on phenomenology ratings: (a) age of the participant, (b) age at the event reported in the memory, and (c) memory age (recency). A large sample of Americans (N = 1120), stratified by chronological age, recalled and rated two meaningful memories, a Turning Point and an Early Childhood Memory. Ratings of phenomenology (e.g., vividness of turning points) were higher among older adults compared to younger adults. Memories of events from the reminiscence bump were more positive in valence than events from other time periods but did not differ on other phenomenological dimensions; recent memories had stronger phenomenology than remote memories. In contrast to phenomenology, narrative content was generally unrelated to participant age, age at the event, or memory age. Overall, the findings indicate age-related differences in how meaningful memories are re-experienced.

  14. Income is a stronger predictor of mortality than education in a national sample of US adults.

    Science.gov (United States)

    Sabanayagam, Charumathi; Shankar, Anoop

    2012-03-01

    Low socioeconomic status (SES) is associated with mortality in several populations. SES measures, such as education and income, may operate through different pathways. However, the independent effect of each measure mutually adjusting for the effect of other SES measures is not clear. The association between poverty-income ratio (PIR) and education and all-cause mortality among 15,646 adults, aged >20 years, who participated in the Third National Health and Nutrition Examination Survey in the USA, was examined. The lower PIR quartiles and less than high school education were positively associated with all-cause mortality in initial models adjusting for the demographic, lifestyle and clinical risk factors. After additional adjustment for education, the lower PIR quartiles were still significantly associated with all-cause mortality. The multivariable odds ratio (OR) [95% confidence interval (CI)] of all-cause mortality comparing the lowest to the highest quartile of PIR was 2.11 (1.52-2.95, p trend education was no longer associated with all-cause mortality [multivariable OR (95% CI) of all-cause mortality comparing less than high school to more than high school education was 1.05 (0.85-1.31, p trend=0.57)]. The results suggest that income may be a stronger predictor of mortality than education, and narrowing the income differentials may reduce the health disparities.

  15. UGC galaxies stronger than 25 mJy at 4.85 GHz

    International Nuclear Information System (INIS)

    Condon, J.J.; Frayer, D.T.; Broderick, J.J.

    1991-01-01

    UGC galaxies in the declination band +5 to +75 deg were identified by position coincidence with radio sources stronger than 25 mJy on the Green Bank 4.85 GHz sky maps. Candidate identifications were confirmed or rejected with the aid of published aperture-synthesis maps and new 4.86 GHz VLA maps having 15 or 18 arcsec resolution, resulting in a sample of 347 nearby radio galaxies plus five new quasar-galaxy pairs. The radio energy sources in UGC galaxies were classified as starbursts or monsters on the basis of their infrared-radio flux ratios, infrared spectral indices, and radio morphologies. The rms scatter in the logarithmic infrared-radio ratio q is not more than 0.16 for starburst galaxies selected at 4.85 GHz. Radio spectral indices were obtained for nearly all of the UGC galaxies, and S0 galaxies account for a disproportionate share of the compact flat-spectrum (alpha less than 0.5) radio sources. The extended radio jets and lobes produced by monsters are preferentially, but not exclusively, aligned within about 30 deg of the optical minor axes of their host galaxies. The tendency toward minor-axis ejection appears to be independent of radio-source size and is strongest for elliptical galaxies. 230 refs

  16. Plant Identity Exerts Stronger Effect than Fertilization on Soil Arbuscular Mycorrhizal Fungi in a Sown Pasture.

    Science.gov (United States)

    Zheng, Yong; Chen, Liang; Luo, Cai-Yun; Zhang, Zhen-Hua; Wang, Shi-Ping; Guo, Liang-Dong

    2016-10-01

    Arbuscular mycorrhizal (AM) fungi play key roles in plant nutrition and plant productivity. AM fungal responses to either plant identity or fertilization have been investigated. However, the interactive effects of different plant species and fertilizer types on these symbiotic fungi remain poorly understood. We evaluated the effects of the factorial combinations of plant identity (grasses Avena sativa and Elymus nutans and legume Vicia sativa) and fertilization (urea and sheep manure) on AM fungi following 2-year monocultures in a sown pasture field study. AM fungal extraradical hyphal density was significantly higher in E. nutans than that in A. sativa and V. sativa in the unfertilized control and was significantly increased by urea and manure in A. sativa and by manure only in E. nutans, but not by either fertilizers in V. sativa. AM fungal spore density was not significantly affected by plant identity or fertilization. Forty-eight operational taxonomic units (OTUs) of AM fungi were obtained through 454 pyrosequencing of 18S rDNA. The OTU richness and Shannon diversity index of AM fungi were significantly higher in E. nutans than those in V. sativa and/or A. sativa, but not significantly affected by any fertilizer in all of the three plant species. AM fungal community composition was significantly structured directly by plant identity only and indirectly by both urea addition and plant identity through soil total nitrogen content. Our findings highlight that plant identity has stronger influence than fertilization on belowground AM fungal community in this converted pastureland from an alpine meadow.

  17. Brain Potentials Highlight Stronger Implicit Food Memory for Taste than Health and Context Associations.

    Science.gov (United States)

    Hoogeveen, Heleen R; Jolij, Jacob; Ter Horst, Gert J; Lorist, Monicque M

    2016-01-01

    Increasingly consumption of healthy foods is advised to improve population health. Reasons people give for choosing one food over another suggest that non-sensory features like health aspects are appreciated as of lower importance than taste. However, many food choices are made in the absence of the actual perception of a food's sensory properties, and therefore highly rely on previous experiences of similar consumptions stored in memory. In this study we assessed the differential strength of food associations implicitly stored in memory, using an associative priming paradigm. Participants (N = 30) were exposed to a forced-choice picture-categorization task, in which the food or non-food target images were primed with either non-sensory or sensory related words. We observed a smaller N400 amplitude at the parietal electrodes when categorizing food as compared to non-food images. While this effect was enhanced by the presentation of a food-related word prime during food trials, the primes had no effect in the non-food trials. More specifically, we found that sensory associations are stronger implicitly represented in memory as compared to non-sensory associations. Thus, this study highlights the neuronal mechanisms underlying previous observations that sensory associations are important features of food memory, and therefore a primary motive in food choice.

  18. Daytime warming has stronger negative effects on soil nematodes than night-time warming

    Science.gov (United States)

    Yan, Xiumin; Wang, Kehong; Song, Lihong; Wang, Xuefeng; Wu, Donghui

    2017-03-01

    Warming of the climate system is unequivocal, that is, stronger warming during night-time than during daytime. Here we focus on how soil nematodes respond to the current asymmetric warming. A field infrared heating experiment was performed in the western of the Songnen Plain, Northeast China. Three warming modes, i.e. daytime warming, night-time warming and diurnal warming, were taken to perform the asymmetric warming condition. Our results showed that the daytime and diurnal warming treatment significantly decreased soil nematodes density, and night-time warming treatment marginally affected the density. The response of bacterivorous nematode and fungivorous nematode to experimental warming showed the same trend with the total density. Redundancy analysis revealed an opposite effect of soil moisture and soil temperature, and the most important of soil moisture and temperature in night-time among the measured environment factors, affecting soil nematode community. Our findings suggested that daily minimum temperature and warming induced drying are most important factors affecting soil nematode community under the current global asymmetric warming.

  19. Earlier adolescent substance use onset predicts stronger connectivity between reward and cognitive control brain networks.

    Science.gov (United States)

    Weissman, David G; Schriber, Roberta A; Fassbender, Catherine; Atherton, Olivia; Krafft, Cynthia; Robins, Richard W; Hastings, Paul D; Guyer, Amanda E

    2015-12-01

    Early adolescent onset of substance use is a robust predictor of future substance use disorders. We examined the relation between age of substance use initiation and resting state functional connectivity (RSFC) of the core reward processing (nucleus accumbens; NAcc) to cognitive control (prefrontal cortex; PFC) brain networks. Adolescents in a longitudinal study of Mexican-origin youth reported their substance use annually from ages 10 to 16 years. At age 16, 69 adolescents participated in a resting state functional magnetic resonance imaging scan. Seed-based correlational analyses were conducted using regions of interest in bilateral NAcc. The earlier that adolescents initiated substance use, the stronger the connectivity between bilateral NAcc and right dorsolateral PFC, right dorsomedial PFC, right pre-supplementary motor area, right inferior parietal lobule, and left medial temporal gyrus. The regions that demonstrated significant positive linear relationships between the number of adolescent years using substances and connectivity with NAcc are nodes in the right frontoparietal network, which is central to cognitive control. The coupling of reward and cognitive control networks may be a mechanism through which earlier onset of substance use is related to brain function over time, a trajectory that may be implicated in subsequent substance use disorders. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Harmful drinking after job loss: a stronger association during the post-2008 economic crisis?

    Science.gov (United States)

    de Goeij, Moniek C M; Bruggink, Jan-Willem; Otten, Ferdy; Kunst, Anton E

    2017-06-01

    This study investigated, among the Dutch working population, whether job loss during the post-2008 economic crisis is associated with harmful drinking and whether this association is stronger than before the crisis. Repeated cross-sectional data from the Dutch Health Interview Survey 2004-2013 were used to define episodic drinking (≥6 glasses on 1 day ≥1/week) and chronic drinking (≥14 glasses/week for women and ≥21 for men). These data were linked to longitudinal data from tax registries, to measure the experience and duration of job loss during a 5-year working history. Before the crisis, job loss experience and duration were not associated with harmful drinking. During the crisis, job loss for more than 6 months was associated with episodic drinking [OR 1.40 (95% CI 1.01; 1.94)], while current job loss was associated with chronic drinking [OR 1.43 (95% CI 1.03; 1.98)]. These associations were most clear in men and different between the pre-crisis and crisis period (p interaction = 0.023 and 0.035, respectively). The results suggest that economic crises strengthen the potential impact of job loss on harmful drinking, predominately among men.

  1. Serum albumin coating of demineralized bone matrix results in stronger new bone formation.

    Science.gov (United States)

    Horváthy, Dénes B; Vácz, Gabriella; Szabó, Tamás; Szigyártó, Imola C; Toró, Ildikó; Vámos, Boglárka; Hornyák, István; Renner, Károly; Klára, Tamás; Szabó, Bence T; Dobó-Nagy, Csaba; Doros, Attila; Lacza, Zsombor

    2016-01-01

    Blood serum fractions are hotly debated adjuvants in bone replacement therapies. In the present experiment, we coated demineralized bone matrices (DBM) with serum albumin and investigated stem cell attachment in vitro and bone formation in a rat calvaria defect model. In the in vitro experiments, we observed that significantly more cells adhere to the serum albumin coated DBMs at every time point. In vivo bone formation with albumin coated and uncoated DBM was monitored biweekly by computed tomography until 11 weeks postoperatively while empty defects served as controls. By the seventh week, the bone defect in the albumin group was almost completely closed (remaining defect 3.0 ± 2.3%), while uncoated DBM and unfilled control groups still had significant defects (uncoated: 40.2 ± 9.1%, control: 52.4 ± 8.9%). Higher density values were also observed in the albumin coated DBM group. In addition, the serum albumin enhanced group showed significantly higher volume of newly formed bone in the microCT analysis and produced significantly higher breaking force and stiffness compared to the uncoated grafts (peak breaking force: uncoated: 15.7 ± 4 N, albumin 46.1 ± 11 N). In conclusion, this investigation shows that implanting serum albumin coated DBM significantly reduces healing period in nonhealing defects and results in mechanically stronger bone. These results also support the idea that serum albumin coating provides a convenient milieu for stem cell function, and a much improved bone grafting success can be achieved without the use of exogenous stem cells. © 2015 Wiley Periodicals, Inc.

  2. Association Between Self-Esteem and Depressive Symptoms Is Stronger Among Black than White Older Adults.

    Science.gov (United States)

    Assari, Shervin

    2017-08-01

    Although poor self-esteem is a core component of depression, we still do not know if racial and ethnic groups differ in the magnitude of this link. This study compared Black and White older adults on the association between self-esteem and depressive symptoms. With a cross-sectional design, this study enrolled 1493 older individuals (age 66 or more) from the 2001 Religion, Aging, and Health Survey, a nationally representative study in the United States. Participants were either Blacks (n = 734) or Whites (n = 759). Depressive symptoms and self-esteem were measured using brief measures of the Center for Epidemiological Studies-Depression scale (CES-D) and the Rosenberg Self-Esteem Scale, respectively. Demographics, socioeconomics, and self-rated health (SRH) were covariates and self-identified race was the moderator. Linear regression models were used for data analysis. Low self-esteem was associated with more depressive symptoms (B = 0.17, 95 % CI 0.15-0.28), above and beyond all covariates. We found a significant and positive interaction between race (Black) and poor self-esteem on depressive symptoms (B = 0.34, 95 % CI 0.17-0.36), suggesting a stronger association between self-esteem and depressive symptoms among Blacks compared to Whites. Although low self-esteem is associated with higher depressive symptoms in both Whites and Blacks (p self-esteem and high depressive symptoms are more closely associated among Blacks than Whites. It is not clear whether depression leaves a larger scar on self-esteem for Blacks, or Blacks are more vulnerable to the effect of low self-esteem on depression.

  3. Pasture v. standard dairy cream in high-fat diet-fed mice: improved metabolic outcomes and stronger intestinal barrier.

    Science.gov (United States)

    Benoit, Bérengère; Plaisancié, Pascale; Géloën, Alain; Estienne, Monique; Debard, Cyrille; Meugnier, Emmanuelle; Loizon, Emmanuelle; Daira, Patricia; Bodennec, Jacques; Cousin, Olivier; Vidal, Hubert; Laugerette, Fabienne; Michalski, Marie-Caroline

    2014-08-28

    Dairy products derived from the milk of cows fed in pastures are characterised by higher amounts of conjugated linoleic acid and α-linolenic acid (ALA), and several studies have shown their ability to reduce cardiovascular risk. However, their specific metabolic effects compared with standard dairy in a high-fat diet (HFD) context remain largely unknown; this is what we determined in the present study with a focus on the metabolic and intestinal parameters. The experimental animals were fed for 12 weeks a HFD containing 20 % fat in the form of a pasture dairy cream (PDC) or a standard dairy cream (SDC). Samples of plasma, liver, white adipose tissue, duodenum, jejunum and colon were analysed. The PDC mice, despite a higher food intake, exhibited lower fat mass, plasma and hepatic TAG concentrations, and inflammation in the adipose tissue than the SDC mice. Furthermore, they exhibited a higher expression of hepatic PPARα mRNA and adipose tissue uncoupling protein 2 mRNA, suggesting an enhanced oxidative activity of the tissues. These results might be explained, in part, by the higher amounts of ALA in the PDC diet and in the liver and adipose tissue of the PDC mice. Moreover, the PDC diet was found to increase the proportions of two strategic cell populations involved in the protective function of the intestinal epithelium, namely Paneth and goblet cells in the small intestine and colon, compared with the SDC diet. In conclusion, a PDC HFD leads to improved metabolic outcomes and to a stronger gut barrier compared with a SDC HFD. This may be due, at least in part, to the protective mechanisms induced by specific lipids.

  4. Stronger back muscles reduce the incidence of vertebral fractures: a prospective 10 year follow-up of postmenopausal women.

    Science.gov (United States)

    Sinaki, M; Itoi, E; Wahner, H W; Wollan, P; Gelzcer, R; Mullan, B P; Collins, D A; Hodgson, S F

    2002-06-01

    The long-term protective effect of stronger back muscles on the spine was determined in 50 healthy white postmenopausal women, aged 58-75 years, 8 years after they had completed a 2 year randomized, controlled trial. Twenty-seven subjects had performed progressive, resistive back-strengthening exercises for 2 years and 23 had served as controls. Bone mineral density, spine radiographs, back extensor strength, biochemical marker values, and level of physical activity were obtained for all subjects at baseline, 2 years, and 10 years. Mean back extensor strength (BES) in the back-exercise (BE) group was 39.4 kg at baseline, 66.8 kg at 2 years (after 2 years of prescribed exercises), and 32.9 kg at 10 years (8 years after cessation of the prescribed exercises). Mean BES in the control (C) group was 36.9 kg at baseline, 49.0 kg at 2 years, and 26.9 kg at 10 years. The difference between the two groups was still statistically significant at 10 year follow-up (p = 0.001). The difference in bone mineral density, which was not significant between the two groups at baseline and 2 year follow-up, was significant at 10 year follow-up (p = 0.0004). The incidence of vertebral compression fracture was 14 fractures in 322 vertebral bodies examined (4.3%) in the C group and 6 fractures in 378 vertebral bodies examined (1.6%) in the BE group (chi-square test, p = 0.0290). The relative risk for compression fracture was 2.7 times greater in the C group than in the BE group. To our knowledge, this is the first study reported in the literature demonstrating the long-term effect of strong back muscles on the reduction of vertebral fractures in estrogen-deficient women.

  5. Bell inequalities stronger than the Clauser-Horne-Shimony-Holt inequality for three-level isotropic states

    International Nuclear Information System (INIS)

    Ito, Tsuyoshi; Imai, Hiroshi; Avis, David

    2006-01-01

    We show that some two-party Bell inequalities with two-valued observables are stronger than the CHSH inequality for 3x3 isotropic states in the sense that they are violated by some isotropic states in the 3x3 system that do not violate the CHSH inequality. These Bell inequalities are obtained by applying triangular elimination to the list of known facet inequalities of the cut polytope on nine points. This gives a partial solution to an open problem posed by Collins and Gisin. The results of numerical optimization suggest that they are candidates for being stronger than the I 3322 Bell inequality for 3x3 isotropic states. On the other hand, we found no Bell inequalities stronger than the CHSH inequality for 2x2 isotropic states. In addition, we illustrate an inclusion relation among some Bell inequalities derived by triangular elimination

  6. Enhanced functional recombinant factor VII production by HEK 293 cells stably transfected with VKORC1 where the gamma-carboxylase inhibitor calumenin is stably suppressed by shRNA transfection.

    Science.gov (United States)

    Wajih, Nadeem; Owen, John; Wallin, Reidar

    2008-01-01

    Recombinant members of the vitamin K-dependent protein family (factors IX and VII and protein C) have become important pharmaceuticals in treatment of bleeding disorders and sepsis. However, because the in vivo gamma-carboxylation system in stable cell lines used for transfection has a limited capacity of post translational gamma-carboxylation, the recovery of fully gamma-carboxylated and functional proteins is low. In this work we have engineered recombinant factor VII producing HEK 293 cells to stably overexpress VKORC1, the reduced vitamin K gamma-carboxylase cofactor and in addition stably silenced the gamma-carboxylase inhibitory protein calumenin. Stable cell lines transfected with only a factor VII cDNA had a 9% production of functional recombinant factor VII. On the other hand, these recombinant factor VII producing cells when engineered to overexpress VKORC1 and having calumenin stably suppressed more than 80% by shRNA expression, produced 68% functional factor VII. The technology presented should be applicable to all vertebrae members of the vitamin K-dependent protein family and should lower the production cost of the clinically used factors VII, IX and protein C.

  7. Knockdown of MAGEA6 Activates AMP-Activated Protein Kinase (AMPK) Signaling to Inhibit Human Renal Cell Carcinoma Cells.

    Science.gov (United States)

    Ye, Xueting; Xie, Jing; Huang, Hang; Deng, Zhexian

    2018-01-01

    Melanoma antigen A6 (MAGEA6) is a cancer-specific ubiquitin ligase of AMP-activated protein kinase (AMPK). The current study tested MAGEA6 expression and potential function in renal cell carcinoma (RCC). MAGEA6 and AMPK expression in human RCC tissues and RCC cells were tested by Western blotting assay and qRT-PCR assay. shRNA method was applied to knockdown MAGEA6 in human RCC cells. Cell survival and proliferation were tested by MTT assay and BrdU ELISA assay, respectively. Cell apoptosis was tested by the TUNEL assay and single strand DNA ELISA assay. The 786-O xenograft in nude mouse model was established to test RCC cell growth in vivo. MAGEA6 is specifically expressed in RCC tissues as well as in the established (786-O and A498) and primary human RCC cells. MAGEA6 expression is correlated with AMPKα1 downregulation in RCC tissues and cells. It is not detected in normal renal tissues nor in the HK-2 renal epithelial cells. MAGEA6 knockdown by targeted-shRNA induced AMPK stabilization and activation, which led to mTOR complex 1 (mTORC1) in-activation and RCC cell death/apoptosis. AMPK inhibition, by AMPKα1 shRNA or the dominant negative AMPKα1 (T172A), almost reversed MAGEA6 knockdown-induced RCC cell apoptosis. Conversely, expression of the constitutive-active AMPKα1 (T172D) mimicked the actions by MAGEA6 shRNA. In vivo, MAGEA6 shRNA-bearing 786-O tumors grew significantly slower in nude mice than the control tumors. AMPKα1 stabilization and activation as well as mTORC1 in-activation were detected in MAGEA6 shRNA tumor tissues. MAGEA6 knockdown inhibits human RCC cells via activating AMPK signaling. © 2018 The Author(s). Published by S. Karger AG, Basel.

  8. Females have stronger neurogenic response than males after non-specific nasal challenge in patients with seasonal allergic rhinitis.

    Science.gov (United States)

    Tomljenovic, Dejan; Baudoin, Tomislav; Megla, Zeljka Bukovec; Geber, Goran; Scadding, Glenis; Kalogjera, Livije

    2018-07-01

    Epidemiological studies show female predominance in the prevalence of non- allergic rhinitis (NAR) and local allergic rhinitis (LAR). Experimental studies show female patients with allergic rhinitis (AR) demonstrate higher levels of sensitivity to irritants and airway hyperresponsiveness than males. Bronchial asthma shows female predominance in post-puberty patients, and gender interaction with severe asthma endotypes. Fibromyalgia, chronic fatigue syndrome, migraine and chronic cough, syndromes, which are commonly related to neurokinin substance P (SP) in the literature, also show strong female predominance. Studies have demonstrated that sex hormones, primarily oestrogens, affect mast cell activation. Mast cell proteases can amplify neurogenic inflammatory responses including the release of SP. Based on human epidemiological data and animal experimental data we hypothesized that female patients have different interaction between mast cell activation and neurogenic inflammation, i.e. substance P release, resulting in a different nasal symptom profile. To test the hypothesis we performed allergen and non-specific nasal challenges in patients with seasonal allergic rhinitis (SAR) out of season and looked for gender differences in subjective and objective responses. The interaction between subjective and objective reactivity was evaluated through the comparison of subjective symptom scores, concentrations of neurokinin substance P (SP) and cellular markers in nasal lavages after low doses of nasal allergen challenges. Female allergic subjects tended to have higher substance P (SP) concentrations both before and after non-specific challenges. The difference between post-allergen and post - hypertonic saline (HTS) challenge was highly significant in female patients (p = 0.001), while insignificant in male subjects (p = 0.14). Female patients had significantly stronger burning sensation after HTS challenge than male. These data indicate difference in the

  9. Stronger Association Between Valence- and Arousal Ratings of Affective Pictures with Older Age: Evidence for Variation Across Emotion Categories

    DEFF Research Database (Denmark)

    Mikkelsen, Mai Bjørnskov; Mehlsen, Mimi Yung; Lyby, Marlene Skovgaard

    A sample of older and younger adults rated affective pictures according to valence, arousal and emotion category (happiness, sadness and disgust). Results indicate that older age is associated with a stronger linear association between ratings of arousal and valence. Further, the strength...... of the association vary according to emotion category....

  10. Silencing of the hTERT gene by shRNA inhibits colon cancer SW480 cell growth in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Ai-Qun Liu

    Full Text Available Human telomerase reverse transcriptase (hTERT is the key enzyme responsible for synthesizing and maintaining the telomeres on the ends of chromosomes, and it is essential for cell proliferation. This has made hTERT a focus of oncology research and an attractive target for anticancer drug development. In this study, we designed a small interfering RNA (siRNA targeting the catalytic subunit of hTERT and tested its effects on the growth of telomerase-positive human colon carcinoma SW480 cells in vitro, as well as on the tumorigenicity of these cells in nude mice. Transient and stable transfection of hTERT siRNA into colon cancer SW480 cells suppressed hTERT expression, reduced telomerase activity and inhibited cell growth and proliferation. Knocking down hTERT expression in SW480 tumors xenografted into nude mice significantly slowed tumor growth and promoted tumor cell apoptosis. Our results suggest that hTERT is involved in carcinogenesis of human colon carcinoma, and they highlight the therapeutic potential of a hTERT knock-down approach.

  11. Adenovirally delivered shRNA strongly inhibits Na+-Ca2+ exchanger expression but does not prevent contraction of neonatal cardiomyocytes.

    Science.gov (United States)

    Hurtado, Cecilia; Ander, Bradley P; Maddaford, Thane G; Lukas, Anton; Hryshko, Larry V; Pierce, Grant N

    2005-04-01

    The cardiac Na(+)-Ca(2+) exchanger (NCX1) is the main mechanism for Ca(2+) efflux in the heart and is thought to serve an essential role in cardiac excitation-contraction (E-C) coupling. The demonstration that an NCX1 gene knock-out is embryonic lethal provides further support for this essential role. However, a recent report employing the Cre/loxP technique for cardiac specific knock-out of NCX1 has revealed that cardiac function is remarkably preserved in these mice, which survived to adulthood. This controversy highlights the necessity for further investigation of NCX1 function in the heart. In this study, we report on a novel approach for depletion of NCX1 in postnatal rat myocytes that utilizes RNA interference (RNAi), administered with high efficiency via adenoviral transfection. Depletion of NCX1 was confirmed by immunocytochemical detection, Western blots and radioisotopic assays of Na(+)-Ca(2+) exchange activity. Exchanger expression was inhibited by up to approximately 94%. Surprisingly, spontaneous beating of these cardiomyocytes was still maintained, although at a lower frequency. Electrical stimulation could elicit a normal beating rhythm, although NCX depleted cells exhibited a depressed Ca(2+) transient amplitude, a depressed rate of Ca(2+) rise and decline, elevated diastolic [Ca(2+)], and shorter action potentials. We also observed a compensatory increase in sarcolemmal Ca(2+) pump expression. Our data support an important, though non-essential, role for the NCX1 in E-C coupling in these neonatal heart cells. Furthermore, this approach provides a valuable means for assessing the role of NCX1 and could be utilized to examine other cardiac proteins in physiological and pathological studies.

  12. Controlling radioactive sources. Stronger 'cradle-to-grave' security needed, IAEA says

    International Nuclear Information System (INIS)

    2002-01-01

    This article highlights the IAEA activities in the field of radiation safety and security of radiation sources and other radioactive materials in its Member States. The IAEA has been active in lending its expertise to search out and secure orphaned sources in several countries. Additionally more than 70 States have joined with the IAEA to collect and share information on trafficking incidents and other unauthorized movements of radioactive sources and other radioactive materials. In March 2002 the IAEA Board of Governors approved a multi-faceted Action plan to Combat Nuclear Terrorism that includes upgrading radiation safety and security. One programme is designed to ensure that significant, uncontrolled radioactive sources are brought under regulatory control and properly secured by providing assistance to Member States in their efforts to identify, locate and secure or dispose of orphan sources

  13. Becoming stronger by becoming weaker: the hunger strike as a mode of doing politics

    DEFF Research Database (Denmark)

    Abrahamsson, Carl Sebastian; Danyi, Endre

    2018-01-01

    immigrants, we aim to achieve three things. First, we foreground physical bodies as political entities caught up in multiple modes of doing politics. Second, we show how such modes relate to one another, reinforcing citizenship, activism and party politics as specific performances of agency associated...... with liberal democracy. Finally, we argue that the Brussels hunger strike also challenges these performances by failing to meet certain expectations about what it is to be political/act politically. As the European refugee crisis is generating louder and louder voices, hunger strikes sensitise us to modes...

  14. A Stronger EU in Cosmos: Embracing the Concept of Space Security

    Directory of Open Access Journals (Sweden)

    Peter PINDJÁK

    2016-09-01

    Full Text Available The recently unveiled EU Global Strategy for Foreign and Security Policy presents bold and ambitious plans in several increasingly important domains for Europe, including outer space. The EU has committed itself to securing an autonomous access to space, providing security for its space-based assets, and promoting the adoption of a voluntary code of conduct in space. With the evolving dynamics in astropolitics, space security has become an ever more important aspect of space activities. Clearly, the EU has a vested interest in space security, whereas space-enabled services form an important part of European economy and contribute to effective implementation of its energy policy, migration, border control as well as domestic and international crisis management. Since the EU is currently in the process of drafting a European Space Strategy, it should seize the opportunity to take stock of its existing space programs and lay out a promising way forward. Besides reinforcing the existing Copernicus and Galileo programs and further developing the Governmental Satellite Communications (GOVSATCOM project, the EU should make a significant investment in space security, particularly through boosting its Space Surveillance and Tracking (SST capabilities and actively working on the international fora to promote a responsible behavior in outer space that could be eventually transformed into a voluntary international code of conduct. Through a comprehensive space policy and by reinforcing its autonomy in outer space, the EU will not only strengthen its foreign and security policy, but also reconfirm its relevant role in global affairs.

  15. Implicit and Explicit Gender Beliefs in Spatial Ability: Stronger Stereotyping in Boys than Girls.

    Science.gov (United States)

    Vander Heyden, Karin M; van Atteveldt, Nienke M; Huizinga, Mariette; Jolles, Jelle

    2016-01-01

    Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering, and mathematics (STEM) and girls' underrepresentation in these domains. In the current study we investigated the presence of stereotypic gender beliefs on spatial ability (i.e., "spatial ability is for boys") in 10- and 12-year-old children. We used both an explicit measure (i.e., a self-report questionnaire) and an implicit measure (i.e., a child IAT). Results of the explicit measure showed that both sexes associated spatial ability with boys, with boys holding more male stereotyped attitudes than girls. On the implicit measure, boys associated spatial ability with boys, while girls were gender-neutral. In addition, we examined the effects of gender beliefs on spatial performance, by experimentally activating gender beliefs within a pretest-instruction-posttest design. We compared three types of instruction: boys are better, girls are better, and no sex differences. No effects of these gender belief instructions were found on children's spatial test performance (i.e., mental rotation and paper folding). The finding that children of this age already have stereotypic beliefs about the spatial capacities of their own sex is important, as these beliefs may influence children's choices for spatial leisure activities and educational tracks in the STEM domain.

  16. Implicit and Explicit Gender Beliefs in Spatial Ability: Stronger Stereotyping in Boys than Girls

    Directory of Open Access Journals (Sweden)

    Karin Vander Heyden

    2016-07-01

    Full Text Available Sex differences in spatial ability are a seriously debated topic, given the importance of spatial ability for success in the fields of science, technology, engineering and mathematics (STEM and girls’ underrepresentation in these domains. In the current study we investigated the presence of stereotypic gender beliefs on spatial ability (i.e., ‘spatial ability is for boys’ in 10- and 12-year-old children. We used both an explicit measure (i.e., a self-report questionnaire and an implicit measure (i.e., a child IAT. Results of the explicit measure showed that both sexes associated spatial ability with boys, with boys holding more male stereotyped attitudes than girls. On the implicit measure, boys associated spatial ability with boys, while girls were gender-neutral. In addition, we examined the effects of gender beliefs on spatial performance, by experimentally activating gender beliefs within a pretest – instruction – posttest design. We compared three types of instruction: boys are better, girls are better, and no sex differences. No effects of these gender belief instructions were found on children’s spatial test performance (i.e., mental rotation and paper folding. The finding that children of this age already have stereotypic beliefs about the spatial capacities of their own sex is important, as these beliefs may influence children’s choices for spatial leisure activities and educational tracks in the STEM domain.

  17. The brain matures with stronger functional connectivity and decreased randomness of its network.

    Directory of Open Access Journals (Sweden)

    Dirk J A Smit

    Full Text Available We investigated the development of the brain's functional connectivity throughout the life span (ages 5 through 71 years by measuring EEG activity in a large population-based sample. Connectivity was established with Synchronization Likelihood. Relative randomness of the connectivity patterns was established with Watts and Strogatz' (1998 graph parameters C (local clustering and L (global path length for alpha (~10 Hz, beta (~20 Hz, and theta (~4 Hz oscillation networks. From childhood to adolescence large increases in connectivity in alpha, theta and beta frequency bands were found that continued at a slower pace into adulthood (peaking at ~50 yrs. Connectivity changes were accompanied by increases in L and C reflecting decreases in network randomness or increased order (peak levels reached at ~18 yrs. Older age (55+ was associated with weakened connectivity. Semi-automatically segmented T1 weighted MRI images of 104 young adults revealed that connectivity was significantly correlated to cerebral white matter volume (alpha oscillations: r = 33, p<01; theta: r = 22, p<05, while path length was related to both white matter (alpha: max. r = 38, p<001 and gray matter (alpha: max. r = 36, p<001; theta: max. r = 36, p<001 volumes. In conclusion, EEG connectivity and graph theoretical network analysis may be used to trace structural and functional development of the brain.

  18. Stronger Together: Use of Storytelling at a Dietetics Conference to Promote Professional Collaboration.

    Science.gov (United States)

    Fox, Ann; Gillis, Doris; Anderson, Barb; Lordly, Daphne

    2017-03-01

    During a Dietitians of Canada conference session (2015), 4 facilitators drew upon "Alice's Adventures in Wonderland" (Alice) to engage participants in discussing the future of dietetic education. The aim was to feature Nova Scotia (NS) collaborative experiences as an example of dietetic education planning that could be implemented elsewhere. Three vignettes from the Alice story were chosen as metaphoric representations of dilemmas and assumptions commonly faced by dietetic educators. Story quotations and facilitator questions related to each vignette-guided discussion. The 3-part story-based arts approach of hearing stories, recognizing stories, and telling stories enabled participants to reflect on their own practice, relate to the challenges of others, and question conventional wisdom. Participants heard the Alice stories, recognized their experiences through the NS examples and had an opportunity to tell their own stories during discussions. Participants identified barriers to and strategies for collaborative planning in their own regions. Evaluation suggests most participants were positively engaged by the storytelling approach. Participants recommended that future offerings allow more time for orientation and for completion of planned activities. Bilingual programming should also be considered. Participants valued the unconventional approach to workshop engagement and planned to implement it in their own workplaces.

  19. Stronger sexual selection in warmer waters: the case of a sex role reversed pipefish.

    Directory of Open Access Journals (Sweden)

    Nuno M Monteiro

    Full Text Available In order to answer broader questions about sexual selection, one needs to measure selection on a wide array of phenotypic traits, simultaneously through space and time. Nevertheless, studies that simultaneously address temporal and spatial variation in reproduction are scarce. Here, we aimed to investigate the reproductive dynamics of a cold-water pipefish simultaneously through time (encompassing variation within each breeding cycle and as individuals grow and space (by contrasting populations experiencing distinct water temperature regimes in order to test hypothesized differences in sexual selection. Even though the sampled populations inhabited locations with very different water temperature regimes, they exhibited considerable similarities in reproductive parameters. The most striking was the existence of a well-defined substructure in reproductive activity, where larger individuals reproduce for longer periods, which seemed dependent on a high temperature threshold for breeding rather than on the low temperatures that vary heavily according to latitude. Furthermore, the perceived disparities among populations, such as size at first reproduction, female reproductive investment, or degree of sexual size dimorphism, seemed dependent on the interplay between seawater temperature and the operational sex ratio (OSR. Contrary to our expectations of an enhanced opportunity for sexual selection in the north, we found the opposite: higher female reproductive investment coupled with increased sexual size dimorphism in warmer waters, implying that a prolonged breeding season does not necessarily translate into reduced sexual selection pressure. In fact, if the limited sex has the ability to reproduce either continuously or recurrently during the entire breeding season, an increased opportunity for sexual selection might arise from the need to compete for available partners under strongly biased OSRs across protracted breeding seasons. A more general

  20. Forging stronger partnerships between academic health centers and patient-driven organizations.

    Science.gov (United States)

    Gallin, Elaine K; Bond, Enriqueta; Califf, Robert M; Crowley, William F; Davis, Pamela; Galbraith, Richard; Reece, E Albert

    2013-09-01

    In this article, the authors review the unique role that patient-driven organizations, such as patient advocacy groups and voluntary health organizations (PAG/VHOs), play in translational and clinical research. The importance of fostering collaborations between these organizations and U.S. academic health centers (AHCs) is also discussed. Although both the PAG/VHO community and AHCs are heterogeneous, and although not all organizations are well governed or provide independent, well-researched views, there are many outstanding, well-managed, independent PAG/VHOs in the United States whose missions overlap with those of AHCs. The characteristics of effective PAG/VHOs that would serve as excellent partners for AHCs are discussed, and examples are provided regarding their many contributions, which have included advancing research on rare diseases, recruiting patients for clinical trials, and establishing patient registries and biospecimen banks. The authors present feedback obtained from informal discussions with PAG/VHO staff, as well as a survey of a small sample of organizations, that has identified bureaucratic processes, negotiating intellectual property rights, and institutional review board (IRB) delays as the most problematic areas of interactions with AHCs. Actions are suggested for building effective partnerships between the two sectors and the activities that AHCs should undertake to facilitate their interactions with PAG/VHOs including streamlining contract review and IRB processes and finding ways to better align the incentives motivating academic clinical and translational investigators with the goals of PAG/VHOs. This article is one product of the Clinical Research Forum's Partnering with Patient Advocacy Groups Initiative.

  1. Building a stronger framework of nuclear law. The IAEA's legislative assistance services

    International Nuclear Information System (INIS)

    Stoiber, C.

    2003-01-01

    The IAEA is publishing a Handbook on Nuclear Law which will provide IAEA Member States with a new resource for assessing the adequacy of their national legal frameworks governing the peaceful uses of nuclear energy; and practical guidance for governments in efforts to enhance their laws and regulations, in harmonizing them with internationally recognized standards, and in meeting their obligations under relevant international instruments. The Handbook responds to the growing demand from many national governments for assistance in the development of nuclear legislation and the need to harmonize their own legal and institutional arrangements with international standards. It also presents concise and authoritative instructional materials for teaching professionals (lawyers, scientists, engineers, health and radiation protection workers, government administrators) on the basic elements of a sound framework for managing and regulating nuclear energy. The Handbook is organized into five general parts: Part I provides a general overview of key concepts in the field: nuclear energy law and the legislative process; the regulatory authority; and the fundamental regulatory activities of licensing, inspection and enforcement. Part II deals with radiation protection. Part Ill covers various subjects arising from nuclear and radiation safety: radiation sources, nuclear installations, emergency preparedness and response, mining and milling, transportation, and waste and spent fuel. Part IV addresses the topic of nuclear liability and coverage. Part V moves to non-proliferation and security related subjects: safeguards, export and import controls, and physical protection. The Handbook also reflects and refers to the extensive range of IAEA Safety Standards covering all fields relevant to peaceful nuclear technology

  2. Income inequality is associated with stronger social comparison effects: The effect of relative income on life satisfaction.

    Science.gov (United States)

    Cheung, Felix; Lucas, Richard E

    2016-02-01

    Previous research has shown that having rich neighbors is associated with reduced levels of subjective well-being, an effect that is likely due to social comparison. The current study examined the role of income inequality as a moderator of this relative income effect. Multilevel analyses were conducted on a sample of more than 1.7 million people from 2,425 counties in the United States. Results showed that higher income inequality was associated with stronger relative income effects. In other words, people were more strongly influenced by the income of their neighbors when income inequality was high. (c) 2016 APA, all rights reserved).

  3. Income Inequality Is Associated with Stronger Social Comparison Effects: The Effect of Relative Income on Life Satisfaction

    Science.gov (United States)

    Cheung, Felix; Lucas, Richard E.

    2015-01-01

    Previous research has shown that having rich neighbors is associated with reduced levels of subjective well-being, an effect that is likely due to social comparison. The current study examined the role of income inequality as a moderator of this relative income effect. Multilevel analyses were conducted on a sample of over 1.7 million people from 2,425 counties in the United States. Results showed that higher income inequality was associated with stronger relative income effects. In other words, people were more strongly influenced by the income of their neighbors when income inequality was high. PMID:26191957

  4. Which global stock indices trigger stronger contagion risk in the Vietnamese stock market? Evidence using a bivariate analysis

    Directory of Open Access Journals (Sweden)

    Wang Kuan-Min

    2013-01-01

    Full Text Available This paper extends recent investigations into risk contagion effects on stock markets to the Vietnamese stock market. Daily data spanning October 9, 2006 to May 3, 2012 are sourced to empirically validate the contagion effects between stock markets in Vietnam, and China, Japan, Singapore, and the US. To facilitate the validation of contagion effects with market-related coefficients, this paper constructs a bivariate EGARCH model of dynamic conditional correlation coefficients. Using the correlation contagion test and Dungey et al.’s (2005 contagion test, we find contagion effects between the Vietnamese and four other stock markets, namely Japan, Singapore, China, and the US. Second, we show that the Japanese stock market causes stronger contagion risk in the Vietnamese stock market compared to the stock markets of China, Singapore, and the US. Finally, we show that the Chinese and US stock markets cause weaker contagion effects in the Vietnamese stock market because of stronger interdependence effects between the former two markets.

  5. The impact of gambling advertising: Problem gamblers report stronger impacts on involvement, knowledge, and awareness than recreational gamblers.

    Science.gov (United States)

    Hanss, Daniel; Mentzoni, Rune A; Griffiths, Mark D; Pallesen, Ståle

    2015-06-01

    Although there is a general lack of empirical evidence that advertising influences gambling participation, the regulation of gambling advertising is hotly debated among academic researchers, treatment specialists, lobby groups, regulators, and policymakers. This study contributes to the ongoing debate by investigating perceived impacts of gambling advertising in a sample of gamblers drawn from the general population in Norway (n = 6,034). Three dimensions of advertising impacts were identified, representing perceived impacts on (a) gambling-related attitudes, interest, and behavior ("involvement"); (b) knowledge about gambling options and providers ("knowledge"); and (c) the degree to which people are aware of gambling advertising ("awareness"). Overall, impacts were strongest for the knowledge dimension, and, for all 3 dimensions, the impact increased with level of advertising exposure. Those identified as problem gamblers in the sample (n = 57) reported advertising impacts concerning involvement more than recreational gamblers, and this finding was not attributable to differences in advertising exposure. Additionally, younger gamblers reported stronger impacts on involvement and knowledge but were less likely to agree that they were aware of gambling advertising than older gamblers. Male gamblers were more likely than female gamblers to report stronger impacts on both involvement and knowledge. These findings are discussed with regard to existing research on gambling advertising as well as their implications for future research and policy-making. (PsycINFO Database Record (c) 2015 APA, all rights reserved).

  6. Removal of proprioception by BCI raises a stronger body ownership illusion in control of a humanlike robot.

    Science.gov (United States)

    Alimardani, Maryam; Nishio, Shuichi; Ishiguro, Hiroshi

    2016-09-22

    Body ownership illusions provide evidence that our sense of self is not coherent and can be extended to non-body objects. Studying about these illusions gives us practical tools to understand the brain mechanisms that underlie body recognition and the experience of self. We previously introduced an illusion of body ownership transfer (BOT) for operators of a very humanlike robot. This sensation of owning the robot's body was confirmed when operators controlled the robot either by performing the desired motion with their body (motion-control) or by employing a brain-computer interface (BCI) that translated motor imagery commands to robot movement (BCI-control). The interesting observation during BCI-control was that the illusion could be induced even with a noticeable delay in the BCI system. Temporal discrepancy has always shown critical weakening effects on body ownership illusions. However the delay-robustness of BOT during BCI-control raised a question about the interaction between the proprioceptive inputs and delayed visual feedback in agency-driven illusions. In this work, we compared the intensity of BOT illusion for operators in two conditions; motion-control and BCI-control. Our results revealed a significantly stronger BOT illusion for the case of BCI-control. This finding highlights BCI's potential in inducing stronger agency-driven illusions by building a direct communication between the brain and controlled body, and therefore removing awareness from the subject's own body.

  7. Knockdown of Pokemon protein expression inhibits hepatocellular carcinoma cell proliferation by suppression of AKT activity.

    Science.gov (United States)

    Zhu, Xiaosan; Dai, Yichen; Chen, Zhangxin; Xie, Junpei; Zeng, Wei; Lin, Yuanyuan

    2013-01-01

    Overexpression of Pokemon, which is an erythroid myeloid ontogenic factor protein, occurs in different cancers, including hepatocellular carcinoma (HCC). Pokemon is also reported to have an oncogenic activity in various human cancers. This study investigated the effect of Pokemon knockdown on the regulation of HCC growth. POK shRNA suppressed the expression of Pokemon protein in HepG2 cells compared to the negative control vector-transfected HCC cells. Pokemon knockdown also reduced HCC cell viability and enhanced cisplatin-induced apoptosis in HCC cells. AKT activation and the expression of various cell cycle-related genes were inhibited following Pokemon knockdown. These data demonstrate that Pokemon may play a role in HCC progression, suggesting that inhibition of Pokemon expression using Pokemon shRNA should be further evaluated as a novel target for the control of HCC.

  8. Collective Nostalgia Is Associated With Stronger Outgroup-Directed Anger and Participation in Ingroup-Favoring Collective Action

    Directory of Open Access Journals (Sweden)

    Wing-Yee Cheung

    2017-08-01

    Full Text Available Collective nostalgia refers to longing for the way society used to be. We tested whether collective nostalgia is associated with ingroup-favoring collective action and whether this association is mediated by outgroup-directed anger and outgroup-directed contempt. We conducted an online study of Hong Kong residents (N = 111 during a large-scale democratic social movement, the Umbrella Movement, that took place in Hong Kong in 2014 in response to proposed electoral reforms by the Chinese government in Mainland China. Reported collective nostalgia for Hong Kong’s past was high in our sample and collective nostalgia predicted stronger involvement in ingroup-favoring collective action, and it did so indirectly via higher intensity of outgroup-directed anger (but not through outgroup-directed contempt. We argue that collective nostalgia has implications for strengthening ingroup-serving collective action, and we highlight the importance of arousal of group-based emotions in this process.

  9. Bilingual recognition memory: stronger performance but weaker levels-of-processing effects in the less fluent language.

    Science.gov (United States)

    Francis, Wendy S; Gutiérrez, Marisela

    2012-04-01

    The effects of bilingual proficiency on recognition memory were examined in an experiment with Spanish-English bilinguals. Participants learned lists of words in English and Spanish under shallow- and deep-encoding conditions. Overall, hit rates were higher, discrimination greater, and response times shorter in the nondominant language, consistent with effects previously observed for lower frequency words. Levels-of-processing effects in hit rates, discrimination, and response time were stronger in the dominant language. Specifically, with shallow encoding, the advantage for the nondominant language was larger than with deep encoding. The results support the idea that memory performance in the nondominant language is impacted by both the greater demand for cognitive resources and the lower familiarity of the words.

  10. Strategic Factors Influencing National and Regional Systems of Innovation: A Case of Weaker NSI with Stronger RSI

    Directory of Open Access Journals (Sweden)

    Pir Roshanuddin Shah Rashdi

    2015-04-01

    Full Text Available The issues of relationship between NSI ((National System of Innovation and RSI (Regional System of Innovation are not well reported with innovation policy research. That is, whether the NSI is the system on top of RSI, or the importance of regions make stronger NSIs. Therefore, it raises concern regarding development of strategic relationship between these two. For this, two cases ? Catalonia (Spain and N Ireland (the UK, have been selected based on theoretical sampling. Key economic indicators have been identified and have been quantitatively analyzed. The evidence suggests that strong NSI has positive influence on RSI. In addition to that, the concentration of knowledge and promotion of institutions may be strategically established and then needed resources may be injected to produce high quality human resources. There is, however, need for more comprehensive studies to be conducted in order to validate the results of this research

  11. The sigh of the oppressed: The palliative effects of ideology are stronger for people living in highly unequal neighbourhoods.

    Science.gov (United States)

    Sengupta, Nikhil K; Greaves, Lara M; Osborne, Danny; Sibley, Chris G

    2017-09-01

    Ideologies that legitimize status hierarchies are associated with increased well-being. However, which ideologies have 'palliative effects', why they have these effects, and whether these effects extend to low-status groups remain unresolved issues. This study aimed to address these issues by testing the effects of the ideology of Symbolic Prejudice on well-being among low- and high-status ethnic groups (4,519 Europeans and 1,091 Māori) nested within 1,437 regions in New Zealand. Results showed that Symbolic Prejudice predicted increased well-being for both groups, but that this relationship was stronger for those living in highly unequal neighbourhoods. This suggests that it is precisely those who have the strongest need to justify inequality that accrue the most psychological benefit from subscribing to legitimizing ideologies. © 2017 The British Psychological Society.

  12. Elite level rhythmic gymnasts have significantly more and stronger pain than peers of similar age: a prospective study.

    Science.gov (United States)

    Sabeti, Manuel; Jeremian, Lusine; Graf, Alexandra; Kandelhart, Robert

    2015-01-01

    Rhythmic gymnastics (RG) unites aesthetic, ballet-like motion, and all aspects of gymnastics. To reach elite level, girls begin at early age the intensive training. To date it is unclear if such demanding training influences the incidence and intensity of painful overuse injuries. The purpose of this study is to analyze anatomical painful regions and pain intensity in elite level rhythmic gymnasts (elRG) and compare results with an age-matched control group (CG). This prospective field study was carried out at the European Championship in RG 2013 (218 participating athletes, Vienna, Austria). Volunteering athletes were interviewed according to a preformed questionnaire. As CG secondary school pupils without any competitive sports experience were analyzed accordingly. Overall, 243 young females (144 elRG/66 % of all participants and 99 CG) were observed. ElRGs were significantly (s.) smaller, lighter, and had s. stronger pain (p < 0.001). A total of 72 % of athletes reported to have at least one painful body region compared with 52 % of CG (p < 0.001). ElRG had nearly three times more serious injuries than the CG. In all 23 % off all elRG reported to have had no access to professional medical care. ElRGs were s. more frequently (25 vs 9 %) affected at the lumbar spine and the ankle joint (17.4 vs 7 %). To our knowledge, this trial analyzes the largest cohort of elRG to date. Hence, it is clearly alluded that intensive training in RG is a significant factor causing more and stronger pain than in a CG.

  13. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

    Science.gov (United States)

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-06-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

  14. Fluorescence measurements show stronger cold inhibition of photosynthetic light reactions in Scots pine compared to Norway spruce as well as during spring compared to autumn.

    Science.gov (United States)

    Linkosalo, Tapio; Heikkinen, Juha; Pulkkinen, Pertti; Mäkipää, Raisa

    2014-01-01

    We studied the photosynthetic activity of Scots pine (Pinus sylvestris L.) and Norway spruce (Picea abies [L.] Karst) in relation to air temperature changes from March 2013 to February 2014. We measured the chlorophyll fluorescence of approximately 50 trees of each species growing in southern Finland. Fluorescence was measured 1-3 times per week. We began by measuring shoots present in late winter (i.e., March 2013) before including new shoots once they started to elongate in spring. By July, when the spring shoots had achieved similar fluorescence levels to the older ones, we proceeded to measure the new shoots only. We analyzed the data by fitting a sigmoidal model containing four parameters to link sliding averages of temperature and fluorescence. A parameter defining the temperature range over which predicted fluorescence increased most rapidly was the most informative with in describing temperature dependence of fluorescence. The model generated similar fluorescence patterns for both species, but differences were observed for critical temperature and needle age. Down regulation of the light reaction was stronger in spring than in autumn. Pine showed more conservative control of the photosynthetic light reactions, which were activated later in spring and more readily attenuated in autumn. Under the assumption of a close correlation of fluorescence and photosynthesis, spruce should therefore benefit more than pine from the increased photosynthetic potential during warmer springs, but be more likely to suffer frost damage with a sudden cooling following a warm period. The winter of 2013-2014 was unusually mild and similar to future conditions predicted by global climate models. During the mild winter, the activity of photosynthetic light reactions of both conifers, especially spruce, remained high. Because light levels during winter are too low for photosynthesis, this activity may translate to a net carbon loss due to respiration.

  15. Fluorescence measurements show stronger cold inhibition of photosynthetic light reactions in Scots pine compared to Norway spruce as well as during spring compared to autumn

    Directory of Open Access Journals (Sweden)

    Tapio eLinkosalo

    2014-06-01

    Full Text Available We studied the photosynthetic activity of Scots pine (Pinus sylvestris L. and Norway spruce (Picea abies [L.] Karst in relation to air temperature changes from March 2013 to February 2014. We measured the chlorophyll fluorescence of approximately 50 trees of each species growing in southern Finland. Fluorescence was measured 13 times per week. We began by measuring shoots present in late winter (i.e., March 2013 before including new shoots once they started to elongate in spring. By July, when the spring shoots had achieved similar fluorescence levels to the older ones, we proceeded to measure the new shoots only.We analysed the data by fitting a sigmoidal model containing four parameters to link sliding averages of temperature and fluorescence. A parameter defining the temperature range over which predicted fluorescence increased most rapidly was the most informative with in describing temperature dependence of fluorescence.The model generated similar fluorescence patterns for both species, but differences were observed for critical temperature and needle age. Down regulation of the light reaction was stronger in spring than in autumn. Pine showed more conservative control of the photosynthetic light reactions, which were activated later in spring and more readily attenuated in autumn. Under the assumption of a close correlation of fluorescence and photosynthesis, spruce should therefore benefit more than pine from the increased photosynthetic potential during warmer springs, but be more likely to suffer frost damage with a sudden cooling following a warm period. The winter of 20132014 was unusually mild and similar to future conditions predicted by global warming models. During the mild winter, the activity of photosynthetic light reactions of both conifers, especially spruce, remained high. Because light levels during winter are too low for photosynthesis, this activity may translate to a net carbon loss due to respiration.

  16. Increased fire frequency promotes stronger spatial genetic structure and natural selection at regional and local scales in Pinus halepensis Mill.

    Science.gov (United States)

    Budde, Katharina B; González-Martínez, Santiago C; Navascués, Miguel; Burgarella, Concetta; Mosca, Elena; Lorenzo, Zaida; Zabal-Aguirre, Mario; Vendramin, Giovanni G; Verdú, Miguel; Pausas, Juli G; Heuertz, Myriam

    2017-04-01

    The recurrence of wildfires is predicted to increase due to global climate change, resulting in severe impacts on biodiversity and ecosystem functioning. Recurrent fires can drive plant adaptation and reduce genetic diversity; however, the underlying population genetic processes have not been studied in detail. In this study, the neutral and adaptive evolutionary effects of contrasting fire regimes were examined in the keystone tree species Pinus halepensis Mill. (Aleppo pine), a fire-adapted conifer. The genetic diversity, demographic history and spatial genetic structure were assessed at local (within-population) and regional scales for populations exposed to different crown fire frequencies. Eight natural P. halepensis stands were sampled in the east of the Iberian Peninsula, five of them in a region exposed to frequent crown fires (HiFi) and three of them in an adjacent region with a low frequency of crown fires (LoFi). Samples were genotyped at nine neutral simple sequence repeats (SSRs) and at 251 single nucleotide polymorphisms (SNPs) from coding regions, some of them potentially important for fire adaptation. Fire regime had no effects on genetic diversity or demographic history. Three high-differentiation outlier SNPs were identified between HiFi and LoFi stands, suggesting fire-related selection at the regional scale. At the local scale, fine-scale spatial genetic structure (SGS) was overall weak as expected for a wind-pollinated and wind-dispersed tree species. HiFi stands displayed a stronger SGS than LoFi stands at SNPs, which probably reflected the simultaneous post-fire recruitment of co-dispersed related seeds. SNPs with exceptionally strong SGS, a proxy for microenvironmental selection, were only reliably identified under the HiFi regime. An increasing fire frequency as predicted due to global change can promote increased SGS with stronger family structures and alter natural selection in P. halepensis and in plants with similar life history traits

  17. Nitrogen fertilization has a stronger effect on soil nitrogen-fixing bacterial communities than elevated atmospheric CO2.

    Science.gov (United States)

    Berthrong, Sean T; Yeager, Chris M; Gallegos-Graves, Laverne; Steven, Blaire; Eichorst, Stephanie A; Jackson, Robert B; Kuske, Cheryl R

    2014-05-01

    Biological nitrogen fixation is the primary supply of N to most ecosystems, yet there is considerable uncertainty about how N-fixing bacteria will respond to global change factors such as increasing atmospheric CO2 and N deposition. Using the nifH gene as a molecular marker, we studied how the community structure of N-fixing soil bacteria from temperate pine, aspen, and sweet gum stands and a brackish tidal marsh responded to multiyear elevated CO2 conditions. We also examined how N availability, specifically, N fertilization, interacted with elevated CO2 to affect these communities in the temperate pine forest. Based on data from Sanger sequencing and quantitative PCR, the soil nifH composition in the three forest systems was dominated by species in the Geobacteraceae and, to a lesser extent, Alphaproteobacteria. The N-fixing-bacterial-community structure was subtly altered after 10 or more years of elevated atmospheric CO2, and the observed shifts differed in each biome. In the pine forest, N fertilization had a stronger effect on nifH community structure than elevated CO2 and suppressed the diversity and abundance of N-fixing bacteria under elevated atmospheric CO2 conditions. These results indicate that N-fixing bacteria have complex, interacting responses that will be important for understanding ecosystem productivity in a changing climate.

  18. How the biotin–streptavidin interaction was made even stronger: investigation via crystallography and a chimaeric tetramer

    Science.gov (United States)

    Chivers, Claire E.; Koner, Apurba L.; Lowe, Edward D.; Howarth, Mark

    2011-01-01

    The interaction between SA (streptavidin) and biotin is one of the strongest non-covalent interactions in Nature. SA is a widely used tool and a paradigm for protein–ligand interactions. We previously developed a SA mutant, termed Tr (traptavidin), possessing a 10-fold lower off-rate for biotin, with increased mechanical and thermal stability. In the present study, we determined the crystal structures of apo-Tr and biotin–Tr at 1.5 Å resolution. In apo-SA the loop (L3/4), near biotin's valeryl tail, is typically disordered and open, but closes upon biotin binding. In contrast, L3/4 was shut in both apo-Tr and biotin–Tr. The reduced flexibility of L3/4 and decreased conformational change on biotin binding provide an explanation for Tr's reduced biotin off- and on-rates. L3/4 includes Ser45, which forms a hydrogen bond to biotin consistently in Tr, but erratically in SA. Reduced breakage of the biotin–Ser45 hydrogen bond in Tr is likely to inhibit the initiating event in biotin's dissociation pathway. We generated a Tr with a single biotin-binding site rather than four, which showed a simi-larly low off-rate, demonstrating that Tr's low off-rate was governed by intrasubunit effects. Understanding the structural features of this tenacious interaction may assist the design of even stronger affinity tags and inhibitors. PMID:21241253

  19. Aryl hydrocarbon receptor signaling modulates antiviral immune responses: ligand metabolism rather than chemical source is the stronger predictor of outcome.

    Science.gov (United States)

    Boule, Lisbeth A; Burke, Catherine G; Jin, Guang-Bi; Lawrence, B Paige

    2018-01-29

    The aryl hydrocarbon receptor (AHR) offers a compelling target to modulate the immune system. AHR agonists alter adaptive immune responses, but the consequences differ across studies. We report here the comparison of four agents representing different sources of AHR ligands in mice infected with influenza A virus (IAV): TCDD, prototype exogenous AHR agonist; PCB126, pollutant with documented human exposure; ITE, novel pharmaceutical; and FICZ, degradation product of tryptophan. All four compounds diminished virus-specific IgM levels and increased the proportion of regulatory T cells. TCDD, PCB126 and ITE, but not FICZ, reduced virus-specific IgG levels and CD8 + T cell responses. Similarly, ITE, PCB126, and TCDD reduced Th1 and Tfh cells, whereas FICZ increased their frequency. In Cyp1a1-deficient mice, all compounds, including FICZ, reduced the response to IAV. Conditional Ahr knockout mice revealed that all four compounds require AHR within hematopoietic cells. Thus, differences in the immune response to IAV likely reflect variances in quality, magnitude, and duration of AHR signaling. This indicates that binding affinity and metabolism may be stronger predictors of immune effects than a compound's source of origin, and that harnessing AHR will require finding a balance between dampening immune-mediated pathologies and maintaining sufficient host defenses against infection.

  20. Which cue to ‘want’? Opioid stimulation of central amygdala makes goal-trackers show stronger goal-tracking, just as sign-trackers show stronger sign-tracking

    Science.gov (United States)

    DiFeliceantonio, Alexandra G.; Berridge, Kent C.

    2012-01-01

    Pavlovian cues that have been paired with reward can gain incentive salience. Drug addicts find drug cues motivationally attractive and binge eaters are attracted by food cues. But the level of incentive salience elicited by a cue re-encounter still varies across time and brain states. In an animal model, cues become attractive and ‘wanted’ in an ‘autoshaping’ paradigm, where different targets of incentive salience emerge for different individuals. Some individuals (sign-trackers) find a predictive discrete cue attractive while others find a reward contiguous and goal cue more attractive (location where reward arrives: goal-trackers). Here we assessed whether central amygdala mu opioid receptor stimulation enhances the phasic incentive salience of the goal-cue for goal-trackers during moments of predictive cue presence (expressed in both approach and consummatory behaviors to goal cue), just as it enhances the attractiveness of the predictive cue target for sign-trackers. Using detailed video analysis we measured the approaches, nibbles, sniffs, and bites directed at their preferred target for both sign-trackers and goal-trackers. We report that DAMGO microinjections in central amygdala made goal-trackers, like sign-trackers, show phasic increases in appetitive nibbles and sniffs directed at the goal-cue expressed selectively whenever the predictive cue was present. This indicates enhancement of incentive salience attributed by both goal trackers and sign-trackers, but attributed in different directions: each to their own target cue. For both phenotypes, amygdala opioid stimulation makes the individual’s prepotent cue into a stronger motivational magnet at phasic moments triggered by a CS that predicts the reward UCS. PMID:22391118

  1. Stronger influence of maternal than paternal obesity on infant and early childhood body mass index: the Fels Longitudinal Study.

    Science.gov (United States)

    Linabery, A M; Nahhas, R W; Johnson, W; Choh, A C; Towne, B; Odegaard, A O; Czerwinski, S A; Demerath, E W

    2013-06-01

    Excessive early childhood adiposity is a prevalent and increasing concern in many parts of the world. Parental obesity is one of the several factors previously associated with infant and early childhood weight, length and adiposity. Parental obesity represents a surrogate marker of the complex interplay among genetic, epigenetic and shared environmental factors, and is potentially modifiable. The relative contributions of maternal and paternal body mass index (BMI) to infant and early childhood growth, as well as the timing of such effects, have not been firmly established. Utilizing serial infant measurements and growth curve modelling, this is the largest study to fully characterize and formally compare associations between maternal and paternal BMI and offspring growth across the entire infancy and early childhood period. Maternal obesity is a stronger determinant of offspring BMI than paternal obesity at birth and from 2 to 3 years of age, suggesting that prevention efforts focused particularly on maternal lifestyle and BMI may be important in reducing excess infant BMI. The observation that maternal BMI effects are not constant, but rather present at birth, wane and re-emerge during late infancy, suggests that there is a window of opportunity in early infancy when targeted interventions on children of obese mothers may be most effective. Parental obesity influences infant body size. To fully characterize their relative effects on infant adiposity, associations between maternal and paternal body mass index (BMI) category (normal: ≤25 kg m(-2) , overweight: 25 - obese: ≥30 kg m(-2) ) and infant BMI were compared in Fels Longitudinal Study participants. A median of 9 serial weight and length measures from birth to 3.5 years were obtained from 912 European American children born in 1928-2008. Using multivariable mixed effects regression, contributions of maternal vs. paternal BMI status to infant BMI growth curves were evaluated. Cubic spline models

  2. Density regulation in Northeast Atlantic fish populations: Density dependence is stronger in recruitment than in somatic growth.

    Science.gov (United States)

    Zimmermann, Fabian; Ricard, Daniel; Heino, Mikko

    2018-05-01

    Population regulation is a central concept in ecology, yet in many cases its presence and the underlying mechanisms are difficult to demonstrate. The current paradigm maintains that marine fish populations are predominantly regulated by density-dependent recruitment. While it is known that density-dependent somatic growth can be present too, its general importance remains unknown and most practical applications neglect it. This study aimed to close this gap by for the first time quantifying and comparing density dependence in growth and recruitment over a large set of fish populations. We fitted density-dependent models to time-series data on population size, recruitment and age-specific weight from commercially exploited fish populations in the Northeast Atlantic Ocean and the Baltic Sea. Data were standardized to enable a direct comparison within and among populations, and estimated parameters were used to quantify the impact of density regulation on population biomass. Statistically significant density dependence in recruitment was detected in a large proportion of populations (70%), whereas for density dependence in somatic growth the prevalence of density dependence depended heavily on the method (26% and 69%). Despite age-dependent variability, the density dependence in recruitment was consistently stronger among age groups and between alternative approaches that use weight-at-age or weight increments to assess growth. Estimates of density-dependent reduction in biomass underlined these results: 97% of populations with statistically significant parameters for growth and recruitment showed a larger impact of density-dependent recruitment on population biomass. The results reaffirm the importance of density-dependent recruitment in marine fishes, yet they also show that density dependence in somatic growth is not uncommon. Furthermore, the results are important from an applied perspective because density dependence in somatic growth affects productivity and

  3. Stronger pack warnings predict quitting more than weaker ones: finding from the ITC Malaysia and Thailand surveys.

    Science.gov (United States)

    Fathelrahman, Ahmed I; Li, Lin; Borland, Ron; Yong, Hua-Hie; Omar, Maizurah; Awang, Rahmat; Sirirassamee, Buppha; Fong, Geoffrey T; Hammond, David

    2013-09-18

    mechanisms for influencing quitting regardless of warning strength. The larger and more informative Thai warnings were associated with higher levels of reactions predictive of quitting and stronger associations with subsequent quitting, demonstrating their greater potency.

  4. F247. INTERNALIZED STIGMA HAS A STRONGER RELATIONSHIP WITH INTRINSIC MOTIVATION COMPARED TO AMOTIVATION IN EARLY PHASE AND PROLONGED SCHIZOPHRENIA

    Science.gov (United States)

    Firmin, Ruth; Luther, Lauren; Lysaker, Paul; Vohs, Jennifer

    2018-01-01

    analyses indicated that, controlling for amotivation, internalized stigma predicted intrinsic motivation in both the prolonged sample (R2=0.09, F(1,64) =6.18, p=0.02) and the early phase schizophrenia sample (R2=0.23, F(1,37)=10.98, p=.00). Discussion Results suggest internalized stigma has a stronger relationship with intrinsic motivation separate from, and above and beyond, its association with amotivation. Findings support models of intrinsic and amotivation being distinct domains. Links between internalized stigma and motivation appear to emerge and persist from the early stages of schizophrenia, suggesting that targeting stigma in early intervention services may help to improve intrinsic motivation in people with schizophrenia.

  5. In roots of Arabidopsis thaliana, the damage-associated molecular pattern AtPep1 is a stronger elicitor of immune signalling than flg22 or the chitin heptamer.

    Directory of Open Access Journals (Sweden)

    Lorenzo Poncini

    Full Text Available Plants interpret their immediate environment through perception of small molecules. Microbe-associated molecular patterns (MAMPs such as flagellin and chitin are likely to be more abundant in the rhizosphere than plant-derived damage-associated molecular patterns (DAMPs. We investigated how the Arabidopsis thaliana root interprets MAMPs and DAMPs as danger signals. We monitored root development during exposure to increasing concentrations of the MAMPs flg22 and the chitin heptamer as well as of the DAMP AtPep1. The tissue-specific expression of defence-related genes in roots was analysed using a toolkit of promoter::YFPN lines reporting jasmonic acid (JA-, salicylic acid (SA-, ethylene (ET- and reactive oxygen species (ROS- dependent signalling. Finally, marker responses were analysed during invasion by the root pathogen Fusarium oxysporum. The DAMP AtPep1 triggered a stronger activation of the defence markers compared to flg22 and the chitin heptamer. In contrast to the tested MAMPs, AtPep1 induced SA- and JA-signalling markers in the root and caused a severe inhibition of root growth. Fungal attack resulted in a strong activation of defence genes in tissues close to the invading fungal hyphae. The results collectively suggest that AtPep1 presents a stronger danger signal to the Arabidopsis root than the MAMPs flg22 and chitin heptamer.

  6. Responding to the Challenge of Providing Stronger Research Base for Teacher Education: Research Discourses in the Norwegian National Research School for Teacher Education

    Science.gov (United States)

    Østern, Anna-Lena

    2016-01-01

    Background and purpose: The purpose of this article is to shed light on how the research projects of 140 PhD candidates in the National Research School for Teacher Education in Norway (NAFOL) respond to the challenges faced by Norwegian teacher education regarding the demand for higher competence and a stronger research base. The concept of NAFOL…

  7. Stronger diversity effects with increased environmental stress : A study of multitrophic interactions between oak, powdery mildew and ladybirds

    NARCIS (Netherlands)

    Dillen, Mathias; Smit, Christian; Buyse, Martijn; Höfte, Monica; De Clercq, Patrick; Verheyen, Kris

    2017-01-01

    Recent research has suggested that increasing neighbourhood tree species diversity may mitigate the impact of pests or pathogens by supporting the activities of their natural enemies and/or reducing the density of available hosts. In this study, we attempted to assess these mechanisms in a

  8. Stronger efferent suppression of cochlear neural potentials by contralateral acoustic stimulation in awake than in anesthetized chinchilla

    Directory of Open Access Journals (Sweden)

    Cristian eAedo

    2015-03-01

    Full Text Available There are two types of sensory cells in the mammalian cochlea, inner hair cells, which make synaptic contact with auditory-nerve afferent fibers, and outer hair cells that are innervated by crossed and uncrossed medial olivocochlear (MOC efferent fibers. Contralateral acoustic stimulation activates the uncrossed efferent MOC fibers reducing cochlear neural responses, thus modifying the input to the central auditory system. The chinchilla, among all studied mammals, displays the lowest percentage of uncrossed MOC fibers raising questions about the strength and frequency distribution of the contralateral-sound effect in this species. On the other hand, MOC effects on cochlear sensitivity have been mainly studied in anesthetized animals and since the MOC-neuron activity depends on the level of anesthesia, it is important to assess the influence of anesthesia in the strength of efferent effects. Seven adult chinchillas (Chinchilla laniger were chronically implanted with round-window electrodes in both cochleae. We compared the effect of contralateral sound in awake and anesthetized condition. Compound action potentials (CAP and cochlear microphonics (CM were measured in the ipsilateral cochlea in response to tones in absence and presence of contralateral sound. Control measurements performed after middle-ear muscles section in one animal discarded any possible middle-ear reflex activation. Contralateral sound produced CAP amplitude reductions in all chinchillas, with suppression effects greater by about 1-3 dB in awake than in anesthetized animals. In contrast, CM amplitude increases of up to 1.9 dB were found in only three awake chinchillas. In both conditions the strongest efferent effects were produced by contralateral tones at frequencies equal or close to those of ipsilateral tones. Contralateral CAP suppressions for 1-6 kHz ipsilateral tones corresponded to a span of uncrossed MOC fiber innervation reaching at least the central third of the

  9. Stronger efferent suppression of cochlear neural potentials by contralateral acoustic stimulation in awake than in anesthetized chinchilla.

    Science.gov (United States)

    Aedo, Cristian; Tapia, Eduardo; Pavez, Elizabeth; Elgueda, Diego; Delano, Paul H; Robles, Luis

    2015-01-01

    There are two types of sensory cells in the mammalian cochlea, inner hair cells, which make synaptic contact with auditory-nerve afferent fibers, and outer hair cells that are innervated by crossed and uncrossed medial olivocochlear (MOC) efferent fibers. Contralateral acoustic stimulation activates the uncrossed efferent MOC fibers reducing cochlear neural responses, thus modifying the input to the central auditory system. The chinchilla, among all studied mammals, displays the lowest percentage of uncrossed MOC fibers raising questions about the strength and frequency distribution of the contralateral-sound effect in this species. On the other hand, MOC effects on cochlear sensitivity have been mainly studied in anesthetized animals and since the MOC-neuron activity depends on the level of anesthesia, it is important to assess the influence of anesthesia in the strength of efferent effects. Seven adult chinchillas (Chinchilla laniger) were chronically implanted with round-window electrodes in both cochleae. We compared the effect of contralateral sound in awake and anesthetized condition. Compound action potentials (CAP) and cochlear microphonics (CM) were measured in the ipsilateral cochlea in response to tones in absence and presence of contralateral sound. Control measurements performed after middle-ear muscles section in one animal discarded any possible middle-ear reflex activation. Contralateral sound produced CAP amplitude reductions in all chinchillas, with suppression effects greater by about 1-3 dB in awake than in anesthetized animals. In contrast, CM amplitude increases of up to 1.9 dB were found in only three awake chinchillas. In both conditions the strongest efferent effects were produced by contralateral tones at frequencies equal or close to those of ipsilateral tones. Contralateral CAP suppressions for 1-6 kHz ipsilateral tones corresponded to a span of uncrossed MOC fiber innervation reaching at least the central third of the chinchilla cochlea.

  10. Using social capital to construct a conceptual International Classification of Functioning, Disability, and Health Children and Youth version-based framework for stronger inclusive education policies in Europe.

    Science.gov (United States)

    Maxwell, Gregor; Koutsogeorgou, Eleni

    2012-02-01

    Inclusive education is part of social inclusion; therefore, social capital can be linked to an inclusive education policy and practice. This association is explored in this article, and a practical measure is proposed. Specifically, the World Health Organization's International Classification of Functioning, Disability and Health Children and Youth Version (ICF-CY) is proposed as the link between social capital and inclusive education. By mapping participation and trust indicators of social capital to the ICF-CY and by using the Matrix to Analyse Functioning in Education Systems (MAFES) to analyze the functioning of inclusive education policies and systems, a measure for stronger inclusive education policies is proposed. Such a tool can be used for policy planning and monitoring to ensure better inclusive education environments. In conclusion, combining enhanced social capital linked to stronger inclusive education policies, by using the ICF-CY, can lead to better health and well-being for all.

  11. Degradation of p53 by human Alphapapillomavirus E6 proteins shows a stronger correlation with phylogeny than oncogenicity.

    Directory of Open Access Journals (Sweden)

    Leiping Fu

    2010-09-01

    Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.

  12. More concerns and stronger beliefs about the necessity of medication in patients with acromegaly are associated with negative illness perceptions and impairment in quality of life.

    Science.gov (United States)

    Andela, Cornelie D; Biermasz, Nienke R; Kaptein, Adrian A; Pereira, Alberto M; Tiemensma, Jitske

    2015-10-01

    Patients with acromegaly can be treated with surgery, radiotherapy and/or medical treatment. In general, patients' beliefs about medication are associated with illness perceptions, a contributory factor of Quality of Life (QoL). At present, there are no quantitative studies on medication beliefs in patients with acromegaly. Here, we aimed to examine possible associations between medication beliefs, illness perceptions, and QoL. Furthermore we aimed to explore whether illness perceptions of patients with remission of acromegaly receiving medical treatment differ from patients without medical treatment. Cross-sectional evaluation of 73 patients with remission of acromegaly (n = 28 patients with medication, n = 45 without medication). The Beliefs about Medicines Questionnaire (BMQ), Illness Perception Questionnaire-Revised (IPQ-R), EuroQoL-5D, and AcroQoL were used for the assessment. Stronger beliefs about the necessity of medical treatment and stronger concerns about the adverse effects were associated with attributing more symptoms to acromegaly, perceiving more negative consequences, and having a stronger belief in a cyclical timeline (BMQ, all P Negative medication beliefs were related to more negative illness perceptions and worse disease-specific QoL. Patients receiving medical treatment for acromegaly tend to perceive a more chronic timeline of their disease, compared to patients with remission without medical treatment. These psychological factors need to be taken into account when treating patients and developing a psychosocial education program aiming to improve QoL. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Silencing Nrf2 impairs glioma cell proliferation via AMPK-activated mTOR inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Jia, Yue [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Handong, E-mail: njhdwang@hotmail.com [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wang, Qiang [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Ding, Hui [Department of Neurosurgery, Jinling Hospital, School of Medicine, Southern Medical University (Guangzhou), 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China); Wu, Heming [Department of Neurosurgery, Nanjing Jingdu Hospital, No. 34, Biao 34, Yanggongjing Road, Nanjing 210002, Jiangsu Province (China); Pan, Hao [Department of Neurosurgery, Jinling Hospital, School of Medicine, Nanjing University, 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province (China)

    2016-01-15

    Gliomas are the leading cause of death among adults with primary brain malignancies. Treatment for malignant gliomas remains limited, and targeted therapies have been incompletely explored. Nuclear factor erythroid 2-related factor 2 (Nrf2), a key transcription regulator for antioxidant and detoxification enzymes, is abundantly expressed in cancer cells. In this study, the role and mechanism of Nrf2 in cancer cell proliferation was investigated in multiple glioma cell lines. We first evaluated the expression patterns of Nrf2 in four glioma cell lines and found all four cell lines expressed Nrf2, but the highest level was observed in U251 cells. We further evaluated the biological functions of Nrf2 in U251 glioma cell proliferation by specific inhibition of Nrf2 using short hairpin RNA (shRNA). We found that Nrf2 depletion inhibited glioma cell proliferation. Nrf2 depletion also decreased colony formation in U251 cells stably expressing Nrf2 shRNA compared to scrambled control shRNA. Moreover, suppression of Nrf2 expression could lead to ATP depletion (with concomitant rise in AMP/ATP ratio) and consequently to AMPK-activated mTOR inhibition. Finally, activation of adenosine monophosphate–activated protein kinase (AMPK) by treated with phenformin, an AMPK agonist, can mimic the inhibitory effect of Nrf2 knockdown in U251 cells. In conclusion, our findings will shed light to the role and mechanism of Nrf2 in regulating glioma proliferation via ATP-depletion-induced AMPK activation and consequent mTOR inhibition, a novel insight into our understanding the role and mechanism of Nrf2 in glioma pathoetiology. To our knowledge, this is also the first report to provide a rationale for the implication of cross-linking between Nrf2 and mTOR signaling.

  14. Faster-higher-stronger -- greener

    International Nuclear Information System (INIS)

    Burgess, A.

    2000-01-01

    The Toronto Olympic Bid Committee is reported to have adopted a strong environmental orientation in its bid to bring the 2008 Olympic Games to Toronto. In a recent address, the President of the Committee outlined details of the bid's environmental component which emphasizes the role of sustainable development within the Olympics and the consequences of this orientation on the design, construction and operation of facilities. The Toronto Bid Committee has gained inspiration and momentum for its 'green bid' from the host city of the 2000 Olympic Games, Sidney, Australia, which has won widespread praise for its efforts to clean up Homebush Bay, a brownfield site long seen as a liability for the city. The Toronto Bid Committee is making itself accountable for: creating the healthiest possible conditions for the athletes, visitors and residents; designing for sustainability; protecting, restoring and enhancing human and natural habitats; conserving resources and minimizing the ecological impact of the Games; promoting innovative, technically proven Canadian environmental technology; and fostering environmental awareness and education. The Committee intends to make the environment a priority and not just an afterthought in the bidding process. It hopes to develop specific goals and where possible, quantifiable targets in non-polluting designs for all Olympic housing and sports facilities. Wherever possible renewable power such as wind, solar and fuel cells will be used, and cleaner fuels such as natural gas where green power is not a viable option

  15. Are melanized feather barbs stronger?

    Science.gov (United States)

    Butler, Michael; Johnson, Amy S

    2004-01-01

    Melanin has been associated with increased resistance to abrasion, decreased wear and lowered barb breakage in feathers. But, this association was inferred without considering barb position along the rachis as a potentially confounding variable. We examined the cross-sectional area, breaking force, breaking stress, breaking strain and toughness of melanized and unmelanized barbs along the entire rachis of a primary feather from an osprey (Pandion haliaetus). Although breaking force was higher for melanized barbs, breaking stress (force divided by cross-sectional area) was greater for unmelanized barbs. But when position was considered, all mechanical differences between melanized and unmelanized barbs disappeared. Barb breaking stress, breaking strain and toughness decreased, and breaking stiffness increased, distally along the rachis. These proximal-distal material property changes are small and seem unlikely to affect flight performance of barbs. Our observations of barb bending, breaking and morphology, however, lead us to propose a design principle for barbs. We propose that, by being thicker-walled dorso-ventrally, the barb's flexural stiffness is increased during flight; but, by allowing for twisting when loaded with dangerously high forces, barbs firstly avoid failure by bending and secondly avoid complete failure by buckling rather than rupturing.

  16. A stronger perfume for LPG

    Energy Technology Data Exchange (ETDEWEB)

    Willcox, C.K.

    1996-11-01

    The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

  17. A stronger perfume for LPG

    International Nuclear Information System (INIS)

    Willcox, C.K.

    1996-01-01

    The odorisation of Liquefied Petroleum Gas (LPG) is undertaken to improve the safe use and transport of this popular fuel. Effective LPG odorisation should enable leaks to be detected by any person with a normal sense of smell before gas concentrations reach a hazardous level. The objective is identical to that for odorising natural gas. However, the physical characteristics of propane and butane present particular difficulties. These do not occur with natural gas, which has a dynamic, flowing, simple-phase system. (author)

  18. Bad is stronger than good

    NARCIS (Netherlands)

    Baumeister, R.F.; Bratslavsky, E.; Finkenauer, C.; Vohs, K.D.

    2001-01-01

    The greater power of bad events over good ones is found in everyday events, major life events (e.g., trauma), close relationship outcomes, social network patterns, interpersonal interactions, and learning processes. Bad emotions, bad parents, and bad feedback have more impact than good ones, and bad

  19. Working Longer Makes Students Stronger?

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup

    Abstract: Despite much discussion on the role of education policy on school and student performance, we know little about the effects of school spending at the margin on student cognitive achievement beyond the effects of class size. Thus this paper examines the effects of annual ninth grade...... classroom hours in literacy and maths on ninth grade (aged 16) student performance in writing and maths, respectively. Using population data for Denmark in 2003-2006, I exploit unique policy-induced variation in classroom hours.On average, the reform changed classroom hours by 2.2-3.3% in literacy and maths...

  20. The polar 2e/12c bond in phenalenyl-azaphenalenyl hetero-dimers: Stronger stacking interaction and fascinating interlayer charge transfer

    Energy Technology Data Exchange (ETDEWEB)

    Zhong, Rong-Lin; Li, Zhi-Ru, E-mail: hlxu@nenu.edu.cn, E-mail: lzr@jlu.edu.cn [Institute of Theoretical Chemistry, Jilin University, Changchun 130023 (China); Xu, Hong-Liang, E-mail: hlxu@nenu.edu.cn, E-mail: lzr@jlu.edu.cn [Institute of Functional Material Chemistry, Faculty of Chemistry, Northeast Normal University, Changchun, Jilin 130024 (China)

    2016-08-07

    An increasing number of chemists have focused on the two-electron/multicenter bond (2e/mc) that was first introduced to interpret the bonding mechanism of radical dimers. Herein, we report the polar two-electron/twelve center (2e/12c) bonding character in a series of phenalenyl-azaphenalenyl radical hetero-dimers. Interestingly, the bonding energy of weaker polar hetero-dimer (P-TAP) is dominated by the overlap of the two different singly occupied molecular orbital of radicals, while that of stronger polar hetero-dimer (P-HAP) is dominated by the electrostatic attraction. Results show that the difference between the electronegativity of the monomers plays a prominent role in the essential attribution of the polar 2e/12c bond. Correspondingly, a stronger stacking interaction in the hetero-dimer could be effectively achieved by increasing the difference of nitrogen atoms number between the monomers. It is worthy of note that an interesting interlayer charge transfer character is induced in the polar hetero-dimers, which is dependent on the difference between the electronegativity of the monomers. It is our expectation that the new knowledge about the bonding nature of radical hetero-dimers might provide important information for designing radical based functional materials with various applications.

  1. Increases in Use and Activity Due to Urban Renewal

    DEFF Research Database (Denmark)

    Andersen, Henriette Bondo; Christiansen, Lars Breum; Klinker, Charlotte Demant

    2017-01-01

    Introduction Urban green space and other recreational facilities are associated with physical activity. For adolescents living in multistory housing, public outdoor spaces that support physical activity may play an important role in activity promotion strategies. However, stronger evidence for a ...

  2. Supporting young people living with cancer to tell their stories in ways that make them stronger: The Beads of Life approach.

    Science.gov (United States)

    Portnoy, Sara; Girling, Isabella; Fredman, Glenda

    2016-04-01

    This article describes the 'Beads of Life' approach--a five-part methodology informed by narrative therapy to enable children and young people to make sense of their cancer journey in ways that make them stronger. Young people are invited to use beads as prompts to tell preferred stories of their identity to create a safe place to stand from which to story their cancer journey. The approach positions young people as experts in their lives. It aims to change their relationship with cancer to reduce its negative impact on life by lessening isolation. By enabling medical staff to get to know the young person apart from the cancer, this approach aims to create hope for the future and improve quality of care. © The Author(s) 2015.

  3. CDC'S Testing Makes Us Stronger (TMUS) Campaign: Was Campaign Exposure Associated With HIV Testing Behavior Among Black Gay and Bisexual Men?

    Science.gov (United States)

    Habarta, Nancy; Boudewyns, Vanessa; Badal, Hannah; Johnston, Jennie; Uhrig, Jennifer; Green, Donata; Ruddle, Paul; Rosenthal, Jacqueline; Stryker, Jo Ellen

    2017-06-01

    This study assessed exposure among Black gay, bisexual, and other men who have sex with men (BMSM) to a communication campaign, Testing Makes Us Stronger (TMUS), and its association with HIV testing to determine campaign effectiveness. Data from an online survey (N = 3,105) were analyzed using propensity score weight-adjusted logistic regression to examine the effect of exposure on HIV testing. Among BMSM aged 18-44 (n = 702), 43.2% reported TMUS exposure. The majority of those exposed were aged 25-34 (54%), HIV-negative (65%), and had some college education (87%). TMUS exposure was associated with reported increased HIV testing behaviors at 6- and 12-month frequencies. Communication campaigns with clear implementation strategies, focused objectives, and online and event presence can be associated with longer-term outcomes such as HIV testing.

  4. Kaempferol induces autophagic cell death of hepatocellular carcinoma cells via activating AMPK signaling.

    Science.gov (United States)

    Han, Bing; Yu, Yi-Qun; Yang, Qi-Lian; Shen, Chun-Ying; Wang, Xiao-Juan

    2017-10-17

    In the present study, we demonstrate that Kaempferol inhibited survival and proliferation of established human hepatocellular carcinoma (HCC) cell lines (HepG2, Huh-7, BEL7402, and SMMC) and primary human HCC cells. Kaempferol treatment in HCC cells induced profound AMP-activated protein kinase (AMPK) activation, which led to Ulk1 phosphorylation, mTOR complex 1 inhibition and cell autophagy. Autophagy induction was reflected by Beclin-1/autophagy gene 5 upregulation and p62 degradation as well as light chain 3B (LC3B)-I to LC3B-II conversion and LC3B puncta formation. Inhibition of AMPK, via AMPKα1 shRNA or dominant negative mutation, reversed above signaling changes. AMPK inhibition also largely inhibited Kaempferol-induced cytotoxicity in HCC cells. Autophagy inhibition, by 3-methyaldenine or Beclin-1 shRNA, also protected HCC cells from Kaempferol. Kaempferol downregulated melanoma antigen 6, the AMPK ubiquitin ligase, causing AMPKα1 stabilization and accumulation. We conclude that Kaempferol inhibits human HCC cells via activating AMPK signaling.

  5. Climate and development: enhancing impact through stronger linkages in the implementation of the Paris Agreement and the Sustainable Development Goals (SDGs).

    Science.gov (United States)

    Gomez-Echeverri, Luis

    2018-05-13

    One of the greatest achievements in the global negotiations of 2015 that delivered the 2030 Agenda for Sustainable Development or Sustainable Development Goals (SDGs) and the Paris Agreement on climate change is that, for the first time, the linkages between climate and development were enshrined in each of the documents. This was done in recognition that climate change and development need to be addressed together in order not only to avoid harmful trade-offs and high costs, particularly for poorer countries, but also to exploit the benefits that come from strengthening these linkages. This review presents some of the latest data that argue for stronger linkages as well as the challenges of implementation which are not only politically and economically related but also include issues such as knowledge gaps, finance and governance. Finally, the review also presents a glimpse at the pathways that will be required to reach the ambitious global temperature targets of the Paris Agreement of less than 2°C above pre-industrial levels with efforts to limit temperature rise even further to 1.5°C. This provides the context for some conclusions and recommendations for policy-makers, including on methodologies for assessing linkages and leveraging them for greater benefit.This article is part of the theme issue 'The Paris Agreement: understanding the physical and social challenges for a warming world of 1.5°C above pre-industrial levels'. © 2018 The Authors.

  6. Climate and development: enhancing impact through stronger linkages in the implementation of the Paris Agreement and the Sustainable Development Goals (SDGs)

    Science.gov (United States)

    Gomez-Echeverri, Luis

    2018-05-01

    One of the greatest achievements in the global negotiations of 2015 that delivered the 2030 Agenda for Sustainable Development or Sustainable Development Goals (SDGs) and the Paris Agreement on climate change is that, for the first time, the linkages between climate and development were enshrined in each of the documents. This was done in recognition that climate change and development need to be addressed together in order not only to avoid harmful trade-offs and high costs, particularly for poorer countries, but also to exploit the benefits that come from strengthening these linkages. This review presents some of the latest data that argue for stronger linkages as well as the challenges of implementation which are not only politically and economically related but also include issues such as knowledge gaps, finance and governance. Finally, the review also presents a glimpse at the pathways that will be required to reach the ambitious global temperature targets of the Paris Agreement of less than 2°C above pre-industrial levels with efforts to limit temperature rise even further to 1.5°C. This provides the context for some conclusions and recommendations for policy-makers, including on methodologies for assessing linkages and leveraging them for greater benefit. This article is part of the theme issue `The Paris Agreement: understanding the physical and social challenges for a warming world of 1.5°C above pre-industrial levels'.

  7. Malnutrition Increases With Obesity and Is a Stronger Independent Risk Factor for Postoperative Complications: A Propensity-Adjusted Analysis of Total Hip Arthroplasty Patients.

    Science.gov (United States)

    Fu, Michael C; D'Ambrosia, Christopher; McLawhorn, Alexander S; Schairer, William W; Padgett, Douglas E; Cross, Michael B

    2016-11-01

    Obesity is frequently associated with complications after total hip arthroplasty (THA) and is often concomitant with malnutrition. The purpose of this study was to investigate the independent morbidity risk of malnutrition relative to obesity. The National Surgical Quality Improvement Program from 2005 to 2013 was queried for elective primary THA cases. Malnutrition was defined as albumin malnutrition with 30-day outcomes. A total of 40,653 THA cases were identified, of which 20,210 (49.7%) had preoperative albumin measurements. Propensity score adjustment successfully reduced potential selection bias, with P > .05 for differences between those with and without albumin data. Malnutrition incidence increased from 2.8% in obese I to 5.7% in obese III patients. With multivariable propensity-adjusted logistic regression, malnutrition was a more robust predictor than any obesity class for any postoperative complication(s) (odds ratio [OR] 1.61, 95% confidence interval [CI] 1.25-2.08), major complications (OR 1.63, 95% CI 1.21-2.19), respiratory complications (OR 2.35, 95% CI 1.27-4.37), blood transfusions (OR 1.71, 95% CI 1.44-2.03), and extended length of stay (OR 1.35, 95% CI 1.14-1.59). Malnutrition incidence increased significantly from obese I to obese III patients and was a stronger and more consistent predictor than obesity of complications after THA. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. 24-hour aortic blood pressure variability showed a stronger association with carotid damage than 24-hour brachial blood pressure variability: The SAFAR study.

    Science.gov (United States)

    Yu, Shikai; Chi, Chen; Protogerou, Athanase D; Safar, Michel E; Blacher, Jacques; Argyris, Antonis A; Nasothimiou, Efthimia G; Sfikakis, Petros P; Papaioannou, Theodore G; Xu, Henry; Zhang, Yi; Xu, Yawei

    2018-03-01

    We aim to compare 24-hour aortic blood pressure variability (BPV) with brachial BPV in relation to carotid damage as estimated by carotid intima-media thickness (CIMT) and cross-sectional area (CCSA). Four hundred and forty five individuals received brachial and aortic 24-hour ambulatory BP monitoring with a validated device (Mobil-O-Graph). Systolic BPV was estimated by average real variability (ARV) and time-weighted standard deviation (wSD). In multiple logistic regression analysis, CIMT > 900 μm was significantly and independently associated with aortic ARV (OR = 1.38; 95% CI: 1.04-1.84), aortic wSD (OR = 1.65; 95% CI: 1.19-2.29) and brachial ARV (OR = 1.53; 95% CI: 1.07-2.18), but not with brachial wSD. CCSA > 90th percentile was significantly and independently associated with aortic ARV (OR = 1.50; 95% CI: 1.07-2.10) and wSD (OR = 1.70; 95% CI: 1.12-2.56), but not with brachial BPVs. In receiver operator characteristics curve analysis, aortic wSD identified CCSA > 90th percentile better than brachial wSD (AUC: 0.73 vs 0.68, P < .01). In conclusion, aortic 24-hour systolic BPV showed a slightly stronger association with carotid damage than brachial BPV. ©2018 Wiley Periodicals, Inc.

  9. The New Bail-in Regime and the Need for Stronger Market Discipline: What Can We Learn From the Greek Case?

    Directory of Open Access Journals (Sweden)

    Evangelos Vasileiou

    2014-01-01

    Full Text Available Effective Market Discipline (MD puzzles financial economists and regulators for decades, while the recent bail-in legislation for European banks extremely raises the need for even stronger MD. It may not be exaggeration to say that a new regime for the European banking market is born after the aforementioned decision. This paper’s objective is the broader MD examination, using variables that are not usually included in MD studies, but concern the European Union (EU and the European Monetary Union (EMU in the last years. In particular, apart from banking, deposit insurance and pure macroeconomic indicators, we also include governance and sovereign debt indices. The new regime may need a new MD approach. We choose Greece to implement our assumptions, because it is the country with the most severe economic, sovereign and governance problems in the EU. We employ data for the period 2002-10. The empirical evidence supports that market discipline is superficial, while there is ample evidence that MD is directly influenced by the poor governance performance and the excessive government debt. Greek authorities have to make major structural reforms in order to create the conditions for long-term stability, while our analysis points out some EMU’s shortfalls. 

  10. Immune indexes of larks from desert and temperate regions show weak associations with life history but stronger links to environmental variation in microbial abundance.

    Science.gov (United States)

    Horrocks, Nicholas P C; Hegemann, Arne; Matson, Kevin D; Hine, Kathryn; Jaquier, Sophie; Shobrak, Mohammed; Williams, Joseph B; Tinbergen, Joost M; Tieleman, B Irene

    2012-01-01

    Immune defense may vary as a result of trade-offs with other life-history traits or in parallel with variation in antigen levels in the environment. We studied lark species (Alaudidae) in the Arabian Desert and temperate Netherlands to test opposing predictions from these two hypotheses. Based on their slower pace of life, the trade-off hypothesis predicts relatively stronger immune defenses in desert larks compared with temperate larks. However, as predicted by the antigen exposure hypothesis, reduced microbial abundances in deserts should result in desert-living larks having relatively weaker immune defenses. We quantified host-independent and host-dependent microbial abundances of culturable microbes in ambient air and from the surfaces of birds. We measured components of immunity by quantifying concentrations of the acute-phase protein haptoglobin, natural antibody-mediated agglutination titers, complement-mediated lysis titers, and the microbicidal ability of whole blood. Desert-living larks were exposed to significantly lower concentrations of airborne microbes than temperate larks, and densities of some bird-associated microbes were also lower in desert species. Haptoglobin concentrations and lysis titers were also significantly lower in desert-living larks, but other immune indexes did not differ. Thus, contrary to the trade-off hypothesis, we found little evidence that a slow pace of life predicted increased immunological investment. In contrast, and in support of the antigen exposure hypothesis, associations between microbial exposure and some immune indexes were apparent. Measures of antigen exposure, including assessment of host-independent and host-dependent microbial assemblages, can provide novel insights into the mechanisms underlying immunological variation.

  11. Stronger default mode network connectivity is associated with poorer clinical insight in youth at ultra high-risk for psychotic disorders.

    Science.gov (United States)

    Clark, Sarah V; Mittal, Vijay A; Bernard, Jessica A; Ahmadi, Aral; King, Tricia Z; Turner, Jessica A

    2018-03-01

    Impaired clinical insight (CI) is a common symptom of psychotic disorders and a promising treatment target. However, to date, our understanding of how variability in CI is tied to underlying brain dysfunction in the clinical high-risk period is limited. Developing a stronger conception of this link will be a vital first step for efforts to determine if CI can serve as a useful prognostic indicator. The current study investigated whether variability in CI is related to major brain networks in adolescents and young adults at ultra high-risk (UHR) of developing psychosis. Thirty-five UHR youth were administered structured clinical interviews as well as an assessment for CI and underwent resting-state magnetic resonance imaging scans. Functional connectivity was calculated in the default mode network (DMN) and fronto-parietal network (FPN), two major networks that are dysfunctional in psychosis and are hypothesized to affect insight. Greater DMN connectivity between the posterior cingulate/precuneus and ventromedial prefrontal cortex (DMN) was related to poorer CI (R 2 =0.399). There were no significant relationships between insight and the FPN. This is the first study to relate a major brain network to clinical insight before the onset of psychosis. Findings are consistent with evidence if a hyperconnected DMN in schizophrenia and UHR, and similar to a previous study of insight and connectivity in schizophrenia. Results suggest that a strongly connected DMN may be related to poor self-awareness of subthreshold psychotic symptoms in UHR adolescents and young adults. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. U-shape rotating anti-cathode compact X-ray generator: 20 times stronger than the commercially available X-ray source

    Energy Technology Data Exchange (ETDEWEB)

    Sakabe, N., E-mail: sakabe-dsb@sbsp.jp; Sakabe, K. [High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba 305-0801 (Japan); Foundation for Advancement of International Science (FAIS), Kasuga 3-chome, Tsukuba, Ibaraki 305-0821 (Japan); Ohsawa, S.; Sakai, T.; Kobayakawa, H.; Sugimura, T.; Ikeda, M.; Tawada, M. [High Energy Accelerator Research Organization (KEK), 1-1 Oho, Tsukuba, Ibaraki 305-0801 (Japan); Watanabe, N.; Sasaki, K. [Nagoya University, Chikusa, Nagoya, Aichi 464-8603 (Japan); Wakatsuki, M. [National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Higashi, Tsukuba, Ibaraki 305-8568 (Japan)

    2013-11-01

    stronger than that of the original commercially offered X-ray generator that we modified.

  13. Reorganization of a marine trophic network along an inshore-offshore gradient due to stronger pelagic-benthic coupling in coastal areas

    Science.gov (United States)

    Kopp, Dorothée; Lefebvre, Sébastien; Cachera, Marie; Villanueva, Maria Ching; Ernande, Bruno

    2015-01-01

    Recent theoretical considerations have highlighted the importance of the pelagic-benthic coupling in marine food webs. In continental shelf seas, it was hypothesized that the trophic network structure may change along an inshore-offshore gradient due to weakening of the pelagic-benthic coupling from coastal to offshore areas. We tested this assumption empirically using the eastern English Channel (EEC) as a case study. We sampled organisms from particulate organic matter to predatory fishes and used baseline-corrected carbon and nitrogen stable isotope ratios (δ13C and δ15N) to determine their trophic position. First, hierarchical clustering on δ13C and δ15N coupled to bootstrapping and estimates of the relative contribution of pelagic and benthic carbon sources to consumers' diet showed that, at mesoscale, the EEC food web forms a continuum of four trophic levels with trophic groups spread across a pelagic and a benthic trophic pathway. Second, based on the same methods, a discrete approach examined changes in the local food web structure across three depth strata in order to investigate the inshore-offshore gradient. It showed stronger pelagic-benthic coupling in shallow coastal areas mostly due to a reorganization of the upper consumers relative to the two trophic pathways, benthic carbon sources being available to pelagic consumers and, reciprocally, pelagic sources becoming accessible to benthic species. Third a continuous approach examined changes in the mean and variance of upper consumers' δ13C and δ15N with depth. It detected a significant decrease in δ13C variance and a significant increase in δ15N variance as depth increases. A theoretical two-source mixing model showed that an inshore-offshore decrease in the pelagic-benthic coupling was a sufficient condition to produce the δ13C variance pattern, thus supporting the conclusions of the discrete approach. These results suggest that environmental gradients such as the inshore-offshore one should

  14. E2A-positive gastric MALT lymphoma has weaker plasmacytoid infiltrates and stronger expression of the memory B-cell-associated miR-223: possible correlation with stage and treatment response.

    Science.gov (United States)

    Liu, Ting-Yun; Chen, Shee-Uan; Kuo, Sung-Hsin; Cheng, Ann-Lii; Lin, Chung-Wu

    2010-11-01

    Extranodal marginal-zone lymphoma of mucosa-associated lymphoid tissue of the stomach (gastric MALT lymphoma) is derived from memory B cells of the marginal zone. Normal memory B cells do not express markers of germinal-center B cells, such as E2A (immunoglobulin enhancer-binding factor E12/E47), B-cell chronic lymphocytic leukemia/lymphoma 6 (BCL6), or activation-induced cytidine deaminase (AID). E2A is a transcription factor that induces somatic hypermutations and blocks plasma cell differentiation. In 50 stage-I(E)/II(E1) gastric MALT lymphomas, we confirmed that all cases were BCL6(-)/AID(-), but a subset (50%, 25/50) was E2A(+). As E2A(-) and E2A(+) gastric MALT lymphomas had similar numbers of somatic hypermutations without intraclonal variations, which implied an origin from memory B cells, the expression of E2A was best regarded as a marker of aberrant follicular differentiation. Although the status of somatic hypermutation was not affected by E2A, E2A(+) gastric MALT lymphoma showed less plasmacytoid infiltrates and higher expressions of miRNA-223, a microRNA associated with memory B cells. Clinically, E2A(+) gastric MALT lymphomas were more likely to spread to perigastric lymph nodes and were less responsive to Helicobacter eradication therapy than were E2A(-) gastric MALT lymphomas. Taken together, aberrant E2A expression is a diagnostic feature of a subtype of gastric MALT lymphoma with weaker plasmacytoid infiltrates and stronger miR-223 expression. A prospective study would be necessary to verify the association between E2A expression and a poor response to Helicobacter eradication therapy.

  15. Gremlin promotes retinal pigmentation epithelial (RPE) cell proliferation, migration and VEGF production via activating VEGFR2-Akt-mTORC2 signaling.

    Science.gov (United States)

    Liu, Yuan; Chen, Zhijun; Cheng, Haixia; Chen, Juan; Qian, Jing

    2017-01-03

    Retinopathy of prematurity (ROP) is characterized by late-phase pathologic retinal vasoproliferation. Gremlin is a novel vascular endothelial growth factors (VEGF) receptor 2 (VEGFR2) agonist and promotes angiogenic response. We demonstrated that gremlin expression was significantly increased in retinas of ROP model mice, which was correlated with VEGF upregulation. In retinal pigmentation epithelial (RPE) cells, gremlin activated VEGFR2-Akt-mTORC2 (mammalian target of rapamycin complex 2) signaling, and promoted cell proliferation, migration and VEGF production. VEGFR inhibition (by SU5416) or shRNA knockdown almost abolished gremlin-mediated pleiotropic functions in RPE cells. Further, pharmacological inhibition of Akt-mTOR, or shRNA knockdown of key mTORC2 component (Rictor or Sin1) also attenuated gremlin-exerted activities in RPE cells. We conclude that gremlin promotes RPE cell proliferation, migration and VEGF production possibly via activating VEGFR2-Akt-mTORC2 signaling. Gremlin could be a novel therapeutic target of ROP or other retinal vasoproliferation diseases.

  16. Epac activation sensitizes rat sensory neurons via activation of Ras

    Science.gov (United States)

    Shariati, Behzad; Thompson, Eric L.; Nicol, Grant D.; Vasko, Michael R.

    2015-01-01

    Guanine nucleotide exchange factors directly activated by cAMP (Epacs) have emerged as important signaling molecules mediating persistent hypersensitivity in animal models of inflammation, by augmenting the excitability of sensory neurons. Although Epacs activate numerous downstream signaling cascades, the intracellular signaling which mediates Epac-induced sensitization of capsaicin-sensitive sensory neurons remains unknown. Here, we demonstrate that selective activation of Epacs with 8-CPT-2′-O-Me-cAMP-AM (8CPT-AM) increases the number of action potentials (APs) generated by a ramp of depolarizing current and augments the evoked release of calcitonin gene-related peptide (CGRP) from isolated rat sensory neurons. Internal perfusion of capsaicin-sensitive sensory neurons with GDP-βS, substituted for GTP, blocks the ability of 8CPT-AM to increase AP firing, demonstrating that Epac-induced sensitization is G-protein dependent. Treatment with 8CPT-AM activates the small G-proteins Rap1 and Ras in cultures of sensory neurons. Inhibition of Rap1, by internal perfusion of a Rap1-neutralizing antibody or through a reduction in the expression of the protein using shRNA does not alter the Epac-induced enhancement of AP generation or CGRP release, despite the fact that in most other cell types, Epacs act as Rap-GEFs. In contrast, inhibition of Ras through expression of a dominant negative Ras (DN-Ras) or through internal perfusion of a Ras-neutralizing antibody blocks the increase in AP firing and attenuates the increase in the evoked release of CGRP induced by Epac activation. Thus, in this subpopulation of nociceptive sensory neurons, it is the novel interplay between Epacs and Ras, rather than the canonical Epacs and Rap1 pathway, that is critical for mediating Epac-induced sensitization. PMID:26596174

  17. Epac activation sensitizes rat sensory neurons through activation of Ras.

    Science.gov (United States)

    Shariati, Behzad; Thompson, Eric L; Nicol, Grant D; Vasko, Michael R

    2016-01-01

    Guanine nucleotide exchange factors directly activated by cAMP (Epacs) have emerged as important signaling molecules mediating persistent hypersensitivity in animal models of inflammation, by augmenting the excitability of sensory neurons. Although Epacs activate numerous downstream signaling cascades, the intracellular signaling which mediates Epac-induced sensitization of capsaicin-sensitive sensory neurons remains unknown. Here, we demonstrate that selective activation of Epacs with 8-CPT-2'-O-Me-cAMP-AM (8CPT-AM) increases the number of action potentials (APs) generated by a ramp of depolarizing current and augments the evoked release of calcitonin gene-related peptide (CGRP) from isolated rat sensory neurons. Internal perfusion of capsaicin-sensitive sensory neurons with GDP-βS, substituted for GTP, blocks the ability of 8CPT-AM to increase AP firing, demonstrating that Epac-induced sensitization is G-protein dependent. Treatment with 8CPT-AM activates the small G-proteins Rap1 and Ras in cultures of sensory neurons. Inhibition of Rap1, by internal perfusion of a Rap1-neutralizing antibody or through a reduction in the expression of the protein using shRNA does not alter the Epac-induced enhancement of AP generation or CGRP release, despite the fact that in most other cell types, Epacs act as Rap-GEFs. In contrast, inhibition of Ras through expression of a dominant negative Ras (DN-Ras) or through internal perfusion of a Ras-neutralizing antibody blocks the increase in AP firing and attenuates the increase in the evoked release of CGRP induced by Epac activation. Thus, in this subpopulation of nociceptive sensory neurons, it is the novel interplay between Epacs and Ras, rather than the canonical Epacs and Rap1 pathway, that is critical for mediating Epac-induced sensitization. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Kindlins, integrin activation and the regulation of talin recruitment to αIIbβ3.

    Directory of Open Access Journals (Sweden)

    Bryan N Kahner

    Full Text Available Talins and kindlins bind to the integrin β3 cytoplasmic tail and both are required for effective activation of integrin αIIbβ3 and resulting high-affinity ligand binding in platelets. However, binding of the talin head domain alone to β3 is sufficient to activate purified integrin αIIbβ3 in vitro. Since talin is localized to the cytoplasm of unstimulated platelets, its re-localization to the plasma membrane and to the integrin is required for activation. Here we explored the mechanism whereby kindlins function as integrin co-activators. To test whether kindlins regulate talin recruitment to plasma membranes and to αIIbβ3, full-length talin and kindlin recruitment to β3 was studied using a reconstructed CHO cell model system that recapitulates agonist-induced αIIbβ3 activation. Over-expression of kindlin-2, the endogenous kindlin isoform in CHO cells, promoted PAR1-mediated and talin-dependent ligand binding. In contrast, shRNA knockdown of kindlin-2 inhibited ligand binding. However, depletion of kindlin-2 by shRNA did not affect talin recruitment to the plasma membrane, as assessed by sub-cellular fractionation, and neither over-expression of kindlins nor depletion of kindlin-2 affected talin interaction with αIIbβ3 in living cells, as monitored by bimolecular fluorescence complementation. Furthermore, talin failed to promote kindlin-2 association with αIIbβ3 in CHO cells. In addition, purified talin and kindlin-3, the kindlin isoform expressed in platelets, failed to promote each other's binding to the β3 cytoplasmic tail in vitro. Thus, kindlins do not promote initial talin recruitment to αIIbβ3, suggesting that they co-activate integrin through a mechanism independent of recruitment.

  19. Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

    Directory of Open Access Journals (Sweden)

    Yang Xing

    2009-07-01

    Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

  20. In vitro activity of flomoxef in comparison to other cephalosporins.

    Science.gov (United States)

    Simon, C; Simon, M; Plieth, C

    1988-01-01

    Flomoxef and cefazolin had nearly the same activity against staphylococci, which was stronger than that of other cephalosporins. Against Streptococcus pyogenes, Streptococcus agalactiae and Streptococcus pneumoniae, cefotaxime and cefazolin were more active than flomoxef, but the other cephamycins were less active than flomoxef. In comparison to the other cephalosporins, latamoxef and flomoxef had higher activity against Branhamella catarrhalis, whereas cefotaxime, latamoxef and cefotetan were more active against Haemophilus influenzae. Flomoxef was the only drug exhibiting activity against Clostridium difficile. The activity of flomoxef and latamoxef against Bacteroides fragilis was stronger than that of the other cephalosporins, but Bacteroides bivius was resistant to each of these antibiotics.

  1. Activation of PPARd and RXRa stimulates fatty acid oxidatin and insulin secretion inpancreatic beta-cells

    DEFF Research Database (Denmark)

    Børgesen, Michael; Ravnskjær, Kim; Frigerio, Francesca

    as a central effector of unsaturated fatty acids in pancreatic ß-cells. Interestingly, activation of PPARd increases basal as well as glucose-stimulated insulin secretion of INS-1E cells. This increase is further potentiated by RXR agonists. This observation suggests that PPARd may mediate some of the positive......ACTIVATION OF PPARd AND RXRa STIMULATES FATTY ACID OXIDATION AND INSULIN SECRETION IN PANCREATIC b-CELLS Michael Boergesen1, Kim Ravnskjaer2, Francesca Frigerio3, Allan E. Karlsen4, Pierre Maechler3 and Susanne Mandrup1 1 Department of Biochemistry and Molecular Biology, University of Southern...... of genes as PPARd specific agonists and stimulates ß-oxidation. Importantly, oleate-induction of gene expression and ß-oxidation in INS-1E cells is abolished by knock-down of PPARd using adenoviral transfer of shRNA. Thus, PPARd appears to be a central regulator of fatty acid metabolism as well...

  2. Does knowledge of teen driving risks and awareness of current law translate into support for stronger GDL provisions? Lessons learned from one state.

    Science.gov (United States)

    Campbell, Brendan T; Chaudhary, Neil K; Saleheen, Hassan; Borrup, Kevin; Lapidus, Garry

    2009-08-01

    Many states are considering strengthening their graduated driving licensing (GDL) systems for teenage drivers but most do not know the level of public support for proposed upgrades. This study provides a method for states to identify specific demographic groups that may differ with regard to their awareness of teen driving risks, knowledge of current GDL law, and support for GDL upgrades. A 28-item questionnaire was administered to Connecticut adults by phone survey during January 2008. We collected demographic information and whether respondents understood driving risks, were aware of the current GDL system, and whether they would support GDL upgrades. The state's motor vehicle crash file (1999-2006) was used to calculate motor vehicle crash rate among 16- and 17-year-old drivers by town and correlate that with support for GDL upgrades. Eight hundred seven people were interviewed. More women than men (92% vs. 86%, p towns (38%). Two thirds supported a passenger restriction upgrade with no differences based upon sex or geographic location. There was less support for an increased penalties in Fairfield County when compared to all other counties (55% vs. 63%, p County versus all other counties (70% vs. 58%, p < .05). Parents of Connecticut teens were more knowledgeable of current law but less supportive of GDL upgrades compared to other adults. Women were more apt to favor GDL upgrades than men. This study identifies subgroups that can be targeted for prevention activities and illustrates a useful method to assess public support for GDL upgrades.

  3. Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

    International Nuclear Information System (INIS)

    Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan; Kim, Hyung Sik; Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung; Oh, Seon-Hee; Jun, Dae Won; Lee, Byung-Hoon

    2017-01-01

    Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

  4. Activation of AMPK by berberine induces hepatic lipid accumulation by upregulation of fatty acid translocase CD36 in mice

    Energy Technology Data Exchange (ETDEWEB)

    Choi, You-Jin; Lee, Kang-Yo; Jung, Seung-Hwan [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Kim, Hyung Sik [School of Pharmacy, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Shim, Gayong; Kim, Mi-Gyeong; Oh, Yu-Kyoung [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of); Oh, Seon-Hee [The Division of Natural Medical Sciences, College of Health Science, Chosun University, Gwangju 501-759 (Korea, Republic of); Jun, Dae Won [Internal Medicine, Hanyang University School of Medicine, Seoul 133-791 (Korea, Republic of); Lee, Byung-Hoon, E-mail: lee@snu.ac.kr [College of Pharmacy, Research Institute of Pharmaceutical Sciences, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2017-02-01

    Emerging evidence has shown that berberine has a protective effect against metabolic syndrome such as obesity and type II diabetes mellitus by activating AMP-activated protein kinase (AMPK). AMPK induces CD36 trafficking to the sarcolemma for fatty acid uptake and oxidation in contracting muscle. However, little is known about the effects of AMPK on CD36 regulation in the liver. We investigated whether AMPK activation by berberine affects CD36 expression and fatty acid uptake in hepatocytes and whether it is linked to hepatic lipid accumulation. Activation of AMPK by berberine or transduction with adenoviral vectors encoding constitutively active AMPK in HepG2 and mouse primary hepatocytes increased the expression and membrane translocation of CD36, resulting in enhanced fatty acid uptake and lipid accumulation as determined by BODIPY-C16 and Nile red fluorescence, respectively. Activation of AMPK by berberine induced the phosphorylation of extracellular signal-regulated kinases 1/2 (ERK1/2) and subsequently induced CCAAT/enhancer-binding protein β (C/EBPβ) binding to the C/EBP-response element in the CD36 promoter in hepatocytes. In addition, hepatic CD36 expression and triglyceride levels were increased in normal diet-fed mice treated with berberine, but completely prevented when hepatic CD36 was silenced with adenovirus containing CD36-specific shRNA. Taken together, prolonged activation of AMPK by berberine increased CD36 expression in hepatocytes, resulting in fatty acid uptake via processes linked to hepatocellular lipid accumulation and fatty liver. - Highlights: • Berberine increases the expression and membrane translocation of CD36 in hepatocytes. • The increase of CD36 results in enhanced fatty acid uptake and lipid accumulation. • Berberine-induced fatty liver is mediated by AMPK-ERK-C/EBPβ pathway. • CD36-specific shRNA inhibited berberine-induced lipid accumulation in liver.

  5. Lean muscle volume of the thigh has a stronger relationship with muscle power than muscle strength in women with knee osteoarthritis.

    Science.gov (United States)

    Davison, Michael J; Maly, Monica R; Keir, Peter J; Hapuhennedige, Sandani M; Kron, Amie T; Adachi, Jonathan D; Beattie, Karen A

    2017-01-01

    Thigh lean muscle and intramuscular fat have been implicated in the impairment of physical function observed in people with knee osteoarthritis. We investigated the relationships of quadriceps and hamstrings intramuscular fat fraction and lean muscle volume with muscle power and strength, controlling for neuromuscular activation, and physical performance in women with knee OA. Women (n=20) 55years or older with symptomatic, radiographic knee osteoarthritis underwent a 3.0T magnetic resonance imaging scan of the thigh of their most symptomatic knee. Axial fat-separated images were analyzed using software to quantify intramuscular fat and lean muscle volumes of the quadriceps and hamstrings. To quantify strength and power of the knee extensors and flexors, participants performed maximum voluntary isometric contraction and isotonic knee extensions and flexions, respectively. Electromyography of the quadriceps and hamstrings was measured. Participants also completed five physical performance tests. Quadriceps and hamstrings lean muscle volumes were related to isotonic knee extensor (B=0.624; p=0.017) and flexor (B=1.518; p=0.032) power, but not knee extensor (B=0.001; p=0.615) or flexor (B=0.001; p=0.564) isometric strength. Intramuscular fat fractions were not related to isotonic knee extensor or flexor power, nor isometric strength. No relationships were found between intramuscular fat or lean muscle volume and physical performance. Muscle power may be more sensitive than strength to lean muscle mass in women with knee osteoarthritis. Thigh lean muscle mass, but neither intramuscular nor intermuscular fat, is related to knee extensor and flexor power in women with knee osteoarthritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Inhibiting cholesterol degradation induces neuronal sclerosis and epileptic activity in mouse hippocampus

    Science.gov (United States)

    Chali, Farah; Djelti, Fathia; Eugene, Emmanuel; Valderrama, Mario; Marquer, Catherine; Aubourg, Patrick; Duykaerts, Charles; Miles, Richard; Cartier, Nathalie; Navarro, Vincent

    2015-01-01

    Elevations in neuronal cholesterol have been associated with several degenerative diseases. An enhanced excitability and synchronous firing in surviving neurons are among the sequels of neuronal death in these diseases and also in some epileptic syndromes. Here, we attempted to increase neuronal cholesterol levels, using a short hairpin RNA (shRNA) to suppress expression of the enzyme CYP46A1. This protein hydroxylates cholesterol and so facilitates trans-membrane extrusion. A sh-RNA CYP46A1construction coupled to an adeno-associated virus (AAV5) was injected focally and unilaterally into mouse hippocampus. It was selectively expressed first in neurons of the CA3a region. Cytoplasmic and membrane cholesterol increased, neuronal soma volume increased and then decreased before pyramidal cells died. As CA3a pyramidal cells died, inter-ictal EEG events occurred during exploration and non-REM sleep. With time, neuronal death spread to involve pyramidal cells and interneurons of the CA1 region. CA1 neuronal death was correlated with a delayed local expression of phosphorylated tau. Astrocytes were activated throughout the hippocampus and microglial activation was specific to regions of neuronal death. CA1 neuronal death was correlated with distinct aberrant EEG activity. During exploratory behaviour and rapid eye movement sleep, EEG oscillations at 7-10 Hz (theta) could accelerate to 14-21 Hz (beta) waves. They were accompanied by low amplitude, high-frequency oscillations of peak power at ~300Hz and a range of 250-350 Hz. While episodes of EEG acceleration were not correlated with changes in exploratory behaviour, they were followed in some animals by structured seizure-like discharges. These data strengthen links between increased cholesterol, neuronal sclerosis and epileptic behavior PMID:25847620

  7. Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

    Directory of Open Access Journals (Sweden)

    Nicosia Alfredo

    2010-04-01

    Full Text Available Abstract Background Prostate stem cell antigen (PSCA is a glycosylphosphatidylinositol (GPI anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. Methods A bladder cell line was engineered to express a doxycycline (dox regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Results Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. Conclusions These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response.

  8. Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated with activation of immune signaling pathways

    International Nuclear Information System (INIS)

    Marra, Emanuele; Ciliberto, Gennaro; Palombo, Fabio; Uva, Paolo; Viti, Valentina; Simonelli, Valeria; Dogliotti, Eugenia; De Rinaldis, Emanuele; Lahm, Armin; La Monica, Nicola; Nicosia, Alfredo

    2010-01-01

    Prostate stem cell antigen (PSCA) is a glycosylphosphatidylinositol (GPI) anchored protein expressed not only in prostate but also in pancreas and bladder cancer as shown by immunohistochemistry and mRNA analysis. It has been targeted by monoclonal antibodies in preclinical animal models and more recently in a clinical trial in prostate cancer patients. The biological role played in tumor growth is presently unknown. In this report we have characterized the contribution of PSCA expression to tumor growth. A bladder cell line was engineered to express a doxycycline (dox) regulated shRNA against PSCA. To shed light on the PSCA biological role in tumor growth, microarray analysis was carried out as a function of PSCA expression. Expression of gene set of interest was further analyzed by qPCR Down regulation of the PSCA expression was associated with reduced cell proliferation in vitro and in vivo. Mice bearing subcutaneous tumors showed a reduced tumor growth upon treatment with dox, which effectively induced shRNA against PSCA as revealed by GFP expression. Pathway analysis of deregulated genes suggests a statistical significant association between PSCA downregulation and activation of genes downstream of the IFNα/β receptor. These experiments established for the first time a correlation between the level of PSCA expression and tumor growth and suggest a role of PSCA in counteracting the natural immune response

  9. Stronger Disciplinary Identities in Multidisciplinary Research Schools

    Science.gov (United States)

    Geschwind, Lars; Melin, Göran

    2016-01-01

    In this study, two multidisciplinary Social Sciences and Humanities research schools in Sweden have been investigated regarding disciplinary identity-making. This study investigates the meetings between different disciplines around a common thematic area of study for Ph.D. students. The Ph.D. students navigate through a complex social and…

  10. Combat Conditioning: The Need for Stronger Marines

    Science.gov (United States)

    2008-02-18

    pounds. This leads to overuse injuries that can reduce a unit’s combat effectiveness. Typically the injuries are isolated to the lower...extremities in the form of femoral and hip stress fractures. The way to avoid these types of injuries is to strengthen the muscles around these areas as...shows how the average weight carried by warriors has increased over time. 3 “ CrossFit is a core strength and conditioning program

  11. Nursing is stronger when we work together.

    Science.gov (United States)

    Catton, Howard

    2017-01-11

    There are some striking similarities between Brexit and the election of Donald Trump as president of the United States: anger with an out-of-touch establishment, a desire to take back control and many people feeling left behind by globalisation.

  12. Accelerator Sector - together we're stronger

    CERN Multimedia

    2002-01-01

    From 1 January onwards, the Accelerator Sector will be reorganised into two new divisions AB and AT. We talked to the leaders of these two divisions, Steve Myers and Philippe Lebrun, about this reorganisation.

  13. Citius, Altius, Fortius: Faster, Higher, Stronger

    Science.gov (United States)

    2013-06-01

    males. For example, elite female athletes improved the national 100- meter sprint and 80- meter hurdle record by nearly two seconds. High jump was...improved by a third of a meter , and shot put and javelin improved by over 30 meters .52 Notably, the motivations of the CCP’s sports policy from 1949 to...per capita gross domestic product (GDP) was around 1,000 yuan in 1988,82 and a bonus for an academic in the space shuttle program was 400 yuan.83

  14. Essentially stronger - 1999 EPCOR annual report

    International Nuclear Information System (INIS)

    1999-01-01

    The year 1999 has been a year of consolidation for EPCOR Utilities, uniting the the former brands of Edmonton Power, Aquaalta and Eltec under a new single brand, EPCOR, to provide Edmontonians with a safe, high quality and reliable essential service at competitive prices . The company is building for growth by augmenting its product line with natural gas and green power, accessing new capital, proceeding with new projects at various sites, creating EPCOR Power Development Corporation with an ambitious mandate to grow beyond the Utilities traditional service areas. In proof of that, EPCOR Water Services won a strategically important contract in Port Hardy, BC; EPCOR Technologies also has been involved in projects beyond Alberta. As a sign of confidence in the company, the City of Edmonton voted to retain ownership of the company in July. The Utility also managed to win national awards for both safety and environmental practices and is the first utility company to have all its generating plants meet ISO 14001 standards. During 2000 the company will tackle the evolution of industry restructuring , will explore more diverse financial structures to accommodate growth and the increase in demand for services to make sure that EPCOR will be a leading provider of electric power and natural gas services as the era of deregulated competitive electrical services in Alberta begins in 2001. This report provides details of the achievements of the company's business units in 1999, accompanied by a consolidated financial statement

  15. Essentially stronger -1999 EPCOR annual report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-07-01

    This annual report provides details of the financial operations of EPCOR, the newly formed utility, combining together three essential elements of modern living --electric power, water and natural gas-- as a single entity. In addition to this report on financial management, there are two companion reports on environmental performance entitled {sup E}ssential Balance', and on contributions to the community with the title of 'Essential Spirit'. While this report focuses on the Corporation's financial performance, it also provides a summary on the Corporation's growth, operational excellence, regulatory matters, environmental achievements and management of the Corporation's people resources. The financial report includes the customary consolidated financial statements, the auditor's report, and management's discussion and analysis of the financial report. Revenues for 1999 totalled just over one billion dollars ($978 million in 1998); net income was $116 million ($121 million in 1998); operating expenses were higher than in 1998 ($765 million versus $642 million) due to higher natural gas prices; capital spending was $198 million, compared to $153 million in 1998. Operations, maintenance, and administrative costs were also higher in 1999 due to higher employee costs across the EPCOR Group, one-time costs associated with EPCOR's master branding initiative, Y2K testing and remediation, and increased business development costs.

  16. Essentially stronger -1999 EPCOR annual report

    International Nuclear Information System (INIS)

    2000-01-01

    This annual report provides details of the financial operations of EPCOR, the newly formed utility, combining together three essential elements of modern living --electric power, water and natural gas-- as a single entity. In addition to this report on financial management, there are two companion reports on environmental performance entitled E ssential Balance', and on contributions to the community with the title of 'Essential Spirit'. While this report focuses on the Corporation's financial performance, it also provides a summary on the Corporation's growth, operational excellence, regulatory matters, environmental achievements and management of the Corporation's people resources. The financial report includes the customary consolidated financial statements, the auditor's report, and management's discussion and analysis of the financial report. Revenues for 1999 totalled just over one billion dollars ($978 million in 1998); net income was $116 million ($121 million in 1998); operating expenses were higher than in 1998 ($765 million versus $642 million) due to higher natural gas prices; capital spending was $198 million, compared to $153 million in 1998. Operations, maintenance, and administrative costs were also higher in 1999 due to higher employee costs across the EPCOR Group, one-time costs associated with EPCOR's master branding initiative, Y2K testing and remediation, and increased business development costs

  17. Chemical reaction due to stronger Ramachandran interaction

    Indian Academy of Sciences (India)

    actions between two polarized atoms are responsible for initiating a chemical reaction, either before or after ... Chemical reaction; Ramachandran interaction; anisotropic and asymmetric polarization; ionization ..... man sequence exactly, including the generalized mech- ..... We now move on and rearrange Eq. (8) to arrive at.

  18. In North American energy markets : stronger credibility

    International Nuclear Information System (INIS)

    Lefevre, M.

    1997-01-01

    Hydro-Quebec''s competitive position as it expands and diversifies its business in the future was discussed. The utility has an outstanding debt of CAN$37 billion, nevertheless, it is considered to be a solid investment by financial experts. Hydro-Quebec is recognized as North America''s biggest electric utility in terms of sales and also has the lowest cost structure on the continent. Moody Investor Services, Duff and Phelps Credit Rating Co., and Standard and Poor, have recently conducted ratings of the utility''s standing on financial markets. Hydro-Quebec maintained their high ratings, of A2, AA-, and A+ respectively. The restructuring of North American electricity market gives Hydro-Quebec substantial growth potential. The utility has an extensive transmission network and can offer reasonable electricity rates

  19. Stronger links between CERN and South Africa

    CERN Multimedia

    Katarina Anthony

    2011-01-01

    iThemba LABS in South Africa is a research facility that, about twenty years ago, started to treat oncological patients with particle beams. Its collaboration with CERN has steadily grown over the years. After becoming a member of the ALICE and ATLAS Collaborations, today iThemba LABS is planning to buy a new medical-use cyclotron proton facility, and is seeking to strengthen its links with CERN and Europe also in this field by collaborating with ENLIGHT. The cyclotron will be dedicated to proton therapy – the only one of its kind in the southern hemisphere.   iThemba LABS (Laboratory for Accelerator Based Sciences) was established near Cape Town, South Africa almost 50 years ago as the continent's base for the Southern Universities Nuclear Institute that is now used mainly for material science research. In the 1980s, iThemba built a 200MeV cyclotron and, following its construction, in the early 1990s branched into a new scientific field: radiation and nuclear medicine. ...

  20. Advanced information technology: Building stronger databases

    Energy Technology Data Exchange (ETDEWEB)

    Price, D. [Lawrence Livermore National Lab., CA (United States)

    1994-12-01

    This paper discusses the attributes of the Advanced Information Technology (AIT) tool set, a database application builder designed at the Lawrence Livermore National Laboratory. AIT consists of a C library and several utilities that provide referential integrity across a database, interactive menu and field level help, and a code generator for building tightly controlled data entry support. AIT also provides for dynamic menu trees, report generation support, and creation of user groups. Composition of the library and utilities is discussed, along with relative strengths and weaknesses. In addition, an instantiation of the AIT tool set is presented using a specific application. Conclusions about the future and value of the tool set are then drawn based on the use of the tool set with that specific application.

  1. Minimal residual method stronger than polynomial preconditioning

    Energy Technology Data Exchange (ETDEWEB)

    Faber, V.; Joubert, W.; Knill, E. [Los Alamos National Lab., NM (United States)] [and others

    1994-12-31

    Two popular methods for solving symmetric and nonsymmetric systems of equations are the minimal residual method, implemented by algorithms such as GMRES, and polynomial preconditioning methods. In this study results are given on the convergence rates of these methods for various classes of matrices. It is shown that for some matrices, such as normal matrices, the convergence rates for GMRES and for the optimal polynomial preconditioning are the same, and for other matrices such as the upper triangular Toeplitz matrices, it is at least assured that if one method converges then the other must converge. On the other hand, it is shown that matrices exist for which restarted GMRES always converges but any polynomial preconditioning of corresponding degree makes no progress toward the solution for some initial error. The implications of these results for these and other iterative methods are discussed.

  2. The increase in medial prefrontal glutamate/glutamine concentration during memory encoding is associated with better memory performance and stronger functional connectivity in the human medial prefrontal-thalamus-hippocampus network.

    Science.gov (United States)

    Thielen, Jan-Willem; Hong, Donghyun; Rohani Rankouhi, Seyedmorteza; Wiltfang, Jens; Fernández, Guillén; Norris, David G; Tendolkar, Indira

    2018-06-01

    The classical model of the declarative memory system describes the hippocampus and its interactions with representational brain areas in posterior neocortex as being essential for the formation of long-term episodic memories. However, new evidence suggests an extension of this classical model by assigning the medial prefrontal cortex (mPFC) a specific, yet not fully defined role in episodic memory. In this study, we utilized 1H magnetic resonance spectroscopy (MRS) and psychophysiological interaction (PPI) analysis to lend further support for the idea of a mnemonic role of the mPFC in humans. By using MRS, we measured mPFC γ-aminobutyric acid (GABA) and glutamate/glutamine (GLx) concentrations before and after volunteers memorized face-name association. We demonstrate that mPFC GLx but not GABA levels increased during the memory task, which appeared to be related to memory performance. Regarding functional connectivity, we used the subsequent memory paradigm and found that the GLx increase was associated with stronger mPFC connectivity to thalamus and hippocampus for associations subsequently recognized with high confidence as opposed to subsequently recognized with low confidence/forgotten. Taken together, we provide new evidence for an mPFC involvement in episodic memory by showing a memory-related increase in mPFC excitatory neurotransmitter levels that was associated with better memory and stronger memory-related functional connectivity in a medial prefrontal-thalamus-hippocampus network. © 2018 The Authors Human Brain Mapping Published by Wiley Periodicals, Inc.

  3. Suppression of the lipopolysaccharide-induced expression of MARCKS-related protein (MRP) affects transmigration in activated RAW264.7 cells.

    Science.gov (United States)

    Chun, Kwang-Rok; Bae, Eun Mi; Kim, Jae-Kwan; Suk, Kyoungho; Lee, Won-Ha

    2009-01-01

    The molecular action mechanism of MRP, one of the protein kinase C (PKC) substrates, has been under intense investigation, but reports on its role in macrophage function remain controversial. The treatment of macrophage cell lines with bacterial lipopolysaccharide (LPS) induced a high level of MRP expression suggesting that MRP plays a role in the function of activated macrophages. In order to investigate the role of MRP in activated RAW264.7 cells, we stably transfected MRP-specific shRNA expression constructs and tested for alterations in macrophage-related functions. The down-regulation of MRP expression resulted in a marked reduction in chemotaxis toward MCP-1 or extracellular matrix proteins. Furthermore, pharmacological inhibitors of PKC significantly inhibited the chemotaxis in RAW264.7 cells. These data reveals the pivotal role of MRP in the transmigration of activated RAW264.7 cells.

  4. Bioactive leptin is stronger related to parameters of fat mass and distribution than conventionally measured leptin: Findings from a longitudinal study in obese children participating in a lifestyle intervention.

    Science.gov (United States)

    Niklowitz, Petra; Rothermel, Juliane; Lass, Nina; Barth, Andre; Reinehr, Thomas

    2018-05-01

    This study analyzed the relationships between bioactive leptin, conventionally measured leptin, and parameters of fat mass and distribution in obese children before and after weight reduction. We determined bioactive leptin (bioLep), conventional measured leptin (conLep), weight, height, body fat based on skinfold measurements and bioimpedance analyses, waist circumference (wc), and pubertal stage in 88 obese children participating in a lifestyle intervention at baseline and one year later. We identified no child with homozygous or heterozygous status for bioinactive leptin mutations. The baseline associations between bioLep and BMI (r = 0.53), BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.61, skinfold thickness: r = 0.49), wc (r = 0.42), and waist to height ratio (whr) (r = 0.39) were stronger than the associations between conLep and BMI (r = 0.50), BMI-SDS (r = 0.44), body fat (bioimpedance: r = 0.57, skinfold thickness: r = 0.41), wc (r = 0.41), and whr (r = 0.37). The changes of bioLep were stronger related to changes of BMI-SDS (r = 0.54), body fat (bioimpedance r = 0.59, skinfold thickness: r = 0.37), wc (r = 0.22), and whr (r = 0.21) than the associations between changes of conLep and changes of BMI-SDS (r = 0.48), body fat (bioimpedance: r = 0.56, skinfold thickness: r = 0.43), wc (r = 0.20), and whr (r = 0.20). The same findings were observed in multiple linear regression analyses adjusted to multiple confounders. In contrast to changes of conLep (r = 0.22), the changes of bioLep during intervention were not related to weight regain after the end of intervention. BioLep concentrations did not differ between prepubertal girls and boys, but were higher in pubertal girls compared to pubertal boys (p = 0.031). Bioactive leptin was stronger related to fat mass and distribution compared to conventionally measured leptin. Copyright © 2018 Elsevier B.V. All rights

  5. “Environmental Psychology” the mental benefits of physical activities in natural settings

    DEFF Research Database (Denmark)

    De Dominicis, Stefano

    2017-01-01

    Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising...

  6. Novel chemokine-like activities of histones in tumor metastasis.

    Science.gov (United States)

    Chen, Ruochan; Xie, Yangchun; Zhong, Xiao; Fu, Yongmin; Huang, Yan; Zhen, Yixiang; Pan, Pinhua; Wang, Haichao; Bartlett, David L; Billiar, Timothy R; Lotze, Michael T; Zeh, Herbert J; Fan, Xue-Gong; Tang, Daolin; Kang, Rui

    2016-09-20

    Histones are intracellular nucleosomal components and extracellular damage-associated molecular pattern molecules that modulate chromatin remodeling, as well as the immune response. However, their extracellular roles in cell migration and invasion remain undefined. Here, we demonstrate that histones are novel regulators of tumor metastasis with chemokine-like activities. Indeed, exogenous histones promote both hepatocellular carcinoma (HCC) cell migration and invasion through toll-like receptor (TLR)4, but not TLR2 or the receptor for advanced glycosylation end product. TLR4-mediated activation of nuclear factor-κB (NF-κB) by extracellular signal-regulated kinase (ERK) is required for histone-induced chemokine (e.g., C-C motif ligand 9/10) production. Pharmacological and genetic inhibition of TLR4-ERK-NF-κB signaling impairs histone-induced chemokine production and HCC cell migration. Additionally, TLR4 depletion (by using TLR4-/- mice and TLR4-shRNA) or inhibition of histone release/activity (by administration of heparin and H3 neutralizing antibody) attenuates lung metastasis of HCC cells injected via the tail vein of mice. Thus, histones promote tumor metastasis of HCC cells through the TLR4-NF-κB pathway and represent novel targets for treating patients with HCC.

  7. Activation of the TXNIP/NLRP3 inflammasome pathway contributes to inflammation in diabetic retinopathy: a novel inhibitory effect of minocycline.

    Science.gov (United States)

    Chen, Wei; Zhao, Minjie; Zhao, Shuzhi; Lu, Qianyi; Ni, Lisha; Zou, Chen; Lu, Li; Xu, Xun; Guan, Huaijin; Zheng, Zhi; Qiu, Qinghua

    2017-02-01

    Chronic low-grade inflammation occurs in diabetic retinopathy (DR), but the underlying mechanism(s) remains (remain) unclear. NLRP3 inflammasome activation is involved in several other inflammatory diseases. Thus, we investigated the role of the NLRP3 inflammasome signaling pathway in the pathogenesis of DR. Diabetes was induced in rats by streptozotocin treatment for 8 weeks. They were treated with NLRP3 shRNA or minocycline during the last 4 weeks. High glucose-exposed human retinal microvascular endothelial cells (HRMECs) were co-incubated with antioxidants or subjected to TXNIP or NLRP3 shRNA interference. In high glucose-exposed HRMECs and retinas of diabetic rats, mRNA and protein expression of NLRP3, ASC, and proinflammatory cytokines were induced significantly by hyperglycemia. Upregulated interleukin (IL)-1β maturation, IL-18 secretion, and caspase-1 cleavage were also observed with increased cell apoptosis and retinal vascular permeability, compared with the control group. NLRP3 silencing blocked these effects in the rat model and HRMECs, confirming that inflammasome activation contributed to inflammation in DR. TXNIP expression was increased by reactive oxygen species (ROS) overproduction in animal and cell models, whereas antioxidant addition or TXNIP silencing blocked IL-1β and IL-18 secretion in high glucose-exposed HRMECs, indicating that the ROS-TXNIP pathway mediates NLRP3 inflammasome activation. Minocycline significantly downregulated ROS generation and reduced TXNIP expression, subsequently inhibited NLRP3 activation, and further decreased inflammatory factors, which were associated with a decrease in retinal vascular permeability and cell apoptosis. Together, our data suggest that the TXNIP/NLRP3 pathway is a potential therapeutic target for the treatment of DR, and the use of minocycline specifically for such therapy may be a new avenue of investigation in inflammatory disease.

  8. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ

    Directory of Open Access Journals (Sweden)

    Pingping Xia

    2018-03-01

    Full Text Available Background/Aims: Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. Methods: The cerebral injury was established by middle cerebral artery occlusion (MCAO. in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD. ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. Results: We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO. Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. Conclusion: The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling

  9. Pioglitazone Confers Neuroprotection Against Ischemia-Induced Pyroptosis due to its Inhibitory Effects on HMGB-1/RAGE and Rac1/ROS Pathway by Activating PPAR-ɤ.

    Science.gov (United States)

    Xia, Pingping; Pan, Yundan; Zhang, Fan; Wang, Na; Wang, E; Guo, Qulian; Ye, Zhi

    2018-01-01

    Recent researches highlighted the protective potential of pioglitazone, a PPAR-γ agonist, in the progression of cerebral ischemia-reperfusion injury. However, there has been no study on the application of pioglitazone in treating ischemic stroke through mechanisms involving pyroptosis. The cerebral injury was established by middle cerebral artery occlusion (MCAO). in vitro ischemia in primary cultured astrocytes was induced by the oxygen-glucose deprivation (OGD). ELISA and Western Blot analysis were employed to the levels of PPAR-γ, pyroptosis-related biomarkers and cytoplasmic translocation of HMGB-1 and RAGE expression as well as Rac1 activity, respectively. We demonstrated that repeated intraperitoneal administration of pioglitazone remarkably reduced the infarct volume, improved neurological deficits and suppressed the Rac1 activity with significant reduction of excessive ROS in rat model of middle cerebral artery occlusion (MCAO). Moreover, pioglitazone alleviated the up-regulation of pyroptosis-related biomarkers and the increased cytoplasmic translocation of HMGB-1 and RAGE expression in cerebral penumbra cortex. Similarly, the protective effects of pioglitazone on cultured astrocytes were characterized by reduced Rac1 activity, pyroptosis related protein expressions and lactate dehydrogenase (LDH) release. However, these protective effects of pioglitazone were neutralized with the use of GW9662, a PPAR-γ inhibitor. Interestingly, Rac1 knockdown in lentivirus with the Rac1 small hair RNA (shRNA) could inhibit the OGD-induced pyroptosis of primary cultured astrocytes. Furthermore, the combination of Rac1-shRNA and pioglitazone can further strengthen the inhibitory effects on pyroptosis induced by OGD. The neuroprotection of pioglitazone was attributable to the alleviated ischemia/hypoxia-induced pyroptosis and was also associated with the PPARγ-mediated suppression of HGMB-1/RAGE signaling pathway. Moreover, the inhibition of Rac1 promoted this function

  10. mTOR inhibition sensitizes ONC201-induced anti-colorectal cancer cell activity.

    Science.gov (United States)

    Jin, Zhe-Zhu; Wang, Wei; Fang, Di-Long; Jin, Yong-Jun

    2016-09-30

    We here tested the anti-colorectal cancer (CRC) activity by a first-in-class small molecule TRAIL inducer ONC201. The potential effect of mTOR on ONC201's actions was also examined. ONC201 induced moderate cytotoxicity against CRC cell lines (HT-29, HCT-116 and DLD-1) and primary human CRC cells. Significantly, AZD-8055, a mTOR kinase inhibitor, sensitized ONC201-induced cytotoxicity in CRC cells. Meanwhile, ONC201-induced TRAIL/death receptor-5 (DR-5) expression, caspase-8 activation and CRC cell apoptosis were also potentiated with AZD-8055 co-treatment. Reversely, TRAIL sequestering antibody RIK-2 or the caspase-8 specific inhibitor z-IETD-fmk attenuated AZD-8055 plus ONC201-induced CRC cell death. Further, mTOR kinase-dead mutation (Asp-2338-Ala) or shRNA knockdown significantly sensitized ONC201's activity in CRC cells, leading to profound cell death and apoptosis. On the other hand, expression of a constitutively-active S6K1 (T389E) attenuated ONC201-induced CRC cell apoptosis. For the mechanism study, we showed that ONC201 blocked Akt, but only slightly inhibited mTOR in CRC cells. Co-treatment with AZD-8055 also concurrently blocked mTOR activation. These results suggest that mTOR could be a primary resistance factor of ONC201 in CRC cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. The NOD2 p.Leu1007fsX1008 mutation (rs2066847 is a stronger predictor of the clinical course of Crohn's disease than the FOXO3A intron variant rs12212067.

    Directory of Open Access Journals (Sweden)

    Fabian Schnitzler

    Full Text Available Very recently, a sub-analysis of genome-wide association scans revealed that the non-coding single nucleotide polymorphism (SNP rs12212067 in the FOXO3A gene is associated with a milder course of Crohn's disease (CD (Cell 2013;155:57-69. The aim of our study was to evaluate the clinical value of the SNP rs12212067 in predicting the severity of CD by correlating CD patient genotype status with the most relevant complications of CD such as stenoses, fistulas, and CD-related surgery.We genotyped 550 CD patients for rs12212067 (FOXO3A and the three common CD-associated NOD2 mutations rs2066844, rs2066847, and rs2066847 and performed genotype-phenotype analyses.No significant phenotypic differences were found between the wild-type genotype TT of the FOXO3A SNP rs12212067 and the minor genotypes TG and GG independently from NOD2 variants. The allele frequency of the minor G allele was 12.7%. Age at diagnosis, disease duration, body mass index, surgery rate, stenoses, fistula, need for immunosuppressive therapy, and disease course were not significantly different. In contrast, the NOD2 mutant p.Leu1007fsX1008 (rs2066847 was highly associated with penetrating CD (p = 0.01, the development of fistulas (p = 0.01 and stenoses (p = 0.01, and ileal disease localization (p = 0.03. Importantly, the NOD2 SNP rs2066847 was a strong separator between an aggressive and a mild course of CD (p = 2.99×10(-5, while the FOXO3A SNP rs12212067 did not separate between mild and aggressive CD behavior in our cohort (p = 0.35. 96.2% of the homozygous NOD2 p.Leu1007fsX1008 carriers had an aggressive disease behavior compared to 69.3% of the patients with the NOD2 wild-type genotype (p = 0.007.In clinical practice, the NOD2 variant p.Leu1007fsX1008 (rs2066847, in particular in homozygous form, is a much stronger marker for a severe clinical phenotype than the FOXO3A rs12212067 SNP for a mild disease course on an individual patient level despite

  12. The NOD2 p.Leu1007fsX1008 mutation (rs2066847) is a stronger predictor of the clinical course of Crohn's disease than the FOXO3A intron variant rs12212067.

    Science.gov (United States)

    Schnitzler, Fabian; Friedrich, Matthias; Wolf, Christiane; Angelberger, Marianne; Diegelmann, Julia; Olszak, Torsten; Beigel, Florian; Tillack, Cornelia; Stallhofer, Johannes; Göke, Burkhard; Glas, Jürgen; Lohse, Peter; Brand, Stephan

    2014-01-01

    Very recently, a sub-analysis of genome-wide association scans revealed that the non-coding single nucleotide polymorphism (SNP) rs12212067 in the FOXO3A gene is associated with a milder course of Crohn's disease (CD) (Cell 2013;155:57-69). The aim of our study was to evaluate the clinical value of the SNP rs12212067 in predicting the severity of CD by correlating CD patient genotype status with the most relevant complications of CD such as stenoses, fistulas, and CD-related surgery. We genotyped 550 CD patients for rs12212067 (FOXO3A) and the three common CD-associated NOD2 mutations rs2066844, rs2066847, and rs2066847 and performed genotype-phenotype analyses. No significant phenotypic differences were found between the wild-type genotype TT of the FOXO3A SNP rs12212067 and the minor genotypes TG and GG independently from NOD2 variants. The allele frequency of the minor G allele was 12.7%. Age at diagnosis, disease duration, body mass index, surgery rate, stenoses, fistula, need for immunosuppressive therapy, and disease course were not significantly different. In contrast, the NOD2 mutant p.Leu1007fsX1008 (rs2066847) was highly associated with penetrating CD (p = 0.01), the development of fistulas (p = 0.01) and stenoses (p = 0.01), and ileal disease localization (p = 0.03). Importantly, the NOD2 SNP rs2066847 was a strong separator between an aggressive and a mild course of CD (p = 2.99×10(-5)), while the FOXO3A SNP rs12212067 did not separate between mild and aggressive CD behavior in our cohort (p = 0.35). 96.2% of the homozygous NOD2 p.Leu1007fsX1008 carriers had an aggressive disease behavior compared to 69.3% of the patients with the NOD2 wild-type genotype (p = 0.007). In clinical practice, the NOD2 variant p.Leu1007fsX1008 (rs2066847), in particular in homozygous form, is a much stronger marker for a severe clinical phenotype than the FOXO3A rs12212067 SNP for a mild disease course on an individual patient level despite its

  13. Protein phosphatase 5 promotes hepatocarcinogenesis through interaction with AMP-activated protein kinase.

    Science.gov (United States)

    Chen, Yao-Li; Hung, Man-Hsin; Chu, Pei-Yi; Chao, Tzu-I; Tsai, Ming-Hsien; Chen, Li-Ju; Hsiao, Yung-Jen; Shih, Chih-Ting; Hsieh, Feng-Shu; Chen, Kuen-Feng

    2017-08-15

    The serine-threonine protein phosphatase family members are known as critical regulators of various cellular functions, such as survival and transformation. Growing evidence suggests that pharmacological manipulation of phosphatase activity exhibits therapeutic benefits. Ser/Thr protein phosphatase 5 (PP5) is known to participate in glucocorticoid receptor (GR) and stress-induced signaling cascades that regulate cell growth and apoptosis, and has been shown to be overexpressed in various human malignant diseases. However, the role of PP5 in hepatocellular carcinoma (HCC) and whether PP5 may be a viable therapeutic target for HCC treatment are unknown. Here, by analyzing HCC clinical samples obtained from 215 patients, we found that overexpression of PP5 is tumor specific and associated with worse clinical outcomes. We further characterized the oncogenic properties of PP5 in HCC cells. Importantly, both silencing of PP5 with lentiviral-mediated short hairpin RNA (shRNA) and chemical inhibition of PP5 phosphatase activity using the natural compound cantharidin/norcantharidin markedly suppressed the growth of HCC cells and tumors in vitro and in vivo. Moreover, we identified AMP-activated protein kinase (AMPK) as a novel downstream target of oncogenic PP5 and demonstrated that the antitumor mechanisms underlying PP5 inhibition involve activation of AMPK signaling. Overall, our results establish a pathological function of PP5 in hepatocarcinogenesis via affecting AMPK signaling and suggest that PP5 inhibition is an attractive therapeutic approach for HCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. The C-type lectin OCILRP2 costimulates EL4 T cell activation via the DAP12-Raf-MAP kinase pathway.

    Science.gov (United States)

    Lou, Qiang; Zhang, Wei; Liu, Guangchao; Ma, Yuanfang

    2014-01-01

    OCILRP2 is a typical Type-II transmembrane protein that is selectively expressed in activated T lymphocytes, dendritic cells, and B cells and functions as a novel co-stimulator of T cell activation. However, the signaling pathways underlying OCILRP2 in T cell activation are still not completely understood. In this study, we found that the knockdown of OCILRP2 expression with shRNA or the blockage of its activity by an anti-OCILRP2 antagonist antibody reduced CD3/CD28-costimulated EL4 T cell viability and IL-2 production, inhibit Raf1, MAPK3, and MAPK8 activation, and impair NFAT and NF-κB transcriptional activities. Furthermore, immunoprecipitation results indicated that OCILRP2 could interact with the DAP12 protein, an adaptor containing an intracellular ITAM motif that can transduce signals to induce MAP kinase activation for T cell activation. Our data reveal that after binding with DAP12, OCILRP2 activates the Raf-MAP kinase pathways, resulting in T cell activation.

  15. The C-type lectin OCILRP2 costimulates EL4 T cell activation via the DAP12-Raf-MAP kinase pathway.

    Directory of Open Access Journals (Sweden)

    Qiang Lou

    Full Text Available OCILRP2 is a typical Type-II transmembrane protein that is selectively expressed in activated T lymphocytes, dendritic cells, and B cells and functions as a novel co-stimulator of T cell activation. However, the signaling pathways underlying OCILRP2 in T cell activation are still not completely understood. In this study, we found that the knockdown of OCILRP2 expression with shRNA or the blockage of its activity by an anti-OCILRP2 antagonist antibody reduced CD3/CD28-costimulated EL4 T cell viability and IL-2 production, inhibit Raf1, MAPK3, and MAPK8 activation, and impair NFAT and NF-κB transcriptional activities. Furthermore, immunoprecipitation results indicated that OCILRP2 could interact with the DAP12 protein, an adaptor containing an intracellular ITAM motif that can transduce signals to induce MAP kinase activation for T cell activation. Our data reveal that after binding with DAP12, OCILRP2 activates the Raf-MAP kinase pathways, resulting in T cell activation.

  16. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  17. shRNA screening identifies JMJD1C as being required for leukemia maintenance

    DEFF Research Database (Denmark)

    Sroczynska, Patrycja; Cruickshank, V Adam; Bukowski, John-Paul

    2014-01-01

    Epigenetic regulatory mechanisms are implicated in the pathogenesis of acute myeloid and lymphoid leukemia (AML and ALL). Recent progress suggests that proteins involved in epigenetic control are amenable to drug intervention, but little is known about the cancer-specific dependency on epigenetic...... candidate drug targets identified in these screens was Jmjd1c. Depletion of Jmjd1c impairs growth and colony formation of mouse MLL-AF9 cells in vitro, as well as establishment of leukemia after transplantation. Depletion of JMJD1C impairs expansion and colony formation of human leukemic cell lines......, with the strongest effect observed in the MLL-rearranged ALL cell line, SEM. In both mouse and human leukemic cells, the growth defect upon JMJD1C depletion appears to be primarily due to increased apoptosis, which implicates JMJD1C as a potential therapeutic target in leukemia....

  18. Apolipoprotein B knockdown by AAV-delivered shRNA lowers plasma cholesterol in mice

    NARCIS (Netherlands)

    Koornneef, Annemart; Maczuga, Piotr; van Logtenstein, Richard; Borel, Florie; Blits, Bas; Ritsema, Tita; van Deventer, Sander; Petry, Harald; Konstantinova, Pavlina

    2011-01-01

    Serum low-density lipoprotein cholesterol (LDL-C) levels are proportionate to the risk of atherosclerotic cardiovascular disease. In order to reduce serum total cholesterol and LDL-C levels in mice, RNA interference (RNAi) was used to inhibit expression of the structural protein of LDL-C,

  19. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    AJL

    2011-02-14

    Feb 14, 2011 ... construct itself or its delivery vehicle (Rao et al., 2009). Through choosing ... Cell culture, transfection and intramuscular injection. MEFs were isolated ..... A system for stable expression of ... Adv. Drug Deliv. Rev. 61: 746-759.

  20. Antioxidant activity of Vitex agnus-castus L. extracts.

    Science.gov (United States)

    Sağlam, Hüsniye; Pabuçcuoğlu, Aysun; Kivçak, Bijen

    2007-11-01

    The ethanol, n-hexane and water extracts of Vitex agnus-castus L. leaves and fruits were screened for antioxidant activity. The antioxidant activity of plant extracts was determined by an improved assay based on the decolorization of the radical monocation of 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS.+). The water and ethanol extracts showed stronger antioxidant activity than the n-hexane extracts. Copyright (c) 2007 John Wiley & Sons, Ltd.

  1. Detection of Extracellular Enzyme Activities in Ganoderma neo-japonicum

    OpenAIRE

    Jo, Woo-Sik; Park, Ha-Na; Cho, Doo-Hyun; Yoo, Young-Bok; Park, Seung-Chun

    2011-01-01

    The ability of Ganoderma to produce extracellular enzymes, including β-glucosidase, cellulase, avicelase, pectinase, xylanase, protease, amylase, and ligninase was tested in chromogenic media. β-glucosidase showed the highest activity, among the eight tested enzymes. In particular, Ganoderma neo-japonicum showed significantly stronger activity for β-glucosidase than that of the other enzymes. Two Ganoderma lucidum isolates showed moderate activity for avicelase; however, Ganoderma neo-japonic...

  2. Activation of the PI3K/AKT pathway in Merkel cell carcinoma.

    Directory of Open Access Journals (Sweden)

    Christian Hafner

    Full Text Available Merkel cell carcinoma (MCC is a highly aggressive skin cancer with an increasing incidence. The understanding of the molecular carcinogenesis of MCC is limited. Here, we scrutinized the PI3K/AKT pathway, one of the major pathways activated in human cancer, in MCC. Immunohistochemical analysis of 41 tumor tissues and 9 MCC cell lines revealed high levels of AKT phosphorylation at threonine 308 in 88% of samples. Notably, the AKT phosphorylation was not correlated with the presence or absence of the Merkel cell polyoma virus (MCV. Accordingly, knock-down of the large and small T antigen by shRNA in MCV positive MCC cells did not affect phosphorylation of AKT. We also analyzed 46 MCC samples for activating PIK3CA and AKT1 mutations. Oncogenic PIK3CA mutations were found in 2/46 (4% MCCs whereas mutations in exon 4 of AKT1 were absent. MCC cell lines demonstrated a high sensitivity towards the PI3K inhibitor LY-294002. This finding together with our observation that the PI3K/AKT pathway is activated in the majority of human MCCs identifies PI3K/AKT as a potential new therapeutic target for MCC patients.

  3. Activation mechanism of ammonium ions on sulfidation of malachite (-201) surface by DFT study

    Science.gov (United States)

    Wu, Dandan; Mao, Yingbo; Deng, Jiushuai; Wen, Shuming

    2017-07-01

    The activation mechanism of ammonium ions on the sulfidation of malachite (-201) was determined by density functional theory (DFT) calculations. Results of DFT calculations indicated that interlayer sulfidation occurs during the sulfidation process of malachite (-201). The absorption of both the ammonium ion and sulfide ion on the malachite (-201) surface is stronger than that of sulfur ion. After sulfidation was activated with ammonium ion, the Cu 3d orbital peak is closer to the Fermi level and characterized by a stronger peak value. Therefore, the addition of ammonium ions activated the sulfidation of malachite (-201), thereby improving the flotation performance.

  4. Cleaved CD147 shed from the surface of malignant melanoma cells activates MMP2 produced by fibroblasts.

    Science.gov (United States)

    Hatanaka, Miho; Higashi, Yuko; Fukushige, Tomoko; Baba, Naoko; Kawai, Kazuhiro; Hashiguchi, Teruto; Su, Juan; Zeng, Weiqi; Chen, Xiang; Kanekura, Takuro

    2014-12-01

    Cluster of differentiation 147 (CD147)/basigin on the malignant tumor cell surface is critical for tumor proliferation, invasiveness, metastasis, and angiogenesis. CD147 expressed on malignant melanoma cells can induce tumor cell invasion by stimulating the production of matrix metalloproteinases (MMPs) by surrounding fibroblasts. Membrane vesicles, microvesicles and exosomes have attracted attention, as vehicles of functional molecules and their association with CD147 has been reported. Cleaved CD147 fragments released from tumor cells were reported to interact with fibroblasts. We investigated the intercellular mechanisms by which CD147 stimulates fibroblasts to induce MMP2 activity. CD147 was knocked-down using short hairpin RNA (shRNA). The stimulatory effect of CD147 in cell culture supernatants, microvesicles, and exosomes on the enzymatic activity of MMP2 was examined by gelatin zymography. Supernatants from A375 control cells induced increased enzymatic activity of fibroblasts; such activity was significantly lower in CD147 knock-down cells. Cleaved CD147 plays a pivotal role in stimulating fibroblasts to induce MMP2 activity. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. ANCCLI. 2014 activity report

    International Nuclear Information System (INIS)

    2015-01-01

    After a presentation of some key figures regarding the ANCCLI (the national association of local information committees) activities for 2014, and a speech made by its chairman during the 2014 CLIs' conference, this report proposes an overview of main actions undertaken in 2014: a new communication strategy, proposals for the bill project on energy transition, audit and hearing by the French Parliament, action for the development of CLIs' citizen expertise). It gives an overview of works performed by its different bodies (its scientific committee, the task officers' club, and the different permanent groups). It presents the different partnerships: participation to initiatives launched by the ASN, a stronger collaboration with the IRSN, partnership with ministries and with the HCTISN or High committee for transparency and information on nuclear safety. Meetings, publications and communication actions are indicated, as well as the participation to European initiatives (notably the ACN process)

  6. Troglitazone suppresses telomerase activity independently of PPARγ in estrogen-receptor negative breast cancer cells

    International Nuclear Information System (INIS)

    Rashid-Kolvear, Fariborz; Taboski, Michael AS; Nguyen, Johnny; Wang, Dong-Yu; Harrington, Lea A; Done, Susan J

    2010-01-01

    Breast cancer is one the highest causes of female cancer death worldwide. Many standard chemotherapeutic agents currently used to treat breast cancer are relatively non-specific and act on all rapidly dividing cells. In recent years, more specific targeted therapies have been introduced. It is known that telomerase is active in over 90% of breast cancer tumors but inactive in adjacent normal tissues. The prevalence of active telomerase in breast cancer patients makes telomerase an attractive therapeutic target. Recent evidence suggests that telomerase activity can be suppressed by peroxisome proliferator activated receptor gamma (PPARγ). However, its effect on telomerase regulation in breast cancer has not been investigated. In this study, we investigated the effect of the PPARγ ligand, troglitazone, on telomerase activity in the MDA-MB-231 breast cancer cell line. Real time RT-PCR and telomerase activity assays were used to evaluate the effect of troglitazone. MDA-MB-231 cells had PPARγ expression silenced using shRNA interference. We demonstrated that troglitazone reduced the mRNA expression of hTERT and telomerase activity in the MDA-MB-231 breast cancer cell line. Troglitazone reduced telomerase activity even in the absence of PPARγ. In agreement with this result, we found no correlation between PPARγ and hTERT mRNA transcript levels in breast cancer patients. Statistical significance was determined using Pearson correlation and the paired Student's t test. To our knowledge, this is the first time that the effect of troglitazone on telomerase activity in breast cancer cells has been investigated. Our data suggest that troglitazone may be used as an anti-telomerase agent; however, the mechanism underlying this inhibitory effect remains to be determined

  7. Ebselen inhibits QSOX1 enzymatic activity and suppresses invasion of pancreatic and renal cancer cell lines.

    Science.gov (United States)

    Hanavan, Paul D; Borges, Chad R; Katchman, Benjamin A; Faigel, Douglas O; Ho, Thai H; Ma, Chen-Ting; Sergienko, Eduard A; Meurice, Nathalie; Petit, Joachim L; Lake, Douglas F

    2015-07-30

    Quiescin sulfhydryl oxidase 1 (QSOX1) is a highly conserved disulfide bond-generating enzyme that is overexpressed in diverse tumor types. Its enzymatic activity promotes the growth and invasion of tumor cells and alters extracellular matrix composition. In a nude mouse-human tumor xenograft model, tumors containing shRNA for QSOX1 grew significantly more slowly than controls, suggesting that QSOX1 supports a proliferative phenotype in vivo. High throughput screening experiments identified ebselen as an in vitro inhibitor of QSOX1 enzymatic activity. Ebselen treatment of pancreatic and renal cancer cell lines stalled tumor growth and inhibited invasion through Matrigel in vitro. Daily oral treatment with ebselen resulted in a 58% reduction in tumor growth in mice bearing human pancreatic tumor xenografts compared to controls. Mass spectrometric analysis of ebselen-treated QSOX1 mechanistically revealed that C165 and C237 of QSOX1 covalently bound to ebselen. This report details the anti-neoplastic properties of ebselen in pancreatic and renal cancer cell lines. The results here offer a "proof-of-principle" that enzymatic inhibition of QSOX1 may have clinical relevancy.

  8. Do associations between objectively-assessed physical activity and neighbourhood environment attributes vary by time of the day and day of the week?

    DEFF Research Database (Denmark)

    Cerin, Ester; Mitáš, Josef; Cain, Kelli L

    2017-01-01

    , intersection density and land use mix were stronger in the mornings of weekdays and the afternoon/evening periods of both weekdays and weekend days. Associations between number of parks and MVPA were stronger in the mornings and afternoon/evenings irrespective of day of the week. Public transport density...... showed consistent positive associations with MVPA during weekends, while stronger effects on weekdays were observed in the morning and early evenings. CONCLUSIONS: This study suggests that space and time constraints in adults' daily activities are important factors that determine the impact...

  9. Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

    Directory of Open Access Journals (Sweden)

    You Mie Lee

    Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

  10. Synthesis and anti-inflammatory activity of phenylbutenoid dimer analogs

    International Nuclear Information System (INIS)

    Kim, Sung Soo; Fang, Yuan Ying; Park, Hae Eil

    2015-01-01

    Several phenylbutenoid dimer (PBD) analogs were synthesized and evaluated for their inhibitory activities against nitric oxide (NO) production and TNF-α release. The PBD analogs were synthesized via Diels–Alder and subsequent Schlosser reactions as key steps. Among the tested compounds, two analogs (8c, 8f) exhibited much stronger inhibitory activity against LPS-stimulated NO production and TNF-α release in RAW 264.7 cells than that of wogonin

  11. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    International Nuclear Information System (INIS)

    Wang, Bing; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-01-01

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells

  12. Belinostat-induced apoptosis and growth inhibition in pancreatic cancer cells involve activation of TAK1-AMPK signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bing, E-mail: wangbin69@yahoo.com; Wang, Xin-bao; Chen, Li-yu; Huang, Ling; Dong, Rui-zen

    2013-07-19

    Highlights: •Belinostat activates AMPK in cultured pancreatic cancer cells. •Activation of AMPK is important for belinostat-induced cytotoxic effects. •ROS and TAK1 are involved in belinostat-induced AMPK activation. •AMPK activation mediates mTOR inhibition by belinostat. -- Abstract: Pancreatic cancer accounts for more than 250,000 deaths worldwide each year. Recent studies have shown that belinostat, a novel pan histone deacetylases inhibitor (HDACi) induces apoptosis and growth inhibition in pancreatic cancer cells. However, the underlying mechanisms are not fully understood. In the current study, we found that AMP-activated protein kinase (AMPK) activation was required for belinostat-induced apoptosis and anti-proliferation in PANC-1 pancreatic cancer cells. A significant AMPK activation was induced by belinostat in PANC-1 cells. Inhibition of AMPK by RNAi knockdown or dominant negative (DN) mutation significantly inhibited belinostat-induced apoptosis in PANC-1 cells. Reversely, AMPK activator AICAR and A-769662 exerted strong cytotoxicity in PANC-1 cells. Belinostat promoted reactive oxygen species (ROS) production in PANC-1 cells, increased ROS induced transforming growth factor-β-activating kinase 1 (TAK1)/AMPK association to activate AMPK. Meanwhile, anti-oxidants N-Acetyl-Cysteine (NAC) and MnTBAP as well as TAK1 shRNA knockdown suppressed belinostat-induced AMPK activation and PANC-1 cell apoptosis. In conclusion, we propose that belinostat-induced apoptosis and growth inhibition require the activation of ROS-TAK1-AMPK signaling axis in cultured pancreatic cancer cells.

  13. Protein kinase C-α signals P115RhoGEF phosphorylation and RhoA activation in TNF-α-induced mouse brain microvascular endothelial cell barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Deng Xiaolu

    2011-04-01

    Full Text Available Abstract Background Tumor necrosis factor-α (TNF-α, a proinflammatory cytokine, is capable of activating the small GTPase RhoA, which in turn contributes to endothelial barrier dysfunction. However, the underlying signaling mechanisms remained undefined. Therefore, we aimed to determine the role of protein kinase C (PKC isozymes in the mechanism of RhoA activation and in signaling TNF-α-induced mouse brain microvascular endothelial cell (BMEC barrier dysfunction. Methods Bend.3 cells, an immortalized mouse brain endothelial cell line, were exposed to TNF-α (10 ng/mL. RhoA activity was assessed by pull down assay. PKC-α activity was measured using enzyme assasy. BMEC barrier function was measured by transendothelial electrical resistance (TER. p115RhoGEF phosphorylation was detected by autoradiography followed by western blotting. F-actin organization was observed by rhodamine-phalloidin staining. Both pharmacological inhibitors and knockdown approaches were employed to investigate the role of PKC and p115RhoGEF in TNF-α-induced RhoA activation and BMEC permeability. Results We observed that TNF-α induces a rapid phosphorylation of p115RhoGEF, activation of PKC and RhoA in BMECs. Inhibition of conventional PKC by Gö6976 mitigated the TNF-α-induced p115RhoGEF phosphorylation and RhoA activation. Subsequently, we found that these events are regulated by PKC-α rather than PKC-β by using shRNA. In addition, P115-shRNA and n19RhoA (dominant negative mutant of RhoA transfections had no effect on mediating TNF-α-induced PKC-α activation. These data suggest that PKC-α but not PKC-β acts as an upstream regulator of p115RhoGEF phosphorylation and RhoA activation in response to TNF-α. Moreover, depletion of PKC-α, of p115RhoGEF, and inhibition of RhoA activation also prevented TNF-α-induced stress fiber formation and a decrease in TER. Conclusions Taken together, our results show that PKC-α phosphorylation of p115RhoGEF mediates TNF

  14. Hypoxic activation of the unfolded protein response (UPR) induces expression of the metastasis-associated gene LAMP3

    International Nuclear Information System (INIS)

    Mujcic, Hilda; Rzymski, Tomasz; Rouschop, Kasper M.A.; Koritzinsky, Marianne; Milani, Manuela; Harris, Adrian L.; Wouters, Bradly G.

    2009-01-01

    Background and purpose: Tumour hypoxia contributes to failure of cancer treatment through its ability to protect against therapy and adversely influence tumour biology. In particular, several studies suggest that hypoxia promotes metastasis. Hypoxia-induced cellular changes are mediated by oxygen-sensitive signaling pathways that activate downstream transcription factors. We have investigated the induction and transcriptional regulation of a novel metastasis-associated gene, LAMP3 during hypoxia. Materials and methods: Microarray, quantitative PCR, Western blot analysis and immunohistochemistry were used to investigate hypoxic regulation of LAMP3. The mechanism for LAMP3 induction was investigated using transient RNAi and stable shRNA targeting components of the hypoxic response. Endoplasmic reticulum stress inducing agents, including proteasome inhibitors were assessed for their ability to regulate LAMP3. Results: LAMP3 is strongly induced by hypoxia at both the mRNA and protein levels in a large panel of human tumour cell lines. Induction of LAMP3 occurs as a consequence of the activation of the PERK/eIF2α/ATF4 arm of the unfolded protein response (UPR) and is independent of HIF-1α. LAMP3 is expressed heterogeneously within the microenvironment of tumours, overexpressed in breast cancer, and increases in tumours treated with avastin. Conclusions: These data identify LAMP3 as a novel hypoxia-inducible gene regulated by the UPR. LAMP3 is a new candidate biomarker of UPR activation by hypoxia in tumours and is a potential mediator of hypoxia-induced metastasis.

  15. GSK621 activates AMPK signaling to inhibit LPS-induced TNFα production

    International Nuclear Information System (INIS)

    Wu, Yong-hong; Li, Quan; Li, Ping; Liu, Bei

    2016-01-01

    LPS stimulation in macrophages/monocytes induces TNFα production. We here tested the potential effect of GSK621, a novel AMP-activated protein kinase (AMPK) activator, against the process. In RAW264.7 macrophages, murine bone marrow-derived macrophages (BMDMs), and chronic obstructive pulmonary disease (COPD) patients' monocytes, GSK621 significantly inhibited LPS-induced TNFα protein secretion and mRNA synthesis. Inhibition of AMPK, through AMPKα shRNA knockdown or dominant negative mutation (T172A), almost abolished GSK621's suppression on TNFα in RAW264.7 cells. Reversely, forced-expression of a constitutively-active AMPKα (T172D) mimicked GSK621 actions and reduced LPS-induced TNFα production. Molecularly, GSK621 suppressed LPS-induced reactive oxygen species (ROS) production and nuclear factor kappa B (NFκB) activation. In vivo, GSK621 oral administration inhibited LPS-induced TNFα production and endotoxin shock in mice. In summary, GSK621 activates AMPK signaling to inhibit LPS-induced TNFα production in macrophages/monocytes. - Highlights: • GSK621 inhibits LPS-induced TNFα production/expression in RAW264.7 cells and BMDMs. • GSK621 inhibits LPS-induced TNFα production/expression in COPD patients' PBMCs. • GSK621's inhibition on TNFα production by LPS requires AMPK activation. • GSK621 inhibits LPS-induced ROS production and NFκB activation, dependent on AMPK. • GSK621 oral administration inhibits LPS-induced TNFα production and endotoxin shock in mice.

  16. Adaptor protein GRB2 promotes Src tyrosine kinase activation and podosomal organization by protein-tyrosine phosphatase ϵ in osteoclasts.

    Science.gov (United States)

    Levy-Apter, Einat; Finkelshtein, Eynat; Vemulapalli, Vidyasiri; Li, Shawn S-C; Bedford, Mark T; Elson, Ari

    2014-12-26

    The non-receptor isoform of protein-tyrosine phosphatase ϵ (cyt-PTPe) supports adhesion of bone-resorbing osteoclasts by activating Src downstream of integrins. Loss of cyt-PTPe reduces Src activity in osteoclasts, reduces resorption of mineralized matrix both in vivo and in cell culture, and induces mild osteopetrosis in young female PTPe KO mice. Activation of Src by cyt-PTPe is dependent upon this phosphatase undergoing phosphorylation at its C-terminal Tyr-638 by partially active Src. To understand how cyt-PTPe activates Src, we screened 73 Src homology 2 (SH2) domains for binding to Tyr(P)-638 of cyt-PTPe. The SH2 domain of GRB2 bound Tyr(P)-638 of cyt-PTPe most prominently, whereas the Src SH2 domain did not bind at all, suggesting that GRB2 may link PTPe with downstream molecules. Further studies indicated that GRB2 is required for activation of Src by cyt-PTPe in osteoclast-like cells (OCLs) in culture. Overexpression of GRB2 in OCLs increased activating phosphorylation of Src at Tyr-416 and of cyt-PTPe at Tyr-638; opposite results were obtained when GRB2 expression was reduced by shRNA or by gene inactivation. Phosphorylation of cyt-PTPe at Tyr-683 and its association with GRB2 are integrin-driven processes in OCLs, and cyt-PTPe undergoes autodephosphorylation at Tyr-683, thus limiting Src activation by integrins. Reduced GRB2 expression also reduced the ability of bone marrow precursors to differentiate into OCLs and reduced the fraction of OCLs in which podosomal adhesion structures assume organization typical of active, resorbing cells. We conclude that GRB2 physically links cyt-PTPe with Src and enables cyt-PTPe to activate Src downstream of activated integrins in OCLs. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Induction of Non-Apoptotic Cell Death by Activated Ras Requires Inverse Regulation of Rac1 and Arf6

    Science.gov (United States)

    Bhanot, Haymanti; Young, Ashley M.; Overmeyer, Jean H.; Maltese, William A.

    2010-01-01

    Methuosis is a unique form of non-apoptotic cell death triggered by alterations in the trafficking of clathrin-independent endosomes, ultimately leading to extreme vacuolization and rupture of the cell. Methuosis can be induced in glioblastoma cells by expression of constitutively active Ras. This study identifies the small GTPases, Rac1 and Arf6, and the Arf6 GTPase-activating-protein, GIT1, as key downstream components of the signaling pathway underlying Ras-induced methuosis. The extent to which graded expression of active H-Ras(G12V) triggers cytoplasmic vacuolization correlates with the amount of endogenous Rac1 in the active GTP state. Blocking Rac1 activation with the specific Rac inhibitor, EHT 1864, or co-expression of dominant-negative Rac1(T17N), prevents the accumulation of vacuoles induced by H-Ras(G12V). Coincident with Rac1 activation, H-Ras(G12V) causes a decrease in the amount of active Arf6, a GTPase that functions in recycling of clathrin-independent endosomes. The effect of H-Ras(G12V) on Arf6 is blocked by EHT 1864, indicating that the decrease in Arf6-GTP is directly linked to activation of Rac1. Constitutively active Rac1(G12V) interacts with GIT1 in immunoprecipitation assays. Ablation of GIT1 by shRNA prevents the decrease in active Arf6, inhibits vacuolization, and prevents loss of cell viability in cells expressing Rac1(G12V). Together the results suggest that perturbations of endosome morphology associated with Ras-induced methuosis are due to downstream activation of Rac1, combined with reciprocal inactivation of Arf6. The latter appears to be mediated through Rac1 stimulation of GIT1. Further insights into this pathway could suggest opportunities for induction of methuosis in cancers that are resistant to apoptotic cell death. PMID:20713492

  18. Saharan Dust, Transport Processes, and Possible Impacts on Hurricane Activities

    Science.gov (United States)

    Lau, William K. M.; Kim, K. M.

    2010-01-01

    In this paper, we present observational evidence of significant relationships between Saharan dust outbreak, and African Easterly wave activities and hurricane activities. We found two dominant paths of transport of Saharan dust: a northern path, centered at 25degN associated with eastward propagating 6-19 days waves over northern Africa, and a southern path centered at 15degN, associated with the AEW, and the Atlantic ITCZ. Seasons with stronger dust outbreak from the southern path are associated with a drier atmosphere over the Maximum Development Region (MDR) and reduction in tropical cyclone and hurricane activities in the MDR. Seasons with stronger outbreak from the northern path are associated with a cooler N. Atlantic, and suppressed hurricane in the western Atlantic basin.

  19. Types of Physical Activity

    Science.gov (United States)

    ... do more work than usual, which makes them stronger. How do I do it? That depends on which muscles you want to work. Examples include doing push- ... do more work than usual, which makes them stronger. How do I do it? That depends on which muscles you want to work. Examples include doing push- ...

  20. Inhibition of Ape1 Redox Activity Promotes Odonto/osteogenic Differentiation of Dental Papilla Cells.

    Science.gov (United States)

    Chen, Tian; Liu, Zhi; Sun, Wenhua; Li, Jingyu; Liang, Yan; Yang, Xianrui; Xu, Yang; Yu, Mei; Tian, Weidong; Chen, Guoqing; Bai, Ding

    2015-12-07

    Dentinogenesis is the formation of dentin, a substance that forms the majority of teeth, and this process is performed by odontoblasts. Dental papilla cells (DPCs), as the progenitor cells of odontoblasts, undergo the odontogenic differentiation regulated by multiple cytokines and paracrine signal molecules. Ape1 is a perfect paradigm of the function complexity of a biological macromolecule with two major functional regions for DNA repair and redox regulation, respectively. To date, it remains unclear whether Ape1 can regulate the dentinogenesis in DPCs. In the present study, we firstly examed the spatio-temporal expression of Ape1 during tooth germ developmental process, and found the Ape1 expression was initially high and then gradually reduced along with the tooth development. Secondly, the osteo/odontogenic differentiation capacity of DPCs was up-regulated when treated with either Ape1-shRNA or E3330 (a specific inhibitor of the Ape1 redox function), respectively. Moreover, we found that the canonical Wnt signaling pathway was activated in this process, and E3330 reinforced-osteo/odontogenic differentiation capacity was suppressed by Dickkopf1 (DKK1), a potent antagonist of canonical Wnt signaling pathway. Taken together, we for the first time showed that inhibition of Ape1 redox regulation could promote the osteo/odontogenic differentiation capacity of DPCs via canonical Wnt signaling pathway.

  1. Dextromethorphan mediated bitter taste receptor activation in the pulmonary circuit causes vasoconstriction.

    Science.gov (United States)

    Upadhyaya, Jasbir D; Singh, Nisha; Sikarwar, Anurag S; Chakraborty, Raja; Pydi, Sai P; Bhullar, Rajinder P; Dakshinamurti, Shyamala; Chelikani, Prashen

    2014-01-01

    Activation of bitter taste receptors (T2Rs) in human airway smooth muscle cells leads to muscle relaxation and bronchodilation. This finding led to our hypothesis that T2Rs are expressed in human pulmonary artery smooth muscle cells and might be involved in regulating the vascular tone. RT-PCR was performed to reveal the expression of T2Rs in human pulmonary artery smooth muscle cells. Of the 25 T2Rs, 21 were expressed in these cells. Functional characterization was done by calcium imaging after stimulating the cells with different bitter agonists. Increased calcium responses were observed with most of the agonists, the largest increase seen for dextromethorphan. Previously in site-directed mutational studies, we have characterized the response of T2R1 to dextromethorphan, therefore, T2R1 was selected for further analysis in this study. Knockdown with T2R1 specific shRNA decreased mRNA levels, protein levels and dextromethorphan-induced calcium responses in pulmonary artery smooth muscle cells by up to 50%. To analyze if T2Rs are involved in regulating the pulmonary vascular tone, ex vivo studies using pulmonary arterial and airway rings were pursued. Myographic studies using porcine pulmonary arterial and airway rings showed that stimulation with dextromethorphan led to contraction of the pulmonary arterial and relaxation of the airway rings. This study shows that dextromethorphan, acting through T2R1, causes vasoconstrictor responses in the pulmonary circuit and relaxation in the airways.

  2. Dextromethorphan mediated bitter taste receptor activation in the pulmonary circuit causes vasoconstriction.

    Directory of Open Access Journals (Sweden)

    Jasbir D Upadhyaya

    Full Text Available Activation of bitter taste receptors (T2Rs in human airway smooth muscle cells leads to muscle relaxation and bronchodilation. This finding led to our hypothesis that T2Rs are expressed in human pulmonary artery smooth muscle cells and might be involved in regulating the vascular tone. RT-PCR was performed to reveal the expression of T2Rs in human pulmonary artery smooth muscle cells. Of the 25 T2Rs, 21 were expressed in these cells. Functional characterization was done by calcium imaging after stimulating the cells with different bitter agonists. Increased calcium responses were observed with most of the agonists, the largest increase seen for dextromethorphan. Previously in site-directed mutational studies, we have characterized the response of T2R1 to dextromethorphan, therefore, T2R1 was selected for further analysis in this study. Knockdown with T2R1 specific shRNA decreased mRNA levels, protein levels and dextromethorphan-induced calcium responses in pulmonary artery smooth muscle cells by up to 50%. To analyze if T2Rs are involved in regulating the pulmonary vascular tone, ex vivo studies using pulmonary arterial and airway rings were pursued. Myographic studies using porcine pulmonary arterial and airway rings showed that stimulation with dextromethorphan led to contraction of the pulmonary arterial and relaxation of the airway rings. This study shows that dextromethorphan, acting through T2R1, causes vasoconstrictor responses in the pulmonary circuit and relaxation in the airways.

  3. Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

    Energy Technology Data Exchange (ETDEWEB)

    Frampton, Gabriel; Coufal, Monique [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Li, Huang [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Department of Hepatobiliary Surgery, First Affiliated Hospital, Sun Yat-Sen University, Guangzhou (China); Ramirez, Jonathan [Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States); DeMorrow, Sharon, E-mail: demorrow@medicine.tamhsc.edu [Department of Internal Medicine, Texas A and M Health Science Center College of Medicine, Temple, TX (United States); Digestive Disease Research Center, Scott and White Hospital, Temple, TX (United States)

    2010-05-15

    The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the {gamma}-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-{gamma}-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the {gamma}-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.

  4. Opposing actions of endocannabinoids on cholangiocarcinoma growth is via the differential activation of Notch signaling

    International Nuclear Information System (INIS)

    Frampton, Gabriel; Coufal, Monique; Li, Huang; Ramirez, Jonathan; DeMorrow, Sharon

    2010-01-01

    The endocannabinoids anandamide (AEA) and 2-arachidonylglycerol (2-AG) have opposing effects on cholangiocarcinoma growth. Implicated in cancer, Notch signaling requires the γ-secretase complex for activation. The aims of this study were to determine if the opposing effects of endocannabinoids depend on the differential activation of the Notch receptors and to demonstrate that the differential activation of these receptors are due to presenilin 1 containing- and presenilin 2 containing-γ-secretase complexes. Mz-ChA-1 cells were treated with AEA or 2-AG. Notch receptor expression, activation, and nuclear translocation were determined. Specific roles for Notch 1 and 2 on cannabinoid-induced effects were determined by transient transfection of Notch 1 or 2 shRNA vectors before stimulation with AEA or 2-AG. Expression of presenilin 1 and 2 was determined after AEA or 2-AG treatment, and the involvement of presenilin 1 and 2 in the cannabinoid-induced effects was demonstrated in cell lines with low presenilin 1 or 2 expression. Antiproliferative effects of AEA required increased Notch 1 mRNA, activation, and nuclear translocation, whereas the growth-promoting effects induced by 2-AG required increased Notch 2 mRNA expression, activation, and nuclear translocation. AEA increased presenilin 1 expression and recruitment into the γ-secretase complex, whereas 2-AG increased expression and recruitment of presenilin 2. The development of novel therapeutic strategies aimed at modulating the endocannabinoid system or mimicking the mode of action of AEA on Notch signaling pathways would prove beneficial for cholangiocarcinoma management.

  5. BAS-drive trait modulates dorsomedial striatum activity during reward response-outcome associations.

    Science.gov (United States)

    Costumero, Víctor; Barrós-Loscertales, Alfonso; Fuentes, Paola; Rosell-Negre, Patricia; Bustamante, Juan Carlos; Ávila, César

    2016-09-01

    According to the Reinforcement Sensitivity Theory, behavioral studies have found that individuals with stronger reward sensitivity easily detect cues of reward and establish faster associations between instrumental responses and reward. Neuroimaging studies have shown that processing anticipatory cues of reward is accompanied by stronger ventral striatum activity in individuals with stronger reward sensitivity. Even though establishing response-outcome contingencies has been consistently associated with dorsal striatum, individual differences in this process are poorly understood. Here, we aimed to study the relation between reward sensitivity and brain activity while processing response-reward contingencies. Forty-five participants completed the BIS/BAS questionnaire and performed a gambling task paradigm in which they received monetary rewards or punishments. Overall, our task replicated previous results that have related processing high reward outcomes with activation of striatum and medial frontal areas, whereas processing high punishment outcomes was associated with stronger activity in insula and middle cingulate. As expected, the individual differences in the activity of dorsomedial striatum correlated positively with BAS-Drive. Our results agree with previous studies that have related the dorsomedial striatum with instrumental performance, and suggest that the individual differences in this area may form part of the neural substrate responsible for modulating instrumental conditioning by reward sensitivity.

  6. On two alternative mechanisms of ethane activation over ZSM-5 zeolite modified by Zn2+ and Ga1+ cations

    NARCIS (Netherlands)

    Kazansky, V.B.; Subbotina, I.R.; Rane, N.J.; Santen, van R.A.; Hensen, E.J.M.

    2005-01-01

    The activation of ethane over zinc- and gallium-modified HZSM-5 dehydrogenation catalysts was studied by diffuse reflectance infrared spectroscopy. Hydrocarbon activation on HZSM-5 modified by bivalent Zn and univalent Ga cations proceeds via two distinctly different mechanisms. The stronger

  7. Healthy hearts--and the universal benefits of being physically active: physical activity and health.

    Science.gov (United States)

    Blair, Steven N; Morris, Jeremy N

    2009-04-01

    Although ancient thinkers suggested that physical activity is good for health, systematic research on the topic did not begin until the middle of the 20th century. Early reports showed that individuals in active occupations had lower rates of heart disease than individuals in sedentary occupations. Investigators then began to evaluate leisure-time physical activity and health and found similar results. Later research used objective measures of cardiorespiratory fitness as the exposure, and found even stronger associations with health outcomes. Recent research has extended the earlier findings on activity or fitness and heart disease to a wide variety of health outcomes. We now know that regular physical activity of 150 minutes/week of moderate intensity physical activity reduces the risk of numerous chronic diseases, preserves health and function (both physical and mental) into old age, and extends longevity. The current challenge is to develop programs and interventions to promote physical activity for all in our increasingly sedentary societies.

  8. Structure-activity relationships of rosiglitazone for peroxisome proliferator-activated receptor gamma transrepression.

    Science.gov (United States)

    Toyota, Yosuke; Nomura, Sayaka; Makishima, Makoto; Hashimoto, Yuichi; Ishikawa, Minoru

    2017-06-15

    Anti-inflammatory effects of peroxisome proliferator-activated receptor gamma (PPRAγ) ligands are thought to be largely due to PPARγ-mediated transrepression. Thus, transrepression-selective PPARγ ligands without agonistic activity or with only partial agonistic activity should exhibit anti-inflammatory properties with reduced side effects. Here, we investigated the structure-activity relationships (SARs) of PPARγ agonist rosiglitazone, focusing on transrepression activity. Alkenic analogs showed slightly more potent transrepression with reduced efficacy of transactivating agonistic activity. Removal of the alkyl group on the nitrogen atom improved selectivity for transrepression over transactivation. Among the synthesized compounds, 3l exhibited stronger transrepressional activity (IC 50 : 14μM) and weaker agonistic efficacy (11%) than rosiglitazone or pioglitazone. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Activation of GSK3β by Sirt2 is required for early lineage commitment of mouse embryonic stem cell.

    Directory of Open Access Journals (Sweden)

    Xiaoxing Si

    Full Text Available Sirt2, a member of the NAD(+-dependent protein deacetylase family, is increasingly recognized as a critical regulator of the cell cycle, cellular necrosis and cytoskeleton organization. However, its role in embryonic stem cells (ESCs remains unclear. Here we demonstrate that Sirt2 is up-regulated during RA (retinoic acid-induced and embryoid body (EB differentiation of mouse ESCs. Using lentivirus-mediated shRNA methods, we found that knockdown of Sirt2 compromises the differentiation of mouse ESCs into ectoderm while promoting mesoderm and endoderm differentiation. Knockdown of Sirt2 expression also leads to the activation of GSK3β through decreased phosphorylation of the serine at position 9 (Ser9 but not tyrosine at position 216 (Tyr216. Moreover, the constitutive activation of GSK3β during EB differentiation mimics the effect of Sirt2 knockdown, while down-regulation of GSK3β rescues the effect of Sirt2 knockdown on differentiation. In contrast to the effect on lineage differentiation, Sirt2 knockdown and GSK3β up-regulation do not change the self-renewal state of mouse ESCs. Overall, our report reveals a new function for Sirt2 in regulating the proper lineage commitment of mouse ESCs.

  10. Fine time course expression analysis identifies cascades of activation and repression and maps a putative regulator of mammalian sex determination.

    Directory of Open Access Journals (Sweden)

    Steven C Munger

    Full Text Available In vertebrates, primary sex determination refers to the decision within a bipotential organ precursor to differentiate as a testis or ovary. Bifurcation of organ fate begins between embryonic day (E 11.0-E12.0 in mice and likely involves a dynamic transcription network that is poorly understood. To elucidate the first steps of sexual fate specification, we profiled the XX and XY gonad transcriptomes at fine granularity during this period and resolved cascades of gene activation and repression. C57BL/6J (B6 XY gonads showed a consistent ~5-hour delay in the activation of most male pathway genes and repression of female pathway genes relative to 129S1/SvImJ, which likely explains the sensitivity of the B6 strain to male-to-female sex reversal. Using this fine time course data, we predicted novel regulatory genes underlying expression QTLs (eQTLs mapped in a previous study. To test predictions, we developed an in vitro gonad primary cell assay and optimized a lentivirus-based shRNA delivery method to silence candidate genes and quantify effects on putative targets. We provide strong evidence that Lmo4 (Lim-domain only 4 is a novel regulator of sex determination upstream of SF1 (Nr5a1, Sox9, Fgf9, and Col9a3. This approach can be readily applied to identify regulatory interactions in other systems.

  11. Neuronal Orphan G-Protein Coupled Receptor Proteins Mediate Plasmalogens-Induced Activation of ERK and Akt Signaling.

    Directory of Open Access Journals (Sweden)

    Md Shamim Hossain

    Full Text Available The special glycerophospholipids plasmalogens (Pls are enriched in the brain and reported to prevent neuronal cell death by enhancing phosphorylation of Akt and ERK signaling in neuronal cells. Though the activation of Akt and ERK was found to be necessary for the neuronal cells survival, it was not known how Pls enhanced cellular signaling. To answer this question, we searched for neuronal specific orphan GPCR (G-protein coupled receptor proteins, since these proteins were believed to play a role in cellular signal transduction through the lipid rafts, where both Pls and some GPCRs were found to be enriched. In the present study, pan GPCR inhibitor significantly reduced Pls-induced ERK signaling in neuronal cells, suggesting that Pls could activate GPCRs to induce signaling. We then checked mRNA expression of 19 orphan GPCRs and 10 of them were found to be highly expressed in neuronal cells. The knockdown of these 10 neuronal specific GPCRs by short hairpin (sh-RNA lentiviral particles revealed that the Pls-mediated phosphorylation of ERK was inhibited in GPR1, GPR19, GPR21, GPR27 and GPR61 knockdown cells. We further found that the overexpression of these GPCRs enhanced Pls-mediated phosphorylation of ERK and Akt in cells. Most interestingly, the GPCRs-mediated cellular signaling was reduced significantly when the endogenous Pls were reduced. Our cumulative data, for the first time, suggest a possible mechanism for Pls-induced cellular signaling in the nervous system.

  12. PTP-PEST targets a novel tyrosine site in p120 catenin to control epithelial cell motility and Rho GTPase activity

    Science.gov (United States)

    Espejo, Rosario; Jeng, Yowjiun; Paulucci-Holthauzen, Adriana; Rengifo-Cam, William; Honkus, Krysta; Anastasiadis, Panos Z.; Sastry, Sarita K.

    2014-01-01

    ABSTRACT Tyrosine phosphorylation is implicated in regulating the adherens junction protein, p120 catenin (p120), however, the mechanisms are not well defined. Here, we show, using substrate trapping, that p120 is a direct target of the protein tyrosine phosphatase, PTP-PEST, in epithelial cells. Stable shRNA knockdown of PTP-PEST in colon carcinoma cells results in an increased cytosolic pool of p120 concomitant with its enhanced tyrosine phosphorylation and decreased association with E-cadherin. Consistent with this, PTP-PEST knockdown cells exhibit increased motility, enhanced Rac1 and decreased RhoA activity on a collagen substrate. Furthermore, p120 localization is enhanced at actin-rich protrusions and lamellipodia and has an increased association with the guanine nucleotide exchange factor, VAV2, and cortactin. Exchange factor activity of VAV2 is enhanced by PTP-PEST knockdown whereas overexpression of a VAV2 C-terminal domain or DH domain mutant blocks cell motility. Analysis of point mutations identified tyrosine 335 in the N-terminal domain of p120 as the site of PTP-PEST dephosphorylation. A Y335F mutant of p120 failed to induce the ‘p120 phenotype’, interact with VAV2, stimulate cell motility or activate Rac1. Together, these data suggest that PTP-PEST affects epithelial cell motility by controlling the distribution and phosphorylation of p120 and its availability to control Rho GTPase activity. PMID:24284071

  13. Distortion of maximal elevator activity by unilateral premature tooth contact

    DEFF Research Database (Denmark)

    Bakke, Merete; Møller, Eigild

    1980-01-01

    In four subjects the electrical activity in the anterior and posterior temporal and masseter muscles during maximal bite was recorded bilaterally with and without premature unilateral contact. Muscle activity was measured as the average level and the peak of the mean voltage with layers of strips...... of 0.05, 0.10, 0.15 and 2.0 mm, placed between first molars either on the left or the right side, and compared with the level of activity with undistrubed occlusion. Unilateral premature contact caused a significant asymmetry of action in all muscles under study with stronger activity ipsilaterally...

  14. Activation of mPTP-dependent mitochondrial apoptosis pathway by a novel pan HDAC inhibitor resminostat in hepatocellular carcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Fu, Meili [Department of Infectious Disease, Linyi People’s Hospital, Linyi (China); Shi, Wenhong [Department of Radiotherapy, Linyi Tumor Hospital, Linyi (China); Li, Zhengling [Department of Nursing, Tengzhou Central People’s Hospital, Tengzhou (China); Liu, Haiyan, E-mail: liuhaiyanlinyi5@sina.com [Department of Nursing, Linyi People’s Hospital, No. 27 Jiefang Road, Linyi 276000, Shandong (China)

    2016-09-02

    Over-expression and aberrant activation of histone deacetylases (HDACs) are often associated with poor prognosis of hepatocellular carcinoma (HCC). Here, we evaluated the potential anti-hepatocellular carcinoma (HCC) cell activity by resminostat, a novel pan HDAC inhibitor (HDACi). We demonstrated that resminostat induced potent cytotoxic and anti-proliferative activity against established HCC cell lines (HepG2, HepB3, SMMC-7721) and patient-derived primary HCC cells. Further, resminostat treatment in HCC cells activated mitochondrial permeability transition pore (mPTP)-dependent apoptosis pathway, which was evidenced by physical association of cyclophilin-D and adenine nucleotide translocator 1 (ANT-1), mitochondrial depolarization, cytochrome C release and caspase-9 activation. Intriguingly, the mPTP blockers (sanglifehrin A and cyclosporine A), shRNA knockdown of cyclophilin-D or the caspase-9 inhibitor dramatically attenuated resminostat-induced HCC cell apoptosis and cytotoxicity. Reversely, HCC cells with exogenous cyclophilin-D over-expression were hyper-sensitive to resminostat. Intriguingly, a low concentration of resminostat remarkably potentiated sorafenib-induced mitochondrial apoptosis pathway activation, leading to a profound cytotoxicity in HCC cells. The results of this preclinical study indicate that resminostat (or plus sorafenib) could be further investigated as a valuable anti-HCC strategy. - Highlights: • Resminostat inhibits human HCC cell survival and proliferation. • Resminostat activates mPTP-dependent mitochondrial apoptosis pathway in HCC cells. • Resminostat potentiates sorafenib-induced mitochondrial apoptosis pathway activation. • mPTP or caspase-9 inhibition attenuates apoptosis by resminostat or plus sorafenib.

  15. Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yi; Cui, Jiang-Tao, E-mail: cuijingtaopaper@126.com

    2016-09-02

    Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

  16. Inhibition of Bcl-2 potentiates AZD-2014-induced anti-head and neck squamous cell carcinoma cell activity

    International Nuclear Information System (INIS)

    Li, Yi; Cui, Jiang-Tao

    2016-01-01

    Mammalian target of rapamycin (mTOR) is a therapeutic target for head and neck squamous cell carcinoma (HNSCC). Here, we evaluated the activity of AZD-2014, a potent mTOR complex 1/2 (mTORC1/2) dual inhibitor, against HNSCC cells. We showed that AZD-2014 blocked mTORC1/2 activation in established and primary human HNSCC cells, where it was anti-proliferative and pro-apoptotic. Yet, AZD-2014 was non-cytotoxic to the human oral epithelial cells with low basal mTORC1/2 activation. In an effect to identify possible AZD-2014 resistance factors, we showed that the anti-apoptosis protein Bcl-2 was upregulated in AZD-2014-resistant SQ20B HNSCC cells. Inhibition of Bcl-2 by ABT-737 (a known Bcl-2 inhibitor) or Bcl-2 shRNA dramatically potentiated AZD-2014 lethality against HNSCC cells. On the other hand, exogenous overexpression of Bcl-2 largely attenuated AZD-2014’s activity against HNSCC cells. For the in vivo studies, we showed that oral gavage of AZD-2014 suppressed SQ20B xenograft growth in severe combined immunodeficient (SCID) mice. It also significantly improved mice survival. Importantly, AZD-2014’s anti-HNSCC activity in vivo was potentiated with co-administration of ABT-737. The preclinical results of this study suggest that AZD-2014 could be further tested as a valuable anti-HNSCC agent, either alone or in combination with Bcl-2 inhibitors. - Highlights: • AZD-2014 blocks mTORC1/2 activation in HNSCC cells. • AZD-2014 suppresses HNSCC cell proliferation. • AZD-2014 activates caspase-3 and apoptosis in HNSCC cells. • Bcl-2 is the key resistance factor of AZD-2014 in HNSCC cells. • ABT-737 sensitizes AZD-2014-induced anti-HNSCC activity in vivo.

  17. As tears go by : Baby tears trigger more brain activity than adult tears in nulliparous women

    NARCIS (Netherlands)

    Hendricx-Riem, M.M.E.; De Carli, P.; van IJzendoorn, M.H.; Vingerhoets, A.J.J.M.; Bakermans-Kranenburg, M.J.

    2017-01-01

    The current functional magnetic resonance imaging study examines brain activity during the perception of infant and adult tears. Infant tears evoke stronger responses in the visual cortex than adult tears, indicating that infant tears are highly salient. In addition, our study shows that infant

  18. Responding to the Challenges of Active Citizenship through the Revised UK Early Years Foundation Stage Curriculum

    Science.gov (United States)

    Baker, Fiona S.

    2013-01-01

    The revised UK Early Years Foundation Stage (EYFS) now places a stronger emphasis on personal, social and emotional development (PSED) as one of its three prime areas. PSED has three characteristics of learning: active learning, creating and thinking critically, and playing and exploring. These aspects of the revised EYFS closely align with the…

  19. “Environmental Psychology” the mental benefits of physical activities in natural settings

    OpenAIRE

    De Dominicis, Stefano

    2017-01-01

    Practicing sports and physical activities has a huge positive impact on physiological and psychological wellbeing of individuals. Drawing from Environmental and Positive psychology, the idea presented in this paper highlight the even stronger psychological benefits related to training, exercising and playing sports in natural environments. Specifically, given their intrinsic characteristics, such contexts are more prone then urban environments to foster positive emotions, controlled cognition...

  20. Histochemical demonstration of activity of acid phosphatase and beta-glucuronidase in bovine incisor tooth germs

    DEFF Research Database (Denmark)

    Kirkeby, S; Salling, E; Moe, D

    1983-01-01

    . After initiation of enamel formation, a change in localization and intensity of the colored reaction product was observed in the ameloblasts. The activity appeared stronger and was restricted to a narrow zone just apical to the nucleus. It is proposed that the acid hydrolases in the tooth forming cells...

  1. Enabling nucleophilic substitution reactions of activated alkyl fluorides through hydrogen bonding.

    Science.gov (United States)

    Champagne, Pier Alexandre; Pomarole, Julien; Thérien, Marie-Ève; Benhassine, Yasmine; Beaulieu, Samuel; Legault, Claude Y; Paquin, Jean-François

    2013-05-03

    It was discovered that the presence of water as a cosolvent enables the reaction of activated alkyl fluorides for bimolecular nucleophilic substitution reactions. DFT calculations show that activation proceeds through stabilization of the transition structure by a stronger F···H2O interaction and diminishing C-F bond elongation, and not simple transition state electrostatic stabilization. Overall, the findings put forward a distinct strategy for C-F bond activation through H-bonding.

  2. Short-chain C6 ceramide sensitizes AT406-induced anti-pancreatic cancer cell activity

    International Nuclear Information System (INIS)

    Zhao, Xiaoguang; Sun, Baoyou; Zhang, Jingjing; Zhang, Ruishen; Zhang, Qing

    2016-01-01

    Our previous study has shown that AT406, a first-in-class small molecular antagonist of IAPs (inhibitor of apoptosis proteins), inhibits pancreatic cancer cell proliferation in vitro and in vivo. The aim of this research is to increase AT406's sensitivity by adding short-chain C6 ceramide. We show that co-treatment of C6 ceramide dramatically potentiated AT406-induced caspase/apoptosis activation and cytotoxicity in established (Panc-1 and Mia-PaCa-2 lines) and primary human pancreatic cancer cells. Reversely, caspase inhibitors largely attenuated C6 ceramide plus AT406-induced above cancer cell death. Molecularly, C6 ceramide downregulated Bcl-2 to increase AT406's sensitivity in pancreatic cancer cells. Intriguingly, C6 ceramide-mediated AT406 sensitization was nullified with Bcl-2 shRNA knockdown or pretreatment of the Bcl-2 inhibitor ABT-737. In vivo, liposomal C6 ceramide plus AT406 co-administration dramatically inhibited Panc-1 xenograft tumor growth in severe combined immunodeficient (SCID) mice. The combined anti-tumor activity was significantly more potent than either single treatment. Expressions of IAPs (cIAP1/XIAP) and Bcl-2 were downregulated in Panc-1 xenografts with the co-administration. Together, we demonstrate that C6 ceramide sensitizes AT406-mediated anti-pancreatic cancer cell activity possibly via downregulating Bcl-2. - Highlights: • C6 ceramide dramatically potentiates AT406-induced pancreatic cancer cell death. • C6 ceramide facilitates AT406-induced pancreatic cancer cell apoptosis. • C6 ceramide downregulates Bcl-2 to increase AT406's sensitivity in pancreatic cancer cells. • Liposomal C6 ceramide enhances AT406-induced anti-pancreatic cancer activity in vivo.

  3. MMP-9 directed shRNAs as relevant inhibitors of matrix metalloproteinase 9 activity and signaling

    Directory of Open Access Journals (Sweden)

    Ewa Nowak

    2013-08-01

    Full Text Available Introduction: The main function of matrix metalloproteinases is the degradation of extracellular matrix components, which is related to changes in the proliferation of cells, their differentiation, motility, and death. MMPs play an important role in physiological processes such as embryogenesis, angiogenesis and tissue remodeling. The increase of MMPs activity is also observed in pathological conditions including tumorigenesis where MMP-2 (gelatinase A and MMP-9 (gelatinase B show the ability to degrade the basement membrane of vessels and they are involved in metastasis. The aim of our study was to verify the changes of MMP-9 enzymatic activity and the mobility of cells after inhibition of MMP-9 gene expression.Material and Methods: The oligonucleotide shRNA insert had been designed to silence MMP-9 gene expression and was cloned into the pSUPER.neo expression vector. The construct was introduced into the HeLa (CCL-2 cervical cancer cells by lipotransfection. Simultaneously in control cells MMP-9 were inhibited by doxycycline. Changes in activity of MMP-9 were analyzed by gelatin zymography and wound-healing assay.Results/Conclusions: Gelatin zymography allowed us to confirm that activity of MMP-9 in cells transfected by shRNA-MMP-9 and treated by doxycycline were similar and significantly lower in comparison with control cells. Phenotypic tests of migration in vitro confirm statistically significant (P<0.05 changes in cell migration – control cells healed 3 to 5 times faster in comparison with transfected or doxycycline treated cells. Our studies show the significant role of MMP-9 in mobility and invasiveness of tumor cells, thus indicating a potential target point of interest for gene therapy.

  4. Attenuated food anticipatory activity and abnormal circadian locomotor rhythms in Rgs16 knockdown mice.

    Directory of Open Access Journals (Sweden)

    Naoto Hayasaka

    Full Text Available Regulators of G protein signaling (RGS are a multi-functional protein family, which functions in part as GTPase-activating proteins (GAPs of G protein α-subunits to terminate G protein signaling. Previous studies have demonstrated that the Rgs16 transcripts exhibit robust circadian rhythms both in the suprachiasmatic nucleus (SCN, the master circadian light-entrainable oscillator (LEO of the hypothalamus, and in the liver. To investigate the role of RGS16 in the circadian clock in vivo, we generated two independent transgenic mouse lines using lentiviral vectors expressing short hairpin RNA (shRNA targeting the Rgs16 mRNA. The knockdown mice demonstrated significantly shorter free-running period of locomotor activity rhythms and reduced total activity as compared to the wild-type siblings. In addition, when feeding was restricted during the daytime, food-entrainable oscillator (FEO-driven elevated food-anticipatory activity (FAA observed prior to the scheduled feeding time was significantly attenuated in the knockdown mice. Whereas the restricted feeding phase-advanced the rhythmic expression of the Per2 clock gene in liver and thalamus in the wild-type animals, the above phase shift was not observed in the knockdown mice. This is the first in vivo demonstration that a common regulator of G protein signaling is involved in the two separate, but interactive circadian timing systems, LEO and FEO. The present study also suggests that liver and/or thalamus regulate the food-entrained circadian behavior through G protein-mediated signal transduction pathway(s.

  5. PKR-like endoplasmic reticulum kinase is necessary for lipogenic activation during HCMV infection.

    Directory of Open Access Journals (Sweden)

    Yongjun Yu

    Full Text Available PKR-like endoplasmic reticulum (ER kinase (PERK is an ER-associated stress sensor protein which phosphorylates eukaryotic initiation factor 2α (eIF2α to induce translation attenuation in response to ER stress. PERK is also a regulator of lipogenesis during adipocyte differentiation through activation of the cleavage of sterol regulatory element binding protein 1 (SREBP1, resulting in the upregulation of lipogenic enzymes. Our recent studies have shown that human cytomegalovirus (HCMV infection in human fibroblasts (HF induces adipocyte-like lipogenesis through the activation of SREBP1. Here, we report that PERK expression is highly increased in HCMV-infected cells and is necessary for HCMV growth. Depletion of PERK, using short hairpin RNA (shRNA, resulted in attenuation of HCMV growth, inhibition of lipid synthesis and reduction of lipogenic gene expression. Examination of the cleavage of SREBP proteins showed PERK depletion inhibited the cleavage of SREBP1, but not SREBP2, in HCMV-infected cells, suggesting different cleavage regulatory mechanisms for SREBP1 and 2. Further studies showed that the depletion of SREBP1, but not SREBP2, reduced lipid synthesis in HCMV infection, suggesting that activation of SREBP1 is sufficient to induce lipogenesis in HCMV infection. The reduction of lipid synthesis by PERK depletion can be partially restored by expressing a Flag-tagged nuclear form of SREBP1a. Our studies also suggest that the induction of PERK in HCMV-infected cells stimulates SREBP1 cleavage by reducing levels of Insig1 (Insulin inducible gene 1 protein; this occurs independent of the phosphorylation of eIF2α. Introduction of an exogenous Insig1-Myc into HCMV infected cells significantly reduced HCMV growth and lipid synthesis. Our data demonstrate that the induction of PERK during HCMV infection is necessary for full activation of lipogenesis; this effect appears to be mediated by limiting the levels of Insig1 thus freeing SREBP1-SCAP

  6. Epigenetic mediated transcriptional activation of WNT5A participates in arsenical-associated malignant transformation

    International Nuclear Information System (INIS)

    Jensen, Taylor J.; Wozniak, Ryan J.; Eblin, Kylee E.; Wnek, Sean M.; Gandolfi, A. Jay; Futscher, Bernard W.

    2009-01-01

    Arsenic is a human carcinogen with exposure associated with cancer of the lung, skin, and bladder. Many potential mechanisms have been implicated as playing a role in the process of arsenical-induced malignancy including the perturbation of signaling pathways and aberrant epigenetic regulation. We initiated studies to examine the role of a member of the non-canonical WNT signaling pathway, WNT5A, in UROtsa cells and arsenite [URO-ASSC] and monomethylarsonous acid [URO-MSC] malignantly transformed variants. We present data herein that suggest that WNT5A is transcriptionally activated during arsenical-induced malignant transformation. This WNT5A transcriptional activation is correlated with the enrichment of permissive histone modifications and the reduction of repressive modifications in the WNT5A promoter region. The epigenetic activation of WNT5A expression and acetylation of its promoter remain after the removal of the arsenical, consistent with the maintenance of an anchorage independent growth phenotype in these cells. Additionally, treatment with epigenetic modifying drugs supports a functional role for these epigenetic marks in controlling gene expression. Reduction of WNT5A using lentiviral shRNA greatly attenuated the ability of these cells to grow in an anchorage independent fashion. Extension of our model into human bladder cancer cell lines indicates that each of the cell lines examined also express WNT5A. Taken together, these data suggest that the epigenetic remodeling of the WNT5A promoter is correlated with its transcriptional activation and this upregulation likely participates in arsenical-induced malignant transformation

  7. Oncogenic S1P signalling in EBV-associated nasopharyngeal carcinoma activates AKT and promotes cell migration through S1P receptor 3.

    Science.gov (United States)

    Lee, Hui Min; Lo, Kwok-Wai; Wei, Wenbin; Tsao, Sai Wah; Chung, Grace Tin Yun; Ibrahim, Maha Hafez; Dawson, Christopher W; Murray, Paul G; Paterson, Ian C; Yap, Lee Fah

    2017-05-01

    Undifferentiated nasopharyngeal carcinoma (NPC) is a cancer with high metastatic potential that is consistently associated with Epstein-Barr virus (EBV) infection. In this study, we have investigated the functional contribution of sphingosine-1-phosphate (S1P) signalling to the pathogenesis of NPC. We show that EBV infection or ectopic expression of the EBV-encoded latent genes (EBNA1, LMP1, and LMP2A) can up-regulate sphingosine kinase 1 (SPHK1), the key enzyme that produces S1P, in NPC cell lines. Exogenous addition of S1P promotes the migration of NPC cells through the activation of AKT; shRNA knockdown of SPHK1 resulted in a reduction in the levels of activated AKT and inhibition of cell migration. We also show that S1P receptor 3 (S1PR3) mRNA is overexpressed in EBV-positive NPC patient-derived xenografts and a subset of primary NPC tissues, and that knockdown of S1PR3 suppressed the activation of AKT and the S1P-induced migration of NPC cells. Taken together, our data point to a central role for EBV in mediating the oncogenic effects of S1P in NPC and identify S1P signalling as a potential therapeutic target in this disease. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  8. Identification of Chloride Channels CLCN3 and CLCN5 Mediating the Excitatory Cl− Currents Activated by Sphingosine-1-Phosphate in Sensory Neurons

    Science.gov (United States)

    Qi, Yanmei; Mair, Norbert; Kummer, Kai K.; Leitner, Michael G.; Camprubí-Robles, María; Langeslag, Michiel; Kress, Michaela

    2018-01-01

    Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception. PMID:29479306

  9. Identification of Chloride Channels CLCN3 and CLCN5 Mediating the Excitatory Cl− Currents Activated by Sphingosine-1-Phosphate in Sensory Neurons

    Directory of Open Access Journals (Sweden)

    Yanmei Qi

    2018-02-01

    Full Text Available Sphingosine-1-phosphate (S1P is a bioactive sphingolipid involved in numerous physiological and pathophysiological processes. We have previously reported a S1P-induced nocifensive response in mice by excitation of sensory neurons via activation of an excitatory chloride current. The underlying molecular mechanism for the S1P-induced chloride conductance remains elusive. In the present study, we identified two CLCN voltage-gated chloride channels, CLCN3 and CLCN5, which mediated a S1P-induced excitatory Cl− current in sensory neurons by combining RNA-seq, adenovirus-based gene silencing and whole-cell electrophysiological voltage-clamp recordings. Downregulation of CLCN3 and CLCN5 channels by adenovirus-mediated delivery of shRNA dramatically reduced S1P-induced Cl− current and membrane depolarization in sensory neurons. The mechanism of S1P-induced activation of the chloride current involved Rho GTPase but not Rho-associated protein kinase. Although S1P-induced potentiation of TRPV1-mediated ionic currents also involved Rho-dependent process, the lack of correlation of the S1P-activated Cl− current and the potentiation of TRPV1 by S1P suggests that CLCN3 and CLCN5 are necessary components for S1P-induced excitatory Cl− currents but not for the amplification of TRPV1-mediated currents in sensory neurons. This study provides a novel mechanistic insight into the importance of bioactive sphingolipids in nociception.

  10. Does pattern-welding make Anglo-Saxon swords stronger?

    DEFF Research Database (Denmark)

    Birch, Thomas

    2013-01-01

    to assess whether the technique affects mechanical properties, this experimental study compared pattern-welded and plain forged blanks in a series of material tests. Specimens were subject to tensile, Charpy and Vickers diamond hardness testing. This was to investigate the relative strength, ductility......The purpose of pattern-welding, used for the construction of some Anglo-Saxon swords, has yet to be fully resolved. One suggestion is that the technique enhanced the mechanical properties of a blade. Another explanation is that pattern-welding created a desired aesthetic appearance. In order...... and toughness of pattern-welding. The results were inconclusive, however the study revealed that the fracture performance of pattern-welding may relate to its use....

  11. Automated Cellient(™) cytoblocks: better, stronger, faster?

    Science.gov (United States)

    Prendeville, S; Brosnan, T; Browne, T J; McCarthy, J

    2014-12-01

    Cytoblocks (CBs), or cell blocks, provide additional morphological detail and a platform for immunocytochemistry (ICC) in cytopathology. The Cellient(™) system produces CBs in 45 minutes using methanol fixation, compared with traditional CBs, which require overnight formalin fixation. This study compares Cellient and traditional CB methods in terms of cellularity, morphology and immunoreactivity, evaluates the potential to add formalin fixation to the Cellient method for ICC studies and determines the optimal sectioning depth for maximal cellularity in Cellient CBs. One hundred and sixty CBs were prepared from 40 cytology samples (32 malignant, eight benign) using four processing methods: (A) traditional; (B) Cellient (methanol fixation); (C) Cellient using additional formalin fixation for 30 minutes; (D) Cellient using additional formalin fixation for 60 minutes. Haematoxylin and eosin-stained sections were assessed for cellularity and morphology. ICC was assessed on 14 cases with a panel of antibodies. Three additional Cellient samples were serially sectioned to determine the optimal sectioning depth. Scoring was performed by two independent, blinded reviewers. For malignant cases, morphology was superior with Cellient relative to traditional CBs (P Cellient process did not influence the staining quality. Serial sectioning through Cellient CBs showed optimum cellularity at 30-40 μm with at least 27 sections obtainable. Cellient CBs provide superior morphology to traditional CBs and, if required, formalin fixation may be added to the Cellient process for ICC. Optimal Cellient CB cellularity is achieved at 30-40 μm, which will impact on the handling of cases in daily practice. © 2014 John Wiley & Sons Ltd.

  12. The imperative for stronger vaccine supply and logistics systems.

    Science.gov (United States)

    Zaffran, Michel; Vandelaer, Jos; Kristensen, Debra; Melgaard, Bjørn; Yadav, Prashant; Antwi-Agyei, K O; Lasher, Heidi

    2013-04-18

    With the introduction of new vaccines, developing countries are facing serious challenges in their vaccine supply and logistics systems. Storage capacity bottlenecks occur at national, regional, and district levels and system inefficiencies threaten vaccine access, availability, and quality. As countries adopt newer and more expensive vaccines and attempt to reach people at different ages and in new settings, their logistics systems must be strengthened and optimized. As a first step, national governments, donors, and international agencies have crafted a global vision for 2020 vaccine supply and logistics systems with detailed plans of action to achieve five priority objectives. Vaccine products and packaging are designed to meet the needs of developing countries. Immunization supply systems support efficient and effective vaccine delivery. The environmental impact of energy, materials, and processes used in immunization systems is minimized. Immunization information systems enable better and more timely decision-making. Competent and motivated personnel are empowered to handle immunization supply chain issues. Over the next decade, vaccine supply and logistics systems in nearly all developing countries will require significant investments of time and resources from global and national partners, donors, and governments. These investments are critical if we are to reach more people with current and newer vaccines. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Slower speed and stronger coupling: adaptive mechanisms of chaos synchronization.

    Science.gov (United States)

    Wang, Xiao Fan

    2002-06-01

    We show that two initially weakly coupled chaotic systems can achieve synchronization by adaptively reducing their speed and/or enhancing the coupling strength. Explicit adaptive algorithms for speed reduction and coupling enhancement are provided. We apply these algorithms to the synchronization of two coupled Lorenz systems. It is found that after a long-time adaptive process, the two coupled chaotic systems can achieve synchronization with almost the minimum required coupling-speed ratio.

  14. A three-legged stool needs a stronger third leg.

    Science.gov (United States)

    Greenberg, Ramon

    2013-12-01

    Whereas the target article stresses the neurobiology and psychology of dreams, this commentary emphasizes that the role of dreams in emotional integration and adaptation contributes to a fuller understanding of dreaming and memory. The dream presented in the target article is used, within the constraints of space, as a possible example of a broader approach to dream material.

  15. Cheetahs have a stronger constitutive innate immunity than leopards.

    Science.gov (United States)

    Heinrich, Sonja K; Hofer, Heribert; Courtiol, Alexandre; Melzheimer, Jörg; Dehnhard, Martin; Czirják, Gábor Á; Wachter, Bettina

    2017-03-23

    As a textbook case for the importance of genetics in conservation, absence of genetic variability at the major histocompatibility complex (MHC) is thought to endanger species viability, since it is considered crucial for pathogen resistance. An alternative view of the immune system inspired by life history theory posits that a strong response should evolve in other components of the immune system if there is little variation in the MHC. In contrast to the leopard (Panthera pardus), the cheetah (Acinonyx jubatus) has a relatively low genetic variability at the MHC, yet free-ranging cheetahs are healthy. By comparing the functional competence of the humoral immune system of both species in sympatric populations in Namibia, we demonstrate that cheetahs have a higher constitutive innate but lower induced innate and adaptive immunity than leopards. We conclude (1) immunocompetence of cheetahs is higher than previously thought; (2) studying both innate and adaptive components of immune systems will enrich conservation science.

  16. Stronger Collaborations Needed for Successful Space Weather Research

    Science.gov (United States)

    Akasofu, Syun-Ichi

    2007-12-01

    One of the purposes of space weather research is to predict when and how the electromagnetic environment around the Earth will be disturbed after specific (solar storms,) which are defined here as various transient solar phenomena that occur at the time of solar flares [Akasofu and Chapman, 1972]. Accurate space weather predictions require an integrating and synthesizing research effort by a close collaboration among solar physicists, interplanetary physicists, magnetospheric physicists, and upper atmosphere physicists. Unfortunately, such integration/synthesis (I/S) projects in the past have often become an umbrella under which individual researchers in the four disciplines pursue only subjects of their own interests, disintegrate into individual projects, and even encourage the trend of infinite specialization because of the potential availability of additional funds.

  17. Effective and Innovative Practices for Stronger Facilities Management.

    Science.gov (United States)

    Banick, Sarah

    2002-01-01

    Describes the five winners of the APPA's Effective & Innovative Practices Award. These facilities management programs and processes were recognized for enhancing service delivery, lowering costs, increasing productivity, improving customer service, generating revenue, or otherwise benefiting the educational institution. (EV)

  18. Medicare and Medicaid: Stronger Enforcement of Nursing Home Requirements Needed.

    Science.gov (United States)

    1987-07-22

    General Unanr . ’, n- ri ...................4" D .. . .. .. ... 1,- . .~ l ’ ’ t ! ! * ’ Executive Summary Pur,,pse One of every four elderly will enter...7 (AO HRD-87-113 Nursing Home Enforeement %% Chapter 1 Introduction One of every four elderly will enter a nursing home during his or her lifetime...during one or more of the five inspections were " treatments to decubitus ulcers that were not done and/or consistently recorded; " essentially bedridden

  19. Teaching Physics Novices at University: A Case for Stronger Scaffolding

    Science.gov (United States)

    Lindstrom, Christine; Sharma, Manjula D.

    2011-01-01

    In 2006 a new type of tutorial, called Map Meeting, was successfully trialled with novice first year physics students at the University of Sydney, Australia. Subsequently, in first semester 2007 a large-scale experiment was carried out with 262 students who were allocated either to the strongly scaffolding Map Meetings or to the less scaffolding…

  20. Stronger at Depth: Jamming Grippers as Deep Sea Sampling Tools.

    Science.gov (United States)

    Licht, Stephen; Collins, Everett; Mendes, Manuel Lopes; Baxter, Christopher

    2017-12-01

    In this work we experimentally demonstrate (a) that the holding strength of universal jamming grippers increases as a function of the jamming pressure to greater than three atmospheres, and (b) that jamming grippers can be operated in the deep sea in ambient pressures exceeding one hundred atmospheres, where such high jamming pressures can be readily achieved. Laboratory experiments in a pressurized, water-filled test cell are used to measure the holding force of a "universal" style jamming gripper as a function of the pressure difference between internal membrane pressure and ambient pressure. Experiments at sea are used to demonstrate that jamming grippers can be installed on, and operated from, remotely operated vehicles at depths in excess of 1200 m. In both experiments, the jamming gripper consists of a latex balloon filled with a mixture of fresh water and ∼200 μm glass beads, which are cheaply available in large quantities as sand blasting media. The use of a liquid, rather than a gas, as the fluid media allows operation of the gripper with a closed-loop fluid system; jamming pressure is controlled with an electrically driven water hydraulic cylinder in the laboratory and with an oil hydraulic-driven large-bore water hydraulic cylinder at sea.

  1. Does Good Corporate Governance Lead to Stronger Productivity Growth?

    NARCIS (Netherlands)

    Koeke, J.; Renneboog, L.D.R.

    2002-01-01

    This study investigates the impact of corporate governance and product market competition on total factor productivity growth in Germany and the UK.For Germany, the prototype of a bank-based governance system, productivity grows faster in firms controlled by financial institutions (in particular,

  2. Natural resistance to ascorbic acid induced oxidative stress is mainly mediated by catalase activity in human cancer cells and catalase-silencing sensitizes to oxidative stress

    Directory of Open Access Journals (Sweden)

    Klingelhoeffer Christoph

    2012-05-01

    Full Text Available Abstract Background Ascorbic acid demonstrates a cytotoxic effect by generating hydrogen peroxide, a reactive oxygen species (ROS involved in oxidative cell stress. A panel of eleven human cancer cell lines, glioblastoma and carcinoma, were exposed to serial dilutions of ascorbic acid (5-100 mmol/L. The purpose of this study was to analyse the impact of catalase, an important hydrogen peroxide-detoxifying enzyme, on the resistance of cancer cells to ascorbic acid mediated oxidative stress. Methods Effective concentration (EC50 values, which indicate the concentration of ascorbic acid that reduced the number of viable cells by 50%, were detected with the crystal violet assay. The level of intracellular catalase protein and enzyme activity was determined. Expression of catalase was silenced by catalase-specific short hairpin RNA (sh-RNA in BT-20 breast carcinoma cells. Oxidative cell stress induced apoptosis was measured by a caspase luminescent assay. Results The tested human cancer cell lines demonstrated obvious differences in their resistance to ascorbic acid mediated oxidative cell stress. Forty-five percent of the cell lines had an EC50 > 20 mmol/L and fifty-five percent had an EC50 50 of 2.6–5.5 mmol/L, glioblastoma cells were the most susceptible cancer cell lines analysed in this study. A correlation between catalase activity and the susceptibility to ascorbic acid was observed. To study the possible protective role of catalase on the resistance of cancer cells to oxidative cell stress, the expression of catalase in the breast carcinoma cell line BT-20, which cells were highly resistant to the exposure to ascorbic acid (EC50: 94,9 mmol/L, was silenced with specific sh-RNA. The effect was that catalase-silenced BT-20 cells (BT-20 KD-CAT became more susceptible to high concentrations of ascorbic acid (50 and 100 mmol/L. Conclusions Fifty-five percent of the human cancer cell lines tested were unable to protect themselves

  3. Antimalarial Activity of C-10 Substituted Triazolyl Artemisinin.

    Science.gov (United States)

    Park, Gab-Man; Park, Hyun; Oh, Sangtae; Lee, Seokjoon

    2017-12-01

    We synthesized C-10 substituted triazolyl artemisinins by the Huisgen cycloaddition reaction between dihydroartemisinins (2) and variously substituted 1, 2, 3-triazoles (8a-8h). The antimalarial activities of 32 novel artemisinin derivatives were screened against a chloroquine-resistant parasite. Among them, triazolyl artemisinins with electron-withdrawing groups showed stronger antimalarial activities than those shown by the derivatives having electron-donating groups. In particularly, m-chlorotriazolyl artemisinin (9d-12d) showed antimalarial activity equivalent to that of artemisinin and could be a strong drug candidate.

  4. Safety activities in small businesses

    Science.gov (United States)

    Sinclair, Raymond C.; Cunningham, Thomas R.

    2015-01-01

    Background Workplace injuries occur at higher rates in smaller firms than in larger firms, and the number of workplace safety activities appear to be inversely associated with those rates. Predictors of safety activities are rarely studied. Methods This study uses data from a national random survey of firms (n = 722) with less than 250 employees conducted in 2002. Results We found that, regardless of firm size or industry, safety activities were more common in 2002 than they were in a similar 1983 study. Having had an OSHA inspection in the last five years and firm size were stronger predictors of safety activities than industry hazardousness and manager’s perceptions of hazardousness. All four variables were significant predictors (β range .19 to .28; R2 = .27). Conclusions Further progress in the prevention of injuries in small firms will require attention to factors likely subsumed within the firm size variable, especially the relative lack of slack resources that might be devoted to safety activities. PMID:26339124

  5. STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis

    Science.gov (United States)

    Li, Ping; Harris, David; Liu, Zhiming; Rozovski, Uri; Ferrajoli, Alessandra; Wang, Yongtao; Bueso-Ramos, Carlos; Hazan-Halevy, Inbal; Grgurevic, Srdana; Wierda, William; Burger, Jan; O'Brien, Susan; Faderl, Stefan; Keating, Michael; Estrov, Zeev

    2014-01-01

    Here it was determined that Chronic Lymphocytic Leukemia (CLL) cells express the α-subunit but not the β-subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSFR/CSF3R). GM-CSFRα was detected on the surface, in the cytosol, and the nucleus of CLL cells via confocal microscopy, cell fractionation, and GM-CSFRα antibody epitope mapping. Because STAT3 is frequently activated in CLL and the GM-CSFRα promoter harbors putative STAT3 consensus binding sites, MM1 cells were transfected with truncated forms of the GM-CSFRα promoter, then stimulated with IL-6 to activate STAT3 to identify STAT3 binding sites. Chromatin immunoprecipitation (ChIP) and an electoromobility shift assay (EMSA) confirmed STAT3 occupancy to those promoter regions in both IL-6 stimulated MM1 and CLL cells. Transfection of MM1 cells with STAT3 siRNA or CLL cells with STAT3 shRNA significantly down-regulated GM-CSFRα mRNA and protein levels. RNA transcripts, involved in regulating cell-survival pathways, and the proteins KAP1 (TRIM28) and ISG15 co-immunoprecipitated with GM-CSFRα. GM-CSFRα-bound KAP1 enhanced the transcriptional activity of STAT3, whereas ISG15 inhibited the NF-κB pathway. Nevertheless, overexpression of GM-CSFRα protected MM1 cells from dexamethasone-induced apoptosis, and GM-CSFRα knockdown induced apoptosis in CLL cells, suggesting that GM-CSFRα provides a ligand-independent survival advantage. PMID:24836891

  6. Constructivist Learning Environment During Virtual and Real Laboratory Activities

    Directory of Open Access Journals (Sweden)

    Ari Widodo

    2017-04-01

    Full Text Available Laboratory activities and constructivism are two notions that have been playing significant roles in science education. Despite common beliefs about the importance of laboratory activities, reviews reported inconsistent results about the effectiveness of laboratory activities. Since laboratory activities can be expensive and take more time, there is an effort to introduce virtual laboratory activities. This study aims at exploring the learning environment created by a virtual laboratory and a real laboratory. A quasi experimental study was conducted at two grade ten classes at a state high school in Bandung, Indonesia. Data were collected using a questionnaire called Constructivist Learning Environment Survey (CLES before and after the laboratory activities. The results show that both types of laboratories can create constructivist learning environments. Each type of laboratory activity, however, may be stronger in improving certain aspects compared to the other. While a virtual laboratory is stronger in improving critical voice and personal relevance, real laboratory activities promote aspects of personal relevance, uncertainty and student negotiation. This study suggests that instead of setting one type of laboratory against the other, lessons and follow up studies should focus on how to combine both types of laboratories to support better learning.

  7. Physical activity: The importance of the extended theory of planned behavior, in type 2 diabetes patients.

    Science.gov (United States)

    Ferreira, Gabriela; Pereira, M Graça

    2017-09-01

    This study focused on the contribution of the extended theory of planned behavior regarding intention to perform physical activity, adherence to physical activity, and its mediator role in the relationship between trust in the physician and adherence to physical activity, in a sample of 120 patients with type 2 diabetes. The results revealed that positive attitudes and perception of control predicted a stronger intention to do physical activity. The intention to do physical activity was the only predictor of adherence to physical activity. Planning mediated the relationship between trust in the physician and adherence. Implications for patients with type 2 diabetes are discussed.

  8. Cultural differences in human brain activity: a quantitative meta-analysis.

    Science.gov (United States)

    Han, Shihui; Ma, Yina

    2014-10-01

    Psychologists have been trying to understand differences in cognition and behavior between East Asian and Western cultures within a single cognitive framework such as holistic versus analytic or interdependent versus independent processes. However, it remains unclear whether cultural differences in multiple psychological processes correspond to the same or different neural networks. We conducted a quantitative meta-analysis of 35 functional MRI studies to examine cultural differences in brain activity engaged in social and non-social processes. We showed that social cognitive processes are characterized by stronger activity in the dorsal medial prefrontal cortex, lateral frontal cortex and temporoparietal junction in East Asians but stronger activity in the anterior cingulate, ventral medial prefrontal cortex and bilateral insula in Westerners. Social affective processes are associated with stronger activity in the right dorsal lateral frontal cortex in East Asians but greater activity in the left insula and right temporal pole in Westerners. Non-social processes induce stronger activity in the left inferior parietal cortex, left middle occipital and left superior parietal cortex in East Asians but greater activations in the right lingual gyrus, right inferior parietal cortex and precuneus in Westerners. The results suggest that cultural differences in social and non-social processes are mediated by distinct neural networks. Moreover, East Asian cultures are associated with increased neural activity in the brain regions related to inference of others' mind and emotion regulation whereas Western cultures are associated with enhanced neural activity in the brain areas related to self-relevance encoding and emotional responses during social cognitive/affective processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Antioxidant, Antibacterial activity and Brine shrimp toxicity test of some Mountainous Lichens from Nepal

    Directory of Open Access Journals (Sweden)

    Babita Paudel

    2012-01-01

    Full Text Available A total of twenty four lichen species belonging to six families were collected from mountainous region of Nepal. The methanol extracts of each species were tested for antimicrobial and antioxidant activitiesin vitro. It was found that extracts of twenty one lichen species were active againstB. subtilis and seven species were active againstS. aureus. Similarly, in DPPH assay, three speciesPeltigera sp.,Cladonia sp., andCanoparmelia sp. showed comparable activity with commercial standard, BHA. In ABTS+ assay, extracts ofParmoterma sp.,Ramalina sp.,Peltigera sp. andCladonia sp. showed stronger activity than ascorbic acid. The observed data after comparison with previously published reports indicated that the high altitude lichens contain stronger antioxidant and antibacterial constituents. Similarly, the methanol extracts ofHeterodermia sp. andRamalina sp. showed comparable toxicity effect with commercial standard berberine chloride indicating a potent source of anticancer drugs.

  10. ERK1/2 signaling plays an important role in topoisomerase II poison-induced G2/M checkpoint activation.

    Science.gov (United States)

    Kolb, Ryan H; Greer, Patrick M; Cao, Phu T; Cowan, Kenneth H; Yan, Ying

    2012-01-01

    Topo II poisons, which target topoisomerase II (topo II) to generate enzyme mediated DNA damage, have been commonly used for anti-cancer treatment. While clinical evidence demonstrate a capability of topo II poisons in inducing apoptosis in cancer cells, accumulating evidence also show that topo II poison treatment frequently results in cell cycle arrest in cancer cells, which was associated with subsequent resistance to these treatments. Results in this report indicate that treatment of MCF-7 and T47D breast cancer cells with topo II poisons resulted in an increased phosphorylation of extracellular signal-regulated kinase 1 and 2 (ERK1/2) and an subsequent induction of G2/M cell cycle arrest. Furthermore, inhibition of ERK1/2 activation using specific inhibitors markedly attenuated the topo II poison-induced G2/M arrest and diminished the topo II poison-induced activation of ATR and Chk1 kinases. Moreover, decreased expression of ATR by specific shRNA diminished topo II poison-induced G2/M arrest but had no effect on topo II poison-induced ERK1/2 activation. In contrast, inhibition of ERK1/2 signaling had little, if any, effect on topo II poison-induced ATM activation. In addition, ATM inhibition by either incubation of cells with ATM specific inhibitor or transfection of cells with ATM specific siRNA did not block topo II poison-induced G2/M arrest. Ultimately, inhibition of ERK1/2 signaling greatly enhanced topo II poison-induced apoptosis. These results implicate a critical role for ERK1/2 signaling in the activation of G2/M checkpoint response following topo II poison treatment, which protects cells from topo II poison-induced apoptosis.

  11. Antioxidant activities of Physalis peruviana.

    Science.gov (United States)

    Wu, Sue-Jing; Ng, Lean-Teik; Huang, Yuan-Man; Lin, Doung-Liang; Wang, Shyh-Shyan; Huang, Shan-Ney; Lin, Chun-Ching

    2005-06-01

    Physalis peruviana (PP) is a widely used medicinal herb for treating cancer, malaria, asthma, hepatitis, dermatitis and rheumatism. In this study, the hot water extract (HWEPP) and extracts prepared from different concentrations of ethanol (20, 40, 60, 80 and 95% EtOH) from the whole plant were evaluated for antioxidant activities. Results displayed that at 100 mug/ml, the extract prepared from 95% EtOH exhibited the most potent inhibition rate (82.3%) on FeCl2-ascorbic acid induced lipid peroxidation in rat liver homogenate. At concentrations 10-100 microg/ml, this extract also demonstrated the strongest superoxide anion scavenging and inhibitory effect on xanthine oxidase activities. In general, the ethanol extracts revealed a stronger antioxidant activity than alpha-tocopherol and HWEPP. Compared to alpha-tocopherol, the IC50 value of 95% EtOH PP extract was lower in thiobarbituric acid test (IC50=23.74 microg/ml vs. 26.71 microg/ml), in cytochrome c test (IC50=10.40 microg/ml vs. 13.39 microg/ml) and in xanthine oxidase inhibition test (IC50=8.97 microg/ml vs. 20.68 microg/ml). The present study concludes that ethanol extracts of PP possess good antioxidant activities, and the highest antioxidant properties were obtained from the 95% EtOH PP.

  12. Reframing the Irish activation debate; Accommodating care and safeguarding social rights and choices

    OpenAIRE

    Murphy, Mary

    2008-01-01

    Work activation is a phrase used to describe a policy objective of moving people of working age from a social welfare payment into paid employment. It uses the social welfare system proactively to support, encourage or oblige claimants to participate in work, education or training. In this context a recent government publication - Proposals for Supporting Lone Parents - signals the introduction of a stronger form of work activation for lone parents and low-income mothers, including the introd...

  13. Relationship of physical activity to fundamental movement skills among adolescents.

    Science.gov (United States)

    Okely, A D; Booth, M L; Patterson, J W

    2001-11-01

    To determine the relationship of participation in organized and nonorganized physical activity with fundamental movement skills among adolescents. Male and female children in Grade 8 (mean age, 13.3 yr) and Grade 10 (mean age, 15.3 yr) were assessed on six fundamental movement skills (run, vertical jump, catch, overhand throw, forehand strike, and kick). Physical activity was assessed using a self-report recall measure where students reported the type, duration, and frequency of participation in organized physical activity and nonorganized physical activity during a usual week. Multiple regression analysis indicated that fundamental movement skills significantly predicted time in organized physical activity, although the percentage of variance it could explain was small. This prediction was stronger for girls than for boys. Multiple regression analysis showed no relationship between time in nonorganized physical activity and fundamental movement skills. Fundamental movement skills are significantly associated with adolescents' participation in organized physical activity, but predict only a small portion of it.

  14. ELANE mutant-specific activation of different UPR pathways in congenital neutropenia.

    Science.gov (United States)

    Nustede, Rainer; Klimiankou, Maksim; Klimenkova, Olga; Kuznetsova, Inna; Zeidler, Cornelia; Welte, Karl; Skokowa, Julia

    2016-01-01

    A number of studies have demonstrated induction of the unfolded protein response (UPR) in patients with severe congenital neutropenia (CN) harbouring mutations of ELANE, encoding neutrophil elastase. Why UPR is not activated in patients with cyclic neutropenia (CyN) carrying the same ELANE mutations is unclear. We evaluated the effects of ELANE mutants on UPR induction in myeloid cells from CN and CyN patients, and analysed whether additional CN-specific defects contribute to the differences in UPR induction between CN and CyN patients harbouring identical ELANE mutations. We investigated CN-specific p.C71R and p.V174_C181del (NP_001963.1) and CN/CyN-shared p.S126L (NP_001963.1) ELANE mutants. We found that transduction of haematopoietic cells with p.C71R, but not with p.V174_C181del or p.S126L ELANE mutants induced expression of ATF6, and the ATF6 target genes PPP1R15A, DDIT3 and HSPA5. Recently, we found that levels of secretory leucocyte protease inhibitor (SLPI), a natural ELANE inhibitor, are diminished in myeloid cells from CN patients, but not CyN patients. Combined knockdown of SLPI by shRNA and transduction of ELANE p.S126L in myeloid cells led to elevated levels of ATF6, PPP1R15A and HSPA5 RNA, suggesting that normal levels of SLPI in CyN patients might protect them from the UPR induced by mutant ELANE. In summary, different ELANE mutants have different effects on UPR activation, and SLPI regulates the extent of ELANE-triggered UPR. © 2015 John Wiley & Sons Ltd.

  15. Androgen receptor activity modulates responses to cisplatin treatment in bladder cancer.

    Science.gov (United States)

    Kashiwagi, Eiji; Ide, Hiroki; Inoue, Satoshi; Kawahara, Takashi; Zheng, Yichun; Reis, Leonardo O; Baras, Alexander S; Miyamoto, Hiroshi

    2016-08-02

    Cisplatin (CDDP)-based combination chemotherapy remains the mainstream treatment for advanced bladder cancer. However, its efficacy is often limited due to the development of resistance for which underlying mechanisms are poorly understood. Meanwhile, emerging evidence has indicated the involvement of androgen-mediated androgen receptor (AR) signals in bladder cancer progression. In this study, we aimed to investigate whether AR signals have an impact on sensitivity to CDDP in bladder cancer cells. UMUC3-control-short hairpin RNA (shRNA) cells with endogenous AR and AR-negative 647V/5637 cells stably expressing AR were significantly more resistant to CDDP treatment at its pharmacological concentrations, compared with UMUC3-AR-shRNA and 647V-vector/5637-vector control cells, respectively. A synthetic androgen R1881 significantly reduced CDDP sensitivity in UMUC3, 647V-AR, or 5637-AR cells, and the addition of an anti-androgen hydroxyflutamide inhibited the effect of R1881. In these AR-positive cells, R1881 treatment also induced the expression levels of NF-κB, which is known to involve CDDP resistance, and its phosphorylated form, as well as nuclear translocation of NF-κB. In CDDP-resistant bladder cancer sublines established following long-term culture with CDDP, the expression levels of AR as well as NF-κB and phospho-NF-κB were considerably elevated, compared with respective control sublines. In bladder cancer specimens, there was a strong trend to correlate between AR positivity and chemoresistance. These results suggest that AR activation correlates with CDDP resistance presumably via modulating NF-κB activity in bladder cancer cells. Targeting AR during chemotherapy may thus be a useful strategy to overcome CDDP resistance in patients with AR-positive bladder cancer.

  16. Structural studies of some activated carbons with different radon adsorption ability by X-ray diffraction techniques

    International Nuclear Information System (INIS)

    Wang Qingbo; Qu Jingyuan; Zhu Wenkai; Cheng Jinxing; Zhou Baichang

    2010-01-01

    Four different activated carbons with different radon adsorption ability were analyzed by X-ray diffraction techniques. Micro crystal parameters were calculated by Scherrer and Hirsch equations. The results show that the activated carbon with micro crystal parameters at =1.7 nm, =1.9 nm, average layers =4 has the stronger adsorption ability in the for carbon samples, which can be referred when developing activated carbons for radon adsorption. (authors)

  17. Sex differences in neural activation to facial expressions denoting contempt and disgust.

    Science.gov (United States)

    Aleman, André; Swart, Marte

    2008-01-01

    The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt) than women. We performed an experiment using functional magnetic resonance imaging (fMRI), in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus), anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions), in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our results suggest a

  18. Sex Differences in Neural Activation to Facial Expressions Denoting Contempt and Disgust

    Science.gov (United States)

    Aleman, André; Swart, Marte

    2008-01-01

    The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt) than women. We performed an experiment using functional magnetic resonance imaging (fMRI), in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus), anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions), in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our results suggest a

  19. Sex differences in neural activation to facial expressions denoting contempt and disgust.

    Directory of Open Access Journals (Sweden)

    André Aleman

    Full Text Available The facial expression of contempt has been regarded to communicate feelings of moral superiority. Contempt is an emotion that is closely related to disgust, but in contrast to disgust, contempt is inherently interpersonal and hierarchical. The aim of this study was twofold. First, to investigate the hypothesis of preferential amygdala responses to contempt expressions versus disgust. Second, to investigate whether, at a neural level, men would respond stronger to biological signals of interpersonal superiority (e.g., contempt than women. We performed an experiment using functional magnetic resonance imaging (fMRI, in which participants watched facial expressions of contempt and disgust in addition to neutral expressions. The faces were presented as distractors in an oddball task in which participants had to react to one target face. Facial expressions of contempt and disgust activated a network of brain regions, including prefrontal areas (superior, middle and medial prefrontal gyrus, anterior cingulate, insula, amygdala, parietal cortex, fusiform gyrus, occipital cortex, putamen and thalamus. Contemptuous faces did not elicit stronger amygdala activation than did disgusted expressions. To limit the number of statistical comparisons, we confined our analyses of sex differences to the frontal and temporal lobes. Men displayed stronger brain activation than women to facial expressions of contempt in the medial frontal gyrus, inferior frontal gyrus, and superior temporal gyrus. Conversely, women showed stronger neural responses than men to facial expressions of disgust. In addition, the effect of stimulus sex differed for men versus women. Specifically, women showed stronger responses to male contemptuous faces (as compared to female expressions, in the insula and middle frontal gyrus. Contempt has been conceptualized as signaling perceived moral violations of social hierarchy, whereas disgust would signal violations of physical purity. Thus, our

  20. Active Teachers - Active Students

    DEFF Research Database (Denmark)

    as an initiative from the Polytechnic in Nantes, France and the University the Los Andes in Bogota, Colombia. The objective was to start a world wide collaboration allowing teachers in engineering to learn from each other about their experiences with active learning. In this thirteenth edition, ALE joins forces...... with the International Research Symposium on Problem Based Learning (IRSPB) and the International Symposium on Project Approaches in Engineering Education (PAEE) to organise the first International Joint Conference on the Learner in Engineering Education (IJCLEE 2015) hosted by Mondragon University, in San Sebastian...

  1. Is activation analysis still active?

    International Nuclear Information System (INIS)

    Chai Zhifang

    2001-01-01

    This paper reviews some aspects of neutron activation analysis (NAA), covering instrumental neutron activation analysis (INAA), k 0 method, prompt gamma-ray neutron activation analysis (PGNAA), radiochemical neutron activation analysis (RNAA) and molecular activation analysis (MAA). The comparison of neutron activation analysis with other analytical techniques are also made. (author)

  2. Activating the Wnt/β-Catenin Pathway for the Treatment of Melanoma--Application of LY2090314, a Novel Selective Inhibitor of Glycogen Synthase Kinase-3.

    Directory of Open Access Journals (Sweden)

    Jennifer M Atkinson

    Full Text Available It has previously been observed that a loss of β-catenin expression occurs with melanoma progression and that nuclear β-catenin levels are inversely proportional to cellular proliferation, suggesting that activation of the Wnt/β-catenin pathway may provide benefit for melanoma patients. In order to further probe this concept we tested LY2090314, a potent and selective small-molecule inhibitor with activity against GSK3α and GSK3β isoforms. In a panel of melanoma cell lines, nM concentrations of LY2090314 stimulated TCF/LEF TOPFlash reporter activity, stabilized β-catenin and elevated the expression of Axin2, a Wnt responsive gene and marker of pathway activation. Cytotoxicity assays revealed that melanoma cell lines are very sensitive to LY2090314 in vitro (IC50 ~10 nM after 72hr of treatment in contrast to other solid tumor cell lines (IC50 >10 uM as evidenced by caspase activation and PARP cleavage. Cell lines harboring mutant B-RAF or N-RAS were equally sensitive to LY2090314 as were those with acquired resistance to the BRAF inhibitor Vemurafenib. shRNA studies demonstrated that β-catenin stabilization is required for apoptosis following treatment with the GSK3 inhibitor since the sensitivity of melanoma cell lines to LY290314 could be overcome by β-catenin knockdown. We further demonstrate that in vivo, LY2090314 elevates Axin2 gene expression after a single dose and produces tumor growth delay in A375 melanoma xenografts with repeat dosing. The activity of LY2090314 in preclinical models suggests that the role of Wnt activators for the treatment of melanoma should be further explored.

  3. Young Children's Screen Activities, Sweet Drink Consumption and Anthropometry

    DEFF Research Database (Denmark)

    Olafsdottir, Steingerdur; Ahrens, Wolfgang; Siani, Alfonso

    2014-01-01

    Background/Objectives: This longitudinal study describes the relationship between young children’s screen time, dietary habits and anthropometric measures. The hypothesis was that television viewing and other screen activities at baseline result in increased consumption of sugar-sweetened beverages...... children, both on their consumption of sugary drinks and on an increase in BMI and central obesity. Our findings suggest that television viewing seems to have a stronger effect on food habits and anthropometry than other screen activities in this age group....

  4. Relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis.

    Science.gov (United States)

    Ehrlich-Jones, Linda; Lee, Jungwha; Semanik, Pamela; Cox, Cheryl; Dunlop, Dorothy; Chang, Rowland W

    2011-12-01

    To determine the relationship between beliefs, motivation, and worries about physical activity and physical activity participation in persons with rheumatoid arthritis (RA). A cross-sectional study used baseline data from 185 adults with RA enrolled in a randomized clinical trial assessing the effectiveness of an intervention to promote physical activity. Data included patients' self-reported beliefs that physical activity can be beneficial for their disease, motivation for physical activity participation, worries about physical activity participation, and average daily accelerometer counts of activity over a week's time. Body mass index (BMI), sex, age, race, and disease activity were measured as potential statistical moderators of physical activity. Physical activity participation was greater for those with higher scores on scales measuring beliefs that physical activity is beneficial for their disease (P for trend = 0.032) and motivation for physical activity participation (P for trend = 0.007) when adjusted for age, sex, BMI, race, and disease activity. There was a positive but nonsignificant trend in physical activity participation in relation to worries. Stronger beliefs that physical activity can be helpful for managing disease and increased motivation to engage in physical activity are related to higher levels of physical activity participation. These data provide a preliminary empirical rationale for why interventions targeting these concepts should lead to improved physical activity participation in adults with RA. Copyright © 2011 by the American College of Rheumatology.

  5. ShRNA en tratamiento in vivo: perspectiva terapéutica en la enfermedad de Alzheimer

    Directory of Open Access Journals (Sweden)

    Kenneth Kosik

    2005-03-01

    Full Text Available Las enfermedades neurodegenerativas son un problema creciente en la población senil, con más de 20 millones de personas afectadas por la enfermedad de Alzheimer (EA esporádica en el mundo y más de 5.000 portadores de EA familiar sólo en el departamento de Antioquia.

  6. Serotonin transporter genotype (5-HTTLPR): effects of neutral and undefined conditions on amygdala activation.

    Science.gov (United States)

    Heinz, Andreas; Smolka, Michael N; Braus, Dieter F; Wrase, Jana; Beck, Anne; Flor, Herta; Mann, Karl; Schumann, Gunter; Büchel, Christian; Hariri, Ahmad R; Weinberger, Daniel R

    2007-04-15

    A polymorphism of the human serotonin transporter gene (SCL6A4) has been associated with serotonin transporter expression and with processing of aversive stimuli in the amygdala. Functional imaging studies show that during the presentation of aversive versus neutral cues, healthy carriers of the short (s) allele showed stronger amygdala activation than long (l) carriers. However, a recent report suggested that this interaction is driven by amygdala deactivation during presentation of neutral stimuli in s carriers. Functional MRI was used to assess amygdala activation during the presentation of a fixation cross or affectively aversive or neutral visual stimuli in 29 healthy men. Amygdala activation was increased in s carriers during undefined states such as the presentation of a fixation cross compared with emotionally neutral conditions. This finding suggests that s carriers show stronger amygdala reactivity to stimuli and contexts that are relatively uncertain, which we propose are stressful.

  7. Brain activations to emotional pictures are differentially associated with valence and arousal ratings

    Directory of Open Access Journals (Sweden)

    Antje B M Gerdes

    2010-10-01

    Full Text Available Several studies have investigated the neural responses triggered by emotional pictures, but the specificity of the involved structures such as the amygdala or the ventral striatum is still under debate. Furthermore, only few studies examined the association of stimuli’s valence and arousal and the underlying brain responses. Therefore, we investigated brain responses with functional magnetic resonance imaging of 17 healthy subjects to pleasant and unpleasant affective pictures with comparable arousal levels and afterwards assessed ratings of valence and arousal. As expected, unpleasant pictures strongly activated the right and left amygdala, the right hippocampus, and the medial occipital lobe, whereas pleasant pictures elicited significant activations in left occipital regions, and in parts of the medial temporal lobe. The direct comparison of unpleasant and pleasant pictures which were comparable in arousal clearly indicated stronger amygdala activation in response to the unpleasant pictures. Most important, correlational analyses revealed on the one hand that the arousal of unpleasant pictures was significantly associated with activations in the right amygdala and the left caudate body. On the other hand, valence of pleasant pictures was significantly correlated with activations in the right caudate head, extending to the nucleus accumbens (NAcc and the left dorso-lateral prefrontal cortex. These findings support the notion that the amygdala is primarily involved in processing of unpleasant stimuli, and the stronger the more arousing the stimuli are, whereas reward-related structures like the NAcc primarily responds to pleasant stimuli, the stronger the more positive the valence of these stimuli is.

  8. Hypoxia promotes uveal melanoma invasion through enhanced Notch and MAPK activation.

    Directory of Open Access Journals (Sweden)

    Laura Asnaghi

    Full Text Available The transcriptional response promoted by hypoxia-inducible factors has been associated with metastatic spread of uveal melanoma. We found expression of hypoxia-inducible factor 1α (HIF-1α protein in well-vascularized tumor regions as well as in four cell lines grown in normoxia, thus this pathway may be important even in well-oxygenated uveal melanoma cells. HIF-1α protein accumulation in normoxia was inhibited by rapamycin. As expected, hypoxia (1% pO2 further induced HIF-1α protein levels along with its target genes VEGF and LOX. Growth in hypoxia significantly increased cellular invasion of all 5 uveal melanoma lines tested, as did the introduction of an oxygen-insensitive HIF-1α mutant into Mel285 cells with low HIF-1α baseline levels. In contrast, HIF-1α knockdown using shRNA significantly decreased growth in hypoxia, and reduced by more than 50% tumor invasion in four lines with high HIF-1α baseline levels. Pharmacologic blockade of HIF-1α protein expression using digoxin dramatically suppressed cellular invasion both in normoxia and in hypoxia. We found that Notch pathway components, including Jag1-2 ligands, Hes1-Hey1 targets and the intracellular domain of Notch1, were increased in hypoxia, as well as the phosphorylation levels of Erk1-2 and Akt. Pharmacologic and genetic inhibition of Notch largely blocked the hypoxic induction of invasion as did the pharmacologic suppression of Erk1-2 activity. In addition, the increase in Erk1-2 and Akt phosphorylation by hypoxia was partially reduced by inhibiting Notch signaling. Our findings support the functional importance of HIF-1α signaling in promoting the invasive capacity of uveal melanoma cells in both hypoxia and normoxia, and suggest that pharmacologically targeting HIF-1α pathway directly or through blockade of Notch or Erk1-2 pathways can slow tumor spread.

  9. Resveratrol induces growth arrest and apoptosis through activation of FOXO transcription factors in prostate cancer cells.

    Directory of Open Access Journals (Sweden)

    Qinghe Chen

    2010-12-01

    Full Text Available Resveratrol, a naturally occurring phytopolyphenol compound, has attracted extensive interest in recent years because of its diverse pharmacological characteristics. Although resveratrol possesses chemopreventive properties against several cancers, the molecular mechanisms by which it inhibits cell growth and induces apoptosis have not been clearly understood. The present study was carried out to examine whether PI3K/AKT/FOXO pathway mediates the biological effects of resveratrol.Resveratrol inhibited the phosphorylation of PI3K, AKT and mTOR. Resveratrol, PI3K inhibitors (LY294002 and Wortmannin and AKT inhibitor alone slightly induced apoptosis in LNCaP cells. These inhibitors further enhanced the apoptosis-inducing potential of resveratrol. Overexpression of wild-type PTEN slightly induced apoptosis. Wild type PTEN and PTEN-G129E enhanced resveratrol-induced apoptosis, whereas PTEN-G129R had no effect on proapoptotic effects of resveratrol. Furthermore, apoptosis-inducing potential of resveratrol was enhanced by dominant negative AKT, and inhibited by wild-type AKT and constitutively active AKT. Resveratrol has no effect on the expression of FKHR, FKHRL1 and AFX genes. The inhibition of FOXO phosphorylation by resveratrol resulted in its nuclear translocation, DNA binding and transcriptional activity. The inhibition of PI3K/AKT pathway induced FOXO transcriptional activity resulting in induction of Bim, TRAIL, p27/KIP1, DR4 and DR5, and inhibition of cyclin D1. Similarly, resveratrol-induced FOXO transcriptional activity was further enhanced when activation of PI3K/AKT pathway was blocked. Over-expression of phosphorylation deficient mutants of FOXO proteins (FOXO1-TM, FOXO3A-TM and FOXO4-TM induced FOXO transcriptional activity, which was further enhanced by resveratrol. Inhibition of FOXO transcription factors by shRNA blocked resveratrol-induced upregulation of Bim, TRAIL, DR4, DR5, p27/KIP1 and apoptosis, and inhibition of cyclin D1 by

  10. Future role and significance of space activities in reflection of global social, technological and economic trends

    Science.gov (United States)

    Diekmann, Andreas; Richarz, Hans.-Peter

    The paper describes the interrelation of space activities and global socio-economic trends like "globalisation of markets" and "renaissance of fine arts". The interrelation reveals the economic strategic, technological and scientific dimension of space activities and their benefits to mankind. Then, the significance and perspectives of space activities in these dimensions are examined in more detail. The paper calls (1) for a more visible initiative to employ space activities to tackle urgent questions of global change and development, and (2) for a stronger impetus to secure European economic position in space sector as a key industry of the 21st century.

  11. mTOR inhibition in macrophages of asymptomatic HIV+ persons reverses the decrease in TLR4-mediated TNFα release through prolongation of MAPK pathway activation1

    Science.gov (United States)

    Li, Xin; Han, Xinbing; Llano, Juliana; Bole, Medhavi; Zhou, Xiuqin; Swan, Katharine; Anandaiah, Asha; Nelson, Benjamin; Patel, Naimish R.; Reinach, Peter S.; Koziel, Henry; Tachado, Souvenir D.

    2011-01-01

    Toll-like receptor 4 (TLR4) mediated signaling is significantly impaired in macrophages from HIV+ persons predominantly due to altered MyD88-dependent pathway signaling caused in part by constitutive activation of PI3K. Here we assessed in these macrophages if the blunted increase in TLR4-mediated TNFα release induced by lipid A are associated with PI3K-induced upregulation of mammalian target of rapamycin (mTOR) activity. mTOR inhibition with rapamycin enhanced TLR4-mediated TNFα release, but instead suppressed anti-inflammatory IL-10 release. Targeted gene silencing of mTOR in macrophages resulted in lipid A-induced TNFα and IL-10 release patterns similar to those induced by rapamycin. Rapamycin restored MyD88-IRAK interaction in a dose-dependent manner. Targeted gene silencing of MyD88 (shRNA) and mTOR (RNAi) inhibition resulted in TLR4-mediated p70s6K activation and enhanced TNFα release, whereas IL-10 release was inhibited in both silenced and non-silenced HIV+ macrophages. Furthermore, mTOR inhibition augmented lipid A-induced TNFα release through enhanced and prolonged phosphorylation of ERK1/2 and JNK1/2 MAP kinases, which was associated with time-dependent MKP-1 destabilization. Taken together, impaired TLR4-mediated TNFα release in HIV+ macrophages is attributable in part to mTOR activation by constitutive PI3K expression in a MyD88-dependent signaling pathway. These changes result in MKP-1 stabilization, which shortens and blunts MAP kinase activation. mTOR inhibition may serve as a potential therapeutic target to upregulate macrophage innate immune host defense responsiveness in HIV+ persons. PMID:22025552

  12. TRPP2 and TRPV4 form an EGF-activated calcium permeable channel at the apical membrane of renal collecting duct cells.

    Directory of Open Access Journals (Sweden)

    Zhi-Ren Zhang

    Full Text Available Regulation of apical calcium entry is important for the function of principal cells of the collecting duct. However, the molecular identity and the regulators of the transporter/channel, which is responsible for apical calcium entry and what factors regulate the calcium conduction remain unclear.We report that endogenous TRPP2 and TRPV4 assemble to form a 23-pS divalent cation-permeable non-selective ion channel at the apical membrane of renal principal cells of the collecting duct. TRPP2\\TRPV4 channel complex was identified by patch-clamp, immunofluorescence and co-immunprecipitation studies in both principal cells that either possess normal cilia (cilia (+ or in which cilia are absent (cilia (-. This channel has distinct biophysical and pharmacological and regulatory profiles compared to either TRPP2 or TRPV4 channels. The rate of occurrence detected by patch clamp was higher in cilia (- compared to cilia (+ cells. In addition, shRNA knockdown of TRPP2 increased the prevalence of TRPV4 channel activity while knockdown of TRPV4 resulted in TRPP2 activity and knockdown of both proteins vastly decreased the 23-pS channel activity. Epidermal growth factor (EGF stimulated TRPP2\\TRPV4 channel through the EGF receptor (EGFR tyrosine kinase-dependent signaling. With loss of cilia, apical EGF treatment resulted in 64-fold increase in channel activity in cilia (- but not cilia (+ cells. In addition EGF increased cell proliferation in cilia (- cell that was dependent upon TRPP2\\TRPV4 channel mediated increase in intracellular calcium.We conclude that in the absence of cilia, an EGF activated TRPP2\\TRPV4 channel may play an important role in increased cell proliferation and cystogenesis.

  13. Physical Activity and Adiposity Markers at Older Ages: Accelerometer Vs Questionnaire Data

    Science.gov (United States)

    Sabia, Séverine; Cogranne, Pol; van Hees, Vincent T.; Bell, Joshua A.; Elbaz, Alexis; Kivimaki, Mika; Singh-Manoux, Archana

    2015-01-01

    Objective Physical activity is critically important for successful aging, but its effect on adiposity markers at older ages is unclear as much of the evidence comes from self-reported data on physical activity. We assessed the associations of questionnaire-assessed and accelerometer-assessed physical activity with adiposity markers in older adults. Design/Setting/Participants This was a cross-sectional study on 3940 participants (age range 60-83 years) of the Whitehall II study who completed a 20-item physical activity questionnaire and wore a wrist-mounted accelerometer for 9 days in 2012 and 2013. Measurements Total physical activity was estimated using metabolic equivalent hours/week for the questionnaire and mean acceleration for the accelerometer. Time spent in moderate-and-vigorous physical activity (MVPA) was also assessed by questionnaire and accelerometer. Adiposity assessment included body mass index, waist circumference, and fat mass index. Fat mass index was calculated as fat mass/height² (kg/m²), with fat mass estimated using bioimpedance. Results Greater total physical activity was associated with lower adiposity for all adiposity markers in a dose-response manner. In men, the strength of this association was 2.4 to 2.8 times stronger with the accelerometer than with questionnaire data. In women, it was 1.9 to 2.3 times stronger. For MVPA, questionnaire data in men suggested no further benefit for adiposity markers past 1 hour/week of activity. This was not the case for accelerometer-assessed MVPA where, for example, compared with men undertaking physical activity with adiposity markers in older adults was stronger when physical activity was assessed by accelerometer compared with questionnaire, suggesting that physical activity might be more important for adiposity than previously estimated. PMID:25752539

  14. Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells

    Directory of Open Access Journals (Sweden)

    Lin JF

    2017-05-01

    Full Text Available Ji-Fan Lin,1 Yi-Chia Lin,2 Te-Fu Tsai,2,3 Hung-En Chen,2 Kuang-Yu Chou,2,3 Thomas I-Sheng Hwang2–4 1Central Laboratory, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, 2Division of Urology, School of Medicine, Fu-Jen Catholic University, New Taipei, 3Division of Urology, Department of Surgery, Shin Kong Wu Ho-Su Memorial Hospital, 4Department of Urology, Taipei Medical University, Taipei, Taiwan Purpose: Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC. Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines.Materials and methods: Human BC cells (5637 and T24 were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1, chloroquine (CQ, and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12 were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation.Results: Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose- and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of

  15. Distinct patterns of brain activity characterise lexical activation and competition in spoken word production.

    Directory of Open Access Journals (Sweden)

    Vitória Piai

    Full Text Available According to a prominent theory of language production, concepts activate multiple associated words in memory, which enter into competition for selection. However, only a few electrophysiological studies have identified brain responses reflecting competition. Here, we report a magnetoencephalography study in which the activation of competing words was manipulated by presenting pictures (e.g., dog with distractor words. The distractor and picture name were semantically related (cat, unrelated (pin, or identical (dog. Related distractors are stronger competitors to the picture name because they receive additional activation from the picture relative to other distractors. Picture naming times were longer with related than unrelated and identical distractors. Phase-locked and non-phase-locked activity were distinct but temporally related. Phase-locked activity in left temporal cortex, peaking at 400 ms, was larger on unrelated than related and identical trials, suggesting differential activation of alternative words by the picture-word stimuli. Non-phase-locked activity between roughly 350-650 ms (4-10 Hz in left superior frontal gyrus was larger on related than unrelated and identical trials, suggesting differential resolution of the competition among the alternatives, as reflected in the naming times. These findings characterise distinct patterns of activity associated with lexical activation and competition, supporting the theory that words are selected by competition.

  16. Esterase activities of intracellular extracts of wild strains of lactic acid bacteria isolated from Serra da Estrela cheese

    OpenAIRE

    Macedo, Angela C.; Tavares, Tânia G.; Malcata, F. Xavier

    2003-01-01

    Lactococcus lactis subsp. lactis strain ESB110019 and Lactobacillus plantarum strain ESB5004, novel strains that were previously isolated from the wild adventitious microflora of certified Serra da Estrela cheeses, were assayed for esterase activity using, as substrates, ortho- and para-nitrophenyl derivatives of fatty acids. Both strains preferentially hydrolyzed short-chain fatty acids; L. lactis ESB110019 exhibited a stronger esterase activity than Lb. plantarum ESB5004 and cleaved the p-n...

  17. Inhibitory effect of burdock leaves on elastase and tyrosinase activity

    Science.gov (United States)

    Horng, Chi-Ting; Wu, Hsing-Chen; Chiang, Ni-Na; Lee, Chiu-Fang; Huang, Yu-Syuan; Wang, Hui-Yun; Yang, Jai-Sing; Chen, Fu-An

    2017-01-01

    Burdock (Arctium lappa L.) leaves generate a considerable amount of waste following burdock root harvest in Taiwan. To increase the use of burdock leaves, the present study investigated the optimal methods for producing burdock leaf extract (BLE) with high antioxidant polyphenolic content, including drying methods and solvent extraction concentration. In addition, the elastase and tyrosinase inhibitory activity of BLE was examined. Burdock leaves were dried by four methods: Shadow drying, oven drying, sun drying and freeze-drying. The extract solution was then subjected to total polyphenol content analysis and the method that produced BLE with the highest amount of total antioxidant components was taken forward for further analysis. The 1,1-diphenyl-2-pycrylhydrazyl scavenging, antielastase and antityrosinase activity of the BLE were measured to enable the evaluation of the antioxidant and skin aging-associated enzyme inhibitory activities of BLE. The results indicated that the total polyphenolic content following extraction with ethanol (EtOH) was highest using the freeze-drying method, followed by the oven drying, shadow drying and sun drying methods. BLE yielded a higher polyphenol content and stronger antioxidant activity as the ratio of the aqueous content of the extraction solvent used increased. BLE possesses marked tyrosinase and elastase inhibitory activities, with its antielastase activity notably stronger compared with its antityrosinase activity. These results indicate that the concentration of the extraction solvent was associated with the antioxidant and skin aging-associated enzyme inhibitory activity of BLE. The reactive oxygen species scavenging theory of skin aging may explain the tyrosinase and elastase inhibitory activity of BLE. In conclusion, the optimal method for obtaining BLE with a high antioxidant polyphenolic content was freeze-drying followed by 30–50% EtOH extraction. In addition, the antielastase and antityrosinase activities of the

  18. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    International Nuclear Information System (INIS)

    Peng, Hui; Wang, Huihui; Xue, Peng; Hou, Yongyong; Dong, Jian; Zhou, Tong; Qu, Weidong; Peng, Shuangqing; Li, Jin; Carmichael, Paul L.; Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2016-01-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As 2 O 3 ), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As 2 O 3 -challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As 2 O 3 -induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As 2 O 3 -induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As 2 O 3 in AML cells. • Sensitization of THP-1 cells to As 2 O 3 toxicity by ethionamide is NRF2-dependent.

  19. Age-specific activation of cerebral areas in motor imagery - a fMRI study

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Li [Chongqing University, Key Laboratory of Biorheological Science and Technology of Ministry of Education, Bioengineering College, Chongqing (China); Third Military Medical University, Department of Medical Image, College of Biomedical Engineering, Chongqing (China); Qiu, Mingguo; Zhang, Jingna; Zhang, Ye; Sang, Linqiong [Third Military Medical University, Department of Medical Image, College of Biomedical Engineering, Chongqing (China); Liu, Chen; Yang, Jun [Third Military Medical University, Department of Radiology, Southwest Hospital, Chongqing (China); Yan, Rubing [Third Military Medical University, Department of Rehabilitation, Southwest Hospital, Chongqing (China); Zheng, Xiaolin [Chongqing University, Key Laboratory of Biorheological Science and Technology of Ministry of Education, Bioengineering College, Chongqing (China)

    2014-04-15

    The objectives of this study were to study the age-specific activation patterns of cerebral areas during motor execution (ME) and motor imaging (MI) of the upper extremities and to discuss the age-related neural mechanisms associated with ME or MI. The functional magnetic resonance imaging technique was used to monitor the pattern and intensity of brain activation during the ME and MI of the upper extremities in 20 elderly (>50 years) and 19 young healthy subjects (<25 years). No major differences were identified regarding the activated brain areas during ME or MI between the two groups; however, a minor difference was noted. The intensity of the activated brain area during ME was stronger in the older group than in the younger group, while the results with MI were the opposite. The posterior central gyrus and supplementary motor area during MI were more active in the younger group than in the older group. The putamen, lingual, and so on demonstrated stronger activation during dominant hand MI in the older group. The results of this study revealed that the brain structure was altered and that neuronal activity was attenuated with age, and the cerebral cortex and subcortical tissues were found to be over-activated to achieve the same level of ME and MI, indicating that the activating effects of the left hemisphere enhanced with age, whereas the inhibitory effects declined during ME, and activation of the right hemisphere became more difficult during MI. (orig.)

  20. Age-specific activation of cerebral areas in motor imagery - a fMRI study

    International Nuclear Information System (INIS)

    Wang, Li; Qiu, Mingguo; Zhang, Jingna; Zhang, Ye; Sang, Linqiong; Liu, Chen; Yang, Jun; Yan, Rubing; Zheng, Xiaolin

    2014-01-01

    The objectives of this study were to study the age-specific activation patterns of cerebral areas during motor execution (ME) and motor imaging (MI) of the upper extremities and to discuss the age-related neural mechanisms associated with ME or MI. The functional magnetic resonance imaging technique was used to monitor the pattern and intensity of brain activation during the ME and MI of the upper extremities in 20 elderly (>50 years) and 19 young healthy subjects (<25 years). No major differences were identified regarding the activated brain areas during ME or MI between the two groups; however, a minor difference was noted. The intensity of the activated brain area during ME was stronger in the older group than in the younger group, while the results with MI were the opposite. The posterior central gyrus and supplementary motor area during MI were more active in the younger group than in the older group. The putamen, lingual, and so on demonstrated stronger activation during dominant hand MI in the older group. The results of this study revealed that the brain structure was altered and that neuronal activity was attenuated with age, and the cerebral cortex and subcortical tissues were found to be over-activated to achieve the same level of ME and MI, indicating that the activating effects of the left hemisphere enhanced with age, whereas the inhibitory effects declined during ME, and activation of the right hemisphere became more difficult during MI. (orig.)

  1. Activated Charcoal

    Science.gov (United States)

    Common charcoal is made from peat, coal, wood, coconut shell, or petroleum. “Activated charcoal” is similar to common charcoal, but is made especially for use as a medicine. To make activated charcoal, manufacturers heat common ...

  2. Oridonin stabilizes retinoic acid receptor alpha through ROS-activated NF-κB signaling.

    Science.gov (United States)

    Cao, Yang; Wei, Wei; Zhang, Nan; Yu, Qing; Xu, Wen-Bin; Yu, Wen-Jun; Chen, Guo-Qiang; Wu, Ying-Li; Yan, Hua

    2015-04-10

    Retinoic acid receptor alpha (RARα) plays an essential role in the regulation of many biological processes, such as hematopoietic cell differentiation, while abnormal RARα function contributes to the pathogenesis of certain diseases including cancers, especially acute promyelocytic leukemia (APL). Recently, oridonin, a natural diterpenoid isolated from Rabdosia rubescens, was demonstrated to regulate RARα by increasing its protein level. However, the underlying molecular mechanism for this action has not been fully elucidated. In the APL cell line, NB4, the effect of oridonin on RARα protein was analyzed by western blot and real-time quantitative RT-PCR analyses. Flow cytometry was performed to detect intracellular levels of reactive oxygen species (ROS). The association between nuclear factor-kappa B (NF-κB) signaling and the effect of oridonin was assessed using specific inhibitors, shRNA gene knockdown, and immunofluorescence assays. In addition, primary leukemia cells were treated with oridonin and analyzed by western blot in this study. RARα possesses transcriptional activity in the presence of its ligand, all-trans retinoic acid (ATRA). Oridonin remarkably stabilized the RARα protein, which retained transcriptional activity. Oridonin also moderately increased intracellular ROS levels, while pretreatment with the ROS scavenger, N-acetyl-l-cysteine (NAC), dramatically abrogated RARα stabilization by oridonin. More intriguingly, direct exposure to low concentrations of H2O2 also increased RARα protein but not mRNA levels, suggesting a role for ROS in oridonin stabilization of RARα protein. Further investigations showed that NAC antagonized oridonin-induced activation of NF-κB signaling, while the NF-κB signaling inhibitor, Bay 11-7082, effectively blocked the oridonin increase in RARα protein levels. In line with this, over-expression of IκΒα (A32/36), a super-repressor form of IκΒα, or NF-κB-p65 knockdown inhibited oridonin or H2O2-induced

  3. Slow Activity in Focal Epilepsy During Sleep and Wakefulness

    DEFF Research Database (Denmark)

    Pellegrino, Giovanni; Tombini, Mario; Curcio, Giuseppe

    2017-01-01

    Introduction We aimed to test differences between healthy subjects and patients with respect to slow wave activity during wakefulness and sleep. Methods Fifteen patients affected by nonlesional focal epilepsy originating within temporal areas and fourteen matched controls underwent a 24-hour EEG....... The effect was widespread for alpha band and above, while localized over the affected hemisphere for delta (sleep cycle 1, P = .006; sleep cycle 2, P = .008; sleep cycle 3, P = .017). The analysis of interhemispheric differences showed that the only frequency band stronger over the affected regions...

  4. Female directors and real activities manipulation: Evidence from China

    Directory of Open Access Journals (Sweden)

    Jin-hui Luo

    2017-06-01

    Full Text Available Unlike previous studies that focus on accrual-based earnings management, this study analyzes real activities manipulation and investigates whether female directors on boards of directors (BoDs affect managers’ real activities manipulation. Using a large sample of 11,831 firm-year observations from Chinese listed companies from the 2000 to 2011 period, we find that higher female participation on BoDs is associated with lower levels of real activities manipulation, and that this negative relationship is stronger when female directors have higher ownership. These results hold for a battery of robustness checks. Overall, our findings indicate that board gender diversity may serve as a substitute mechanism for corporate governance to curb real activities manipulation and thus provide interested stakeholders with higher quality earnings reports.

  5. The Importance of Leisure Activities in the Relationship between Physical Health and Well-Being in a Life Span Sample.

    Science.gov (United States)

    Paggi, Michelle E; Jopp, Daniela; Hertzog, Christopher

    2016-01-01

    Previous studies have examined the relationships between physical health and leisure activities and between leisure activities and well-being, but, to our knowledge, none has examined these relationships simultaneously. This study investigated the relationships between leisure activities, health and well-being considering the role of age, and whether leisure activities mediate the relationship between physical health and well-being. Utilizing a cross-sectional database of 259 adults (ages 18-81 years) who completed several questionnaires, linear regression models and mediation models were tested. Regression analyses indicated that physical health was related to leisure activities and leisure activities were related to well-being. When physical health was measured by subjective ratings, age had a stronger relationship with leisure activities. However, when physical health was indicated by health restrictions, physical health had a stronger relationship with leisure activities than did age. Leisure activities were a partial mediator of the relationship between physical health and well-being. The results demonstrated that the reduction in leisure activities with age has more to do with physical health limitations than with older age itself. In addition, regardless of age, the benefits of physical health for well-being are due in part to the level of leisure activity participation. These results highlight the importance of leisure activities for successful aging throughout the adult life span. Interventions designed to improve well-being through increasing leisure activity participation should take physical health into consideration, particularly for older adults. © 2016 S. Karger AG, Basel.

  6. Antioxidant Activity of Mulberry Fruit Extracts

    Science.gov (United States)

    Arfan, Muhammad; Khan, Rasool; Rybarczyk, Anna; Amarowicz, Ryszard

    2012-01-01

    Phenolic compounds were extracted from the fruits of Morus nigra and Morus alba using methanol and acetone. The sugar-free extracts (SFEs) were prepared using Amberlite XAD-16 column chromatography. All of the SFEs exhibited antioxidant potential as determined by ABTS (0.75–1.25 mmol Trolox/g), DPPH (2,2-diphenyl-1-picrylhydrazyl) (EC50 from 48 μg/mL to 79 μg/mL), and reducing power assays. However, a stronger activity was noted for the SFEs obtained from Morus nigra fruits. These extracts also possessed the highest contents of total phenolics: 164 mg/g (methanolic SFE) and 173 mg/g (acetonic SFE). The presence of phenolic acids and flavonoids in the extracts was confirmed using HPLC method and chlorogenic acid and rutin were found as the dominant phenolic constituents in the SFEs. PMID:22408465

  7. Antioxidant Activity of Mulberry Fruit Extracts

    Directory of Open Access Journals (Sweden)

    Ryszard Amarowicz

    2012-02-01

    Full Text Available Phenolic compounds were extracted from the fruits of Morus nigra and Morus alba using methanol and acetone. The sugar-free extracts (SFEs were prepared using Amberlite XAD-16 column chromatography. All of the SFEs exhibited antioxidant potential as determined by ABTS (0.75–1.25 mmol Trolox/g, DPPH (2,2-diphenyl-1-picrylhydrazyl (EC50 from 48 μg/mL to 79 μg/mL, and reducing power assays. However, a stronger activity was noted for the SFEs obtained from Morus nigra fruits. These extracts also possessed the highest contents of total phenolics: 164 mg/g (methanolic SFE and 173 mg/g (acetonic SFE. The presence of phenolic acids and flavonoids in the extracts was confirmed using HPLC method and chlorogenic acid and rutin were found as the dominant phenolic constituents in the SFEs.

  8. Active ageing

    Directory of Open Access Journals (Sweden)

    Frode F. Jacobsen

    2017-09-01

    Full Text Available Background: The concept of active ageing has been gaining prominence in the Nordic countries and beyond. This has been reflected in policy papers in Norway and other Nordic nations. Aims: The aim of this article is to analyse the topic of active ageing in five Norwegian White Papers (2002 to 2015 and discuss those policy documents in context of relevant research literature. Methods: A qualitative document analyses is employed focusing on how active ageing, and ageing in general, is described and which concepts are employed. No ethical approval was needed. Findings: The general theme of ageing and the specific theme of active ageing are increasingly prominent in the Norwegian White Papers studied. In all documents, some assumptions regarding ageing and active ageing seem implicit, such as independence being more important than (interdependence. ‘Productive’ activities like participation in working life are stressed, while others, like reading, watching TV or watching children playing in the street, are ignored. Conclusions: The policy documents demonstrate that the topic of active ageing is growing in importance. The documents increasingly seem to stress ‘productive’ activities – those related to working life, voluntary work or sports and physical training. They exclude activities that are meaningful for many older people, like watching their grandchildren play or reading books. Implications for practice: Practitioners in older people’s care could consider reflecting on: Government documents dealing with their own practice The prevalent concept of active ageing The trend of active ageing as a facilitating or hindering factor for good care work How present discourse on active ageing may influence their attitude towards frail older persons How they wish to relate to active ageing in their own practice

  9. Stay active and exercise - arthritis

    Science.gov (United States)

    ... around your spine and legs stronger. Ask your health care provider if you can use a stationary bike. Be aware that if you have arthritis of the hip or knee cap, biking can worsen your symptoms. If you are not ...

  10. Immunomodulating Activity of Aronia melanocarpa Polyphenols

    Directory of Open Access Journals (Sweden)

    Giang T. T. Ho

    2014-06-01

    Full Text Available The immunomodulating effects of isolated proanthocyanidin-rich fractions, procyanidins C1, B5 and B2 and anthocyanins of Aronia melanocarpa were investigated. In this work, the complement-modulating activities, the inhibitory activities on nitric oxide (NO production in LPS-induced RAW 264.7 macrophages and effects on cell viability of these polyphenols were studied. Several of the proanthocyanidin-rich fractions, the procyanidins C1, B5 and B2 and the cyanidin aglycone possessed strong complement-fixing activities. Cyanidin 3-glucoside possessed stronger activity than the other anthocyanins. Procyanidins C1, B5 and B2 and proanthocyanidin-rich fractions having an average degree of polymerization (PD of 7 and 34 showed inhibitory activities on NO production in LPS-stimulated RAW 264.7 mouse macrophages. All, except for the fraction containing proanthocyanidins with PD 34, showed inhibitory effects without affecting cell viability. This study suggests that polyphenolic compounds of A. melanocarpa may have beneficial effects as immunomodulators and anti-inflammatory agents.

  11. Cyclooxygenase-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 in breast cancer cells.

    Science.gov (United States)

    Chuang, Chun-Wei; Pan, Mei-Ren; Hou, Ming-Feng; Hung, Wen-Chun

    2013-02-01

    Up-regulation of cyclooxygenase-2 (COX-2) is frequently found in human cancers and is significantly associated with tumor metastasis. Our previous results demonstrate that COX-2 and its metabolite prostaglandin E2 (PGE2) stimulate the expression of CCR7 chemokine receptor via EP2/EP4 receptors to promote lymphatic invasion in breast cancer cells. In this study, we address the underlying mechanism of COX-2/PGE2-induced CCR7 expression. We find that COX-2/PGE2 increase CCR7 expression via the AKT signaling pathway in breast cancer cells. Promoter deletion and mutation assays identify the Sp1 site located at the -60/-57 region of CCR7 gene promoter is critical for stimulation. Chromatin immunoprecipitation (ChIP) assay confirms that in vivo binding of Sp1 to human CCR7 promoter is increased by COX-2 and PGE2. Knockdown of Sp1 by shRNA reduces the induction of CCR7 by PGE2. We demonstrate for the first time that AKT may directly phosphorylate Sp1 at S42, T679, and S698. Phosphorylation-mimic Sp1 protein harboring S42D, T679D, and S698D mutation strongly activates CCR7 expression. In contrast, change of these three residues to alanine completely blocks the induction of CCR7 by PGE2. Pathological investigation demonstrates that CCR7 expression is strongly associated with phospho-AKT and Sp1 in 120 breast cancer tissues. Collectively, our results demonstrate that COX-2 up-regulates CCR7 expression via AKT-mediated phosphorylation and activation of Sp1 and this pathway is highly activated in metastatic breast cancer. Copyright © 2012 Wiley Periodicals, Inc.

  12. Small molecule activators of the Nrf2-HO-1 antioxidant axis modulate heme metabolism and inflammation in BV2 microglia cells.

    Science.gov (United States)

    Foresti, Roberta; Bains, Sandip K; Pitchumony, Tamil Selvi; de Castro Brás, Lisandra E; Drago, Filippo; Dubois-Randé, Jean-Luc; Bucolo, Claudio; Motterlini, Roberto

    2013-10-01

    The nuclear factor erythroid derived 2-related factor 2 (Nrf2) and the antioxidant protein heme oxygenase-1 (HO-1) are crucial components of the cellular stress response. These two systems work together to combat oxidative stress and inflammation and are attractive drug targets for counteracting different pathologies, including neuroinflammation. We aimed to identify the most effective Nrf2/HO-1 activators that modulate the inflammatory response in microglia cells. In the present study, we searched the literature and selected 56 compounds reported to activate Nrf2 or HO-1 and analyzed them for HO-1 induction at 6 and 24h and cytotoxicity in BV2 microglial cells in vitro. Approximately 20 compounds up-regulated HO-1 at the concentrations tested (5-20 μM) with carnosol, supercurcumin, cobalt protoporphyrin-IX and dimethyl fumarate exhibiting the best induction/low cytotoxicity profile. Up-regulation of HO-1 by some compounds resulted in increased cellular bilirubin levels but did not augment the expression of proteins involved in heme synthesis (ALAS 1) or biliverdin reductase. Bilirubin production by HO-1 inducers correlated with their potency in inhibiting nitrite production after challenge with interferon-γ (INF-γ) or lipopolysaccharide (LPS). The compounds down-regulated the inflammatory response (TNF-α, PGE2 and nitrite) more strongly in cells challenged with INF-γ than LPS, and silencing HO-1 or Nrf2 with shRNA differentially affected the levels of inflammatory markers. These findings indicate that some small activators of Nrf2/HO-1 are effective modulators of microglia inflammation and highlight the chemical scaffolds that can serve for the synthesis of potent new derivatives to counteract neuroinflammation and neurodegeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Physical Activity

    DEFF Research Database (Denmark)

    Andersen, Lars Bo; Anderssen, Sigmund Alfred; Wisløff, Ulrik

    2014-01-01

    Andersen LB, Anderssen SA, Wisløff U, Hellénius M-L, Fogelholm M, Ekelund U. (Expert Group) Nordic Nutrition Recommendations 2012. Integrating nutrition and physical activity. Chapter: Physical Activity p. 195-217.Nordic Counsil of Ministers.......Andersen LB, Anderssen SA, Wisløff U, Hellénius M-L, Fogelholm M, Ekelund U. (Expert Group) Nordic Nutrition Recommendations 2012. Integrating nutrition and physical activity. Chapter: Physical Activity p. 195-217.Nordic Counsil of Ministers....

  14. Glutamate acid decarboxylase 1 promotes metastasis of human oral cancer by β-catenin translocation and MMP7 activation

    International Nuclear Information System (INIS)

    Kimura, Ryota; Tanzawa, Hideki; Uzawa, Katsuhiro; Kasamatsu, Atsushi; Koyama, Tomoyoshi; Fukumoto, Chonji; Kouzu, Yukinao; Higo, Morihiro; Endo-Sakamoto, Yosuke; Ogawara, Katsunori; Shiiba, Masashi

    2013-01-01

    Glutamate decarboxylase 1 (GAD1), a rate-limiting enzyme in the production of γ-aminobutyric acid (GABA), is found in the GABAergic neurons of the central nervous system. Little is known about the relevance of GAD1 to oral squamous cell carcinoma (OSCC). We investigated the expression status of GAD1 and its functional mechanisms in OSCCs. We evaluated GAD1 mRNA and protein expressions in OSCC-derived cells using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) and immunoblotting analyses. To assess the critical functions of GAD1, i.e., cellular proliferation, invasiveness, and migration, OSCC-derived cells were treated with the shRNA and specific GAD1 inhibitor, 3-mercaptopropionic acid (3-MPA). GAD1 expression in 80 patients with primary OSCCs was analyzed and compared to the clinicopathological behaviors of OSCC. qRT-PCR and immunoblotting analyses detected frequent up-regulation of GAD1 in OSCC-derived cells compared to human normal oral keratinocytes. Suppression of nuclear localization of β-catenin and MMP7 secretion was observed in GAD1 knockdown and 3-MPA-treated cells. We also found low cellular invasiveness and migratory abilities in GAD1 knockdown and 3-MPA-treated cells. In the clinical samples, GAD1 expression in the primary OSCCs was significantly (P < 0.05) higher than in normal counterparts and was correlated significantly (P < 0.05) with regional lymph node metastasis. Our data showed that up-regulation of GAD1 was a characteristic event in OSCCs and that GAD1 was correlated with cellular invasiveness and migration by regulating β-catenin translocation and MMP7 activation. GAD1 might play an important role in controlling tumoral invasiveness and metastasis in oral cancer

  15. Longitudinal examination of social and environmental influences on motivation for physical activity.

    Science.gov (United States)

    Richards, Elizabeth A; McDonough, Meghan; Fu, Rong

    2017-10-01

    Physical activity behavior is influenced by numerous factors including motivation, social interactions, and the walkability of the environment. To examine how social contexts and environmental features affect physical activity motivational processes across time. Participants (N=104) completed 3 monthly online surveys assessing self-determination theory constructs, social partners in physical activity, neighborhood walkability, and weekly physical activity. Longitudinal path analysis examined the degree to which physical activity was predicted by individual goals, orientation, and autonomy support and whether these associations were meditated by motivation and moderated by the social and environmental contexts of physical activity. The effect of controlled exercise orientations on physical activity was mediated by autonomous motivation. This association was stronger among those who perceived less crime in their neighborhoods. To improve the ability to tailor physical activity counseling it is important to understand how each person views exercise situations and to understand his/her social and neighborhood environments. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Intrinsic resting-state activity predicts working memory brain activation and behavioral performance.

    Science.gov (United States)

    Zou, Qihong; Ross, Thomas J; Gu, Hong; Geng, Xiujuan; Zuo, Xi-Nian; Hong, L Elliot; Gao, Jia-Hong; Stein, Elliot A; Zang, Yu-Feng; Yang, Yihong

    2013-12-01

    Although resting-state brain activity has been demonstrated to correspond with task-evoked brain activation, the relationship between intrinsic and evoked brain activity has not been fully characterized. For example, it is unclear whether intrinsic activity can also predict task-evoked deactivation and whether the rest-task relationship is dependent on task load. In this study, we addressed these issues on 40 healthy control subjects using resting-state and task-driven [N-back working memory (WM) task] functional magnetic resonance imaging data collected in the same session. Using amplitude of low-frequency fluctuation (ALFF) as an index of intrinsic resting-state activity, we found that ALFF in the middle frontal gyrus and inferior/superior parietal lobules was positively correlated with WM task-evoked activation, while ALFF in the medial prefrontal cortex, posterior cingulate cortex, superior frontal gyrus, superior temporal gyrus, and fusiform gyrus was negatively correlated with WM task-evoked deactivation. Further, the relationship between the intrinsic resting-state activity and task-evoked activation in lateral/superior frontal gyri, inferior/superior parietal lobules, superior temporal gyrus, and midline regions was stronger at higher WM task loads. In addition, both resting-state activity and the task-evoked activation in the superior parietal lobule/precuneus were significantly correlated with the WM task behavioral performance, explaining similar portions of intersubject performance variance. Together, these findings suggest that intrinsic resting-state activity facilitates or is permissive of specific brain circuit engagement to perform a cognitive task, and that resting activity can predict subsequent task-evoked brain responses and behavioral performance. Copyright © 2012 Wiley Periodicals, Inc.

  17. Activity report

    International Nuclear Information System (INIS)

    1990-11-01

    The Department of Physics and Measurement Technology, Biology and Chemistry (IFM) presents every year a progress report containing a brief description of activities in research and education within the department. The report is intended as an information for colleagues and institutions. The present report contains activities for the academic year July 1989 to June 1990

  18. The neural coding of expected and unexpected monetary performance outcomes: dissociations between active and observational learning.

    Science.gov (United States)

    Bellebaum, C; Jokisch, D; Gizewski, E R; Forsting, M; Daum, I

    2012-02-01

    Successful adaptation to the environment requires the learning of stimulus-response-outcome associations. Such associations can be learned actively by trial and error or by observing the behaviour and accompanying outcomes in other persons. The present study investigated similarities and differences in the neural mechanisms of active and observational learning from monetary feedback using functional magnetic resonance imaging. Two groups of 15 subjects each - active and observational learners - participated in the experiment. On every trial, active learners chose between two stimuli and received monetary feedback. Each observational learner observed the choices and outcomes of one active learner. Learning performance as assessed via active test trials without feedback was comparable between groups. Different activation patterns were observed for the processing of unexpected vs. expected monetary feedback in active and observational learners, particularly for positive outcomes. Activity for unexpected vs. expected reward was stronger in the right striatum in active learning, while activity in the hippocampus was bilaterally enhanced in observational and reduced in active learning. Modulation of activity by prediction error (PE) magnitude was observed in the right putamen in both types of learning, whereas PE related activations in the right anterior caudate nucleus and in the medial orbitofrontal cortex were stronger for active learning. The striatum and orbitofrontal cortex thus appear to link reward stimuli to own behavioural reactions and are less strongly involved when the behavioural outcome refers to another person's action. Alternative explanations such as differences in reward value between active and observational learning are also discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Preparation and Characterization of Activated Carbon Fibers from Liquefied Wood by ZnCl2 Activation

    Directory of Open Access Journals (Sweden)

    Zhigao Liu

    2016-02-01

    Full Text Available In this study, activated carbon fibers (ACFs were prepared from liquefied wood by chemical activation with ZnCl2, with a particular focus on the effects of temperature and ZnCl2: liquefied wood-based fiber (LWF ratio on yield, porous texture, and surface chemistry. The characterization and properties of these ACFs were investigated by nitrogen adsorption/desorption, Fourier transform infrared (FTIR spectroscopy, and X-ray photoelectron spectroscopy (XPS. When using a 6:1 impregnation ratio, the specific surface area (SBET of the resultant ACFs was as high as 1423 m2/g. The effect of an increase in impregnation ratio on the porosity of ACFs was stronger than that of an increase in the activation temperature. However, the former had a weaker impact on the surface chemistry and structure. It was also found that the yields of ACFs obtained by ZnCl2 activation were higher than those obtained by physical activation. Besides, the prepared ACFs presented higher adsorption than other raw materials in the adsorption test, indicating that ACFs prepared from LWF by ZnCl2 activation could be used as an adsorbent for the adsorption of medium size organic compounds.

  20. Impact of repeated insecticide application on soil microbial activity

    International Nuclear Information System (INIS)

    Xu Bujin; Zhang Yongxi; Chen Meici; Zhu Nanwen; Ming Hong

    2001-01-01

    The effects of repeated insecticide application on soil microbial activity were studied both in a cotton field and in the laboratory. The results of experiment show that there are some effects on soil microbial activities, such as the population of soil microorganisms, soil respiration, dehydrogenase activity and nitrogen fixation. The degree of effects depends on the chemical dosage. Within the range of 0.5-10.0 μg/g air-dry-soil, the higher the concentration, the stronger effect. In this experiment, the effect disappeared within 4, 8 or 16 days after treatment, depending on the dose applied. In field conditions, the situation is more complex and the data of field experiment show greater fluctuation. (author)

  1. Activation of c-MET induces a stem-like phenotype in human prostate cancer.

    Directory of Open Access Journals (Sweden)

    Geert J L H van Leenders

    Full Text Available Prostate cancer consists of secretory cells and a population of immature cells. The function of immature cells and their mutual relation with secretory cells are still poorly understood. Immature cells either have a hierarchical relation to secretory cells (stem cell model or represent an inducible population emerging upon appropriate stimulation of differentiated cells. Hepatocyte Growth Factor (HGF receptor c-MET is specifically expressed in immature prostate cells. Our objective is to determine the role of immature cells in prostate cancer by analysis of the HGF/c-MET pathway.Gene-expression profiling of DU145 prostate cancer cells stimulated with HGF revealed induction of a molecular signature associated with stem cells, characterized by up-regulation of CD49b, CD49f, CD44 and SOX9, and down-regulation of CD24 ('stem-like signature'. We confirmed the acquisition of a stem-like phenotype by quantitative PCR, FACS analysis and Western blotting. Further, HGF led to activation of the stem cell related Notch pathway by up-regulation of its ligands Jagged-1 and Delta-like 4. Small molecules SU11274 and PHA665752 targeting c-MET activity were both able to block the molecular and biologic effects of HGF. Knock-down of c-MET by shRNA infection resulted in significant reduction and delay of orthotopic tumour-formation in male NMRI mice. Immunohistochemical analysis in prostatectomies revealed significant enrichment of c-MET positive cells at the invasive front, and demonstrated co-expression of c-MET with stem-like markers CD49b and CD49f.In conclusion, activation of c-MET in prostate cancer cells induced a stem-like phenotype, indicating a dynamic relation between differentiated and stem-like cells in this malignancy. Its mediation of efficient tumour-formation in vivo and predominant receptor expression at the invasive front implicate that c-MET regulates tumour infiltration in surrounding tissues putatively by acquisition of a stem-like phenotype.

  2. The Activity of Carbohydrate-Degrading Enzymes in the Development of Brood and Newly Emerged workers and Drones of the Carniolan Honeybee, Apis mellifera carnica

    OpenAIRE

    Żółtowska, Krystyna; Lipiński, Zbigniew; Łopieńska-Biernat, Elżbieta; Farjan, Marek; Dmitryjuk, Małgorzata

    2012-01-01

    The activity of glycogen Phosphorylase and carbohydrate hydrolyzing enzymes α-amylase, glucoamylase, trehalase, and sucrase was studied in the development of the Carniolan honey bee, Apis mellifera carnica Pollman (Hymenoptera: Apidae), from newly hatched larva to freshly emerged imago of worker and drone. Phosphorolytic degradation of glycogen was significantly stronger than hydrolytic degradation in all developmental stages. Developmental profiles of hydrolase activity were similar in both ...

  3. [Active euthanasia].

    Science.gov (United States)

    Folker, A P; Hvidt, N

    1995-02-20

    The growing interest in the subject of active euthanasia in connection with the debate regarding legalization of such practices in Denmark necessitates taking a definite standpoint. The difference in concept between active and passive euthanasia is stressed, and the Dutch guidelines are reviewed. The article discusses how far the patient's autonomy should go, as it regards the consideration of self-determination as being too narrow a criterion in itself. The discussion on the quality of life is included, and the consequences of the process of expulsion as a sociological concept are considered--the risk of a patient feeling guilty for being alive and therefore feeling compelled to request active euthanasia. The changed function of the physician is underlined, and it is discussed whether active euthansia will cause a breach of confidence between the physician and his patient. In connection with the debate the following tendencies in society are emphasized: lack of clarity, increasing medicalization and utilitarian priorities.

  4. Examining the relationship between psychosocial working conditions, physical work demands, and leisure time physical activity in Canada.

    Science.gov (United States)

    Morassaei, Sara; Smith, Peter M

    2011-10-01

    To examine the effects of psychosocial working conditions and physical work demands on leisure time physical activity (LTPA). Using path analysis, direct and indirect effects of self-reported working conditions on LTPA levels were assessed in a representative sample of 4167 workers from the 2000 to 2001 Canadian National Population Health Survey. Higher levels of skill discretion and decision latitude were associated with higher LTPA. Physical work demands had opposite effects among men versus women, and skill discretion had a stronger effect among women than among men. Job security had a stronger effect on older workers and those without children younger than 13 years. The results support the influence of the work environment on LTPA and suggest that certain work conditions should be targeted in future interventions seeking to impact participation in physical activity.

  5. Goal conflict and the moderating effects of intention stability in intention-behavior relations: physical activity among Hong Kong chinese.

    Science.gov (United States)

    Li, Kin-Kit; Chan, Darius K S

    2008-02-01

    This study examined how goal conflict influences the pattern of the moderating effects of intention stability on the intention-behavior relations in the context of physical activity participation. A longitudinal study of 136 young adult students with three waves of data collection (a 2-week interval between waves) was conducted. Results showed a significant three-way interaction among intention, goal conflict,& intention stability in explaining vigorous-intensity physical activity (Beta = -.25, p goal conflict was low, the intention-behavior relations were stronger with stable intentions and weaker with unstable intentions. However, when the level of goal conflict was high, the intention-behavior relations were weaker with stable intentions and stronger with unstable intentions. Possible underlying processes of goal conflict and intention stability on the intention-behavior relations are discussed.

  6. R-spondin3-LGR4 signaling protects hepatocytes against DMOG-induced hypoxia/reoxygenation injury through activating β-catenin.

    Science.gov (United States)

    Liu, Shiying; Yin, Yue; Yu, Ruili; Li, Yin; Zhang, Weizhen

    2018-04-30

    Leucine-rich repeat G-protein-coupled receptor 4 (LGR4) and its ligands R-spondin1-4 (Rspos) have been vastly investigated in embryonic development. The biological functions of Rspos-LGR4 system in liver remains largely unknown. Here, we explored whether it protects hepatocytes against hypoxia/reoxygenation (H/R) induced damage. H/R injury was induced by dimethyloxalylglycine (DMOG) in AML12 cells and the effects of Rspo3 on cell proliferation and apoptosis were assessed. Specific shRNAs were used to interfere LGR4 or β-catenin. DMOG caused hepatocytes damage evidenced by increase in HIF-1α, cell death and apoptosis genes p27 and Bax, with concurrent decrease of cell proliferation genes PCNA and CyclinD1. Of all the Rspos, Rspo3 is predominantly expressed in AML12 hepatocytes. Importantly, Rspo3 demonstrated an alteration in a manner similar to proliferation-related genes during H/R injury. Rspo3 pretreatment rendered hepatocytes less vulnerable to DMOG induced H/R injury. Ablation of LGR4 using shRNA attenuated the protective effects of Rspo3. Wnt3a also protected AML12 cells from damages caused by H/R, showing enhanced proliferation activity. Notably, knockdown of β-catenin in hepatocytes completely abolished the effect of Rspo3 pretreatment on the expression levels of PCNA and CyclinD1. Rspo3-LGR4 axis protects hepatocytes from H/R injury via activating β-catenin. Copyright © 2018. Published by Elsevier Inc.

  7. Inhibition of Rac1 activity induces G1/S phase arrest through the GSK3/cyclin D1 pathway in human cancer cells.

    Science.gov (United States)

    Liu, Linna; Zhang, Hongmei; Shi, Lei; Zhang, Wenjuan; Yuan, Juanli; Chen, Xiang; Liu, Juanjuan; Zhang, Yan; Wang, Zhipeng

    2014-10-01

    Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells. Inhibition of Rac1 by inhibitor NSC23766 induced G1/S phase arrest and inhibited the proliferation of A431, SW480 and U2-OS cells. Suppression of GSK3 by shRNA partially rescued G1/S phase arrest and inhibition of proliferation. Incubation of cells with NSC23766 reduced p-AKT and inactivated p-GSK3α and p-GSK3β, increased p-cyclin D1 expression and decreased the level of cyclin D1 protein. Consequently, cyclin D1 targeting transcriptional factor E2F1 expression, which promotes G1 to S phase transition, was also reduced. In contrast, constitutive active Rac1 resulted in increased p-AKT and inactivated p-GSK3α and p-GSK3β, decreased p-cyclin D1 expression and enhanced levels of cyclin D1 and E2F1 expression. Moreover, suppression of GSK3 did not alter p-AKT or Rac1 activity, but decreased p-cyclin D1 and increased total cyclin D1 protein. However, neither Rac1 nor GSK3 inhibition altered cyclin D1 at the RNA level. Moreover, after inhibition of Rac1 or GSK3 following proteasome inhibitor MG132 treatment, cyclin D1 expression at the protein level remained constant, indicating that Rac1 and GSK3 may regulate cyclin D1 turnover through phosphorylation and degradation. Therefore, our findings suggest that inhibition of Rac1 induces cell cycle G1/S arrest in cancer cells by regulation of the GSK3/cyclin D1 pathway.

  8. Activation of human stearoyl-coenzyme A desaturase 1 contributes to the lipogenic effect of PXR in HepG2 cells.

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    Full Text Available The pregnane X receptor (PXR was previously known as a xenobiotic receptor. Several recent studies suggested that PXR also played an important role in lipid homeostasis but the underlying mechanism remains to be clearly defined. In this study, we found that rifampicin, an agonist of human PXR, induced lipid accumulation in HepG2 cells. Lipid analysis showed the total cholesterol level increased. However, the free cholesterol and triglyceride levels were not changed. Treatment of HepG2 cells with rifampicin induced the expression of the free fatty acid transporter CD36 and ABCG1, as well as several lipogenic enzymes, including stearoyl-CoA desaturase-1 (SCD1, long chain free fatty acid elongase (FAE, and lecithin-cholesterol acyltransferase (LCAT, while the expression of acyl:cholesterol acetyltransferase(ACAT1 was not affected. Moreover, in PXR over-expressing HepG2 cells (HepG2-PXR, the SCD1 expression was significantly higher than in HepG2-Vector cells, even in the absence of rifampicin. Down-regulation of PXR by shRNA abolished the rifampicin-induced SCD1 gene expression in HepG2 cells. Promoter analysis showed that the human SCD1 gene promoter is activated by PXR and a novel DR-7 type PXR response element (PXRE response element was located at -338 bp of the SCD1 gene promoter. Taken together, these results indicated that PXR activation promoted lipid synthesis in HepG2 cells and SCD1 is a novel PXR target gene.

  9. Alcoholism and dampened temporal limbic activation to emotional faces.

    Science.gov (United States)

    Marinkovic, Ksenija; Oscar-Berman, Marlene; Urban, Trinity; O'Reilly, Cara E; Howard, Julie A; Sawyer, Kayle; Harris, Gordon J

    2009-11-01

    Excessive chronic drinking is accompanied by a broad spectrum of emotional changes ranging from apathy and emotional flatness to deficits in comprehending emotional information, but their neural bases are poorly understood. Emotional abnormalities associated with alcoholism were examined with functional magnetic resonance imaging in abstinent long-term alcoholic men in comparison to healthy demographically matched controls. Participants were presented with emotionally valenced words and photographs of faces during deep (semantic) and shallow (perceptual) encoding tasks followed by recognition. Overall, faces evoked stronger activation than words, with the expected material-specific laterality (left hemisphere for words, and right for faces) and depth of processing effects. However, whereas control participants showed stronger activation in the amygdala and hippocampus when viewing faces with emotional (relative to neutral) expressions, the alcoholics responded in an undifferentiated manner to all facial expressions. In the alcoholic participants, amygdala activity was inversely correlated with an increase in lateral prefrontal activity as a function of their behavioral deficits. Prefrontal modulation of emotional function as a compensation for the blunted amygdala activity during a socially relevant face appraisal task is in agreement with a distributed network engagement during emotional face processing. Deficient activation of amygdala and hippocampus may underlie impaired processing of emotional faces associated with long-term alcoholism and may be a part of the wide array of behavioral problems including disinhibition, concurring with previously documented interpersonal difficulties in this population. Furthermore, the results suggest that alcoholics may rely on prefrontal rather than temporal limbic areas in order to compensate for reduced limbic responsivity and to maintain behavioral adequacy when faced with emotionally or socially challenging situations.

  10. Bcl-2 silencing attenuates hypoxia-induced apoptosis resistance in pulmonary microvascular endothelial cells.

    Science.gov (United States)

    Cao, Yongmei; Jiang, Zhen; Zeng, Zhen; Liu, Yujing; Gu, Yuchun; Ji, Yingying; Zhao, Yupeng; Li, Yingchuan

    2016-01-01

    Pulmonary arterial hypertension (PAH) is a life-threatening disorder that ultimately causes heart failure. While the underlying causes of this condition are not well understood, previous studies suggest that the anti-apoptotic nature of pulmonary microvascular endothelial cells (PMVECs) in hypoxic environments contributes to PAH pathogenesis. In this study, we focus on the contribution of Bcl-2 and hypoxia response element (HRE) to apoptosis-resistant endothelial cells and investigate the mechanism. PMVECs obtained from either normal rats or apoptosis-resistant PMVECs obtained from PAH rats were transduced with recombinant lentiviral vectors carrying either Bcl-2-shRNA or HRE combined Bcl-2-shRNA, and then cultured these cells for 24 h under hypoxic (5% O2) or normoxic (21% O2) conditions. In normal PMVECs, Bcl-2-shRNA or HRE combined with Bcl-2-shRNA transduction successfully decreased Bcl-2 expression, while increasing apoptosis as well as caspase-3 and P53 expression in a normoxic environment. In a hypoxic environment, the effects of Bcl-2-shRNA treatment on cell apoptosis, and on Bcl-2, caspase-3, P53 expression were significantly suppressed. Conversely, HRE activation combined with Bcl-2-shRNA transduction markedly enhanced cell apoptosis and upregulated caspase-3 and P53 expression, while decreasing Bcl-2 expression. Furthermore, in apoptosis-resistant PMVECs, HRE-mediated Bcl-2 silencing effectively enhanced cell apoptosis and caspase-3 activity. The apoptosis rate was significantly depressed when Lv-HRE-Bcl-2-shRNA was combined with Lv-P53-shRNA or Lv-caspase3-shRNA transduction in a hypoxic environment. These results suggest that HRE-mediated Bcl-2 inhibition can effectively attenuate hypoxia-induced apoptosis resistance in PMVECs by downregulating Bcl-2 expression and upregulating caspase-3 and P53 expression. This study therefore reveals critical insight into potential therapeutic targets for treating PAH.

  11. Antitumor activity and inhibitory effects on cancer stem cell-like properties of Adeno-associated virus (AAV) -mediated Bmi-1 interference driven by Bmi-1 promoter for gastric cancer

    Science.gov (United States)

    Wang, Xiaofeng; Liu, Xinyang; Huang, Mingzhu; Gan, Lu; Cheng, Yufan; Li, Jin

    2016-01-01

    Bmi-1 is aberrantly activated in various cancers and plays a vital role in maintaining the self-renewal of stem cells. Our previous research revealed that Bmi-1 was overexpressed in gastric cancer (GC) and it's overexpression was an independent negative prognostic factor, suggesting it can be a therapeutic target. The main purpose of this investigation was to explore the antitumor activity of Bmi-1 interference driven by its own promoter (Ad-Bmi-1i) for GC. In this study, we used adenoviral vector to deliver Bmi-1 shRNA driven by its own promoter to treat GC. Our results revealed that Ad-Bmi-1i could selectively silence Bmi-1 in GC cells which overexpress Bmi-1 and suppress the malignant phenotypes and stem-like properties of GC cells in vitro and in vivo. Moreover, direct injection of Ad-Bmi-1i into xenografts suppressed tumor growth and destroyed cancer cells in vivo. Ad-Bmi-1i inhibited the proliferation of GC cells mainly via inducing senescence in vitro, but it suppressed tumor through inducing senescence and apoptosis, and inhibiting angiogenesis in vivo. Bmi-1 knockdown by Ad-Bmi-1i downregulated VEGF via inhibiting AKT activity. These results suggest that Ad-Bmi-1i not only inhibits tumor growth and stem cell-like phenotype by inducing cellular senescence directly, but also has an indirect anti-tumor activity by anti-angiogenesis effects via regulating PTEN/AKT/VEGF pathway. Transfer of gene interference guided by its own promoter by an adeno-associated virus (AAV) vector might be a potent antitumor approach for cancer therapy. PMID:27009837

  12. The NDUFB6 subunit of the mitochondrial respiratory chain complex I is required for electron transfer activity: A proof of principle study on stable and controlled RNA interference in human cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France); Rustin, Pierre, E-mail: pierre.rustin@inserm.fr [Inserm U676, Hopital Robert Debre, F-75019 Paris (France); Universite Paris 7, Faculte de medecine Denis Diderot, IFR02 Paris (France)

    2011-10-22

    Highlights: {yields} NDUFB6 is required for activity of mitochondrial complex I in human cell lines. {yields} Lentivirus based RNA interference results in frequent off target insertions. {yields} Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.

  13. The NDUFB6 subunit of the mitochondrial respiratory chain complex I is required for electron transfer activity: A proof of principle study on stable and controlled RNA interference in human cell lines

    International Nuclear Information System (INIS)

    Loublier, Sandrine; Bayot, Aurelien; Rak, Malgorzata; El-Khoury, Riyad; Benit, Paule; Rustin, Pierre

    2011-01-01

    Highlights: → NDUFB6 is required for activity of mitochondrial complex I in human cell lines. → Lentivirus based RNA interference results in frequent off target insertions. → Flp-In recombinase mediated miRNA insertion allows gene-specific extinction. -- Abstract: Molecular bases of inherited deficiencies of mitochondrial respiratory chain complex I are still unknown in a high proportion of patients. Among 45 subunits making up this large complex, more than half has unknown function(s). Understanding the function of these subunits would contribute to our knowledge on mitochondrial physiology but might also reveal that some of these subunits are not required for the catalytic activity of the complex. A direct consequence of this finding would be the reduction of the number of candidate genes to be sequenced in patients with decreased complex I activity. In this study, we tested two different methods to stably extinct complex I subunits in cultured cells. We first found that lentivirus-mediated shRNA expression frequently resulted in the unpredicted extinction of additional gene(s) beside targeted ones. This can be ascribed to uncontrolled genetic material insertions in the genome of the host cell. This approach thus appeared inappropriate to study unknown functions of a gene. Next, we found it possible to specifically extinct a CI subunit gene by direct insertion of a miR targeting CI subunits in a Flp site (HEK293 Flp-In cells). By using this strategy we unambiguously demonstrated that the NDUFB6 subunit is required for complex I activity, and defined conditions suitable to undertake a systematic and stable extinction of the different supernumerary subunits in human cells.

  14. Active colloids

    International Nuclear Information System (INIS)

    Aranson, Igor S

    2013-01-01

    A colloidal suspension is a heterogeneous fluid containing solid microscopic particles. Colloids play an important role in our everyday life, from food and pharmaceutical industries to medicine and nanotechnology. It is useful to distinguish two major classes of colloidal suspensions: equilibrium and active, i.e., maintained out of thermodynamic equilibrium by external electric or magnetic fields, light, chemical reactions, or hydrodynamic shear flow. While the properties of equilibrium colloidal suspensions are fairly well understood, active colloids pose a formidable challenge, and the research is in its early exploratory stage. One of the most remarkable properties of active colloids is the possibility of dynamic self-assembly, a natural tendency of simple building blocks to organize into complex functional architectures. Examples range from tunable, self-healing colloidal crystals and membranes to self-assembled microswimmers and robots. Active colloidal suspensions may exhibit material properties not present in their equilibrium counterparts, e.g., reduced viscosity and enhanced self-diffusivity, etc. This study surveys the most recent developments in the physics of active colloids, both in synthetic and living systems, with the aim of elucidation of the fundamental physical mechanisms governing self-assembly and collective behavior. (physics of our days)

  15. Population activity structure of excitatory and inhibitory neurons.

    Directory of Open Access Journals (Sweden)

    Sean R Bittner

    Full Text Available Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

  16. Population activity structure of excitatory and inhibitory neurons.

    Science.gov (United States)

    Bittner, Sean R; Williamson, Ryan C; Snyder, Adam C; Litwin-Kumar, Ashok; Doiron, Brent; Chase, Steven M; Smith, Matthew A; Yu, Byron M

    2017-01-01

    Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure.

  17. Population activity structure of excitatory and inhibitory neurons

    Science.gov (United States)

    Doiron, Brent

    2017-01-01

    Many studies use population analysis approaches, such as dimensionality reduction, to characterize the activity of large groups of neurons. To date, these methods have treated each neuron equally, without taking into account whether neurons are excitatory or inhibitory. We studied population activity structure as a function of neuron type by applying factor analysis to spontaneous activity from spiking networks with balanced excitation and inhibition. Throughout the study, we characterized population activity structure by measuring its dimensionality and the percentage of overall activity variance that is shared among neurons. First, by sampling only excitatory or only inhibitory neurons, we found that the activity structures of these two populations in balanced networks are measurably different. We also found that the population activity structure is dependent on the ratio of excitatory to inhibitory neurons sampled. Finally we classified neurons from extracellular recordings in the primary visual cortex of anesthetized macaques as putative excitatory or inhibitory using waveform classification, and found similarities with the neuron type-specific population activity structure of a balanced network with excitatory clustering. These results imply that knowledge of neuron type is important, and allows for stronger statistical tests, when interpreting population activity structure. PMID:28817581

  18. Physics activities

    International Nuclear Information System (INIS)

    1997-09-01

    As we move into the 21st Century, nuclear technology is on the verge of rejuvenation in advanced Member States and of expansion in developing Member States. The principal responsibilities of the IAEA are transferring technologies, co-ordinating scientific research, managing specialized projects and maintaining analytical quality control. The IAEA physics activities provide assistance with nuclear instrumentation, promote more effective utilization of research reactors and accelerators, and facilitate global co-operation in nuclear fusion research. These activities will help Member States improve their standards of living through the benefits of nuclear technology. This booklet presents a brief profile on the physics activities and involvement in these fields of the Physics Section, IAEA

  19. IKKα/CHUK regulates extracellular matrix remodeling independent of its kinase activity to facilitate articular chondrocyte differentiation.

    Directory of Open Access Journals (Sweden)

    Eleonora Olivotto

    Full Text Available BACKGROUND: The non-canonical NF-κB activating kinase IKKα, encoded by CHUK (conserved-helix-loop-helix-ubiquitous-kinase, has been reported to modulate pro- or anti- inflammatory responses, cellular survival and cellular differentiation. Here, we have investigated the mechanism of action of IKKα as a novel effector of human and murine chondrocyte extracellular matrix (ECM homeostasis and differentiation towards hypertrophy. METHODOLOGY/PRINCIPAL FINDINGS: IKKα expression was ablated in primary human osteoarthritic (OA chondrocytes and in immature murine articular chondrocytes (iMACs derived from IKKα(f/f:CreERT2 mice by retroviral-mediated stable shRNA transduction and Cre recombinase-dependent Lox P site recombination, respectively. MMP-10 was identified as a major target of IKKα in chondrocytes by mRNA profiling, quantitative RT-PCR analysis, immunohistochemistry and immunoblotting. ECM integrity, as assessed by type II collagen (COL2 deposition and the lack of MMP-dependent COL2 degradation products, was enhanced by IKKα ablation in mice. MMP-13 and total collagenase activities were significantly reduced, while TIMP-3 (tissue inhibitor of metalloproteinase-3 protein levels were enhanced in IKKα-deficient chondrocytes. IKKα deficiency suppressed chondrocyte differentiation, as shown by the quantitative inhibition of.Alizarin red staining and the reduced expression of multiple chondrocyte differentiation effectors, including Runx2, Col10a1 and Vegfa,. Importantly, the differentiation of IKKα-deficient chondrocytes was rescued by a kinase-dead IKKα protein mutant. CONCLUSIONS/SIGNIFICANCE: IKKα acts independent of its kinase activity to help drive chondrocyte differentiation towards a hypertrophic-like state. IKKα positively modulates ECM remodeling via multiple downstream targets (including MMP-10 and TIMP-3 at the mRNA and post-transcriptional levels, respectively to maintain maximal MMP-13 activity, which is required for ECM

  20. Effects of nitrogen enrichment on phosphatase activity and nitrogen : phosphorus relationships in Cladonia portentosa.

    Science.gov (United States)

    Hogan, E J; Minnullina, G; Smith, R I; Crittenden, P D

    2010-06-01

    *Relationships between nitrogen deposition in the UK and phosphomonoesterase (PME) activity and nitrogen (N) and phosphorus (P) concentrations in Cladonia portentosa were quantified to understand factors limiting lichen growth and to further develop biomarkers for N pollution. *Lichen was collected from sites differing either in rates of wet N (NH(4)(+) + NO(3)(-)) deposition or in annual mean N concentration in rainfall based on both measured and modelled data sets. The PME activity, and total N and P concentrations were measured in specific horizontal strata in lichen mats and PME activity in the thallus was located using an enzyme-labelled fluorescent phosphatase substrate. *With an increase in modelled N deposition from 4.1 to 32.8 kg N ha(-1) yr(-1), PME activity, thallus N and N : P ratio increased by factors of 2.3, 1.4 and 1.8, respectively. Correlations with modelled data were generally stronger than with measured data and those with N deposition were stronger than those with N concentration in rainfall. The PME activity was located solely in the lichen fungus in outer regions of the thallus. *Nitrogen enrichment changes lichen N : P ratios from values typical of N limitation (for example, 10) to those indicative of P limitation (for example, 26) driving upregulation of PME activity.

  1. TRPV4 activation mediates flow-induced nitric oxide production in the rat thick ascending limb

    Science.gov (United States)

    Garvin, Jeffrey L.

    2014-01-01

    Nitric oxide (NO) regulates renal function. Luminal flow stimulates NO production in the thick ascending limb (TAL). Transient receptor potential vanilloid 4 (TRPV4) is a mechano-sensitive channel activated by luminal flow in different types of cells. We hypothesized that TRPV4 mediates flow-induced NO production in the rat TAL. We measured NO production in isolated, perfused rat TALs using the fluorescent dye DAF FM. Increasing luminal flow from 0 to 20 nl/min stimulated NO from 8 ± 3 to 45 ± 12 arbitrary units (AU)/min (n = 5; P < 0.05). The TRPV4 antagonists, ruthenium red (15 μmol/l) and RN 1734 (10 μmol/l), blocked flow-induced NO production. Also, luminal flow did not increase NO production in the absence of extracellular calcium. We also studied the effect of luminal flow on NO production in TALs transduced with a TRPV4shRNA. In nontransduced TALs luminal flow increased NO production by 47 ± 17 AU/min (P < 0.05; n = 5). Similar to nontransduced TALs, luminal flow increased NO production by 39 ± 11 AU/min (P < 0.03; n = 5) in TALs transduced with a control negative sequence-shRNA while in TRPV4shRNA-transduced TALs, luminal flow did not increase NO production (Δ10 ± 15 AU/min; n = 5). We then tested the effect of two different TRPV4 agonists on NO production in the absence of luminal flow. 4α-Phorbol 12,13-didecanoate (1 μmol/l) enhanced NO production by 60 ± 11 AU/min (P < 0.002; n = 7) and GSK1016790A (10 ηmol/l) increased NO production by 52 ± 15 AU/min (P < 0.03; n = 5). GSK1016790A (10 ηmol/l) did not stimulate NO production in TRPV4shRNA-transduced TALs. We conclude that activation of TRPV4 channels mediates flow-induced NO production in the rat TAL. PMID:24966090

  2. Regulatory activities

    International Nuclear Information System (INIS)

    2001-01-01

    This publication, compiled in 8 chapters, presents the regulatory system developed by the Nuclear Regulatory Authority (NRA) of the Argentine Republic. The following activities and developed topics in this document describe: the evolution of the nuclear regulatory activity in Argentina; the Argentine regulatory system; the nuclear regulatory laws and standards; the inspection and safeguards of nuclear facilities; the emergency systems; the environmental systems; the environmental monitoring; the analysis laboratories on physical and biological dosimetry, prenatal irradiation, internal irradiation, radiation measurements, detection techniques on nuclear testing, medical program on radiation protection; the institutional relations with national and international organization; the training courses and meeting; the technical information

  3. Identity Activities

    Science.gov (United States)

    2016-08-03

    in reaction to their environment. They reflect an individual’s internal or external, conscious or subconscious , overt or covert, voluntary or...identity activities under a range of legal authorities, policy constraints, transnational threats, regional concerns and biases , and most likely...Biography. A baseline and descriptive analytic product that supports the development of the behavioral influences analysis ( BIA ) individual behavioral

  4. Active instruments

    DEFF Research Database (Denmark)

    Lim, Miguel Antonio; Ørberg, Jakob Williams

    2017-01-01

    themselves. We draw on two multi-year field studies of India and Denmark to investigate how national reforms and developments within the ranking industry interact in often surprising ways. Rankings do not always do what policy makers expect. We (1) highlight the activity of rankers in these two countries, (2...

  5. Active house

    DEFF Research Database (Denmark)

    Eriksen, Kurt Emil; Olesen, Gitte Gylling Hammershøj

    Formålet med dette abstrakt er at illustrere, at huse kan være konstrueret til at basere sig udelukkende på vedvarende energikilder og samtidig være CO2-neutrale og producere mere energi end de forbruger. Active House Visionen undersøger disse muligheder i otte demonstration huse i fem forskellige...

  6. [Antibacterial and anti-hemolysin activities of tea catechins and their structural relatives].

    Science.gov (United States)

    Toda, M; Okubo, S; Ikigai, H; Shimamura, T

    1990-03-01

    Among catechins tested, (-)epigallocatechin (EGC), (-)epicatechin gallate (ECg), (-) epigallocatechin gallate (EGCg) inhibited the growth of Staphylococcus aureus, Vibrio cholerae O1 classical Inaba 569B and El Tor Inaba V86. S. aureus was more sensitive than V. cholerae O1 to these compounds. EGCg showed also a bactericidal activity against V. cholerae O1 569B. Pyrogallol showed a stronger antibacterial activity against S. aureus and V. cholerae O1 than tannic and gallic acid. Rutin or caffein had no effect on them. ECg and EGCg showed the most potent anti-hemolysin activity against S. aureus alpha-toxin, Vibrio parahaemolyticus thermostable direct hemolysin (Vp-TDH) and cholera hemolysin. Among catechin relatives, only tannic acid had a potent anti-hemolysin activity against alpha-toxin. These results suggest that the catechol and pyrogallol groups are responsible for the antibacterial and bactericidal activities, while the conformation of catechins might play an important role in the anti-hemolysin activity.

  7. Plasticizers May Activate Human Hepatic Peroxisome Proliferator-Activated Receptor α Less Than That of a Mouse but May Activate Constitutive Androstane Receptor in Liver

    Science.gov (United States)

    Ito, Yuki; Nakamura, Toshiki; Yanagiba, Yukie; Ramdhan, Doni Hikmat; Yamagishi, Nozomi; Naito, Hisao; Kamijima, Michihiro; Gonzalez, Frank J.; Nakajima, Tamie

    2012-01-01

    Dibutylphthalate (DBP), di(2-ethylhexyl)phthalate (DEHP), and di(2-ethylhexyl)adipate (DEHA) are used as plasticizers. Their metabolites activate peroxisome proliferator-activated receptor (PPAR) α, which may be related to their toxicities. However, species differences in the receptor functions between rodents and human make it difficult to precisely extrapolate their toxicity from animal studies to human. In this paper, we compared the species differences in the activation of mouse and human hepatic PPARα by these plasticizers using wild-type (mPPARα) and humanized PPARα (hPPARα) mice. At 12 weeks old, each genotyped male mouse was classified into three groups, and fed daily for 2 weeks per os with corn oil (vehicle control), 2.5 or 5.0 mmol/kg DBP (696, 1392 mg/kg), DEHP (977, 1953 mg/kg), and DEHA (926, 1853 mg/kg), respectively. Generally, hepatic PPARα of mPPARα mice was more strongly activated than that of hPPARα mice when several target genes involving β-oxidation of fatty acids were evaluated. Interestingly, all plasticizers also activated hepatic constitutive androstane receptor (CAR) more in hPPARα mice than in mPPARα mice. Taken together, these plasticizers activated mouse and human hepatic PPARα as well as CAR. The activation of PPARα was stronger in mPPARα mice than in hPPARα mice, while the opposite was true of CAR. PMID:22792086

  8. Plasticizers May Activate Human Hepatic Peroxisome Proliferator-Activated Receptor α Less Than That of a Mouse but May Activate Constitutive Androstane Receptor in Liver

    Directory of Open Access Journals (Sweden)

    Yuki Ito

    2012-01-01

    Full Text Available Dibutylphthalate (DBP, di(2-ethylhexylphthalate (DEHP, and di(2-ethylhexyladipate (DEHA are used as plasticizers. Their metabolites activate peroxisome proliferator-activated receptor (PPAR α, which may be related to their toxicities. However, species differences in the receptor functions between rodents and human make it difficult to precisely extrapolate their toxicity from animal studies to human. In this paper, we compared the species differences in the activation of mouse and human hepatic PPARα by these plasticizers using wild-type (mPPARα and humanized PPARα (hPPARα mice. At 12 weeks old, each genotyped male mouse was classified into three groups, and fed daily for 2 weeks per os with corn oil (vehicle control, 2.5 or 5.0 mmol/kg DBP (696, 1392 mg/kg, DEHP (977, 1953 mg/kg, and DEHA (926, 1853 mg/kg, respectively. Generally, hepatic PPARα of mPPARα mice was more strongly activated than that of hPPARα mice when several target genes involving β-oxidation of fatty acids were evaluated. Interestingly, all plasticizers also activated hepatic constitutive androstane receptor (CAR more in hPPARα mice than in mPPARα mice. Taken together, these plasticizers activated mouse and human hepatic PPARα as well as CAR. The activation of PPARα was stronger in mPPARα mice than in hPPARα mice, while the opposite was true of CAR.

  9. Scaling behavior of online human activity

    Science.gov (United States)

    Zhao, Zhi-Dan; Cai, Shi-Min; Huang, Junming; Fu, Yan; Zhou, Tao

    2012-11-01

    The rapid development of the Internet technology enables humans to explore the web and record the traces of online activities. From the analysis of these large-scale data sets (i.e., traces), we can get insights about the dynamic behavior of human activity. In this letter, the scaling behavior and complexity of human activity in the e-commerce, such as music, books, and movies rating, are comprehensively investigated by using the detrended fluctuation analysis technique and the multiscale entropy method. Firstly, the interevent time series of rating behaviors of these three types of media show similar scaling properties with exponents ranging from 0.53 to 0.58, which implies that the collective behaviors of rating media follow a process embodying self-similarity and long-range correlation. Meanwhile, by dividing the users into three groups based on their activities (i.e., rating per unit time), we find that the scaling exponents of the interevent time series in the three groups are different. Hence, these results suggest that a stronger long-range correlations exist in these collective behaviors. Furthermore, their information complexities vary in the three groups. To explain the differences of the collective behaviors restricted to the three groups, we study the dynamic behavior of human activity at the individual level, and find that the dynamic behaviors of a few users have extremely small scaling exponents associated with long-range anticorrelations. By comparing the interevent time distributions of four representative users, we can find that the bimodal distributions may bring forth the extraordinary scaling behaviors. These results of the analysis of the online human activity in the e-commerce may not only provide insight into its dynamic behaviors but may also be applied to acquire potential economic interest.

  10. Brain activation associated with pride and shame.

    Science.gov (United States)

    Roth, Lilian; Kaffenberger, Tina; Herwig, Uwe; Brühl, Annette B

    2014-01-01

    Self-referential emotions such as shame/guilt and pride provide evaluative information about persons themselves. In addition to emotional aspects, social and self-referential processes play a role in self-referential emotions. Prior studies have rather focused on comparing self-referential and other-referential processes of one valence, triggered mostly by external stimuli. In the current study, we aimed at investigating the valence-specific neural correlates of shame/guilt and pride, evoked by the remembrance of a corresponding autobiographical event during functional magnetic resonance imaging. A total of 25 healthy volunteers were studied. The task comprised a negative (shame/guilt), a positive (pride) and a neutral condition (expecting the distractor). Each condition was initiated by a simple cue, followed by the remembrance and finished by a distracting picture. Pride and shame/guilt conditions both activated typical emotion-processing circuits including the amygdala, insula and ventral striatum, as well as self-referential brain regions such as the bilateral dorsomedial prefrontal cortex. Comparing the two emotional conditions, emotion-processing circuits were more activated by pride than by shame, possibly due to either hedonic experiences or stronger involvement of the participants in positive self-referential emotions due to a self-positivity bias. However, the ventral striatum was similarly activated by pride and shame/guilt. In the whole-brain analysis, both self-referential emotion conditions activated medial prefrontal and posterior cingulate regions, corresponding to the self-referential aspect and the autobiographical evocation of the respective emotions. Autobiographically evoked self-referential emotions activated basic emotional as well as self-referential circuits. Except for the ventral striatum, emotional circuits were more active with pride than with shame.

  11. AMP-activated protein kinase α2 and E2F1 transcription factor mediate doxorubicin-induced cytotoxicity by forming a positive signal loop in mouse embryonic fibroblasts and non-carcinoma cells.

    Science.gov (United States)

    Yang, Wookyeom; Park, In-Ja; Yun, Hee; Im, Dong-Uk; Ock, Sangmi; Kim, Jaetaek; Seo, Seon-Mi; Shin, Ha-Yeon; Viollet, Benoit; Kang, Insug; Choe, Wonchae; Kim, Sung-Soo; Ha, Joohun

    2014-02-21

    Doxorubicin is one of the most widely used anti-cancer drugs, but its clinical application is compromised by severe adverse effects in different organs including cardiotoxicity. In the present study we explored mechanisms of doxorubicin-induced cytotoxicity by revealing a novel role for the AMP-activated protein kinase α2 (AMPKα2) in mouse embryonic fibroblasts (MEFs). Doxorubicin robustly induced the expression of AMPKα2 in MEFs but slightly reduced AMPKα1 expression. Our data support the previous notion that AMPKα1 harbors survival properties under doxorubicin treatment. In contrast, analyses of Ampkα2(-/-) MEFs, gene knockdown of AMPKα2 by shRNA, and inhibition of AMPKα2 activity with an AMPK inhibitor indicated that AMPKα2 functions as a pro-apoptotic molecule under doxorubicin treatment. Doxorubicin induced AMPKα2 at the transcription level via E2F1, a transcription factor that regulates apoptosis in response to DNA damage. E2F1 directly transactivated the Ampkα2 gene promoter. In turn, AMPKα2 significantly contributed to stabilization and activation of E2F1 by doxorubicin, forming a positive signal amplification loop. AMPKα2 directly interacted with and phosphorylated E2F1. This signal loop was also detected in H9c2, C2C12, and ECV (human epithelial cells) cells as well as mouse liver under doxorubicin treatment. Resveratrol, which has been suggested to attenuate doxorubicin-induced cytotoxicity, significantly blocked induction of AMPKα2 and E2F1 by doxorubicin, leading to protection of these cells. This signal loop appears to be non-carcinoma-specific because AMPKα2 was not induced by doxorubicin in five different tested cancer cell lines. These results suggest that AMPKα2 may serve as a novel target for alleviating the cytotoxicity of doxorubicin.

  12. Physical activity measurement in older adults: relationships with mental health.

    Science.gov (United States)

    Parker, Sarah J; Strath, Scott J; Swartz, Ann M

    2008-10-01

    This study examined the relationship between physical activity (PA) and mental health among older adults as measured by objective and subjective PA-assessment instruments. Pedometers (PED), accelerometers (ACC), and the Physical Activity Scale for the Elderly (PASE) were administered to measure 1 week of PA among 84 adults age 55-87 (mean = 71) years. General mental health was measured using the Positive and Negative Affect Scale (PANAS) and the Satisfaction With Life Scale (SWL). Linear regressions revealed that PA estimated by PED significantly predicted 18.1%, 8.3%, and 12.3% of variance in SWL and positive and negative affect, respectively, whereas PA estimated by the PASE did not predict any mental health variables. Results from ACC data were mixed. Hotelling-William tests between correlation coefficients revealed that the relationship between PED and SWL was significantly stronger than the relationship between PASE and SWL. Relationships between PA and mental health might depend on the PA measure used.

  13. Active particles

    CERN Document Server

    Degond, Pierre; Tadmor, Eitan

    2017-01-01

    This volume collects ten surveys on the modeling, simulation, and applications of active particles using methods ranging from mathematical kinetic theory to nonequilibrium statistical mechanics. The contributing authors are leading experts working in this challenging field, and each of their chapters provides a review of the most recent results in their areas and looks ahead to future research directions. The approaches to studying active matter are presented here from many different perspectives, such as individual-based models, evolutionary games, Brownian motion, and continuum theories, as well as various combinations of these. Applications covered include biological network formation and network theory; opinion formation and social systems; control theory of sparse systems; theory and applications of mean field games; population learning; dynamics of flocking systems; vehicular traffic flow; and stochastic particles and mean field approximation. Mathematicians and other members of the scientific commu...

  14. [In vitro study of joint intervention of E-cad and Bmi-1 mediated by transcription activator-like effector nuclease in nasopharyngeal carcinoma].

    Science.gov (United States)

    Luo, Tingting; Yan, Aifen; Liu, Lian; Jiang, Hong; Feng, Cuilan; Liu, Guannan; Liu, Fang; Tang, Dongsheng; Zhou, Tianhong

    2018-03-28

    To explore the effect of intervention of E-cadherin (E-cad) and B-lymphoma Moloney murine leukemia virus insertion region-1 (Bmi-1) mediated by transcription activator-like effector nuclease (TALEN) on the biological behaviors of nasopharyngeal carcinoma cells.
 Methods: Multi-locus gene targeting vectors pUC-DS1-CMV-E-cad-2A-Neo-DS2 and pUC-DS1-Bmi-1 shRNA-Zeo-DS2 were constructed, and the E-cad and Bmi-1 targeting vectors were transferred with TALEN plasmids to CNE-2 cells individually or simultaneously. The integration of target genes were detected by PCR, the expressions of E-cad and Bmi-1 were detected by Western blot. The changes of cell proliferation were detected by cell counting kit-8 (CCK-8) assay. The cell cycle and apoptosis were detected by flow cytometry. The cell migration and invasion were detected by Transwell assay.
 Results: The E-cad and Bmi-1 shRNA expression elements were successfully integrated into the genome of CNE-2 cells, the protein expression level of E-cad was up-regulated, and the protein expression level of Bmi-1 was down-regulated. The intervention of E-cad and Bmi-1 didn't affect the proliferation, cell cycle and apoptosis of CNE-2 cells, but it significantly inhibited the migration and invasion ability of CNE-2 cells. Furthermore, the intervention of E-cad and Bmi-1 together significantly inhibited the migration ability of nasopharyngeal carcinoma cells compared with the intervention of E-cad or Bmi-1 alone (all Pcad and Bmi-1 mediated by TALEN can effectively inhibit the migration and invasion of nasopharyngeal carcinoma cells in vitro, which may lay the preliminary experimental basis for gene therapy of human cancer.

  15. Activating transcription factor-3 (ATF3) functions as a tumor suppressor in colon cancer and is up-regulated upon heat-shock protein 90 (Hsp90) inhibition

    International Nuclear Information System (INIS)

    Hackl, Christina; Stoeltzing, Oliver; Lang, Sven A; Moser, Christian; Mori, Akira; Fichtner-Feigl, Stefan; Hellerbrand, Claus; Dietmeier, Wolfgang; Schlitt, Hans J; Geissler, Edward K

    2010-01-01

    Activating transcription factor-3 (ATF3) is involved in the complex process of cellular stress response. However, its exact role in cancer is discussed controversially because both tumor suppressive and oncogenic effects have been described. Here we followed-up on our previous observation that inhibition of Hsp90 may increase ATF3 expression and sought to determine the role of ATF3 in colon cancer. Regulation of ATF3 was determined in cancer cells using signaling inhibitors and a heat-shock protein-90 (Hsp90) antagonist. Human HCT116 cancer cells were stably transfected with an ATF3-shRNA or a luciferase-shRNA expression plasmid and alterations in cell motility were assessed in migration assays. The impact of ATF3 down-regulation on cancer growth and metastasis were investigated in a subcutaneous tumor model, a model of hepatic tumor growth and in a model of peritoneal carcinomatosis. Human colon cancer tissues were analyzed for ATF3 expression. The results show that therapeutic Hsp90 inhibition substantially up-regulates the expression of ATF3 in various cancer cells, including colon, gastric and pancreatic cancer. This effect was evident both in vitro and in vivo. RNAi mediated knock-down of ATF3 in HCT116 colon cancer cells significantly increased cancer cell migration in vitro. Moreover, in xenogenic mouse models, ATF3 knock-down promoted subcutaneous tumor growth and hepatic metastasis, as well as peritoneal carcinomatosis. Importantly, ATF3 expression was lower in human colon cancer specimens, as compared to corresponding normal surrounding tissues, suggesting that ATF3 may represent a down-regulated tumor suppressor in colon cancer. In conclusion, ATF3 down-regulation in colon cancer promotes tumor growth and metastasis. Considering that blocking Hsp90 induces ATF3 expression, Hsp90 inhibition may represent a valid strategy to treat metastatic colon cancer by up-regulating this anti-metastatic transcription factor

  16. Data on mass spectrometry-based proteomics for studying the involvement of CYLD in the ubiquitination events downstream of EGFR activation

    Directory of Open Access Journals (Sweden)

    Virginia Sanchez-Quiles

    2018-06-01

    Full Text Available The present data article corresponds to the proteomic data of the involvement of Cylindromatosis protein (CYLD in the ubiquitination signaling initiated by EGF stimulation. CYLD tumor suppressor protein has Lys63-chain deubiquitinase activity that has been proved essential for the negative regulation of crucial signaling mechanisms, namely the NFkB pathway. Previous results have suggested the involvement of CYLD in the EGF-dependent signal transduction as well, showing its engagement within the tyrosine-phosphorylated complexes formed following the addition of the growth factor. EGFR signaling participates in central cellular processes and its tight regulation, partly through ubiquitination cascades, is decisive for a balanced cellular homeostasis. We carried out the substitution of the endogenous pool of ubiquitin for a His-FLAG-tagged ubiquitin (Stable Ubiquitin Exchange, StUbEx, in combination with the shRNA silencing of CYLD and SILAC-labeling on HeLa cells. The subsequent tandem affinity purification of ubiquitinated proteins in control and CYLD-depleted cells was followed by mass spectrometric analysis. Therefore, we present an unbiased study investigating the impact of CYLD in the EGF-dependent ubiquitination. The data supplied herein is related to the research article entitled “Cylindromatosis tumor suppressor protein (CYLD deubiquitinase is necessary for proper ubiquitination and degradation of the epidermal growth factor receptor” (Sanchez-Quiles et al., 2017 [1]. We provide the associated mass spectrometry raw files, excel tables and gene ontology enrichments. The data have been deposited in the ProteomeXchange with the identifier PXD003423.

  17. Active solar information dissemination activities

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-07-01

    The principal objective of the project has been the development of an information dissemination strategy for the UK active solar heating industry. The project has also aimed to prepare the industry for the implementation of such a strategy and to produce initial information materials to support the early stages of the implementation process. (author)

  18. Culture but not gender modulates amygdala activation during explicit emotion recognition.

    Science.gov (United States)

    Derntl, Birgit; Habel, Ute; Robinson, Simon; Windischberger, Christian; Kryspin-Exner, Ilse; Gur, Ruben C; Moser, Ewald

    2012-05-29

    Mounting evidence indicates that humans have significant difficulties in understanding emotional expressions from individuals of different ethnic backgrounds, leading to reduced recognition accuracy and stronger amygdala activation. However, the impact of gender on the behavioral and neural reactions during the initial phase of cultural assimilation has not been addressed. Therefore, we investigated 24 Asians students (12 females) and 24 age-matched European students (12 females) during an explicit emotion recognition task, using Caucasian facial expressions only, on a high-field MRI scanner. Analysis of functional data revealed bilateral amygdala activation to emotional expressions in Asian and European subjects. However, in the Asian sample, a stronger response of the amygdala emerged and was paralleled by reduced recognition accuracy, particularly for angry male faces. Moreover, no significant gender difference emerged. We also observed a significant inverse correlation between duration of stay and amygdala activation. In this study we investigated the "alien-effect" as an initial problem during cultural assimilation and examined this effect on a behavioral and neural level. This study has revealed bilateral amygdala activation to emotional expressions in Asian and European females and males. In the Asian sample, a stronger response of the amygdala bilaterally was observed and this was paralleled by reduced performance, especially for anger and disgust depicted by male expressions. However, no gender difference occurred. Taken together, while gender exerts only a subtle effect, culture and duration of stay as well as gender of poser are shown to be relevant factors for emotion processing, influencing not only behavioral but also neural responses in female and male immigrants.

  19. Culture but not gender modulates amygdala activation during explicit emotion recognition

    Directory of Open Access Journals (Sweden)

    Derntl Birgit

    2012-05-01

    Full Text Available Abstract Background Mounting evidence indicates that humans have significant difficulties in understanding emotional expressions from individuals of different ethnic backgrounds, leading to reduced recognition accuracy and stronger amygdala activation. However, the impact of gender on the behavioral and neural reactions during the initial phase of cultural assimilation has not been addressed. Therefore, we investigated 24 Asians students (12 females and 24 age-matched European students (12 females during an explicit emotion recognition task, using Caucasian facial expressions only, on a high-field MRI scanner. Results Analysis of functional data revealed bilateral amygdala activation to emotional expressions in Asian and European subjects. However, in the Asian sample, a stronger response of the amygdala emerged and was paralleled by reduced recognition accuracy, particularly for angry male faces. Moreover, no significant gender difference emerged. We also observed a significant inverse correlation between duration of stay and amygdala activation. Conclusion In this study we investigated the “alien-effect” as an initial problem during cultural assimilation and examined this effect on a behavioral and neural level. This study has revealed bilateral amygdala activation to emotional expressions in Asian and European females and males. In the Asian sample, a stronger response of the amygdala bilaterally was observed and this was paralleled by reduced performance, especially for anger and disgust depicted by male expressions. However, no gender difference occurred. Taken together, while gender exerts only a subtle effect, culture and duration of stay as well as gender of poser are shown to be relevant factors for emotion processing, influencing not only behavioral but also neural responses in female and male immigrants.

  20. Lymphotoxin β receptor activation promotes mRNA expression of RelA and pro-inflammatory cytokines TNFα and IL-1β in bladder cancer cells.

    Science.gov (United States)

    Shen, Mo; Zhou, Lianlian; Zhou, Ping; Zhou, Wu; Lin, Xiangyang

    2017-07-01

    The role of inflammation in tumorigenesis and development is currently well established. Lymphotoxin β receptor (LTβR) activation induces canonical and noncanonical nuclear factor (NF)‑κB signaling pathways, which are linked to inflammation‑induced carcinogenesis. In the present study, 5,637 bladder cancer cells were cultured and the activation of LTβR was induced by functional ligand, lymphotoxin (LT) α1β2, and silencing with shRNA. Reverse transcription‑quantitative polymerase chain reaction was utilized to detect the mRNA expression levels of NF‑κB family members RelA and RelB, cytokines including LTα, LTβ, tumor necrosis factor (TNF)α, TNF superfamily member 14, interleukin (IL)‑6 and IL‑1β, and proliferation‑related genes including CyclinD1 and Survivin. The expression of phospho‑p65 was determined by western blotting. Activation of LTβR on bladder cancer 5,637 cells was demonstrated to upregulate the mRNA expression levels of the RELA proto‑oncogene, RelA, by 2.5‑fold compared with unstimulated cells, while no significant change was observed in the RELB proto‑oncogene NF‑κB member mRNA levels. Expression of pro‑inflammatory cytokines tumor necrosis factor (TNF)α and interleukin (IL)‑1β mRNA levels were significantly increased nearly 5‑fold and 1.5‑fold, respectively, following LTβR activation compared with unstimulated cells. The LTβR‑induced upregulation of RelA, TNFα and IL‑1β was decreased by ~33, 27, and 26% respectively when LTβR was silenced via short hairpin RNA. Activation of LTβR had no effect on 5,637 cell growth, despite CyclinD1 and Survivin mRNA levels increasing by ~2.7 and 1.3‑fold, respectively, compared with unstimulated cells. In conclusion, activation of LTβR induced the expression of RelA mRNA levels. LTβR activation might be an important mediator in promoting an inflammatory microenvironment in bladder cancer, via the upregulation of TNFα and IL‑1β mRNA levels. LTβR may

  1. Basal Forebrain Gating by Somatostatin Neurons Drives Prefrontal Cortical Activity.

    Science.gov (United States)

    Espinosa, Nelson; Alonso, Alejandra; Morales, Cristian; Espinosa, Pedro; Chávez, Andrés E; Fuentealba, Pablo

    2017-11-17

    The basal forebrain provides modulatory input to the cortex regulating brain states and cognitive processing. Somatostatin-expressing neurons constitute a heterogeneous GABAergic population known to functionally inhibit basal forebrain cortically projecting cells thus favoring sleep and cortical synchronization. However, it remains unclear if somatostatin cells can regulate population activity patterns in the basal forebrain and modulate cortical dynamics. Here, we demonstrate that somatostatin neurons regulate the corticopetal synaptic output of the basal forebrain impinging on cortical activity and behavior. Optogenetic inactivation of somatostatin neurons in vivo rapidly modified neural activity in the basal forebrain, with the consequent enhancement and desynchronization of activity in the prefrontal cortex, reflected in both neuronal spiking and network oscillations. Cortical activation was partially dependent on cholinergic transmission, suppressing slow waves and potentiating gamma oscillations. In addition, recruitment dynamics was cell type-specific, with interneurons showing similar temporal profiles, but stronger responses than pyramidal cells. Finally, optogenetic stimulation of quiescent animals during resting periods prompted locomotor activity, suggesting generalized cortical activation and increased arousal. Altogether, we provide physiological and behavioral evidence indicating that somatostatin neurons are pivotal in gating the synaptic output of the basal forebrain, thus indirectly controlling cortical operations via both cholinergic and non-cholinergic mechanisms. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Cisplatin induces protective autophagy through activation of BECN1 in human bladder cancer cells.

    Science.gov (United States)

    Lin, Ji-Fan; Lin, Yi-Chia; Tsai, Te-Fu; Chen, Hung-En; Chou, Kuang-Yu; Hwang, Thomas I-Sheng

    2017-01-01

    Cisplatin-based chemotherapy is the first line treatment for several cancers including bladder cancer (BC). Autophagy induction has been implied to contribute to cisplatin resistance in ovarian cancer; and a high basal level of autophagy has been demonstrated in human bladder tumors. Therefore, it is reasonable to speculate that autophagy may account for the failure of cisplatin single treatment in BC. This study investigated whether cisplatin induces autophagy and the mechanism involved using human BC cell lines. Human BC cells (5637 and T24) were used in this study. Cell viability was detected using water soluble tetrazolium-8 reagents. Autophagy induction was detected by monitoring the levels of light chain 3 (LC3)-II and p62 by Western blot, LC3-positive puncta formation by immunofluorescence, and direct observation of the autophagolysosome (AL) formation by transmission electron microscopy. Inhibitors including bafilomycin A1 (Baf A1), chloroquine (CQ), and shRNA-based lentivirus against autophagy-related genes (ATG7 and ATG12) were utilized. Apoptosis level was detected by caspase 3/7 activity and DNA fragmentation. Cisplatin decreased cell viability and induced apoptosis of 5637 and T24 cells in a dose-and time-dependent manner. The increased LC3-II accumulation, p62 clearance, the number of LC3-positive puncta, and ALs in cisplatin-treated cells suggested that cisplatin indeed induces autophagy. Inhibition of cisplatin-induced autophagy using Baf A1, CQ, or ATG7/ATG12 shRNAs significantly enhanced cytotoxicity of cisplatin toward BC cells. These results indicated that cisplatin induced protective autophagy which may contribute to the development of cisplatin resistance and resulted in treatment failure. Mechanistically, upregulation of beclin-1 (BECN1) was detected in cisplatin-treated cells, and knockdown of BECN1 using shRNA attenuated cisplatin-induced autophagy and subsequently enhanced cisplatin-induced apoptosis. Collectively, the study results

  3. Chocolate active

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    There is a table of current radioactivity values for various foods and mushrooms. A special accent is on milk and chocolate. Chocolate sorts with more powdered milk are more active. Finally there is a chapter on radionucleides contained in the Chernobyl fallout, other than cesium 137, cesium 134 and strontium 90. The amounts of ruthenium 106, antimony 125, cerium 144, silver 110 m, cesium 134, strontium 90 and plutonium 239 relative to cesium 137 in soil samples in autumn 1987 are given. Special emphasis is on ruthenium 'hot particles' and on plutonium. (qui)

  4. Social reward improves the voluntary control over localized brain activity in fMRI-based neurofeedback training

    Directory of Open Access Journals (Sweden)

    Krystyna Anna Mathiak

    2015-06-01

    Full Text Available Neurofeedback (NF based on real-time functional magnetic resonance imaging (rt-fMRI allows voluntary regulation of the activity in a selected brain region. For the training of this regulation, a well-designed feedback system is required. Social reward may serve as an effective incentive in NF paradigms, but its efficiency has not yet been tested. Therefore, we developed a social reward NF paradigm and assessed it in comparison with a typical visual NF paradigm (moving bar.We trained 24 healthy participants, on three consecutive days, to control activation in dorsal anterior cingulate cortex (ACC with fMRI-based NF. In the social feedback group, an avatar gradually smiled when ACC activity increased, whereas in the standard feedback group, a moving bar indicated the activation level. To assess a transfer of the NF training both groups were asked to up-regulate their brain activity without receiving feedback immediately before and after the NF training (pre- and post-test. Finally, the effect of the acquired NF training on ACC function was evaluated in a cognitive interference task (Simon task during the pre- and post-test.Social reward led to stronger activity in the ACC and reward-related areas during the NF training when compared to standard feedback. After the training, both groups were able to regulate ACC without receiving feedback, with a trend for stronger responses in the social feedback group. Moreover, despite a lack of behavioral differences, significant higher ACC activations emerged in the cognitive interference task, reflecting a stronger generalization of the NF training on cognitive interference processing after social feedback.Social reward can increase self-regulation in fMRI-based NF and strengthen its effects on neural processing in related tasks, such as cognitive interference. An advantage of social feedback is that a direct external reward is provided as in natural social interactions, opening perspectives for implicit

  5. The impact of the neurodevelopmental traction technique on activation of lateral abdominal muscles in children aged 11-13 years.

    Science.gov (United States)

    Gogola, Anna; Gnat, Rafał; Dziub, Dorota; Gwóźdź, Michalina; Zaborowska, Małgorzata

    2016-06-27

    The aim of the study was to evaluate the activation of lateral abdominal muscles (LAM) in response to neurodevelopmental traction technique as assessed by ultrasounds as well as to compare the effects of different traction forces. An experiment with repeated measurements of the dependent variables was conducted. Thirty-seven children (22 girls) participated. Measurements of LAM thickness (indicating LAM activation) were performed bilaterally during traction of 5% body weight: 1) in neutral position, 2) in 20° posterior trunk inclination; during traction of 15% body weight: 3) in neutral position, 4) in 20° posterior trunk inclination. The ultrasound technology was employed. When applying the lighter traction the superficial LAM (external and internal oblique muscles) showed significant changes. The mean thickness of both muscles during traction increased (both p  0.05). Stronger traction elicited smaller changes. External and internal oblique muscles showed significant increases (p stronger traction (p Stronger traction induces smaller LAM thickness changes than lighter traction.

  6. Brain activity associated with translation from a visual to a symbolic representation in algebra and geometry.

    Science.gov (United States)

    Leikin, Mark; Waisman, Ilana; Shaul, Shelley; Leikin, Roza

    2014-03-01

    This paper presents a small part of a larger interdisciplinary study that investigates brain activity (using event related potential methodology) of male adolescents when solving mathematical problems of different types. The study design links mathematics education research with neurocognitive studies. In this paper we performed a comparative analysis of brain activity associated with the translation from visual to symbolic representations of mathematical objects in algebra and geometry. Algebraic tasks require translation from graphical to symbolic representation of a function, whereas tasks in geometry require translation from a drawing of a geometric figure to a symbolic representation of its property. The findings demonstrate that electrical activity associated with the performance of geometrical tasks is stronger than that associated with solving algebraic tasks. Additionally, we found different scalp topography of the brain activity associated with algebraic and geometric tasks. Based on these results, we argue that problem solving in algebra and geometry is associated with different patterns of brain activity.

  7. Structure-activity relationships of diverse xanthones against multidrug resistant human tumor cells.

    Science.gov (United States)

    Wang, Qiwen; Ma, Chenyao; Ma, Yun; Li, Xiang; Chen, Yong; Chen, Jianwei

    2017-02-01

    Thirteen xanthones were isolated naturally from the stem of Securidaca inappendiculata Hassk, and structure-activity relationships (SARs) of these compounds were comparatively predicted for their cytotoxic activity against three human multidrug resistant (MDR) cell lines MCF-7/ADR, SMMC-7721/Taxol, and A549/Taxol cells. The results showed that the selected xanthones exhibited different potent cytotoxic activity against the growth of different human tumor cell lines, and most of the xanthones exhibited selective cytotoxicity against SMMC-7721/Taxol cells. Furthermore, some tested xanthones showed stronger cytotoxicity than Cisplatin, which has been used in clinical application extensively. The SARs analysis revealed that the cytotoxic activities of diverse xanthones were affected mostly by the number and position of methoxyl and hydroxyl groups. Xanthones with more free hydroxyl and methoxyl groups increased the cytotoxic activity significantly, especially for those with the presence of C-3 hydroxyl and C-4 methoxyl groups. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. New amides from seeds of Silybum marianum with potential antioxidant and antidiabetic activities.

    Science.gov (United States)

    Qin, Ning-Bo; Jia, Cui-Cui; Xu, Jun; Li, Da-Hong; Xu, Fan-Xing; Bai, Jiao; Li, Zhan-Lin; Hua, Hui-Ming

    2017-06-01

    Two new amide compounds, mariamides A and B (1-2), were obtained together with fourteen known compounds from the seeds of milk thistle (Silybum marianum). Their structures were established on the basis of extensive 1D and 2D NMR analyses, as well as HR-ESI-MS data. Most of the compounds showed significant antioxidant activities than positive control in ABTS and FRAP assays. However, only amide compounds 1-4 showed moderate DPPH radical scavenging activity and compounds 7 and 16 showed the most potent activity against DPPH. Most of the compounds showed moderate to stronger α-glucosidase inhibitory activities. Nevertheless, only flavonoids showed strong PTP1B inhibitory activities. These results indicate a use of milk thistle seed extracts as promising antioxidant and antidiabetic agents. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Brain activation during anticipation of sound sequences.

    Science.gov (United States)

    Leaver, Amber M; Van Lare, Jennifer; Zielinski, Brandon; Halpern, Andrea R; Rauschecker, Josef P

    2009-02-25

    Music consists of sound sequences that require integration over time. As we become familiar with music, associations between notes, melodies, and entire symphonic movements become stronger and more complex. These associations can become so tight that, for example, hearing the end of one album track can elicit a robust image of the upcoming track while anticipating it in total silence. Here, we study this predictive "anticipatory imagery" at various stages throughout learning and investigate activity changes in corresponding neural structures using functional magnetic resonance imaging. Anticipatory imagery (in silence) for highly familiar naturalistic music was accompanied by pronounced activity in rostral prefrontal cortex (PFC) and premotor areas. Examining changes in the neural bases of anticipatory imagery during two stages of learning conditional associations between simple melodies, however, demonstrates the importance of fronto-striatal connections, consistent with a role of the basal ganglia in "training" frontal cortex (Pasupathy and Miller, 2005). Another striking change in neural resources during learning was a shift between caudal PFC earlier to rostral PFC later in learning. Our findings regarding musical anticipation and sound sequence learning are highly compatible with studies of motor sequence learning, suggesting common predictive mechanisms in both domains.

  10. Staying Active: Physical Activity and Exercise

    Science.gov (United States)

    ... Events Advocacy For Patients About ACOG Staying Active: Physical Activity and Exercise Home For Patients Search FAQs Staying ... Exercise FAQ045, November 2016 PDF Format Staying Active: Physical Activity and Exercise Women's Health What are the benefits ...

  11. URG4/URGCP enhances the angiogenic capacity of human hepatocellular carcinoma cells in vitro via activation of the NF-κB signaling pathway

    International Nuclear Information System (INIS)

    Xing, Sizhong; Zhang, Bing; Hua, Ruixi; Tai, William Chi-shing; Zeng, Zhirong; Xie, Binhui; Huang, Chenghui; Xue, Jisu; Xiong, Shiqiu; Yang, Jianyong; Liu, Side; Li, Heping

    2015-01-01

    Angiogenesis is essential for tumor growth. Hepatocellular carcinoma (HCC) is characterized by hypervascularity; high levels of angiogenesis are associated with poor prognosis and a highly invasive phenotype in HCC. Up-regulated gene-4 (URG4), also known as upregulator of cell proliferation (URGCP), is overexpressed in multiple tumor types and has been suggested to act as an oncogene. This study aimed to elucidate the effect of URG4/URGCP on the angiogenic capacity of HCC cells in vitro. Expression of URG4/URGCP in HCC cell lines and normal liver epithelial cell lines was examined by Western blotting and quantitative real-time PCR. URG4/URGCP was stably overexpressed or transiently knocked down using a shRNA in two HCC cell lines. The human umbilical vein endothelial cell (HUVEC) tubule formation and Transwell migration assays and chicken chorioallantoic membrane (CAM) assay were used to examine the angiogenic capacity of conditioned media from URG4/URGCP-overexpressing and knockdown cells. A luciferase reporter assay was used to examine the transcriptional activity of nuclear factor kappa – light – chain - enhancer of activated B cells (NF-κB). NF-κB was inhibited by overexpressing degradation-resistant mutant inhibitor of κB (IκB)-α. Expression of vascular endothelial growth factor C (VEGFC), tumor necrosis factor-α (TNFα), interleukin (IL)-6, IL-8 and v-myc avian myelocytomatosis viral oncogene homolog (MYC) were examined by quantitative real-time PCR; VEGFC protein expression was analyzed using an ELISA. URG4/URGCP protein and mRNA expression were significantly upregulated in HCC cell lines. Overexpressing URG4/URGCP enhanced - while silencing URG4/URGCP decreased - the capacity of HCC cell conditioned media to induce HUVEC tubule formation and migration and neovascularization in the CAM assay. Furthermore, overexpressing URG4/URGCP increased - whereas knockdown of URG4/URGCP decreased - VEGFC expression, NF-κB transcriptional activity, the levels

  12. Halal Activism

    DEFF Research Database (Denmark)

    Fischer, Johan

    2016-01-01

    The purpose of this article is to further our understanding of contemporary Muslim consumer activism in Malaysia with a particular focus on halal (in Arabic, literally “permissible” or “lawful”) products and services. Muslim activists and organisations promote halal on a big scale in the interface...... zones between new forms of Islamic revivalism, the ethnicised state and Muslim consumer culture. Organisations such as the Muslim Consumers Association of Malaysia play an important role in pushing and protecting halal in Malaysia, that is, halal activists constantly call on the state to tighten halal...... in particular historical/national settings and that these issues should be explored in the interfaces between Islam, the state and market. More specifically, this article examines the above issues building on ethnography from fieldwork with three Muslim organisations in Malaysia....

  13. Different activation of opercular and posterior cingulate cortex (PCC) in patients with complex regional pain syndrome (CRPS I) compared with healthy controls during perception of electrically induced pain: a functional MRI study.

    Science.gov (United States)

    Freund, Wolfgang; Wunderlich, Arthur P; Stuber, Gregor; Mayer, Florian; Steffen, Peter; Mentzel, Martin; Weber, Frank; Schmitz, Bernd

    2010-05-01

    Although the etiology of complex regional pain syndrome type 1 (CRPS 1) is still debated, many arguments favor central maladaptive changes in pain processing as an important causative factor. To look for the suspected alterations, 10 patients with CRPS affecting the left hand were explored with functional magnetic resonance imaging during graded electrical painful stimulation of both hands subsequently and compared with healthy participants. Activation of the anterior insula, posterior cingulate cortex (PCC), and caudate nucleus was seen in patients during painful stimulation. Compared with controls, CRPS patients had stronger activation of the PCC during painful stimulation of the symptomatic hand. The comparison of insular/opercular activation between controls and patients with CRPS I during painful stimulation showed stronger (posterior) opercular activation in controls than in patients. Stronger PCC activation during painful stimulation may be interpreted as a correlate of motor inhibition during painful stimuli different from controls. Also, the decreased opercular activation in CRPS patients shows less sensory-discriminative processing of painful stimuli.These results show that changed cerebral pain processing in CRPS patients is less sensory-discriminative but more motor inhibition during painful stimuli. These changes are not limited to the diseased side but show generalized alterations of cerebral pain processing in chronic pain patients.

  14. The TORC1/P70S6K and TORC1/4EBP1 signaling pathways have a stronger contribution on skeletal muscle growth than MAPK/ERK in an early vertebrate: Differential involvement of the IGF system and atrogenes.

    Science.gov (United States)

    Fuentes, Eduardo N; Einarsdottir, Ingibjörg Eir; Paredes, Rodolfo; Hidalgo, Christian; Valdes, Juan Antonio; Björnsson, Björn Thrandur; Molina, Alfredo

    2015-01-01

    Knowledge about the underlying mechanisms, particularly the signaling pathways that account for muscle growth in vivo in early vertebrates is still scarce. Fish (Paralichthys adspersus) were fasted for 3weeks to induce a catabolic period of strong muscle atrophy. Subsequently, fish were refed for 2weeks to induce compensatory muscle hypertrophy. During refeeding, the fish were treated daily with either rapamycin (TORC blocker), PD98059 (MEK blocker), or PBS (V; vehicle), or were untreated (C; control). Rapamycin and PD98059 differentially impaired muscle cellularity in vivo, growth performance, and the expression of growth-related genes, and the inhibition of TORC1 had a greater impact on fish muscle growth than the inhibition of MAPK. Blocking TORC1 inhibited the phosphorylation of P70S6K and 4EBP1, two downstream components activated by TORC1, thus affecting protein contents in muscle. Concomitantly, the gene expression in muscle of igf-1, 2 and igfbp-4, 5 was down-regulated while the expression of atrogin-1, murf-1, and igfbp-2, 3 was up-regulated. Muscle hypertrophy was abolished and muscle atrophy was promoted, which finally affected body weight. TORC2 complex was not affected by rapamycin. On the other hand, the PD98059 treatment triggered ERK inactivation, a downstream component activated by MEK. mRNA contents of igf-1 in muscle were down-regulated, and muscle hypertrophy was partially impaired. The present study provides the first direct data on the in vivo contribution of TORC1/P70S6K, TORC1/4EBP1, and MAPK/ERK signaling pathways in the skeletal muscle of an earlier vertebrate, and highlights the transcendental role of TORC1 in growth from the cellular to organism level. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Theory of corticothalamic brain activity in a spherical geometry: Spectra, coherence, and correlation

    Science.gov (United States)

    Mukta, K. N.; MacLaurin, J. N.; Robinson, P. A.

    2017-11-01

    Corticothalamic neural field theory is applied to a spherical geometry to better model neural activity in the human brain and is also compared with planar approximations. The frequency power spectrum, correlation, and coherence functions are computed analytically and numerically. The effects of cortical boundary conditions and resulting modal aspects of spherical corticothalamic dynamics are explored, showing that the results of spherical and finite planar geometries converge to those for the infinite planar geometry in the limit of large brain size. Estimates are made of the point at which modal series can be truncated and it is found that for physiologically plausible parameters only the lowest few spatial eigenmodes are needed for an accurate representation of macroscopic brain activity. A difference between the geometries is that there is a low-frequency 1 /f spectrum in the infinite planar geometry, whereas in the spherical geometry it is 1 /f2 . Another difference is that the alpha peak in the spherical geometry is sharper and stronger than in the planar geometry. Cortical modal effects can lead to a double alpha peak structure in the power spectrum, although the main determinant of the alpha peak is corticothalamic feedback. In the spherical geometry, the cross spectrum between two points is found to only depend on their relative distance apart. At small spatial separations the low-frequency cross spectrum is stronger than for an infinite planar geometry and the alpha peak is sharper and stronger due to the partitioning of the energy into discrete modes. In the spherical geometry, the coherence function between points decays monotonically as their separation increases at a fixed frequency, but persists further at resonant frequencies. The correlation between two points is found to be positive, regardless of the time lag and spatial separation, but decays monotonically as the separation increases at fixed time lag. At fixed distance the correlation has peaks

  16. Active sharing

    CERN Multimedia

    2012-01-01

    The big news this week is, of course, the conclusions from the LHC performance workshop held in Chamonix from 6 to 10 February . The main recommendation, endorsed by CERN’s Machine Advisory Committee and adopted by the Management, is that the LHC will run at 4 TeV per beam this year. You can find all the details from Chamonix in the slides presented on Wednesday at the summary session, which leaves me free to talk about another important development coming up soon.   In ten days time, a new kind of gathering will be taking place in Geneva, bringing together two previously separate conferences, one driven by physics, the other by the medical community, but both looking to apply physics to the advancement of health. The merger of the International Conference for Translational Research in Radio-Oncology and CERN’s workshop on Physics for Health in Europe (ICTR-PHE) makes for a very eclectic mix. Presentations range from active shielding for interplanetary flight to the rather...

  17. Active Segmentation.

    Science.gov (United States)

    Mishra, Ajay; Aloimonos, Yiannis

    2009-01-01

    The human visual system observes and understands a scene/image by making a series of fixations. Every fixation point lies inside a particular region of arbitrary shape and size in the scene which can either be an object or just a part of it. We define as a basic segmentation problem the task of segmenting that region containing the fixation point. Segmenting the region containing the fixation is equivalent to finding the enclosing contour- a connected set of boundary edge fragments in the edge map of the scene - around the fixation. This enclosing contour should be a depth boundary.We present here a novel algorithm that finds this bounding contour and achieves the segmentation of one object, given the fixation. The proposed segmentation framework combines monocular cues (color/intensity/texture) with stereo and/or motion, in a cue independent manner. The semantic robots of the immediate future will be able to use this algorithm to automatically find objects in any environment. The capability of automatically segmenting objects in their visual field can bring the visual processing to the next level. Our approach is different from current approaches. While existing work attempts to segment the whole scene at once into many areas, we segment only one image region, specifically the one containing the fixation point. Experiments with real imagery collected by our active robot and from the known databases 1 demonstrate the promise of the approach.

  18. Gritty people try harder: grit and effort-related cardiac autonomic activity during an active coping challenge.

    Science.gov (United States)

    Silvia, Paul J; Eddington, Kari M; Beaty, Roger E; Nusbaum, Emily C; Kwapil, Thomas R

    2013-05-01

    Grit, a recently proposed personality trait associated with persistence for long-range goals, predicts achievement in a wide range of important life outcomes. Using motivational intensity theory, the present research examined the physiological underpinnings of grit during an active coping task. Forty young adults completed the Short Grit Scale and worked on a self-paced mental effort task. Effort-related autonomic nervous system (ANS) activity was assessed using impedance cardiography, which yielded measures of sympathetic activity (pre-ejection period; PEP) and parasympathetic activity (respiratory sinus arrhythmia; RSA). Multilevel models revealed that people high on the Perseverance of Effort subscale showed autonomic coactivation: both PEP and RSA became stronger during the task, reflecting higher activity of both ANS divisions. The Consistency of Interest subscale, in contrast, predicted only weaker sympathetic activity (slower PEP). Taken together, the findings illuminate autonomic processes associated with how "gritty" people pursue goals, and they suggest that more attention should be paid to the facets' distinct effects. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. PARP-1 depletion in combination with carbon ion exposure significantly reduces MMPs activity and overall increases TIMPs expression in cultured HeLa cells

    International Nuclear Information System (INIS)

    Ghorai, Atanu; Sarma, Asitikantha; Chowdhury, Priyanka; Ghosh, Utpal

    2016-01-01

    Hadron therapy is an innovative technique where cancer cells are precisely killed leaving surrounding healthy cells least affected by high linear energy transfer (LET) radiation like carbon ion beam. Anti-metastatic effect of carbon ion exposure attracts investigators into the field of hadron biology, although details remain poor. Poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors are well-known radiosensitizer and several PARP-1 inhibitors are in clinical trial. Our previous studies showed that PARP-1 depletion makes the cells more radiosensitive towards carbon ion than gamma. The purpose of the present study was to investigate combining effects of PARP-1 inhibition with carbon ion exposure to control metastatic properties in HeLa cells. Activities of matrix metalloproteinases-2, 9 (MMP-2, MMP-9) were measured using the gelatin zymography after 85 MeV carbon ion exposure or gamma irradiation (0- 4 Gy) to compare metastatic potential between PARP-1 knock down (HsiI) and control cells (H-vector - HeLa transfected with vector without shRNA construct). Expression of MMP-2, MMP-9, tissue inhibitor of MMPs such as TIMP-1, TIMP-2 and TIMP-3 were checked by immunofluorescence and western blot. Cell death by trypan blue, apoptosis and autophagy induction were studied after carbon ion exposure in each cell-type. The data was analyzed using one way ANOVA and 2-tailed paired-samples T-test. PARP-1 silencing significantly reduced MMP-2 and MMP-9 activities and carbon ion exposure further diminished their activities to less than 3 % of control H-vector. On the contrary, gamma radiation enhanced both MMP-2 and MMP-9 activities in H-vector but not in HsiI cells. The expression of MMP-2 and MMP-9 in H-vector and HsiI showed different pattern after carbon ion exposure. All three TIMPs were increased in HsiI, whereas only TIMP-1 was up-regulated in H-vector after irradiation. Notably, the expressions of all TIMPs were significantly higher in HsiI than H-vector at 4 Gy. Apoptosis was

  20. What propels sexual murderers: a proposed integrated theory of social learning and routine activities theories.

    Science.gov (United States)

    Chan, Heng Choon Oliver; Heide, Kathleen M; Beauregard, Eric

    2011-04-01

    Despite the great interest in the study of sexual homicide, little is known about the processes involved in an individual's becoming motivated to sexually kill, deciding to sexually kill, and acting on that desire, intention, and opportunity. To date, no comprehensive model of sexual murdering from the offending perspective has been proposed in the criminological literature. This article incorporates the works of Akers and Cohen and Felson regarding their social learning theory and routine activities theory, respectively, to construct an integrated conceptual offending framework in sexual homicide. This integrated model produces a stronger and more comprehensive explanation of sexual murder than any single theory currently available.

  1. The gender differences in the inhibitory action of UVB-induced melanocyte activation by the administration of tranexamic acid.

    Science.gov (United States)

    Hiramoto, Keiichi; Yamate, Yurika; Sugiyama, Daijiro; Takahashi, Yumi; Mafune, Eiichi

    2016-05-01

    Tranexamic acid has an inhibitory action on ultraviolet (UV) B-induced melanocyte activation. This study examined the sex differences in the inhibitory action of tranexamic acid on UVB-induced melanocyte activation. We irradiated the eye and ear of male and female mice with UVB at a dose of 1.0 kJ/m(2) using a 20SE sunlamp. We orally administered tranexamic acid (750 mg/kg/day) at 30 min before UVB exposure. Tranexamic acid inhibited the UVB-induced epidermal melanocyte activation, and the effect was more remarkable under UVB eye irradiation than under UVB ear irradiation. Furthermore, the melanocyte activity suppression effect was stronger in female mice than in male mice. Following the administration of tranexamic acid, the female displayed increased blood levels of β-endorphin and μ-opioid receptor and estradiol receptor β expression in comparison with the male. Furthermore, the effect of melanocyte activity suppression in the female mice was decreased by the administration of tamoxifen (antagonist of estrogen receptor) or naltrexone (antagonist of μ-opioid receptor). These results suggest that the suppression by tranexamic acid of the UVB-induced melanocyte activation (UVB sensitivity) is stronger in female mice than in male mice and that female hormones and β-endorphin play an important role in this sex difference. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Openness as a predictor of political orientation and conventional and unconventional political activism in Western and Eastern Europe.

    Science.gov (United States)

    Roets, Arne; Cornelis, Ilse; Van Hiel, Alain

    2014-01-01

    This study provides a comprehensive investigation of the relationship between Openness and political orientation and activism in Europe. Analyses were conducted on the 4 waves of the European Social Survey, including large representative samples in up to 26 European countries (total N > 175,000). In line with previous studies, a robust, positive relationship between Openness and left-wing political orientation was obtained in Western Europe. However, in Eastern Europe, the relationship between Openness and political orientation was weaker, and reversed in 3 out of 4 waves. Moreover, Openness yielded significant positive relationships with unconventional activism and to a lesser degree with conventional activism. The magnitude of the relationship between Openness and activism was dependent on political orientation and region. Stronger associations between Openness and activism were found for those having a left-wing orientation in Western Europe, whereas in Eastern Europe, Openness was somewhat stronger related to activism for those having a right-wing orientation. In the discussion we elaborate on the role of the geopolitical context in the relationship between Openness and political variables.

  3. REX-1 expression and p38 MAPK activation status can determine proliferation/differentiation fates in human mesenchymal stem cells.

    Directory of Open Access Journals (Sweden)

    Dilli Ram Bhandari

    Full Text Available BACKGROUND: REX1/ZFP42 is a well-known embryonic stem cell (ESC marker. However, the role of REX1, itself, is relatively unknown because the function of REX1 has only been reported in the differentiation of ESCs via STAT signaling pathways. Human mesenchymal stem cells (hMSCs isolated from young tissues and cancer cells express REX1. METHODOLOGY/PRINCIPAL FINDING: Human umbilical cord blood-derived MSCs (hUCB-MSCs and adipose tissue-derived MSCs (hAD-MSCs strongly express REX1 and have a lower activation status of p38 MAPK, but bone marrow-derived MSCs (hBM-MSCs have weak REX1 expression and higher activation of p38 MAPK. These results indicated that REX1 expression in hMSCs was positively correlated with proliferation rates but inversely correlated with the phosphorylation of p38 MAPK. In hUCB-MSCs, the roles of REX1 and p38 MAPK were investigated, and a knockdown study was performed using a lentiviral vector-based small hairpin RNA (shRNA. After REX1 knockdown, decreased cell proliferation was observed. In REX1 knocked-down hUCB-MSCs, the osteogenic differentiation ability deteriorated, but the adipogenic potential increased or was similar to that observed in the controls. The phosphorylation of p38 MAPK in hUCB-MSCs significantly increased after REX1 knockdown. After p38 MAPK inhibitor treatment, the cell growth in REX1 knocked-down hUCB-MSCs almost recovered, and the suppressed expression levels of CDK2 and CCND1 were also restored. The expression of MKK3, an upstream regulator of p38 MAPK, significantly increased in REX1 knocked-down hUCB-MSCs. The direct binding of REX1 to the MKK3 gene was confirmed by a chromatin immunoprecipitation (ChIP assay. CONCLUSIONS/SIGNIFICANCE: These findings showed that REX1 regulates the proliferation/differentiation of hMSCs through the suppression of p38 MAPK signaling via the direct suppression of MKK3. Therefore, p38 MAPK and REX-1 status can determine the cell fate of adult stem cells (ASCs. These

  4. Suppression of NRF2–ARE activity sensitizes chemotherapeutic agent-induced cytotoxicity in human acute monocytic leukemia cells

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Hui [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Wang, Huihui [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Xue, Peng [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Hou, Yongyong [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); Dong, Jian [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Institute of Biology and Medicine, Wuhan University of Science and Technology, Wuhan (China); Zhou, Tong [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Peng, Shuangqing [Institute of Disease Control and Prevention, Academy of Military Medical Sciences, Beijing (China); Li, Jin; Carmichael, Paul L. [Unilever, Safety & Environmental Assurance Centre, Colworth Science Park, Sharnbrook, Bedfordshire MK44 1LQ (United Kingdom); Nelson, Bud; Clewell, Rebecca; Zhang, Qiang; Andersen, Melvin E. [The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States); Pi, Jingbo, E-mail: jpi@mail.cmu.edu.cn [School of Public Health, China Medical University, 77 Puhe Road, Shenyang North New Area, Shenyang (China); The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC (United States)

    2016-02-01

    Nuclear factor erythroid 2-related factor 2 (NRF2), a master regulator of the antioxidant response element (ARE)-dependent transcription, plays a pivotal role in chemical detoxification in normal and tumor cells. Consistent with previous findings that NRF2–ARE contributes to chemotherapeutic resistance of cancer cells, we found that stable knockdown of NRF2 by lentiviral shRNA in human acute monocytic leukemia (AML) THP-1 cells enhanced the cytotoxicity of several chemotherapeutic agents, including arsenic trioxide (As{sub 2}O{sub 3}), etoposide and doxorubicin. Using an ARE-luciferase reporter expressed in several human and mouse cells, we identified a set of compounds, including isonicotinic acid amides, isoniazid and ethionamide, that inhibited NRF2–ARE activity. Treatment of THP-1 cells with ethionamide, for instance, significantly reduced mRNA expression of multiple ARE-driven genes under either basal or As{sub 2}O{sub 3}-challenged conditions. As determined by cell viability and cell cycle, suppression of NRF2–ARE by ethionamide also significantly enhanced susceptibility of THP-1 and U937 cells to As{sub 2}O{sub 3}-induced cytotoxicity. In THP-1 cells, the sensitizing effect of ethionamide on As{sub 2}O{sub 3}-induced cytotoxicity was highly dependent on NRF2. To our knowledge, the present study is the first to demonstrate that ethionamide suppresses NRF2–ARE signaling and disrupts the transcriptional network of the antioxidant response in AML cells, leading to sensitization to chemotherapeutic agents. - Highlights: • Identification of novel inhibitors of ARE-dependent transcription • Suppression of NRF2–ARE sensitizes THP-1 cells to chemotherapy. • Ethionamide suppresses ARE-dependent transcriptional activity. • Ethionamide and isoniazid increase the cytotoxicity of As{sub 2}O{sub 3} in AML cells. • Sensitization of THP-1 cells to As{sub 2}O{sub 3} toxicity by ethionamide is NRF2-dependent.

  5. Position in Educational Activity and Empathy Ability in Adolescence and Teenage Years

    Directory of Open Access Journals (Sweden)

    Klimenkova E.N.

    2017-11-01

    Full Text Available The article is devoted to the study of the relationship between empathy and learning activity position in adolescence and young. We present the results of empirical research of 78 assisting professions students (psychologists and teachers and 42 Polytechnic College students with the techniques of studying empathic abilities (questionnaire of the Interpersonal Reactivity Index of M. Davis in the adaptation of TD Karyagina, projective technique "Consolation Strategies" Vasiluk and EV Sheryagina, processing in the modification of AB Kholmogorova, and the the subject position (the questionnaire "Subject Position in studying activity" by Yu.V. Zaretsky and V.K. Zaretsky. Students less likely to use emotional support, the objective position is more clearly expressed and less subjective in relation to learning activity. Subjects with a subjective learning activity position have stronger empathy, perspective taking and the ability to provide support. Subjects with a subject position often use emotional support.

  6. Composition and antioxidant activities of four polysaccharides extracted from Herba Lophatheri.

    Science.gov (United States)

    Ge, Qing; Mao, Jian-wei; Guo, Xiao-qing; Zhou, Yi-feng; Gong, Jing-yan; Mao, Shuang-rong

    2013-09-01

    Four polysaccharides (BLF80-A, BLF80-B, BLF80-C and BLF80-D) were isolated by hot-water extraction and purified from the leaves of Herba Lophatheri by DEAE-Sepharose fast flow. Their chemical and physical characteristics were determined and antioxidant activities were investigated on the basis of DPPH radical assay, hydroxyl radical assay and superoxide radical assay. The results showed that four polysaccharides exhibited antioxidant activities in a concentration-dependent manner, and the higher molecular weight, the stronger antioxidant activities of polysaccharides. Besides, the monosaccharide compositions of polysaccharides also influence their antioxidant activities. BLP80-D showed the strongest scavenging ability, followed by BLP80-C, BLP80-B and BLP80-A. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Yields, Phenolic Profiles and Antioxidant Activities of Ziziphus jujube Mill. in Response to Different Fertilization Treatments

    Directory of Open Access Journals (Sweden)

    Min Wang

    2013-09-01

    Full Text Available Increasing demand for more jujube (Ziziphus jujube Mill. production requires understanding the specific fertilization needs of jujube trees. This study was conducted to compare fruit yields, phenolic profiles and antioxidant activity of jujube in response to different fertilizers. Application of organic fertilizer appeared to enhance the phenolics and antioxidant activity accumulation of jujubes, compared to conventional fertilized jujubes. Amongst inorganic fertilizers, supplemental potassium as an individual nutrient improved the accumulation of phenolics in jujubes. Our results demonstrate that phenolics levels and antioxidant activity of jujube can be manipulated through fertilizer management and tracked by following proanthocyanidin concentrations. In a practical production context, the combination of organic fertilizers and inorganic fertilizers such as more supplemental individual potassium, and less supplemental individual nitrogen and phosphorus, might be the best management combination for achieving higher phenolic concentration, stronger antioxidant activity and a good harvest.

  8. IASS Activity

    Science.gov (United States)

    Hojaev, Alisher S.; Ibragimova, Elvira M.

    2015-08-01

    It’s well known, astronomy in Uzbekistan has ancient roots and traditions (e.g., Mirzo Ulugh Beg, Abū al-Rayhān al-Bīrūnī, Abū ‘Abdallāh al-Khwārizmī) and astronomical heritage carefully preserved. Nowadays uzbek astronomers play a key role in scientific research but also in OAD and Decadal Plan activity in the Central Asia region. International Aerospace School (IASS) is an amazing and wonderful event held annually about 30 years. IASS is unique project in the region, and at the beginning we spent the Summer and Winter Schools. At present in the summer camp we gather about 50 teenage and undergraduate students over the country and abroad (France, Malaysia, Turkey, Azerbaijan, Pakistan, Russia, etc.). They are selected on the basis of tests of astronomy and space issues. During two weeks of IASS camp the invited scientists, cosmonauts and astronauts as well as other specialists give lectures and engage in practical exercises with IASS students in astronomy, including daily observations of the Sun and night sky observations with meniscus telescope, space research and exploration, aerospace modelling, preparation and presentation of original projects. This is important that IASS gives not theoretical grounds only but also practically train the students and the hands-on training is the major aims of IASS. Lectures and practice in the field of astronomy carried out with the direct involvement and generous assistance of Uranoscope Association (Paris, France). The current 26-th IASS is planned to held in July 2015.

  9. Emission activity of the Be star 60 Cygni

    Directory of Open Access Journals (Sweden)

    Šejnová K.

    2017-01-01

    Full Text Available In this paper we present results of spectroscopic analysis of the H® line profile of the Be star 60 Cygni. We present time evolution of the equivalent width of the H® line profiles during years 1992 - 2016 and V=R variation during years 1995 - 2016. We analyzed data from Ondřejov Observatory and from BeSS Database. The circumstellar disk of the star was present twice during years 1992 - 2016 and the second cycle shows stronger emission activity. We found out that the formation of the disk takes longer time than the disk extinction (the extinction is much steeper than the formation and that there is no evident period of changes in the V=R variation.

  10. Synthesis of chitosan derivative with diethyldithiocarbamate and its antifungal activity.

    Science.gov (United States)

    Qin, Yukun; Xing, Ronge; Liu, Song; Li, Kecheng; Hu, Linfeng; Yu, Huahua; Chen, Xiaolin; Li, Pengcheng

    2014-04-01

    With an aim to discover novel chitosan derivatives with enhanced antifungal properties compared with chitosan. Diethyl dithiocarbamate chitosan (EtDTCCS) was investigated and its structure was well identified. The antifungal activity of EtDTCCS against Alternaria porri (A. porri), Gloeosporium theae sinensis Miyake (G. theae sinensis), and Stemphylium solani Weber (S. solani) was tested at 0.25, 0.5, and 1.0 mg/mL, respectively. Compared with plain chitosan, EtDTCCS shows better inhibitory effect with 93.2% inhibitory index on G. theae sinensis at 1.0 mg/mL, even stronger than for polyoxin (82.5%). It was inferred derivatives of this kind may find potential applications for the treatment of various crop-threatening diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Optical limiting properties of optically active phthalocyanine derivatives

    Science.gov (United States)

    Wang, Peng; Zhang, Shuang; Wu, Peiji; Ye, Cheng; Liu, Hongwei; Xi, Fu

    2001-06-01

    The optical limiting properties of four optically active phthalocyanine derivatives in chloroform solutions and epoxy resin thin plates were measured at 532 nm with 10 ns pulses. The excited state absorption cross-section σex and refractive-index cross-section σr were determined with the Z-scan technique. These chromophores possess larger σex than the ground state absorption cross-section σ0, indicating that they are the potential materials for reverse saturable absorption (RSA). The negative σr values of these chromophores add to the thermal contribution, producing a larger defocusing effect, which may be helpful in further enhancing their optical limiting performance. The optical limiting responses of the thin plate samples are stronger than those of the chloroform solutions.

  12. Activation Energy

    Science.gov (United States)

    Gadeken, Owen

    2002-01-01

    Teaming is so common in today's project management environment that most of us assume it comes naturally. We further assume that when presented with meaningful and challenging work, project teams will naturally engage in productive activity to complete their tasks. This assumption is expressed in the simple (but false) equation: Team + Work = Teamwork. Although this equation appears simple and straightforward, it is far from true for most project organizations whose reality is a complex web of institutional norms based on individual achievement and rewards. This is illustrated by the very first successful team experience from my early Air Force career. As a young lieutenant, I was sent to Squadron Officer School, which was the first in the series of Air Force professional military education courses I was required to complete during my career. We were immediately formed into teams of twelve officers. Much of the course featured competition between these teams. As the most junior member of my team, I quickly observed the tremendous pressure to show individual leadership capability. At one point early in the course, almost everyone in our group was vying to become the team leader. This conflict was so intense that it caused us to fail miserably in our first outdoor team building exercise. We spent so much time fighting over leadership that we were unable to complete any of the events on the outdoor obstacle course. This complete lack of success was so disheartening to me that I gave our team little hope for future success. What followed was a very intense period of bickering, conflict, and even shouting matches as our dysfunctional team tried to cope with our early failures and find some way to succeed. British physician and researcher Wilfred Bion (Experiences in Groups, 1961) discovered that there are powerful psychological forces inherent in all groups that divert from accomplishing their primary tasks. To overcome these restraining forces and use the potential

  13. Changes in the pharmacodynamics and pharmacokinetics of psycholeptic drugs in radiation-sickness. Effect of X-ray radiation on pharmacodynamic activity of nitrazepam in animals

    International Nuclear Information System (INIS)

    Szczawinska, K.; Chodera, A.; Wojciak, Z.; Kozaryn, I.

    1975-01-01

    The anticonvulsive effect of nitrazepam was determined in animals exposed to a single 600 R radiation and the exploring activity of the animals was studied after nitrazepam administered during radiation sickness caused by this exposure. On the 1st day after exposure the activity, reducing effect was slightly weaker but on days 3rd and 6th this effect was significantly stronger. The anticonvulsant effect of nitrazepam on the 3rd day after exposure was significantly greater as compared with control animals, but on the 6th day no difference in the power of anticonvulsant activity between the two groups of animals was found. (author)

  14. Hepatitis C virus core protein potentiates proangiogenic activity of hepatocellular carcinoma cells.

    Science.gov (United States)

    Shao, Yu-Yun; Hsieh, Min-Shu; Wang, Han-Yu; Li, Yong-Shi; Lin, Hang; Hsu, Hung-Wei; Huang, Chung-Yi; Hsu, Chih-Hung; Cheng, Ann-Lii

    2017-10-17

    Increased angiogenic activity has been demonstrated in hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC), but the mechanism was unclear. To study the role of HCV core protein, we used tube formation and Matrigel plug assays to assess the proangiogenic activity of an HCC cell line, HuH7, and 2 of its stable clones-HuH7-core-high and HuH7-core-low, with high and low HCV core protein expression, respectively. In both assays, HuH7-core-high and HuH7-core-low cells dose-dependently induced stronger angiogenesis than control cells. HuH7 cells with HCV core protein expression showed increased mRNA and protein expression of vascular endothelial growth factor (VEGF). VEGF inhibition by bevacizumab reduced the proangiogenic activity of HuH7-core-high cells. The promotor region of VEGF contains the binding site of activator protein-1 (AP-1). Compared with controls, HuH7-core-high cells had an increased AP-1 activity and nuclear localization of phospho-c-jun. AP-1 inhibition using either RNA knockdown or AP-1 inhibitors reduced the VEGF mRNA expression and the proangiogenic activity of HuH7-core-high cells. Among 131 tissue samples from HCC patients, HCV-related HCC revealed stronger VEGF expression than did hepatitis B virus-related HCC. In conclusion, increased VEGF expression through AP-1 activation is a crucial mechanism underlying the proangiogenic activity of the HCV core protein in HCC cells.

  15. Habit strength is predicted by activity dynamics in goal-directed brain systems during training.

    Science.gov (United States)

    Zwosta, Katharina; Ruge, Hannes; Goschke, Thomas; Wolfensteller, Uta

    2018-01-15

    Previous neuroscientific research revealed insights into the brain networks supporting goal-directed and habitual behavior, respectively. However, it remains unclear how these contribute to inter-individual differences in habit strength which is relevant for understanding not only normal behavior but also more severe dysregulations between these types of action control, such as in addiction. In the present fMRI study, we trained subjects on approach and avoidance behavior for an extended period of time before testing the habit strength of the acquired stimulus-response associations. We found that stronger habits were associated with a stronger decrease in inferior parietal lobule activity for approach and avoidance behavior and weaker vmPFC activity at the end of training for avoidance behavior, areas associated with the anticipation of outcome identity and value. VmPFC in particular showed markedly different activity dynamics during the training of approach and avoidance behavior. Furthermore, while ongoing training was accompanied by increasing functional connectivity between posterior putamen and premotor cortex, consistent with previous assumptions about the neural basis of increasing habitualization, this was not predictive of later habit strength. Together, our findings suggest that inter-individual differences in habitual behavior are driven by differences in the persistent involvement of brain areas supporting goal-directed behavior during training. Copyright © 2017. Published by Elsevier Inc.

  16. Using perturbations to identify the brain circuits underlying active vision.

    Science.gov (United States)

    Wurtz, Robert H

    2015-09-19

    The visual and oculomotor systems in the brain have been studied extensively in the primate. Together, they can be regarded as a single brain system that underlies active vision--the normal vision that begins with visual processing in the retina and extends through the brain to the generation of eye movement by the brainstem. The system is probably one of the most thoroughly studied brain systems in the primate, and it offers an ideal opportunity to evaluate the advantages and disadvantages of the series of perturbation techniques that have been used to study it. The perturbations have been critical in moving from correlations between neuronal activity and behaviour closer to a causal relation between neuronal activity and behaviour. The same perturbation techniques have also been used to tease out neuronal circuits that are related to active vision that in turn are driving behaviour. The evolution of perturbation techniques includes ablation of both cortical and subcortical targets, punctate chemical lesions, reversible inactivations, electrical stimulation, and finally the expanding optogenetic techniques. The evolution of perturbation techniques has supported progressively stronger conclusions about what neuronal circuits in the brain underlie active vision and how the circuits themselves might be organized.

  17. Lateralized frontal activity for Japanese phonological processing during child development

    Directory of Open Access Journals (Sweden)

    Takaaki eGoto

    2015-07-01

    Full Text Available Phonological awareness is essential for reading, and is common to all language systems, including alphabetic languages and Japanese. This cognitive factor develops during childhood, and is thought to be associated with shifts in brain activity. However, the nature of this neurobiological developmental shift is unclear for speakers of Japanese, which is not an alphabetical language. The present study aimed to reveal a shift in brain functions for processing phonological information in native-born Japanese children. We conducted a phonological awareness task and examined hemodynamic activity in 103 children aged 7 to 12 years. While younger children made mistakes and needed more time to sort phonological information in reverse order, older children completed the task quickly and accurately. Additionally, younger children exhibited increased activity in the bilateral dorsolateral prefrontal cortex, which may be evidence of immature phonological processing skills. Older children exhibited dominant activity in the left compared with the right dorsolateral prefrontal cortex, suggesting that they had already acquired phonological processing skills. We also found significant effects of age and lateralized activity on behavioral performance. During earlier stages of development, the degree of left lateralization appears to have a smaller effect on behavioral performance. Conversely, in later stages of development, the degree of left lateralization appears to have a stronger influence on behavioral performance. These initial findings regarding a neurobiological developmental shift in Japanese speakers suggest that common brain regions play a critical role in the development of phonological processing skills among different languages systems, such as Japanese and alphabetical languages.

  18. Increasing physical activity through mobile device interventions: A systematic review.

    Science.gov (United States)

    Muntaner, Adrià; Vidal-Conti, Josep; Palou, Pere

    2016-09-01

    Physical inactivity is a health problem that affects people worldwide and has been identified as the fourth largest risk factor for overall mortality (contributing to 6% of deaths globally). Many researchers have tried to increase physical activity levels through traditional methods without much success. Thus, many researchers are turning to mobile technology as an emerging method for changing health behaviours. This systematic review sought to summarise and update the existing scientific literature on increasing physical activity through mobile device interventions, taking into account the methodological quality of the studies. The articles were identified by searching the PubMed, SCOPUS and SPORTDiscus databases for studies published between January 2003 and December 2013. Studies investigating efforts to increase physical activity through mobile phone or even personal digital assistant interventions were included. The search results allowed the inclusion of 11 studies that gave rise to 12 publications. Six of the articles included in this review reported significant increases in physical activity levels. The number of studies using mobile devices for interventions has increased exponentially in the last few years, but future investigations with better methodological quality are needed to draw stronger conclusions regarding how to increase physical activity through mobile device interventions. © The Author(s) 2015.

  19. Activity of upper limb muscles during human walking.

    Science.gov (United States)

    Kuhtz-Buschbeck, Johann P; Jing, Bo

    2012-04-01

    The EMG activity of upper limb muscles during human gait has rarely been studied previously. It was examined in 20 normal volunteers in four conditions: walking on a treadmill (1) with unrestrained natural arm swing (Normal), (2) while volitionally holding the arms still (Held), (3) with the arms immobilized (Bound), and (4) with the arms swinging in phase with the ipsilateral legs, i.e. opposite-to-normal phasing (Anti-Normal). Normal arm swing involved weak rhythmical lengthening and shortening contractions of arm and shoulder muscles. Phasic muscle activity was needed to keep the unrestricted arms still during walking (Held), indicating a passive component of arm swing. An active component, possibly programmed centrally, existed as well, because some EMG signals persisted when the arms were immobilized during walking (Bound). Anti-Normal gait involved stronger EMG activity than Normal walking and was uneconomical. The present results indicate that normal arm swing has both passive and active components. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Comparison of the Microbicidal activity of monochloramine and iodine.

    Science.gov (United States)

    Arnitz, R; Nagl, M; Gottardi, W

    2015-12-01

    Recently, we showed that monochloramine (NH2 Cl) has a significantly stronger bactericidal and fungicidal activity than chloramine T despite its lower oxidizing power. This phenomenon was explained by increased penetration because of the higher lipophilicity and smaller bulk of NH2 Cl. As iodine (I2 ) has an even fivefold higher bulk than NH2 Cl, a comparison of both compounds regarding their microbicidal activity became the aim of this study. Aqueous solutions of I2 at a concentration of 10·7 μmol l(-1) killed 10(6) colony forming units per millilitre (CFU ml(-1) ) of Escherichia coli, Staphylococcus aureus or Pseudomonas aeruginosa to the detection limit of 10(2) CFU ml(-1) within 1 min at 20°C and pH 7·1, while a concentration of 36-355 μmol l(-1) of NH2 Cl was needed to achieve the same effect. Aspergillus fumigatus was inactivated within 5 min by 36 μmol l(-1) I2 and by 355 μmol l(-1) NH2 Cl, Candida albicans within 1 min by 10·7 μmol l(-1) I2 and by 355 μmol l(-1) NH2 Cl. The lipophilicity of I2 , determined with the octanol/water method, was three powers of 10 higher than that of NH2 Cl. The at least 10-fold stronger microbicidal activity of iodine suggests that the hindrance of penetration of the bulky molecule is outweighed by enhanced lipophilicity. The microbicidal activity of active halogen compounds increases not only with their reactivity, but also with higher lipophilicity and lower bulk, as shown recently. In this study, iodine showed a higher microbicidal activity than monochloramine and a 1000-fold higher lipophilicity. Therefore, the lipophilicity of a disinfectant may be more important than the bulk for bactericidal activity. These facts should be considered upon the design of new antiseptics and their clinical application. © 2015 The Society for Applied Microbiology.

  1. Culture modulates brain activity during empathy with anger.

    Science.gov (United States)

    de Greck, Moritz; Shi, Zhenhao; Wang, Gang; Zuo, Xiangyu; Yang, Xuedong; Wang, Xiaoying; Northoff, Georg; Han, Shihui

    2012-02-01

    Interdependent cultures (such as the Chinese) and independent cultures (such as the German) differ in their attitude towards harmony that is more valued in interdependent cultures. Interdependent and independent cultures also differ in their appreciation of anger--an emotion that implies the disruption of harmony. The present study investigated if interdependent and independent cultures foster distinct brain activity associated with empathic processing of familiar angry, familiar neutral, and unfamiliar neutral faces. Using functional MRI, we scanned Chinese and German healthy subjects during an intentional empathy task, a control task (the evaluation of skin color), and a baseline condition. The subject groups were matched with regard to age, gender, and education. Behaviorally, Chinese subjects described themselves as significantly more interdependent compared to German subjects. The contrast 'intentional empathy for familiar angry'>'baseline' revealed several regions, including the left inferior frontal cortex, the left supplementary motor area, and the left insula, that showed comparable hemodynamic responses in both groups. However, the left dorsolateral prefrontal cortex had stronger hemodynamic responses in Chinese subjects in the contrast 'intentional empathy for familiar angry'>'baseline'. Germans, in contrast, showed stronger hemodynamic responses in the right temporo-parietal junction, right inferior and superior temporal gyrus, and left middle insula for the same contrast. Hemodynamic responses in the latter three brain regions correlated with interdependences scores over all subjects. Our results suggest that enhanced emotion regulation during empathy with anger in the interdependent lifestyle is mediated by the left dorsolateral prefrontal cortex. Increased tolerance towards the expression of anger in the independent lifestyle, in contrast, is associated with increased activity of the right inferior and superior temporal gyrus and the left middle

  2. MAGNETIC ENERGY SPECTRA IN SOLAR ACTIVE REGIONS

    International Nuclear Information System (INIS)

    Abramenko, Valentyna; Yurchyshyn, Vasyl

    2010-01-01

    Line-of-sight magnetograms for 217 active regions (ARs) with different flare rates observed at the solar disk center from 1997 January until 2006 December are utilized to study the turbulence regime and its relationship to flare productivity. Data from the SOHO/MDI instrument recorded in the high-resolution mode and data from the BBSO magnetograph were used. The turbulence regime was probed via magnetic energy spectra and magnetic dissipation spectra. We found steeper energy spectra for ARs with higher flare productivity. We also report that both the power index, α, of the energy spectrum, E(k) ∼ k -α , and the total spectral energy, W = ∫E(k)dk, are comparably correlated with the flare index, A, of an AR. The correlations are found to be stronger than those found between the flare index and the total unsigned flux. The flare index for an AR can be estimated based on measurements of α and W as A = 10 b (αW) c , with b = -7.92 ± 0.58 and c = 1.85 ± 0.13. We found that the regime of the fully developed turbulence occurs in decaying ARs and in emerging ARs (at the very early stage of emergence). Well-developed ARs display underdeveloped turbulence with strong magnetic dissipation at all scales.

  3. Alpha-Amylase Activity in Blood Increases after Pharmacological, But Not Psychological, Activation of the Adrenergic System.

    Directory of Open Access Journals (Sweden)

    Urs M Nater

    Full Text Available Alpha-amylase in both blood and saliva has been used as a diagnostic parameter. While studies examining alpha-amylase activity in saliva have shown that it is sensitive to physiological and psychological challenge of the adrenergic system, no challenge studies have attempted to elucidate the role of the adrenergic system in alpha-amylase activity in blood. We set out to examine the impact of psychological and pharmacological challenge on alpha-amylase in blood in two separate studies.In study 1, healthy subjects were examined in a placebo-controlled, double-blind paradigm using yohimbine, an alpha2-adrenergic antagonist. In study 2, subjects were examined in a standardized rest-controlled psychosocial stress protocol. Alpha-amylase activity in blood was repeatedly measured in both studies.Results of study 1 showed that alpha-amylase in blood is subject to stronger increases after injection of yohimbine compared to placebo. In study 2, results showed that there was no significant effect of psychological stress compared to rest.Alpha-amylase in blood increases after pharmacological activation of the adrenergic pathways suggesting that sympathetic receptors are responsible for these changes. Psychological stress, however, does not seem to have an impact on alpha-amylase in blood. Our findings provide insight into the mechanisms underlying activity changes in alpha-amylase in blood in healthy individuals.

  4. FTY720 and two novel butterfly derivatives exert a general anti-inflammatory potential by reducing immune cell adhesion to endothelial cells through activation of S1P(3) and phosphoinositide 3-kinase.

    Science.gov (United States)

    Imeri, Faik; Blanchard, Olivier; Jenni, Aurelio; Schwalm, Stephanie; Wünsche, Christin; Zivkovic, Aleksandra; Stark, Holger; Pfeilschifter, Josef; Huwiler, Andrea

    2015-12-01

    Sphingosine-1-phosphate (S1P) is a key lipid regulator of a variety of cellular responses including cell proliferation and survival, cell migration, and inflammatory reactions. Here, we investigated the effect of S1P receptor activation on immune cell adhesion to endothelial cells under inflammatory conditions. We show that S1P reduces both tumor necrosis factor (TNF)-α- and lipopolysaccharide (LPS)-stimulated adhesion of Jurkat and U937 cells to an endothelial monolayer. The reducing effect of S1P was reversed by the S1P1+3 antagonist VPC23019 but not by the S1P1 antagonist W146. Additionally, knockdown of S1P3, but not S1P1, by short hairpin RNA (shRNA) abolished the reducing effect of S1P, suggesting the involvement of S1P3. A suppression of immune cell adhesion was also seen with the immunomodulatory drug FTY720 and two novel butterfly derivatives ST-968 and ST-1071. On the molecular level, S1P and all FTY720 derivatives reduced the mRNA expression of LPS- and TNF-α-induced adhesion molecules including ICAM-1, VCAM-1, E-selectin, and CD44 which was reversed by the PI3K inhibitor LY294002, but not by the MEK inhibitor U0126.In summary, our data demonstrate a novel molecular mechanism by which S1P, FTY720, and two novel butterfly derivatives acted anti-inflammatory that is by suppressing gene transcription of various endothelial adhesion molecules and thereby preventing adhesion of immune cells to endothelial cells and subsequent extravasation.

  5. Effects of a sour bolus on the intramuscular electromyographic (EMG) activity of muscles in the submental region.

    Science.gov (United States)

    Palmer, Phyllis M; McCulloch, Timothy M; Jaffe, Debra; Neel, Amy T

    2005-01-01

    A sour bolus has been used as a modality in the treatment of oropharyngeal dysphagia based on the hypothesis that this stimulus provides an effective preswallow sensory input that lowers the threshold required to trigger a pharyngeal swallow. The result is a more immediate swallow onset time. Additionally, the sour bolus may invigorate the oral muscles resulting in stronger contractions during the swallow. The purpose of this investigation was to compare the intramuscular electromyographic activity of the mylohyoid, geniohyoid, and anterior belly of the digastric muscles during sour and water boluses with regard to duration, strength, and timing of muscle activation. Muscle duration, swallow onset time, and pattern of muscle activation did not differ for the two bolus types. Muscle activation time was more tightly approximated across the onsets of the three muscles when a sour bolus was used. A sour bolus also resulted in a stronger muscle contraction as evidenced by greater electromyographic activity. These data support the use of a sour bolus as part of a treatment paradigm.

  6. Towards RNAi based therapy of liver diseases : diversity and complexity of shRNA and miRNA processing and functions

    NARCIS (Netherlands)

    Maczuga, Piotr

    2013-01-01

    Familial hypercholesterolemia (FH) is a genetic disorder characterized by high levels of low density lipoprotein cholesterol (LDL-C) and increasing the risk of cardio vascular diseases. FH and many other liver diseases can possibly be treated with RNA interference (RNAi). RNAi is a natural process

  7. Blocking hepatic metastases of colon cancer cells using an shRNA against Rac1 delivered by activatable cell-penetrating peptide.

    Science.gov (United States)

    Bao, Ying; Guo, Huihui; Lu, Yongliang; Feng, Wenming; Sun, Xinrong; Tang, Chengwu; Wang, Xiang; Shen, Mo

    2016-11-22

    Hepatic metastasis is one of the critical progressions of colon cancer. Blocking this process is key to prolonging survival time in cancer patients. Studies on activatable cell-penetrating peptides (dtACPPs) have demonstrated their potential as gene carriers. It showed high tumor cell-targeting specificity and transfection efficiency and low cytotoxicity in the in vitro settings of drug delivery. However, using this system to silence target genes to inhibit metastasis in colorectal cancer cells has not been widely reported and requires further investigation. In this study, we observed that expression of Rac1, a key molecule for cytoskeletal reorganization, was higher in hepatic metastatic tumor tissue compared with prime colon cancer tissue and that patients with high Rac1-expressing colon cancer showed shorter survival time. Base on these findings, we created dtACPP-PEG-DGL (dtACPPD)/shRac1 nanoparticles and demonstrated that they downregulated Rac1 expression in colon cancer cells. Moreover, we observed inhibitory effects on migration, invasion and adhesion in HCT116 colorectal cancer cells in vitro, and our results showed that Rac1 regulated colon cancer cell matrix adhesion through the regulation of cytofilament dynamics. Moreover, mechanically, repression of Rac1 inhibiting cells migration and invasion by enhancing cell to cell adhesion and reducing cell to extracellular matrix adhesion. Furthermore, when atCDPPD/shRac1 nanoparticles were administered intravenously to a HCT116 xenograft model, significant tumor metastasis to the liver was inhibited. Our results suggest that atCDPP/shRac1 nanoparticles may enable the blockade of hepatic metastasis in colon cancer.

  8. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Directory of Open Access Journals (Sweden)

    Monika Stimac

    Full Text Available Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET (TS plasmid, in comparison to the plasmid with constitutive promoter (CON plasmid, in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  9. Gene Electrotransfer of Plasmid with Tissue Specific Promoter Encoding shRNA against Endoglin Exerts Antitumor Efficacy against Murine TS/A Tumors by Vascular Targeted Effects.

    Science.gov (United States)

    Stimac, Monika; Dolinsek, Tanja; Lampreht, Ursa; Cemazar, Maja; Sersa, Gregor

    2015-01-01

    Vascular targeted therapies, targeting specific endothelial cell markers, are promising approaches for the treatment of cancer. One of the targets is endoglin, transforming growth factor-β (TGF-β) co-receptor, which mediates proliferation, differentiation and migration of endothelial cells forming neovasculature. However, its specific, safe and long-lasting targeting remains the challenge. Therefore, in our study we evaluated the transfection efficacy, vascular targeted effects and therapeutic potential of the plasmid silencing endoglin with the tissue specific promoter, specific for endothelial cells marker endothelin-1 (ET) (TS plasmid), in comparison to the plasmid with constitutive promoter (CON plasmid), in vitro and in vivo. Tissue specificity of TS plasmid was demonstrated in vitro on several cell lines, and its antiangiogenic efficacy was demonstrated by reducing tube formation of 2H11 endothelial cells. In vivo, on a murine mammary TS/A tumor model, we demonstrated good antitumor effect of gene electrotransfer (GET) of either of both plasmids in treatment of smaller tumors still in avascular phase of growth, as well as on bigger tumors, already well vascularized. In support to the observations on predominantly vascular targeted effects of endoglin, histological analysis has demonstrated an increase in necrosis and a decrease in the number of blood vessels in therapeutic groups. A significant antitumor effect was observed in tumors in avascular and vascular phase of growth, possibly due to both, the antiangiogenic and the vascular disrupting effect. Furthermore, the study indicates on the potential use of TS plasmid in cancer gene therapy since the same efficacy as of CON plasmid was determined.

  10. Active Commuting: Workplace Health Promotion for Improved Employee Well-Being and Organizational Behavior.

    Science.gov (United States)

    Page, Nadine C; Nilsson, Viktor O

    2016-01-01

    Objective: This paper describes a behavior change intervention that encourages active commuting using electrically assisted bikes (e-bikes) for health promotion in the workplace. This paper presents the preliminary findings of the intervention's impact on improving employee well-being and organizational behavior, as an indicator of potential business success. Method: Employees of a UK-based organization participated in a workplace travel behavior change intervention and used e-bikes as an active commuting mode; this was a change to their usual passive commuting behavior. The purpose of the intervention was to develop employee well-being and organizational behavior for improved business success. We explored the personal benefits and organizational co-benefits of active commuting and compared these to a travel-as-usual group of employees who did not change their behavior and continued taking non-active commutes. Results: Employees who changed their behavior to active commuting reported more positive affect, better physical health and more productive organizational behavior outcomes compared with passive commuters. In addition, there was an interactive effect of commuting mode and commuting distance: a more frequent active commute was positively associated with more productive organizational behavior and stronger overall positive employee well-being whereas a longer passive commute was associated with poorer well-being, although there was no impact on organizational behavior. Conclusion: This research provides emerging evidence of the value of an innovative workplace health promotion initiative focused on active commuting in protecting and improving employee well-being and organizational behavior for stronger business performance. It considers the significant opportunities for organizations pursuing improved workforce well-being, both in terms of employee health, and for improved organizational behavior and business success.

  11. Using open source accelerometer analysis to assess physical activity and sedentary behaviour in overweight and obese adults.

    Science.gov (United States)

    Innerd, Paul; Harrison, Rory; Coulson, Morc

    2018-04-23

    Physical activity and sedentary behaviour are difficult to assess in overweight and obese adults. However, the use of open-source, raw accelerometer data analysis could overcome this. This study compared raw accelerometer and questionnaire-assessed moderate-to-vigorous physical activity (MVPA), walking and sedentary behaviour in normal, overweight and obese adults, and determined the effect of using different methods to categorise overweight and obesity, namely body mass index (BMI), bioelectrical impedance analysis (BIA) and waist-to-hip ratio (WHR). One hundred twenty adults, aged 24-60 years, wore a raw, tri-axial accelerometer (Actigraph GT3X+), for 3 days and completed a physical activity questionnaire (IPAQ-S). We used open-source accelerometer analyses to estimate MVPA, walking and sedentary behaviour from a single raw accelerometer signal. Accelerometer and questionnaire-assessed measures were compared in normal, overweight and obese adults categorised using BMI, BIA and WHR. Relationships between accelerometer and questionnaire-assessed MVPA (Rs = 0.30 to 0.48) and walking (Rs = 0.43 to 0.58) were stronger in normal and overweight groups whilst sedentary behaviour were modest (Rs = 0.22 to 0.38) in normal, overweight and obese groups. The use of WHR resulted in stronger agreement between the questionnaire and accelerometer than BMI and BIA. Finally, accelerometer data showed stronger associations with BMI, BIA and WHR (Rs = 0.40 to 0.77) than questionnaire data (Rs = 0.24 to 0.37). Open-source, raw accelerometer data analysis can be used to estimate MVPA, walking and sedentary behaviour from a single acceleration signal in normal, overweight and obese adults. Our data supports the use of WHR to categorise overweight and obese adults. This evidence helps researchers obtain more accurate measures of physical activity and sedentary behaviour in overweight and obese populations.

  12. Participating in Politics Resembles Physical Activity: General Action Patterns in International Archives, United States Archives, and Experiments

    Science.gov (United States)

    Noguchi, Kenji; Handley, Ian M.; Albarracín, Dolores

    2016-01-01

    A series of studies examined whether political participation can emerge from general patterns of indiscriminate activity. In the first two studies, general action tendencies were measured by combining national and state-level indicators of high activity (e.g., impulsiveness, pace of life, and physical activity) from international and U.S. data. This action-tendency index positively correlated with a measure of political participation that consisted of voting behaviors and participation in political demonstrations. The following two experimental studies indicated that participants exposed to action words (e.g., go, move) had stronger intentions to vote in an upcoming election and volunteered more time to make phone calls on behalf of a university policy than participants exposed to inaction words did (e.g., relax, stop). These studies suggest that political participation can be predicted from general tendencies toward activity present at the national and state levels, as well as from verbal prompts suggestive of activity. PMID:21177515

  13. The Sun in Time: Activity and Environment

    Directory of Open Access Journals (Sweden)

    Güdel Manuel

    2007-12-01

    Full Text Available The Sun's magnetic activity has steadily declined during its main-sequence life. While the solar photospheric luminosity was about 30% lower 4.6 Gyr ago when the Sun arrived on the main sequence compared to present-day levels, its faster rotation generated enhanced magnetic activity; magnetic heating processes in the chromosphere, the transition region, and the corona induced ultraviolet, extreme-ultraviolet, and X-ray emission about 10, 100, and 1000 times, respectively, the present-day levels, as inferred from young solar-analog stars. Also, the production rate of accelerated, high-energy particles was orders of magnitude higher than in present-day solar flares, and a much stronger wind escaped from the Sun, permeating the entire solar system. The consequences of the enhanced radiation and particle fluxes from the young Sun were potentially severe for the evolution of solar-system planets and moons. Interactions of high-energy radiation and the solar wind with upper planetary atmospheres may have led to the escape of important amounts of atmospheric constituents. The present dry atmosphere of Venus and the thin atmosphere of Mars may be a product of early irradiation and heating by solar high-energy radiation. High levels of magnetic activity are also inferred for the pre-main sequence Sun. At those stages, interactions of high-energy radiation and particles with the circumsolar disk in which planets eventually formed were important. Traces left in meteorites by energetic particles and anomalous isotopic abundance ratios in meteoritic inclusions may provide evidence for a highly active pre-main sequence Sun. The present article reviews these various issues related to the magnetic activity of the young Sun and the consequent interactions with its environment. The emphasis is on the phenomenology related to the production of high-energy photons and particles. Apart from the activity on the young Sun, systematic trends applicable to the entire

  14. A comparison of pharmacy students' and active older adults' perceptions regarding geriatric quality of life.

    Science.gov (United States)

    Gilligan, Adrienne M; Loui, James Aaron; Mezdo, Ashorena; Patel, Nikita; Lee, Jeannie K

    2014-02-12

    To measure perceptions of quality of life (QOL) in an active geriatric population and compare their responses with pharmacy students' perceptions of older adult QOL. Pharmacy students and active older adults completed the modified and standard version of a validated health survey instrument, respectively, and their responses were compared. Eighty-six students and 20 active older adults participated. Student perceptions of geriatric QOL were significantly lower in all domains except health change compared to older adult perceptions (p<0.001 for all domains). Interest in a geriatric pharmacy career (p=0.04) and previously having taken the Perspectives in Geriatrics course and laboratory (p=0.05 and 0.02, respectively) were significantly associated with higher student scores on the physical component portion of the survey. Stronger emphasis on geriatric QOL within pharmacy curricula may improve pharmacy students' perceptions regarding outcomes related to healthy older adults.

  15. New Biflavonoids with α-Glucosidase and Pancreatic Lipase Inhibitory Activities from Boesenbergia rotunda

    Directory of Open Access Journals (Sweden)

    Nutputsorn Chatsumpun

    2017-10-01

    Full Text Available Roots of Boesenbergia rotunda (L. Mansf. are prominent ingredients in the cuisine of several Asian countries, including Thailand, Malaysia, Indonesia, India, and China. An extract prepared from the roots of this plant showed strong inhibitory activity against enzymes α-glucosidase and pancreatic lipase and was subjected to chromatographic separation to identify the active components. Three new biflavonoids of the flavanone-chalcone type (9, 12, and 13 were isolated, along with 12 known compounds. Among the 15 isolates, the three new compounds showed stronger inhibitory activity against α-glucosidase than the drug acarbose but displayed lower pancreatic lipase inhibitory effect than the drug orlistat. The results indicated the potential of B. rotunda roots as a functional food for controlling after-meal blood glucose levels.

  16. Effects of muscle activation on shear between human soleus and gastrocnemius muscles.

    Science.gov (United States)

    Finni, T; Cronin, N J; Mayfield, D; Lichtwark, G A; Cresswell, A G

    2017-01-01

    Lateral connections between muscles provide pathways for myofascial force transmission. To elucidate whether these pathways have functional roles in vivo, we examined whether activation could alter the shear between the soleus (SOL) and lateral gastrocnemius (LG) muscles. We hypothesized that selective activation of LG would decrease the stretch-induced shear between LG and SOL. Eleven volunteers underwent a series of knee joint manipulations where plantar flexion force, LG, and SOL muscle fascicle lengths and relative displacement of aponeuroses between the muscles were obtained. Data during a passive full range of motion were recorded, followed by 20° knee extension stretches in both passive conditions and with selective electrical stimulation of LG. During active stretch, plantar flexion force was 22% greater (P stronger (stiffer) connectivity between the two muscles, at least at flexed knee joint angles, which may serve to facilitate myofascial force transmission. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    International Nuclear Information System (INIS)

    Lv, Peng; Xue, Peng; Dong, Jian; Peng, Hui; Clewell, Rebecca; Wang, Aiping; Wang, Yue; Peng, Shuangqing; Qu, Weidong; Zhang, Qiang; Andersen, Melvin E.; Pi, Jingbo

    2013-01-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation

  18. Keap1 silencing boosts lipopolysaccharide-induced transcription of interleukin 6 via activation of nuclear factor κB in macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Lv, Peng [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Xue, Peng; Dong, Jian [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Peng, Hui [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Clewell, Rebecca [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Wang, Aiping [Institute of Materia Medica, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wang, Yue [Institute for Medical Device Standardization Administration, National Institutes for Food and Drug Control, Beijing (China); Peng, Shuangqing [Evaluation and Research Center for Toxicology, Institute of Disease Control and Prevention, Academy of Military Medical Sciences (China); Qu, Weidong [Key Laboratory of the Public Health Safety, Ministry of Education, School of Public Health, Fudan University, Shanghai (China); Zhang, Qiang; Andersen, Melvin E. [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States); Pi, Jingbo, E-mail: jpi@thehamner.org [Institute for Chemical Safety Sciences, The Hamner Institutes for Health Sciences, 6 Davis Drive, Research Triangle Park, NC 27709 (United States)

    2013-11-01

    Interleukin-6 (IL6) is a multifunctional cytokine that regulates immune and inflammatory responses. Multiple transcription factors, including nuclear factor κB (NF-κB) and nuclear factor E2-related factor 2 (Nrf2), regulate IL6 transcription. Kelch-like ECH-associated protein 1 (Keap1) is a substrate adaptor protein for the Cullin 3-dependent E3 ubiquitin ligase complex, which regulates the degradation of many proteins, including Nrf2 and IκB kinase β (IKKβ). Here, we found that stable knockdown of Keap1 (Keap1-KD) in RAW 264.7 (RAW) mouse macrophages and human monocyte THP-1 cells significantly increased expression of Il6, and Nrf2-target genes, under basal and lipopolysaccharide (LPS, 0.001–0.1 μg/ml)-challenged conditions. However, Nrf2 activation alone, by tert-butylhydroquinone treatment of RAW cells, did not increase expression of Il6. Compared to cells transduced with scrambled non-target negative control shRNA, Keap1-KD RAW cells showed enhanced protein levels of IKKβ and increased expression and phosphorylation of NF-κB p65 under non-stressed and LPS-treated conditions. Because the expression of Il6 in Keap1-KD RAW cells was significantly attenuated by silencing of Ikkβ, but not Nrf2, it appears that stabilized IKKβ is responsible for the enhanced transactivation of Il6 in Keap1-KD cells. This study demonstrated that silencing of Keap1 in macrophages boosts LPS-induced transcription of Il6 via NF-κB activation. Given the importance of IL6 in the inflammatory response, the Keap1–IKKβ–NF-κB pathway may be a novel target for treatment and prevention of inflammation and associated disorders. - Highlights: • Knockdown of Keap1 increases expression of Il6 in macrophages. • Silencing of Keap1 results in protein accumulation of IKKβ and NF-κB p65. • Induction of Il6 resulting from Keap1 silencing is attributed to NF-κB activation.

  19. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... Needs for Pregnant or Postpartum Women Physical Activity & Health Adding Physical Activity to Your Life Activities for ... Guide Visual Guide Worksite Physical Activity Steps to Wellness Walkability Audit Tool Sample Audit Glossary Selected References ...

  20. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... for Older Adults Needs for Pregnant or Postpartum Women Physical Activity & Health Adding Physical Activity to Your ... Activity, 2014 Recommendations & Guidelines Fact Sheets & Infographics Social Media Tools Community Strategies BE Active: Connecting Routes + Destinations ...

  1. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... Physical Activity Data, Trends and Maps Surveillance Systems Resources & Publications Reports Adults Need More Physical Activity MMWR ... Active: Connecting Routes + Destinations Real-World Examples Implementation Resource Guide Visual Guide Worksite Physical Activity Steps to ...

  2. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... Physical Activity Basics Needs for Adults Needs for Children What Counts Needs for Older Adults Needs for ... Adding Physical Activity to Your Life Activities for Children Activities for Older Adults Overcoming Barriers Measuring Physical ...

  3. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... to Your Life Activities for Children Activities for Older Adults Overcoming Barriers ... required by a person to do an activity. When using relative intensity, people pay attention to how physical activity affects their ...

  4. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... Adults Need More Physical Activity MMWR Data Highlights State Indicator Report on Physical Activity, 2014 Recommendations & Guidelines ... Activity Overweight & Obesity Healthy Weight Breastfeeding Micronutrient Malnutrition State and Local Programs Measuring Physical Activity Intensity Recommend ...

  5. Measuring Physical Activity Intensity

    Medline Plus

    Full Text Available ... Adults Needs for Children What Counts Needs for Older Adults Needs for Pregnant or Postpartum Women Physical Activity & ... to Your Life Activities for Children Activities for Older Adults Overcoming Barriers Measuring Physical Activity Intensity Target Heart ...

  6. BAM! Physical Activity

    Science.gov (United States)

    ... Smarts Links Fuel Up for Fun Power Packing Physical Activity Activity Calendar Activity Information Sheets I Heard Hurdle ... Links Sleep Game Questions Answered Under the Microscope Physical Activity Game Questions Answered Under the Microscope Lurking in ...

  7. Facts about Physical Activity

    Science.gov (United States)

    ... Micronutrient Malnutrition State and Local Programs Facts about Physical Activity Recommend on Facebook Tweet Share Compartir Some Americans ... Activity Guideline for aerobic activity than older adults. Physical activity and socioeconomic status Adults with more education are ...

  8. Physical Activity Guidelines

    Science.gov (United States)

    ... use this site. health.gov Physical Activity Guidelines Physical Activity Physical activity is key to improving the health of the Nation. Based on the latest science, the Physical Activity Guidelines for Americans is an essential resource for ...

  9. A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

    Science.gov (United States)

    Lam, Sonia Y; Yeung, Rachel C Y; Yu, Tsz-Ha; Sze, Kong-Hung; Wong, Kam-Bo

    2011-03-01

    Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity. Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy. Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

  10. A rigidifying salt-bridge favors the activity of thermophilic enzyme at high temperatures at the expense of low-temperature activity.

    Directory of Open Access Journals (Sweden)

    Sonia Y Lam

    2011-03-01

    Full Text Available Thermophilic enzymes are often less active than their mesophilic homologues at low temperatures. One hypothesis to explain this observation is that the extra stabilizing interactions increase the rigidity of thermophilic enzymes and hence reduce their activity. Here we employed a thermophilic acylphosphatase from Pyrococcus horikoshii and its homologous mesophilic acylphosphatase from human as a model to study how local rigidity of an active-site residue affects the enzymatic activity.Acylphosphatases have a unique structural feature that its conserved active-site arginine residue forms a salt-bridge with the C-terminal carboxyl group only in thermophilic acylphosphatases, but not in mesophilic acylphosphatases. We perturbed the local rigidity of this active-site residue by removing the salt-bridge in the thermophilic acylphosphatase and by introducing the salt-bridge in the mesophilic homologue. The mutagenesis design was confirmed by x-ray crystallography. Removing the salt-bridge in the thermophilic enzyme lowered the activation energy that decreased the activation enthalpy and entropy. Conversely, the introduction of the salt-bridge to the mesophilic homologue increased the activation energy and resulted in increases in both activation enthalpy and entropy. Revealed by molecular dynamics simulations, the unrestrained arginine residue can populate more rotamer conformations, and the loss of this conformational freedom upon the formation of transition state justified the observed reduction in activation entropy.Our results support the conclusion that restricting the active-site flexibility entropically favors the enzymatic activity at high temperatures. However, the accompanying enthalpy-entropy compensation leads to a stronger temperature-dependency of the enzymatic activity, which explains the less active nature of the thermophilic enzymes at low temperatures.

  11. Heterogeneity of hydrolytic enzyme activities under drought: imaging and quantitative analysis

    Science.gov (United States)

    Sanaullah, Muhammad; Razavi, Bahar S.; Kuzyakov, Yakov

    2015-04-01

    The zymography-based "snap-shoot" of enzyme activities in the rhizosphere is challenging to detect the in situ microbial response to global climate change. We developed in situ soil zymography and used it for identification and localization of hotspots of β-glucosidase activity in the rhizosphere of maize under drought stress (30% of field capacity). The zymographic signals were especially high at root tips and were much stronger for activity of β-glucosidase under drought as compared with optimal moisture (70% of field capacity). This distribution of enzyme activity was confirmed by fluorogenically labelled substrates applied directly to the root exudates. The activity of β-glucosidase in root exudates (produced by root and microorganism associated on the root surface), sampled within 1 hour after zymography was significantly higher by drought stressed plants as compared with optimal moisture. In contrast, the β-glucosidase activity in destructively sampled rhizosphere soil was lower under drought stress compared with optimal moisture. Furthermore, drought stress did not affected β-glucosidase activity in bulk soil, away from rhizosphere. Consequently, we conclude that higher release of mucilage by roots und drought stimulated β-glucosidase activity in the rhizosphere. Thus, the zymography revealed plant-mediated mechanisms accelerating β-glucosidase activity under drought at the root-soil interface. So, coupling of zymography and enzyme assays in the rhizosphere and non-rhizosphere soil enables precise mapping the changes in two-dimensional distribution of enzyme activities due to climate change within dynamic soil interfaces.

  12. A study on biological activity of marine fungi from different habitats in coastal regions.

    Science.gov (United States)

    Zhou, Songlin; Wang, Min; Feng, Qi; Lin, Yingying; Zhao, Huange

    2016-01-01

    In recent years, marine fungi have become an important source of active marine natural products. Former researches are limited in habitats selection of fungi with bioactive compounds. In this paper were to measure antibacterial and antitumor cell activity for secondary metabolites of marine fungi, which were isolated from different habitats in coastal regions. 195 strains of marine fungi were isolated and purified from three different habitats. They biologically active experiment results showed that fungi isolation from the mangrove habitats had stronger antibacterial activity than others, and the stains isolated from the estuarial habitats had the least antibacterial activity. However, the strains separated from beach habitats strongly inhibited tumor cell proliferation in vitro, and fungi of mangrove forest habitats had the weakest activity of inhibiting tumor. Meanwhile, 195 fungal strains belonged to 46 families, 84 genera, 142 species and also showed 137 different types of activity combinations by analyzing the inhibitory activity of the metabolites fungi for 4 strains of pathogenic bacteria and B-16 cells. The study investigated the biological activity of marine fungi isolated from different habitats in Haikou coastal regions. The results help us to understand bioactive metabolites of marine fungi from different habitats, and how to selected biological activity fungi from various marine habitats effectively.

  13. Comparative study on the antioxidant activity of peptides from pearl oyster ( Pinctada martensii) mantle type V collagen and tilapia ( Oreochromis niloticus) scale type I collagen

    Science.gov (United States)

    Xia, Guanghua; Zhang, Xueying; Dong, Zhenghua; Shen, Xuanri

    2017-12-01

    In this study, Pearl oyster mantle type V collagen (POMC) and tilapia scale type I collagen (TSC) were extracted and hydrolyzed by various proteases in order to obtain peptides. The antioxidant activity of the peptides was investigated by DPPH, hydroxyl radical scavenging experiments and a dynamic digestion model in vitro. The results show that there are significant differences in amino acid composition between POMC and TSC. The collagen peptides obtained from pearl oyster mantle (POMCP) by treating with alkaline protease exhibited higher antioxidant activity than that from tilapia scale (TSCP) treated with papaya protease, and both of them showed greater DPPH and hydroxyl radical scavenging activity than other peptides. After being separated via Sephadex G-25 chromatography, the M1 fraction isolated from POMCP, and the S1 fraction from TSCP with which both had higher molecular weights showed the strongest antioxidant activity than other fractions, and the M1 fraction exhibited stronger antioxidant activity than the S1 fraction in scavenging free-radicals and protecting cells from the oxidation damage. Furthermore, after treating the dynamic digestion system model in vitro, the DPPH and hydroxyl radical scavenging activity of the M1 fraction increased slightly. These results suggest that POMCP exhibits stronger antioxidant activity than TSCP, which means that PMOP may be a good candidate to be a potential natural antioxidant in the food-processing industry.

  14. Active knee joint flexibility and sports activity

    DEFF Research Database (Denmark)

    Hahn, Thomas; Foldspang, Anders; Vestergaard, E

    1999-01-01

    was significantly higher in women than in men and significantly positively associated with weekly hours of swimming and weekly hours of competitive gymnastics. Active knee flexion was significantly positively associated with participation in basketball, and significantly negatively associated with age and weekly......The aim of the study was to estimate active knee flexion and active knee extension in athletes and to investigate the potential association of each to different types of sports activity. Active knee extension and active knee flexion was measured in 339 athletes. Active knee extension...... hours of soccer, European team handball and swimming. The results point to sport-specific adaptation of active knee flexion and active knee extension. Udgivelsesdato: 1999-Apr...

  15. The activity of carbohydrate-degrading enzymes in the development of brood and newly emerged workers and drones of the Carniolan honeybee, Apis mellifera carnica.

    Science.gov (United States)

    Żółtowska, Krystyna; Lipiński, Zbigniew; Łopieńska-Biernat, Elżbieta; Farjan, Marek; Dmitryjuk, Małgorzata

    2012-01-01

    The activity of glycogen Phosphorylase and carbohydrate hydrolyzing enzymes α-amylase, glucoamylase, trehalase, and sucrase was studied in the development of the Carniolan honey bee, Apis mellifera carnica Pollman (Hymenoptera: Apidae), from newly hatched larva to freshly emerged imago of worker and drone. Phosphorolytic degradation of glycogen was significantly stronger than hydrolytic degradation in all developmental stages. Developmental profiles of hydrolase activity were similar in both sexes of brood; high activity was found in unsealed larvae, the lowest in prepupae followed by an increase in enzymatic activity. Especially intensive increases in activity occurred in the last stage of pupae and newly emerged imago. Besides α-amylase, the activities of other enzymes were higher in drone than in worker broods. Among drones, activity of glucoamylase was particularly high, ranging from around three times higher in the youngest larvae to 13 times higher in the oldest pupae. This confirms earlier suggestions about higher rates of metabolism in drone broods than in worker broods.

  16. [Knockdown of STAT3 inhibits proliferation and migration of HepG2 hepatoma cells induced by IFN1].

    Science.gov (United States)

    Li, Xiaofang; Wang, Yuqi; Yan, Ben; Fang, Peipei; Ma, Chao; Xu, Ning; Fu, Xiaoyan; Liang, Shujuan

    2018-02-01

    Objective To prepare lentiviruses expressing shRNA sequences targeting human signal transducer and activator of transcription 3 (STAT3) and detect the effect of STAT3 knockdown on type I interferon (IFN1)-induced proliferation and migration in HepG2 cells. Methods Four STAT3-targeting shRNA sequences (shRNA1-shRNA4) and one control sequence (Ctrl shRNA) were selected and cloned respectively into pLKO.1-sp6-pgk-GFP to construct shRNA-expressing vectors. Along with backbone psPAX2 and pMD2.G vectors, they were separately transfected into HEK293T cells to prepare lentiviruses. HepG2 cells were infected with the lentiviruses. Cytoplastic STAT3 level was detected by Western blotting to screen effective shRNA sequence(s) targeting STAT3. Proliferation and migration of HepG2 cells were analyzed by CCK-8 assay and Transwell TM migration and scratching assay, respectively. To detect the effect of IFN1 on cell proliferation and migration of HepG2 cells, the cells were treated with 2000 U/mL IFNα2b for indicated time and the activation of IFN-triggered STAT1 signal transduction was assayed by Western blotting. Results Two most effective STAT3-targeting shRNA sequences shRNA1 and shRNA2 were selected, and the expression of both STAT3 shRNA significantly decreased proliferation and migration of HepG2 cells. When treated with IFNα2b, 2000 U/mL of IFN1 showed more competent in attenuating growth and migration of HepG2 cells. Our data further proved that knockdown of STAT3 increased the phosphorylation of STAT1, and IFNα2b further enhanced the activation of STAT1 signaling in HepG2 cells. Conclusion Knockdown of STAT3 inhibits cell migration and growth, and rescues IFN response through up-regulating STAT1 signal transduction in HepG2 hepatoma cells.

  17. Associations between physical activity and physical and mental health--a HUNT 3 study.

    Science.gov (United States)

    Bertheussen, Gro F; Romundstad, Pål R; Landmark, Tormod; Kaasa, Stein; Dale, Ola; Helbostad, Jorunn L

    2011-07-01

    Health-related quality of life (HRQoL) has been characterized as the ultimate goal for health interventions such as physical activity (PA). We assessed how frequency, duration, and intensity of PA were related to HRQoL in younger (physical and mental health. HRQoL was measured by SF-8 Health Survey. Frequency and duration were assessed by items validated in a previous HUNT study, and intensity was assessed by Borg RPE scale. Associations between PA and physical and mental health were estimated using general linear modeling. A total of 4500 participants (56% females), age 19-91 yr, with mean age of 53±15 yr, were included. Of these, 40% were less active than recommended by international guidelines. In general, mean physical health (PCS-8) in females and males was 47.4±9.7 and 48.8±8.9, and mental health (MCS-8) was 50.5±8.0 and 51.9±7.3, respectively. Age-adjusted association between PA and HRQoL was stronger for physical than mental health in both genders and age groups. The largest differences were between no exercise and exercise groups at any level for frequency, duration, and intensity of PA. We found no substantial gender differences in association between PA and HRQoL, but association was stronger in older (≥65 yr) than younger (physical and mental health in both genders compared with no exercise, particularly among the older individuals.

  18. Parkinson-related changes of activation in visuomotor brain regions during perceived forward self-motion.

    Directory of Open Access Journals (Sweden)

    Anouk van der Hoorn

    Full Text Available Radial expanding optic flow is a visual consequence of forward locomotion. Presented on screen, it generates illusionary forward self-motion, pointing at a close vision-gait interrelation. As particularly parkinsonian gait is vulnerable to external stimuli, effects of optic flow on motor-related cerebral circuitry were explored with functional magnetic resonance imaging in healthy controls (HC and patients with Parkinson's disease (PD. Fifteen HC and 22 PD patients, of which 7 experienced freezing of gait (FOG, watched wide-field flow, interruptions by narrowing or deceleration and equivalent control conditions with static dots. Statistical parametric mapping revealed that wide-field flow interruption evoked activation of the (pre-supplementary motor area (SMA in HC, which was decreased in PD. During wide-field flow, dorsal occipito-parietal activations were reduced in PD relative to HC, with stronger functional connectivity between right visual motion area V5, pre-SMA and cerebellum (in PD without FOG. Non-specific 'changes' in stimulus patterns activated dorsolateral fronto-parietal regions and the fusiform gyrus. This attention-associated network was stronger activated in HC than in PD. PD patients thus appeared compromised in recruiting medial frontal regions facilitating internally generated virtual locomotion when visual motion support falls away. Reduced dorsal visual and parietal activations during wide-field optic flow in PD were explained by impaired feedforward visual and visuomotor processing within a magnocellular (visual motion functional chain. Compensation of impaired feedforward processing by distant fronto-cerebellar circuitry in PD is consistent with motor responses to visual motion stimuli being either too strong or too weak. The 'change'-related activations pointed at covert (stimulus-driven attention.

  19. Marital status, labour force activity and mortality: a study in the USA and six European countries.

    Science.gov (United States)

    Van Hedel, Karen; Van Lenthe, Frank J; Avendano, Mauricio; Bopp, Matthias; Esnaola, Santiago; Kovács, Katalin; Martikainen, Pekka; Regidor, Enrique; Mackenbach, Johan P

    2015-07-01

    Labour force activity and marriage share some pathways through which they potentially influence health. In this paper, we examine whether marriage and labour force participation interact in the way they influence mortality in the USA and six European countries. We used data from the US National Health Interview Survey linked to the National Death Index, and national mortality registry data for Austria, England/Wales, Finland, Hungary, Norway and Spain (specifically, the Basque country) during 1999-2007, for men and women aged 30-59 years at baseline. We used Poisson regression to estimate both the additive (relative excess risk due to interaction) and multiplicative interactions between marriage and labour force activity on mortality. Labour force inactivity was associated with higher mortality, but this association was stronger for unmarried, rather than married, individuals. Likewise, being unmarried was associated with higher mortality, but this association was stronger for inactive than for active individuals. To illustrate, among US women out of the labour force, being unmarried was associated with a 3.98 times (95%CI 3.28-4.82) higher risk of dying than being married; whereas the relative risk (RR) was 2.49 (95%CI 2.10-2.94), for women who were active in the labour market. Although this interaction between marriage and labour force activity was only significant for women on a multiplicative scale, there was a significant additive interaction for both men and women. The pattern was similar across all countries. Marriage attenuated the increased mortality risk associated with labour force inactivity; while labour force activity attenuated the mortality risk associated with being unmarried. Our study emphasizes the importance of public health and social policies that improve the health and well-being of unmarried and inactive men and women. © 2015 the Nordic Societies of Public Health.

  20. Structural Requirements of Alkylglyceryl-l-Ascorbic Acid Derivatives for Melanogenesis Inhibitory Activity.

    Science.gov (United States)

    Taira, Norihisa; Katsuyama, Yushi; Yoshioka, Masato; Muraoka, Osamu; Morikawa, Toshio

    2018-04-10

    l-Ascorbic acid has multifunctional benefits on skin aesthetics, including inhibition of melanin production, and is widely used in cosmetics. It, however, has low stability and poor skin penetration. We hypothesize that alkylglyceryl-l-ascorbic acid derivatives, highly stable vitamin C-alkylglycerol conjugates, would have similar anti-melanogenic activity with better stability and penetration. We test 28 alkylglyceryl-l-ascorbic acid derivatives ( 1 - 28 ) on theophylline-stimulated B16 melanoma 4A5 cells to determine if they inhibit melanogenesis and establish any structure-function relationships. Although not the most potent inhibitors, 3- O -(2,3-dihydroxypropyl)-2- O -hexyl-l-ascorbic acid ( 6 , IC 50 = 81.4 µM) and 2- O -(2,3-dihydroxypropyl)-3- O -hexyl-l-ascorbic acid ( 20 , IC 50 = 117 µM) are deemed the best candidate derivatives based on their inhibitory activities and low toxicities. These derivatives are also found to be more stable than l-ascorbic acid and to have favorable characteristics for skin penetration. The following structural requirements for inhibitory activity of alkylglyceryl-l-ascorbic acid derivatives are also determined: (i) alkylation of glyceryl-l-ascorbic acid is essential for inhibitory activity; (ii) the 3- O -alkyl-derivatives ( 2 - 14 ) exhibit stronger inhibitory activity than the corresponding 2- O -alkyl-derivatives ( 16 - 28 ); and (iii) derivatives with longer alkyl chains have stronger inhibitory activities. Mechanistically, our studies suggest that l-ascorbic acid derivatives exert their effects by suppressing the mRNA expression of tyrosinase and tyrosine-related protein-1.

  1. Spatially Offset Active Galactic Nuclei. II. Triggering in Galaxy Mergers

    Energy Technology Data Exchange (ETDEWEB)

    Barrows, R. Scott; Comerford, Julia M. [Department of Astrophysical and Planetary Sciences, University of Colorado Boulder, Boulder, CO 80309 (United States); Greene, Jenny E. [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States); Pooley, David, E-mail: Robert.Barrows@Colorado.edu [Department of Physics and Astronomy, Trinity University, San Antonio, TX 78212 (United States)

    2017-04-01

    Galaxy mergers are likely to play a role in triggering active galactic nuclei (AGNs), but the conditions under which this process occurs are poorly understood. In Paper I, we constructed a sample of spatially offset X-ray AGNs that represent galaxy mergers hosting a single AGN. In this paper, we use our offset AGN sample to constrain the parameters that affect AGN observability in galaxy mergers. We also construct dual-AGN samples with similar selection properties for comparison. We find that the offset AGN fraction shows no evidence for a dependence on AGN luminosity, while the dual-AGN fractions show stronger evidence for a positive dependence, suggesting that the merger events forming dual AGNs are more efficient at instigating accretion onto supermassive black holes than those forming offset AGNs. We also find that the offset and dual-AGN fractions both have a negative dependence on nuclear separation and are similar in value at small physical scales. This dependence may become stronger when restricted to high AGN luminosities, although a larger sample is needed for confirmation. These results indicate that the probability of AGN triggering increases at later merger stages. This study is the first to systematically probe down to nuclear separations of <1 kpc (∼0.8 kpc) and is consistent with predictions from simulations that AGN observability peaks in this regime. We also find that the offset AGNs are not preferentially obscured compared to the parent AGN sample, suggesting that our selection may be targeting galaxy mergers with relatively dust-free nuclear regions.

  2. Spatially Offset Active Galactic Nuclei. II. Triggering in Galaxy Mergers

    Science.gov (United States)

    Barrows, R. Scott; Comerford, Julia M.; Greene, Jenny E.; Pooley, David

    2017-04-01

    Galaxy mergers are likely to play a role in triggering active galactic nuclei (AGNs), but the conditions under which this process occurs are poorly understood. In Paper I, we constructed a sample of spatially offset X-ray AGNs that represent galaxy mergers hosting a single AGN. In this paper, we use our offset AGN sample to constrain the parameters that affect AGN observability in galaxy mergers. We also construct dual-AGN samples with similar selection properties for comparison. We find that the offset AGN fraction shows no evidence for a dependence on AGN luminosity, while the dual-AGN fractions show stronger evidence for a positive dependence, suggesting that the merger events forming dual AGNs are more efficient at instigating accretion onto supermassive black holes than those forming offset AGNs. We also find that the offset and dual-AGN fractions both have a negative dependence on nuclear separation and are similar in value at small physical scales. This dependence may become stronger when restricted to high AGN luminosities, although a larger sample is needed for confirmation. These results indicate that the probability of AGN triggering increases at later merger stages. This study is the first to systematically probe down to nuclear separations of <1 kpc (˜0.8 kpc) and is consistent with predictions from simulations that AGN observability peaks in this regime. We also find that the offset AGNs are not preferentially obscured compared to the parent AGN sample, suggesting that our selection may be targeting galaxy mergers with relatively dust-free nuclear regions.

  3. p38 mitogen-activated protein kinase is involved in arginase-II-mediated eNOS-uncoupling in obesity.

    Science.gov (United States)

    Yu, Yi; Rajapakse, Angana G; Montani, Jean-Pierre; Yang, Zhihong; Ming, Xiu-Fen

    2014-07-18

    Endothelial nitric oxide synthase (eNOS)-uncoupling links obesity-associated insulin resistance and type-II diabetes to the increased incidence of cardiovascular disease. Studies have indicated that increased arginase is involved in eNOS-uncoupling through competing with the substrate L-arginine. Given that arginase-II (Arg-II) exerts some of its biological functions through crosstalk with signal transduction pathways, and that p38 mitogen-activated protein kinase (p38mapk) is involved in eNOS-uncoupling, we investigated here whether p38mapk is involved in Arg-II-mediated eNOS-uncoupling in a high fat diet (HFD)-induced obesity mouse model. Obesity was induced in wild type (WT) and Arg-II-deficient (Arg-II(-/-)) mice on C57BL/6 J background by high-fat diet (HFD, 55% fat) for 14 weeks starting from age of 7 weeks. The entire aortas were isolated and subjected to 1) immunoblotting analysis of the protein level of eNOS, Arg-II and p38mapk activation; 2) arginase activity assay; 3) endothelium-dependent and independent vasomotor responses; 4) en face staining of superoxide anion and NO production with Dihydroethidium and 4,5-Diaminofluorescein Diacetate, respectively, to assess eNOS-uncoupling. To evaluate the role of p38mapk, isolated aortas were treated with p38mapk inhibitor SB203580 (10 μmol/L, 1 h) prior to the analysis. In addition, the role of p38mapk in Arg-II-induced eNOS-uncoupling was investigated in cultured human endothelial cells overexpressing Arg-II in the absence or presence of shRNA against p38mapk. HFD enhanced Arg-II expression/activity and p38mapk activity, which was associated with eNOS-uncoupling as revealed by decreased NO and enhanced L-NAME-inhibitable superoxide in aortas of WT obese mice. In accordance, WT obese mice revealed decreased endothelium-dependent relaxations to acetylcholine despite of higher eNOS protein level, whereas Arg-II(-/-) obese mice were protected from HFD-induced eNOS-uncoupling and endothelial dysfunction, which

  4. Impact of a physical activity intervention program on cognitive predictors of behaviour among adults at risk of Type 2 diabetes (ProActive randomised controlled trial

    Directory of Open Access Journals (Sweden)

    Sutton Stephen

    2009-03-01

    Full Text Available Abstract Background In the ProActive Trial an intensive theory-based intervention program was no more effective than theory-based brief advice in increasing objectively measured physical activity among adults at risk of Type 2 diabetes. We aimed to illuminate these findings by assessing whether the intervention program changed cognitions about increasing activity, defined by the Theory of Planned Behaviour, in ways consistent with the theory. Methods N = 365 sedentary participants aged 30–50 years with a parental history of Type 2 diabetes were randomised to brief advice alone or to brief advice plus the intervention program delivered face-to-face or by telephone. Questionnaires at baseline, 6 and 12 months assessed cognitions about becoming more physically active. Analysis of covariance was used to test intervention impact. Bootstrapping was used to test multiple mediation of intervention impact. Results At 6 months, combined intervention groups (face-to-face and telephone reported that they found increasing activity more enjoyable (affective attitude, d = .25, and they perceived more instrumental benefits (e.g., improving health (d = .23 and more control (d = .32 over increasing activity than participants receiving brief advice alone. Stronger intentions (d = .50 in the intervention groups than the brief advice group at 6 months were partially explained by affective attitude and perceived control. At 12 months, intervention groups perceived more positive instrumental (d = .21 and affective benefits (d = .29 than brief advice participants. The intervention did not change perceived social pressure to increase activity. Conclusion Lack of effect of the intervention program on physical activity over and above brief advice was consistent with limited and mostly small short-term effects on cognitions. Targeting affective benefits (e.g., enjoyment, social interaction and addressing barriers to physical activity may strengthen intentions, but

  5. Stronger evidence for own-age effects in memory for older as compared to younger adults

    Czech Academy of Sciences Publication Activity Database

    Freund, A.M.; Kouřilová, Sylvie; Kuhl, P.

    2011-01-01

    Roč. 19, č. 5 (2011), s. 429-448 ISSN 0965-8211 Institutional research plan: CEZ:AV0Z70250504 Keywords : own- age effect * memory bias * age relevance * age ing Subject RIV: AN - Psychology Impact factor: 2.089, year: 2011

  6. Steroid requirements and immune associations with vitamin D are stronger in children than adults with asthma.

    Science.gov (United States)

    Goleva, Elena; Searing, Daniel A; Jackson, Leisa P; Richers, Brittany N; Leung, Donald Y M

    2012-05-01

    The effects of serum vitamin D status on atopy, steroid requirement, and functional responsiveness to corticosteroids in children versus adults with asthma have not been studied systematically. We sought to explore the age-specific effects of vitamin D in asthmatic patients. Serum vitamin D levels were examined in a prospective study of adults and children (102 healthy control subjects and 103 asthmatic patients). PBMCs were cultured for 3 hours with or without 100 nmol/L dexamethasone, and the expression of corticosteroid-regulated genes was detected by using real-time PCR. Serum IgE levels were measured, and information about asthmatic patients' steroid requirements was collected. Deficient serum vitamin D levels (<20 ng/mL) were found in 47.6% of asthmatic patients and 56.8% of healthy control subjects, with means ± SDs of 20.7 ± 9.8 and 19.2 ± 7.7 ng/mL, respectively. In multivariate regression models a significant positive correlation between serum vitamin D levels and the expression of vitamin D-regulated targets, cytochrome P450, family 24, subfamily a (cyp24a) expression by PBMCs (P = .0084, pediatric asthma group only) and serum LL-37 levels (P = .0006 in the pediatric group but P = .0067 in the adult asthma group), was found. An inverse association between vitamin D and serum IgE levels was observed in the pediatric (P = .006) asthma group. Serum vitamin D level (P = .05), as well as PBMC cyp24a expression (P = .0312), demonstrated a significant inverse relationship with daily inhaled corticosteroid dose in the pediatric asthma group only. Cyp24a expression in PBMCs correlated positively with in vitro suppression of TNF-α by dexamethasone (P = .05) and IL-13 (P = .0094) in PBMCs in the pediatric asthma group only. This study demonstrated significant associations between serum vitamin D status and steroid requirement and in vitro responsiveness to