WorldWideScience

Sample records for strong phylogenetic relationships

  1. Refuting phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Bapteste Eric

    2006-09-01

    Full Text Available Abstract Background Phylogenetic methods are philosophically grounded, and so can be philosophically biased in ways that limit explanatory power. This constitutes an important methodologic dimension not often taken into account. Here we address this dimension in the context of concatenation approaches to phylogeny. Results We discuss some of the limits of a methodology restricted to verificationism, the philosophy on which gene concatenation practices generally rely. As an alternative, we describe a software which identifies and focuses on impossible or refuted relationships, through a simple analysis of bootstrap bipartitions, followed by multivariate statistical analyses. We show how refuting phylogenetic relationships could in principle facilitate systematics. We also apply our method to the study of two complex phylogenies: the phylogeny of the archaea and the phylogeny of the core of genes shared by all life forms. While many groups are rejected, our results left open a possible proximity of N. equitans and the Methanopyrales, of the Archaea and the Cyanobacteria, and as well the possible grouping of the Methanobacteriales/Methanoccocales and Thermosplasmatales, of the Spirochaetes and the Actinobacteria and of the Proteobacteria and firmicutes. Conclusion It is sometimes easier (and preferable to decide which species do not group together than which ones do. When possible topologies are limited, identifying local relationships that are rejected may be a useful alternative to classical concatenation approaches aiming to find a globally resolved tree on the basis of weak phylogenetic markers. Reviewers This article was reviewed by Mark Ragan, Eugene V Koonin and J Peter Gogarten.

  2. Phylogenetic Relationships and Biogeographic History of Iriarteeae

    DEFF Research Database (Denmark)

    Bacon, Christine D.; Florez, Alexander; Balslev, Henrik

    sequence data for 11 loci (5 chloroplast and 6 nuclear) to reconstruct a coalescent species tree and infer relationships amongst genera and species to, in turn, allow for tests of biogeography and community phylogenetics in the tribe. Our results define inter-generic relationships and resolve all genera...... as strongly supported monophyletic groups. The patterns of lineage diversification correspond to Andean orogeny and the formation of the Amazon basin. A description of the fossil pollen record is presented and compared with the phylogenetic results for a holistic interpretation of the biogeographic evolution...

  3. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  4. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the trnL-trnF spacer, and therefore, are suitable for phylogenetic comparison on a lower taxonomic level. Gladiolus cultivars are extensively used as an ornamental crop and ...

  5. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  6. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    The phylogenetic relationships among flesh flies of the family Sarcophagidae has been based mainly on the morphology of male genitalia. However, the male genitalic character-based relationships are far from satisfactory. Therefore, in the present study mitochondrial DNA has been used as marker to unravel genetic ...

  7. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    The plastid genome regions of two intergenic spacers, psbA–trnH and trnL–trnF, were sequenced to study the nucleotide diversity and phylogenetic relationships among Gladiolus cultivars. Nucleotide diversity of psbA–trnH region was higher than trnL–trnF region of chloroplast. We employed Bayesian, maximum ...

  8. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  9. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  10. Phylogenetic relationships among Lemuridae (Primates): evidence from mtDNA.

    Science.gov (United States)

    Pastorini, Jennifer; Forstner, Michael R J; Martin, Robert D

    2002-10-01

    The family Lemuridae includes four genera: Eulemur, Hapalemur, Lemur,Varecia. Taxonomy and phylogenetic relationships between L. catta, Eulemur and Hapalemur, and of Varecia to these other lemurids, continue to be hotly debated. Nodal relationships among the five Eulemur species also remain contentious. A mitochondrial DNA sequence dataset from the ND 3, ND 4 L, ND 4 genes and five tRNAs (Gly, Arg, His, Ser, Leu) was generated to try to clarify phylogenetic relationships w ithin the Lemuridae. Samples (n=39) from all ten lemurid species were collected and analysed. Three Daubentonia madagascariensis were included as outgroup taxa. The approximately 2400 bp sequences were analysed using maximum parsimony, neighbor-joining and maximum likelihood methods. The results support monophyly of Eulemur, a basal divergence of Varecia, and a sister-group relationship for Lemur/Hapalemur. Based on tree topology, bootstrap values, and pairwise distance comparisons, we conclude thatVarecia and Eulemur both represent distinct genera separate from L. catta. H. griseus andH. aureus form a clade with strong support, but the sequence data do not permit robust resolution of the trichotomy involving H. simus, H. aureus/H. griseus and L. catta. Within Eulemur there is strong support for a clade containing E. fulvus, E. mongoz and E. rubriventer. However, analyses failed to clearly resolve relationships among those three species or with the more distantly related E. coronatus and E. macaco. Our sequencing data support the current subspecific status of E.m. macaco and E.m. flavifrons, and that of V.v. variegata and V.v. rubra. However, tree topology and relatively large genetic distances among individual V.v. variegata indicate that there may be more phylogenetic structure within this taxon than is indicated by current taxonomy.

  11. Molecular diversity and phylogenetic relationships of the gastropod ...

    African Journals Online (AJOL)

    The phylogenetic relationship between morphs or genetic clones of Melanoides in Lake Malawi was inferred by phylogenetic analyses of DNA sequence data from the mitochondrial genes 16S and COI. Additional sequences from GenBank were included to investigate the relationship to other morphs from different parts of ...

  12. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  13. Worldwide phylogenetic relationship of avian poxviruses

    Science.gov (United States)

    Gyuranecz, Miklós; Foster, Jeffrey T.; Dán, Ádám; Ip, Hon S.; Egstad, Kristina F.; Parker, Patricia G.; Higashiguchi, Jenni M.; Skinner, Michael A.; Höfle, Ursula; Kreizinger, Zsuzsa; Dorrestein, Gerry M.; Solt, Szabolcs; Sós, Endre; Kim, Young Jun; Uhart, Marcela; Pereda, Ariel; González-Hein, Gisela; Hidalgo, Hector; Blanco, Juan-Manuel; Erdélyi, Károly

    2013-01-01

    Poxvirus infections have been found in 230 species of wild and domestic birds worldwide in both terrestrial and marine environments. This ubiquity raises the question of how infection has been transmitted and globally dispersed. We present a comprehensive global phylogeny of 111 novel poxvirus isolates in addition to all available sequences from GenBank. Phylogenetic analysis of Avipoxvirus genus has traditionally relied on one gene region (4b core protein). In this study we have expanded the analyses to include a second locus (DNA polymerase gene), allowing for a more robust phylogenetic framework, finer genetic resolution within specific groups and the detection of potential recombination. Our phylogenetic results reveal several major features of avipoxvirus evolution and ecology and propose an updated avipoxvirus taxonomy, including three novel subclades. The characterization of poxviruses from 57 species of birds in this study extends the current knowledge of their host range and provides the first evidence of the phylogenetic effect of genetic recombination of avipoxviruses. The repeated occurrence of avian family or order-specific grouping within certain clades (e.g. starling poxvirus, falcon poxvirus, raptor poxvirus, etc.) indicates a marked role of host adaptation, while the sharing of poxvirus species within prey-predator systems emphasizes the capacity for cross-species infection and limited host adaptation. Our study provides a broad and comprehensive phylogenetic analysis of the Avipoxvirus genus, an ecologically and environmentally important viral group, to formulate a genome sequencing strategy that will clarify avipoxvirus taxonomy.

  14. The phylogenetic relationships and generic limits of finches (Fringillidae).

    Science.gov (United States)

    Zuccon, Dario; Prŷs-Jones, Robert; Rasmussen, Pamela C; Ericson, Per G P

    2012-02-01

    Phylogenetic relationships among the true finches (Fringillidae) have been confounded by the recurrence of similar plumage patterns and use of similar feeding niches. Using a dense taxon sampling and a combination of nuclear and mitochondrial sequences we reconstructed a well resolved and strongly supported phylogenetic hypothesis for this family. We identified three well supported, subfamily level clades: the Holoarctic genus Fringilla (subfamly Fringillinae), the Neotropical Euphonia and Chlorophonia (subfamily Euphoniinae), and the more widespread subfamily Carduelinae for the remaining taxa. Although usually separated in a different family-group taxon (Drepanidinae), the Hawaiian honeycreepers are deeply nested within the Carduelinae and sister to a group of Asian Carpodacus. Other new relationships recovered by this analysis include the placement of the extinct Chaunoproctus ferreorostris as sister to some Asian Carpodacus, a clade combining greenfinches (Carduelis chloris and allies), Rhodospiza and Rhynchostruthus, and a well-supported clade with the aberrant Callacanthis and Pyrrhoplectes together with Carpodacus rubescens. Although part of the large Carduelis-Serinus complex, the poorly known Serinus estherae forms a distinct lineage without close relatives. The traditionally delimited genera Carduelis, Serinus, Carpodacus, Pinicola and Euphonia are polyphyletic or paraphyletic. Based on our results we propose a revised generic classification of finches and describe a new monotypic genus for Carpodacus rubescens. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Contrasting biodiversity-ecosystem functioning relationships in phylogenetic and functional diversity.

    Science.gov (United States)

    Steudel, Bastian; Hallmann, Christine; Lorenz, Maike; Abrahamczyk, Stefan; Prinz, Kathleen; Herrfurth, Cornelia; Feussner, Ivo; Martini, Johannes W R; Kessler, Michael

    2016-10-01

    It is well known that ecosystem functioning is positively influenced by biodiversity. Most biodiversity-ecosystem functioning experiments have measured biodiversity based on species richness or phylogenetic relationships. However, theoretical and empirical evidence suggests that ecosystem functioning should be more closely related to functional diversity than to species richness. We applied different metrics of biodiversity in an artificial biodiversity-ecosystem functioning experiment using 64 species of green microalgae in combinations of two to 16 species. We found that phylogenetic and functional diversity were positively correlated with biomass overyield, driven by their strong correlation with species richness. At low species richness, no significant correlation between overyield and functional and phylogenetic diversity was found. However, at high species richness (16 species), we found a positive relationship of overyield with functional diversity and a negative relationship with phylogenetic diversity. We show that negative phylogenetic diversity-ecosystem functioning relationships can result from interspecific growth inhibition. The opposing performances of facilitation (functional diversity) and inhibition (phylogenetic diversity) we observed at the 16 species level suggest that phylogenetic diversity is not always a good proxy for functional diversity and that results from experiments with low species numbers may underestimate negative species interactions. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  16. Phylogenetic relationships in genus Gloriosa L.

    African Journals Online (AJOL)

    Both species are near-endemics, occurring in east Africa with L. revoilii extending into south Yemen. The third clade comprises species of the Gloriosa superba L. complex and Gloriosa sessiliflora Nordal & Bingham. These three lineages are also strongly supported by ecological, geographical and morphological characters ...

  17. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  18. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA (RAPD) analysis for 20 species of Phalaenopsis was conducted to determine their genetic distances and relationships. Among 20 different primers used for RAPD analysis, 10 primers showed polymorphism, and according to the primer type, 26 to 54 DNA fragments were amplified.

  19. The phylogenetic relationships of known mosquito (Diptera: Culicidae) mitogenomes.

    Science.gov (United States)

    Chu, Hongliang; Li, Chunxiao; Guo, Xiaoxia; Zhang, Hengduan; Luo, Peng; Wu, Zhonghua; Wang, Gang; Zhao, Tongyan

    2018-01-01

    The known mosquito mitogenomes, containing a total of 34 species, which belong to five genera, were collected from GenBank, and the practicality and effectiveness of the variation in the complete mitochondrial DNA genome and portions of mitochondrial COI gene were assessed to reconstruct the phylogeny of mosquitoes. Phylogenetic trees were reconstructed on the basis of parsimony, maximum likelihood, and Bayesian (BI) methods. It is concluded that: (1) Both mitogenomes and COI gene support the monophly of following taxa: Subgenus Nyssorhynchus, Subgenus Cellia, Anopheles albitarsis complex, Anopheles gambiae complex, and Anopheles punctulatus group; (2) Genus Aedes is not monophyletic relative to Ochlerotatus vigilax; (3) The mitogenome results indicate a close relationship between Anopheles epiroticus and Anopheles gambiae complex, Anopheles dirus complex and Anopheles punctulatus group, respectively; (4) The Bayesian posterior probability (BPP) within phylogenetic tree reconstructed by mitogenomes is higher than COI tree. The results show that phylogenetic relationships reconstructed using the mitogenomes were more similar to those based on morphological data.

  20. Phylogenetic and genomic relationships in the genus Malus based ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-08-04

    Aug 4, 2009 ... Phylogenetic and genomic relationships in the genus. Malus based on RAPDs. Ogunkanmi Liasu Adebayo2*, Oboh Bola2, Williams Opeyemi2, Monu Gloria2 and Ogundipe. Olowatoyin Temitope1. 1Botany and Microbiology Department, University of Lagos, Nigeria. 2Cell Biology and Genetics Department ...

  1. Phylogenetic relationship and time of divergence of Mus terricolor ...

    Indian Academy of Sciences (India)

    Mitochondrial DNA control region ofMus terricolor. , three aboriginal speciesM. spretus. ,M. macedonicus. ,M. spicilegus. ;the Asian lineageM. caroli. ,M. cervicolor. ,M. cookii. ; and the two house mice,M. musculus domesticusandM. m. castaneuswere analysed to estimate the substitution rate, phylogenetic relationship and ...

  2. Phylogenetic relationships within Fritillaria section Petilium based on AFLP fingerprints

    NARCIS (Netherlands)

    Wietsma, W.A.; Deinum, D.; Teunissen, H.; Berg, van den R.G.

    2015-01-01

    Fritillaria sect. Petilium (Fritillaria L., Liliaceae), consists of four species: F. chitralensis, F. eduardii, F. imperialis and F. raddeana. We studied their phylogenetic relationships with AFLP’s, crossing experiments and morphological observations. The AFLP data confirm that F. eduardii is a

  3. Phylogenetic relationships and call structure in four African bufonid ...

    African Journals Online (AJOL)

    Four species of toads of the genus Bufo, comprising three species endemic to southern Africa and one closely-related species, were examined electrophoretically to infer their phylogenetic relationships. The evolution of advertisement call structure in these species is discussed in relation to this phylogeny. Bufo rangeri and ...

  4. Evolutionary change and phylogenetic relationships in light of ...

    Indian Academy of Sciences (India)

    2015-04-20

    Apr 20, 2015 ... Evolutionary change and phylogenetic relationships in light of horizontal gene transfer. LUIS BOTO. Departamento de Biodiversidad y Biología Evolutiva, Museo Nacional Ciencias. Naturales, CSIC, C/ José Gutierrez Abascal 2, 28006, Madrid, Spain. (Fax, 34-915645078; Email, mcnb119@mncn.csic.es).

  5. Phylogenetic relationship analysis of Genista L. (Fabaceae) species ...

    African Journals Online (AJOL)

    USER

    molecular marker system that provides reliable results. Based on ISSR data, genetic similarities and dendrogram demonstrating the phylogenetic relationships among the Genista taxa were prepared by the. NTSYSpc 2.0 software. In this study, infrageneric classifications of the Genista taxa belonging to the. Flora of Turkey ...

  6. An explosive innovation: Phylogenetic relationships of Solanum section Gonatotrichum (Solanaceae

    Directory of Open Access Journals (Sweden)

    Stephen Stern

    2012-01-01

    Full Text Available Solanum is one of the largest plant genera and exhibits a wide range of morphological diversity. Solanum section Gonatotrichum, the focus of this study, is unique within the genus because of its fruits that swell with turgor pressure and explosively dehisce to disperse the seeds. We infer phylogenetic relationships within section Gonatotrichum using DNA sequence data from two nuclear regions (ITS and the granule-bound starch synthase gene [GBSSI or waxy] and the chloroplast region trnT-F. The resulting phylogenetic trees support the monophyly of the section with the inclusion of S. lignescens, a species not previously thought to belong to the group due to the presence of stellate hairs. This inclusion of this species in section Gonatotrichum suggests that the simple, often geniculate hairs of species in the group may represent reduced stellate hairs. The presence of heterantherous flowers appears to be derived in the section, but this character is largely lost in S. parcistrigosum.

  7. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  8. Phylogenetic relationships among superfamilies of Neritimorpha (Mollusca: Gastropoda).

    Science.gov (United States)

    Uribe, Juan E; Colgan, Don; Castro, Lyda R; Kano, Yasunori; Zardoya, Rafael

    2016-11-01

    Despite the extraordinary morphological and ecological diversity of Neritimorpha, few studies have focused on the phylogenetic relationships of this lineage of gastropods, which includes four extant superfamilies: Neritopsoidea, Hydrocenoidea, Helicinoidea, and Neritoidea. Here, the nucleotide sequences of the complete mitochondrial genomes of Georissa bangueyensis (Hydrocenoidea), Neritina usnea (Neritoidea), and Pleuropoma jana (Helicinoidea) and the nearly complete mt genomes of Titiscania sp. (Neritopsoidea) and Theodoxus fluviatilis (Neritoidea) were determined. Phylogenetic reconstructions using probabilistic methods were based on mitochondrial (13 protein coding genes and two ribosomal rRNA genes), nuclear (partial 28S rRNA, 18S rRNA, actin, and histone H3 genes) and combined sequence data sets. All phylogenetic analyses except one converged on a single, highly supported tree in which Neritopsoidea was recovered as the sister group of a clade including Helicinoidea as the sister group of Hydrocenoidea and Neritoidea. This topology agrees with the fossil record and supports at least three independent invasions of land by neritimorph snails. The mitochondrial genomes of Titiscania sp., G. bangueyensis, N. usnea, and T. fluviatilis share the same gene organization previously described for Nerita mt genomes whereas that of P. jana has undergone major rearrangements. We sequenced about half of the mitochondrial genome of another species of Helicinoidea, Viana regina, and confirmed that this species shares the highly derived gene order of P. jana. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. The phylogenetic relationships of seven European Ips (Scolytidae, Ipinae) species.

    Science.gov (United States)

    Stauffer, C; Lakatos, F; Hewitt, G M

    1997-08-01

    In Central Europe seven lps species are characterized by differences in morphology, structure of galleries, host specificity and aggressiveness. These species were analysed by allozyme markers and by sequencing 567 bp of the mitochondrial cytochrome oxidase I gene, in order to define their phylogenetic relationships. Orthotomicus erosus and Tomicus minor were taken as outgroup species. The data revealed high inter-specific and low intra-specific sequence divergence. Plotting the observed sequence divergence caused by transversions (Tv) and transitions (Ts) and the level of saturation for Ts and Tv of each codon position showed that the third positions were highly saturated by multiple substitutions. Maximum parsimony analysis produced two groups: (1) I. typographus, I. cembrae, I. amitinus, I. duplicatus and I. acuminatus; (2) I. mannsfeldi, I. sexdentatus and the two outgroups. In all analyses the species of the first cluster were put together and I. typographus and I. cembrae, and I. mannsfeldi and O. erosus emerged as sister pairs. The data do not support a common ancestor for the seven European lps species. The eight-spined bark beetles (except I. mannsfeldi) and I. acuminatus formed a monophyletic group. The close relationship of I. mannsfeldi and O. erosus supports the latter belonging to the genus lps as proposed by Wood (1982) and Escherich (1923). However, more genetic markers and more species of the genera Orthotomicus and Pityokteines have to be analysed to resolve the phylogenetic positions of I. sexdentatus I. mannsfeldi within the tribe lpinl.

  10. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  11. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  12. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  13. Phylogenetic relationships of Malassezia species based on multilocus sequence analysis.

    Science.gov (United States)

    Castellá, Gemma; Coutinho, Selene Dall' Acqua; Cabañes, F Javier

    2014-01-01

    Members of the genus Malassezia are lipophilic basidiomycetous yeasts, which are part of the normal cutaneous microbiota of humans and other warm-blooded animals. Currently, this genus consists of 14 species that have been characterized by phenetic and molecular methods. Although several molecular methods have been used to identify and/or differentiate Malassezia species, the sequencing of the rRNA genes and the chitin synthase-2 gene (CHS2) are the most widely employed. There is little information about the β-tubulin gene in the genus Malassezia, a gene has been used for the analysis of complex species groups. The aim of the present study was to sequence a fragment of the β-tubulin gene of Malassezia species and analyze their phylogenetic relationship using a multilocus sequence approach based on two rRNA genes (ITS including 5.8S rRNA and D1/D2 region of 26S rRNA) together with two protein encoding genes (CHS2 and β-tubulin). The phylogenetic study of the partial β-tubulin gene sequences indicated that this molecular marker can be used to assess diversity and identify new species. The multilocus sequence analysis of the four loci provides robust support to delineate species at the terminal nodes and could help to estimate divergence times for the origin and diversification of Malassezia species.

  14. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  15. Strong motion duration and earthquake magnitude relationships

    International Nuclear Information System (INIS)

    Salmon, M.W.; Short, S.A.; Kennedy, R.P.

    1992-06-01

    Earthquake duration is the total time of ground shaking from the arrival of seismic waves until the return to ambient conditions. Much of this time is at relatively low shaking levels which have little effect on seismic structural response and on earthquake damage potential. As a result, a parameter termed ''strong motion duration'' has been defined by a number of investigators to be used for the purpose of evaluating seismic response and assessing the potential for structural damage due to earthquakes. This report presents methods for determining strong motion duration and a time history envelope function appropriate for various evaluation purposes, for earthquake magnitude and distance, and for site soil properties. There are numerous definitions of strong motion duration. For most of these definitions, empirical studies have been completed which relate duration to earthquake magnitude and distance and to site soil properties. Each of these definitions recognizes that only the portion of an earthquake record which has sufficiently high acceleration amplitude, energy content, or some other parameters significantly affects seismic response. Studies have been performed which indicate that the portion of an earthquake record in which the power (average rate of energy input) is maximum correlates most closely with potential damage to stiff nuclear power plant structures. Hence, this report will concentrate on energy based strong motion duration definitions

  16. Strong motion duration and earthquake magnitude relationships

    Energy Technology Data Exchange (ETDEWEB)

    Salmon, M.W.; Short, S.A. [EQE International, Inc., San Francisco, CA (United States); Kennedy, R.P. [RPK Structural Mechanics Consulting, Yorba Linda, CA (United States)

    1992-06-01

    Earthquake duration is the total time of ground shaking from the arrival of seismic waves until the return to ambient conditions. Much of this time is at relatively low shaking levels which have little effect on seismic structural response and on earthquake damage potential. As a result, a parameter termed ``strong motion duration`` has been defined by a number of investigators to be used for the purpose of evaluating seismic response and assessing the potential for structural damage due to earthquakes. This report presents methods for determining strong motion duration and a time history envelope function appropriate for various evaluation purposes, for earthquake magnitude and distance, and for site soil properties. There are numerous definitions of strong motion duration. For most of these definitions, empirical studies have been completed which relate duration to earthquake magnitude and distance and to site soil properties. Each of these definitions recognizes that only the portion of an earthquake record which has sufficiently high acceleration amplitude, energy content, or some other parameters significantly affects seismic response. Studies have been performed which indicate that the portion of an earthquake record in which the power (average rate of energy input) is maximum correlates most closely with potential damage to stiff nuclear power plant structures. Hence, this report will concentrate on energy based strong motion duration definitions.

  17. Phylogenetic relationships in Nuphar (Nymphaeaceae): evidence from morphology, chloroplast DNA, and nuclear ribosomal DNA.

    Science.gov (United States)

    Padgett, D J; Les, D H; Crow, G E

    1999-09-01

    The genus Nuphar consists of yellow-flowered waterlilies and is widely distributed in north-temperate bodies of water. Despite regular taxonomic evaluation of these plants, no explicit phylogenetic hypotheses have been proposed for the genus. We investigated phylogenetic relationships in Nuphar using morphology and sequences of the chloroplast gene matK and of the internal transcribed spacer (ITS) regions of nuclear ribosomal DNA. Two major lineages within Nuphar are consistently resolved with the morphological and molecular data sets. One lineage comprises New World taxa and the other represents a primarily Old World lineage. Relationships within the major lineages were poorly resolved by morphology and ITS, yet certain relationships were elucidated by all analyses. Most notable is the strong support for a monophyletic lineage of dwarf taxa and the alliance of the North American N. microphylla with the Eurasian taxa. Minor discordance between the independent cladograms is accounted for by hybridization. The common taxonomic practice of uniting all North American and Eurasian taxa under one species is not supported phylogenetically.

  18. Complete plastid genome sequences of Drimys, Liriodendron, and Piper: implications for the phylogenetic relationships of magnoliids

    Directory of Open Access Journals (Sweden)

    dePamphilis Claude W

    2006-10-01

    Full Text Available Abstract Background The magnoliids with four orders, 19 families, and 8,500 species represent one of the largest clades of early diverging angiosperms. Although several recent angiosperm phylogenetic analyses supported the monophyly of magnoliids and suggested relationships among the orders, the limited number of genes examined resulted in only weak support, and these issues remain controversial. Furthermore, considerable incongruence resulted in phylogenetic reconstructions supporting three different sets of relationships among magnoliids and the two large angiosperm clades, monocots and eudicots. We sequenced the plastid genomes of three magnoliids, Drimys (Canellales, Liriodendron (Magnoliales, and Piper (Piperales, and used these data in combination with 32 other angiosperm plastid genomes to assess phylogenetic relationships among magnoliids and to examine patterns of variation of GC content. Results The Drimys, Liriodendron, and Piper plastid genomes are very similar in size at 160,604, 159,886 bp, and 160,624 bp, respectively. Gene content and order are nearly identical to many other unrearranged angiosperm plastid genomes, including Calycanthus, the other published magnoliid genome. Overall GC content ranges from 34–39%, and coding regions have a substantially higher GC content than non-coding regions. Among protein-coding genes, GC content varies by codon position with 1st codon > 2nd codon > 3rd codon, and it varies by functional group with photosynthetic genes having the highest percentage and NADH genes the lowest. Phylogenetic analyses using parsimony and likelihood methods and sequences of 61 protein-coding genes provided strong support for the monophyly of magnoliids and two strongly supported groups were identified, the Canellales/Piperales and the Laurales/Magnoliales. Strong support is reported for monocots and eudicots as sister clades with magnoliids diverging before the monocot-eudicot split. The trees also provided

  19. Phylogenetic relationships among the true porpoises (Cetacea:Phocoenidae).

    Science.gov (United States)

    Rosel, P E; Haygood, M G; Perrin, W F

    1995-12-01

    Portions of the cytochrome b gene and control region of the mitochondrial DNA molecule were sequenced to investigate systematic relationships among the six extant species of true porpoises, (Cetacea: Phocoenidae). Phylogenetic analyses of mitochondrial cytochrome b sequences support a close relationship between Burmeister's porpoise, Phocoena spinipinnis, and the vaquita, Phocoena sinus, and the association of these two species with the spectacled porpoise, Australophocaena dioptrica. The latter result is not in concordance with a recent morphological reclassification which groups A. dioptrica with Dall's porpoise, Phocoenoides dalli, in the subfamily Phocoenoidinae. The molecular analysis found no support for this grouping. A. dioptrica was originally described as a member of the genus Phocoena, and our results support returning it to that genus at this time. Finally, the data suggest that the tropical species Neophocaena phocaenoides, the finless porpoise, may represent the most basal member of the family. The control region sequences corroborated the relationships among the closely related taxa P. sinus, P. spinipinnis, and A. dioptrica, but were unable to resolve the deeper branches of the tree, probably as a result of a high level of saturation of these sequences.

  20. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  1. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  2. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  3. Sequence capture using RAD probes clarifies phylogenetic relationships and species boundaries in Primula sect. Auricula.

    Science.gov (United States)

    Boucher, F C; Casazza, G; Szövényi, P; Conti, E

    2016-11-01

    Species-rich evolutionary radiations are a common feature of mountain floras worldwide. However, the frequent lack of phylogenetic resolution in species-rich alpine plant groups hampers progress towards clarifying the causes of diversification in mountains. In this study, we use the largest plant group endemic to the European Alpine system, Primula sect. Auricula, as a model system. We employ a newly developed next-generation-sequencing protocol, involving sequence capture with RAD probes, and map reads to the reference genome of Primula veris to obtain DNA matrices with thousands of SNPs. We use these data-rich matrices to infer phylogenetic relationships in Primula sect. Auricula and examine species delimitations in two taxonomically difficult subgroups: the clades formed by the close relatives of P. auricula and P. pedemontana, respectively. Our molecular dataset enables us to resolve most phylogenetic relationships in the group with strong support, and in particular to infer four well-supported clades within sect. Auricula. Our results support existing species delimitations for P. auricula, P. lutea, and P. subpyrenaica, while they suggest that the group formed by P. pedemontana and close relatives might need taxonomic revision. Finally, we discuss preliminary implications of these findings on the biogeographic history of Primula sect. Auricula. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  5. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  6. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  7. Phylogenetic relationships among subsurface microorganisms. Project technical progress report

    Energy Technology Data Exchange (ETDEWEB)

    Nierzwicki-Bauer, S.A.

    1993-08-01

    The development of group-specific, 16S ribosomal RNA-targeted oligonucleotide hybridization probes for the rapid detection of specific types of subsurface microorganisms is described. Because portions of the 16S RRNA molecule are unique to particular organisms or groups, these unique sequences can serve as targets for hybridization probes with varied specificity. Target sequences for selected microbial groups have been identified by analysis of the available RRNA sequence data for subsurface microbes. Hybridization probes for these target sequences were produced and their effectiveness and specificity tested with RNA cell blot and in situ hybridizations. Selected probes were used to study phylogenetic relationships among subsurface microbes and to classify these organisms into the specific groups that the probes are designed to detect. To date, this work has been performed on the P24 and C10 borehole isolates from the Savannah River Site. The probes will also be used, with in situ hybridizations, to detect and monitor selected microbial groups in freshly collected subsurface samples and laboratory microcosms in collaboration with other investigators. In situ hybridizations permit detection of selected microbial types without the necessity to isolate and culture them in the laboratory.

  8. Phylogenetically diverse AM fungi from Ecuador strongly improve seedling growth of native potential crop trees.

    Science.gov (United States)

    Schüßler, Arthur; Krüger, Claudia; Urgiles, Narcisa

    2016-04-01

    In many deforested regions of the tropics, afforestation with native tree species could valorize a growing reservoir of degraded, previously overused and abandoned land. The inoculation of tropical tree seedlings with arbuscular mycorrhizal fungi (AM fungi) can improve tree growth and viability, but efficiency may depend on plant and AM fungal genotype. To study such effects, seven phylogenetically diverse AM fungi, native to Ecuador, from seven genera and a non-native AM fungus (Rhizophagus irregularis DAOM197198) were used to inoculate the tropical potential crop tree (PCT) species Handroanthus chrysanthus (synonym Tabebuia chrysantha), Cedrela montana, and Heliocarpus americanus. Twenty-four plant-fungus combinations were studied in five different fertilization and AMF inoculation treatments. Numerous plant growth parameters and mycorrhizal root colonization were assessed. The inoculation with any of the tested AM fungi improved seedling growth significantly and in most cases reduced plant mortality. Plants produced up to threefold higher biomass, when compared to the standard nursery practice. AM fungal inoculation alone or in combination with low fertilization both outperformed full fertilization in terms of plant growth promotion. Interestingly, root colonization levels for individual fungi strongly depended on the host tree species, but surprisingly the colonization strength did not correlate with plant growth promotion. The combination of AM fungal inoculation with a low dosage of slow release fertilizer improved PCT seedling performance strongest, but also AM fungal treatments without any fertilization were highly efficient. The AM fungi tested are promising candidates to improve management practices in tropical tree seedling production.

  9. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  10. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-11-05

    Saitou and Nei, 1987). Genetic distances were generated of phylogenetic reconstruction using the best fit evolution models corrected with the shape parameter of a gamma distribution (Γ) substitution suggested by Model test.

  11. Phylogenetic reconstruction using four low-copy nuclear loci strongly supports a polyphyletic origin of the genus Sorghum.

    Science.gov (United States)

    Hawkins, Jennifer S; Ramachandran, Dhanushya; Henderson, Ashley; Freeman, Jasmine; Carlise, Michael; Harris, Alex; Willison-Headley, Zachary

    2015-08-01

    Sorghum is an essential grain crop whose evolutionary placement within the Andropogoneae has been the subject of scrutiny for decades. Early studies using cytogenetic and morphological data point to a poly- or paraphyletic origin of the genus; however, acceptance of poly- or paraphyly has been met with resistance. This study aimed to address the species relationships within Sorghum, in addition to the placement of Sorghum within the tribe, using a phylogenetic approach and employing broad taxon sampling. From 16 diverse Sorghum species, eight low-copy nuclear loci were sequenced that are known to play a role in morphological diversity and have been previously used to study evolutionary relationships in grasses. Further, the data for four of these loci were combined with those from 57 members of the Andropogoneae in order to determine the placement of Sorghum within the tribe. Both maximum likelihood and Bayesian analyses were performed on multilocus concatenated data matrices. The Sorghum-specific topology provides strong support for two major lineages, in alignment with earlier studies employing chloroplast and internal transcribed spacer (ITS) markers. Clade I is composed of the Eu-, Chaeto- and Heterosorghum, while clade II contains the Stipo- and Parasorghum. When combined with data from the Andropogoneae, Clade II resolves as sister to a clade containing Miscanthus and Saccharum with high posterior probability and bootstrap support, and to the exclusion of Clade I. The results provide compelling evidence for a two-lineage polyphyletic ancestry of Sorghum within the larger Andropogoneae, i.e. the derivation of the two major Sorghum clades from a unique common ancestor. Rejection of monophyly in previous molecular studies is probably due to limited taxon sampling outside of the genus. The clade consisting of Para- and Stiposorghum resolves as sister to Miscanthus and Saccharum with strong node support. © The Author 2015. Published by Oxford University Press on

  12. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  13. Phylogenetic relationships of diurnal, phytotelm-breeding Melanophryniscus (Anura: Bufonidae) based on mitogenomic data.

    Science.gov (United States)

    Pie, Marcio R; Ströher, Patrícia R; Belmonte-Lopes, Ricardo; Bornschein, Marcos R; Ribeiro, Luiz F; Faircloth, Brant C; McCormack, John E

    2017-09-10

    Melanophryniscus is a bufonid frog genus with a broad geographic distribution over southeastern South America. In recent years, several new species of Melanophryniscus have been discovered in southern Brazil showing a distinctive life-history strategy for the genus - breeding in phytotelmata - as well as a strong association with high-altitude regions. In this study, we use mitogenomic data to infer the phylogenetic relationships among diurnal, phytotelm-breeding Melanophryniscus and to determine the timing of their divergence. We obtained the mitochondrial genomes (not including the control region) for eight individuals of Melanophryniscus representing all three described species (M. alipioi, M. milanoi, and M. xanthostomus), as well as some recently-discovered and potentially new species. Gene order was conserved in all species and corresponded to the general order found in bufonids. Although the phylogenetic relationships among the studied species was poorly supported, dating confirmed that they diverged during the Pleistocene, suggesting that phytotelm breeding could have arisen during drier periods in the glacial/interglacial cycles due to a decrease in the availability of permanent streams or ephemeral/temporary streams or ponds in which Melanophryniscus species commonly breed. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  15. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  16. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  17. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  18. [Phylogenetic relationships among Neotropical deer genera (Artiodactyla: Cervidae) by means of DNAmt sequences and microsatellite markers].

    Science.gov (United States)

    Ruiz-García, Manuel; Randi, Ettore; Martínez-Agüero, María; Alvarez, Diana

    2007-06-01

    The current work shows two molecular phylogenetic analyses on Neotropical deers. In the first analysis, the mitochondrial control region (D-loop) was sequenced in six Odocoileinae species from Latin America, using the sequences of two Muntiacinae as outgroups. The results obtained were as follows: A sequence of Mazama americana showed a striking relationship with several sequences of Odocoileus in contrast to that expected, since this M. americana haplotype, from a Mexican origin, was not associated with several Bolivian Mazama sequences analyzed. This could put forward that this genera is not monophyletic. On the other hand, these Bolivian Mazama formed a clade with Pudu puda and Ozotoceros bezoarticus. Likely, an Odocoileus virginianus sequence from the Central area of Colombia showed a more strong relationship with a Northamerican O. heminonus sequence than with the other O. virginianus sequences of Colombian origin as well. This could be explained by means of various different hypotheses. The first is the existence of common ancestral haplotypes between both species. Another one is the reiterative hybridization among both Odocoileus species before the migration of O. virginianus from North America to South America. Moreover, the maximum parsimony analysis showed an intense relationship between the Muntiacinae and this Neotropical Cervidae clade. In addition, and adding credence to the relevant polyphyletism found in Mazama by means of the mitochondrial control region DNA sequences, a second analysis with 16 DNA microsatellite loci also showed a higher genetic relationship between M. americana and O. virginianus, than between the first species regard to Mazama gouazoubira.

  19. Strong phylogenetic effects on floral scent variation of oil-secreting orchids in South Africa.

    Science.gov (United States)

    Steiner, Kim E; Kaiser, Roman; Dötterl, Stefan

    2011-10-01

    Evolution involves the interplay between natural selection and phylogenetic constraint. This is particularly evident among the flowering plants where form and diversity of flowers attest to the importance of both pollinator-mediated selection and phylogenetic constraint. Although this has been studied mostly using visible floral characters, invisible volatile chemicals emitted by the flowers should be subject to these same evolutionary forces. Unfortunately, most analyses of floral volatiles have over-emphasized the importance of natural selection and underplayed phylogenetic constraint without quantifying their respective roles in the evolution and composition of floral scents. We used multivariate analyses to test the relative importance of pollinators vs. phylogeny in determining the composition of floral scents among oil-secreting orchids in southern Africa. Floral scents of 42 oil-secreting taxa/ecotypes distributed among 12 subclades in the tribe Diseae were sampled using headspace adsorption and gas chromatography-mass spectroscopy. We identified 257 scent compounds distributed over nine different compound classes, with the majority of scents dominated by aliphatic or benzenoid compounds. The only significant predictor of floral scent among these orchids above the species level was phylogeny. Nevertheless, in two of the clades there were differences in scent profiles at the species and ecotype level that corresponded to different pollinators and were thus suggestive of pollinator-mediated selection. Scent variation was greater than expected and phylogeny was more important than pollinator-mediated selection in predicting the composition of floral scents of oil-secreting orchids, despite the specialized nature of the pollinator reward system.

  20. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  1. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  2. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  3. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  4. Evolutionary relationships of Fusobacterium nucleatum based on phylogenetic analysis and comparative genomics

    Directory of Open Access Journals (Sweden)

    Moreira David

    2004-11-01

    Full Text Available Abstract Background The phylogenetic position and evolutionary relationships of Fusobacteria remain uncertain. Especially intriguing is their relatedness to low G+C Gram positive bacteria (Firmicutes by ribosomal molecular phylogenies, but their possession of a typical gram negative outer membrane. Taking advantage of the recent completion of the Fusobacterium nucleatum genome sequence we have examined the evolutionary relationships of Fusobacterium genes by phylogenetic analysis and comparative genomics tools. Results The data indicate that Fusobacterium has a core genome of a very different nature to other bacterial lineages, and branches out at the base of Firmicutes. However, depending on the method used, 35–56% of Fusobacterium genes appear to have a xenologous origin from bacteroidetes, proteobacteria, spirochaetes and the Firmicutes themselves. A high number of hypothetical ORFs with unusual codon usage and short lengths were found and hypothesized to be remnants of transferred genes that were discarded. Some proteins and operons are also hypothesized to be of mixed ancestry. A large portion of the Gram-negative cell wall-related genes seems to have been transferred from proteobacteria. Conclusions Many instances of similarity to other inhabitants of the dental plaque that have been sequenced were found. This suggests that the close physical contact found in this environment might facilitate horizontal gene transfer, supporting the idea of niche-specific gene pools. We hypothesize that at a point in time, probably associated to the rise of mammals, a strong selective pressure might have existed for a cell with a Clostridia-like metabolic apparatus but with the adhesive and immune camouflage features of Proteobacteria.

  5. The complete mitochondrial genome of Flustra foliacea (Ectoprocta, Cheilostomata - compositional bias affects phylogenetic analyses of lophotrochozoan relationships

    Directory of Open Access Journals (Sweden)

    Nesnidal Maximilian P

    2011-11-01

    Full Text Available Abstract Background The phylogenetic relationships of the lophophorate lineages, ectoprocts, brachiopods and phoronids, within Lophotrochozoa are still controversial. We sequenced an additional mitochondrial genome of the most species-rich lophophorate lineage, the ectoprocts. Although it is known that there are large differences in the nucleotide composition of mitochondrial sequences of different lineages as well as in the amino acid composition of the encoded proteins, this bias is often not considered in phylogenetic analyses. We applied several approaches for reducing compositional bias and saturation in the phylogenetic analyses of the mitochondrial sequences. Results The complete mitochondrial genome (16,089 bp of Flustra foliacea (Ectoprocta, Gymnolaemata, Cheilostomata was sequenced. All protein-encoding, rRNA and tRNA genes are transcribed from the same strand. Flustra shares long intergenic sequences with the cheilostomate ectoproct Bugula, which might be a synapomorphy of these taxa. Further synapomorphies might be the loss of the DHU arm of the tRNA L(UUR, the loss of the DHU arm of the tRNA S(UCN and the unique anticodon sequence GAG of the tRNA L(CUN. The gene order of the mitochondrial genome of Flustra differs strongly from that of the other known ectoprocts. Phylogenetic analyses of mitochondrial nucleotide and amino acid data sets show that the lophophorate lineages are more closely related to trochozoan phyla than to deuterostomes or ecdysozoans confirming the Lophotrochozoa hypothesis. Furthermore, they support the monophyly of Cheilostomata and Ectoprocta. However, the relationships of the lophophorate lineages within Lophotrochozoa differ strongly depending on the data set and the used method. Different approaches for reducing heterogeneity in nucleotide and amino acid data sets and saturation did not result in a more robust resolution of lophotrochozoan relationships. Conclusion The contradictory and usually weakly

  6. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  7. DNA barcoding evaluation and implications for phylogenetic relationships in ladybird beetles (Coleoptera: Coccinellidae).

    Science.gov (United States)

    Wang, Zheng-Liang; Wang, Tian-Zhao; Zhu, Hang-Feng; Wang, Zi-Ye; Yu, Xiao-Ping

    2018-03-08

    Ladybird beetles (Coleoptera: Coccinellidae), with broad morphological diversity, wide geographic distribution and substantial agricultural significance, are a challenging group for taxonomists and phylogenetics. As a promising tool to identify and discover new species, DNA barcoding might offer significant potential for identification, taxonomy and phylogeny of ladybird beetles. In the present study, a total of 1364 COI (cytochrome C oxidase subunit I) sequences representing 128 species from 52 genera of ladybird beetles were screened for barcoding evaluation and phylogenetic analysis. Our results from the barcoding analysis revealed that COI displays a similar level of species identification efficiency (nearly 90%) either based on Kimura two-parameter (K2P) distances calculation or on simplified neighbour-joining (NJ) tree construction. The phylogenetic relationships within the family Coccinellidae was analyzed by Bayesian-inference (BI) method. The phylogenetic results confirmed the monophyly of the subfamilies Microweisinae and Coccinellinae sensu Ślipiński (2007), and suggested that the subfamilies Coccidulinae, Chilocorinae and Scymninae are paraphyletic. However, the phylogenetic relationships among different subfamilies are not clearly defined and thus remain to be thoroughly studied. Overall, our study confirmed the usefulness of DNA barcoding for coccinellid species identification and phylogenetic inference.

  8. Phylogenetic relationships in Myrceugenia (Myrtaceae) based on plastid and nuclear DNA sequences.

    Science.gov (United States)

    Murillo-A, José; Ruiz-P, Eduardo; Landrum, Leslie R; Stuessy, Tod F; Barfuss, Michael H J

    2012-02-01

    Myrceugenia is a genus endemic to South America with a disjunct distribution: 12 species occurring mainly in central Chile and approximately 25 in southeastern Brazil. Relationships are reconstructed within Myrceugenia from four plastid markers (partial trnK-matK, rpl32-trnL, trnQ-5'rps16 and rpl16) and two ribosomal nuclear regions (ETS and ITS) using maximum parsimony and Bayesian analyses. Relationships inferred previously from morphological data are not completely consistent with those from molecular data. All molecular analyses support the hypothesis that Myrceugenia is monophyletic, except for M. fernadeziana that falls outside the genus. Chilean species and Brazilian species form two separate lineages. Chilean species form three early diverging clades, whereas Brazilian species are a strongly supported monophyletic group in a terminal position. Least average evolutionary divergence, low resolution, short branches, and high species diversity found in the Brazilian clade suggest rapid radiation. Geographical distributions and phylogenetic reconstructions suggest that extant Myrceugenia species arose in northern Chile followed by colonization southward and finally to the Juan Fernández Islands and southeastern Brazil. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Statistical relationship of strong earthquakes with planetary geomagnetic field activity

    Science.gov (United States)

    Pogrebnikov, M. M.; Komarovski, N. I.; Kopytenko, Y. A.; Pushel, A. P.

    1984-12-01

    Earlier studies reported a significant decrease in the geomagnetic field before strong earthquakes. Possible relationships between earthquakes with magnitude greater than 7 (Soviet scale) and planetary terrestrial magnetic field activity as characterized by the K sub p index were investigated. A total of 100 cases of strong earthquakes on magnetically quiet days in 1965 to 1975 were studied. The K sub p indexes were studied for two days before and two days after the earthquakes. The dispersion curve shows a significant decrease one day before each event. The relationship of the planetary K sub p index with seismic activity indicates that the period of preparation for an earthquake and at the moment of the shock are reflected in the terrestrial magnetic field.

  10. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... 1Department of Natural Resources and Environmental Sciences, Alabama A and M University, P. O. Box 1208 Normal. Al, 35762, USA. ... both functional relationships as well as homology, possibly due to selection at the RAPD loci associated with ..... causes include inadequate or non-judicious sampling,.

  11. Phylogenetic relationships of the Acanthocephala inferred from 18S ribosomal DNA sequences.

    Science.gov (United States)

    Near, T J; Garey, J R; Nadler, S A

    1998-12-01

    Phylogenetic relationships within the Acanthocephala have remained unresolved. Past systematic efforts have focused on creating classifications with little consideration of phylogenetic methods. The Acanthocephala are currently divided into three major taxonomic groups: Archiacanthocephala, Palaeacanthocephala, and Eoacanthocephala. These groups are characterized by structural features in addition to the taxonomy and habitat of hosts parasitized. In this study the phylogenetic relationships of 11 acanthocephalan species are examined with 18S rDNA sequences. Maximum parsimony, minimum evolution, and maximum likelihood methods are used to estimate phylogenetic relationships. Within the context of sampled taxa, all phylogenetic analyses are consistent with monophyly of the major taxonomic groups of the Acanthocephala, suggesting that the current higher order classification is natural. The molecular phylogeny is used to examine patterns of character evolution for various structural and ecological characteristics of the Acanthocephala. Arthropod intermediate host distributions, when mapped on the phylogeny, are consistent with monophyletic groups of acanthocephalans. Vertebrate definitive host distributions among the Acanthocephala display independent radiations into similar hosts. Levels of uncorrected sequence divergence among acanthocephalans are high; however, relative-rate tests indicate significant departure from rate uniformity among acanthocephalans, arthropods, and vertebrates. This precludes comparison of 18S divergence levels to assess the relative age of the Acanthocephala. However, other evidence suggests an ancient origin of the acanthocephalan-arthropod parasitic association. Copyright 1998 Academic Press.

  12. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  13. Deconstructing the relationships between phylogenetic diversity and ecology: a case study on ecosystem functioning.

    Science.gov (United States)

    Davies, T Jonathan; Urban, Mark C; Rayfield, Bronwyn; Cadotte, Marc W; Peres-Neto, Pedro R

    2016-09-01

    Recent studies have supported a link between phylogenetic diversity and various ecological properties including ecosystem function. However, such studies typically assume that phylogenetic branches of equivalent length are more or less interchangeable. Here we suggest that there is a need to consider not only branch lengths but also their placement on the phylogeny. We demonstrate how two common indices of network centrality can be used to describe the evolutionary distinctiveness of network elements (nodes and branches) on a phylogeny. If phylogenetic diversity enhances ecosystem function via complementarity and the representation of functional diversity, we would predict a correlation between evolutionary distinctiveness of network elements and their contribution to ecosystem process. In contrast, if one or a few evolutionary innovations play key roles in ecosystem function, the relationship between evolutionary distinctiveness and functional contribution may be weak or absent. We illustrate how network elements associated with high functional contribution can be identified from regressions between phylogenetic diversity and productivity using a well-known empirical data set on plant productivity from the Cedar Creek Long-Term Ecological Research. We find no association between evolutionary distinctiveness and ecosystem functioning, but we are able to identify phylogenetic elements associated with species of known high functional contribution within the Fabaceae. Our perspective provides a useful guide in the search for ecological traits linking diversity and ecosystem function, and suggests a more nuanced consideration of phylogenetic diversity is required in the conservation and biodiversity-ecosystem-function literature. © 2016 by the Ecological Society of America.

  14. Phylogenomics provides strong evidence for relationships of butterflies and moths.

    Science.gov (United States)

    Kawahara, Akito Y; Breinholt, Jesse W

    2014-08-07

    Butterflies and moths constitute some of the most popular and charismatic insects. Lepidoptera include approximately 160 000 described species, many of which are important model organisms. Previous studies on the evolution of Lepidoptera did not confidently place butterflies, and many relationships among superfamilies in the megadiverse clade Ditrysia remain largely uncertain. We generated a molecular dataset with 46 taxa, combining 33 new transcriptomes with 13 available genomes, transcriptomes and expressed sequence tags (ESTs). Using HaMStR with a Lepidoptera-specific core-orthologue set of single copy loci, we identified 2696 genes for inclusion into the phylogenomic analysis. Nucleotides and amino acids of the all-gene, all-taxon dataset yielded nearly identical, well-supported trees. Monophyly of butterflies (Papilionoidea) was strongly supported, and the group included skippers (Hesperiidae) and the enigmatic butterfly-moths (Hedylidae). Butterflies were placed sister to the remaining obtectomeran Lepidoptera, and the latter was grouped with greater than or equal to 87% bootstrap support. Establishing confident relationships among the four most diverse macroheteroceran superfamilies was previously challenging, but we recovered 100% bootstrap support for the following relationships: ((Geometroidea, Noctuoidea), (Bombycoidea, Lasiocampoidea)). We present the first robust, transcriptome-based tree of Lepidoptera that strongly contradicts historical placement of butterflies, and provide an evolutionary framework for genomic, developmental and ecological studies on this diverse insect order. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  15. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  16. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  17. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  18. The evolutionary relationships and age of Homo naledi: An assessment using dated Bayesian phylogenetic methods.

    Science.gov (United States)

    Dembo, Mana; Radovčić, Davorka; Garvin, Heather M; Laird, Myra F; Schroeder, Lauren; Scott, Jill E; Brophy, Juliet; Ackermann, Rebecca R; Musiba, Chares M; de Ruiter, Darryl J; Mooers, Arne Ø; Collard, Mark

    2016-08-01

    Homo naledi is a recently discovered species of fossil hominin from South Africa. A considerable amount is already known about H. naledi but some important questions remain unanswered. Here we report a study that addressed two of them: "Where does H. naledi fit in the hominin evolutionary tree?" and "How old is it?" We used a large supermatrix of craniodental characters for both early and late hominin species and Bayesian phylogenetic techniques to carry out three analyses. First, we performed a dated Bayesian analysis to generate estimates of the evolutionary relationships of fossil hominins including H. naledi. Then we employed Bayes factor tests to compare the strength of support for hypotheses about the relationships of H. naledi suggested by the best-estimate trees. Lastly, we carried out a resampling analysis to assess the accuracy of the age estimate for H. naledi yielded by the dated Bayesian analysis. The analyses strongly supported the hypothesis that H. naledi forms a clade with the other Homo species and Australopithecus sediba. The analyses were more ambiguous regarding the position of H. naledi within the (Homo, Au. sediba) clade. A number of hypotheses were rejected, but several others were not. Based on the available craniodental data, Homo antecessor, Asian Homo erectus, Homo habilis, Homo floresiensis, Homo sapiens, and Au. sediba could all be the sister taxon of H. naledi. According to the dated Bayesian analysis, the most likely age for H. naledi is 912 ka. This age estimate was supported by the resampling analysis. Our findings have a number of implications. Most notably, they support the assignment of the new specimens to Homo, cast doubt on the claim that H. naledi is simply a variant of H. erectus, and suggest H. naledi is younger than has been previously proposed. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Analysis of strong ground motions to evaluate regional attenuation relationships

    Directory of Open Access Journals (Sweden)

    V. Montaldo

    2002-06-01

    Full Text Available Italian attenuation relationships at regional scale have been refined using a data set of 322 horizontal components of strong ground motions recorded mainly during the 1997-1998 Umbria-Marche, Central Italy, earthquake sequence. The data set includes records generated by events with local magnitude (M L ranging between 4.5 and 5.9, recorded at rock or soil sites and epicentral distance smaller than 100 km. Through a multiple step regression analysis, we calculated empirical equations for the peak ground acceleration and velocity, the Arias Intensity and for the horizontal components of the 5% damped velocity pseudo response spectra, corresponding to 14 frequencies ranging from 0.25 to 25 Hz. We compared our results with well known predictive equations, widely used on the national territory for Probabilistic Seismic Hazard Analysis. The results obtained in this study show smaller values for all the analyzed ground motion indicators compared to other predictive equations.

  20. Lizards from the end of the world: phylogenetic relationships of the Liolaemus lineomaculatus section (Squamata: Iguania: Liolaemini).

    Science.gov (United States)

    Breitman, M Florencia; Avila, Luciano J; Sites, Jack W; Morando, Mariana

    2011-05-01

    The Liolaemus lineomaculatus section is a geographically widely distributed group of lizards from the Patagonian region of southern South America, and includes 18 described species representing the most southerly distributed Liolaemus taxa (the genus includes 228 species and extends from Tierra del Fuego north to south-central Peru). Despite high species diversity, the phylogenetic relationships of this section are unknown. In the present work we sampled all described species in the L. lineomaculatus section as well as currently undescribed candidate species to reconstruct the first complete phylogenetic hypothesis for the clade. Our data set included four anonymous nuclear loci, three nuclear protein-coding loci, and two mitochondrial genes. We compared results obtained with three different phylogenetic methods for the concatenated data set (Maximum Parsimony, Maximum Likelihood and Bayesian Inference) with a coalescent-based species tree approach (BEST), and recovered congruent, strongly-supported topological arrangements across all methods. We identified four main clades within the L. lineomaculatus section: the lineomaculatus, magellanicus, somuncurae, and kingii+archeforus groups, for which we estimated divergence times. We discuss the taxonomic implications of these results and how the future integration of phylogeographic, niche modeling and morphological approaches will allow testing biogeographical hypotheses in this clade. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  2. Phylogenetic Relationships among Turbellarian Orders Inferred from 18S rDNA Sequences

    OpenAIRE

    Tomoe, Katayama; Megumi, Nishioka; Masamichi, Yamamoto; Ushimado Marine Laboratory, Okayama University; Ushimado Marine Laboratory, Okayama University; Ushimado Marine Laboratory, Okayama University

    1996-01-01

    The turbellarian flatworm is a key group to understand the origin and the early evolution of triploblastic, bilaterally symmetrical animals, but phylogenetic relationships among turbellarian orders have been a subject of debates for decades, especially on the position of the acoel turbellarians. Some workers have considered the acoel representing the most primitive turbellarian order but others have regarded them as regressive. We determined almost the entire lengths of the nucleotide sequenc...

  3. Study of phylogenetic relationship of Turkish species ofMatthiola (Brassicaceae) based on ISSR amplification

    OpenAIRE

    DOĞAN, BEKİR; ÇELİK, MUSTAFA; ÜNAL, MURAT; SEFALI, ABDURRAHMAN; MARTİN, ESRA; KAYA, AYLA

    2016-01-01

    Matthiola W.T.Aiton is a taxonomically complex genus in which there are many problems, mostly with Matthiola longipetala and M. Odoratissima. Matthiola species native to Turkey were collected from various locations in Anatolia, and their DNA was isolated. Revision studies performed on the basis of molecular data obtained from studies conducted in recent years have made the phylogenetic relationships and systematic positions of the taxa more apparent and reliable. Consequently, the remaining t...

  4. Evolutionary relationships of the Critically Endangered frog Ericabatrachus baleensis Largen, 1991 with notes on incorporating previously unsampled taxa into large-scale phylogenetic analyses

    Science.gov (United States)

    2014-01-01

    Background The phylogenetic relationships of many taxa remain poorly known because of a lack of appropriate data and/or analyses. Despite substantial recent advances, amphibian phylogeny remains poorly resolved in many instances. The phylogenetic relationships of the Ethiopian endemic monotypic genus Ericabatrachus has been addressed thus far only with phenotypic data and remains contentious. Results We obtained fresh samples of the now rare and Critically Endangered Ericabatrachus baleensis and generated DNA sequences for two mitochondrial and four nuclear genes. Analyses of these new data using de novo and constrained-tree phylogenetic reconstructions strongly support a close relationship between Ericabatrachus and Petropedetes, and allow us to reject previously proposed alternative hypotheses of a close relationship with cacosternines or Phrynobatrachus. Conclusions We discuss the implications of our results for the taxonomy, biogeography and conservation of E. baleensis, and suggest a two-tiered approach to the inclusion and analyses of new data in order to assess the phylogenetic relationships of previously unsampled taxa. Such approaches will be important in the future given the increasing availability of relevant mega-alignments and potential framework phylogenies. PMID:24612655

  5. Phylogenetic Relationships of the Fern Cyrtomium falcatum (Dryopteridaceae from Dokdo Island Based on Chloroplast Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Gurusamy Raman

    2016-12-01

    Full Text Available Cyrtomium falcatum is a popular ornamental fern cultivated worldwide. Native to the Korean Peninsula, Japan, and Dokdo Island in the Sea of Japan, it is the only fern present on Dokdo Island. We isolated and characterized the chloroplast (cp genome of C. falcatum, and compared it with those of closely related species. The genes trnV-GAC and trnV-GAU were found to be present within the cp genome of C. falcatum, whereas trnP-GGG and rpl21 were lacking. Moreover, cp genomes of Cyrtomium devexiscapulae and Adiantum capillus-veneris lack trnP-GGG and rpl21, suggesting these are not conserved among angiosperm cp genomes. The deletion of trnR-UCG, trnR-CCG, and trnSeC in the cp genomes of C. falcatum and other eupolypod ferns indicates these genes are restricted to tree ferns, non-core leptosporangiates, and basal ferns. The C. falcatum cp genome also encoded ndhF and rps7, with GUG start codons that were only conserved in polypod ferns, and it shares two significant inversions with other ferns, including a minor inversion of the trnD-GUC region and an approximate 3 kb inversion of the trnG-trnT region. Phylogenetic analyses showed that Equisetum was found to be a sister clade to Psilotales-Ophioglossales with a 100% bootstrap (BS value. The sister relationship between Pteridaceae and eupolypods was also strongly supported by a 100% BS, but Bayesian molecular clock analyses suggested that C. falcatum diversified in the mid-Paleogene period (45.15 ± 4.93 million years ago and might have moved from Eurasia to Dokdo Island.

  6. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  7. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  8. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...

  9. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  10. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  11. Mitochondrial matR sequences help to resolve deep phylogenetic relationships in rosids

    Directory of Open Access Journals (Sweden)

    Dilcher David L

    2007-11-01

    Full Text Available Abstract Background Rosids are a major clade in the angiosperms containing 13 orders and about one-third of angiosperm species. Recent molecular analyses recognized two major groups (i.e., fabids with seven orders and malvids with three orders. However, phylogenetic relationships within the two groups and among fabids, malvids, and potentially basal rosids including Geraniales, Myrtales, and Crossosomatales remain to be resolved with more data and a broader taxon sampling. In this study, we obtained DNA sequences of the mitochondrial matR gene from 174 species representing 72 families of putative rosids and examined phylogenetic relationships and phylogenetic utility of matR in rosids. We also inferred phylogenetic relationships within the "rosid clade" based on a combined data set of 91 taxa and four genes including matR, two plastid genes (rbcL, atpB, and one nuclear gene (18S rDNA. Results Comparison of mitochondrial matR and two plastid genes (rbcL and atpB showed that the synonymous substitution rate in matR was approximately four times slower than those of rbcL and atpB; however, the nonsynonymous substitution rate in matR was relatively high, close to its synonymous substitution rate, indicating that the matR has experienced a relaxed evolutionary history. Analyses of our matR sequences supported the monophyly of malvids and most orders of the rosids. However, fabids did not form a clade; instead, the COM clade of fabids (Celastrales, Oxalidales, Malpighiales, and Huaceae was sister to malvids. Analyses of the four-gene data set suggested that Geraniales and Myrtales were successively sister to other rosids, and that Crossosomatales were sister to malvids. Conclusion Compared to plastid genes such as rbcL and atpB, slowly evolving matR produced less homoplasious but not less informative substitutions. Thus, matR appears useful in higher-level angiosperm phylogenetics. Analysis of matR alone identified a novel deep relationship within

  12. Structure of mitochondrial DNA control region of Fenneropenaeus chinensis and phylogenetic relationship among different populations.

    Science.gov (United States)

    Zhang, Hui; Li, Pengfei; Gao, Tianxiang; Zhuang, Zhimeng; Jin, Xianshi

    2012-06-01

    This paper deals with the structure of mitochondrial DNA control region of Fenneropenaeus chinensis. The termination-associated sequence (TAS), cTAS, CSB-D-CSB-F, and CSB-1 are detected in the species. The results indicate that the structures of these parts are similar to those of most marine organisms. Two conserved regions and many stable conserved boxes are found in the extended TAS area, central sequences blocks, and conserved sequences blocks (CSBs). This is the special character of F. chinensis. All the mtDNA control region sequences do not have CSB2 and CSB3 blocks, which is quite different from most vertebrates. In addition, the complete mtDNA control region sequences are used to analyze the phylogenetic relationships of F. chinensis. The phylogenetic trees show a lack of genetic structure among populations, which is similar to many previous studies.

  13. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  14. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...

  15. Phylogenetic relationships of phrynosomatid lizards based on nuclear and mitochondrial data, and a revised phylogeny for Sceloporus.

    Science.gov (United States)

    Wiens, John J; Kuczynski, Caitlin A; Arif, Saad; Reeder, Tod W

    2010-01-01

    Phrynosomatid lizards are among the most common and diverse groups of reptiles in western North America, Mexico, and Central America. Phrynosomatidae includes 136 species in 10 genera. Phrynosomatids are used as model systems in many research programs in evolution and ecology, and much of this research has been undertaken in a comparative phylogenetic framework. However, relationships among many phrynosomatid genera are poorly supported and in conflict between recent studies. Further, previous studies based on mitochondrial DNA sequences suggested that the most species-rich genus (Sceloporus) is possibly paraphyletic with respect to as many as four other genera (Petrosaurus, Sator, Urosaurus, and Uta). Here, we collect new sequence data from five nuclear genes and combine them with published data from one additional nuclear gene and five mitochondrial gene regions. We compare trees from nuclear and mitochondrial data from 37 phrynosomatid taxa, including a "species tree" (from BEST) for the nuclear data. We also present a phylogeny for 122 phrynosomatid species based on maximum likelihood analysis of the combined data, which provides a strongly-supported hypothesis for relationships among most phrynosomatid genera and includes most phrynosomatid species. Our results strongly support the monophyly of Sceloporus (including Sator) and many of the relationships within it. We present a new classification for phrynosomatid lizards and the genus Sceloporus, and offer a new tree with branch lengths for use in comparative studies.

  16. A multivariate analysis of variation in genome size and endoreduplication in angiosperms reveals strong phylogenetic signal and association with phenotypic traits.

    Science.gov (United States)

    Bainard, Jillian D; Bainard, Luke D; Henry, Thomas A; Fazekas, Aron J; Newmaster, Steven G

    2012-12-01

    Genome size (C-value) and endopolyploidy (endoreduplication index, EI) are known to correlate with various morphological and ecological traits, in addition to phylogenetic placement. A phylogenetically controlled multivariate analysis was used to explore the relationships between DNA content and phenotype in angiosperms. Seeds from 41 angiosperm species (17 families) were grown in a common glasshouse experiment. Genome size (2C-value and 1Cx-value) and EI (in four tissues: leaf, stem, root, petal) were determined using flow cytometry. The phylogenetic signal was calculated for each measure of DNA content, and phylogenetic canonical correlation analysis (PCCA) explored how the variation in genome size and EI was correlated with 18 morphological and ecological traits. Phylogenetic signal (λ) was strongest for EI in all tissues, and λ was stronger for the 2C-value than the 1Cx-value. PCCA revealed that EI was correlated with pollen length, stem height, seed mass, dispersal mechanism, arbuscular mycorrhizal association, life history and flowering time, and EI and genome size were both correlated with stem height and life history. PCCA provided an effective way to explore multiple factors of DNA content variation and phenotypic traits in a phylogenetic context. Traits that were correlated significantly with DNA content were linked to plant competitive ability. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  17. Phylogenetic assemblage structure of North American trees is more strongly shaped by glacial-interglacial climate variability in gymnosperms than in angiosperms.

    Science.gov (United States)

    Ma, Ziyu; Sandel, Brody; Svenning, Jens-Christian

    2016-05-01

    How fast does biodiversity respond to climate change? The relationship of past and current climate with phylogenetic assemblage structure helps us to understand this question. Studies of angiosperm tree diversity in North America have already suggested effects of current water-energy balance and tropical niche conservatism. However, the role of glacial-interglacial climate variability remains to be determined, and little is known about any of these relationships for gymnosperms. Moreover, phylogenetic endemism, the concentration of unique lineages in restricted ranges, may also be related to glacial-interglacial climate variability and needs more attention. We used a refined phylogeny of both angiosperms and gymnosperms to map phylogenetic diversity, clustering and endemism of North American trees in 100-km grid cells, and climate change velocity since Last Glacial Maximum together with postglacial accessibility to recolonization to quantify glacial-interglacial climate variability. We found: (1) Current climate is the dominant factor explaining the overall patterns, with more clustered angiosperm assemblages toward lower temperature, consistent with tropical niche conservatism. (2) Long-term climate stability is associated with higher angiosperm endemism, while higher postglacial accessibility is linked to to more phylogenetic clustering and endemism in gymnosperms. (3) Factors linked to glacial-interglacial climate change have stronger effects on gymnosperms than on angiosperms. These results suggest that paleoclimate legacies supplement current climate in shaping phylogenetic patterns in North American trees, and especially so for gymnosperms.

  18. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  19. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  20. Analysis of genetic diversity and phylogenetic relationships among red jungle fowls and Chinese domestic fowls.

    Science.gov (United States)

    Bao, WenBin; Chen, GuoHong; Li, BiChun; Wu, XinSheng; Shu, JingTing; Wu, ShengLong; Xu, Qi; Weigend, Steffen

    2008-06-01

    Genetic diversity and phylogenetic relationships among 568 individuals of two red jungle fowl subspecies (Gallus gallus spadiceus in China and Gallus gallus gallus in Thailand) and 14 Chinese domestic chicken breeds were evaluated with 29 microstaellite loci, the genetic variability within population and genetic differentiation among population were estimated, and then genetic diversity and phylogenetic relationships were analyzed among red jungle fowls and Chinese domestic fowls. A total of 286 alleles were detected in 16 population with 29 microsatellite markers and the average number of the alleles observed in 29 microsatellite loci was 9.86+/-6.36. The overall expected heterozygosity of all population was 0.6708+/-0.0251, and the number of population deviated from Hardy-Weinberg equilibrium per locus ranged from 0 to 7. In the whole population, the average of genetic differentiation among population, measured as FST value, was 16.7% (Pjungle fowl than other domestic chicken breeds. G. gallus spadiceus showed closer phylogenetic relationship with Chinese domestic chicken breeds than G. gallus gallus. All 29 microstaellite loci in this study showed high levels of polymorphism and significant genetic differentiation was observed among two subspecies of red jungle fowl and 14 Chinese domestic chicken breeds. The evolutional dendrogram is as follows: evolutional breeds-->primitive breeds (Chahua chicken and Tibetan)-->red jungle fowl in China (G. gallus spadiceus)-->red jungle fowl in Thailand (G. gallus gallus). The results supported the theory that the domestic fowls might originate from different subspecies of red jungle fowl and Chinese domestic fowls had independent origin.

  1. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  2. Phylogenetic relationships in Cortinarius, section Calochroi, inferred from nuclear DNA sequences

    Directory of Open Access Journals (Sweden)

    Ammirati Joseph

    2009-01-01

    Full Text Available Abstract Background Section Calochroi is one of the most species-rich lineages in the genus Cortinarius (Agaricales, Basidiomycota and is widely distributed across boreo-nemoral areas, with some extensions into meridional zones. Previous phylogenetic studies of Calochroi (incl. section Fulvi have been geographically restricted; therefore, phylogenetic and biogeographic relationships within this lineage at a global scale have been largely unknown. In this study, we obtained DNA sequences from a nearly complete taxon sampling of known species from Europe, Central America and North America. We inferred intra- and interspecific phylogenetic relationships as well as major morphological evolutionary trends within section Calochroi based on 576 ITS sequences, 230 ITS + 5.8S + D1/D2 sequences, and a combined dataset of ITS + 5.8S + D1/D2 and RPB1 sequences of a representative subsampling of 58 species. Results More than 100 species were identified by integrating DNA sequences with morphological, macrochemical and ecological data. Cortinarius section Calochroi was consistently resolved with high branch support into at least seven major lineages: Calochroi, Caroviolacei, Dibaphi, Elegantiores, Napi, Pseudoglaucopodes and Splendentes; whereas Rufoolivacei and Sulfurini appeared polyphyletic. A close relationship between Dibaphi, Elegantiores, Napi and Splendentes was consistently supported. Combinations of specific morphological, pigmentation and molecular characters appear useful in circumscribing clades. Conclusion Our analyses demonstrate that Calochroi is an exclusively northern hemispheric lineage, where species follow their host trees throughout their natural ranges within and across continents. Results of this study contribute substantially to defining European species in this group and will help to either identify or to name new species occurring across the northern hemisphere. Major groupings are in partial agreement with earlier morphology

  3. Phylogenetic relationships in Cortinarius, section Calochroi, inferred from nuclear DNA sequences

    Science.gov (United States)

    Garnica, Sigisfredo; Weiß, Michael; Oertel, Bernhard; Ammirati, Joseph; Oberwinkler, Franz

    2009-01-01

    Background Section Calochroi is one of the most species-rich lineages in the genus Cortinarius (Agaricales, Basidiomycota) and is widely distributed across boreo-nemoral areas, with some extensions into meridional zones. Previous phylogenetic studies of Calochroi (incl. section Fulvi) have been geographically restricted; therefore, phylogenetic and biogeographic relationships within this lineage at a global scale have been largely unknown. In this study, we obtained DNA sequences from a nearly complete taxon sampling of known species from Europe, Central America and North America. We inferred intra- and interspecific phylogenetic relationships as well as major morphological evolutionary trends within section Calochroi based on 576 ITS sequences, 230 ITS + 5.8S + D1/D2 sequences, and a combined dataset of ITS + 5.8S + D1/D2 and RPB1 sequences of a representative subsampling of 58 species. Results More than 100 species were identified by integrating DNA sequences with morphological, macrochemical and ecological data. Cortinarius section Calochroi was consistently resolved with high branch support into at least seven major lineages: Calochroi, Caroviolacei, Dibaphi, Elegantiores, Napi, Pseudoglaucopodes and Splendentes; whereas Rufoolivacei and Sulfurini appeared polyphyletic. A close relationship between Dibaphi, Elegantiores, Napi and Splendentes was consistently supported. Combinations of specific morphological, pigmentation and molecular characters appear useful in circumscribing clades. Conclusion Our analyses demonstrate that Calochroi is an exclusively northern hemispheric lineage, where species follow their host trees throughout their natural ranges within and across continents. Results of this study contribute substantially to defining European species in this group and will help to either identify or to name new species occurring across the northern hemisphere. Major groupings are in partial agreement with earlier morphology-based and molecular phylogenetic

  4. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  5. Phylogenetic relationships within the speciose family Characidae (Teleostei: Ostariophysi: Characiformes based on multilocus analysis and extensive ingroup sampling

    Directory of Open Access Journals (Sweden)

    Vari Richard P

    2011-09-01

    Full Text Available Abstract Background With nearly 1,100 species, the fish family Characidae represents more than half of the species of Characiformes, and is a key component of Neotropical freshwater ecosystems. The composition, phylogeny, and classification of Characidae is currently uncertain, despite significant efforts based on analysis of morphological and molecular data. No consensus about the monophyly of this group or its position within the order Characiformes has been reached, challenged by the fact that many key studies to date have non-overlapping taxonomic representation and focus only on subsets of this diversity. Results In the present study we propose a new definition of the family Characidae and a hypothesis of relationships for the Characiformes based on phylogenetic analysis of DNA sequences of two mitochondrial and three nuclear genes (4,680 base pairs. The sequences were obtained from 211 samples representing 166 genera distributed among all 18 recognized families in the order Characiformes, all 14 recognized subfamilies in the Characidae, plus 56 of the genera so far considered incertae sedis in the Characidae. The phylogeny obtained is robust, with most lineages significantly supported by posterior probabilities in Bayesian analysis, and high bootstrap values from maximum likelihood and parsimony analyses. Conclusion A monophyletic assemblage strongly supported in all our phylogenetic analysis is herein defined as the Characidae and includes the characiform species lacking a supraorbital bone and with a derived position of the emergence of the hyoid artery from the anterior ceratohyal. To recognize this and several other monophyletic groups within characiforms we propose changes in the limits of several families to facilitate future studies in the Characiformes and particularly the Characidae. This work presents a new phylogenetic framework for a speciose and morphologically diverse group of freshwater fishes of significant ecological and

  6. Phylogenetic relationships within the speciose family Characidae (Teleostei: Ostariophysi: Characiformes) based on multilocus analysis and extensive ingroup sampling.

    Science.gov (United States)

    Oliveira, Claudio; Avelino, Gleisy S; Abe, Kelly T; Mariguela, Tatiane C; Benine, Ricardo C; Ortí, Guillermo; Vari, Richard P; Corrêa e Castro, Ricardo M

    2011-09-26

    With nearly 1,100 species, the fish family Characidae represents more than half of the species of Characiformes, and is a key component of Neotropical freshwater ecosystems. The composition, phylogeny, and classification of Characidae is currently uncertain, despite significant efforts based on analysis of morphological and molecular data. No consensus about the monophyly of this group or its position within the order Characiformes has been reached, challenged by the fact that many key studies to date have non-overlapping taxonomic representation and focus only on subsets of this diversity. In the present study we propose a new definition of the family Characidae and a hypothesis of relationships for the Characiformes based on phylogenetic analysis of DNA sequences of two mitochondrial and three nuclear genes (4,680 base pairs). The sequences were obtained from 211 samples representing 166 genera distributed among all 18 recognized families in the order Characiformes, all 14 recognized subfamilies in the Characidae, plus 56 of the genera so far considered incertae sedis in the Characidae. The phylogeny obtained is robust, with most lineages significantly supported by posterior probabilities in Bayesian analysis, and high bootstrap values from maximum likelihood and parsimony analyses. A monophyletic assemblage strongly supported in all our phylogenetic analysis is herein defined as the Characidae and includes the characiform species lacking a supraorbital bone and with a derived position of the emergence of the hyoid artery from the anterior ceratohyal. To recognize this and several other monophyletic groups within characiforms we propose changes in the limits of several families to facilitate future studies in the Characiformes and particularly the Characidae. This work presents a new phylogenetic framework for a speciose and morphologically diverse group of freshwater fishes of significant ecological and evolutionary importance across the Neotropics and portions

  7. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  8. Phylogenetic relationships among Staphylococcus aureus isolated from clinical samples in Mashhad, Iran.

    Science.gov (United States)

    Khademi, Farzad; Ghanbari, Fahimeh; Mellmann, Alexander; Najafzadeh, Mohammad J; Khaledi, Azad

    2016-01-01

    The spa gene occurs in all strains of Staphylococcus aureus (S. aureus), can function as a genetic marker and might be used distinguish strains at the species level. Hence, due to these advantages, we used spa typing and the Based Upon Repeat Pattern (BURP) to assign the clonal and phylogenetic relationships of S. aureus strains. The sensitivity of S. aureus strains to methicillin was determined using agar disk diffusion. The extracted DNA from 56 isolates of S. aureus was subjected to PCR to detect the spa gene with specific primers. The spa typing method was performed for each of the isolates, and then, BURP was used to cluster spa types (spa-CCs). Finally, using relevant software, the phylogenic tree was drawn. The results of this study showed that 25 out of 56 (44.6%) isolates were resistant to methicillin. The typing of S. aureus isolates revealed 24 different spa types among 56 isolates, and BURP analysis clustered the 24 spa types into 5 spa clonal complexes (CCs) and 12 singletons. The process of spa typing, in combination with BURP analysis, provides an efficient method for investigating phylogenetic and clonal relationships among clinical isolates and can be useful for monitoring bacterial spread between hospitals and communities as well as between and within hospitals. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  9. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  10. Phylogenetic relationships among deep-sea and chemosynthetic sea anemones: actinoscyphiidae and actinostolidae (Actiniaria: Mesomyaria.

    Directory of Open Access Journals (Sweden)

    Estefanía Rodríguez

    Full Text Available Sea anemones (Cnidaria, Actiniaria are present in all marine ecosystems, including chemosynthetic environments. The high level of endemicity of sea anemones in chemosynthetic environments and the taxonomic confusion in many of the groups to which these animals belong makes their systematic relationships obscure. We use five molecular markers to explore the phylogenetic relationships of the superfamily Mesomyaria, which includes most of the species that live in chemosynthetic, deep-sea, and polar sea habitats and to test the monophyly of the recently defined clades Actinostolina and Chemosynthina. We found that sea anemones of chemosynthetic environments derive from at least two different lineages: one lineage including acontiate deep-sea taxa and the other primarily encompassing shallow-water taxa.

  11. Phylogenetic relationships of North American garter snakes (Thamnophis) based on four mitochondrial genes: how much DNA sequence is enough?

    Science.gov (United States)

    de Queiroz, Alan; Lawson, Robin; Lemos-Espinal, Julio A

    2002-02-01

    The clade of garter snakes (Thamnophis) includes some of the most abundant and well-studied snakes in North America. However, phylogenetic relationships within this group have been little studied. We used DNA sequences of four mitochondrial genes (cytochrome b and NADH dehydrogenase subunits 1, 2, and 4) to estimate relationships among 29 of the 31 recognized species of Thamnophis plus the related species Adelophis foxi. Both maximum parsimony (MP) and maximum-likelihood (ML) analyses of all these genes combined produced well-resolved trees with moderate (70-89%) to strong (90-100%) bootstrap support for most clades. MP and ML trees were very similar, with no strongly supported conflict between the two analyses. These analyses identify a clade of 12 species largely restricted to México (the "Mexican clade"), and a clade containing 15 species that collectively range from Central America to southern Canada (the "widespread clade"). These two groups are identified as sister taxa in both MP and ML analyses. A clade consisting of the ribbon snakes (T. sauritus and T. proximus) and the common garter snake (T. sirtalis) is placed as the sister group to all other Thamnophis (i.e., the Mexican + widespread clades) in our analyses. High bootstrap proportions at several levels in the tree support the inclusion of both Thamnophis validus, which has traditionally been placed in the genus Nerodia, and the poorly known species Adelophis foxi within Thamnophis. We used randomly sampled characters (i.e., standard bootstrapping) and randomly sampled contiguous blocks of characters to examine the effect of number of characters on resolution of and support for relationships within Thamnophis using MP. In general, these analyses indicate that we have reached a point of strongly diminishing returns with respect to the effect of adding mtDNA sequence characters for the current set of taxa; our sample of 3809 mtDNA characters is apparently "enough." The next steps to improve the

  12. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  13. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  14. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  15. Global phylogenetic relationships, population structure and gene flow estimation of Trialeurodes vaporariorum (Greenhouse whitefly).

    Science.gov (United States)

    Wainaina, J M; De Barro, P; Kubatko, L; Kehoe, M A; Harvey, J; Karanja, D; Boykin, L M

    2018-02-01

    Trialeurodes vaporariorum (Westwood, 1856) (Greenhouse whitefly) is an agricultural pest of global importance. It is associated with damage to plants during feeding and subsequent virus transmission. Yet, global phylogenetic relationships, population structure, and estimation of the rates of gene flow within this whitefly species remain largely unexplored. In this study, we obtained and filtered 227 GenBank records of mitochondrial cytochrome c oxidase I (mtCOI) sequences of T. vaporariorum, across various global locations to obtain a final set of 217 GenBank records. We further amplified and sequenced a ~750 bp fragment of mtCOI from an additional 31 samples collected from Kenya in 2014. Based on a total of 248 mtCOI sequences, we identified 16 haplotypes, with extensive overlap across all countries. Population structure analysis did not suggest population differentiation. Phylogenetic analysis indicated the 2014 Kenyan collection of samples clustered with a single sequence from the Netherlands to form a well-supported clade (denoted clade 1a) nested within the total set of sequences (denoted clade 1). Pairwise distances between sequences show greater sequence divergence between clades than within clades. In addition, analysis using migrate-n gave evidence for recent gene flow between the two groups. Overall, we find that T. vaporariorum forms a single large group, with evidence of further diversification consisting primarily of Kenyan sequences and one sequence from the Netherlands forming a well-supported clade.

  16. Genetic characterization of the Wyeomyia group of orthobunyaviruses and their phylogenetic relationships.

    Science.gov (United States)

    Chowdhary, Rashmi; Street, Craig; Travassos da Rosa, Amelia; Nunes, Marcio R T; Tee, Kok Keng; Hutchison, Stephen K; Vasconcelos, Pedro F C; Tesh, Robert B; Lipkin, W Ian; Briese, Thomas

    2012-05-01

    Phylogenetic analyses can give new insights into the evolutionary history of viruses, especially of viruses with segmented genomes. However, sequence information for many viral families or genera is still limited and phylogenies based on single or short genome fragments can be misleading. We report the first genetic analysis of all three genome segments of Wyeomyia group viruses Wyeomyia, Taiassui, Macaua, Sororoca, Anhembi and Cachoeira Porteira (BeAr328208) in the genus Orthobunyavirus of the family Bunyaviridae. In addition, Tucunduba and Iaco viruses were identified as members of the Wyeomyia group. Features of Wyeomyia group members that distinguish them from other viruses in the Bunyamwera serogroup and from other orthobunyaviruses, including truncated NSs sequences that may not counteract the host's interferon response, were characterized. Our findings also suggest genome reassortment within the Wyeomyia group, identifying Macaua and Tucunduba viruses as M-segment reassortants that, in the case of Tucunduba virus, may have altered pathogenicity, stressing the need for whole-genome sequence information to facilitate characterization of orthobunyaviruses and their phylogenetic relationships.

  17. Diversity and phylogenetic relationships of Wolbachia in Drosophila and other native Hawaiian insects.

    Science.gov (United States)

    Bennett, Gordon M; Pantoja, Norma A; O'Grady, Patrick M

    2012-01-01

    Wolbachia is a genus of parasitic alphaproteobacteria found in arthropods and nematodes, and represents on of the most common, widespread endosymbionts known. Wolbachia affects a variety of reproductive functions in its host (e.g., male killing, cytoplasmic incompatibility, parthenogenesis), which have the potential to dramatically impact host evolution and species formation. Here, we present the first broad-scale study to screen natural populations of native Hawaiian insects for Wolbachia, focusing on the endemic Diptera. Results indicate that Wolbachia infects native Hawaiian taxa, with alleles spanning phylogenetic supergroups, A and B. The overall frequency of Wolbachia incidene in Hawaiian insects was 14%. The incidence of infection in native Hawaiian Diptera was 11% for individuals and 12% for all species screened. Wolbachia was not detected in two large, widespread Hawaiian dipteran families-Dolichopodidae (44 spp screened) and Limoniidae (12 spp screened). Incidence of infection within endemic Hawaiian lineages that carry Wolbachia was 18% in Drosophilidae species, 25% in Caliphoridae species, > 90% in Nesophrosyne species, 20% in Drosophila dasycnemia and 100% in Nesophrosyne craterigena. Twenty unique alleles were recovered in this study, of which 18 are newly recorded. Screening of endemic populations of D. dasycnemia across Hawaii Island revealed 4 unique alleles. Phylogenetic relationships and allele diversity provide evidence for horizontal transfer of Wolbachia among Hawaiian arthropod lineages.

  18. Complete mitochondrial genomes of Teinopalpus imperialis (Lepidoptera: Papilionidae) and phylogenetic relationships analyses.

    Science.gov (United States)

    Huang, Chao-Bin; Zeng, Ju-Ping; Zhou, Shan-Yi

    2016-07-01

    In this study, we sequenced the complete mitochondrial genome of Teinopalpus imperialis, which is a national butterfly of India, and a grade-II protected species in China. The complete mtDNA from T. imperialis was 15 299 base pairs in length and contained 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and 401 bp non-coding region. The T. imperialis genes were highly similar to those of sequenced mitogenomes of other lepidopteran species in the order and orientation. Twelve PCGs (ND2, ATP8, ND3, COII, ATP6, COIII, ND4, ND4L, CytB, ND1, ND5, and ND6) start with a typical ATN codon, only the COI gene starts with CGA codon. Eight PCGs (ND2, COI, ATP8, ATP6, COIII, ND5, ND6, and Cyt B) terminate in the common stop codon TAA, three PCGs (ND4L, ND3, and ND1) terminate in the stop codon TAG, and two PCGs (COII and ND4) terminate in a single T residue. The phylogenetic relationships were reconstructed with the concatenated sequences of the 13 PCGs of the mitochondrial genome, and phylogenetic results showed that Danaidae, Satyridae, Libytheidae, Nymphalidae, Acraeidae, Pieridae, Hesperiidae, Riodinidae, and Lycaenidae are monophyletic clades.

  19. Phylogenetic relationships among turbellarian orders inferred from 18S rDNA sequences.

    Science.gov (United States)

    Katayama, T; Nishioka, M; Yamamoto, M

    1996-10-01

    The turbellarian flatworm is a key group to understand the origin and the early evolution of triploblastic, bilaterally symmetrical animals, but phylogenetic relationships among turbellarian orders have been a subject of debates for decades, especially on the position of the acoel turbellarians. Some workers have considered the acoel representing the most primitive turbellarian order but others have regarded them as regressive. We determined almost the entire lengths of the nucleotide sequences of 18S ribosomal RNA gene (rDNA) in 17 species from 9 turbellarian orders (the Acoela, Catenulida, Macrostomida, Lecithoepitheliata, Rhabdocoela, Prolecithophora, Proseriata, Tricladida, and Polycladida). After adding the sequences of a cestode, two trematodes and some diploblastic animals obtained from databases, we reconstructed phylogenetic trees using the neighbor-joining, maximum-likelihood and maximum-parsimony methods. All trees significantly indicated that the Acoela is the earliest divergent group among the turbellarian orders. The trees also suggested that the Tricladida evolved in the separate lineage from that of a cluster of the Catenulida, Macrostomida, Lecithoepitheliata, Rhabdocoela, Polycladida, Trematoda and Cestoda after the divergence of the Acoela.

  20. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  1. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  2. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms.

    Science.gov (United States)

    Ezcurra, Martín D

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is "Proterosuchia," which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic "Prolacertiformes" and "Protorosauria," in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived "disaster" clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. "Proterosuchia" is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more crownward

  3. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Directory of Open Access Journals (Sweden)

    Martín D. Ezcurra

    2016-04-01

    Full Text Available The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to

  4. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  5. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  6. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  7. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  8. Phylogenetic relationships of Mediterranean Mullidae species (Perciformes inferred from genetic and morphologic data

    Directory of Open Access Journals (Sweden)

    Cemal Turan

    2006-06-01

    Full Text Available Genetic and morphological divergence and phylogenetic relationships of four species Mullus barbatus, Mullus surmuletus, Upeneus moluccensis, Upeneus pori and one subspecies M.b. ponticus of Mullus were investigated using 12 enzymatic systems, corresponding to 17 putative loci. Eight loci (AAT-1*, AAT-2*, ADH*, GAPDH*, G6PDH*, IDHP*, PGI-2*, SOD* were found to be polymorphic in at least one species, while the remaining nine (mAAT*, CK-1*, CK-2*, G3PDH*, MDH*, ME-1*, ME-2*, PGI-1*, PGM* were monomorphic in all species. Several loci showed different electrophoretic patterns among species and thus can be used in species taxonomy as diagnostic markers. The PGM* and SOD* loci proved to be especially species-specific. Fisher’s exact test revealed overall highly significant allele frequency differences between M. barbatus and M. b. ponticus (P

  9. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... revision for this ordinal-level study, with homology assessed beyond their original formulation and across all infraorders. We found significant support for many major clades (including the Diptera, Culicomorpha, Bibionomorpha, Brachycera, Eremoneura, Cyclorrhapha, Schizophora, Calyptratae and Oestroidea...

  10. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  11. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  12. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  13. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  14. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  15. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  16. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  17. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  18. Analyses of 32 Loci Clarify Phylogenetic Relationships among Trypanosoma cruzi Lineages and Support a Single Hybridization prior to Human Contact

    Science.gov (United States)

    Flores-López, Carlos A.; Machado, Carlos A.

    2011-01-01

    Background The genetic diversity of Trypanosoma cruzi, the etiological agent of Chagas disease, has been traditionally divided in two major groups, T. cruzi I and II, corresponding to discrete typing units TcI and TcII-VI under a recently proposed nomenclature. The two major groups of T. cruzi seem to differ in important biological characteristics, and are thus thought to represent a natural division relevant for epidemiological studies and development of prophylaxis. To understand the potential connection between the different manifestations of Chagas disease and variability of T. cruzi strains, it is essential to have a correct reconstruction of the evolutionary history of T. cruzi. Methodology/Principal Findings Nucleotide sequences from 32 unlinked loci (>26 Kilobases of aligned sequence) were used to reconstruct the evolutionary history of strains representing the known genetic variability of T. cruzi. Thorough phylogenetic analyses show that the original classification of T. cruzi in two major lineages does not reflect its evolutionary history and that there is only strong evidence for one major and recent hybridization event in the history of this species. Furthermore, estimates of divergence times using Bayesian methods show that current extant lineages of T. cruzi diverged very recently, within the last 3 million years, and that the major hybridization event leading to hybrid lineages TcV and TcVI occurred less than 1 million years ago, well before the contact of T. cruzi with humans in South America. Conclusions/Significance The described phylogenetic relationships among the six major genetic subdivisions of T. cruzi should serve as guidelines for targeted epidemiological and prophylaxis studies. We suggest that it is important to reconsider conclusions from previous studies that have attempted to uncover important biological differences between the two originally defined major lineages of T. cruzi especially if those conclusions were obtained from single

  19. Ten new complete mitochondrial genomes of pulmonates (Mollusca: Gastropoda and their impact on phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    de Frias Martins António

    2011-10-01

    Full Text Available Abstract Background Reconstructing the higher relationships of pulmonate gastropods has been difficult. The use of morphology is problematic due to high homoplasy. Molecular studies have suffered from low taxon sampling. Forty-eight complete mitochondrial genomes are available for gastropods, ten of which are pulmonates. Here are presented the new complete mitochondrial genomes of the ten following species of pulmonates: Salinator rhamphidia (Amphiboloidea; Auriculinella bidentata, Myosotella myosotis, Ovatella vulcani, and Pedipes pedipes (Ellobiidae; Peronia peronii (Onchidiidae; Siphonaria gigas (Siphonariidae; Succinea putris (Stylommatophora; Trimusculus reticulatus (Trimusculidae; and Rhopalocaulis grandidieri (Veronicellidae. Also, 94 new pulmonate-specific primers across the entire mitochondrial genome are provided, which were designed for amplifying entire mitochondrial genomes through short reactions and closing gaps after shotgun sequencing. Results The structural features of the 10 new mitochondrial genomes are provided. All genomes share similar gene orders. Phylogenetic analyses were performed including the 10 new genomes and 17 genomes from Genbank (outgroups, opisthobranchs, and other pulmonates. Bayesian Inference and Maximum Likelihood analyses, based on the concatenated amino-acid sequences of the 13 protein-coding genes, produced the same topology. The pulmonates are paraphyletic and basal to the opisthobranchs that are monophyletic at the tip of the tree. Siphonaria, traditionally regarded as a basal pulmonate, is nested within opisthobranchs. Pyramidella, traditionally regarded as a basal (non-euthyneuran heterobranch, is nested within pulmonates. Several hypotheses are rejected, such as the Systellommatophora, Geophila, and Eupulmonata. The Ellobiidae is polyphyletic, but the false limpet Trimusculus reticulatus is closely related to some ellobiids. Conclusions Despite recent efforts for increasing the taxon sampling in

  20. Phylogenetic assemblage structure of North American trees is more strongly shaped by glacial–interglacial climate variability in gymnosperms than in angiosperms

    DEFF Research Database (Denmark)

    Ma, Ziyu; Sandel, Brody Steven; Svenning, Jens-Christian

    2016-01-01

    to recolonization to quantify glacial-interglacial climate variability. We found: i) Current climate is the dominant factor explaining the overall patterns, with more clustered angiosperm assemblages towards lower temperature, consistent with tropical niche conservatism. ii) Long-term climate stability...... and tropical niche conservatism. However, the role of glacial-interglacial climate variability remains to be determined, and little is known about any of these relationships for gymnosperms. Moreover, phylogenetic edemism, patterns of unique lineages in restricted ranges is also related to glacial......-interglacial climate variability and needs more attention. We used a refined phylogeny of both angiosperms and gymnosperms to map phylogenetic diversity, clustering and endemism of North American trees in 100-km grid cells, and climate change velocity since Last Glacial Maximum together with postglacial accessibility...

  1. Snake mitochondrial genomes: phylogenetic relationships and implications of extended taxon sampling for interpretations of mitogenomic evolution

    Science.gov (United States)

    2010-01-01

    Background Snake mitochondrial genomes are of great interest in understanding mitogenomic evolution because of gene duplications and rearrangements and the fast evolutionary rate of their genes compared to other vertebrates. Mitochondrial gene sequences have also played an important role in attempts to resolve the contentious phylogenetic relationships of especially the early divergences among alethinophidian snakes. Two recent innovative studies found dramatic gene- and branch-specific relative acceleration in snake protein-coding gene evolution, particularly along internal branches leading to Serpentes and Alethinophidia. It has been hypothesized that some of these rate shifts are temporally (and possibly causally) associated with control region duplication and/or major changes in ecology and anatomy. Results The near-complete mitochondrial (mt) genomes of three henophidian snakes were sequenced: Anilius scytale, Rhinophis philippinus, and Charina trivirgata. All three genomes share a duplicated control region and translocated tRNALEU, derived features found in all alethinophidian snakes studied to date. The new sequence data were aligned with mt genome data for 21 other species of snakes and used in phylogenetic analyses. Phylogenetic results agreed with many other studies in recovering several robust clades, including Colubroidea, Caenophidia, and Cylindrophiidae+Uropeltidae. Nodes within Henophidia that have been difficult to resolve robustly in previous analyses remained uncompellingly resolved here. Comparisons of relative rates of evolution of rRNA vs. protein-coding genes were conducted by estimating branch lengths across the tree. Our expanded sampling revealed dramatic acceleration along the branch leading to Typhlopidae, particularly long rRNA terminal branches within Scolecophidia, and that most of the dramatic acceleration in protein-coding gene rate along Serpentes and Alethinophidia branches occurred before Anilius diverged from other

  2. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  3. Snake mitochondrial genomes: phylogenetic relationships and implications of extended taxon sampling for interpretations of mitogenomic evolution

    Directory of Open Access Journals (Sweden)

    Gower David J

    2010-01-01

    Full Text Available Abstract Background Snake mitochondrial genomes are of great interest in understanding mitogenomic evolution because of gene duplications and rearrangements and the fast evolutionary rate of their genes compared to other vertebrates. Mitochondrial gene sequences have also played an important role in attempts to resolve the contentious phylogenetic relationships of especially the early divergences among alethinophidian snakes. Two recent innovative studies found dramatic gene- and branch-specific relative acceleration in snake protein-coding gene evolution, particularly along internal branches leading to Serpentes and Alethinophidia. It has been hypothesized that some of these rate shifts are temporally (and possibly causally associated with control region duplication and/or major changes in ecology and anatomy. Results The near-complete mitochondrial (mt genomes of three henophidian snakes were sequenced: Anilius scytale, Rhinophis philippinus, and Charina trivirgata. All three genomes share a duplicated control region and translocated tRNALEU, derived features found in all alethinophidian snakes studied to date. The new sequence data were aligned with mt genome data for 21 other species of snakes and used in phylogenetic analyses. Phylogenetic results agreed with many other studies in recovering several robust clades, including Colubroidea, Caenophidia, and Cylindrophiidae+Uropeltidae. Nodes within Henophidia that have been difficult to resolve robustly in previous analyses remained uncompellingly resolved here. Comparisons of relative rates of evolution of rRNA vs. protein-coding genes were conducted by estimating branch lengths across the tree. Our expanded sampling revealed dramatic acceleration along the branch leading to Typhlopidae, particularly long rRNA terminal branches within Scolecophidia, and that most of the dramatic acceleration in protein-coding gene rate along Serpentes and Alethinophidia branches occurred before Anilius

  4. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  5. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  6. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  7. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  8. Phylogenetic relationships of the freshwater alga Boldia erythrosiphon (Compsopogonales, Rhodophyta) based on 18S rRNA gene sequences

    NARCIS (Netherlands)

    Holton, R.W; Boele-Bos, S.A.; Stam, W.T.

    The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that

  9. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  10. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  11. Morphological variation of Telmatobius atahualpai (Anura: Telmatobiidae with comments on its phylogenetic relationships and synapomorphies for the genus

    Directory of Open Access Journals (Sweden)

    César Aguilar

    2012-06-01

    Full Text Available Telmatobius atahualpai was described on the basis of a subadult female and three juveniles. A new diagnosis and a description of the adult skeleton of specimens from two localities are provided. We also comment on synapomorphies of the genus and on possible phylogenetic relationships of T. atahualpai with other members of the genus.

  12. Phylogenetic relationships between geographically separate Phormidium cyanobacteria: is there a link between north and south polar regions?

    Czech Academy of Sciences Publication Activity Database

    Strunecký, Otakar; Elster, Josef; Komárek, Jiří

    2010-01-01

    Roč. 33, č. 10 (2010), s. 1419-1428 ISSN 0722-4060 R&D Projects: GA MŠk ME 934; GA MŠk ME 945; GA MŠk MEB080822 Institutional research plan: CEZ:AV0Z60050516 Keywords : polar regions * phylogenetic relationships * cyanobacteria Subject RIV: EF - Botanics Impact factor: 1.445, year: 2010

  13. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  14. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant- soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  15. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu. Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  16. Phylogenetic relationships and phylogeography of relevant lineages within the complex Campanulaceae family in Macaronesia.

    Science.gov (United States)

    Menezes, Tiago; Romeiras, Maria M; de Sequeira, Miguel M; Moura, Mónica

    2018-01-01

    Macaronesia has long been recognized as a natural model for studying evolutionary processes in plant diversification. Several studies have attempted to focus on single lineages, and few have covered the diversification of a family across all the archipelagos. We used a comprehensive sample to clarify the phylogenetic relationships and the biogeographic history of the Macaronesian Campanulaceae. Hypotheses related to the colonization of these archipelagos will be used to examine the diversification patterns of different lineages. We sequenced the ITS region and six cpDNA markers ( atpB , matK , petD , rbcL , trnL-F , and psbA-trnH ) from 10 Campanulaceae species, including seven endemic species in Macaronesia. The phylogeny of these taxa was reconstructed using maximum parsimony, maximum likelihood, and Bayesian inference. To study the relationships within each lineage, haplotype networks were calculated using NeighborNet and TCS algorithms. Moreover, data were combined with fossil information to construct time-calibrated trees for the Macaronesian Campanulaceae species. The phylogenetic analyses are largely congruent with current taxon circumscriptions, and all the endemic genera formed monophyletic clades, namely Azorina in Azores; Musschia in Madeira; and Campanula in Cape Verde. The Azorina clade and the Cape Verde endemic Campanula may share a common ancestor in North Africa, and the divergence was dated ca. 12.3 million years ago (Mya). The divergence of the Musschia clade began in the Pliocene ca. 3.4 Mya. Moreover, several examples of intraspecific variation were revealed among the native species with a clear geographic structured patterns, suggesting that cryptic diversity might exist within the native Macaronesian Campanulaceae when compared to the close mainland taxa (e.g., Campanula erinus , Trachelium caeruleum ), but additional studies are needed to support the molecular data. This study highlights the power of combining data (e.g., phylogeny and

  17. Phylogenetic relationships and evolution in Chrysosplenium (Saxifragaceae) based on matK sequence data.

    Science.gov (United States)

    Soltis, D E; Tago-Nakazawa, M; Xiang, Q Y; Kawano, S; Murata, J; Wakabayashi, M; Hibsch-Jetter, C

    2001-05-01

    Chrysosplenium (Saxifragaceae) consists of 57 species widely distributed in temperate and arctic regions of the Northern Hemisphere, with two species restricted to the southern part of South America. Species relationships within the genus are highly problematic. The genus has traditionally been divided into two groups, sometimes recognized as sections (Oppositifolia and Alternifolia), based on leaf arrangement, or, alternatively, into 17 series. Based on morphological features, Hara suggested that the genus originated in South America and then subsequently migrated to the Northern Hemisphere. We conducted phylogenetic analyses of DNA sequences of the chloroplast gene matK for species of Chrysosplenium to elucidate relationships, test Hara's biogeographic hypothesis for the genus, and examine chromosomal and gynoecial diversification. These analyses revealed that both sections Oppositifolia and Alternifolia are monophyletic and form two large sister clades. Hence, leaf arrangement is a good indicator of relationships within this genus. Hara's series Pilosa and Macrostemon are each also monophyletic; however, series Oppositifolia, Alternifolia, and Nepalensia are clearly not monophyletic. MacClade reconstructions suggest that the genus arose in Eastern Asia, rather than in South America, with several independent migration events from Asia to the New World. In one well-defined subclade, species from eastern and western North America form a discrete clade, with Old World species as their sister group, suggesting that the eastern and western North American taxa diverged following migration to that continent. The South American species forms a clade with species from eastern Asia; this disjunction may be the result of ancient long-distance dispersal. Character mapping demonstrated that gynoecial diversification is dynamic, with reversals from inferior to half-inferior ovaries, as well as to ovaries that appear superior. Chromosomal evolution also appears to be labile

  18. Description and phylogenetic relationships of Spumochlamys perforata n. sp. and Spumochlamys bryora n. sp. (Amoebozoa, Arcellinida).

    Science.gov (United States)

    Kudryavtsev, Alexander; Pawlowski, Jan; Hausmann, Klaus

    2009-01-01

    Spumochlamys perforata n. sp. and Spumochlamys bryora n. sp. were isolated and described from dry epiphytic moss. The morphology and ultrastructure of both species clearly demonstrate that they belong to the genus Spumochlamys (family Microchlamyiidae). They differ from its only described member, Spumochlamys iliensis (as well as from species of Microchlamys), in the relief of the dorsal surface of the test, revealed by scanning electron microscopy, which can represent a good characteristic for species identification. They also differ in the structure of the dorsal part of the test wall (especially S. perforata). Small subunit ribosomal DNA-based molecular phylogenetic analyses show that Spumochlamys is a deeply branching lineage of the Arcellinida, without any close affinities. Actin gene sequence analysis places this genus within the Tubulinea, close to two other arcellinid lineages but without forming a monophyletic group with them. These data together strongly suggest that the lack of resolution in the arcellinid molecular phylogenies is due to serious undersampling of taxa, a limited number of sequence data, and high divergence rates in most of the species.

  19. Phylogenetic relationships among seed plants: Persistent questions and the limits of molecular data.

    Science.gov (United States)

    Mathews, Sarah

    2009-01-01

    Trees inferred from DNA sequence data provide only limited insight into the phylogeny of seed plants because the living lineages (cycads, Ginkgo, conifers, gnetophytes, and angiosperms) represent fewer than half of the major lineages that have been detected in the fossil record. Nevertheless, phylogenetic trees of living seed plants inferred from sequence data can provide a test of relationships inferred in analyses that include fossils. So far, however, significant uncertainty persists because nucleotide data support several conflicting hypotheses. It is likely that improved sampling of gymnosperm diversity in nucleotide data sets will help alleviate some of the analytical issues encountered in the estimation of seed plant phylogeny, providing a more definitive test of morphological trees. Still, rigorous morphological analyses will be required to answer certain fundamental questions, such as the identity of the angiosperm sister group and the rooting of crown seed plants. Moreover, it will be important to identify approaches for incorporating insights from data that may be accurate but less likely than sequence data to generate results supported by high bootstrap values. How best to weigh evidence and distinguish among hypotheses when some types of data give high support values and others do not remains an important problem.

  20. Ovalopodium desertum n. sp. and the phylogenetic relationships of Cochliopodiidae (Amoebozoa).

    Science.gov (United States)

    Kudryavtsev, Alexander; Wylezich, Claudia; Pawlowski, Jan

    2011-10-01

    An amoeba isolated from a weakly saline semi-desert pond in Kazakhstan (Central Asia) resembles a small Cochliopodium in the light microscope, but has a dorsal fibrous cell coat without scales. Thus it can be identified morphologically as a new species of Ovalopodium Sawyer, 1980, and it is herein named O. desertum. Phylogenetic analysis of the SSU rRNA gene sequences of the new species and four Cochliopodium spp. sequenced additionally shows that Ovalopodium desertum is a sister clade to a robustly monophyletic Cochliopodium. The close relationship between Ovalopodium and Cochliopodium is also confirmed by the analysis of SSU rRNA secondary structure showing the specific helices in the region V5 in all species of both genera. Analysis of actin gene sequences fails to resolve the position of Ovalopodium but demonstrates that Parvamoeba Rogerson, 1993 is probably related to Cochliopodium. The position of Cochliopodiidae within Amoebozoa remains unresolved, despite our efforts to resolve it using broader taxonomic sampling of Amoebozoa, testing alternative tree topologies and removing the fast-evolving sites. Among sequenced genera, Parvamoeba and Endostelium Olive et al., 1984 are probable relatives to Cochliopodiidae. Molecular trees weakly support an inclusion of the family in Flabellinia (Discosea), but more phylogenomic data are necessary to test this hypothesis. Copyright © 2011 Elsevier GmbH. All rights reserved.

  1. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  2. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia

    Directory of Open Access Journals (Sweden)

    Tong Liu

    2016-10-01

    Full Text Available The greater horseshoe bat, Rhinolophus ferrumequinum, is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  3. The phylogenetic relationships of Pachyrhachis problematicus, and the evolution of limblessness in snakes (Lepidosauria, Squamata)

    Science.gov (United States)

    Zaher, Hussam; Rieppel, Olivier

    1999-12-01

    We have revisited the type material of Pachyrhachis problematicus, a fossil snake from the Cenomanian (Cretaceous) of the Middle East, and found a number of characters in need of revision with respect to its recent re-description. A new interpretation is given for several cranial characters. There is no identifiable regionalization of the presacral-vertebral column beyond that found in booid snakes. The identification of a free sacral rib in Pachyrhachis is more parsimoniously interpreted as the first lymphapophysis. It is questionable that the pelvic rudiment would have been suspended from the axial skeleton. We have also extensively reviewed the evidence that is believed to link Pachyrhachis, and with it all other snakes, to a mosasauroid ancestor. We were not able to corroborate this hypothesis, which involves characters related to the dentition, braincase morphology, and the intramandibular joint. Instead, re-analysis of the phylogenetic relationships of Pachyrhachis corroborates the hypothesis that it represents the sister-group of macrostomatan snakes, i.e., advanced snakes. Given that Pachyrhachis is nested within the hierarchy of snakes, it is entirely possible that this snake re-developed almost complete hind limbs. A less parsimonious hypothesis would be to consider the hind limbs to have been lost independently in the major basal clades of extant snakes (Scolecophidia, Anilioidea, and Macrostomata). The latter hypothesis is considered a serious possibility given the recently described findings on the mechanisms of limb development in Python, which could account for the highly variable pattern of hindlimb reduction found among basal snakes.

  4. Relationships between Substrate Promiscuity and Chiral Selectivity of Esterases from Phylogenetically and Environmentally Diverse Microorganisms

    Directory of Open Access Journals (Sweden)

    Cristina Coscolín

    2018-01-01

    Full Text Available Substrate specificity and selectivity of a biocatalyst are determined by the protein sequence and structure of its active site. Finding versatile biocatalysts acting against multiple substrates while at the same time being chiral selective is of interest for the pharmaceutical and chemical industry. However, the relationships between these two properties in natural microbial enzymes remain underexplored. Here, we performed an experimental analysis of substrate promiscuity and chiral selectivity in a set of 145 purified esterases from phylogenetically and environmentally diverse microorganisms, which were assayed against 96 diverse esters, 20 of which were enantiomers. Our results revealed a negative correlation between substrate promiscuity and chiral selectivity in the evaluated enzymes. Esterases displaying prominent substrate promiscuity and large catalytic environments are characterized by low chiral selectivity, a feature that has limited commercial value. Although a low level of substrate promiscuity does not guarantee high chiral selectivity, the probability that esterases with smaller active sites possess chiral selectivity factors of interest for industry (>25 is significantly higher than for promiscuous enzymes. Together, the present study unambiguously demonstrates that promiscuous and selective esterases appear to be rare in nature and that substrate promiscuity can be used as an indicator of the chiral selectivity level of esterases, and vice versa.

  5. New insights into relationships between active and dormant organisms, phylogenetic diversity and ecosystem productivity.

    Science.gov (United States)

    Cram, Jacob A

    2015-12-01

    Marine microbes make up a key part of ocean food webs and drive ocean chemistry through a range of metabolic processes. A fundamental question in ecology is whether the diversity of organisms in a community shapes the ecological functions of that community. While there is substantial evidence to support a positive link between diversity and ecological productivity for macro-organisms in terrestrial environments, this relationship has not previously been verified for marine microbial communities. One factor complicating the understanding of this relationship is that many marine microbes are dormant and are easily dispersed by ocean currents, making it difficult to ensure that the organisms found in a given environmental sample accurately reflect processes occurring in that environment. Another complication is that, due to microbes great range of genotypic and phenotypic variability, communities with distantly related species may have greater range of metabolic functions than communities have the same richness and evenness, but in which the species present are more closely related to each other. In this issue of Molecular Ecology, Galand et al. (2015) provide compelling evidence that the most metabolically active communities are those in which the nondormant portion of the microbial community has the highest phylogenetic diversity. They also illustrate that focusing on the active portion of the community allows for detection of temporal patterns in community structure that would not be otherwise evident. The authors' point out that the presence of many dormant organisms that do not contribute to ecosystem functioning is a feature that makes microbial ecosystems fundamentally different from macro-ecosystems and that this difference needs to be accounted for in microbial ecology theory. © 2015 John Wiley & Sons Ltd.

  6. Phylogenetic relationships of geckos of the genus Nactus and their relatives (Squamata: Gekkonidae

    Directory of Open Access Journals (Sweden)

    Todd R. Jackman

    2008-05-01

    Full Text Available We employed nuclear and mitochondrial DNA sequence data to investigate relationships within the gekkonid genus Nactus and between Nactus and other gekkonid genera. Nuclear (RAG-1, PDC and mitochondrial (ND2 data provide strong support for conflicting patterns of relationship among bisexual New Guinean species of Nactus and the unisexual oceanic form N. pelagicus. This may be explained by an ancient mitochondrial introgression event between N. sphaerodactylodes and N. vankampeni, a recent selective sweep of mitochondrial DNA throughout N. vankampeni, and gene conflict stemming from the hybrid event that gave rise to N. pelagicus. Strong support from all data partitions is obtained for the sister group relationship of Nactus to a clade consisting of the Australian Heteronotia and the Southeast Asian Dixonius. Putative synapomorphies of the Nactus/Heteronotia/Dixonius clade include the reduction of the second phalanx of digit IV of the manus and the presence of regular rows of keeled (sometimes multicarinate dorsal tubercles on the dorsum. Nactus and Heteronotia both include parthenogenetic species formed via hybridogenesis. This is rare among geckos, and vertebrates in general, and at some level may also be synapomorphic. Dixonius is not known to have any all-female species, but “D. siamensis” consists of multiple chromosome “races” that mirror morphologically cryptic, but karyotypically distinct, species in the other two genera. The strong support for the Nactus/Heteronotia/Dixonius clade demonstrates that the leaf-toed digital morphology of Dixonius has evolved multiple times within the Gekkonidae and suggests that superficial digital morphology may be misleading with respect to gekkonid suprageneric relationships.

  7. Genetic diversity and phylogenetic relationships in local cattle breeds of Senegal based on autosomal microsatellite markers.

    Science.gov (United States)

    Ndiaye, Ndèye Penda; Sow, Adama; Dayo, Guiguigbaza-Kossigan; Ndiaye, Saliou; Sawadogo, Germain Jerôme; Sembène, Mbacké

    2015-08-01

    In Senegal, uncontrolled cross-breeding of cattle breeds and changes in production systems are assumed to lead to an increase of gene flow between populations. This might constitute a relevant threat to livestock improvement. Therewith, this study was carried out to assess the current genetic diversity and the phylogenetic relationships of the four native Senegalese cattle breeds (Gobra zebu, Maure zebu, Djakoré, and N'Dama). Genomic DNA was isolated from blood samples of 120 unrelated animals collected from three agro-ecological areas of Senegal according to their phenotypic traits. Genotyping was done using 11 specific highly polymorphic microsatellite makers recommended by Food and Agriculture Organization. The basic measures of genetic variation and phylogenetic trees were computed using bioinformatics' software. A total of 115 alleles were identified with a number of alleles (Na) at one locus ranging from 6 to 16. All loci were polymorphic with a mean polymorphic information content of 0.76. The mean allelic richness (Rs) lay within the narrow range of 5.14 in N'Dama taurine to 6.10 in Gobra zebu. While, the expected heterozygosity (HE) per breed was high in general with an overall mean of 0.76±0.04. Generally, the heterozygote deficiency (FIS) of 0.073±0.026 was relatively due to inbreeding among these cattle breeds or the occurrence of population substructure. The high values of allelic and gene diversity showed that Senegalese native cattle breeds represented an important reservoir of genetic variation. The genetic distances and clustering trees concluded that the N'Dama cattle were most distinct among the investigated cattle populations. So, the principal component analyses showed qualitatively that there was an intensive genetic admixture between the Gobra zebu and Maure zebu breeds. The broad genetic diversity in Senegalese cattle breeds will allow for greater opportunities for improvement of productivity and adaptation relative to global changes. For

  8. Genetic diversity and phylogenetic relationships in local cattle breeds of Senegal based on autosomal microsatellite markers

    Directory of Open Access Journals (Sweden)

    Ndèye Penda Ndiaye

    2015-08-01

    Full Text Available Aim: In Senegal, uncontrolled cross-breeding of cattle breeds and changes in production systems are assumed to lead to an increase of gene flow between populations. This might constitute a relevant threat to livestock improvement. Therewith, this study was carried out to assess the current genetic diversity and the phylogenetic relationships of the four native Senegalese cattle breeds (Gobra zebu, Maure zebu, Djakoré, and N’Dama. Methods: Genomic DNA was isolated from blood samples of 120 unrelated animals collected from three agro-ecological areas of Senegal according to their phenotypic traits. Genotyping was done using 11 specific highly polymorphic microsatellite makers recommended by Food and Agriculture Organization. The basic measures of genetic variation and phylogenetic trees were computed using bioinformatics’ software. Results: A total of 115 alleles were identified with a number of alleles (Na at one locus ranging from 6 to 16. All loci were polymorphic with a mean polymorphic information content of 0.76. The mean allelic richness (Rs lay within the narrow range of 5.14 in N’Dama taurine to 6.10 in Gobra zebu. While, the expected heterozygosity (HE per breed was high in general with an overall mean of 0.76±0.04. Generally, the heterozygote deficiency (FIS of 0.073±0.026 was relatively due to inbreeding among these cattle breeds or the occurrence of population substructure. The high values of allelic and gene diversity showed that Senegalese native cattle breeds represented an important reservoir of genetic variation. The genetic distances and clustering trees concluded that the N’Dama cattle were most distinct among the investigated cattle populations. So, the principal component analyses showed qualitatively that there was an intensive genetic admixture between the Gobra zebu and Maure zebu breeds. Conclusions: The broad genetic diversity in Senegalese cattle breeds will allow for greater opportunities for improvement of

  9. Remarkable teleostean fishes from the Late Jurassic of southern Germany and their phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    G. Arratia

    2000-01-01

    Full Text Available Complete descriptions, as preservation permits, are provided for new Late Jurassic taxa (e.g., †Ascalabothrissops voelkli n. gen. and n. sp., †Anaethalion zapporum n. sp., and †Elopsomolos frickhingeri n. gen. and n. sp.; the phylogenetic positions of these taxa are given, as well as an evaluation of the European teleosts during the Late Jurassic. The relationships among certain fossil and extant teleosts are evaluated based on 191 unweighted morphological characters by using cladistic principles. The results suggest that †Ascalabothrissops n. gen. from the Kimmeridgian of Schamhaupten is the sister-taxon of †Pachythrissops from the Tithonian of Bavaria, and consequently is an ichthyodectiform. †Anaethalion zapporum n. sp., an elopiform, stands in an unresolved polytomy with †A. angustus, †A. knorri, and a clade formed by †A. angustissimus and more advanced elopiforms. The new results confirm Arratia (1997 that †Anaethalion, as presently understood, is a paraphyletic taxon. †Elopsomolos frickhingeri n. gen. and n. sp. forms a polytomy with †Elopsomolos sp. 1 and 3, and [Elops + Megalops]. Monophyly of the Kimmeridgian and Tithonian genus †Elopsomolos is not certain. Following the new phylogenetic hypothesis, that includes new taxa and new characters, the elopomorphs stand as the primitive sister-group of osteoglossomorphs and more advanced teleosts. The new information does not affect the phylogenetic position of the main extant teleostean clades and confirms previous results by Arratia (1991, 1996, 1997, 1999. The analysis of the elopiforms through time shows that the group had an important radiation during the Late Jurassic, to be replaced by new genera and species during the Cretaceous, and again during the Cenozoic. From numerous genera living in the past, elopiforms are represented now by two genera, Elops and Megalops. Soweit es die Erhaltung zulässt, werden vollständige Beschreibungen der drei neuen sp

  10. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  11. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  12. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  13. Enhancing Homeland Security Efforts by Building Strong Relationships between the Muslim Community and Local Law Enforcement

    National Research Council Canada - National Science Library

    Jensen, Dennis L

    2006-01-01

    ... to follow up on the incident and to prevent future attacks. It is undeniable that building a strong relationship between the local police and the Muslim community is essential in defending America against acts of terrorism...

  14. The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres)

    Science.gov (United States)

    Worthy, Trevor H.; Degrange, Federico J.; Handley, Warren D.; Lee, Michael S. Y.

    2017-10-01

    The extinct dromornithids, gastornithids and phorusrhacids are among the most spectacular birds to have ever lived, with some giants exceeding 500 kg. The affinities and evolution of these and other related extinct birds remain contentious, with previous phylogenetic analyses being affected by widespread convergence and limited taxon sampling. We address these problems using both parsimony and tip-dated Bayesian approaches on an expansive taxon set that includes all key extinct flightless and flighted (e.g. Vegavis and lithornithids) forms, an extensive array of extant fowl (Galloanseres), representative Neoaves and palaeognaths. The Paleogene volant Lithornithidae are recovered as stem palaeognaths in the Bayesian analyses. The Galloanseres comprise four clades inferred to have diverged in the Late Cretaceous on Gondwana. In addition to Anseriformes and Galliformes, we recognize a robust new clade (Gastornithiformes) for the giant flightless Dromornithidae (Australia) and Gastornithidae (Eurasia, North America). This clade exhibits parallels to ratite palaeognaths in that flight presumably was lost and giant size attained multiple times. A fourth clade is represented by the Cretaceous Vegavis (Antarctica), which was strongly excluded from Anseriformes; thus, a crucial molecular calibration point needs to be reconsidered. The presbyornithids Wilaru (Australia) and Presbyornis (Northern Hemisphere) are robustly found to be the sister group to Anatoidea (Anseranatidae + Anatidae), a relatively more basal position than hitherto recognized. South America's largest bird, Brontornis, is not a galloansere, but a member of Neoaves related to Cariamiformes; therefore, giant Galloanseres remain unknown from this continent. Trait analyses showed that while gigantism and flightlessness evolved repeatedly in groups, diet is constrained by phylogeny: all giant Galloanseres and palaeognaths are herbivores or mainly herbivorous, and giant neoavians are zoophagous or omnivorous.

  15. Examining phylogenetic relationships of Erwinia and Pantoea species using whole genome sequence data.

    Science.gov (United States)

    Zhang, Yucheng; Qiu, Sai

    2015-11-01

    The genera Erwinia and Pantoea contain species that are devastating plant pathogens, non-pathogen epiphytes, and opportunistic human pathogens. However, some controversies persist in the taxonomic classification of these two closely related genera. The phylogenomic analysis of these two genera was investigated via a comprehensive analysis of 25 Erwinia genomes and 23 Pantoea genomes. Single-copy orthologs could be extracted from the Erwinia/Pantoea core-genome to reconstruct the Erwinia/Pantoea phylogeny. This tree has strong bootstrap support for almost all branches. We also estimated the in silico DNA-DNA hybridization (isDDH) and the average nucleotide identity (ANI) values between each genome; strains from the same species showed ANI values ≥96% and isDDH values >70%. These data confirm that whole genome sequence data provides a powerful tool to resolve the complex taxonomic questions of Erwinia/Pantoea, e.g. Pantoea agglomerans 299R was not clustered into a single group with other P. agglomerans strains, and the ANI values and isDDH values between them were agglomerans 299R should not be classified into the P. agglomerans species. In addition, another strain (Pantoea sp. At_9b) was identified that may represent a novel Pantoea species. We also evaluated the performance of six commonly used housekeeping genes (atpD, carA, gyrB, infB, recA, and rpoB) in phylogenetic inference. A single gene was not enough to obtain a reliable species tree, and it was necessary to use the multilocus sequence analysis of the six marker genes to recover the Erwinia/Pantoea phylogeny.

  16. Phylogenetic relationships of the Australian Oligo-Miocene ratite Emuarius gidju Casuariidae.

    Science.gov (United States)

    Worthy, Trevor H; Hand, Suzanne J; Archer, Michael

    2014-03-01

    In Australia, ratites (Aves: Palaeognathae) are represented in the extant fauna by the family Casuariidae with 1 species of emu Dromaius novaehollandiae and 1 cassowary Casuarius casuarius. The Australian fossil record reveals no other extinct ratite families but there are a number of other casuariid species. Most significant of these, due to its Oligo-Miocene age and because it is known from abundant material, is Emuarius gidju. Here, we describe additional material and confirm that the taxon had a temporal range of Late Oligocene to Middle Miocene (approximately 24-15 Ma). We reveal new morphological details, including notably that the species had relatively much smaller eyes than D. novaehollandiae, in addition to a less well-developed cursorial ability, as inferred from its pelvic limb. In these respects, Emuarius is similar to Casuarius and suggest that it was adapted to denser vegetation than the open woodlands and grasslands that characterise much of Australia today and to which D. novaehollandiae, with its large eyes and enhanced cursorial ability, is strongly adapted. Emuarius was compared to and found to be distinct from the poorly provenanced Australian fossil species C. lydekkeri. We conducted a phylogenetic analysis of morphological data that robustly shows that E. gidju is the sister taxon of Dromaius and together these taxa form a clade that is sister to Casuarius. This indicates that the evolution towards enhanced cursorality that characterises Dromaius took place after the divergence of the emu-cassowary lineages and was likely not the driving mechanism of this divergence. Comparisons between D. novaehollandiae and D. baudinianus revealed no qualitative skeletal differences and we suggest that the latter taxon is best considered to be an island dwarf that should be taxonomically recognized at a subspecific level only. © 2013 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty

  17. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  18. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  19. Phylogenetic relationships, virulence factors and Rep-PCR epidemiological analysis of E. coli from human sources

    Directory of Open Access Journals (Sweden)

    Simona Caroppo

    2010-06-01

    Full Text Available The potential of Escherichia coli to cause of extra-intestinal infections was studied on a group of 94 clinical isolates. In this work, 32 E. coli isolates from urinary tract infections, 25 from bacteraemia, 12 from low respiratory tract infections, and 25 from the normal commensal flora were characterized for the phylogenetic type, the virulence factors (VFs carriage and the Rep-PCR clonal composition.The B2 phylogenetic type was predominant among the urinary isolates (59%, the B2 and D strains among the haematic isolates (32% and 32%.The A phylogenetic type was predominant among the commensal and the respiratory isolates (52% and 58% respectively.The distribution of the B2 type strains among the urinary isolates and of the D type strains among the faecal isolates was suggesting a urinary-origin for the B2 phylogenetic type isolates found in the blood and a direct faecal derivation for the haematic isolates with D phylogenetic type.Twenty-nine VFs were analyzed.The B2 and D type strains carried a higher burden of VFs than the A and B1 phylogenetic type strains (average of VFs/strain = 8 vs 3. Some of the VFs were homogeneously distributed among the phylogenetic types (fimH, iutA, fyuA, traT. The PAI, papGII, ibeA, KpsMTIII were exclusive of B2 and D phylogenetic type strains, while sfa/foc, focG, cnf1, hlyA and rfc were exclusively observed among the B2 type strains.The clustering analysis by Rep-PCR distinguished two groups of strains, the first including 96.77% of B2 and D type strains, while the second encompassing 91,5% of A and B1 type strains.

  20. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes.

    Science.gov (United States)

    Jensen, Anders; Kilian, Mogens

    2012-01-01

    The taxonomic status and structure of Streptococcus dysgalactiae have been the object of much confusion. Bacteria belonging to this species are usually referred to as Lancefield group C or group G streptococci in clinical settings in spite of the fact that these terms lack precision and prevent recognition of the exact clinical relevance of these bacteria. The purpose of this study was to develop an improved basis for delineation and identification of the individual species of the pyogenic group of streptococci in the clinical microbiology laboratory, with a special focus on S. dysgalactiae. We critically reexamined the genetic relationships of the species S. dysgalactiae, Streptococcus pyogenes, Streptococcus canis, and Streptococcus equi, which may share Lancefield group antigens, by phylogenetic reconstruction based on multilocus sequence analysis (MLSA) and 16S rRNA gene sequences and by emm typing combined with phenotypic characterization. Analysis of concatenated sequences of seven genes previously used for examination of viridans streptococci distinguished robust and coherent clusters. S. dysgalactiae consists of two separate clusters consistent with the two recognized subspecies dysgalactiae and equisimilis. Both taxa share alleles with S. pyogenes in several housekeeping genes, which invalidates identification based on single-locus sequencing. S. dysgalactiae, S. canis, and S. pyogenes constitute a closely related branch within the genus Streptococcus indicative of recent descent from a common ancestor, while S. equi is highly divergent from other species of the pyogenic group streptococci. The results provide an improved basis for identification of clinically important pyogenic group streptococci and explain the overlapping spectrum of infections caused by the species associated with humans.

  2. Delineation of Streptococcus dysgalactiae, Its Subspecies, and Its Clinical and Phylogenetic Relationship to Streptococcus pyogenes

    Science.gov (United States)

    Jensen, Anders

    2012-01-01

    The taxonomic status and structure of Streptococcus dysgalactiae have been the object of much confusion. Bacteria belonging to this species are usually referred to as Lancefield group C or group G streptococci in clinical settings in spite of the fact that these terms lack precision and prevent recognition of the exact clinical relevance of these bacteria. The purpose of this study was to develop an improved basis for delineation and identification of the individual species of the pyogenic group of streptococci in the clinical microbiology laboratory, with a special focus on S. dysgalactiae. We critically reexamined the genetic relationships of the species S. dysgalactiae, Streptococcus pyogenes, Streptococcus canis, and Streptococcus equi, which may share Lancefield group antigens, by phylogenetic reconstruction based on multilocus sequence analysis (MLSA) and 16S rRNA gene sequences and by emm typing combined with phenotypic characterization. Analysis of concatenated sequences of seven genes previously used for examination of viridans streptococci distinguished robust and coherent clusters. S. dysgalactiae consists of two separate clusters consistent with the two recognized subspecies dysgalactiae and equisimilis. Both taxa share alleles with S. pyogenes in several housekeeping genes, which invalidates identification based on single-locus sequencing. S. dysgalactiae, S. canis, and S. pyogenes constitute a closely related branch within the genus Streptococcus indicative of recent descent from a common ancestor, while S. equi is highly divergent from other species of the pyogenic group streptococci. The results provide an improved basis for identification of clinically important pyogenic group streptococci and explain the overlapping spectrum of infections caused by the species associated with humans. PMID:22075580

  3. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae).

    Science.gov (United States)

    Krak, K; Caklová, P; Chrtek, J; Fehrer, J

    2013-02-01

    Phylogeny reconstruction based on multiple unlinked markers is often hampered by incongruent gene trees, especially in closely related species complexes with high degrees of hybridization and polyploidy. To investigate the particular strengths and limitations of chloroplast DNA (cpDNA), low-copy nuclear and multicopy nuclear markers for elucidating the evolutionary history of such groups, we focus on Hieracium s.str., a predominantly apomictic genus combining the above-mentioned features. Sequences of the trnV-ndhC and trnT-trnL intergenic spacers were combined for phylogenetic analyses of cpDNA. Part of the highly variable gene for squalene synthase (sqs) was applied as a low-copy nuclear marker. Both gene trees were compared with previous results based on the multicopy external transcribed spacer (ETS) of the nuclear ribosomal DNA. The power of the different markers to detect hybridization varied, but they largely agreed on particular hybrid and allopolyploid origins. The same crown groups of species were recognizable in each dataset, but basal relationships were strongly incongruent among cpDNA, sqs and ETS trees. The ETS tree was considered as the best approximation of the species tree. Both cpDNA and sqs trees showed basal polytomies as well as merging or splitting of species groups of non-hybrid taxa. These patterns can be best explained by a rapid diversification of the genus with ancestral polymorphism and incomplete lineage sorting. A hypothetical scenario of Hieracium speciation based on all available (including non-molecular) evidence is depicted. Incorporation of seemingly contradictory information helped to better understand species origins and evolutionary patterns in this notoriously difficult agamic complex.

  4. Phylogenetic relationships of Mesoamerican spider monkeys (Ateles geoffroyi): Molecular evidence suggests the need for a revised taxonomy.

    Science.gov (United States)

    Morales-Jimenez, Alba Lucia; Cortés-Ortiz, Liliana; Di Fiore, Anthony

    2015-01-01

    Mesoamerican spider monkeys (Ateles geoffroyi sensu lato) are widely distributed from Mexico to northern Colombia. This group of primates includes many allopatric forms with morphologically distinct pelage color and patterning, but its taxonomy and phylogenetic history are poorly understood. We explored the genetic relationships among the different forms of Mesoamerican spider monkeys using mtDNA sequence data, and we offer a new hypothesis for the evolutionary history of the group. We collected up to ∼800 bp of DNA sequence data from hypervariable region 1 (HV1) of the control region, or D-loop, of the mitochondrion for multiple putative subspecies of Ateles geoffroyi sensu lato. Both maximum likelihood and Bayesian reconstructions, using Ateles paniscus as an outgroup, showed that (1) A. fusciceps and A. geoffroyi form two different monophyletic groups and (2) currently recognized subspecies of A. geoffroyi are not monophyletic. Within A. geoffroyi, our phylogenetic analysis revealed little concordance between any of the classifications proposed for this taxon and their phylogenetic relationships, therefore a new classification is needed for this group. Several possible clades with recent divergence times (1.7-0.8 Ma) were identified within Ateles geoffroyi sensu lato. Some previously recognized taxa were not separated by our data (e.g., A. g. vellerosus and A. g. yucatanensis), while one distinct clade had never been described as a different evolutionary unit based on pelage or geography (Ateles geoffroyi ssp. indet. from El Salvador). Based on well-supported phylogenetic relationships, our results challenge previous taxonomic arrangements for Mesoamerican spider monkeys. We suggest a revised arrangement based on our data and call for a thorough taxonomic revision of this group. Copyright © 2014. Published by Elsevier Inc.

  5. Suprafamilial relationships among Rodentia and the phylogenetic effect of removing fast-evolving nucleotides in mitochondrial, exon and intron fragments

    Directory of Open Access Journals (Sweden)

    Arnal Véronique

    2008-11-01

    Full Text Available Abstract Background The number of rodent clades identified above the family level is contentious, and to date, no consensus has been reached on the basal evolutionary relationships among all rodent families. Rodent suprafamilial phylogenetic relationships are investigated in the present study using ~7600 nucleotide characters derived from two mitochondrial genes (Cytochrome b and 12S rRNA, two nuclear exons (IRBP and vWF and four nuclear introns (MGF, PRKC, SPTBN, THY. Because increasing the number of nucleotides does not necessarily increase phylogenetic signal (especially if the data is saturated, we assess the potential impact of saturation for each dataset by removing the fastest-evolving positions that have been recognized as sources of inconsistencies in phylogenetics. Results Taxonomic sampling included multiple representatives of all five rodent suborders described. Fast-evolving positions for each dataset were identified individually using a discrete gamma rate category and sites belonging to the most rapidly evolving eighth gamma category were removed. Phylogenetic tree reconstructions were performed on individual and combined datasets using Parsimony, Bayesian, and partitioned Maximum Likelihood criteria. Removal of fast-evolving positions enhanced the phylogenetic signal to noise ratio but the improvement in resolution was not consistent across different data types. The results suggested that elimination of fastest sites only improved the support for nodes moderately affected by homoplasy (the deepest nodes for introns and more recent nodes for exons and mitochondrial genes. Conclusion The present study based on eight DNA fragments supports a fully resolved higher level rodent phylogeny with moderate to significant nodal support. Two inter-suprafamilial associations emerged. The first comprised a monophyletic assemblage containing the Anomaluromorpha (Anomaluridae + Pedetidae + Myomorpha (Muridae + Dipodidae as sister clade to the

  6. Intragenomic variation in the ITS rDNA region obscures phylogenetic relationships and inflates estimates of operational taxonomic units in genus Laetiporus

    Science.gov (United States)

    Daniel L. Lindner; Mark T. Banik

    2011-01-01

    Regions of rDNA are commonly used to infer phylogenetic relationships among fungal species and as DNA barcodes for identification. These regions occur in large tandem arrays, and concerted evolution is believed to reduce intragenomic variation among copies within these arrays, although some variation still might exist. Phylogenetic studies typically use consensus...

  7. Cyphocoleus Chaudoir (Coleoptera, Carabidae, Odacanthini: descriptive taxonomy, phylogenetic relationships, and the Cenozoic history of New Caledonia

    Directory of Open Access Journals (Sweden)

    James Liebherr

    2016-11-01

    Full Text Available The precinctive New Caledonian genus Cyphocoleus Chaudoir is revised with 22 species recognized, 12 newly described: C. lissus sp. n., C. prolixus sp. n., C. parovicollis sp. n., C. burwelli sp. n., C. angustatus sp. n., C. monteithi sp. n., C. fasciatus sp. n., C. lescheni Liebherr & Will, sp. n., C. cordatus sp. n., C. bourailensis sp. n., C. subulatus sp. n., and C. iledespinsensis sp. n. Atongolium Park & Will is found to be a junior synonym of Cyphocoleus, with its two species recombined as C. mirabilis comb. n. and C. moorei comb. n. Results of a survey of Harpalinae Bonelli place Cyphocoleus as a member of Odacanthini based on synapomorphies of the eighth abdominal tergite and the female spermathecal assembly. Cyphocoleus shares with five other generic-level taxa – Homethes Newman, Aeolodermus Andrewes, Stenocheila Laporte, Quammenis Erwin and Diplacanthogaster Liebke – a single-segmented maxillary galea that is appressed to the outer margin of the maxillary lacinia. These six generic-level taxa are newly classified as members of subtribe Homethina subtrib. n. (type genus Homethes. Cladistic analysis including 79 taxa and utilizing 119 morphological characters supports division of Odacanthini into four monophyletic subtribes: 1, Actenonycina (Actenonyx White; 2, Homethina; 3, Pentagonicina (Pentagonica Dana, Parascopodes Darlington, Scopodes Erichson; and 4, Odacanthina (24 genera in this analysis monophyletically defined by Lasiocera Dejean and its adelphotaxon. These subtribes are phylogenetically arranged as: (Actenonycina (Homethina (Pentagonicina + Odacanthina. Area relationships defined within Homethina – (New Caledonia (Australia (South America + Central America – support the origin of New Caledonian Cyphocoleus prior to amphiantarctic vicariance between South America and Australia. Consistent with previous molecular dating of 100–105 Ma for the origin of Odacanthini, a general vicariance-based hypothesis proposes that

  8. Relationship between virulence factors, resistance to antibiotics and phylogenetic groups of uropathogenic Escherichia coli in two locations in Mexico.

    Science.gov (United States)

    Miranda-Estrada, Laura Iveth; Ruíz-Rosas, María; Molina-López, José; Parra-Rojas, Isela; González-Villalobos, Edgar; Castro-Alarcón, Natividad

    Escherichia coli is the major causative agent of urinary tract infections (UTI), and virulence factors are responsible for the severity of these emerging infections. The aim of this study was to evaluate the relationship between virulence determinants and antibiotic susceptibility with phylogenetic groups of E.coli isolates of UTI in two locations in Mexico. An analysis was performed on 50 isolates of E.coli from the centre of the country and 57 from a town in the southwest. The isolates were characterized by phenotype (serotyping assays, in vitro adhesion, biofilm formation, production of haemolysin, and antibiotic susceptibility) and genotype (phylogenetic groups and virulence genes). In the centre of the country location the phylogenetic group B2 (60%) and F (12%) were significantly more prevalent and had a higher frequency of genes, fimH (96%), iutA (66%), sat (36%), compared to the southwest location, where the group A (35%) and B1 (21%) were significantly predominant and had fewer virulence genes. About one-fifth (21.5%) of all isolates belonged to the O25-ST131 group. Haemolysin and biofilm producing strains were significantly higher in the southwest location. Resistance to ampicillin (92.5%), tetracycline (76.6%), and trimethoprim/sulfamethoxazole (70.1%) were the most common in both groups. The phylogenetic group, virulence factors, and antibiotic susceptibility of the E.coli that causes UTI in the community, varies significantly among the Mexican populations studied. Phylogenetic groups A and B1 may be multidrug resistant and have the ability to produce UTI. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  9. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  10. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  11. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  12. Strong but diverging clonality - climate relationships of different plant clades explain weak overall pattern across China

    Science.gov (United States)

    Ye, Duo; Liu, Guofang; Song, Yao-Bin; Cornwell, William K.; Dong, Ming; Cornelissen, Johannes H. C.

    2016-06-01

    The clonal strategy should be relatively important in stressful environments (i.e. of low resource availability or harsh climate), e.g. in cold habitats. However, our understanding of the distribution pattern of clonality along environmental gradients is still far from universal. The weakness and inconsistency of overall clonality-climate relationships across taxa, as reported in previous studies, may be due to different phylogenetic lineages having fundamental differences in functional traits other than clonality determining their climate response. Thus, in this study we compared the clonality-climate relationships along a latitudinal gradient within and between different lineages at several taxonomic levels, including four major angiosperm lineages (Magnoliidae, Monocotyledoneae, Superrosidae and Superasteridae), orders and families. To this aim we used a species clonality dataset for 4015 vascular plant species in 545 terrestrial communities across China. Our results revealed clear predictive patterns of clonality proportion in relation to environmental gradients for the predominant representatives of each of the taxonomic levels above, but the relationships differed in shape and strength between the 4 major angiosperm lineages, between the 12 orders and between the 12 families. These different relationships canceled out one another when all lineages at a certain taxonomic level were pooled. Our findings highlight the importance of explicitly accounting for the functional or taxonomic scale for studying variation in plant ecological strategy across environmental gradients.

  13. Resolving phylogenetic signal from noise when divergence is rapid: a new look at the old problem of echinoderm class relationships.

    Science.gov (United States)

    Pisani, Davide; Feuda, Roberto; Peterson, Kevin J; Smith, Andrew B

    2012-01-01

    Resolving evolutionary relationships in groups that underwent fast radiation in deep time is a problem for molecular phylogeny, as the scant phylogenetic signal that characterises short internal branches is generally swamped by more recent substitutions. We implement an approach, that maps how the support for rival phylogenies changes when analysing subsets of sites with either faster and more heterogeneous rates or slower and more homogeneous rates, to address a long-standing problem in deuterostome phylogeny - the interrelationships of the eleutherozoan echinoderm classes. We show that miRNA genes are phylogenetically uninformative as to the relationships of asteroids, echinoids and ophiuroids, consistent with a rapid radiation of these groups as suggested by their fossil record. Using three nuclear rRNAs and seven nuclear housekeeping genes, we map the support for the three possible phylogenetic arrangements of asteroids, ophiuroids and echinoids when moving between subsets of the data with very similar or very different rates of evolution. Only one of the three possible topologies (asteroids (ophiuroids+echinoids)) strengthens when the most rate-homogeneous subset of data are analysed. The other two possible pairings become stronger in a less reliable data subset, which includes the fastest and thus homoplasy-rich data in our alignment. Thus, while superficial analysis of our concatenated alignment identifies asteroids and ophiuroids as sister taxa, more thorough analyses suggest that ophiuroids may be more closely related to echinoids. Divergence of these echinoderm groups, using a relaxed molecular clock, is estimated to have occurred within ≈ 5 million years. Our results illustrate that the analytic approach of phylogenetic signal dissection can be a powerful tool to investigate rapid radiations in deep geologic time. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Quantitative analysis of species specificity of two anti-parvalbumin antibodies for detecting southern hemisphere fish species demonstrating strong phylogenetic association.

    Science.gov (United States)

    Liang, Ji; Tan, Chui Choo; Taylor, Steve L; Baumert, Joseph L; Lopata, Andreas L; Lee, N Alice

    2017-12-15

    This study aimed to develop a novel approach to determine the correlation between the parvalbumin (PAV) contents and their corresponding immunoreactivity (detectability) in southern hemisphere fish species. The immuno-detected PAV contents of the test fish species were estimated by a quantitative SDS-PAGE. A quantitative Enzyme-Linked ImmunoSorbent Assay (ELISA) was formatted to assess relative immunoreactivity of PAV. Sixteen species (forty-three percent) displayed a positive correlation with the anti-cod PAV polyclonal antibody, but no correlation with the anti-carp PAV monoclonal antibody. There was a strong phylogenetic association of the PAV immunoreactivity. Species from the order of Perciformes showed strong binding with both antibodies; whereas species from Salmoniformes, Ophidiiformes, Scombriformes, Scorpaeniformes, and Tetraodontiformes showed weak or no binding. This approach showed for the first time a statistical correlation between the PAV content and the immunoreactivity and allowed to rank the relative species/order specificity of the two antibodies for the southern hemisphere fish PAV. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Phylogenetic relationships of the brown algal orders Ectocarpales, Chordariales, Dictyosiphonales, and Tilopteridales (Phaeophyceae) based on RUBISCO large subunit and spacer sequences

    NARCIS (Netherlands)

    Siemer, BL; Stam, WT; Olsen, JL; Pedersen, Poul M.

    1998-01-01

    Phylogenetic relationships among 23 species of morphologically simple brown algae belonging to the Ectocarpales sensu stricto, Chordariales, Dictyosiphonales, and Tilopteridales sensu stricto, Phaeophyceae (Fucophyceae), were analyzed using chloroplast-encoded RUBISCO large subunit gene sequences

  16. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......, several nuclei, vacuoles of varying density distributed through-out the cell, and mitochondria with tubular cristae. The cell wall of I. hoferi contains chitin....

  17. 45S rDNA external transcribed spacer organization reveals new phylogenetic relationships in Avena genus.

    Science.gov (United States)

    Rodrigues, Joana; Viegas, Wanda; Silva, Manuela

    2017-01-01

    The genus Avena comprises four distinct genomes organized in diploid (AA or CC), tetraploid (AABB or AACC) and hexaploid species (AACCDD), constituting an interesting model for phylogenetic analysis. The aim of this work was to characterize 45S rDNA intergenic spacer (IGS) variability in distinct species representative of Avena genome diversity-A. strigosa (AA), A. ventricosa (CvCv), A. eriantha (CpCp), A. barbata (AABB), A. murphyi (AACC), A. sativa (AACCDD) and A. sterilis (AACCDD) through the assessment of the 5' external transcribed spacer (5'-ETS), a promising IGS region for phylogenetic studies poorly studied in Avena genus. In this work, IGS length polymorphisms were detected mainly due to distinct 5'-ETS sequence types resulting from major differences in the number and organization of repeated motifs. Although species with A genome revealed a 5'-ETS organization (A-organization) similar to the one previously described in A. sativa, a distinct organization was unraveled in C genome diploid species (C-organization). Interestingly, such new organization presents a higher similarity with other Poaceae species than A-genome sequences, supporting the hypothesis of C-genome being the ancestral Avena genome. Additionally, polyploid species with both genomes mainly retain the A-genome 5'-ETS organization, confirming the preferential elimination of C-genome sequences in Avena polyploid species. Moreover, 5'-ETS sequences phylogenetic analysis consistently clustered the species studied according to ploidy and genomic constitution supporting the use of ribosomal genes to highlight Avena species evolutive pathways.

  18. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  19. Utility of mtDNA-COI Barcode Region for Phylogenetic Relationship and Diagnosis of Five Common Pest Cockroaches

    Directory of Open Access Journals (Sweden)

    Saedeh Sadat Hashemi-Aghdam

    2017-06-01

    Full Text Available Background: Cockroaches are of vital importance medically and hygienically as they can disperse human patho­genic agents and are especially responsible for food contamination and spreading of food borne pathogens. In this study, part of mtDNA-COI gene of five common pest cockroaches was tested for diagnostic and phylogenetic pur­poses.Methods: We have described barcode region of mtDNA-COI gene of five cockroach species: Blattella germanica, Blatta orientalis, Periplaneta americana, Shelfordella lateralis, and Supella longipalpa, along with the development of a PCR-RFLP method for rapid detection and differentiation of these health pest species.Results: The PCR generates a single 710 bp-sized amplicon in all cockroach specimens, followed by direct se­quencing. AluI predicted from the sequencing data provided different RFLP profiles among five species. There was a significant intra-species variation within the American cockroach populations, but no genetic variation within other species. Accordingly, phylogenetic analysis demonstrates common monophyly for cockroach families in agreement with conventional taxonomy. However S. longipalpa (Ectobiidae diverged as an early ancestor of other cockroaches and was not associated with other Ectobiidae.Conclusion: The PCR-RFLP protocol might be useful when the conventional taxonomic methods are not able to identify specimens, particularly when only small body parts of specimens are available or they are in a decaying condition. mtDNA-COI gene shows potentially useful for studying phylogenetic relationships of Blattodea order.

  20. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  1. Relationship Between Personality Types on the Strong-Campbell and Myers-Briggs Instruments.

    Science.gov (United States)

    Dillon, Michael; Weissman, Shel

    1987-01-01

    Examined relationship between Holland's personality types as measured by the Strong-Campbell Interest Inventory and Jung's personality types as measured by the Myers-Briggs Type Indicator. College students' (N=394) responses to the two instruments revealed significant associations between certain types based on interests and preferences.…

  2. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  3. Phylogenetic relationships of HTLV-I/STLV-I in the world.

    Science.gov (United States)

    Yamashita, M; Miura, T; Ibuki, K; Takehisa, J; Chen, J; Ido, E; Hayami, M

    1997-04-01

    In an effort to delineate the origin and evolution of HTLV-I/STLV-I, we have been conducting phylogenetic analyses on LTR sequences of this virus group. HTLV-I isolates newly analyzed in the present study were from Iran, South Africa, Cameroon, Sakhalin and Brazil where little is known concerning the genetic features of HTLV-I. In addition, STLV-I isolates were obtained from non-human primates in Africa and Asia including an isolate from orangutans in Indonesia. Proviral LTR sequences were amplified by nested PCR, and then sequenced. Phylogenetic trees were constructed by the neighbor joining method. The results obtained are: 1) African STLV-I isolates formed one large cluster together with the Central African group of HTLV-I in the tree; 2) Asian STLV-I isolates including that of an orangutan in Indonesia were highly divergent from African STLV-I and the Cosmopolitan group of HTLV-I, but not so closely related to each other and to the Melanesian group of HTLV-I; 3) An HTLV-I isolate of Cameroon Pygmy was related to African STLV-I isolates, but distinct from the Central African group of HTLV-I; 4) The majority of HTLV-I isolates belonged to subgroup A which is the most widespread subgroup of the Cosmopolitan group of HTLV-I, while some Brazilian isolates from descendants of Japanese immigrants belonged to subgroup B which mainly consists of HTLV-I isolates from Japan. 5) In the phylogenetic tree, several HTLV-I isolates of subgroup A from the same areas appear to form monophyletic clusters such as a subcluster of Brazilian and Colombian isolates and that of Iranian isolates.

  4. Phylogenetic relationship of ribosomal ITS2 and mitochondrial COI among diploid and triploid Paragonimus westermani isolates

    Science.gov (United States)

    Im, Kyung-Il; Yong, Tai-Soon

    2003-01-01

    We compared patterns of intraspecific polymorphism of two markers with contrasting modes of evolution, nuclear ribosomal DNA (rDNA) and mitochondrial DNA (mtDNA), in the lung fluke, diploid and triploid Paragonimus westermani from three geographical regions of Korea. The genetic distances between three populations of Korean diploid and triploid P. westermani showed no significant difference in the nucleotide sequences of the mitochondrial cytochrome c oxidase subunit I (mtCOI) and ribosomaal second internal transcribed spacer (ITS2) genes. A highly resolved strict-consensus tree was obtained that illustrated phylogenetically useful information of the ITS2 and mtCOI sequences from diploid and triploid P. westermani. PMID:12666730

  5. Biochemical identification and phylogenetic relationships in free-living amoebas of the genus Naegleria.

    Science.gov (United States)

    Pernin, P; Cariou, M L; Jacquier, A

    1985-11-01

    Using isoelectric focusing, the zymograms of 23 pathogenic and nonpathogenic Naegleria strains were studied for the activity of 16 enzymes. Certain enzymes (lactate dehydrogenase, L-threonine dehydrogenase, superoxide dismutase, acid phosphatase, malic enzyme, and leucine aminopeptidase) proved particularly useful from a practical point of view as they allow easy and reliable identification of pathogenic N. fowleri and N. australiensis as well as nonpathogenic N. lovaniensis strains. Genetic interpretation of these zymograms gave estimates of genetic distances that largely confirmed the taxonomic position of the Naegleria species. In addition, the genetic data suggest that there are two main phylogenetic groups in the genus Naegleria.

  6. The evolution pattern of rDNA ITS in Avena and phylogenetic relationship of the Avena species (Poaceae: Aveneae).

    Science.gov (United States)

    Peng, Yuan-Ying; Baum, Bernard R; Ren, Chang-Zhong; Jiang, Qian-Tao; Chen, Guo-Yue; Zheng, You-Liang; Wei, Yu-Ming

    2010-10-01

    Ribosomal ITS sequences are commonly used for phylogenetic reconstruction because they are included in rDNA repeats, and these repeats often undergo rapid concerted evolution within and between arrays. Therefore, the rDNA ITS copies appear to be virtually identical and can sometimes be treated as a single gene. In this paper we examined ITS polymorphism within and among 13 diploid (A and C genomes), seven tetraploid (AB, AC and CC genomes) and four hexaploid (ACD genome) to infer the extent and direction of concerted evolution, and to reveal the phylogenetic and genome relationship among species of Avena. A total of 170 clones of the ITS1-5.8S-ITS2 fragment were sequenced to carry out haplotype and phylogenetic analysis. In addition, 111 Avena ITS sequences retrieved from GenBank were combined with 170 clones to construct a phylogeny and a network. We demonstrate the major divergence between the A and C genomes whereas the distinction among the A and B/D genomes was generally not possible. High affinity among the A(d) genome species A. damascena and the ACD genome species A. fatua was found, whereas the rest of the ACD genome hexaploids and the AACC tetraploids were highly affiliated with the A(l) genome diploid A. longiglumis. One of the AACC species A. murphyi showed the closest relationship with most of the hexaploid species. Both C(v) and C(p) genome species have been proposed as paternal donors of the C-genome carrying polyploids. Incomplete concerted evolution is responsible for the observed differences among different clones of a single Avena individual. The elimination of C-genome rRNA sequences and the resulting evolutionary inference of hexaploid species are discussed. © 2010 The Authors.

  7. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5 ' AGTCGTAACAAGGTTTCCGTAGGTG3 ' and ITS6-R: 5 ' TTCCCGCTTCACTCGC-AGT3 ' primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  9. Phylogenetic relationships of the genera of the Pronocephalidae Looss, 1902 (Digenea: Paramphistomiformes).

    Science.gov (United States)

    Pérez Ponce de León, G; Brooks, D R

    1995-04-01

    Quantitative phylogenetic analysis of 20 nominal genera of the Pronocephalidae based on 47 morphological transformation series produced 6 equally parsimonious trees, each with a consistency index of 77.8%. All trees agree that Adenogaster is the sister group to the rest of the pronocephalids, and a new subfamily is proposed for it. The Pronocephalinae comprises Pronocephalus, Ruicephalus, Neopronocephalus, Macravestibulum, Choanophorus, Cetiosaccus, and Metacetabulum. The Charaxicephalinae comprises Charaxicephalus, Desmogonius, Diaschistorchis, Pleurogonius, Iguanacola, Renigonius, Parapleurogonius, Himasomum, Pyelosomum, Cricocephalus, Barisomum, and Pseudobarisomum. An amended diagnosis for Himasomum is presented. The trees differ only in the placements of Pleurogonius, Renigonius + Parapleurogonius, Iguanacola, and Himasomum relative to each other. Parapronocephalum and Notocotyloides are members of the clade containing the Notocotylidae. The phylogenetic tree supports interpretations of 3-4 transitions from marine to freshwater turtles, 3 host switches from marine turtles to the Galapagos marine iguana and 3 from marine turtles to the French angelfish, and widespread host switching among marine chelonians. No switches to non-chelonian hosts coincide with transitions from marine to freshwater.

  10. Phylogenetic relationships of platyhelminthes based on 18S ribosomal gene sequences.

    Science.gov (United States)

    Campos, A; Cummings, M P; Reyes, J L; Laclette, J P

    1998-08-01

    Nucleotide sequences of 18S ribosomal RNA from 71 species of Platyhelminthes, the flatworms, were analyzed using maximum likelihood, and the resulting phylogenetic trees were compared with previous phylogenetic hypotheses. Analyses including 15 outgroup species belonging to eight other phyla show that Platyhelminthes are monophyletic with the exception of a sequence putatively from Acoela sp., Lecithoepitheliata, Polycladida, Tricladida, Trematoda (Aspidobothrii + Digenea), Monogenea, and Cestoda (Gyrocotylidea + Amphilinidea + Eucestoda) are monophyletic groups. Catenulids form the sister group to the rest of platyhelminths, whereas a complex clade formed by Acoela, Tricladida, "Dalyellioida", and perhaps "Typhloplanoida" is sister to Neodermata. "Typhloplanoida" does not appear to be monophyletic; Fecampiida does not appear to belong within "Dalyellioida," nor Kalyptorhynchia within "Typhloplanoida." Trematoda is the sister group to the rest of Neodermata, and Monogenea is sister group to Cestoda. Within Trematoda, Aspidobothrii is the sister group of Digenea and Heronimidae is the most basal family in Digenea. Our trees support the hypothesis that parasitism evolved at least twice in Platyhelminthes, once in the ancestor to Neodermata and again in the ancestor of Fecampiida, independently to the ancestor of putatively parasitic "Dalyellioida."

  11. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  12. Nuclear ribosomal ITS functional paralogs resolve the phylogenetic relationships of a late-Miocene radiation cycad Cycas (Cycadaceae.

    Directory of Open Access Journals (Sweden)

    Long-Qian Xiao

    Full Text Available Cycas is the most widespread and diverse genus among the ancient cycads, but the extant species could be the product of late Miocene rapid radiations. Taxonomic treatments to date for this genus are quite controversial, which makes it difficult to elucidate its evolutionary history. We cloned 161 genomic ITS sequences from 31 species representing all sections of Cycas. The divergent ITS paralogs were examined within each species and identified as putative pseudogenes, recombinants and functional paralogs. Functional paralogs were used to reconstruct phylogenetic relationships with pseudogene sequences as molecular outgroups, since an unambiguous ITS sequence alignment with their closest relatives, the Zamiaceae, is unachievable. A fully resolved and highly supported tree topology was obtained at the section level, with two major clades including six minor clades. The results fully supported the classification scheme proposed by Hill (2004 at the section level, with the minor clades representing his six sections. The two major clades could be recognised as two subgenera. The obtained pattern of phylogenetic relationships, combined with the different seed dispersal capabilities and paleogeography, allowed us to propose a late Miocene rapid radiation of Cycas that might have been promoted by vicariant events associated with the complex topography and orogeny of South China and adjacent regions. In contrast, transoceanic dispersals might have played an important role in the rapid diversification of sect. Cycas, whose members have evolved a spongy layer in their seeds aiding water dispersals.

  13. Nuclear Ribosomal ITS Functional Paralogs Resolve the Phylogenetic Relationships of a Late-Miocene Radiation Cycad Cycas (Cycadaceae)

    Science.gov (United States)

    Xiao, Long-Qian; Möller, Michael

    2015-01-01

    Cycas is the most widespread and diverse genus among the ancient cycads, but the extant species could be the product of late Miocene rapid radiations. Taxonomic treatments to date for this genus are quite controversial, which makes it difficult to elucidate its evolutionary history. We cloned 161 genomic ITS sequences from 31 species representing all sections of Cycas. The divergent ITS paralogs were examined within each species and identified as putative pseudogenes, recombinants and functional paralogs. Functional paralogs were used to reconstruct phylogenetic relationships with pseudogene sequences as molecular outgroups, since an unambiguous ITS sequence alignment with their closest relatives, the Zamiaceae, is unachievable. A fully resolved and highly supported tree topology was obtained at the section level, with two major clades including six minor clades. The results fully supported the classification scheme proposed by Hill (2004) at the section level, with the minor clades representing his six sections. The two major clades could be recognised as two subgenera. The obtained pattern of phylogenetic relationships, combined with the different seed dispersal capabilities and paleogeography, allowed us to propose a late Miocene rapid radiation of Cycas that might have been promoted by vicariant events associated with the complex topography and orogeny of South China and adjacent regions. In contrast, transoceanic dispersals might have played an important role in the rapid diversification of sect. Cycas, whose members have evolved a spongy layer in their seeds aiding water dispersals. PMID:25635842

  14. [RAPD analysis of the intraspecific and interspecific variation and phylogenetic relationships of Aegilops L. species with the U genome].

    Science.gov (United States)

    Goriunova, S V; Chikida, N N; Kochieva, E Z

    2010-07-01

    RAPD analysis was used to study the genetic variation and phylogenetic relationships of polyploid Aegilops species with the U genome. In total, 115 DNA samples of eight polyploid species containing the U genome and the diploid species Ae. umbellulata (U) were examined. Substantial interspecific polymorphism was observed for the majority of the polyploid species with the U genome (interspecific differences, 0.01-0,2; proportion of polymorphic loci, 56.6-88.2%). Aegilops triuncialis was identified as the only alloploid species with low interspecific polymorphism (interspecific differences, 0-0.01, P = 50%) in the U-genome group. The U-genome Aegilops species proved to be separated from other species of the genus. The phylogenetic relationships were established for the U-genome species. The greatest separation within the U-genome group was observed for the US-genome species Ae. kotschyi and Ae. variabilis. The tetraploid species Ae. triaristata and Ae. columnaris, which had the UX genome, and the hexaploid species Ae. recta (UXN) were found to be related to each other and separate from the UM-genome species. A similarity was observed between the U M-genome species Ae. ovata and Ae. biuncialis, which had the UM genome, and the ancestral diploid U-genome species Ae. umbellulata. The UC-genome species Ae. triuncialis was rather separate and slightly similar to the UX-genome species.

  15. Phylogenetic relationships of Spiruromorpha from birds of prey based on 18S rDNA.

    Science.gov (United States)

    Honisch, M; Krone, O

    2008-06-01

    A total of 153 free-ranging birds from Germany belonging to 15 species were examined for nematodes in their digestive and respiratory tracts. In 51.7% of the birds 14 different nematode species were found: the intestinal ascarids Porrocaecum depressum and P. angusticolle, the strongylid Hovorkonema variegatum, which inhabits the trachea and bronchi, the hairworms Eucoleus dispar and Capillaria tenuissima isolated from the digestive system, the spirurid nematodes Cyrnea leptoptera, C. mansioni, C. seurati, Microtetrameres cloacitectus, Physaloptera alata, P. apivori, Synhimantus hamatus and S. laticeps, which inhabit the proventriculus and gizzard of the raptors, and the spirurid nematode Serratospiculum tendo, which lives in the air sacs. To revise their systematic positions the ribosomal 18S gene regions of the nematode species were analysed and a phylogenetic tree was constructed. The molecular data confirmed the morphological systematics, except the spirurid family Physalopteridae, which grouped together with the Acuariidae.

  16. Scapteromys aquaticus (Rodentia: Sigmodontinae in Brazil with comments on karyotype and phylogenetics relationships

    Directory of Open Access Journals (Sweden)

    Cibele R. Bonvicino

    2013-04-01

    Full Text Available The swamp rats are distributed in Argentina, southern Paraguay, Uruguay and southern Brazil, with two species currently accepted: Scapteromys aquaticus Thomas, 1920 and Scapteromys tumidus Waterhouse, 1837. While S. aquaticus occurs in Argentina, Paraguay and western Uruguay, S. tumidus occurs in Brazil and Uruguay. Here we report for the first time the occurrence of S. aquaticus in gallery forest remnants in Southern Brazil. Karyologic analysis showed 2n = 32 and FNa = 40. Phylogenetic analyses, based on DNA sequences from the mitochondrial cytochrome-b gene indicate that the Brazilian and the Argentinian specimens of S. aquaticus shared one haplotype, while median joining analysis showed lack of population structure. This register, plus the karyotype data available for Brazilian population, recovered four karyomorphotypes in Brazil, corresponding to the two known species of Scapteromys and two unnamed species. This scenario indicates that more multidisciplinary studies are necessary to understand the actual diversity of Scapteromys.

  17. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  18. Chaperonin GroEL: a novel phylogenetically conserved protein with strong immunoreactivity of Avian Pathogenic Escherichia coli isolates from duck identified by immunoproteomics.

    Science.gov (United States)

    Bao, Yinli; Zhai, Zhipeng; Wang, Shaohui; Ma, Jiale; Zhang, Wei; Lu, Chengping

    2013-06-19

    Avian Pathogenic Escherichia coli (APEC) is one of the most important bacterial pathogens of poultry. The lack of suitable vaccines and the emergence of multi-resistant strains have hampered the control of avian colibacillosis. To identify immunogenic proteins of APEC as vaccine candidates, immunoproteomics and matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) were applied. Proteins from total cell lysates of APEC DE205B isolated from the brain of a duck with septicemia and neurological symptom in China were separated by two-dimensional electrophoresis (2-DE) and reacted with hyperimmune duck serum against DE205B. Fourteen immunoreactive spots were found, representing 11 distinct proteins. These included two predominant immunogenic components, outer membrane protein A (OmpA) and flagellin (FliC). GroEL, which is a member of the molecular chaperone family and identical structurally to eukaryotic heat shock protein 60 (Hsp60), and the other eight antigens are reported here as immunoreactive proteins of APEC for the first time. Subsequently, nine genes encoding the identified proteins were successfully cloned and expressed in E. coli BL21 (DE3). Seven of the recombinant proteins were able to react with hyperimmune duck serum and three of them, GroEL, OmpA and FliC, showed stronger immunoreactivity. Challenge studies revealed that, just like OmpA and FliC, recombinant GroEL stimulated a strong antibody response and supported protective efficacy against APEC infection in ducks. With high phylogenetic conservation, it is considered that GroEL would be an ideal immunogen of APEC for vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Phylogenetic Relationships among Whiteflies in the Bemisia tabaci (Gennadius Species Complex from Major Cassava Growing Areas in Kenya

    Directory of Open Access Journals (Sweden)

    Duke M. Manani

    2017-02-01

    Full Text Available Whiteflies, Bemisia tabaci (Gennadius are major insect pests that affect many crops such as cassava, tomato, beans, cotton, cucurbits, potato, sweet potato, and ornamental crops. Bemisia tabaci transmits viral diseases, namely cassava mosaic and cassava brown streak diseases, which are the main constraints to cassava production, causing huge losses to many small-scale farmers. The aim of this work was to determine the phylogenetic relationships among Bemisia tabaci species in major cassava growing areas of Kenya. Surveys were carried out between 2013 and 2015 in major cassava growing areas (Western, Nyanza, Eastern, and Coast regions, for cassava mosaic disease (CMD and cassava brown streak disease (CBSD. Mitochondrial cytochrome oxidase I (mtCOI-DNA was used to determine the genetic diversity of B. tabaci. Phylogenetic trees were constructed using Bayesian methods to understand the genetic diversity across the study regions. Phylogenetic analysis revealed two B. tabaci species present in Kenya, sub-Saharan Africa 1 and 2 comprising five distinct clades (A–E with percent sequence similarity ranging from 97.7 % to 99.5%. Clades B, C, D, and E are predominantly distributed in the Western and Nyanza regions of Kenya whereas clade B is dominantly found along the coast, the eastern region, and parts of Nyanza. Our B. tabaci clade A groups with sub-Saharan Africa 2-(SSA2 recorded a percent sequence similarity of 99.5%. In this study, we also report the identification of SSA2 after a 15 year absence in Kenya. The SSA2 species associated with CMD has been found in the Western region of Kenya bordering Uganda. More information is needed to determine if these species are differentially involved in the epidemiology of the cassava viruses.

  20. Complete mitochondrial genomes of Nanorana taihangnica and N. yunnanensis (Anura: Dicroglossidae) with novel gene arrangements and phylogenetic relationship of Dicroglossidae.

    Science.gov (United States)

    Zhang, Jia-Yong; Zhang, Le-Ping; Yu, Dan-Na; Storey, Kenneth B; Zheng, Rong-Quan

    2018-02-27

    Complete mitochondrial (mt) genomes have been used extensively to test hypotheses about microevolution and to study population structure, phylogeography, and phylogenetic relationships of Anura at various taxonomic levels. Large-scale mt genomic reorganizations have been observed among many fork-tongued frogs (family Dicroglossidae). The relationships among Dicroglossidae and validation of the genus Feirana are still problematic. Hence, we sequenced the complete mt genomes of Nanorana taihangnica (=F. taihangnica) and N. yunnanensis as well as partial mt genomes of six Quasipaa species (dicroglossid taxa), two Odorrana and two Amolops species (Ranidae), and one Rhacophorus species (Rhacophoridae) in order to identify unknown mt gene rearrangements, to investigate the validity of the genus Feirana, and to test the phylogenetic relationship of Dicroglossidae. In the mt genome of N. taihangnica two trnM genes, two trnP genes and two control regions were found. In addition, the trnA, trnN, trnC, and trnQ genes were translocated from their typical positions. In the mt genome of N. yunnanensis, three control regions were found and eight genes (ND6, trnP, trnQ, trnA, trnN, trnC, trnY and trnS genes) in the L-stand were translocated from their typical position and grouped together. We also found intraspecific rearrangement of the mitochondrial genomes in N. taihangnica and Quasipaa boulengeri. In phylogenetic trees, the genus Feirana nested deeply within the clade of genus Nanorana, indicating that the genus Feirana may be a synonym to Nanorana. Ranidae as a sister clade to Dicroglossidae and the clade of (Ranidae + Dicroglossidae) as a sister clade to (Mantellidae + Rhacophoridae) were well supported in BI analysis but low bootstrap in ML analysis. We found that the gene arrangements of N. taihangnica and N. yunnanensis differed from other published dicroglossid mt genomes. The gene arrangements in N. taihangnica and N. yunnanensis could be explained by the Tandem

  1. Special structure of mitochondrial DNA control region and phylogenetic relationship among individuals of the black rockfish, Sebastes schlegelii.

    Science.gov (United States)

    Zhang, Hui; Zhang, Yan; Zhang, Xiumei; Song, Na; Gao, Tianxiang

    2013-04-01

    This study deals with the structure of mitochondrial DNA (mtDNA) control region (CR) of the black rockfish, Sebastes schlegelii. Two termination-associated sequences (TASs), two complementary termination-associated sequences (cTASs), and conserved sequence block (CSB), such as CSB-F, CSB-E, CSB-D, CSB1, CSB2, and CSB3, were detected in S. schlegelii. The results indicated that the structures of these blocks are similar to most marine fishes, but it is special that there are two TASs and two cTASs in the CR of S. schlegelii. One conserved region was found from 450 bp to the end of the CR, which is also a special feature of S. schlegelii. All sequences of CSB1, CSB2, and CSB3 blocks are the consensus among different individuals, which is quite different from most vertebrates. In addition, the complete mtDNA CR sequences and the first 449 bp of the CR are used to analyze the phylogenetic relationships of S. schlegelii. The phylogenetic trees show a lack of genetic structure among individuals. This study also indicated a signal that the genetic diversity might be similar between the wild and cultured individuals, which may be helpful to the fisheries management.

  2. Testing the utility of mitochondrial cytochrome oxidase subunit 1 sequences for phylogenetic estimates of relationships between crane (Grus) species.

    Science.gov (United States)

    Yu, D B; Chen, R; Kaleri, H A; Jiang, B C; Xu, H X; Du, W-X

    2011-12-21

    Morphology and biogeography are widely used in animal taxonomy. Recent study has suggested that a DNA-based identification system, using a 648-bp portion of the mitochondrial gene cytochrome oxidase subunit 1 (CO1), also known as the barcoding gene, can aid in the resolution of inferences concerning phylogenetic relationships and for identification of species. However, the effectiveness of DNA barcoding for identifying crane species is unknown. We amplified and sequenced 894-bp DNA fragments of CO1 from Grus japonensis (Japanese crane), G. grus (Eurasian crane), G. monacha (hooded crane), G. canadensis (sandhill crane), G. leucogeranus (Siberian crane), and Balearica pavonina (crowned crane), along with those of 15 species obtained from GenBank and DNA barcoding, to construct four algorithms using Tringa stagnatilis, Scolopax rusticola, and T. erythropus as outgroups. The four phylum profiles showed good resolution of the major taxonomic groups. We concluded that reconstruction of the molecular phylogenetic tree can be helpful for classification and that CO1 sequences are suitable for studying the molecular evolution of cranes. Although support for several deeper branches was limited, CO1 data gave remarkably good separations, especially considering that our analysis was based on just a fragment of the gene and that CO1 has generally been viewed as useful only for resolving shallow divergences.

  3. Genomic features, phylogenetic relationships, and comparative genomics of Elizabethkingia anophelis strain EM361-97 isolated in Taiwan.

    Science.gov (United States)

    Lin, Jiun-Nong; Lai, Chung-Hsu; Yang, Chih-Hui; Huang, Yi-Han; Lin, Hsi-Hsun

    2017-10-30

    Elizabethkingia anophelis has become an emerging infection in humans. Recent research has shown that previous reports of E. meningoseptica infections might in fact be caused by E. anophelis. We aimed to investigate the genomic features, phylogenetic relationships, and comparative genomics of this emerging pathogen. Elizabethkingia anophelis strain EM361-97 was isolated from the blood of a cancer patient in Taiwan. The total length of the draft genome was 4,084,052 bp. The whole-genome analysis identified the presence of a number of antibiotic resistance genes, which corresponded with the antibiotic susceptibility phenotype of this strain. Based on the average nucleotide identity, the phylogenetic analysis revealed that E. anophelis EM361-97 was a sister group to E. anophelis FMS-007, which was isolated from a patient with T-cell non-Hodgkin's lymphoma in China. Knowledge of the genomic characteristics and comparative genomics of E. anophelis will provide researchers and clinicians with important information to understand this emerging microorganism.

  4. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  5. Phylogenetic Characterization of Encephalitozoon Romaleae (Microsporidia) from a Grasshopper Host: Relationship to Encephalitozoon spp. Infecting Humans

    Science.gov (United States)

    Encephalitozoon species are the most common microsporidian pathogens of humans and domesticated animals. We recently discovered a new microsporidium, Encephalitozoon romaleae, infecting the eastern lubber grasshopper Romalea microptera. To understand its evolutionary relationships, we compared par...

  6. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  7. Species Delimitation and Phylogenetic Relationships in Ectobiid Cockroaches (Dictyoptera, Blattodea from China.

    Directory of Open Access Journals (Sweden)

    Yanli Che

    Full Text Available We collected Ectobiidae cockroach specimens from 44 locations in the south of the Yangtze valley. We obtained 297 COI sequences specimens and carried out phylogenetic and divergence dating analyses, as well as species delimitation analysis using a General Mixed Yule Coalescent (GMYC framework. The intraspecific and interspecific sequence divergence in Ectobiidae cockroaches ranged from 0.0 to 7.0% and 4.6 to 30.8%, respectively. GMYC analysis resulted in 53 (confidence interval: 37-65 entities (likelihood ratio = 103.63 including 14 downloaded species. The COI GMYC groups partly corresponded to the ectobiid species and 52 ectobiid species were delimited successfully based on the combination of GMYC result with morphological information. We used the molecular data and 6 cockroach fossil calibrations to obtain a preliminary estimate of the timescale of ectobiid evolution. The major subfamilies in the group were found to have diverged between ~125-110 Ma, and morphospecies pairs were found to have diverged ~10 or more Ma.

  8. Isolation and phylogenetic relationships of bat trypanosomes from different biomes in Mato Grosso, Brazil.

    Science.gov (United States)

    Marcili, Arlei; da Costa, Andrea P; Soares, Herbert S; Acosta, Igor da C L; de Lima, Julia T R; Minervino, Antonio H H; Melo, Andréia T L; Aguiar, Daniel M; Pacheco, Richard C; Gennari, Solange M

    2013-12-01

    In the order Chiroptera, more than 30 trypanosome species belonging to the subgenera Herpetosoma, Schizotrypanum, Megatrypanum, and Trypanozoon have been described. The species Trypanosoma cruzi , Trypanosoma cruzi marinkellei, and Trypanosoma dionisii are the most common in bats and belong to the Schizotrypanum subgenus. Bats from 2 different biomes, Pantanal and Amazonia/Cerrado in the state of Mato Grosso, Brazil, were evaluated according to the presence of trypanosome parasites by means of hemoculture and PCR in primary samples (blood samples). A total of 211 bats from 20 different species were caught and the trypanosome prevalence, evaluated through hemoculture, was 9.0% (19), 15.5% (13), and 4.8% (6) in the municipalities of Confresa (Amazonia/Cerrado biome) and Poconé (Pantanal biome). Among the 123 primary samples obtained from the bats, only 3 (2.4%) were positive. Phylogenetic analysis using trypanosomatid barcoding (V7V8 region of SSU rDNA) identified all the isolates and primary samples as T. c. marinkellei. The sequences of the isolates were segregated according to the bat host genus or species and suggest that co-evolutionary patterns exist between hosts and parasites. Further studies in different Brazilian regions and biomes need to be conducted in order to gain real understanding of the diversity of trypanosomes in bats.

  9. Characterization of the complete mitochondrial genome and phylogenetic relationship of Caranx tille (Perciformes: Carangidae).

    Science.gov (United States)

    Ma, Hongyu; Ma, Chunyan; Zhang, Heng; Zhang, Xun; Feng, Chunlei; Zhang, Yu; Wang, Wei; Chen, Wei; Ma, Lingbo

    2016-11-01

    In the present study, we determined the complete mitochondrial genome sequence of Caranx tille by using Illumina and Sanger sequencing technology that was 16 593 bp in size. This mitochondrial genome was made up of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and a putative control region. Of these 37 genes, 28 were encoded by heavy strand, while nine were encoded by light strand. Three types of start codons and four kinds of stop codons were separately detected in 13 protein-coding genes. The overall base composition of this genome was 28.95% for A, 15.84% for G, 26.26% for T, and 28.95% for C, with a slight higher A + T content of 55.21%. From the phylogenetic tree constructed based on 13 concatenated protein-coding genes, we can see that C. tille, C. melampygus and C. ignobilis grouped together and formed a single cluster. In addition, C. tille was genetically closest to C. melampygus. This work should facilitate the studies on molecular evolution and population genetic structure for fishes under family Carangidae.

  10. Reproductive isolating mechanisms and molecular phylogenetic relationships among Palearctic and Oriental brown frogs.

    Science.gov (United States)

    Sumida, Masayuki; Ueda, Hiroaki; Nishioka, Midori

    2003-05-01

    Crossing experiments were made among various brown frog species and populations collected from Japan, China, Russia and Taiwan. The main purpose of these experiments was to confirm the existence of reproductive isolating mechanisms among Rana pirica from Japan, R. chensinensis from China and R. chensinensis from Russia, and between these three taxa and the other brown frogs distributed in the Palearctic and Oriental regions. It was found that there was no or a slight gametic isolation among the three taxa. While there was a nearly equal number of male and female offspring in the control groups, the hybrid frogs were all males, and completely sterile upon attaining sexual maturity. Thus, each of the Japanese R. pirica and the Russian R. chensinensis is a valid species, distinct from the Chinese R. chensinensis. The phylogenetic tree based on nucleotide sequence data from the mitochondrial 12S and 16S rRNA genes of the Palearctic and Oriental brown frogs showed that the three taxa are included in a cluster together with the other species with 2n=24 chromosomes. The present crossing experiments and molecular data support the hypothesis that each of them is a separate but closely related species.

  11. Prolidase in the Marine Sponge Suberites domuncula: Enzyme Activity, Molecular Cloning, and Phylogenetic Relationship.

    Science.gov (United States)

    Wiens; Koziol; Batel; Müller

    1999-03-01

    : The enzyme prolidase hydrolyzes the peptide bond that involves the imino nitrogen of proline or hydroxyproline; hence, it catalyzes the final step in collagen degradation. From mammals it is known that this enzyme plays a major role in the recycling of proline for collagen synthesis and can be considered to be essential for the control of cell growth. The dominant organic exoskeleton in sponges, especially in Demospongiae, is collagen and the collagen-related spongin. Here we demonstrate that crude extracts of the demosponge Suberites domuncula contain prolidase or prolidase-like activity. The complementary DNA encoding the putative prolidase was cloned from a library of the same animal. Two different forms of cDNAs, termed SDPEPD1 and SDPEPD2, were identified, coding for the putative polypeptides PEPD_SD-1 with a molecular mass of 55,805 Da and PEPD_SD-2 with 51,684. Evidence is presented suggesting that the two different transcripts originate from the same gene but are formed by an alternative splicing event. We conclude that demosponges contain the activity as well as the gene for prolidase, a major enzyme involved in collagen metabolism, spicule formation, and cell motility. Phylogenetic analysis revealed that the sponge prolidase branches off first from the common ancestor of metazoan prolidases and later than the yeast prolidase; only distantly related are the bacterial enzymes.

  12. Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

    Science.gov (United States)

    Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

    2017-12-01

    The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

  13. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Mitochondrial genome evolution in Ophiuroidea, Echinoidea, and Holothuroidea: insights in phylogenetic relationships of Echinodermata.

    Science.gov (United States)

    Perseke, Marleen; Bernhard, Detlef; Fritzsch, Guido; Brümmer, Franz; Stadler, Peter F; Schlegel, Martin

    2010-07-01

    The genome architecture and amino acid sequences of six new complete mitochondrial genomes were determined from representatives of Hemichordata (1), Ophiuroidea (3), Echinoidea (1) and Holothuroidea (1) and were analysed together with previously known sequences. Phylogenetic analyses recovered three lineages within echinoderms, Crinoidea, Ophiuroidea and a group comprising Holothuroidea, Echinoidea, and Asteroidea. In contrast to previous analyses of mitochondrial genomes the increased data set recovered the classical echinoderm phylogeny of Eleutherozoa and Echinozoa in Maximum Likelihood and Bayesian analyses using hemichordate out-group representatives. However, an inconsistent ramification appeared with vertebrate out-groups and in Maximum Parsimony and Neighbour Joining reconstructions. The basal (consensus) gene orders of all three lineages could be derived from a hypothetical ancestral crinoid gene order by one single rearrangement in each lineage. The genome architecture was highly conserved in Echinoidea, whereas the highest gene order differences and large amounts of unassigned sequences (UAS) were detected in Ophiuroidea, supporting a higher evolutionary rate than in any other echinoderm lineage. The variability in gene order and UAS regions in ophiuroid genomes suggest dominating rearrangement mechanisms by duplication events. Copyright 2010 Elsevier Inc. All rights reserved.

  15. Structure and variation of the Fringillidae (Aves: Passeriformes) mitochondrial DNA control region and their phylogenetic relationship.

    Science.gov (United States)

    Huang, Zuhao; Shen, Yamin; Ma, Yurong

    2017-11-01

    The control region is the major noncoding segment of animal mitochondrial DNA. To infer the structure and variation of Fringillidae mitochondrial DNA control region, the entire control region sequences of 25 species were analyzed. The length of the control region sequences was very conserved (1230 ± 18) and can be separated into three domains. The frequency of both substitutions and gaps was highest in the third domain and lowest in the central region. The control region has the same flanking gene order from tRNA Glu to tRNA Phe . Genetic distances between species ranged from 1.80% (between Carduelis pinus and Carduelis spinus) to 25.34% (between Carduelis sinica and Coccothraustes vespertinus). The average genetic distances among the species within the genera varied from 5.11% (Leucosticte) to 14.31% (Carpodacus). The average genetic distances showed insignificantly negative correlation with ts/tv. Domain III is the most variable of the three domains among all the genera. The control region of Fringillidae contains a putative TAS element and the highly conserved CSB-1, and F, E, D, C boxes. However, neither CSB-2 nor CSB-3 could be unambiguously identified in the Fringillidae. The maximum likelihood method was used to construct a phylogenetic tree. Control region analysis demonstrated that some currently recognized genera may be polyphyletic, including Carpodacus, Carduelis and Serinus.

  16. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

    Directory of Open Access Journals (Sweden)

    Maritza Barrera

    2017-01-01

    Full Text Available In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV, clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  17. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador.

    Science.gov (United States)

    Barrera, Maritza; Garrido-Haro, Ana; Vaca, María S; Granda, Danilo; Acosta-Batallas, Alfredo; Pérez, Lester J

    2017-01-01

    In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV), clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  18. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  19. Phylogenetic relationships in the Niviventer-Chiromyscus complex (Rodentia, Muridae inferred from molecular data, with description of a new species

    Directory of Open Access Journals (Sweden)

    Alexander Balakirev

    2014-11-01

    Full Text Available Based on molecular data for mitochondrial (Cyt b, COI and nuclear (IRBP, GHR genes, and morphological examinations of museum specimens, we examined diversity, species boundaries, and relationships within and between the murine genera Chiromyscus and Niviventer. Phylogenetic patterns recovered demonstrate that Niviventer sensu lato is not monophyletic but instead includes Chiromyscus chiropus, the only previously recognized species of Chiropus. To maintain the genera Niviventer and Chiropus as monophyletic lineages, the scope and definition of the genus Chiromyscus is revised to include at least three distinct species: Chiromyscus chiropus (the type species of Chiromyscus, C. langbianis (previously regarded as a species of Niviventer, and a new species, described in this paper under the name C. thomasi sp. n.

  20. Phylogenetic relationships of the genus Eurytrema from domestic and wild animal based on 18S rRNA sequences.

    Science.gov (United States)

    Cai, Zhihua; Zhang, Yueling; Ye, Xiangqun

    2012-10-01

    Since Loss (1907) established the genus Eurytrema, there were more than eleven species found worldwide from America, Europe to Asia. Adult worms are generally found in pancreatic and bile ducts of wild and domestic ruminants. Some species from wild animal and domestic animal have already differentiated. In this study, we amplified and sequenced the partial 18S rRNA sequences of some Eurytrema species found in wild and domestic animals. The phylogenetic analysis was conducted to show the genetic relationship of these Eurytrema species. The results demonstrated that same species of Eurytrema from domestic animal and wild animal or from separated geological region have a considerable degree of genetic differentiation. Analysis of the 18S rRNA sequences indicated that Eurytrema fukienensis is an independent species and suggested that it may represent the intermediate species between wild and domestic animal.

  1. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    Bacteroidetes/Chlorobi genomes to elucidate their phylogenetic relationship and to gain insight into what is separating the gut living Bacteroides and Parabacteroides genera from other Bacteroidetes/Chlorobi species. A comprehensive analysis shows that Bacteroides species have a higher number...... that Bacteroides and Parabacteroides species share a large common core of 1,085 protein families. Genome atlases illustrate that there are few and only small unique areas on the chromosomes of four Bacteroides/Parabacteroides genomes. Functional classification to clusters of othologus groups show that Bacteroides...... species are enriched in carbohydrate transport and metabolism proteins. Classification of proteins in KEGG metabolic pathways gives a detailed view of the genome’s metabolic capabilities that can be linked to its habitat. Bacteroides pectinophilus and Bacteroides capillosus do not cluster together...

  2. Resolving phylogenetic relationships of the recently radiated carnivorous plant genus Sarracenia using target enrichment.

    Science.gov (United States)

    Stephens, Jessica D; Rogers, Willie L; Heyduk, Karolina; Cruse-Sanders, Jennifer M; Determann, Ron O; Glenn, Travis C; Malmberg, Russell L

    2015-04-01

    The North American carnivorous pitcher plant genus Sarracenia (Sarraceniaceae) is a relatively young clade (carnivorous plants; however, little is known regarding evolutionary relationships within the genus. Previous attempts at resolving the phylogeny have been unsuccessful, most likely due to few parsimony-informative sites compounded by incomplete lineage sorting. Here, we applied a target enrichment approach using multiple accessions to assess the relationships of Sarracenia species. This resulted in 199 nuclear genes from 75 accessions covering the putative 8-11 species and 8 subspecies/varieties. In addition, we recovered 42kb of plastome sequence from each accession to estimate a cpDNA-derived phylogeny. Unsurprisingly, the cpDNA had few parsimony-informative sites (0.5%) and provided little information on species relationships. In contrast, use of the targeted nuclear loci in concatenation and coalescent frameworks elucidated many relationships within Sarracenia even with high heterogeneity among gene trees. Results were largely consistent for both concatenation and coalescent approaches. The only major disagreement was with the placement of the purpurea complex. Moreover, results suggest an Appalachian massif biogeographic origin of the genus. Overall, this study highlights the utility of target enrichment using multiple accessions to resolve relationships in recently radiated taxa. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. High time for a roll call: gene duplication and phylogenetic relationships of TCP-like genes in monocots

    Science.gov (United States)

    Mondragón-Palomino, Mariana; Trontin, Charlotte

    2011-01-01

    Background and Aims The TCP family is an ancient group of plant developmental transcription factors that regulate cell division in vegetative and reproductive structures and are essential in the establishment of flower zygomorphy. In-depth research on eudicot TCPs has documented their evolutionary and developmental role. This has not happened to the same extent in monocots, although zygomorphy has been critical for the diversification of Orchidaceae and Poaceae, the largest families of this group. Investigating the evolution and function of TCP-like genes in a wider group of monocots requires a detailed phylogenetic analysis of all available sequence information and a system that facilitates comparing genetic and functional information. Methods The phylogenetic relationships of TCP-like genes in monocots were investigated by analysing sequences from the genomes of Zea mays, Brachypodium distachyon, Oryza sativa and Sorghum bicolor, as well as EST data from several other monocot species. Key Results All available monocot TCP-like sequences are associated in 20 major groups with an average identity ≥64 % and most correspond to well-supported clades of the phylogeny. Their sequence motifs and relationships of orthology were documented and it was found that 67 % of the TCP-like genes of Sorghum, Oryza, Zea and Brachypodium are in microsyntenic regions. This analysis suggests that two rounds of whole genome duplication drove the expansion of TCP-like genes in these species. Conclusions A system of classification is proposed where putative or recognized monocot TCP-like genes are assigned to a specific clade of PCF-, CIN- or CYC/tb1-like genes. Specific biases in sequence data of this family that must be tackled when studying its molecular evolution and phylogeny are documented. Finally, the significant retention of duplicated TCP genes from Zea mays is considered in the context of balanced gene drive. PMID:21444336

  4. 2-oxo-1,2-dihydroquinoline 8-monooxygenase: phylogenetic relationship to other multicomponent nonheme iron oxygenases.

    Science.gov (United States)

    Rosche, B; Tshisuaka, B; Hauer, B; Lingens, F; Fetzner, S

    1997-06-01

    2-Oxo-1,2-dihydroquinoline 8-monooxygenase, an enzyme involved in quinoline degradation by Pseudomonas putida 86, had been identified as a class IB two-component nonheme iron oxygenase based on its biochemical and biophysical properties (B. Rosche, B. Tshisuaka, S. Fetzner, and F. Lingens, J. Biol. Chem. 270:17836-17842, 1995). The genes oxoR and oxoO, encoding the reductase and the oxygenase components of the enzyme, were sequenced and analyzed. oxoR was localized approximately 15 kb downstream of oxoO. Expression of both genes was detected in a recombinant Pseudomonas strain. In the deduced amino acid sequence of the NADH:(acceptor) reductase component (OxoR, 342 amino acids), putative binding sites for a chloroplast-type [2Fe-2S] center, for flavin adenine dinucleotide, and for NAD were identified. The arrangement of these cofactor binding sites is conserved in all known class IB reductases. A dendrogram of reductases confirmed the similarity of OxoR to other class IB reductases. The oxygenase component (OxoO, 446 amino acids) harbors the conserved amino acid motifs proposed to bind the Rieske-type [2Fe-2S] cluster and the mononuclear iron. In contrast to known class IB oxygenase components, which are composed of differing subunits, OxoO is a homomultimer, which is typical for class IA oxygenases. Sequence comparison of oxygenases indeed revealed that OxoO is more related to class IA than to class IB oxygenases. Thus, 2-oxo-1,2-dihydroquinoline 8-monooxygenase consists of a class IB-like reductase and a class IA-like oxygenase. These results support the hypothesis that multicomponent enzymes may be composed of modular elements having different phylogenetic origins.

  5. The Anatomy and Phylogenetic Relationships of "Pelorosaurus" becklesii (Neosauropoda, Macronaria from the Early Cretaceous of England.

    Directory of Open Access Journals (Sweden)

    Paul Upchurch

    Full Text Available The sauropod dinosaur "Pelorosaurus" becklesii was named in 1852 on the basis of an associated left humerus, ulna, radius and skin impression from the Early Cretaceous (Berriasian-Valanginian Hastings Beds Group, near Hastings, East Sussex, southeast England, United Kingdom. The taxonomy and nomenclature of this specimen have a complex history, but most recent workers have agreed that "P." becklesii represents a distinct somphospondylan (or at least a titanosauriform and is potentially the earliest titanosaur body fossil from Europe or even globally. The Hastings specimen is distinct from the approximately contemporaneous Pelorosaurus conybeari from Tilgate Forest, West Sussex. "P." becklesii can be diagnosed on the basis of five autapomorphies, such as: a prominent anteriorly directed process projecting from the anteromedial corner of the distal humerus; the proximal end of the radius is widest anteroposteriorly along its lateral margin; and the unique combination of a robust ulna and slender radius. The new generic name Haestasaurus is therefore erected for "P." becklesii. Three revised and six new fore limb characters (e.g. the presence/absence of condyle-like projections on the posterodistal margin of the radius are discussed and added to three cladistic data sets for Sauropoda. Phylogenetic analysis confirms that Haestasaurus becklesii is a macronarian, but different data sets place this species either as a non-titanosauriform macronarian, or within a derived clade of titanosaurs that includes Malawisaurus and Saltasauridae. This uncertainty is probably caused by several factors, including the incompleteness of the Haestasaurus holotype and rampant homoplasy in fore limb characters. Haestasaurus most probably represents a basal macronarian that independently acquired the robust ulna, enlarged olecranon, and other states that have previously been regarded as synapomorphies of clades within Titanosauria. There is growing evidence that basal

  6. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  7. Factors influencing the potential for strong brand relationships with consumer product brands: An overview and research agenda

    DEFF Research Database (Denmark)

    Bech-Larsen, Tino; Bergkvist, Lars; Francis, Julie

    Based on the premise that consumer product brands are different with respect to their potential to form strong long-term relationships with consumers, this paper aims to identify factors that influence brands' potential for strong long-term relationships and to suggest how these can be empirically...

  8. Strategies/Behaviors That Successful Superintendents Use to Build Strong Relationships and Trust during Their Entry Period

    Science.gov (United States)

    Green, C. K.

    2012-01-01

    The purpose of the study was to identify strategies/behaviors that successful superintendents used to build strong relationships and trust with their school boards within their entry period. The following research questions guided the study: (1) What strategies/behaviors are successful superintendents using to build strong relationships and trust…

  9. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  10. Phylogenetic relationships among extant classes of echinoderms, as inferred from sequences of 18S rDNA, coincide with relationships deduced from the fossil record.

    Science.gov (United States)

    Wada, H; Satoh, N

    1994-01-01

    In spite of the rich fossil record and multiple descriptions of morphological and embryological characteristics, the origin and subsequent evolution of echinoderms remain highly controversial issues. Using sequence data derived from 18S rDNA, we have investigated the phylogenetic relationships among five extant classes of echinoderms--namely, crinoids, asteroids, ophiuroids, echinoids, and holothurians. Almost complete sequences of 18S rDNA were determined for one species in each class, and phylogenetic trees were constructed both by the neighbor-joining method and by the maximum-likelihood method, with a hemichordate as an outgroup. The trees constructed by these methods support the hypothesis that the phylum Echinodermata can be subdivided into two subphyla, Pelmatozoa and Eleutherozoa. The class Holothuroidea, which has been the subject of debate with respect to whether the members are primitive or advanced echinoderms, did not occupy a primitive position but had an affinity for the class Echinoidea. Since both trees gave different branching topologies for the order of emergence of asteroids and ophiuroids, it seems likely that these two groups emerged within a very short period of time. A rough estimate of the timing of the divergence of the five classes from the present molecular analysis coincided with that deduced from the fossil record.

  11. Phylogenetic relationships of Middle American cichlids (Cichlidae, Heroini) based on combined evidence from nuclear genes, mtDNA, and morphology.

    Science.gov (United States)

    Rícan, Oldrich; Zardoya, Rafael; Doadrio, Ignacio

    2008-12-01

    Heroine cichlids are the second largest and very diverse tribe of Neotropical cichlids, and the only cichlid group that inhabits Mesoamerica. The taxonomy of heroines is complex because monophyly of most genera has never been demonstrated, and many species groups are without applicable generic names after their removal from the catch-all genus Cichlasoma (sensu Regan, 1905). Hence, a robust phylogeny for the group is largely wanting. A rather complete heroine phylogeny based on cytb sequence data is available [Concheiro Pérez, G.A., Rícan O., Ortí G., Bermingham, E., Doadrio, I., Zardoya, R. 2007. Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene. Mol. Phylogenet. Evol. 43, 91-110], and in the present study, we have added and analyzed independent data sets (nuclear and morphological) to further confirm and strengthen the cytb-phylogenetic hypothesis. We have analyzed a combined cytb-nuclear (RAG1 and two S7 introns) data set of 48 species representing main heroine lineages to achieve further resolution of heroine higher taxonomic levels and a combined cytb-morphological data set of 92 species to stabilize generic taxonomy. The recovered phylogenies supported the circumamazonian--CAM--Heroini (sensu Concheiro Peréz et al., 2007) as a monophyletic group, that could be divided into six main clades: (1) australoheroines (the southernmost heroine genus Australoheros), (2) nandopsines (the Antillean genus Nandopsis), (3) caquetaines (including the north western Amazonian genera Caquetaia and Heroina), (4) astatheroines (including Astatheros, Herotilapia and Rocio), (5) amphilophines (including Amphilophus and related genera), and (6) herichthyines (including Herichthyis and related genera). Nuclear and mitochondrial data partitions arrived at highly congruent topologies. Suprageneric relationships were influenced mainly by the nuclear signal, as well as the most basal phylogenetic position

  12. Phylogenetic relationships of Amazonian anole lizards (Dactyloa): taxonomic implications, new insights about phenotypic evolution and the timing of diversification.

    Science.gov (United States)

    Prates, Ivan; Rodrigues, Miguel Trefaut; Melo-Sampaio, Paulo Roberto; Carnaval, Ana Carolina

    2015-01-01

    The ecology and evolution of Caribbean anoles are well described, yet little is known about mainland anole species. Lack of phylogenetic information limits our knowledge about species boundaries, morphological evolution, and the biogeography of anoles in South America. To help fill this gap, we provide an updated molecular phylogeny of the Dactyloa (Dactyloidae), with emphasis on the punctata species group. By sampling understudied Amazonian taxa, we (i) assess the phylogenetic placement of the 'odd anole', D. dissimilis; (ii) infer the relationships of the proboscis-bearing D. phyllorhina, testing the hypothesis of independent nasal appendage evolution within the anole radiation; and (iii) examine genetic and dewlap color variation in D. punctata and D. philopunctata. Combining multiple nuclear loci with a review of the fossil record, we also (iv) estimate divergence times within the pleurodont iguanian clade of lizards, including Amazonian representatives of Dactyloa and Norops (Dactyloidae) and of Polychrus (Polychrotidae). We recover the five Dactyloa clades previously referred to as the aequatorialis, heteroderma, latifrons, punctata and roquet species groups, as well as a sixth clade composed of D. dissimilis and the non-Amazonian D. neblinina and D. calimae. We find D. phyllorhina to be nested within the punctata group, suggesting independent evolution of the anole proboscis. We consistently recover D. philopunctata nested within D. punctata, and report limited genetic divergence between distinct dewlap phenotypes. The most recent common ancestor of Dactyloa, Anolis and Norops dates back to the Eocene. Most Amazonian taxa within both Dactyloa and Norops diverged in the Miocene, but some diversification events were as old as the late Eocene and late Oligocene. Amazonian Polychrus diverged in the Pliocene. Our findings have broad implications for anole biogeography, disputing recent suggestions that modern dactyloid genera were present in the Caribbean region

  13. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  14. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  15. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  16. Strong generalized synchronization with a particular relationship R between the coupled systems

    Science.gov (United States)

    Grácio, Clara; Fernandes, Sara; Mário Lopes, Luís

    2018-03-01

    The question of the chaotic synchronization of two coupled dynamical systems is an issue that interests researchers in many fields, from biology to psychology, through economics, chemistry, physics, and many others. The different forms of couplings and the different types of synchronization, give rise to many problems, most of them little studied. In this paper we deal with general couplings of two dynamical systems and we study strong generalized synchronization with a particular relationship R between them. Our results include the definition of a window in the domain of the coupling strength, where there is an exponentially stable solution, and the explicit determination of this window. In the case of unidirectional or symmetric couplings, this window is presented in terms of the maximum Lyapunov exponent of the systems. Examples of applications to chaotic systems of dimension one and two are presented.

  17. Phylogenetic Relationships between Four Salix L. Species Based on DArT Markers

    Directory of Open Access Journals (Sweden)

    Jerzy A. Przyborowski

    2013-12-01

    Full Text Available The objectives of this study were to evaluate the usefulness of DArT markers in genotypic identification of willow species and describe genetic relationships between four willow species: Salix viminalis, S. purpurea, S. alba and S. triandra. The experimental plant material comprised 53 willow genotypes of these four species, which are popularly grown in Poland. DArT markers seem to identify Salix species with a high degree of accuracy. As a result, the examined species were divided into four distinct groups which corresponded to the four analyzed species. In our study, we observed that S. triandra was very different genetically from the other species, including S. alba which is generally classified into the same subgenus of Salix. The above corroborates the findings of other authors who relied on molecular methods to reveal that the classification of S. triandra to the subgenus Salix was erroneous. The Principal Coordinate Analysis (PCoA and the neighbor-joining dendrogram also confirmed the clear division of the studied willow genotypes into four clusters corresponding to individual species. This confirmed the usefulness of DArT markers in taxonomic analyses and identification of willow species.

  18. Gisekia (Gisekiaceae): phylogenetic relationships, biogeography, and ecophysiology of a poorly known C₄ lineage in the Caryophyllales.

    Science.gov (United States)

    Bissinger, Kerstin; Khoshravesh, Roxanne; Kotrade, Jan Peter; Oakley, Jason; Sage, Tammy L; Sage, Rowan F; Hartmann, Heidrun E K; Kadereit, Gudrun

    2014-03-01

    Gisekiaceae are a monogeneric family of the core Caryophyllales distributed in arid regions of Africa and Asia. The only widespread species of the genus, Gisekia pharnaceoides, performs C4 photosynthesis based on CO2 compensation point measurements. This study investigates the C4 syndrome and its evolution in Gisekia. The infrageneric relationships, distribution and bioclimatic preferences of Gisekia are also investigated. Leaf gas exchange characteristics, activity of Rubisco and major C4 cycle enzymes, and ultrastructural characteristics of mesophyll and bundle sheath cells are studied for Gisekia pharnaceoides. δ(13)C values and leaf anatomy are analyzed for all species. A dated molecular phylogeny of 39 accessions representing all species of Gisekiaceae and 14 representatives of closely related core Caryophyllales families is generated using four cp markers and ITS. The precise current distribution and bioclimatic niche of Gisekia is assessed on the basis of 520 georeferenced specimen localities. All traditionally recognized species of Gisekia are C4 plants with atriplicoid Kranz anatomy. Gisekia pharnaceoides uses the NAD-ME biochemical type. The molecular phylogeny demonstrated two East African clades nested within South African clades, demonstrating migration along the arid areas of eastern Africa during the Late Miocene/Pliocene Epochs. Most traditionally defined species are polyphyletic. Gisekia represents an isolated C4 lineage within core Caryophyllales dating back to the Miocene Epoch and probably spread along the African arid corridor from a South African center of origin. The seven currently recognized species should be treated as one polymorphic species or species complex, Gisekia pharnaceoides agg.

  19. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  20. Exploring the potential of small RNA subunit and ITS sequences for resolving phylogenetic relationships within the phylum Ctenophora.

    Science.gov (United States)

    Simion, Paul; Bekkouche, Nicolas; Jager, Muriel; Quéinnec, Eric; Manuel, Michaël

    2015-04-01

    Ctenophores are a phylum of non-bilaterian marine (mostly planktonic) animals, characterised by several unique synapomorphies (e.g., comb rows, apical organ). Relationships between and within the nine recognised ctenophore orders are far from understood, notably due to a paucity of phylogenetically informative anatomical characters. Previous attempts to address ctenophore phylogeny using molecular data (18S rRNA) led to poorly resolved trees but demonstrated the paraphyly of the order Cydippida. Here we compiled an updated 18S rRNA data set, notably including a few newly sequenced species representing previously unsampled families (Lampeidae, Euryhamphaeidae), and we constructed an additional more rapidly evolving ITS1 + 5.8S rRNA + ITS2 alignment. These data sets were analysed separately and in combination under a probabilistic framework, using different methods (maximum likelihood, Bayesian inference) and models (e.g., doublet model to accommodate secondary structure; data partitioning). An important lesson from our exploration of these datasets is that the fast-evolving internal transcribed spacer (ITS) regions are useful markers for reconstructing high-level relationships within ctenophores. Our results confirm the paraphyly of the order Cydippida (and thus a "cydippid-like" ctenophore common ancestor) and suggest that the family Mertensiidae could be the sister group of all other ctenophores. The family Lampeidae (also part of the former "Cydippida") is probably the sister group of the order Platyctenida (benthic ctenophores). The order Beroida might not be monophyletic, due to the position of Beroe abyssicola outside of a clade grouping the other Beroe species and members of the "Cydippida" family Haeckeliidae. Many relationships (e.g. between Pleurobrachiidae, Beroida, Cestida, Lobata, Thalassocalycida) remain unresolved. Future progress in understanding ctenophore phylogeny will come from the use of additional rapidly evolving markers and improvement of

  1. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  2. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Study on phylogenetic relationships, variability, and correlated mutations in M2 proteins of influenza virus A.

    Directory of Open Access Journals (Sweden)

    Ly Le

    Full Text Available M2 channel, an influenza virus transmembrane protein, serves as an important target for antiviral drug design. There are still discordances concerning the role of some residues involved in proton transfer as well as the mechanism of inhibition by commercial drugs. The viral M2 proteins show high conservativity; about 3/4 of the positions are occupied by one residue in over 95%. Nine M2 proteins from the H3N2 strain and possibly two proteins from H2N2 strains make a phylogenic cluster closely related to 2RLF. The variability range is limited to 4 residues/position with one exception. The 2RLF protein stands out by the presence of 2 serines at the positions 19 and 50, which are in most other M2 proteins occupied by cysteines. The study of correlated mutations shows that there are several positions with significant mutational correlation that have not been described so far as functionally important. That there are 5 more residues potentially involved in the M2 mechanism of action. The original software used in this work (Consensus Constructor, SSSSg, Corm, Talana is freely accessible as stand-alone offline applications upon request to the authors. The other software used in this work is freely available online for noncommercial purposes at public services on bioinformatics such as ExPASy or NCBI. The study on mutational variability, evolutionary relationship, and correlated mutation presented in this paper is a potential way to explain more completely the role of significant factors in proton channel action and to clarify the inhibition mechanism by specific drugs.

  4. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand

    Directory of Open Access Journals (Sweden)

    Kittisak Buddhachat

    2018-01-01

    Full Text Available Taxonomic uncertainty of the Asian tree frog Polypedates leucomystax complex presents the challenging task of inferring its biogeographical history. Here, we describe its dispersion and the genetic relationships among different populations in Thailand, where we connect the population of the P. leucomystax complex of the Sunda Islands to the Indochina (mainland population based on analyses of 266 sequences of the mitochondrial cytochrome c oxidase subunit I (COI gene. Our maternal genealogy implies that there are four well-supported lineages in Thailand, consisting of Northern A (clade A: Polypedates sp., Nan (clade B: P. cf. impresus, Southern (clade C: P. cf. leucomystax and Northern D (clade D: P. cf. megacephalus, with Bayesian posterior probability >0.9. Phylogeny and haplotype networks indicate that clades A, B and D are sympatric. In contrast, clade C (P. cf. leucomystax and clade D (P. cf. megacephalus are genetically divergent due to the geographical barrier of the Isthmus of Kra, resulting in an allopatric distribution. Climatic conditions, in particular differences in rainfall on each side of the Isthmus of Kra, may play an important role in limiting the immigration of both clades. For the within-populations of either clades C or D, there was no significant correlation between geographic and genetic distance by the isolation-by-distance test, indicating intraspecific-dispersal of each clade. Population expansion occurred in clade C, whereas clade D showed a constant population. Taken together, the P. leucomystax complex in South East Asia may have diversified under climatic pressure, leading to allopatric and/or sympatric speciation.

  5. Phylogenetic relationships of the anoplocephaline cestodes of Australasian marsupials and resurrection of the genus Wallabicestus Schmidt, 1975.

    Science.gov (United States)

    Hardman, L M; Haukisalmi, V; Beveridge, I

    2012-05-01

    A phylogenetic analysis was carried out on rDNA of 45 species of anoplocephaline cestodes from marsupial hosts. The exclusively Australasian genera Progamotaenia Nybelin, 1917, Triplotaenia Boas, 1902, Paramoniezia Maplestone & Southwell, 1923 and Phascolotaenia Beveridge, 1976 formed a monophyletic clade, and the previously suggested relationship between the Australasian species of the cosmopolitan genus Bertiella Stiles & Hassall, 1902 and species of Progamotaenia was supported. A low degree of phyletic co-evolution was detected within endemic Australasian clades. Colonisation rather than co-speciation appeared to be the principal means of diversification within the Australasian anoplocephaline radiation. The clade of bile duct-inhabiting Progamotaenia species emphasises the role of microhabitat rather than host species as a driver of speciation. Triplotaenia undosa Beveridge, 1976 described from a wide variety of macropodid hosts was found to be polyphyletic and a proposition was made to resurrect Wallabicestus Schmidt, 1975, with W. ewersi Schmidt, 1975 as the type-species and including W. ualabati (Beveridge, 2009) n. comb. [previously Progamotaenia ualabati Beveridge, 2009].

  6. Genetic diversity and phylogenetic relationships of seven Amorphophallus species in southwestern China revealed by chloroplast DNA sequences.

    Science.gov (United States)

    Gao, Yong; Yin, Si; Yang, Huixiao; Wu, Lifang; Yan, Yuehui

    2017-07-15

    Plants species in the genus Amorphophallus are of great economic importance, as they are the only plants known to produce glucomannan. Although southwestern China has been recognized as one of the origin centres of Amorphophallus, only a few studies assessing its genetic diversity have been reported. To aid in the utilization and conservation of Amorphophallus species, we evaluated the genetic diversity and phylogenetic relationships among seven edible Amorphophallus species using three chloroplast DNA regions (rbcL, trnL and trnK-matK). The results showed that the genetic diversity at the population level was relatively low, with over half of the populations harbouring only one haplotype. The widely scattered species, A. konjac, had the largest genetic diversity, while the narrow endemic species, A. yuloensis, possessed only one haplotype. Phylogeny analysis identified three well-supported major lineages. Our study suggested that habitat fragmentation might be a driver of the genetic variation patterns within and between populations of Amorphophallus. A conservation strategy consisting of in situ conservation and germplasm collection is recommended.

  7. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  8. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  9. Arthropod Phylogenetics in Light of Three Novel Millipede (Myriapoda: Diplopoda) Mitochondrial Genomes with Comments on the Appropriateness of Mitochondrial Genome Sequence Data for Inferring Deep Level Relationships

    Science.gov (United States)

    Brewer, Michael S.; Swafford, Lynn; Spruill, Chad L.; Bond, Jason E.

    2013-01-01

    Background Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. Results The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. Conclusions The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the

  10. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  11. Phylogenetic relationships and biogeography of the groundwater-dwelling amphipod genus Pseudoniphargus (Crustacea), with emphasis on the Iberian species

    NARCIS (Netherlands)

    Notenboom, Jos

    1988-01-01

    Numerical phylogenetic methods are applied in order to arrive at synapomorphic similarities between species of the stygobiont amphipod genus Pseudoniphargus. Character polarity is assessed by comparison with the relevant outgroups Parapseudoniphargus and Allomelita, within a cluster of presumedly

  12. Strong conservation of rhoptry-associated-protein-1 (RAP-1) locus organization and sequence among Babesia isolates infecting sheep from China (Babesia motasi-like phylogenetic group).

    Science.gov (United States)

    Niu, Qingli; Valentin, Charlotte; Bonsergent, Claire; Malandrin, Laurence

    2014-12-01

    Rhoptry-associated-protein 1 (RAP-1) is considered as a potential vaccine candidate due to its involvement in red blood cell invasion by parasites in the genus Babesia. We examined its value as a vaccine candidate by studying RAP-1 conservation in isolates of Babesia sp. BQ1 Ningxian, Babesia sp. Tianzhu and Babesia sp. Hebei, responsible for ovine babesiosis in different regions of China. The rap-1 locus in these isolates has very similar features to those described for Babesia sp. BQ1 Lintan, another Chinese isolate also in the B. motasi-like phylogenetic group, namely the presence of three types of rap-1 genes (rap-1a, rap-1b and rap-1c), multiple conserved rap-1b copies (5) interspaced with more or less variable rap-1a copies (6), and the 3' localization of one rap-1c. The isolates Babesia sp. Tianzhu, Babesia sp. BQ1 Lintan and Ningxian were almost identical (average nucleotide identity of 99.9%) over a putative locus of about 31 Kb, including the intergenic regions. Babesia sp. Hebei showed a similar locus organization but differed in the rap-1 locus sequence, for each gene and intergenic region, with an average nucleotide identity of 78%. Our results are in agreement with 18S rDNA phylogenetic studies performed on these isolates. However, in extremely closely related isolates the rap-1 locus seems more conserved (99.9%) than the 18S rDNA (98.7%), whereas in still closely related isolates the identities are much lower (78%) compared with the 18S rDNA (97.7%). The particularities of the rap-1 locus in terms of evolution, phylogeny, diagnosis and vaccine development are discussed. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Phylogenetic Relationships among Species of Phellinus sensu stricto, Cause of White Trunk Rot of Hardwoods, from Northern North America

    OpenAIRE

    Nicholas J. Brazee

    2015-01-01

    Species in Phellinus s.s. are some of the most important wood-decaying fungal pathogens in northern temperate forests, yet data on species incidence in North America remains limited. Therefore, phylogenetic analyses were performed using four loci (ITS, nLSU, tef1 and rpb2) with isolates representing 13 species. Results of phylogenetic analyses using maximum likelihood and Bayesian inference revealed that eight species of Phellinus s.s. occur in North America, and include: P. alni, P. arctost...

  14. Phylogenetic Relationships, Breeding Implications, and Cultivation History of Hawaiian Taro (Colocasia Esculenta) Through Genome-Wide SNP Genotyping.

    Science.gov (United States)

    Helmkampf, Martin; Wolfgruber, Thomas K; Bellinger, M Renee; Paudel, Roshan; Kantar, Michael B; Miyasaka, Susan C; Kimball, Heather L; Brown, Ashley; Veillet, Anne; Read, Andrew; Shintaku, Michael

    2018-03-16

    Taro, Colocasia esculenta, is one of the world's oldest root crops and is of particular economic and cultural significance in Hawai'i, where historically more than 150 different landraces were grown. We developed a genome-wide set of more than 2400 high-quality single nucleotide polymorphism (SNP) markers from 70 taro accessions of Hawaiian, South Pacific, Palauan, and mainland Asian origins, with several objectives: 1) uncover the phylogenetic relationships between Hawaiian and other Pacific landraces, 2) shed light on the history of taro cultivation in Hawai'i, and 3) develop a tool to discriminate among Hawaiian and other taros. We found that almost all existing Hawaiian landraces fall into 5 monophyletic groups that are largely consistent with the traditional Hawaiian classification based on morphological characters, for example, leaf shape and petiole color. Genetic diversity was low within these clades but considerably higher between them. Population structure analyses further indicated that the diversification of taro in Hawai'i most likely occurred by a combination of frequent somatic mutation and occasional hybridization. Unexpectedly, the South Pacific accessions were found nested within the clades mainly composed of Hawaiian accessions, rather than paraphyletic to them. This suggests that the origin of clades identified here preceded the colonization of Hawai'i and that early Polynesian settlers brought taro landraces from different clades with them. In the absence of a sequenced genome, this marker set provides a valuable resource towards obtaining a genetic linkage map and to study the genetic basis of phenotypic traits of interest to taro breeding such as disease resistance.

  15. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Phylogenetic relationships within Echinococcus and Taenia tapeworms (Cestoda: Taeniidae): an inference from nuclear protein-coding genes.

    Science.gov (United States)

    Knapp, Jenny; Nakao, Minoru; Yanagida, Tetsuya; Okamoto, Munehiro; Saarma, Urmas; Lavikainen, Antti; Ito, Akira

    2011-12-01

    The family Taeniidae of tapeworms is composed of two genera, Echinococcus and Taenia, which obligately parasitize mammals including humans. Inferring phylogeny via molecular markers is the only way to trace back their evolutionary histories. However, molecular dating approaches are lacking so far. Here we established new markers from nuclear protein-coding genes for RNA polymerase II second largest subunit (rpb2), phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold). Bayesian inference and maximum likelihood analyses of the concatenated gene sequences allowed us to reconstruct phylogenetic trees for taeniid parasites. The tree topologies clearly demonstrated that Taenia is paraphyletic and that the clade of Echinococcus oligarthrus and Echinococcusvogeli is sister to all other members of Echinococcus. Both species are endemic in Central and South America, and their definitive hosts originated from carnivores that immigrated from North America after the formation of the Panamanian land bridge about 3 million years ago (Ma). A time-calibrated phylogeny was estimated by a Bayesian relaxed-clock method based on the assumption that the most recent common ancestor of E. oligarthrus and E. vogeli existed during the late Pliocene (3.0 Ma). The results suggest that a clade of Taenia including human-pathogenic species diversified primarily in the late Miocene (11.2 Ma), whereas Echinococcus started to diversify later, in the end of the Miocene (5.8 Ma). Close genetic relationships among the members of Echinococcus imply that the genus is a young group in which speciation and global radiation occurred rapidly. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  18. Archigregarines of the English Channel revisited: New molecular data on Selenidium species including early described and new species and the uncertainties of phylogenetic relationships.

    Directory of Open Access Journals (Sweden)

    Sonja Rueckert

    Full Text Available Gregarines represent an important transition step from free-living predatory (colpodellids s.l. and/or photosynthetic (Chromera and Vitrella apicomplexan lineages to the most important pathogens, obligate intracellular parasites of humans and domestic animals such as coccidians and haemosporidians (Plasmodium, Toxoplasma, Eimeria, Babesia, etc.. While dozens of genomes of other apicomplexan groups are available, gregarines are barely entering the molecular age. Among the gregarines, archigregarines possess a unique mixture of ancestral (myzocytosis and derived (lack of apicoplast, presence of subpellicular microtubules features.In this study we revisited five of the early-described species of the genus Selenidium including the type species Selenidium pendula, with special focus on surface ultrastructure and molecular data. We were also able to describe three new species within this genus. All species were characterized at morphological (light and scanning electron microscopy data and molecular (SSU rDNA sequence data levels. Gregarine specimens were isolated from polychaete hosts collected from the English Channel near the Station Biologique de Roscoff, France: Selenidium pendula from Scolelepis squamata, S. hollandei and S. sabellariae from Sabellaria alveolata, S. sabellae from Sabella pavonina, Selenidium fallax from Cirriformia tentaculata, S. spiralis sp. n. and S. antevariabilis sp. n. from Amphitritides gracilis, and S. opheliae sp. n. from Ophelia roscoffensis. Molecular phylogenetic analyses of these data showed archigregarines clustering into five separate clades and support previous doubts about their monophyly.Our phylogenies using the extended gregarine sampling show that the archigregarines are indeed not monophyletic with one strongly supported clade of Selenidium sequences around the type species S. pendula. We suggest the revision of the whole archigregarine taxonomy with only the species within this clade remaining in the genus

  19. Evaluation of the Start Strong initiative: preventing teen dating violence and promoting healthy relationships among middle school students.

    Science.gov (United States)

    Miller, Shari; Williams, Jason; Cutbush, Stacey; Gibbs, Deborah; Clinton-Sherrod, Monique; Jones, Sarah

    2015-02-01

    This study reports on an independent evaluation of Start Strong: Building Healthy Teen Relationships, a multicomponent initiative targeting 11- to 14-year-olds. "Start Strong" was designed to focus on the developmental needs of middle school students and to enhance skills and attitudes consistent with promotion of healthy relationships and reduction of teen dating violence (TDV). The quasi-experimental evaluation design included data collection from four Start Strong schools and four comparison schools. Student surveys were collected at four waves of data at the beginning and the end of grades 7 and 8. Multilevel models used repeated observations nested within students who were, in turn, nested within schools to determine whether participation in Start Strong enhanced healthy skills and relationships and decreased TDV-related attitudes and behaviors. Short-term effects from waves 1 to 2 were statistically significant for increased parent-child communication and boy/girlfriend relationship satisfaction and support and decreased gender stereotypes and attitudes supporting TDV. Findings for acceptance of TDV and gender stereotypes persisted longitudinally. Results are promising and illustrate that a multicomponent, community-based initiative reduced risk factors predictive of TDV. Start Strong is innovative in its focus on early adolescence, which is a critical period in the transition to dating. The results inform future intervention efforts and underscore the need for further study of middle school students. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.

  20. The Effects of Building Strong Families: A Healthy Marriage and Relationship Skills Education Program for Unmarried Parents

    Science.gov (United States)

    Wood, Robert G.; McConnell, Sheena; Moore, Quinn; Clarkwest, Andrew; Hsueh, JoAnn

    2012-01-01

    This article examines the impacts of Building Strong Families, a healthy marriage and relationship skills education program serving unmarried parents who were expecting or had recently had a baby. Based on a random assignment research design, the analysis uses survey data from more than 4,700 couples across eight research sites to estimate program…

  1. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  2. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  3. Phylogenetic relationships of the Gorgoderidae (Platyhelminthes: Trematoda), including the proposal of a new subfamily (Degeneriinae n. subfam.).

    Science.gov (United States)

    Cutmore, Scott C; Miller, Terrence L; Curran, Stephen S; Bennett, Michael B; Cribb, Thomas H

    2013-08-01

    Phylogenetic analyses of a range of gorgoderid trematodes based on ITS2 and partial 28S rDNA data lead us to propose the Degeneriinae n. subfam. for the genus Degeneria in recognition of its phylogenetic isolation and distinctive morphology and biology. The current concepts of the subfamilies Anaporrhutinae and Gorgoderinae were supported. Within the Gorgoderinae, the large genus Phyllodistomum is shown to be paraphyletic relative to Pseudophyllodistomum and Xystretrum. Notably, the clade of marine Phyllodistomum does not form a clade with the other marine genus, Xystretrum. Distinct clades within the Gorgoderinae correspond variously to identity of first intermediate host, form of cercaria and their marine or freshwater habitat. We are not yet in a position to propose separate genera for these clades.

  4. Phylogenetic relationships within the family Halomonadaceae based on comparative 23S and 16S rRNA gene sequence analysis.

    Science.gov (United States)

    de la Haba, Rafael R; Arahal, David R; Márquez, M Carmen; Ventosa, Antonio

    2010-04-01

    A phylogenetic study of the family Halomonadaceae was carried out based on complete 16S rRNA and 23S rRNA gene sequences. Several 16S rRNA genes of type strains were resequenced, and 28 new sequences of the 23S rRNA gene were obtained. Currently, the family includes nine genera (Carnimonas, Chromohalobacter, Cobetia, Halomonas, Halotalea, Kushneria, Modicisalibacter, Salinicola and Zymobacter). These genera are phylogenetically coherent except Halomonas, which is polyphyletic. This genus comprises two clearly distinguished clusters: group 1 includes Halomonas elongata (the type species) and the species Halomonas eurihalina, H. caseinilytica, H. halmophila, H. sabkhae, H. almeriensis, H. halophila, H. salina, H. organivorans, H. koreensis, H. maura and H. nitroreducens. Group 2 comprises the species Halomonas aquamarina, H. meridiana, H. axialensis, H. magadiensis, H. hydrothermalis, H. alkaliphila, H. venusta, H. boliviensis, H. neptunia, H. variabilis, H. sulfidaeris, H. subterranea, H. janggokensis, H. gomseomensis, H. arcis and H. subglaciescola. Halomonas salaria forms a cluster with Chromohalobacter salarius and the recently described genus Salinicola, and their taxonomic affiliation requires further study. More than 20 Halomonas species are phylogenetically not within the core constituted by the Halomonas sensu stricto cluster (group 1) or group 2 and, since their positions on the different phylogenetic trees are not stable, they cannot be recognized as additional groups either. In general, there is excellent agreement between the phylogenies based on the two rRNA gene sequences, but the 23S rRNA gene showed higher resolution in the differentiation of species of the family Halomonadaceae.

  5. Redescription and phylogenetic relationships of Solenodonsaurus janenschi Broili, 1924, from the Late Carboniferous of Nýřany, Czech Republic

    OpenAIRE

    Danto, M.; Witzmann, F.; Müller, J.

    2012-01-01

    The basal tetrapod Solenodonsaurus janenschi Broili, 1924, from Nýřany (Westphalian D, Late Carboniferous), Czech Republic, is redescribed and its phylogenetic position reevaluated. A distinct groove at the base of the maxillary teeth is regarded as an autapomorphic character, which is present in both the large and small specimens. Other characteristic features, which are not unique to S. janenschi, are: an extension of the lacrimal that forms the anteroventral margin of the orbit; a long pos...

  6. Phylogenetic relationships among members of the Fusarium solani species complex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov

    DEFF Research Database (Denmark)

    Short, Dylan P.G.; O’Donnell, Kerry; Thrane, Ulf

    2013-01-01

    Fusarium species are frequently associated with mycotic keratitis and, to a lesser extent, cases of localized and disseminated infections. The Fusarium solani species complex (FSSC) is the most common group of fusaria associated with human infectious diseases. Several studies to date have revealed...... dozens of strongly supported phylogenetic species within this important evolutionary clade, though little work has been done to improve the taxonomy and understanding of the reproductive mode and phenotypes of the predominant clinically relevant species. Here we described Fusarium keratoplasticum sp. nov...

  7. Karyotype Evolution and Phylogenetic Relationships of Cricetulus sokolovi Orlov et Malygin 1988 (Cricetidae, Rodentia) Inferred from Chromosomal Painting and Molecular Data.

    Science.gov (United States)

    Poplavskaya, Natalia S; Romanenko, Svetlana A; Serdyukova, Natalia A; Trifonov, Vladimir A; Yang, Fengtang; Nie, Wenhui; Wang, Jinghuan; Bannikova, Anna A; Surov, Alexey V; Lebedev, Vladimir S

    2017-01-01

    Sokolov's dwarf hamster (Cricetulus sokolovi) is the least studied representative of the striped hamsters (Cricetulus barabensis species group), the taxonomy of which remains controversial. The species was described based on chromosome morphology, but neither the details of the karyotype nor the phylogenetic relationships with other Cricetulus are known. In the present study, the karyotype of C. sokolovi was examined using cross-species chromosome painting. Molecular and cytogenetic data were employed to determine the phylogenetic position of Sokolov's hamster and to analyze the potential pathways of chromosome evolution in Cricetulus. Both the chromosome and molecular data support the species status of Sokolov's hamster. Phylogenetic analysis of the CYTB data placed C. sokolovi as sister to all other striped hamsters (sequence divergence of 8.1%). FISH data revealed that the karyotype of C. sokolovi is highly rearranged, with the most parsimonious scenario of its origin implying at least 4 robertsonian events and a centromere shift. Comparative cytogenetic data on Cricetinae suggest that their evolutionary history includes both periods of chromosomal conservatism and episodes of rapid chromosomal change. © 2017 S. Karger AG, Basel.

  8. Complete mitochondrial genome sequence of Tridentiger bifasciatus and Tridentiger barbatus (Perciformes, Gobiidae): a mitogenomic perspective on the phylogenetic relationships of Gobiidae.

    Science.gov (United States)

    Jin, Xiaoxiao; Wang, Rixin; Wei, Tao; Tang, Da; Xu, Tianjun

    2015-01-01

    The fishes of suborder Gobioidei is the largest group of those in present living Perciformes, which contains about 2,200 species belonging to 270 genera of 9 families in the world. The monophyly and phylogenetic relationships of gobies have been controversial and disputable for a long time. In the present study, the complete mitochondrial genome of the shimofuri goby Tridentiger bifasciatus (T. bifasciatus) and shokihaze goby Tridentiger barbatus (T. barbatus) were firstly determined. The two mitochondrial genomes were both consisted of 2 ribosomal RNA (rRNA) genes, 13 protein-coding genes, 22 transfer RNA (tRNA) genes, and one major control region (CR). They shared similar features with those of other gobies in terms of gene arrangement, base composition, and tRNA structures. The CR was absence of typical conserved blocks (CSB-E, and CSB-F) respectively for the T. bifasciatus and T. barbatus. Phylogenomic analyses, which based on 12 concatenated protein-coding genes and complete mitochondrial genome sequences, revealed that there were two groups within the Gobiidae. A large group consisted of the Amblyopinae, Gobionellinae, Oxudercinae and Sicydiinae, and Amblyopinae was nested in Oxudercinae and they were both paraphyletic to Sicydiinae. The other group was the Gobiinae. As a whole, our phylogenetic data was different from the traditionally classification of Gobiidae, but supported the new phylogenetic taxonomy view of Thacker (Copeia 2009:93-104, 2009).

  9. Phylogenetic relationship of Paenibacillus species based on putative replication origin regions and analysis of an yheCD-like sequence found in this region.

    Science.gov (United States)

    Iiyama, Kazuhiro; Otao, Masahiro; Mori, Kazuki; Mon, Hiroaki; Lee, Jae Man; Kusakabe, Takahiro; Tashiro, Kousuke; Asano, Shin-Ichiro; Yasunaga-Aoki, Chisa

    2014-01-01

    To determine the phylogenetic relationship among Paenibacillus species, putative replication origin regions were compared. In the rsmG-gyrA region, gene arrangements in Paenibacillus species were identical to those of Bacillus species, with the exception of an open reading frame (orf14) positioned between gyrB and gyrA, which was observed only in Paenibacillus species. The orf14 product was homologous to the endospore-associated proteins YheC and YheD of Bacillus subtilis. Phylogenetic analysis based on the YheCD proteins suggested that Orf14 could be categorized into the YheC group. In the Paenibacillus genome, DnaA box clusters were found in rpmH-dnaA and dnaA-dnaN intergenic regions, known as box regions C and R, respectively; this localization was similar to that observed in B. halodurans. A phylogenetic tree based on the nucleotide sequences of the whole replication origin regions suggested that P. popilliae, P. thiaminolyticus, and P. dendritiformis are closely related species.

  10. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  11. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  12. Phylogenetic inferences on the relationship of North American and European Picea species based on nuclear ribosomal 18S sequences and the internal transcribed spacer 1 region.

    Science.gov (United States)

    Smith, D E; Klein, A S

    1994-03-01

    We have used PCR (polymerase chain reaction) to isolate nuclear ribosomal sequences from seven species of Picea (spruce). The amplified products contained approximately 200 base pairs from the 3' end of the 18S rRNA gene and the entire first internal transcribed spacer (ITS1). The sequences from these two functionally distinct regions were aligned and variable positions were used to construct a character matrix for cladistic-based phylogenetic analysis. Short insertions or deletions (indels) were common in the ITS1 and distinguished some intragenus phylogenetic relationships. In the present study, evolutionary relationships, based on DNA sequence variation within the ribosomal repeat, were determined for seven North American and European species of Picea. The results support the hypothesis of Wright (1955) that P. rubens and P. mariana are more closely related to the European species P. omorika than to other North American Picea. Molecular data suggest P. pungens has a closer relationship to eastern North American and European Picea than its presumed affiliation with northwestern American species.

  13. Familial Longevity Is Associated With Higher TSH Secretion and Strong TSH-fT3 Relationship

    DEFF Research Database (Denmark)

    Jansen, Steffy W; Roelfsema, Ferdinand; van der Spoel, Evie

    2015-01-01

    CONTEXT: Longevity is associated with changes in circulating levels of thyroid hormone (TH) and/or TSH in animals and humans, but underlying mechanisms remain elusive. OBJECTIVE: We explored in 38 offspring of nonagenarian participants from the Leiden Longevity Study, who are enriched for longevity...... properties of TSH. The temporal relationship between TSH and free T3 at zero delay was higher in offspring (0.48 ± 0.2) compared with partners (0.26 ± 0.4) (P = .05), but the feedback and forward interplay between TSH and TH did not differ. CONCLUSIONS: Familial longevity is associated with increased basal...

  14. Phylogenetic relationships of the endangered Shenandoah salamander (Plethodon shenandoah) and other salamanders of the Plethodon cinereus group (Caudata : Plethodontidae)

    Science.gov (United States)

    Sites, J.W.; Morando, M.; Highton, R.; Huber, F.; Jung, R.E.

    2004-01-01

    The Shenandoah salamander (Plethodon shenandoah), known from isolated talus slopes on three of the highest mountains in Shenandoah National Park, is listed as state-endangered in Virginia and federally endangered under the U.S. Endangered Species Act. A 1999 paper by G. R. Thurow described P. shenandoah-like salamanders from three localities further south in the Blue Ridge Physiographic Province, which, if confirmed, would represent a range extension for P. shenandoah of approximately 90 km from its nearest known locality. Samples collected from two of these three localities were included in a molecular phylogenetic study of the known populations of P. shenandoah, and all other recognized species in the Plethodon cinereus group, using a 792 bp region of the mitochondrial cytochrome-b gene. Phylogenetic estimates were based on Bayesian, maximum likelihood, and maximum parsimony methods and topologies examined for placement of the new P. shenandoah-like samples relative to all others. All topologies recovered all haplotypes of the P. shenandoah-like animals nested within P. cinereus, and a statistical comparison of the best likelihood tree topology with one with an enforced (Thurow + Shenandoah P. shenandoah) clade revealed that the unconstrained tree had a significantly lower -In L score (P < 0.05, using the Shimodaira-Hasegawa test) than the constraint tree. This result and other anecdotal information give us no solid reason to consider the Thurow report valid. The current recovery program for P. shenandoah should remain focused on populations in Shenandoah National Park.

  15. Redescription and phylogenetic relationships of Solenodonsaurus janenschi Broili, 1924, from the Late Carboniferous of Nýřany, Czech Republic

    Directory of Open Access Journals (Sweden)

    M. Danto

    2012-08-01

    Full Text Available The basal tetrapod Solenodonsaurus janenschi Broili, 1924, from Nýřany (Westphalian D, Late Carboniferous, Czech Republic, is redescribed and its phylogenetic position reevaluated. A distinct groove at the base of the maxillary teeth is regarded as an autapomorphic character, which is present in both the large and small specimens. Other characteristic features, which are not unique to S. janenschi, are: an extension of the lacrimal that forms the anteroventral margin of the orbit; a long posterior extension of the jugal; spool-shaped vertebrae, and small, wedge-like intercentra. A phylogenetic analysis based on the data matrix of Ruta, Coates and Quicke suggests that S. janenschi is the sister taxon of the Lepospondyli. Shared characters include the shape of the vertebrae, non-swollen neural arches, and absence of an intertemporal. Although nested within the amniote stem, S. janenschi is not as closely related to basal amniotes as previously suggested. A rather long, slender humerus argues for a predominantly terrestrial mode of life, and the curved, slender ribs, as well as the comparatively small skull, suggest costal ventilation of the lungs similar to that in amniotes, rather than buccal pumping. The morphology of the shallow squamosal embayment in which an ossified dorsal margin is absent, renders the presence of a tympanum unlikely. doi:10.1002/mmng.201200003

  16. Phylogenetic and Geographic Relationships of Severe Fever With Thrombocytopenia Syndrome Virus in China, South Korea, and Japan.

    Science.gov (United States)

    Yoshikawa, Tomoki; Shimojima, Masayuki; Fukushi, Shuetsu; Tani, Hideki; Fukuma, Aiko; Taniguchi, Satoshi; Singh, Harpal; Suda, Yuto; Shirabe, Komei; Toda, Shoichi; Shimazu, Yukie; Nomachi, Taro; Gokuden, Mutsuyo; Morimitsu, Toshiharu; Ando, Katsuyuki; Yoshikawa, Akira; Kan, Miki; Uramoto, Marina; Osako, Hideo; Kida, Kouji; Takimoto, Hirokazu; Kitamoto, Hiroaki; Terasoma, Fumio; Honda, Akiko; Maeda, Ken; Takahashi, Toru; Yamagishi, Takuya; Oishi, Kazunori; Morikawa, Shigeru; Saijo, Masayuki

    2015-09-15

    Severe fever with thrombocytopenia syndrome (SFTS) is a tick-borne acute infectious disease caused by the SFTS virus (SFTSV). SFTS has been reported in China, South Korea, and Japan as a novel Bunyavirus. Although several molecular epidemiology and phylogenetic studies have been performed, the information obtained was limited, because the analyses included no or only a small number of SFTSV strains from Japan. The nucleotide sequences of 75 SFTSV samples in Japan were newly determined directly from the patients' serum samples. In addition, the sequences of 7 strains isolated in vitro were determined and compared with those in the patients' serum samples. More than 90 strains that were identified in China, 1 strain in South Korea, and 50 strains in Japan were phylogenetically analyzed. The viruses were clustered into 2 clades, which were consistent with the geographic distribution. Three strains identified in Japan were clustered in the Chinese clade, and 4 strains identified in China and 26 in South Korea were clustered in the Japanese clade. Two clades of SFTSV may have evolved separately over time. On rare occasions, the viruses were transmitted overseas to the region in which viruses of the other clade were prevalent. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Phylogenetic Relationships among Species of Phellinus sensu stricto, Cause of White Trunk Rot of Hardwoods, from Northern North America

    Directory of Open Access Journals (Sweden)

    Nicholas J. Brazee

    2015-11-01

    Full Text Available Species in Phellinus s.s. are some of the most important wood-decaying fungal pathogens in northern temperate forests, yet data on species incidence in North America remains limited. Therefore, phylogenetic analyses were performed using four loci (ITS, nLSU, tef1 and rpb2 with isolates representing 13 species. Results of phylogenetic analyses using maximum likelihood and Bayesian inference revealed that eight species of Phellinus s.s. occur in North America, and include: P. alni, P. arctostaphyli, P. betulinus, P. lundellii, P. nigricans, P. tremulae and two undescribed species, P. NA1 and P. NA2. Meanwhile, P. tuberculosus, P. igniarius s.s., P. populicola, P. laevigatus s.s. and P. orienticus were not detected and appear restricted to Europe and/or Asia. The tef1 dataset outperformed all other loci used and was able to discriminate among all 13 of the currently known Phellinus s.s. species with significant statistical support. The internal transcribed spacer (ITS region performed well but a high level of intraspecific variation could lead to inflated taxa recognition. Phellinus alni exhibited the broadest host range, as demonstrated previously, and appears to be the most common species in northern hardwood (Acer-Betula-Fagus, northern floodplain (Fraxinus-Populus-Ulmus and coastal alder (Alnus forests of North America.

  18. Comparative genome analysis and phylogenetic relationship of order Liliales insight from the complete plastid genome sequences of two Lilies (Lilium longiflorum and Alstroemeria aurea).

    Science.gov (United States)

    Kim, Jung Sung; Kim, Joo-Hwan

    2013-01-01

    Monocots are one of the most diverse, successful and economically important clades of angiosperms. We attempt to analyse the complete plastid genome sequences of two lilies and their lengths were 152,793bp in Lilium longiflorum (Liliaceae) and 155,510bp in Alstroemeria aurea (Alstroemeriaceae). Phylogenetic analyses were performed for 28 taxa including major lineages of monocots using the sequences of 79 plastid genes for clarifying the phylogenetic relationship of the order Liliales. The sister relationship of Liliales and Asparagales-commelinids was improved with high resolution. Comparative analyses of inter-familial and inter-specific sequence variation were also carried out among three families of Liliaceae, Smilacaceae, and Alstroemeriaceae, and between two Lilium species of L. longflorum and L. superbum. Gene content and order were conserved in the order Liliales except infA loss in Smilax and Alstroemeria. IR boundaries were similar in IRa, however, IRb showed different extension patterns as JLB of Smilax and JSB in Alstroemeria. Ka/Ks ratio was high in matK among the pair-wise comparison of three families and the most variable genes were psaJ, ycf1, rpl32, rpl22, matK, and ccsA among the three families and rps15, rpoA, matK, and ndhF between Lilium.

  19. Comparative genome analysis and phylogenetic relationship of order Liliales insight from the complete plastid genome sequences of two Lilies (Lilium longiflorum and Alstroemeria aurea.

    Directory of Open Access Journals (Sweden)

    Jung Sung Kim

    Full Text Available Monocots are one of the most diverse, successful and economically important clades of angiosperms. We attempt to analyse the complete plastid genome sequences of two lilies and their lengths were 152,793bp in Lilium longiflorum (Liliaceae and 155,510bp in Alstroemeria aurea (Alstroemeriaceae. Phylogenetic analyses were performed for 28 taxa including major lineages of monocots using the sequences of 79 plastid genes for clarifying the phylogenetic relationship of the order Liliales. The sister relationship of Liliales and Asparagales-commelinids was improved with high resolution. Comparative analyses of inter-familial and inter-specific sequence variation were also carried out among three families of Liliaceae, Smilacaceae, and Alstroemeriaceae, and between two Lilium species of L. longflorum and L. superbum. Gene content and order were conserved in the order Liliales except infA loss in Smilax and Alstroemeria. IR boundaries were similar in IRa, however, IRb showed different extension patterns as JLB of Smilax and JSB in Alstroemeria. Ka/Ks ratio was high in matK among the pair-wise comparison of three families and the most variable genes were psaJ, ycf1, rpl32, rpl22, matK, and ccsA among the three families and rps15, rpoA, matK, and ndhF between Lilium.

  20. Primary structures of skin antimicrobial peptides indicate a close, but not conspecific, phylogenetic relationship between the leopard frogs Lithobates onca and Lithobates yavapaiensis (Ranidae).

    Science.gov (United States)

    Conlon, J Michael; Coquet, Laurent; Leprince, Jérôme; Jouenne, Thierry; Vaudry, Hubert; King, Jay D

    2010-04-01

    The phylogenetic relationship between the relict leopard frog Lithobates (Rana) onca (Cope, 1875) and the lowland leopard frog Lithobates (Rana) yavapaiensis (Platz and Frost, 1984) is unclear. Chromatographic analysis of norepinephrine-stimulated skin secretions from L. onca led to the identification of six peptides with antimicrobial activity. Determination of their primary structures indicated that four of the peptides were identical to brevinin-1Ya, brevinin-1Yb, brevinin-1Yc and ranatuerin-2Ya previously isolated from skin secretions of L. yavapaiensis. However, a peptide belonging to the temporin family (temporin-ONa: FLPTFGKILSGLF.NH(2)) and an atypical member of the ranatuerin-2 family containing a C-terminal cyclic heptapeptide domain (ranatuerin-2ONa: GLMDTVKNAAKNLAGQMLDKLKCKITGSC) were isolated from the L. onca secretions but were not present in the L. yavapaiensis secretions. Ranatuerin-2ONa inhibited the growth of Escherichia coli (MIC=50muM) and Candida albicans (MIC=100muM ) and showed hemolytic activity (LC(50)=90muM) but was inactive against Staphylococcus aureus. The data indicate a close phylogenetic relationship between L. onca and L. yavapaiensis but suggest that they are not conspecific species.

  1. Earthquake clustering in modern seismicity and its relationship with strong historical earthquakes around Beijing, China

    Science.gov (United States)

    Wang, Jian; Main, Ian G.; Musson, Roger M. W.

    2017-11-01

    Beijing, China's capital city, is located in a typical intraplate seismic belt, with relatively high-quality instrumental catalogue data available since 1970. The Chinese historical earthquake catalogue contains six strong historical earthquakes of Ms ≥ 6 around Beijing, the earliest in 294 AD. This poses a significant potential hazard to one of the most densely populated and economically active parts of China. In some intraplate areas, persistent clusters of events associated with historical events can occur over centuries, for example, the ongoing sequence in the New Madrid zone of the eastern US. Here we will examine the evidence for such persistent clusters around Beijing. We introduce a metric known as the `seismic density index' that quantifies the degree of clustering of seismic energy release. For a given map location, this multi-dimensional index depends on the number of events, their magnitudes, and the distances to the locations of the surrounding population of earthquakes. We apply the index to modern instrumental catalogue data between 1970 and 2014, and identify six clear candidate zones. We then compare these locations to earthquake epicentre and seismic intensity data for the six largest historical earthquakes. Each candidate zone contains one of the six historical events, and the location of peak intensity is within 5 km or so of the reported epicentre in five of these cases. In one case—the great Ms 8 earthquake of 1679—the peak is closer to the area of strongest shaking (Intensity XI or more) than the reported epicentre. The present-day event rates are similar to those predicted by the modified Omori law but there is no evidence of ongoing decay in event rates. Accordingly, the index is more likely to be picking out the location of persistent weaknesses in the lithosphere. Our results imply zones of high seismic density index could be used in principle to indicate the location of unrecorded historical of palaeoseismic events, in China and

  2. First Record of Orobdella tsushimensis (Hirudinida: Arhynchobdellida: Gastrostomobdellidae from the Korean Peninsula and Molecular Phylogenetic Relationships of the Specimens

    Directory of Open Access Journals (Sweden)

    Nakano, Takafumi

    2014-04-01

    Full Text Available Specimens of the genus Orobdella Oka, 1895 from Korea, including various locations in the Korean Peninsula, were identified as Orobdella tsushimensis Nakano, 2011. Phylogenetic analyses using mitochondrial cytochrome oxidase subunit 1 (COI, ND1, $tRNA^{Cys}$ 수식 이미지, $tRNA^{Met}$ 수식 이미지, 12S rRNA, $tRNA^{val}$ 수식 이미지, and 16S rRNA markers show that the newly collected specimens form a monophyletic group with the known O. tsushimensis specimens. The genetic distance of COI of these specimens was in the range 0.4-6.6%. These results confirm that the newly collected specimens belong to O. tsushimensis. This is the first record of the genus Orobdella from the Korean Peninsula.

  3. A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate.

    Science.gov (United States)

    Bracho, Maria Alma; Carrillo-Cruz, Francy Yolima; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    Hepatitis C virus (HCV) is the leading cause of chronic liver disease and is associated with hepatocellular carcinoma. However, there have been few studies on the distribution and genetic diversity of HCV isolates in non-developed countries. Here, the complete genome sequence of an HCV genotype 1 isolate from Equatorial Guinea is reported, the first complete HCV-1 genome of African origin. Phylogenetic analysis revealed that this sequence always grouped with sequences of genotype 1, but did not group clearly with any subtype described so far. An analysis of partial NS5B gene sequences with additional sequences of African origin also failed to find close similarities between the new sequence and any previously known isolate. Genetic divergence of the coding region of this new sequence with respect to the recognized subtypes of HCV-1 ranged from 20 to 22%. It is proposed that this isolate is a representative of a new, distinct variant of HCV subtype 1.

  4. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.

    2014-08-13

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  5. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of AsianJuglansSpecies Using Restriction Site-Associated DNA-Sequencing.

    Science.gov (United States)

    Mu, Xian-Yun; Sun, Miao; Yang, Pei-Fang; Lin, Qin-Wen

    2017-01-01

    Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans , five species are widely distributed in China. The most famous of these is Mahetao ( J. hopeiensis ), which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica . However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans . Additionally, J. ailantifolia, J. cathayensis , and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  6. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  7. Molecular systematics of South American dolphins Sotalia: sister taxa determination and phylogenetic relationships, with insights into a multi-locus phylogeny of the Delphinidae.

    Science.gov (United States)

    Caballero, Susana; Jackson, Jennifer; Mignucci-Giannoni, Antonio A; Barrios-Garrido, Héctor; Beltrán-Pedreros, Sandra; Montiel-Villalobos, Mari A G; Robertson, Kelly M; Baker, C Scott

    2008-01-01

    The evolutionary relationships among members of the cetacean family Delphinidae, the dolphins, pilot whales and killer whales, are still not well understood. The genus Sotalia (coastal and riverine South American dolphins) is currently considered a member of the Stenoninae subfamily, along with the genera Steno (rough toothed dolphin) and Sousa (humpbacked dolphin). In recent years, a revision of this classification was proposed based on phylogenetic analysis of the mitochondrial gene cytochrome b, wherein Sousa was included in the Delphininae subfamily, keeping only Steno and Sotalia as members of the Stenoninae subfamily. Here we investigate the phylogenetic placement of Sotalia using two mitochondrial genes, six autosomal introns and four Y chromosome introns, providing a total of 5,196 base pairs (bp) for each taxon in the combined dataset. Sequences from these genomic regions were obtained for 17 delphinid species, including at least one species from each of five or six currently recognized subfamilies plus five odontocete outgroup species. Maximum Parsimony, Maximum Likelihood and Bayesian phylogenetic analysis of independent (each fragment) and combined datasets (mtDNA, nuDNA or mtDNA+nuDNA) showed that Sotalia and Sousa fall within a clade containing other members of Delphininae, exclusive of Steno. Sousa was resolved as the sister taxon to Sotalia according to analysis of the nuDNA dataset but not analysis of the mtDNA or combined mtDNA+nuDNA datasets. Based on the results from our multi-locus analysis, we offer several novel changes to the classification of Delphinidae, some of which are supported by previous morphological and molecular studies.

  8. Hepatozoon canis in German red foxes (Vulpes vulpes) and their ticks: molecular characterization and the phylogenetic relationship to other Hepatozoon spp.

    Science.gov (United States)

    Najm, Nour-Addeen; Meyer-Kayser, Elisabeth; Hoffmann, Lothar; Pfister, Kurt; Silaghi, Cornelia

    2014-07-01

    In this study, the prevalence of Hepatozoon spp. in red foxes (Vulpes vulpes) and their ticks from Germany, as well as molecular characterizations and phylogenetic relationship to other Hepatozoon spp. were investigated. DNA extracts of 261 spleen samples and 1,953 ticks were examined for the presence of Hepatozoon spp. by a conventional polymerase chain reaction (PCR) targeting the 18S rRNA gene. The ticks included four tick species: Ixodes ricinus, Ixodes canisuga, Ixodes hexagonus and Dermacentor reticulatus. A total of 118/261 foxes (45.2%) and 148/1,953 ticks (7.5%) were Hepatozoon PCR-positive. Amplicons from 36 positive foxes and 41 positive ticks were sequenced. All sequences obtained from foxes and 39/41 from ticks had a 99% similarity to Hepatozoon canis, whereas two ticks' sequences had a 99% identity to Hepatozoon sp. The obtained Hepatozoon sequences in this study were phylogenetically related to other Hepatozoon sequences detected in other countries, which may represent strain variants. The high prevalence of H. canis DNA in red foxes in this study supports the suggested role of those animals in distribution of this parasite. Furthermore, detection of DNA of H. canis in foxes and all examined tick species collected from those foxes allows speculating about previously undescribed potential vectors for H. canis and suggests a potential role of the red fox in its natural endemic cycles.

  9. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  10. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  11. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Pristurus rupestris.

    Science.gov (United States)

    Badiane, Arnaud; Garcia-Porta, Joan; Červenka, Jan; Kratochvíl, Lukáš; Sindaco, Roberto; Robinson, Michael D; Morales, Hernan; Mazuch, Tomáš; Price, Thomas; Amat, Fèlix; Shobrak, Mohammed Y; Wilms, Thomas; Simó-Riudalbas, Marc; Ahmadzadeh, Faraham; Papenfuss, Theodore J; Cluchier, Alexandre; Viglione, Julien; Carranza, Salvador

    2014-07-09

    A molecular phylogeny of the sphaerodactylid geckos of the genus Pristurus is inferred based on an alignment of 1845 base pairs (bp) of concatenated mitochondrial (12S) and nuclear (acm4, cmos, rag1 and rag2) genes for 80 individuals, representing 18 of the 23-26 species, and the three subspecies of P. rupestris. The results indicate that P. rupestris is polyphyletic and includes two highly divergent clades: the eastern clade, found in coastal Iran and throughout the Hajar Mountain range in northern Oman and eastern UAE; and the western clade, distributed from central coastal Oman, through Yemen, Saudi Arabia and north to southern Jordan. Inferred haplotype networks for the four nuclear genes show that the eastern and western clades of "P. rupestris" are highly differentiated and do not share any alleles. Moreover, although the two clades are differentiated by a morphological multivariate analysis, no one character or set of characters was found to be diagnostic. Based on the molecular analysis of specimens from the type locality of P. rupestris rupestris, the name P. rupestris is applied to the eastern clade. The name that should apply to the western clade cannot be clarified until morphological and genetic data for "P. rupestris" is available from the vicinity of Bosaso, Somalia, and therefore we refer to it as Pristurus sp. 1. The phylogenetic tree of Pristurus supports the hypothesis that P. celerrimus is sister to all the other species in the analyses and that the Socotra Archipelago was independently colonized a minimum of two times.

  12. The Efficacy of Consensus Tree Methods for Summarizing Phylogenetic Relationships from a Posterior Sample of Trees Estimated from Morphological Data.

    Science.gov (United States)

    O'Reilly, Joseph E; Donoghue, Philip C J

    2018-03-01

    Consensus trees are required to summarize trees obtained through MCMC sampling of a posterior distribution, providing an overview of the distribution of estimated parameters such as topology, branch lengths, and divergence times. Numerous consensus tree construction methods are available, each presenting a different interpretation of the tree sample. The rise of morphological clock and sampled-ancestor methods of divergence time estimation, in which times and topology are coestimated, has increased the popularity of the maximum clade credibility (MCC) consensus tree method. The MCC method assumes that the sampled, fully resolved topology with the highest clade credibility is an adequate summary of the most probable clades, with parameter estimates from compatible sampled trees used to obtain the marginal distributions of parameters such as clade ages and branch lengths. Using both simulated and empirical data, we demonstrate that MCC trees, and trees constructed using the similar maximum a posteriori (MAP) method, often include poorly supported and incorrect clades when summarizing diffuse posterior samples of trees. We demonstrate that the paucity of information in morphological data sets contributes to the inability of MCC and MAP trees to accurately summarise of the posterior distribution. Conversely, majority-rule consensus (MRC) trees represent a lower proportion of incorrect nodes when summarizing the same posterior samples of trees. Thus, we advocate the use of MRC trees, in place of MCC or MAP trees, in attempts to summarize the results of Bayesian phylogenetic analyses of morphological data.

  13. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  14. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  15. Genotyping of Capreolus pygargus fossil DNA from Denisova cave reveals phylogenetic relationships between ancient and modern populations.

    Directory of Open Access Journals (Sweden)

    Nadezhda V Vorobieva

    Full Text Available BACKGROUND: The extant roe deer (Capreolus Gray, 1821 includes two species: the European roe deer (C. capreolus and the Siberian roe deer (C. pygargus that are distinguished by morphological and karyotypical differences. The Siberian roe deer occupies a vast area of Asia and is considerably less studied than the European roe deer. Modern systematics of the Siberian roe deer remain controversial with 4 morphological subspecies. Roe deer fossilized bones are quite abundant in Denisova cave (Altai Mountains, South Siberia, where dozens of both extant and extinct mammalian species from modern Holocene to Middle Pleistocene have been retrieved. METHODOLOGY/PRINCIPAL FINDINGS: We analyzed a 629 bp fragment of the mitochondrial control region from ancient bones of 10 Holocene and four Pleistocene Siberian roe deer from Denisova cave as well as 37 modern specimen belonging to populations from Altai, Tian Shan (Kyrgyzstan, Yakutia, Novosibirsk region and the Russian Far East. Genealogical reconstructions indicated that most Holocene haplotypes were probably ancestral for modern roe deer populations of Western Siberia and Tian Shan. One of the Pleistocene haplotypes was possibly ancestral for modern Yakutian populations, and two extinct Pleistocene haplotypes were close to modern roe deer from Tian Shan and Yakutia. Most modern geographical populations (except for West Siberian Plains are heterogeneous and there is some tentative evidence for structure. However, we did not find any distinct phylogenetic signal characterizing particular subspecies in either modern or ancient samples. CONCLUSION/SIGNIFICANCE: Analysis of mitochondrial DNA from both ancient and modern samples of Siberian roe deer shed new light on understanding the evolutionary history of roe deer. Our data indicate that during the last 50,000 years multiple replacements of populations of the Siberian roe deer took place in the Altai Mountains correlating with climatic changes. The Siberian

  16. Genotyping of Capreolus pygargus Fossil DNA from Denisova Cave Reveals Phylogenetic Relationships between Ancient and Modern Populations

    Science.gov (United States)

    Vorobieva, Nadezhda V.; Sherbakov, Dmitry Y.; Druzhkova, Anna S.; Stanyon, Roscoe; Tsybankov, Alexander A.; Vasil'ev, Sergey K.; Shunkov, Mikhail V.; Trifonov, Vladimir A.; Graphodatsky, Alexander S.

    2011-01-01

    Background The extant roe deer (Capreolus Gray, 1821) includes two species: the European roe deer (C. capreolus) and the Siberian roe deer (C. pygargus) that are distinguished by morphological and karyotypical differences. The Siberian roe deer occupies a vast area of Asia and is considerably less studied than the European roe deer. Modern systematics of the Siberian roe deer remain controversial with 4 morphological subspecies. Roe deer fossilized bones are quite abundant in Denisova cave (Altai Mountains, South Siberia), where dozens of both extant and extinct mammalian species from modern Holocene to Middle Pleistocene have been retrieved. Methodology/Principal Findings We analyzed a 629 bp fragment of the mitochondrial control region from ancient bones of 10 Holocene and four Pleistocene Siberian roe deer from Denisova cave as well as 37 modern specimen belonging to populations from Altai, Tian Shan (Kyrgyzstan), Yakutia, Novosibirsk region and the Russian Far East. Genealogical reconstructions indicated that most Holocene haplotypes were probably ancestral for modern roe deer populations of Western Siberia and Tian Shan. One of the Pleistocene haplotypes was possibly ancestral for modern Yakutian populations, and two extinct Pleistocene haplotypes were close to modern roe deer from Tian Shan and Yakutia. Most modern geographical populations (except for West Siberian Plains) are heterogeneous and there is some tentative evidence for structure. However, we did not find any distinct phylogenetic signal characterizing particular subspecies in either modern or ancient samples. Conclusion/Significance Analysis of mitochondrial DNA from both ancient and modern samples of Siberian roe deer shed new light on understanding the evolutionary history of roe deer. Our data indicate that during the last 50,000 years multiple replacements of populations of the Siberian roe deer took place in the Altai Mountains correlating with climatic changes. The Siberian roe deer

  17. The Anatomy and Phylogenetic Relationships of “Pelorosaurus“ becklesii (Neosauropoda, Macronaria) from the Early Cretaceous of England

    Science.gov (United States)

    Upchurch, Paul; Mannion, Philip D.; Taylor, Michael P.

    2015-01-01

    The sauropod dinosaur “Pelorosaurus” becklesii was named in 1852 on the basis of an associated left humerus, ulna, radius and skin impression from the Early Cretaceous (Berriasian-Valanginian) Hastings Beds Group, near Hastings, East Sussex, southeast England, United Kingdom. The taxonomy and nomenclature of this specimen have a complex history, but most recent workers have agreed that “P.” becklesii represents a distinct somphospondylan (or at least a titanosauriform) and is potentially the earliest titanosaur body fossil from Europe or even globally. The Hastings specimen is distinct from the approximately contemporaneous Pelorosaurus conybeari from Tilgate Forest, West Sussex. “P.” becklesii can be diagnosed on the basis of five autapomorphies, such as: a prominent anteriorly directed process projecting from the anteromedial corner of the distal humerus; the proximal end of the radius is widest anteroposteriorly along its lateral margin; and the unique combination of a robust ulna and slender radius. The new generic name Haestasaurus is therefore erected for “P.” becklesii. Three revised and six new fore limb characters (e.g. the presence/absence of condyle-like projections on the posterodistal margin of the radius) are discussed and added to three cladistic data sets for Sauropoda. Phylogenetic analysis confirms that Haestasaurus becklesii is a macronarian, but different data sets place this species either as a non-titanosauriform macronarian, or within a derived clade of titanosaurs that includes Malawisaurus and Saltasauridae. This uncertainty is probably caused by several factors, including the incompleteness of the Haestasaurus holotype and rampant homoplasy in fore limb characters. Haestasaurus most probably represents a basal macronarian that independently acquired the robust ulna, enlarged olecranon, and other states that have previously been regarded as synapomorphies of clades within Titanosauria. There is growing evidence that basal

  18. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  19. A consistent phylogenetic backbone for the fungi.

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-05-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data-a common practice in phylogenomic analyses-introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses.

  20. New insights into the genetic composition and phylogenetic relationship of wolves and dogs in the Iberian Peninsula

    OpenAIRE

    Pires, Ana Elisabete; Amorim, Isabel R.; Borges, Carla; Sim?es, Fernanda; Teixeira, Tatiana; Quaresma, Andreia; Petrucci?Fonseca, Francisco; Matos, Jos?

    2017-01-01

    Abstract This study investigates the gene pool of Portuguese autochthonous dog breeds and their wild counterpart, the Iberian wolf subspecies (Canis lupus signatus), using standard molecular markers. A combination of paternal and maternal molecular markers was used to investigate the genetic composition, genetic differentiation and genetic relationship of native Portuguese dogs and the Iberian wolf. A total of 196 unrelated dogs, including breed and village dogs from Portugal, and other dogs ...

  1. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  2. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  3. Strong Relationship between Irreversibility Field and Crystallinity Discovered in Undoped and Carbon Substituted MgB2 Bulks

    International Nuclear Information System (INIS)

    Yamamoto, Akiyasu; Shimoyama, Jun-ichi; Ueda, Shinya; Iwayama, Isao; Katsura, Yukari; Horii, Shigeru; Kishio, Kohji

    2006-01-01

    The relationship between irreversibility field, H irr , and crystallinity of MgB 2 bulks including SiC or B 4 C doped samples was studied. Among the XRD peaks of MgB 2 , the FWHM of (110) reflection corresponding to the in-plane disorder was strongly dependent on the samples and H irr was found to be systematically increased with an increase of the FWHM of MgB 2 (110) peak. Enhanced intra-band scattering and strengthened grain boundary flux pinning are suggested to contribute to the excellent H irr characteristics. On the other hand, weak correlation between H irr and FWHM of (002) peak was confirmed. These mean that introduction of disorders into the ab-plane, i.e., distortion in honeycomb boron sheet, is essentially effective to enhance H irr

  4. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

    Directory of Open Access Journals (Sweden)

    Carla Maria Meireles

    1999-09-01

    Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

  5. First time molecular detection and phylogenetic relationships of torque teno sus virus 1 and 2 in domestic pigs in Uganda: further evidence for a global distribution.

    Science.gov (United States)

    Brink, Matilda; Ståhl, Karl; Masembe, Charles; Okurut, Ademun Rose; Berg, Mikael; Blomström, Anne-Lie

    2012-02-15

    Torque teno sus virus 1 (TTSuV1) and 2 (TTSuV2) are small, single-stranded circular DNA viruses belonging to the Anelloviridae family. Available studies clearly show that both viruses are widely distributed in the pig populations in America, Europe and Asia, although the impact of the infection is still unclear. Currently, the situation in domestic pig populations on the African continent is not known. Therefore, the aim of this study was to investigate the possible presence of the two viruses in domestic pigs in Uganda, and describe the phylogenetic relationships to those in the rest of the world. Ninety-five serum samples from six districts in Uganda were used, and PCR using TTSuV1 and 2 specific primers for the UTR region was run for viral nucleic acid detection. The positive samples were sequenced, and phylogenetic analyses performed in order to compare the Ugandan sequences with sequences from other parts of the world. The prevalence of TTSuV1 and 2 in the selected domestic pigs were estimated at 16.8% and 48.4% respectively, with co-infection found in 13.7%. The sequence identity was 90-100% between the Ugandan TTSuV1; and 63-100% between the Ugandan TTSuV2 sequences. This is the first report on the presence of TTSuV1 and 2 in domestic pigs in Uganda. These results highlight the importance of screening for emerging viruses given the globalisation of human activities.

  6. The blind catfish from the caves of Chapada Diamantina, Bahia, Brazil (Siluriformes: Heptapteridae: description, anatomy, phylogenetic relationships, natural history, and biogeography

    Directory of Open Access Journals (Sweden)

    Flávio A. Bockmann

    Full Text Available Rhamdiopsis krugi, a new troglobitic heptapterid catfish, is described from the caves of Chapada Diamantina, State of Bahia, northeastern Brazil. This species, although frequently cited in the scientific literature along the last seventeen years, remained undescribed largely due to its uncertain phylogenetic affinities. The generic assignment of R. krugi was clouded largely by its high number of unusual morphological features (some related to cave life, for instance: absence of eyes and body pigmentation; presence of a widely exposed pseudotympanum; posterior border of the anterior branch and anterior margin of the arborescent portion of the posterior branch of the transverse process of fourth vertebra joined; dorsal hypural plate commonly with seven rays; ventral caudal plate usually with six rays; dorsal and ventral caudal-fin lobes typically with six branched fin rays each; 38-39 vertebrae; anal fin with 14-17 rays; and lateral line very short. Rhamdiopsis krugi can be easily distinguished from its congeners, R. microcephala and R. moreirai, by its troglomorphic features and by the presence of a shorter lateral line, fewer vertebrae and anal-fin rays, pattern of branching of caudal-fin rays, and several attributes of skeletal system. The affinities of this new species are discussed in light of current phylogenetic knowledge of the family Heptapteridae. Incongruent derived characters do not allow selection of a particular hypothesis of sister group relationships among species of Rhamdiopsis. The occurrence of R. krugi in the rio Paraguaçu basin is possibly due to an event of hydrological capture from a section of the middle portion of the rio São Francisco basin, caused by tectonic events. The semi-arid region where R. krugi presently lives was probably covered by a wide forested area during a humid cycle in Quaternary. A summary of natural history and ecology data of R. krugi, as well as notes on its conservation, are provided. We also

  7. Molecular epidemiology of Newcastle disease viruses isolated in South Korea using sequencing of the fusion protein cleavage site region and phylogenetic relationships.

    Science.gov (United States)

    Lee, Youn Jeong; Sung, Haan Woo; Choi, Jun Gu; Kim, Jae Hong; Song, Chang Seon

    2004-10-01

    The study, using sequence analysis and the phylogenetic relationship of the fusion protein gene, divided the Korean epizootic isolates of Newcastle disease virus (NDV) into several lineages to determine the molecular epidemiology of the virus. A 695 base pair fragment was amplified by polymerase chain reaction between matrix protein gene and fusion protein gene of 30 Korean NDV isolates, which were isolated from field outbreaks of Newcastle disease between 1949 and 2002. All isolates showed the amino acid sequence 112R-R-Q/R-K-R116 at the C-terminus of the F2 protein and phenylalanine (F) at the N-terminus of the F1 protein, residue 117. These amino acid sequences were identical to a known virulent motif. The region of the F gene between nucleotides 47 and 435 was compared by phylogenetic analysis. Based on nucleotide sequence, the Korean NDV isolates belonged to genotype III, V, VI and VII corresponding to isolates in 1949, 1982 to 1984, 1988 to 1997, and 1995 to 2002, respectively. These data showed that genotypes of five Korean Newcastle disease epizootics had replaced each other serially (III, V, VI and VII) in chronological order. Further, the five Korean Newcastle disease epizootics were closely related with the Newcastle disease panzootics or Newcastle disease epizootics in other countries. Present study showed that the Korean genotype V isolated before 1984 was related with European Newcastle disease epizootics in the 1970s, whereas the Korean genotypes VI and VII isolated after 1988 were more closely related with Far East Newcastle disease epizootics, especially Newcastle disease epizootics in Japan, Taiwan and China. Since 1988, the genotypes VI and VII of Far East origin were dominant in South Korea. That might be due to the increased trade of agricultural products including poultry among Far East Asian countries.

  8. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin.

    Science.gov (United States)

    Sanjur, Oris I; Piperno, Dolores R; Andres, Thomas C; Wessel-Beaver, Linda

    2002-01-08

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico.

  9. Phylogenetic relationships and cryptic species diversity in the Brazilian egg-brooding tree frog, genus Fritziana Mello-Leitão 1937 (Anura: Hemiphractidae).

    Science.gov (United States)

    Walker, Marina; Lyra, Mariana L; Haddad, Célio F B

    2018-06-01

    The genus Fritziana (Anura: Hemiphractidae) comprises six described species (F. goeldii, F. ohausi, F. fissilis, F. ulei, F. tonimi, and F. izecksohni) that are endemic to the Brazilian Atlantic Forest. Although the genus has been the subject of studies dealing with its taxonomy, phylogeny, and systematics, there is considerable evidence for cryptic diversity hidden among the species. The present study aims to understand the genetic diversity and phylogenetic relationships among the species of Fritziana, as well as the relationships among populations within species. We analyzed 107 individuals throughout the distribution of the genus using three mitochondrial gene fragments (12S, 16S, and COI) and two nuclear genes (RAG1 and SLC8A3). Our data indicated that the species diversity in the genus Fritziana is underestimated by the existence of at least three candidate species hidden amongst the group of species with a closed dorsal pouch (i.e. F. fissilis and F. ulei). We also found four species presenting geographical population structures and high genetic diversity, and thus require further investigations. In addition, we found that two candidate species show a new arrangement for the tRNA-Phe gene, unique in Anura so far. Based on our results, we suggest that the conservation status of the species, as well as the species diversity in the genus Fritziana, needs to be reviewed. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. The phylogenetic relationships among germplasm resources of wild ramie (boehmeria nivea l. gaud) in china based on trnl-f and its sequences

    International Nuclear Information System (INIS)

    Runqing, Y.; Baloch, S.U.; Lijun, L.; Dingxiang, P.

    2015-01-01

    Ramie (Boehmeria nivea L. Gaud) is an important fiber crop in China, which also possesses many wild species in genus Boehmeria Jacq. However, the taxonomic position of these species has not been settled. To determine the evolutionary relationships among the members of the genus Boehmeria, the combination of ITS and trnL-F sequences were used for molecular phylogenetic analyses of 31 ramie accessions (28 species and three varieties) including multiple materials collected in high-altitude regions that have not been previously reported (B. clidemioides var. diffusa, B. bicuspis and B. longispica). The ITS and trnL-F trees produced showed that Boehmeria was classified into four separate clusters. The Sect. Duretia, which has a high evolutionary level, clustered with Sects Zoilingeriana and Phyllostachys. The grouping pattern of clustering differed from traditional taxonomy and indicated possible interspecific hybridization among Boehmeria. We found that B. malabarica Wedd. var. leioclada of Sect. Boehmeria clustered into a clade with Sect. Tilocnide, providing solid support for the expansion of wild ramie core germplasm resources. The molecular results did not support the intraspecific geographic migration of Boehmeria. This study, therefore, established relationships among wild species which will help in ramie crop improvement programs. The results will be important for the collection and conservation of germplasm resources of Chinese wild ramie. (author)

  11. A model for the training effects in swimming demonstrates a strong relationship between parasympathetic activity, performance and index of fatigue.

    Directory of Open Access Journals (Sweden)

    Sébastien Chalencon

    Full Text Available Competitive swimming as a physical activity results in changes to the activity level of the autonomic nervous system (ANS. However, the precise relationship between ANS activity, fatigue and sports performance remains contentious. To address this problem and build a model to support a consistent relationship, data were gathered from national and regional swimmers during two 30 consecutive-week training periods. Nocturnal ANS activity was measured weekly and quantified through wavelet transform analysis of the recorded heart rate variability. Performance was then measured through a subsequent morning 400 meters freestyle time-trial. A model was proposed where indices of fatigue were computed using Banister's two antagonistic component model of fatigue and adaptation applied to both the ANS activity and the performance. This demonstrated that a logarithmic relationship existed between performance and ANS activity for each subject. There was a high degree of model fit between the measured and calculated performance (R(2=0.84±0.14,p<0.01 and the measured and calculated High Frequency (HF power of the ANS activity (R(2=0.79±0.07, p<0.01. During the taper periods, improvements in measured performance and measured HF were strongly related. In the model, variations in performance were related to significant reductions in the level of 'Negative Influences' rather than increases in 'Positive Influences'. Furthermore, the delay needed to return to the initial performance level was highly correlated to the delay required to return to the initial HF power level (p<0.01. The delay required to reach peak performance was highly correlated to the delay required to reach the maximal level of HF power (p=0.02. Building the ANS/performance identity of a subject, including the time to peak HF, may help predict the maximal performance that could be obtained at a given time.

  12. Phylogenetic relationships of Iranian infectious hematopoietic necrosis virus of rainbow trout (Oncorhynchus mykiss) based on the glycoprotein gene

    Science.gov (United States)

    Adel, Milad; Amiri, Alireza Babaalian; Dada, Maryam; Kurath, Gael; Laktarashi, Bahram; Ghajari, Amrolah; Breyta, Rachel

    2016-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of family Rhabdoviridae and genus Novirhabdoviridae, causes a highly lethal disease of salmon and trout. In Iran IHNV was first detected in 2001 on farms rearing rainbow trout (Oncorhynchus mykiss). To evaluate the genetic relationships of IHNV from northern and western Iran, the sequences of a 651-nt region of the glycoprotein gene were determined for two Iranian isolates. These sequences were analyzed to evaluate their genetic relatedness to worldwide isolates representing the five known genogroups of IHNV. Iranian isolates were most closely related to European isolates within the genogroup E rather than those of North American genogroups U, M and L, or the Asian genogroup J. It appears that Iranian IHNV was most likely introduced to Iran from a source in Europe by the movement of contaminated fish eggs.

  13. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida in Wild and Domestic Mammals.

    Directory of Open Access Journals (Sweden)

    Natalia Sastre

    Full Text Available This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13% and bats (17%. The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii and two different mites (both inferred to be members of the Prostigmata order in one marmot species (Marmota flaviventris, we tentatively concluded that these skin mites 1 cannot be assigned to the same genus based only on a common host, and 2 seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius. All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  14. Detection, Prevalence and Phylogenetic Relationships of Demodex spp and further Skin Prostigmata Mites (Acari, Arachnida) in Wild and Domestic Mammals.

    Science.gov (United States)

    Sastre, Natalia; Francino, Olga; Curti, Joseph N; Armenta, Tiffany C; Fraser, Devaughn L; Kelly, Rochelle M; Hunt, Erin; Silbermayr, Katja; Zewe, Christine; Sánchez, Armand; Ferrer, Lluís

    2016-01-01

    This study was conceived to detect skin mites in social mammals through real-time qPCR, and to estimate taxonomic Demodex and further Prostigmata mite relationships in different host species by comparing sequences from two genes: mitochondrial 16S rRNA and nuclear 18S rRNA. We determined the mite prevalence in the hair follicles of marmots (13%) and bats (17%). The high prevalence found in marmots and bats by sampling only one site on the body may indicate that mites are common inhabitants of their skin. Since we found three different mites (Neuchelacheles sp, Myobia sp and Penthaleus sp) in three bat species (Miotis yumanensis, Miotis californicus and Corynorhinus townsendii) and two different mites (both inferred to be members of the Prostigmata order) in one marmot species (Marmota flaviventris), we tentatively concluded that these skin mites 1) cannot be assigned to the same genus based only on a common host, and 2) seem to evolve according to the specific habitat and/or specific hair and sebaceous gland of the mammalian host. Moreover, two M. yumanensis bats harbored identical Neuchelacheles mites, indicating the possibility of interspecific cross-infection within a colony. However, some skin mites species are less restricted by host species than previously thought. Specifically, Demodex canis seems to be more transmissible across species than other skin mites. D. canis have been found mostly in dogs but also in cats and captive bats. In addition, we report the first case of D. canis infestation in a domestic ferret (Mustela putorius). All these mammalian hosts are related to human activities, and D. canis evolution may be a consequence of this relationship. The monophyletic Demodex clade showing closely related dog and human Demodex sequences also supports this likely hypothesis.

  15. New insights into the genetic composition and phylogenetic relationship of wolves and dogs in the Iberian Peninsula.

    Science.gov (United States)

    Pires, Ana Elisabete; Amorim, Isabel R; Borges, Carla; Simões, Fernanda; Teixeira, Tatiana; Quaresma, Andreia; Petrucci-Fonseca, Francisco; Matos, José

    2017-06-01

    This study investigates the gene pool of Portuguese autochthonous dog breeds and their wild counterpart, the Iberian wolf subspecies ( Canis lupus signatus ), using standard molecular markers. A combination of paternal and maternal molecular markers was used to investigate the genetic composition, genetic differentiation and genetic relationship of native Portuguese dogs and the Iberian wolf. A total of 196 unrelated dogs, including breed and village dogs from Portugal, and other dogs from Spain and North Africa, and 56 Iberian wolves (wild and captive) were analyzed for nuclear markers, namely Y chromosome SNPs, Y chromosome STR loci, autosomal STR loci, and a mitochondrial fragment of the control region I. Our data reveal new variants for the molecular markers and confirm significant genetic differentiation between Iberian wolf and native domestic dogs from Portugal. Based on our sampling, no signs of recent introgression between the two subspecies were detected. Y chromosome data do not reveal genetic differentiation among the analyzed dog breeds, suggesting they share the same patrilineal origin. Moreover, the genetic distinctiveness of the Iberian wolf from other wolf populations is further confirmed with the description of new mtDNA variants for this endemism. Our research also discloses new molecular markers for wolf and dog subspecies assignment, which might become particularly relevant in the case of forensic or noninvasive genetic studies. The Iberian wolf represents a relic of the once widespread wolf population in Europe and our study reveals that it is a reservoir of unique genetic diversity of the grey wolf, Canis lupus . These results stress the need for conservation plans that will guarantee the sustainability of this threatened top predator in Iberia.

  16. Forgotten in the taxonomic literature: Resurrection of the scleractinian coral genus Sclerophyllia (Scleractinia, Lobophylliidae) from the Arabian Peninsula and its phylogenetic relationships

    KAUST Repository

    Arrigoni, Roberto

    2014-11-21

    The monospecific scleractinian coral genus Sclerophyllia Klunzinger, 1879 was originally described from Al-Qusayr (Egypt) in the Red Sea based on a series of solitary specimens. Thenceforth, it has been considered a junior synonym of Symphyllia and Cynarina based on corallum macromorphology. In this study, several specimens of Sclerophyllia margariticola were collected on the coasts of Saudi Arabia in the northern and central Red Sea. Four molecular markers were sequenced, COI and the intergenic spacer between COI and l-rRNA from mitochondrial DNA and Histone H3 and ribosomal ITS2 from nuclear DNA. Phylogenetic trees and haplotype network analyses show that S. margariticola belongs to the family Lobophylliidae and that it is closely related to Acanthastrea maxima, an uncommon species from waters around the Arabian peninsula (the Gulf of Aden, Arabian Sea, Gulf of Oman and Persian Gulf). Sclerophyllia margariticola and A. maxima share several macro- and micromorphological characters, such as the presence of free septa, high elliptical septal teeth perpendicular to the septal margin, irregular lobate tips, very wide tooth spacing, a very strong granulation with granules scattered all along the septal sides, and a palisade interarea structure, and their micromorphology differs substantially from that of Acanthastrea echinata, the type species of Acanthastrea. Therefore, we formally resurrect Sclerophyllia, provide a revised diagnosis for the genus, and move A. maxima into Sclerophyllia.

  17. Mitochondrial DNA sequence variation among geographical isolates of Opisthorchis viverrini in Thailand and Lao PDR, and phylogenetic relationships with other trematodes

    Science.gov (United States)

    SAIJUNTHA, W.; SITHITHAWORN, P.; WONGKHAM, S.; LAHA, T.; CHILTON, N. B.; PETNEY, T.N.; BARTON, M.; ANDREWS, R. H.

    2008-01-01

    SUMMARY The present study compared the genetic variation among 14 different geographical isolates of Opisthorchis viverrini sensu lato from Thailand and Lao PDR using sequence data for 2 mitochondrial DNA genes, the subunit 1 of NADH dehydrogenase gene (nad1) and cytochrome c oxidase gene (cox1). Four different nad1 haplotypes were detected among isolates, all of which were identical at the amino acid sequence level. Nucleotide sequence variation among 14 isolates ranged from 0 to 0·3% for nad1. Two different cox1 haplotypes were detected among isolates. These two haplotypes differed at 2 nucleotide positions, one of which resulted in a change in the amino acid sequence. Nucleotide sequence variation among isolates for cox1 ranged from 0 to 0·5%. Comparison of cox1 sequences of O. viverrini to those of other trematodes revealed nucleotide differences of 13-31%. A phylogenetic analysis of the cox1 sequence data revealed strong statistical support for a clade containing O. viverrini and 2 other species of opisthorchid trematodes; O. felineus and Clonorchis sinsensis. PMID:18937886

  18. Phylogenetic relationships among extinct and extant turtles: the position of Pleurodira and the effects of the fossils on rooting crown-group turtles

    NARCIS (Netherlands)

    Sterli, J.

    2010-01-01

    The origin and evolution of the crown-group of turtles (Cryptodira + Pleurodira) is one of the most interesting topics in turtle evolution, second perhaps only to the phylogenetic position of turtles among amniotes. The present contribution focuses on the former problem, exploring the phylogenetic

  19. Testing the phylogenetic affinities of Southeast Asia's rarest geckos: Flap-legged geckos (Luperosaurus), Flying geckos (Ptychozoon) and their relationship to the pan-Asian genus Gekko.

    Science.gov (United States)

    Brown, Rafe M; Siler, Cameron D; Das, Indraneil; Min, Yong

    2012-06-01

    Some of Southeast Asia's most poorly known vertebrates include forest lizards that are rarely seen by field biologists. Arguably the most enigmatic of forest lizards from the Indo Australian archipelago are the Flap-legged geckos and the Flying geckos of the genera Luperosaurus and Ptychozoon. As new species have accumulated, several have been noted for their bizarre combination of morphological characteristics, seemingly intermediate between these genera and the pan-Asian gecko genus Gekko. We used the first multilocus phylogeny for these taxa to estimate their relationships, with particular attention to the phylogenetic placement of the morphologically intermediate taxa Ptychozoon rhacophorus, Luperosaurus iskandari, and L. gulat. Surprisingly, our results demonstrate that Luperosaurus is more closely related to Lepidodactylus and Pseudogekko than it is to Gekko but that some species currently classified as Luperosaurus are nested within Gekko. The Flying Gecko genus Ptychozoon is also nested within Gekko, suggesting that higher-level taxonomic revision of the generic boundaries within Southeast Asian gekkonines will be a priority for the immediate future. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. An appraisal of the phylogenetic relationships of Hypoptopomatini cascudinhos with description of two new genera and three new species (Siluriformes: Loricariidae

    Directory of Open Access Journals (Sweden)

    Maria Laura S. Delapieve

    2017-12-01

    Full Text Available ABSTRACT The discovery of three new taxa of Hypoptotopomatini with ambiguous generic assignment prompted a reanalysis of the phylogenetic relationships of the tribe. The analysis focused on a data matrix of 56 terminals and 107 morphological characters comprising the three new taxa, most species of Hypoptopoma and Otocinclus, and all other species of the tribe. The 162 maximally parsimonious trees of 382 steps, consistency index of 0.41, and retention index of 0.83 were then summarized in a strict consensus tree. The results confirm the monophyly of the Hypoptopomatini, recover four genera as monophyletic (Acestridium, Hypoptopoma, Niobichthys, and Otocinclus, revealed Hypoptopoma and Oxyropsis to be non-monophyletic; and revealed two new genera within Hypoptopomatini. Additionally, Otocinclus was found to be sister to a group with all remaining genera of the tribe; Acestridium and Niobichthys were found to be sister to each other and that clade sister to a group formed by ((Leptotocinclus + Hypoptopoma [part] + (Nannoxyropsis (Oxyropsis + Hypoptopoma [part]. Based on this framework, changes to the classification and the taxonomy of the Hypoptopomatini are suggested and the new taxa are described.

  1. Phylogenetic relationships among domesticated and wild species of Cucurbita (Cucurbitaceae) inferred from a mitochondrial gene: Implications for crop plant evolution and areas of origin

    Science.gov (United States)

    Sanjur, Oris I.; Piperno, Dolores R.; Andres, Thomas C.; Wessel-Beaver, Linda

    2002-01-01

    We have investigated the phylogenetic relationships among six wild and six domesticated taxa of Cucurbita using as a marker an intron region from the mitochondrial nad1 gene. Our study represents one of the first successful uses of a mtDNA gene in resolving inter- and intraspecific taxonomic relationships in Angiosperms and yields several important insights into the origins of domesticated Cucurbita. First, our data suggest at least six independent domestication events from distinct wild ancestors. Second, Cucurbita argyrosperma likely was domesticated from a wild Mexican gourd, Cucurbita sororia, probably in the same region of southwest Mexico that gave rise to maize. Third, the wild ancestor of Cucurbita moschata is still unknown, but mtDNA data combined with other sources of information suggest that it will probably be found in lowland northern South America. Fourth, Cucurbita andreana is supported as the wild progenitor of Cucurbita maxima, but humid lowland regions of Bolivia in addition to warmer temperate zones in South America from where C. andreana was originally described should possibly be considered as an area of origin for C. maxima. Fifth, our data support other molecular results that indicate two separate domestications in the Cucurbita pepo complex. The potential zone of domestication for one of the domesticated subspecies, C. pepo subsp. ovifera, includes eastern North America and should be extended to northeastern Mexico. The wild ancestor of the other domesticated subspecies, C. pepo subsp. pepo, is undiscovered but is closely related to C. pepo subsp. fraterna and possibly will be found in southern Mexico. PMID:11782554

  2. Phylogenetic relationships among Synallaxini spinetails (Aves: Furnariidae) reveal a new biogeographic pattern across the Amazon and Paraná river basins.

    Science.gov (United States)

    Claramunt, Santiago

    2014-09-01

    Relationships among genera in the tribe Synallaxini have proved difficult to resolve. In this study, I investigate relationships among Synallaxis, Certhiaxis and Schoeniophylax using DNA sequences from the mitochondrion and three nuclear regions. I implemented novel primers and protocols for amplifying and sequencing autosomal and sex-linked introns in Furnariidae that resolved basal relationships in the Synallaxini with strong support. Synallaxis propinqua is sister to Schoeniophylax phryganophilus, and together they form a clade with Certhiaxis. The results are robust to analytical approaches when all genomic regions are analyzed jointly (parsimony, maximum likelihood, and species-tree analysis) and the same basal relationships are recovered by most genomic regions when analyzed separately. A sister relationship between S. propinqua, an Amazonian river island specialist, and S. phryganophilus, from the Paraná River basin region, reveals a new biogeographic pattern shared by at least other four pairs of taxa with similar distributions and ecologies. Estimates of divergence times for these five pairs span from the late Miocene to the Pleistocene. Identification of the historical events that produced this pattern is difficult and further advances will require additional studies of the taxa involved and a better understanding of the recent environmental history of South America. A new classification is proposed for the Synallaxini, including the description of a new genus for S. propinqua. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. PHYLOGENETIC RELATIONSHIPS OF THE METAZOAN ...

    African Journals Online (AJOL)

    Mgina

    Victoria from which a total of 32 parasite species were documented from 658 specimens of clariid fishes representing seven different species. Of the parasites recovered only 16 were identified ... use in resolving recent evolutionary history. MATERIALS AND .... tribocytic or Brandes organ located in the forebody, posterior to ...

  4. Phylogenetic relationships among subsurface microorganisms

    Energy Technology Data Exchange (ETDEWEB)

    Nierzwicki-Bauer, S.A.

    1991-01-01

    This project involves the development of group specific 16S ribosomal RNA-targeted oligonucleotide hybridization probes for the rapid detection of specific types of subsurface organisms (e.g., groups of microbes that share certain physiological traits). Major accomplishments for the period of 6/91 to 12/1/91 are described. Nine new probes have been synthesized on the basis of published 16S rRNA sequence data from the Ribosomal Database Project. We have initiated rapid screening of many of the subsurface microbial isolates obtained from the P24 borehole at the Savannah River Site. To date, we have screened approximately 50% of the isolates from P24. We have optimized our {und in situ} hybridization technique, and have developed a cell blot hybridization technique to screen 96 samples on a single blot. This is much faster than reading 96 individual slides. Preliminary experiments have been carried out which indicate specific nutrients can be used to amplify rRNA only in those organisms capable of metabolizing those nutrients. 1 tab., 2 figs.

  5. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  6. Co-existence of Paragonimus harinasutai and Paragonimus bangkokensis metacercariae in fresh water crab hosts in central Viet Nam with special emphasis on their close phylogenetic relationship.

    Science.gov (United States)

    Doanh, Pham Ngoc; Hien, Hoang Van; Nonaka, Nariaki; Horii, Yoichiro; Nawa, Yukifumi

    2012-09-01

    During our epidemiological surveys for Paragonimus species in central Viet Nam, we found four morphologically different Paragonimus metacercariae in mountainous crabs. They were identified as metacercariae of Paragonimus westermani, P. bangkokensis, P. proliferus, and P. harinasutai in the order of their prevalence in crab hosts. This is the first discovery of P. harinasutai in Viet Nam, co-inhabiting with P. bangkokensis and other species. Metacercariae of P. harinasutai were given orally to a cat to obtain adult worms. Then, ITS2 and CO1 sequences of metacercariae and adults of P. harinasutai, and metacercariae of P. bangkokensis collected from the same place were determined for analyses of phylogenetic relationships to other P. harinasutai and P. bangkokensis populations as well as related species. The results of molecular analyses showed that P. harinasutai from Quang Binh province of central Viet Nam was almost completely identical with those from Vientiane, Lao PDR; P. bangkokensis from Quang Binh, Viet Nam was also almost completely identical with those from Lao PDR and from Quang Ninh province, Viet Nam. Except for one P. harinasutai isolate from China, all populations of P. harinasutai and P. bangkokensis from Thailand, Lao and Viet Nam make a single clade in both ITS2 and CO1 trees. In ITS2 sequences, AT deletion and ATC insertion were observed in some isolates of both species, indicating recent gene flow between P. harinasutai and P. bangkokensis. Moreover, because of their extremely high genetic similarities and their co-inhabitation in the same crab hosts found in Thailand, Lao PDR and Viet Nam, they should be considered as the sister species at the early stage of divergence. In addition, P. microrchis previously described from Yunnan, China should be placed as the synonym of P. harinasutai, because of their morphological and molecular similarities. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  7. Phylogenetic relationships between some members of the genera Neisseria, Acinetobacter, Moraxella, and Kingella based on partial 16S ribosomal DNA sequence analysis.

    Science.gov (United States)

    Enright, M C; Carter, P E; MacLean, I A; McKenzie, H

    1994-07-01

    We obtained 16S ribosomal DNA (rDNA) sequence data for strains belonging to 11 species of Proteobacteria, including the type strains of Kingella kingae, Neisseria lactamica, Neisseria meningitidis, Moraxella lacunata subsp. lacunata, [Neisseria] ovis, Moraxella catarrhalis, Moraxella osloensis, [Moraxella] phenylpyruvica, and Acinetobacter lwoffii, as well as strains of Neisseria subflava and Acinetobacter calcoaceticus. The data in a distance matrix constructed by comparing the sequences supported the proposal that the genera Acinetobacter and Moraxella and [N.] ovis should be excluded from the family Neisseriaceae. Our results are consistent with hybridization data which suggest that these excluded taxa should be part of a new family, the Moraxellaceae. The strains that we studied can be divided into the following five groups: (i) M. lacunata subsp. lacunata, [N.] ovis, and M. catarrhalis; (ii) M. osloensis; (iii) [M.] phenylpyruvica; (iv) A. calcoaceticus and A. lwoffii; and (v) N. meningitidis, N. subflava, N. lactamica, and K. kingae. We agree with the previous proposal that [N.] ovis should be renamed Moraxella ovis, as this organism is closely related to Moraxella species and not to Neisseria species. The generically misnamed taxon [M.] phenylpyruvica belongs to the proposed family Moraxellaceae, but it is sufficiently different to warrant exclusion from the genus Moraxella. Further work needs to be done to investigate genetically similar species, such as Psychrobacter immobilis, before the true generic position of this organism can be determined. Automated 16S rDNA sequencing with the PCR allows workers to accurately determine phylogenetic relationships between groups of organisms.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Identification of pre-fertilization reproductive barriers and the underlying cytological mechanism in crosses among three petal-types of Jasminum sambac and their relevance to phylogenetic relationships.

    Science.gov (United States)

    Deng, Yanming; Sun, Xiaobo; Gu, Chunsun; Jia, Xinping; Liang, Lijian; Su, Jiale

    2017-01-01

    Crosses among single-, double- and multi-petal jasmine cultivars (Jasminum sambac Aiton) are unable to easily generate hybrids. To identify the reproductive barriers restricting hybrid set, dynamic changes in jasmine pollen viability and pistil receptivity were compared at different flowering stages. Pollen-pistil interactions in six reciprocal crosses were also investigated to characterize pollen-stigma compatibility. Additionally, paraffin sections of pollinated embryo sacs were prepared for subsequent analyses of developmental status. Furthermore, pistil cell ultrastructural characteristics were observed to reveal cytological mechanism regulating pistil receptivity and the pollen-pistil interactions. We observed that pollen viability and stigma receptivity varied depending on petal phenotype and flowering stage and were easily lost during flowering. Different reciprocal crosses exhibited varied pollen-stigma compatibilities according to the pollen germination rates. Although some pollen grains germinated normally on maternal stigmas, the pollen tubes were arrested in the pistils and were unable to reach the ovaries. Additionally, the embryo sacs remained unfertilized until degenerating. Therefore, jasmine crosses are affected by pre-fertilization reproductive barriers. Low pollen fertility and poor stigma receptivity are detrimental to pollen germination and pollen-pistil compatibility, indicating they are two factors affecting hybrid set. Ultrastructural observation of the pistil cells revealed that cell death occurred during flowering. Thus, the early and rapid senescence of pistils is likely responsible for the decreased pistil receptivity and inhibited pollen tube growth. These findings may be relevant for future jasmine hybridizations. They provide new insights for the development of methods to overcome reproductive barriers and may also be useful for clarifying the phylogenetic relationships among jasmine cultivars with differing petal phenotypes.

  9. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  10. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  11. Mitochondrial evidence on the phylogenetic position of caecilians (Amphibia: Gymnophiona).

    Science.gov (United States)

    Zardoya, R; Meyer, A

    2000-01-01

    The complete nucleotide sequence (17,005 bp) of the mitochondrial genome of the caecilian Typhlonectes natans (Gymnophiona, Amphibia) was determined. This molecule is characterized by two distinctive genomic features: there are seven large 109-bp tandem repeats in the control region, and the sequence for the putative origin of replication of the L strand can potentially fold into two alternative secondary structures (one including part of the tRNA(Cys)). The new sequence data were used to assess the phylogenetic position of caecilians and to gain insights into the origin of living amphibians (frogs, salamanders, and caecilians). Phylogenetic analyses of two data sets-one combining protein-coding genes and the other combining tRNA genes-strongly supported a caecilian + frog clade and, hence, monophyly of modern amphibians. These two data sets could not further resolve relationships among the coelacanth, lungfishes, and tetrapods, but strongly supported diapsid affinities of turtles. Phylogenetic relationships among a larger set of species of frogs, salamanders, and caecilians were estimated with a mitochondrial rRNA data set. Maximum parsimony analysis of this latter data set also recovered monophyly of living amphibians and favored a frog + salamander (Batrachia) relationship. However, bootstrap support was only moderate at these nodes. This is likely due to an extensive among-site rate heterogeneity in the rRNA data set and the narrow window of time in which the three main groups of living amphibians were originated. PMID:10835397

  12. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  13. Phylogenetic signal in diatom ecology: perspectives for aquatic ecosystems biomonitoring.

    Science.gov (United States)

    Keck, François; Rimet, Frédéric; Franc, Alain; Bouchez, Agnés

    2016-04-01

    Diatoms include a great diversity of taxa and are recognized as powerful bioindicators in rivers. However using diatoms for monitoring programs is costly and time consuming because most of the methodologies necessitate species-level identification. This raises the question of the optimal trade-off between taxonomic resolution and bioassessment quality. Phylogenetic tools may form the bases of new, more efficient approaches for biomonitoring if relationships between ecology and phylogeny can be demonstrated. We estimated the ecological optima of 127 diatom species for 19 environmental parameters using count data from 2119 diatom communities sampled during eight years in eastern France. Using uni- and multivariate analyses, we explored the relationships between freshwater diatom phylogeny and ecology (i.e., the phylogenetic signal). We found a significant phylogenetic signal for many of the ecological optima that were tested, but the strength of the signal varied significantly from one trait to another. Multivariate analysis also showed that the multidimensional ecological niche of diatoms can be strongly related to phylogeny. The presence of clades containing species that exhibit homogeneous ecology suggests that phylogenetic information can be useful for aquatic biomonitoring. This study highlights the presence of significant patterns of ecological optima for freshwater diatoms in relation to their phylogeny. These results suggest the presence of a signal above the species level, which is encouraging for the development of simplified methods for biomonitoring survey.

  14. Chromosomal evolution and phylogenetic analyses in Tayassu ...

    Indian Academy of Sciences (India)

    The phylogenetic relationships among the tayassuids are unclear and have insti- gated debate over the ... [Adega F., Chaves R. and Guedes-Pinto H. 2007 Chromosomal evolution and phylogenetic analyses in Tayassu pecari and Pecari tajacu. (Tayassuidae): tales ..... Chromosome banding in Amphibia. XXV. Karyotype ...

  15. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    NARCIS (Netherlands)

    Timmermans, M.J.T.N.; Roelofs, D.; Mariën, A.G.H.; van Straalen, N.M.

    2008-01-01

    Background. In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  16. Revealing pancrustacean relationships : phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    NARCIS (Netherlands)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-01-01

    BACKGROUND: In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  17. Complete mitochondrial genomes from four subspecies of common chaffinch (Fringilla coelebs): new inferences about mitochondrial rate heterogeneity, neutral theory, and phylogenetic relationships within the order Passeriformes.

    Science.gov (United States)

    Marshall, H Dawn; Baker, Allan J; Grant, Allison R

    2013-03-15

    We describe whole mitochondrial genome sequences from four subspecies of the common chaffinch (Fringilla coelebs), and compare them to 31 publicly available mitochondrial genome sequences from other Passeriformes. Rates and patterns of mitochondrial gene evolution are analyzed at different taxonomic levels within this avian order, and evidence is adduced for and against the nearly neutral theory of molecular evolution and the role of positive selection in shaping genetic variation of this small but critical genome. We find evidence of mitochondrial rate heterogeneity in birds as in other vertebrates, likely due to differences in mutational pressure across the genome. Unlike in gadine fish and some of the human mitochondrial work we do not observe strong support for the nearly neutral theory of molecular evolution; instead evidence from molecular clocks, distribution of dN/dS ratios at different levels of the taxonomic hierarchy and in different lineages, McDonald-Kreitman tests within Fringillidae, and site-specific tests of selection within Passeriformes, all point to a role for positive selection, especially for the complex I NADH dehydrogenase genes. The protein-coding mitogenome phylogeny of the order Passeriformes is broadly consistent with previously-reported molecular findings, but provides support for a sister relationship between the superfamilies Muscicapoidea and Passeroidea on a short basal internode of the Passerida where relationships have been difficult to resolve. An unexpected placement of the Paridae (represented by Hume's groundpecker) within the Muscicapoidea was observed. Consistent with other molecular studies the mtDNA phylogeny reveals paraphyly within the Muscicapoidea and a sister relationship of Fringilla with Carduelis rather than Emberiza. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  19. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  20. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  1. Utilizing RADseq data for phylogenetic analysis of challenging taxonomic groups: A case study in Carex sect. Racemosae.

    Science.gov (United States)

    Massatti, Rob; Reznicek, Anton A; Knowles, L Lacey

    2016-02-01

    Relationships among closely related and recently diverged taxa can be especially difficult to resolve. Here we use both Sanger sequencing and next-generation RADseq data sets to estimate phylogenetic relationships among species of Carex section Racemosae (Cyperaceae), a clade largely restricted to high latitudes and elevations. Interest in relationships among these taxa derives from questions about the species' biogeographic histories and possible links between diversification and Pleistocene glaciations. A combination of approaches and molecular markers were used to estimate relationships among Carex species within sect. Racemosae and taxa from closely related sections. Nuclear and chloroplast loci generated by Sanger sequencing were analyzed with *BEAST, and SNP data from RADseq loci were analyzed as a concatenated data set using maximum likelihood and as independent loci using SVDquartets. Sanger sequencing data sets resolved relationships among taxa at intermediate phylogenetic depths (albeit with low levels of support). Only the RADseq data resolved relationships with strong support at all phylogenetic depths. Moreover, different methods and data partitions of the RADseq data resulted in nearly identical topologies. Carex sect. Racemosae is a strongly supported clade, although a handful of species were found to group with closely related sections. Herbarium specimens up to 35 yr old successfully produced informative RADseq data. Despite the short read lengths of RADseq data, they nevertheless resolved relationships that Sanger sequencing data did not. Resolution of the phylogenetic relationships among recently and rapidly diversifying taxa within sect. Racemosae clades suggest a role for the Pleistocene glaciations in clade diversification. © 2016 Botanical Society of America.

  2. Determination of 16S rRNA sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic relationships among members of the genus Streptococcus.

    Science.gov (United States)

    Kawamura, Y; Hou, X G; Sultana, F; Miura, H; Ezaki, T

    1995-04-01

    We determined the 16S rRNA sequences of the type strains of Streptococcus mitis and Streptococcus gordonii and calculated the phylogenetic distances between those organisms and other members of the genus Streptococcus. The viridans group streptococci were separated into five phylogenetic groups; we named these groups the anginosus group, the mitis group, the salivarius group, the bovis group, and the mutans group. S. mitis and S. gordonii clustered in the mitis group together with Streptococcus pneumoniae, Streptococcus oralis, Streptococcus sanguis, and Streptococcus parasanguis at levels of sequence homology of more than 96%. Within this group, S. mitis, S. oralis, and S. pneumoniae exhibited more than 99% sequence homology with each other, although the DNA-DNA similarity values for their total chromosome DNAs were less than 60%.

  3. Redescription and phylogenetic relationships of Solenodonsaurus janenschi Broili, 1924, from the Late Carboniferous of Nýřany, Czech Republic

    OpenAIRE

    M. Danto; F. Witzmann; J. Müller

    2012-01-01

    The basal tetrapod Solenodonsaurus janenschi Broili, 1924, from Nýřany (Westphalian D, Late Carboniferous), Czech Republic, is redescribed and its phylogenetic position reevaluated. A distinct groove at the base of the maxillary teeth is regarded as an autapomorphic character, which is present in both the large and small specimens. Other characteristic features, which are not unique to S. janenschi, are: an extension of the lacrimal that forms the anteroventral margin of the orbit; a long pos...

  4. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  5. Resolving mammalian relationships with molecules

    NARCIS (Netherlands)

    Madsen, Ole

    2003-01-01

    The aim of the present study was to gain a deeper knowledge about the phylogenetic relationships amongst extant mammals, as derived from extensive molecular data sets. Analyses of molecular data gave strong evidence for dividing placental (eutherian) mammals into four major groups. One of these

  6. Revision of the family Carabodidae (Acari, Oribatida) VII. Redefinition of the genus Malgasodes; redescription of M. curvisetus Mahunka, 2000; and complementary description of M. hungarorum Mahunka, 2010. Phylogenetic relationships between Malgasodes, Bovicarabodes, Afticarabodes, Congocepheus and Cavaecarabodes are discussed.

    Science.gov (United States)

    Fernandez, Nestor; Theron, Pieter; Rollard, Christine; Castillo, Elio Rodrigo

    2014-01-01

    The genus Malgasodes is redefined; the type species M. curvisetus Mahunka, 2000, is redescribed by means of studies using optic and Scanning Electron Microsopy (SEM), and a complementary description of M. hungarorum Mahunka, 2000 is included. Comparison of genera Malgasodes Mahunka, 2000, Bovicarabodes Fernandez, Theron, Rollard, 2013a, Cavaecarabodes Fernandez, Theron, Rollard, Rodriguez Castillo, 2014, Afticarabodes Fernandez, Theron, Rollard, 2013b, and Congocepheus Balogh, 1958 is made. Problems concerning chaetotaxy, regressive evolution and neotrichy are explained and phylogenetic relationships between Malgasodes, Bovicarabodes, Afticarabodes, Congocepheus and Cavaecarabodes are discussed.

  7. Diversity and Phylogenetic Distribution of Extracellular Microbial Peptidases

    Science.gov (United States)

    Nguyen, Trang; Mueller, Ryan; Myrold, David

    2017-04-01

    secreted peptidases was found to be significantly correlated with phylogenetic relationships within kingdoms (archaea rMantel=0.364, p=0.001; bacteria rMantel=0.257, p=0.001, and fungi rMantel=0.281, p=0.005), inferring an evolutionary relationship where subsets of phylogenetically related organisms share similar types of secreted peptidases. We also tested the phylogenetic signal strength of each peptidase subfamily for each microbial kingdom based on the binary traits of the distribution (presence or absence of secreted peptidase subfamilies in individual species). About one-third of the peptidase subfamilies displayed a strong evolutionary signal; the rest were phylogenetically over-dispersed, suggesting that these subfamilies are randomly distributed across the tree of life or the result of events such as horizontal gene transfer. Study of the diversity and phylogenetic distribution of secreted peptidases offered a mechanistic basis to anticipate the proteolytic potential function of microbial communities.

  8. High-resolution phylogenetic microbial community profiling

    Energy Technology Data Exchange (ETDEWEB)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett; Schwientek, Patrick; Clum, Alicia; Copeland, Alex; Ciobanu, Doina; Cheng, Jan-Fang; Gies, Esther; Hallam, Steve; Tringe, Susannah; Woyke, Tanja

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance our knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.

  9. HOW STRONG IS THE RELATIONSHIP BETWEEN RAINFALL VARIABILITY AND CAATINGA PRODUCTIVITY? A CASE STUDY UNDER A CHANGING CLIMATE.

    Science.gov (United States)

    Salimon, Cleber; Anderson, Liana

    2017-05-22

    Despite the knowledge of the influence of rainfall on vegetation dynamics in semiarid tropical Brazil, few studies address and explore quantitatively the various aspects of this relationship. Moreover, Northeast Brazil is expected to have its rainfall reduced by as much as 60% until the end of the 21st Century, under scenario AII of the IPCC Report 2010. We sampled and analyzed satellite-derived monthly rainfall and a vegetation index data for 40 sites with natural vegetation cover in Paraíba State, Brazil from 2001 to 2012. In addition, the anomalies for both variables were calculated. Rainfall variation explained as much as 50% of plant productivity, using the vegetation index as a proxy, and rainfall anomaly explained 80% of the vegetation productivity anomaly. In an extreme dry year (2012), with 65% less rainfall than average for the period 2001-2012, the vegetation index decreased by 25%. If such decrease persists in a long term trend in rainfall reduction, this could lead to a disruption in this ecosystem functioning and the dominant vegetation could become even more xeric or desert-like, bringing serious environmental, social and economical impacts.

  10. Global patterns of amphibian phylogenetic diversity

    DEFF Research Database (Denmark)

    Fritz, Susanne; Rahbek, Carsten

    2012-01-01

    phylogeny (2792 species). We combined each tree with global species distributions to map four indices of phylogenetic diversity. To investigate congruence between global spatial patterns of amphibian species richness and phylogenetic diversity, we selected Faith’s phylogenetic diversity (PD) index......Aim  Phylogenetic diversity can provide insight into how evolutionary processes may have shaped contemporary patterns of species richness. Here, we aim to test for the influence of phylogenetic history on global patterns of amphibian species richness, and to identify areas where macroevolutionary...... processes such as diversification and dispersal have left strong signatures on contemporary species richness. Location  Global; equal-area grid cells of approximately 10,000 km2. Methods  We generated an amphibian global supertree (6111 species) and repeated analyses with the largest available molecular...

  11. Ultrastructure, SSU rRNA gene sequences and phylogenetic relationships of Flamella Schaeffer, 1926 (Amoebozoa), with description of three new species.

    Science.gov (United States)

    Kudryavtsev, Alexander; Wylezich, Claudia; Schlegel, Martin; Walochnik, Julia; Michel, Rolf

    2009-02-01

    We isolated and described three new freshwater amoebozoan species that could be unambiguously assigned to the genus Flamella Schaeffer, 1926 by light microscopy. The phylogenetic position of the genus Flamella within the Amoebozoa was unknown, and gene sequence data were lacking. We sequenced the SSU rRNA gene of five Flamella spp., including a previously described F. aegyptia Michel et Smirnov, 1999. The phylogenetic trees inferred from these data showed, that Flamella is monophyletic and robustly branches within Amoebozoa. It belongs to a clade comprising Filamoeba spp., "Arachnula" sp., some protostelids and several SSU rRNA sequences of unidentified or uncultured eukaryotes. This clade consistently branched close to Archamoebae, Mycetozoa, Acramoeba dendroida and Multicilia marina; in contrast to the previous hypotheses, Flamella spp. did not show any relatedness either to Leptomyxida, or to Flabellinea. The ultrastructure of trophic amoebae and especially cysts of the species studied showed considerable similarity to Comandonia operculata Pernin et Pussard, 1979. We therefore suggest that Comandonia may be a junior synonym of Flamella, although more ultrastructural data about Comandonia operculata are necessary to test this hypothesis.

  12. Resolution of the enigmatic phylogenetic relationship of the critically endangered Western Swamp Tortoise Pseudemydura umbrina (Pleurodira: Chelidae) using a complete mitochondrial genome.

    Science.gov (United States)

    Zhang, Xiuwen; Unmack, Peter J; Kuchling, Gerald; Wang, Yinan; Georges, Arthur

    2017-10-01

    Pseudemydura umbrina is one of the most endangered turtle species in the world, and the imperative for its conservation is its distinctive morphology and relict status among the Chelidae. We use Illumina sequencing to obtain the complete mitogenome for resolving its uncertain phylogenetic position. A novel nuclear paralogue confounded the assembly, and resolution of the authentic mitogenome required further Sanger sequencing. The P. umbrina mitogenome is 16,414bp comprising 37 genes organized in a conserved pattern for other vertebrates. The nuclear paralogue is 547bp, 97.8% identity to the corresponding mitochondrial sequence. Particular features of the mitogenome include an nd3 174+1A frameshift, loss of DHC loop in tRNA Ser (AGN), and a light-strand replication initiation site in Wancy region that extends into an adjacent tRNA gene. Phylogenetic analysis showed that P. umbrina is the monotypic sister lineage to the remaining Australasian Chelidae, a lineage probably dating back to the Cretaceous. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  14. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  15. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Science.gov (United States)

    Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  16. Genetic characterization and phylogenetic relationships based on 18S rRNA and ITS1 region of small form of canine Babesia spp. from India.

    Science.gov (United States)

    Mandal, M; Banerjee, P S; Garg, Rajat; Ram, Hira; Kundu, K; Kumar, Saroj; Kumar, G V P P S Ravi

    2014-10-01

    Canine babesiosis is a vector borne disease caused by intra-erythrocytic apicomplexan parasites Babesia canis (large form) and Babesia gibsoni (small form), throughout the globe. Apart from few sporadic reports on the occurrence of B. gibsoni infection in dogs, no attempt has been made to characterize Babesia spp. of dogs in India. Fifteen canine blood samples, positive for small form of Babesia, collected from northern to eastern parts of India, were used for amplification of 18S rRNA gene (∼1665bp) of Babesia sp. and partial ITS1 region (∼254bp) of B. gibsoni Asian genotype. Cloning and sequencing of the amplified products of each sample was performed separately. Based on sequences and phylogenetic analysis of 18S rRNA and ITS1 sequences, 13 were considered to be B. gibsoni. These thirteen isolates shared high sequence identity with each other and with B. gibsoni Asian genotype. The other two isolates could not be assigned to any particular species because of the difference(s) in 18S rRNA sequence with B. gibsoni and closer identity with Babesiaoccultans and Babesiaorientalis. In the phylogenetic tree, all the isolates of B. gibsoni Asian genotype formed a separate major clade named as Babesia spp. sensu stricto clade with high bootstrap support. The two unnamed Babesia sp. (Malbazar and Ludhiana isolates) clustered close together with B. orientalis, Babesia sp. (Kashi 1 isolate) and B. occultans of bovines. It can be inferred from this study that 18S rRNA gene and ITS1 region are highly conserved among 13 B. gibsoni isolates from India. It is the maiden attempt of genetic characterization by sequencing of 18S rRNA gene and ITS1 region of B. gibsoni from India and is also the first record on the occurrence of an unknown Babesia sp. of dogs from south and south-east Asia. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  18. The dawn of open access to phylogenetic data.

    Directory of Open Access Journals (Sweden)

    Andrew F Magee

    Full Text Available The scientific enterprise depends critically on the preservation of and open access to published data. This basic tenet applies acutely to phylogenies (estimates of evolutionary relationships among species. Increasingly, phylogenies are estimated from increasingly large, genome-scale datasets using increasingly complex statistical methods that require increasing levels of expertise and computational investment. Moreover, the resulting phylogenetic data provide an explicit historical perspective that critically informs research in a vast and growing number of scientific disciplines. One such use is the study of changes in rates of lineage diversification (speciation--extinction through time. As part of a meta-analysis in this area, we sought to collect phylogenetic data (comprising nucleotide sequence alignment and tree files from 217 studies published in 46 journals over a 13-year period. We document our attempts to procure those data (from online archives and by direct request to corresponding authors, and report results of analyses (using Bayesian logistic regression to assess the impact of various factors on the success of our efforts. Overall, complete phylogenetic data for [Formula: see text] of these studies are effectively lost to science. Our study indicates that phylogenetic data are more likely to be deposited in online archives and/or shared upon request when: (1 the publishing journal has a strong data-sharing policy; (2 the publishing journal has a higher impact factor, and; (3 the data are requested from faculty rather than students. Importantly, our survey spans recent policy initiatives and infrastructural changes; our analyses indicate that the positive impact of these community initiatives has been both dramatic and immediate. Although the results of our study indicate that the situation is dire, our findings also reveal tremendous recent progress in the sharing and preservation of phylogenetic data.

  19. Improved integration time estimation of endogenous retroviruses with phylogenetic data.

    Directory of Open Access Journals (Sweden)

    Hugo Martins

    2011-03-01

    Full Text Available Endogenous retroviruses (ERVs are genetic fossils of ancient retroviral integrations that remain in the genome of many organisms. Most loci are rendered non-functional by mutations, but several intact retroviral genes are known in mammalian genomes. Some have been adopted by the host species, while the beneficial roles of others remain unclear. Besides the obvious possible immunogenic impact from transcribing intact viral genes, endogenous retroviruses have also become an interesting and useful tool to study phylogenetic relationships. The determination of the integration time of these viruses has been based upon the assumption that both 5' and 3' Long Terminal Repeats (LTRs sequences are identical at the time of integration, but evolve separately afterwards. Similar approaches have been using either a constant evolutionary rate or a range of rates for these viral loci, and only single species data. Here we show the advantages of using different approaches.We show that there are strong advantages in using multiple species data and state-of-the-art phylogenetic analysis. We incorporate both simple phylogenetic information and Monte Carlo Markov Chain (MCMC methods to date the integrations of these viruses based on a relaxed molecular clock approach over a Bayesian phylogeny model and applied them to several selected ERV sequences in primates. These methods treat each ERV locus as having a distinct evolutionary rate for each LTR, and make use of consensual speciation time intervals between primates to calibrate the relaxed molecular clocks.The use of a fixed rate produces results that vary considerably with ERV family and the actual evolutionary rate of the sequence, and should be avoided whenever multi-species phylogenetic data are available. For genome-wide studies, the simple phylogenetic approach constitutes a better alternative, while still being computationally feasible.

  20. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  1. Trypanosoma (Megatrypanum) melophagium in the sheep ked Melophagus ovinus from organic farms in Croatia: phylogenetic inferences support restriction to sheep and sheep keds and close relationship with trypanosomes from other ruminant species.

    Science.gov (United States)

    Martinković, Franjo; Matanović, Krešimir; Rodrigues, Adriana C; Garcia, Herakles A; Teixeira, Marta M G

    2012-01-01

    Trypanosoma (Megatrypanum) melophagium is a parasite of sheep transmitted by sheep keds, the sheep-restricted ectoparasite Melophagus ovinus (Diptera: Hippoboscidae). Sheep keds were 100% prevalent in sheep from five organic farms in Croatia, Southeastern Europe, whereas trypanosomes morphologically compatible with T. melophagium were 86% prevalent in the guts of the sheep keds. Multilocus phylogenetic analyses using sequences of small subunit rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase, spliced leader, and internal transcribed spacer 1 of the rDNA distinguished T. melophagium from all allied trypanosomes from other ruminant species and placed the trypanosome in the subgenus Megatrypanum. Trypanosomes from sheep keds from Croatia and Scotland, the only available isolates for comparison, shared identical sequences. All biologic and phylogenetic inferences support the restriction of T. melophagium to sheep and, especially, to the sheep keds. The comparison of trypanosomes from sheep, cattle, and deer from the same country, which was never achieved before this work, strongly supported the host-restricted specificity of trypanosomes of the subgenus Megatrypanum. Our findings indicate that with the expansion of organic farms, both sheep keds and T. melophagium may re-emerge as parasitic infections of sheep. © 2011 The Author(s) Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.

  2. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Phylogenetic molecular function annotation

    International Nuclear Information System (INIS)

    Engelhardt, Barbara E; Jordan, Michael I; Repo, Susanna T; Brenner, Steven E

    2009-01-01

    It is now easier to discover thousands of protein sequences in a new microbial genome than it is to biochemically characterize the specific activity of a single protein of unknown function. The molecular functions of protein sequences have typically been predicted using homology-based computational methods, which rely on the principle that homologous proteins share a similar function. However, some protein families include groups of proteins with different molecular functions. A phylogenetic approach for predicting molecular function (sometimes called 'phylogenomics') is an effective means to predict protein molecular function. These methods incorporate functional evidence from all members of a family that have functional characterizations using the evolutionary history of the protein family to make robust predictions for the uncharacterized proteins. However, they are often difficult to apply on a genome-wide scale because of the time-consuming step of reconstructing the phylogenies of each protein to be annotated. Our automated approach for function annotation using phylogeny, the SIFTER (Statistical Inference of Function Through Evolutionary Relationships) methodology, uses a statistical graphical model to compute the probabilities of molecular functions for unannotated proteins. Our benchmark tests showed that SIFTER provides accurate functional predictions on various protein families, outperforming other available methods.

  4. Exploring the role nurses play at different stages of the birthing process. Developing strong and long-term relationships with women by examining relationship-building stages prior to delivery, during delivery, and after delivery.

    Science.gov (United States)

    Peltier, J W; Schibrowski, J A; Westfall, J

    2000-01-01

    The health care community is becoming increasingly aware of the need to develop strong and long-term relationships with the women who make up the majority of the health care market. The perceived quality of obstetric care positively impacts future revenue streams by creating "family" loyalty for an umbrella of other health services offered by the provider organization. This article examines the differential impact that various service performance dimensions have on women's perceptions of quality for different stages of the birthing process, and how relationship-marketing principles can be utilized to develop loyal partnerships. The three distinct relationship-building stages are examined--birthing experiences prior to delivery, during delivery, and after delivery--along with their implications for perceptions of quality analyzed.

  5. Phylogenetic relationships and biogeography of Ptilophora (Gelidiales, Rhodophyta) with descriptions of P. aureolusa, P. malagasya, and P. spongiophila from Madagascar.

    Science.gov (United States)

    Boo, Ga Hun; Gall, Line Le; Hwang, Il Ki; Miller, Kathy Ann; Boo, Sung Min

    2018-04-01

    The genus Ptilophora currently includes 16 species occurring mostly in subtidal habitats of the Indo-Pacific Ocean, but its global diversity and biogeography are poorly understood. We analyzed mitochondrial cox1, plastid rbcL and plastid psbA sequences from specimens collected in southern Madagascar during the 2010 Atimo Vatae expedition and studied their morphologies. Both morphological and molecular data sets demonstrated the presence of five species in southern Madagascar: Ptilophora hildebrandtii, P. pterocladioides, and three new species described here, P. aureolusa, P. malagasya, and P. spongiophila. Ptilophora aureolusa is distinguished by its compound pinnae with uniformly spaced pinnules. Ptilophora malagasya has an indistinct midrib and irregularly spaced pinnules. Ptilophora spongiophila, heavily coated with sponges, has cylindrical to flattened main axes, lateral and surface proliferations, and spatulate tetrasporangial sori. The species of Ptilophora found in Madagascar are endemic, except P. hildebrandtii, which also occurs in eastern Africa. Ptilophora comprises four phylogenetic groups that map to eastern Australia, Japan, western Australia/Southeast Asia/Madagascar/eastern Africa, and Madagascar/eastern Africa/Aegean Sea. Biogeographical analysis revealed that the ancestor of Ptilophora originated in Australia, but most of the species radiated from Madagascar. © 2018 Phycological Society of America.

  6. Suitability of Root and Rhizome Anatomy for Taxonomic Classification and Reconstruction of Phylogenetic Relationships in the Tribes Cardueae and Cichorieae (Asteraceae).

    Science.gov (United States)

    Ginko, Elisabeth; Dobeš, Christoph; Saukel, Johannes

    2016-05-27

    The value of root and rhizome anatomy for the taxonomic characterisation of 59 species classified into 34 genera and 12 subtribes from the Asteraceae tribes Cardueae and Cichorieae was assessed. In addition, the evolutionary history of anatomical characters was reconstructed using a nuclear ribosomal DNA sequence-based phylogeny of the Cichorieae. Taxa were selected with a focus on pharmaceutically relevant species. A binary decision tree was constructed and discriminant function analyses were performed to extract taxonomically relevant anatomical characters and to infer the separability of infratribal taxa, respectively. The binary decision tree distinguished 33 species and two subspecies, but only five of the genera (sampled for at least two species) by a unique combination of hierarchically arranged characters. Accessions were discriminated-except for one sample worthy of discussion-according to their subtribal affiliation in the discriminant function analyses (DFA). However, constantly expressed subtribe-specific characters were almost missing and even in combination, did not discriminate the subtribes. Most anatomical characters showed at least some degree of homoplasious evolution limiting their suitability as phylogenetically informative characters.

  7. Phylogenetic relationships among Hoplobatrachus rugulosus in Thailand as inferred from mitochondrial DNA sequences of the cytochrome-b gene (Amphibia, Anura, Dicroglossidae).

    Science.gov (United States)

    Pansook, Anusorn; Khonsue, Wichase; Piyapattanakorn, Sanit; Pariyanonth, Putsatee

    2012-01-01

    A fragment (564 bp) of the mitochondrial cytochrome-b (Cyt-b) gene was studied for 73 individual rice field frogs (Hoplobatrachus rugulosus) from 18 geographical locations (populations) within Thailand. Sequence analysis revealed the presence of 12 haplotypes, with five haplotypes being represented in two or more populations, and the other seven being population-distinct haplotypes. Phylogenetic analysis by maximum parsimony, maximum likelihood, and neighbor joining analyses all placed the 12 haplotypes into two distinct and well-separated clades with high bootstrap support, reflecting the high sequence divergences between the clades (25.3-32.3%). The mountain ranges and the Isthmus of Kra are likely to have played important roles in hindering gene flow among H. rugulosus populations in Thailand. From the sequence divergence values, the two clades of H. rugulosus can be classified into two distinct species, and therefore, the strains of H. rugulosus bred in farm stocks should be restricted to a population of one clade so as to avoid cross breeding between the two clades.

  8. Phylogenetic relationships of closely related potyviruses infecting sweet potato determined by genomic characterization of Sweet potato virus G and Sweet potato virus 2.

    Science.gov (United States)

    Li, Fan; Xu, Donglin; Abad, Jorge; Li, Ruhui

    2012-08-01

    Complete nucleotide sequences of Sweet potato virus G (SPVG) and Sweet potato virus 2 (SPV2) were determined to be 10,800 and 10,731 nucleotides, respectively, excluding the 3'-poly(A) tail. Their genomic organizations are typical of potyviruses, encoding a polyprotein which is likely cleaved into 10 mature proteins by three viral proteinases. Conserved motifs of orthologous proteins of viruses in the genus Potyvirus are found in corresponding positions of both viruses. Pairwise comparisons of individual protein sequences of the two viruses with those of 78 other potyviruses show that P1 protein and coat protein (CP) of both viruses are significantly large, with the SPVG CP as the largest among the all the known species of the genus Potyvirus. The extended N-terminal region of the P1 protein is conserved in the potyviruses and ipomovirus infecting sweet potato. A novel ORF, PISPO, is identified within the P1 region of SPVG, SPV2, Sweet potato feathery mottle virus (SPFMV), and Sweet potato virus C (SPVC). The C-terminal half of CP is highly conserved among SPFMV, SPVC, SPVG, SPV2, and Sweet potato virus-Zimbabwe. Phylogenetic analysis based on the deduced CP amino acid sequences supports the view that these five viruses are grouped together in a SPFMV lineage. The analysis also reveals that Sweet potato virus Y and Ipomoea vein mosaic virus are grouped with SPV2 as one species, and these two viruses should be consolidated with SPV2.

  9. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  10. Relaciones filogenéticas del género Anomala (Coleoptera: Melolonthidae: Rutelinae Phylogenetic relationships of the genus Anomala (Coleoptera: Melolonthidae: Rutelinae

    Directory of Open Access Journals (Sweden)

    Andrés Ramírez-Ponce

    2009-08-01

    Full Text Available Se presenta un análisis filogenético basado en caracteres morfológicos de adultos de varios géneros de la tribu Anomalini para redefinir al género Anomala Samouelle, 1819 y evaluar su situación filogenética. El análisis de parsimonia, que incluyó 46 especies de 18 géneros procedentes de varias partes del mundo, permitió poner a prueba la monofilia de algunos géneros y evaluar su posición taxonómica, además de revelar que los límites de algunos géneros no son claros. Con base en el cladograma de consenso estricto existen evidencias suficientes para considerar las especies americanas hasta ahora incluidas en Anomala como un género diferente, al que corresponde nombrar Paranomala Casey, 1915, stat. rev. También se comprobó que algunas especies americanas incluidas en el género Callistethus Blanchard, 1851 deben incorporarse al género Paranomala, con excepción de C. viduus (Newman, la cual fundamenta la revalidación del género Pachystethus Blanchard, 1851, stat. rev. También se sinonimiza el género Anomalacra Casey, 1915 con Paranomala, y se transfiere Anomala carlsoni Hardy, 1976 a Leptohoplia Saylor, 1935. Se actualizan las descripciones y diagnosis de los géneros Anomala, Paranomala, Callistethus y Pachystethus y se incluye una clave de los géneros americanos de Anomalini que incorpora las definiciones y cambios nomenclaturales propuestos.A phylogenetic analysis based on adult morphology that includes some genera included in the tribe Anomalini is presented, to redefine the genus Anomala Samouelle, 1819, and evaluate its phylogenetic situation. The parsimony analysis, based on 46 species of 18 genera from several areas of the world, allowed us to test the monophyly of some genera and evaluate their taxonomic position, and to reveal that the generic limits are not clear. On the basis of the strict consensus cladogram there is reason to consider the American species heretofore included in Anomala as members of a

  11. Recovering phylogenetic signal from DNA sequences: relationships within the corvine assemblage (class aves) as inferred from complete sequences of the mitochondrial DNA cytochrome-b gene.

    Science.gov (United States)

    Helm-Bychowski, K; Cracraft, J

    1993-11-01

    Phylogenetic analysis of cytochrome-b sequences and cranial osteological characters for nine genera of corvine passerine birds supports the hypothesis that the two major groups of birds of paradise, the manucodines and paradisaeinines, constitute a monophyletic group and that their postulated sister group is the Corvidae (crows, jays, and allies). The data are also consistent with the hypothesis that the bowerbirds are not closely related to the birds of paradise but instead lie near the base of the corvine assemblage. The corvine radiation exemplifies a case of multiple star phylogenies embedded within a major clade, with the branching pattern characterized by very short internodal divergence times. Such histories are difficult to resolve no matter what type of data is employed, because little change accumulates between branching events. With respect to sequence data, reconstructed tree topologies are sensitive to the choice of outgroup and to the method of analysis (e.g., transversion vs. global parsimony). In such cases, assessing the "reliability" of a best-fit or most-parsimonious tree inferred from any particular data set becomes problematic. Statistical tests of tree topologies that depend on random sampling of characters will generally be inconclusive in that all cladistic components will tend to be poorly supported because relatively few character-state changes will be recorded between branching events. It is suggested, on the other hand, that congruence in cladistic signal across different data sets may be a potentially more useful method for evaluating the reliability of the signal of any one data set. Resolution of star phylogenies will probably be possible only if DNA sequence and morphological characters are combined in a single analysis.

  12. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  13. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  14. Phylogenetic relationships among the European and American bison and seven cattle breeds recon structed using the Bovine SNP50 Illumina Genotyping BeadChip

    DEFF Research Database (Denmark)

    Pertoldi, Cino; Wójcik, Jan M; Kawalko, Agata

    2010-01-01

    bison Bi on bison athabascae (WB) and seven (PB), the wood bison (WB) and seven cattle Bostaurus breeds. Our aims were to (1) reconstruct their evolutionary relationships, (2) detect any genetic signature of past bottlenecks and to quantify the con sequences of bottle necks on the genetic distances...

  15. Ecosystem functions across trophic levels are linked to functional and phylogenetic diversity.

    Directory of Open Access Journals (Sweden)

    Patrick L Thompson

    Full Text Available In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1 zooplankton community biomass and (2 phytoplankton abundance (Chl a. We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures.

  16. Ecosystem functions across trophic levels are linked to functional and phylogenetic diversity.

    Science.gov (United States)

    Thompson, Patrick L; Davies, T Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures.

  17. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  18. Structure–Activity Relationship of Oligomeric Flavan-3-ols: Importance of the Upper-Unit B-ring Hydroxyl Groups in the Dimeric Structure for Strong Activities

    Directory of Open Access Journals (Sweden)

    Yoshitomo Hamada

    2015-10-01

    Full Text Available Proanthocyanidins, which are composed of oligomeric flavan-3-ol units, are contained in various foodstuffs (e.g., fruits, vegetables, and drinks and are strongly biologically active compounds. We investigated which element of the proanthocyanidin structure is primarily responsible for this functionality. In this study, we elucidate the importance of the upper-unit of 4–8 condensed dimeric flavan-3-ols for antimicrobial activity against Saccharomyces cerevisiae (S. cerevisiae and cervical epithelioid carcinoma cell line HeLa S3 proliferation inhibitory activity. To clarify the important constituent unit of proanthocyanidin, we synthesized four dimeric compounds, (−-epigallocatechin-[4,8]-(+-catechin, (−-epigallocatechin-[4,8]-(−-epigallocatechin, (−-epigallocatechin-[4,8]-(−-epigallocatechin-3-O-gallate, and (+-catechin-[4,8]-(−-epigallocatechin and performed structure–activity relationship (SAR studies. In addition to antimicrobial activity against S. cerevisiae and proliferation inhibitory activity on HeLa S3 cells, the correlation of 2,2-diphenyl-l-picrylhydrazyl radical scavenging activity with the number of phenolic hydroxyl groups was low. On the basis of the results of our SAR studies, we concluded that B-ring hydroxyl groups of the upper-unit of the dimer are crucially important for strong and effective activity.

  19. Men without a sense of smell exhibit a strongly reduced number of sexual relationships, women exhibit reduced partnership security - a reanalysis of previously published data.

    Science.gov (United States)

    Croy, Ilona; Bojanowski, Viola; Hummel, Thomas

    2013-02-01

    Olfactory function influences social behavior. For instance, olfaction seems to play a key role in mate choice and helps detecting emotions in other people. In a previous study, we showed that people who were born without a sense of smell exhibit enhanced social insecurity. Based on the comments to this article we decided to have a closer look to whether the absence of the sense of smell affects men and women differently. Under this focus questionnaire data of 32 patients, diagnosed with isolated congenital anosmia (10 men, 22 women) and 36 age-matched healthy controls (15 men, 21 women) was reanalyzed. In result, men and women without a sense of smell reported enhanced social insecurity, but with different consequences: Men who were born without a sense of smell exhibit a strongly reduced number of sexual relationships and women are affected such that they feel less secure about their partner. This emphasizes the importance of the sense of smell for intimate relationships. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae

    Directory of Open Access Journals (Sweden)

    Tarcilla C. Borghesan

    2018-02-01

    Full Text Available This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA barcoding showed that Angomonas predominated (46% over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH and internal transcribed spacer rDNA (ITS rDNA sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4, and four corresponding symbiont genotypes (Kcr1–Kcr4. Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This

  1. Genetic Diversity and Phylogenetic Relationships of Coevolving Symbiont-Harboring Insect Trypanosomatids, and Their Neotropical Dispersal by Invader African Blowflies (Calliphoridae)

    Science.gov (United States)

    Borghesan, Tarcilla C.; Campaner, Marta; Matsumoto, Tania E.; Espinosa, Omar A.; Razafindranaivo, Victor; Paiva, Fernando; Carranza, Julio C.; Añez, Nestor; Neves, Luis; Teixeira, Marta M. G.; Camargo, Erney P.

    2018-01-01

    This study is about the inter- and intra-specific genetic diversity of trypanosomatids of the genus Angomonas, and their association with Calliphoridae (blowflies) in Neotropical and Afrotropical regions. Microscopic examination of 3,900 flies of various families, mostly Calliphoridae, revealed that 31% of them harbored trypanosomatids. Small subunit rRNA (SSU rRNA) barcoding showed that Angomonas predominated (46%) over the other common trypanosomatids of blowflies of genera Herpetomonas and Wallacemonas. Among Angomonas spp., A. deanei was much more common than the two-other species, A. desouzai and A. ambiguus. Phylogenetic analyses based on SSU rRNA, glycosomal glyceraldehyde-3-phosphate dehydrogenase (gGAPDH) and internal transcribed spacer rDNA (ITS rDNA) sequences revealed a marked genetic diversity within A. deanei, which comprised four infraspecific genotypes (Dea1–Dea4), and four corresponding symbiont genotypes (Kcr1–Kcr4). Host and symbiont phylogenies were highly congruent corroborating their co-divergence, consistent with host-symbiont interdependent metabolism and symbiont reduced genomes shaped by a long coevolutionary history. We compared the diversity of Angomonas/symbionts from three genera of blowflies, Lucilia, Chrysomya and Cochliomyia. A. deanei, A. desouzai, and A. ambiguus were found in the three genera of blowflies in South America. In Africa, A. deanei and A. ambiguus were identified in Chrysomya. The absence of A. desouzai in Africa and its presence in Neotropical Cochliomyia and Lucilia suggests parasite spillback of A. desouzai into Chrysomya, which was most likely introduced four decades ago from Africa into the Neotropic. The absence of correlation between parasite diversity and geographic and genetic distances, with identical genotypes of A. deanei found in the Neotropic and Afrotropic, is consistent with disjunct distribution due to the recent human-mediated transoceanic dispersal of Angomonas by Chrysomya. This study provides

  2. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    VNTR numbers that occurred over the course of one year. Conclusions The comparative genomic analysis of the SAG clarifies the phylogenetics of these bacteria and supports the distinct species classification. Numerous potential virulence determinants were identified and provide a foundation for further studies into SAG pathogenesis. Furthermore, the data may be used to enable the development of rapid diagnostic assays and therapeutics for these pathogens. PMID:24341328

  3. Phylogenetic effective sample size.

    Science.gov (United States)

    Bartoszek, Krzysztof

    2016-10-21

    In this paper I address the question-how large is a phylogenetic sample? I propose a definition of a phylogenetic effective sample size for Brownian motion and Ornstein-Uhlenbeck processes-the regression effective sample size. I discuss how mutual information can be used to define an effective sample size in the non-normal process case and compare these two definitions to an already present concept of effective sample size (the mean effective sample size). Through a simulation study I find that the AICc is robust if one corrects for the number of species or effective number of species. Lastly I discuss how the concept of the phylogenetic effective sample size can be useful for biodiversity quantification, identification of interesting clades and deciding on the importance of phylogenetic correlations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Phylogenetic lineages in Entomophthoromycota

    NARCIS (Netherlands)

    Gryganskyi, A.P.; Humber, R.A.; Smith, M.E.; Hodge, K.; Huang, B.; Voigt, K.; Vilgalys, R.

    2013-01-01

    Entomophthoromycota is one of six major phylogenetic lineages among the former phylum Zygomycota. These early terrestrial fungi share evolutionarily ancestral characters such as coenocytic mycelium and gametangiogamy as a sexual process resulting in zygospore formation. Previous molecular studies

  5. How does cognition evolve? Phylogenetic comparative psychology

    Science.gov (United States)

    Matthews, Luke J.; Hare, Brian A.; Nunn, Charles L.; Anderson, Rindy C.; Aureli, Filippo; Brannon, Elizabeth M.; Call, Josep; Drea, Christine M.; Emery, Nathan J.; Haun, Daniel B. M.; Herrmann, Esther; Jacobs, Lucia F.; Platt, Michael L.; Rosati, Alexandra G.; Sandel, Aaron A.; Schroepfer, Kara K.; Seed, Amanda M.; Tan, Jingzhi; van Schaik, Carel P.; Wobber, Victoria

    2014-01-01

    Now more than ever animal studies have the potential to test hypotheses regarding how cognition evolves. Comparative psychologists have developed new techniques to probe the cognitive mechanisms underlying animal behavior, and they have become increasingly skillful at adapting methodologies to test multiple species. Meanwhile, evolutionary biologists have generated quantitative approaches to investigate the phylogenetic distribution and function of phenotypic traits, including cognition. In particular, phylogenetic methods can quantitatively (1) test whether specific cognitive abilities are correlated with life history (e.g., lifespan), morphology (e.g., brain size), or socio-ecological variables (e.g., social system), (2) measure how strongly phylogenetic relatedness predicts the distribution of cognitive skills across species, and (3) estimate the ancestral state of a given cognitive trait using measures of cognitive performance from extant species. Phylogenetic methods can also be used to guide the selection of species comparisons that offer the strongest tests of a priori predictions of cognitive evolutionary hypotheses (i.e., phylogenetic targeting). Here, we explain how an integration of comparative psychology and evolutionary biology will answer a host of questions regarding the phylogenetic distribution and history of cognitive traits, as well as the evolutionary processes that drove their evolution. PMID:21927850

  6. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  7. A multi-locus approach resolves the phylogenetic relationships of the Simulium asakoae and Simulium ceylonicum species groups in Malaysia: evidence for distinct evolutionary lineages.

    Science.gov (United States)

    Low, V L; Takaoka, H; Adler, P H; Ya'cob, Z; Norma-Rashid, Y; Chen, C D; Sofian-Azirun, M

    2015-09-01

    A multi-locus approach was used to examine the DNA sequences of 10 nominal species of blackfly in the Simulium subgenus Gomphostilbia (Diptera: Simuliidae) in Malaysia. Molecular data were acquired from partial DNA sequences of the mitochondria-encoded cytochrome c oxidase subunit I (COI), 12S rRNA and 16S rRNA genes, and the nuclear-encoded 18S rRNA and 28S rRNA genes. No single gene, nor the concatenated gene set, resolved all species or all relationships. However, all morphologically established species were supported by at least one gene. The multi-locus sequence analysis revealed two distinct evolutionary lineages, conforming to the morphotaxonomically recognized Simulium asakoae and Simulium ceylonicum species groups. © 2015 The Royal Entomological Society.

  8. Phylogenetic relationships of click beetles (Coleoptera: Elateridae) inferred from 28S ribosomal DNA: insights into the evolution of bioluminescence in Elateridae.

    Science.gov (United States)

    Sagegami-Oba, Reiko; Oba, Yuichi; Ohira, Hitoo

    2007-02-01

    Although the taxonomy of click beetles (family Elateridae) has been studied extensively, inconsistencies remain. We examine here the relationships between species of Elateridae based on partial sequences of nuclear 28S ribosomal DNA. Specimens were collected primarily from Japan, while luminous click beetles were also sampled from Central and South America to investigate the origins of bioluminescence in Elateridae. Neighbor-joining, maximum-parsimony, and maximum-likelihood analyses produced a consistent basal topology with high statistical support that is partially congruent with the results of previous investigations based on the morphological characteristics of larvae and adults. The most parsimonious reconstruction of the "luminous" and "nonluminous" states, based on the present molecular phylogeny, indicates that the ancestral state of Elateridae was nonluminous. This suggests that the bioluminescence in click beetle evolved independent of that of other luminous beetles, such as Lampyridae, despite their common mechanisms of bioluminescence.

  9. Serous cutaneous glands in new world hylid frogs: an ultrastructural study on skin poisons confirms phylogenetic relationships between Osteopilus septentrionalis and Phrynohyas venulosa.

    Science.gov (United States)

    Delfino, Giovanni; Brizzi, Rossana; Nosi, Daniele; Terreni, Alessandro

    2002-08-01

    Transmission electron microscope investigations of the serous (poison) skin glands in the New World tree frogs Osteopilus septentrionalis and Phrynohyas venulosa revealed that they produce granules with closely similar substructures, namely, a dense cortex and pale medulla. In both species these features, that contrast the complex, sometimes repeating patterns described in other hylid frogs, derive from similar secretory and maturational processes starting from the Golgi phase of poison biosynthesis. Observations on secretory discharge showed that the two species share common release mechanisms, based on bulk discharge (holocrine) processes. Our data provide novel evidence of the extensive ultrastructural polymorphism of serous skin products in Hylidae and agree with phylogenies that regard this family as polyphyletic in origin. Assuming that ultrastructural features of cutaneous poison biosynthesis and maturation are adequate clues for tracking anuran phylogeny, the present findings also support a close relationship between Osteopilus and Phrynohyas taxa as previously suggested by osteological evidence. Copyright 2002 Wiley-Liss, Inc.

  10. Mesoamerican tree squirrels evolution (Rodentia: Sciuridae): a molecular phylogenetic analysis

    OpenAIRE

    Federico Villalobos; Gustavo Gutierrez-Espeleta

    2014-01-01

    The tribe Sciurini comprehends the genera Sciurus, Syntheosiurus, Microsciurus, Tamiasciurus and Rheinthrosciurus. The phylogenetic relationships within Sciurus have been only partially done, and the relationship between Mesoamerican species remains unsolved. The phylogenetic relationships of the Mesoamerican tree squirrels were examined using molecular data. Sequence data publicly available (12S, 16S, CYTB mitochondrial genes and IRBP nuclear gene) and cytochrome B gene sequences of four pre...

  11. Phylogenetic Structure of Foliar Spectral Traits in Tropical Forest Canopies

    Directory of Open Access Journals (Sweden)

    Kelly M. McManus

    2016-02-01

    Full Text Available The Spectranomics approach to tropical forest remote sensing has established a link between foliar reflectance spectra and the phylogenetic composition of tropical canopy tree communities vis-à-vis the taxonomic organization of biochemical trait variation. However, a direct relationship between phylogenetic affiliation and foliar reflectance spectra of species has not been established. We sought to develop this relationship by quantifying the extent to which underlying patterns of phylogenetic structure drive interspecific variation among foliar reflectance spectra within three Neotropical canopy tree communities with varying levels of soil fertility. We interpreted the resulting spectral patterns of phylogenetic signal in the context of foliar biochemical traits that may contribute to the spectral-phylogenetic link. We utilized a multi-model ensemble to elucidate trait-spectral relationships, and quantified phylogenetic signal for spectral wavelengths and traits using Pagel’s lambda statistic. Foliar reflectance spectra showed evidence of phylogenetic influence primarily within the visible and shortwave infrared spectral regions. These regions were also selected by the multi-model ensemble as those most important to the quantitative prediction of several foliar biochemical traits. Patterns of phylogenetic organization of spectra and traits varied across sites and with soil fertility, indicative of the complex interactions between the environmental and phylogenetic controls underlying patterns of biodiversity.

  12. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo

    2014-01-01

    An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  13. The phylogenetic likelihood library.

    Science.gov (United States)

    Flouri, T; Izquierdo-Carrasco, F; Darriba, D; Aberer, A J; Nguyen, L-T; Minh, B Q; Von Haeseler, A; Stamatakis, A

    2015-03-01

    We introduce the Phylogenetic Likelihood Library (PLL), a highly optimized application programming interface for developing likelihood-based phylogenetic inference and postanalysis software. The PLL implements appropriate data structures and functions that allow users to quickly implement common, error-prone, and labor-intensive tasks, such as likelihood calculations, model parameter as well as branch length optimization, and tree space exploration. The highly optimized and parallelized implementation of the phylogenetic likelihood function and a thorough documentation provide a framework for rapid development of scalable parallel phylogenetic software. By example of two likelihood-based phylogenetic codes we show that the PLL improves the sequential performance of current software by a factor of 2-10 while requiring only 1 month of programming time for integration. We show that, when numerical scaling for preventing floating point underflow is enabled, the double precision likelihood calculations in the PLL are up to 1.9 times faster than those in BEAGLE. On an empirical DNA dataset with 2000 taxa the AVX version of PLL is 4 times faster than BEAGLE (scaling enabled and required). The PLL is available at http://www.libpll.org under the GNU General Public License (GPL). © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  14. Phylogenetic position of the spirochetal genus Cristispira

    DEFF Research Database (Denmark)

    Paster, B.J.; Pelletier, D.A.; Dewhirst, F.E.

    1996-01-01

    Comparative sequence analysis of 16S rRNA genes was used to determine the phylogenetic relationship of the genus Cristispira to other spirochetes. Since Cristispira organisms cannot presently be grown in vitro, 16S rRNA genes were amplified directly from bacterial DNA isolated from Cristispira a ...

  15. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  16. Phylogenetic relationship of asam gelugur (Garcinia atroviridis Griff. ex T. Anders) based on morphological characters in Langkat and Serdang Berdagai, Sumatera Utara

    Science.gov (United States)

    Bayu, E. S.; Lestami, A.; Kardhinata, E. H.; Rosemary

    2018-02-01

    Garcinia atroviridis plant is a commodity that has the potential to become an export commodity in Sumatera Utara. Characterization is an activity in germplasm to determine the morphological properties that can be utilized in differentiating between accessions and assessing the magnitude of genetic diversity. The magnitude of genetic diversity based on morphological properties can support breeding programs. The research was conducted in several areas of G. atroviridis plant, i.e. Gebang, Bahorok, Padang Tualang, Pegajahan, Sei Rampah, Pantai Cermin, and Perbaungan sub-districts in September 2016 with direct observation method. The aim of this research is to explore and characterization between G. atroviridis plant in Langkat and Serdang Berdagai. Parameters morphology characters were observed based on IPGRI, and observation data were analyzed by using SPSS version 21 to obtain the dendogram. The dendogram results showed that there are four groups of kinship relationships on the scale of the spacing (euclidean distance scale) 17. The lowest unequal value (closest kinship) in accessions G3(Bahorok) and G7(Sei Rampah) is 16.328 while the highest value of inequality (farthest kinship) in G5( Padang Tualang) and G6 (Pegajahan) is equal to 54.187. It needs the conservation of G. atroviridis although must be done next observation.

  17. Phylogenetic analysis of two single-copy nuclear genes revealed origin and complex relationships of polyploid species of Hordeum in Triticeae (Poaceae).

    Science.gov (United States)

    Hu, Qianni; Sun, Genlou

    2017-06-01

    Two single-copy nuclear genes, the second largest subunit of RNA polymerase II (RPB2) and thioredoxin-like gene (HTL), were used to explore the phylogeny and origin of polyploid species in Hordeum. Our results were partly in accord with previous studies, but disclosed additional complexity. Both RPB2 and HTL trees confirmed the presence of Xa genome in H. capense and H. secalinum, and that H. depressum originated from H. californicum together with other American diploids, either H. intercedens or H. pusillum. American diploids solely contributed to the origin of H. depressum. The Asian diploids, either H. bogdanii or H. brevisubulatum, contributed to the formation of American polyploids except H. depressum. RPB2 and HTL sequences showed that H. roshevitzii did not contribute to the origin of American tetraploids. Our data showed a close relationship between the hexaploids H. procerum and H. parodii and the tetraploids H. brachyantherum, H. fuegianum, H. guatemalense, H. jubatum, and H. tetraploidum. The involvement of the diploid H. pusillum and the tetraploid H. jubatum in the formation of H. arizonicum was also indicated in the HTL phylogeny. Our results suggested a possible gene introgression of W- and P-genome species into the tetraploid H. jubatum and the hexaploid H. procerum.

  18. Molecular identification of Anaplasma marginale in two autochthonous South American wild species revealed an identical new genotype and its phylogenetic relationship with those of bovines.

    Science.gov (United States)

    Guillemi, Eliana C; de la Fourniere, Sofía; Orozco, Marcela; Peña Martinez, Jorge; Correa, Elena; Fernandez, Javier; Lopez Arias, Ludmila; Paoletta, Martina; Corona, Belkis; Pinarello, Valérie; Wilkowsky, Silvina E; Farber, Marisa D

    2016-05-26

    Anaplasma marginale is a well-known cattle pathogen of tropical and subtropical world regions. Even though, this obligate intracellular bacterium has been reported in other host species different than bovine, it has never been documented in Myrmecophaga tridactyla (giant anteater) or Hippocamelus antisense (taruca), which are two native endangered species. Samples from two sick wild animals: a Myrmecophaga tridactyla (blood) and a Hippocamelus antisense (blood and serum) were studied for the presence of A. marginale DNA through msp5 gene fragment amplification. Further characterization was done through MSP1a tandem repeats analysis and MLST scheme and the genetic relationship among previously characterized A. marginale sequences were studied by applying, eBURST algorithm and AMOVA analysis. Anaplasma marginale DNA was identified in the Myrmecophaga tridactyla and Hippocamelus antisense samples. Through molecular markers, we identified an identical genotype in both animals that was not previously reported in bovine host. The analysis through eBURST and AMOVA revealed no differentiation between the taruca/anteater isolate and the bovine group. In the present publication we report the identification of A. marginale DNA in a novel ruminant (Hippocamelus antisense) and non-ruminant (Myrmecophaga tridactyla) host species. Genotyping analysis of isolates demonstrated the close relatedness of the new isolate with the circulation population of A. marginale in livestock. Further analysis is needed to understand whether these two hosts contribute to the anaplasmosis epidemiology.

  19. Evolution of the brain and phylogenetic development of Mrican ...

    African Journals Online (AJOL)

    Evolution of the brain and phylogenetic development of Mrican Bovidae. Henriette Oboussier. Zoological Institute and Museum, University of Hamburg. Evidence drawn from the study of 270 brains of 54 species and subspecies of African Bovidae makes it possible to base phylogenetic relationships on the similarities in the ...

  20. Phylogenetic relationships of some spirurine nematodes (Nematoda: Chromadorea: Rhabditida: Spirurina) parasitic in fishes inferred from SSU rRNA gene sequences.

    Science.gov (United States)

    Cernotíková, Eva; Horák, Ales; Moravec, Frantisek

    2011-06-01

    Abstract: Small subunit rRNA sequences were obtained from 38 representatives mainly of the nematode orders Spirurida (Camallanidae, Cystidicolidae, Daniconematidae, Philometridae, Physalopteridae, Rhabdochonidae, Skrjabillanidae) and, in part, Ascaridida (Anisakidae, Cucullanidae, Quimperiidae). The examined nematodes are predominantly parasites of fishes. Their analyses provided well-supported trees allowing the study ofphylogenetic relationships among some spirurine nematodes. The present results support the placement of Cucullanidae at the base of the suborder Spirurina and, based on the position of the genus Philonema (subfamily Philoneminae) forming a sister group to Skrjabillanidae (thus Philoneminae should be elevated to Philonemidae), the paraphyly of the Philometridae. Comparison of a large number of sequences of representatives of the latter family supports the paraphyly of the genera Philometra, Philometroides and Dentiphilometra. The validity of the newly included genera Afrophilometra and Caranginema is not supported. These results indicate geographical isolation has not been the cause of speciation in this parasite group and no coevolution with fish hosts is apparent. On the contrary, the group of South-American species ofAlinema, Nilonema and Rumai is placed in an independent branch, thus markedly separated from other family members. Molecular data indicate that the skrjabillanid subfamily Esocineminae (represented by Esocinema bohemicum) should be either elevated to the rank of an independent family or Daniconematidae (Mexiconema africanum) should be decreased to Daniconematinae and transferred to the family Skrjabillanidae. Camallanid genera Camallanus and Procamallanus, as well as the subgenera Procamallanus and Spirocamallanus are confirmed to be paraphyletic. Paraphyly has also been found within Filarioidea, Habronematoidea and Thelazioidea and in Cystidicolidae, Physalopteridae and Thelaziidae. The results of the analyses also show that

  1. Phylogenetic constraints in key functional traits behind species' climate niches

    DEFF Research Database (Denmark)

    Kellermann, Vanessa; Loeschcke, Volker; Hoffmann, Ary A

    2012-01-01

    adapted to similar environments or alternatively phylogenetic inertia. For desiccation resistance, weak phylogenetic inertia was detected; ancestral trait reconstruction, however, revealed a deep divergence that could be traced back to the genus level. Despite drosophilids’ high evolutionary potential......) for 92–95 Drosophila species and assessed their importance for geographic distributions, while controlling for acclimation, phylogeny, and spatial autocorrelation. Employing an array of phylogenetic analyses, we documented moderate-to-strong phylogenetic signal in both desiccation and cold resistance....... Desiccation and cold resistance were clearly linked to species distributions because significant associations between traits and climatic variables persisted even after controlling for phylogeny. We used different methods to untangle whether phylogenetic signal reflected phylogenetically related species...

  2. Comparative analysis of morphological and behavioral characters in the domestic dog and their importance in the reconstruction of phylogenetic relationships in canids

    Directory of Open Access Journals (Sweden)

    J. Jordana

    1999-03-01

    Full Text Available Relationships among 25 dog breeds, classified a priori by their respective ancestral trunks, were studied using data from 29 morphological and 13 behavioral characteristics. Although a certain correlation was found between both types of traits (r = 0.13; P As relações entre 25 raças de cães, classificadas "a priori" pelos seus respectivos troncos ancestrais, foram estudadas usando-se dados de 29 características morfológicas e 13 comportamentais. Embora tenha sido encontrada uma certa correlação entre ambos os tipos de caracteres (r = 0.13; P < 0.05, esta relação não se manifestou, com relação ao nível de classificação racial, nos dendrogramas obtidos. As relações entre as raças obtidas dos dados morfológicos foram mais congruentes do que as obtidas dos dados comportamentais, quando comparadas com filogenias de outras fontes de informação (análise eletroforética, principalmente. Isso indica que os caracteres morfológicos poderiam fornecer informações complementares melhores e em maior número do que os caracteres comportamentais, na reconstrução das relações filogenéticas dos canídeos. A diferença média de caráter (MCD, usada como uma medida de semelhança taxonômica entre raças, teve um valor de 0,53 (± 0,12 desvios padrão e foi de uma magnitude muito semelhante à obtida em outras espécies de animais domésticos (bovinos, eqüinos, ovinos e caprinos, indicando que existe um grau similar de diferenças morfológicas entre as raças destas espécies.

  3. Chloroplast microsatellites and mitochondrial nad1 intron 2 sequences indicate congruent phylogenetic relationships among Swiss stone pine (Pinus cembra), Siberian stone pine (Pinus sibirica), and Siberian dwarf pine (Pinus pumila).

    Science.gov (United States)

    Gugerli, F; Senn, J; Anzidei, M; Madaghiele, A; Büchler, U; Sperisen, C; Vendramin, G G

    2001-06-01

    We studied the phylogenetic relationships among the three stone pine species, Pinus cembra, P. sibirica, and P. pumila, using chloroplast microsatellites and mitochondrial nad1 intron 2 sequences. The three chloroplast microsatellite loci combined into a total of 18 haplotypes. Fourteen haplotypes were detected in 15 populations of P. cembra and one population of P. sibirica, five of which were shared between the two species, and the two populations of P. pumila comprised four species-specific haplotypes. Mitochondrial intron sequences confirmed this grouping of species. Sequences of P. cembra and P. sibirica were identical, but P. pumila differed by several nucleotide substitutions and insertions/deletions. A repeat region found in the former two species showed no intraspecific variation. These results indicate a relatively recent evolutionary separation of P. cembra and P. sibirica, despite their currently disjunct distributions. The species-specific chloroplast and mitochondrial markers of P. sibirica and P. pumila should help to trace the hybridization in their overlapping distribution area and to identify fossil remains with respect to the still unresolved postglacial re-colonization history of these two species.

  4. Phylogenetic relationships among marine Alteromonas-like proteobacteria: emended description of the family Alteromonadaceae and proposal of Pseudoalteromonadaceae fam. nov., Colwelliaceae fam. nov., Shewanellaceae fam. nov., Moritellaceae fam. nov., Ferrimonadaceae fam. nov., Idiomarinaceae fam. nov. and Psychromonadaceae fam. nov.

    Science.gov (United States)

    Ivanova, Elena P; Flavier, Sébastien; Christen, Richard

    2004-09-01

    The phylogenetic relationships among marine Alteromonas-like bacteria of the genera Alteromonas, Pseudoalteromonas, Glaciecola, Thalassomonas, Colwellia, Idiomarina, Oceanimonas, Oceanisphaera, Shewanella, Moritella, Ferrimonas, Psychromonas and several other genera of the 'Gammaproteobacteria' were studied. Results of 16S rRNA gene sequence analyses revealed that some members of these genera formed several coherent groups at the family level. Characteristic signature oligonucleotides for studied taxa were defined. Signature positions are divided into three classes: (i) single compensatory mutations, (ii) double compensatory mutations and (iii) mutations affecting nucleotides not paired in the secondary structure. The 16S rRNA gene sequence similarity level within genera was 93 % or above. This value can be a useful additional criterion for genus discrimination. On the basis of this work and previous polyphasic taxonomic studies, the circumscription of the family Alteromonadaceae is limited to the genera Alteromonas and Glaciecola and the creation is proposed of the families Pseudoalteromonadaceae fam. nov. to accommodate bacteria of the genera Pseudoalteromonas and Algicola gen. nov. (formerly Pseudoalteromonas bacteriolytica) and Colwelliaceae fam. nov. to accommodate bacteria of the genera Colwellia and Thalassomonas. Bacteria of the genera Oceanimonas and Oceanisphaera formed a robust cluster and shared common signature oligonucleotides. Because of deep branching and lack of association with any other genus, the following families are proposed that include single genera: Idiomarinaceae fam. nov., Psychromonadaceae fam. nov., Moritellaceae fam. nov., Ferrimonadaceae fam. nov. and Shewanellaceae fam. nov. Finally, this study also revealed that [Hyphomicrobium] indicum should be reclassified as Photobacterium indicum comb. nov.

  5. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  6. Genetic and phylogenetic analysis of ten Gobiidae species in China ...

    African Journals Online (AJOL)

    Administrator

    2011-09-07

    In Chinese). Xu F, Sun M (2001). Comparative analysis of phylogenetic relationships of grain amaranths and their wild relatives (Amaranthus;. Amaranthaceae) using internal transcribed spacer, amplified fragment length ...

  7. Molecular phylogenetic relationship of Paragonimus pseudoheterotremus.

    Science.gov (United States)

    Thaenkham, Urusa; Waikagul, Jitra

    2008-03-01

    A part of the mitochondrial cytochrome c oxidase subunit I (COI) gene and the nuclear ribosomal DNA second internal transcribed spacer 2 (ITS2) of a newly described lung fluke, Paragonimus pseudoheterotremus, were sequenced and compared with P. heterotremus, the species with a similar morphology. Pairwise distance of COI sequences revealed a genetic difference between P. heterotremus and P pseudoheterotremus with a nucleotide difference of COI sequences between these two species of 10.6%. The constructed phylogenic tree with high bootstrap proportion suggested that P. pseudoheterotremus is a sister species of P. heterotremus.

  8. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    Ajabsido and SC 22 were used as controls for Miniature Inverted. Repeat Transposable Elements (MITEs) assay, BTx623 and SC283 for SbMATE and BTx623 with SC 373 for open reading frame (ORF. 9) assay. DNA was extracted from five leaves of each line which were collected and immediately frozen in liquid nitrogen.

  9. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... Artificial hybridization and selection for desired phenotypes have already produced large number of cultivars. Phenotypic characters have ... genomic DNA was extracted from young fresh leaves of all the collected genotypes following CTAB method (Doyle and Doyle 1990). Quantitation of purified DNAs ...

  10. Phylogenetic diversity and relationships among sorghum ...

    African Journals Online (AJOL)

    Two DNA-based fingerprinting techniques, simple sequence repeats (SSR) and random amplified polymorphic DNA (RAPD) analyses, were applied in sorghum ... indicated that the genetic distances calculated from SSR data were highly correlated with the distances based on the geographic origin and race classifications.

  11. Evaluation of genetic divergence and phylogenetic relationship ...

    African Journals Online (AJOL)

    AMOVA results among groups and among cultivars were 10 and 90%, respectively, while the estimated gene flow was 6.117. The overall Nei's gene diversity (0.238) and Shannon's information index (0.372) indicated high degree of genetic polymorphism revealed by the STMS molecular markers. So, genetic divergence in ...

  12. Phylogenetic relationships between some African Characidae ...

    African Journals Online (AJOL)

    ... sequence data of the cytochrome-b gene also showed weak support for the grouping of the latter genus. However, clear support was found for the monophyletic origin of the other genera studied and for the validity of all three characiform families present in Africa. African Journal of Aquatic Science 2005, 30(1): 77–84 ...

  13. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Lines MSCRO2, MSCRC1 and MSCRN60, screened to be Al tolerant were genetically related at 70% average linkage similarity level and therefore recommend their further development as a food security measure in Kenya. Keywords: Aluminium (Al) toxicity, Sorghum bicolor, Sorghum bicolor multi-drug, toxic extrusion ...

  14. Phylogenetic relationships in genus Gloriosa L.

    African Journals Online (AJOL)

    In an attempt to test the monophyly of the genus Gloriosa L., the chloroplast region trnL-trnF sequences were employed using Baeometra uniflora, Hexacyrtis dickiana, Neodregea glassii, Onixotis punctata, Onixotis stricta, Ornithoglossum parviflorum, Ornithoglossum undulatum, Ornithoglossum viride, Ornithoglossum ...

  15. Phylogenetic relationships within indigenous Sudanese Cassia senna

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... Table 2. Polymorphism detected by the use of 6 random primers on 27 Cassia senna individuals. Name of primer. Sequence of primer. (5'- 3'). Total number of bands. Number of. Polymorphic bands. % of polymorphic bands. OPA-03. AGTCAGCCAC. 7. 6. 83.3. OPA-9. GGGTAACGCC. 5. 5. 100. OPA-20.

  16. Phylogenetic relationships among subsurface microorganisms. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Nierzwicki-Bauer, S.A.

    1991-12-31

    This project involves the development of group specific 16S ribosomal RNA-targeted oligonucleotide hybridization probes for the rapid detection of specific types of subsurface organisms (e.g., groups of microbes that share certain physiological traits). Major accomplishments for the period of 6/91 to 12/1/91 are described. Nine new probes have been synthesized on the basis of published 16S rRNA sequence data from the Ribosomal Database Project. We have initiated rapid screening of many of the subsurface microbial isolates obtained from the P24 borehole at the Savannah River Site. To date, we have screened approximately 50% of the isolates from P24. We have optimized our {und in situ} hybridization technique, and have developed a cell blot hybridization technique to screen 96 samples on a single blot. This is much faster than reading 96 individual slides. Preliminary experiments have been carried out which indicate specific nutrients can be used to amplify rRNA only in those organisms capable of metabolizing those nutrients. 1 tab., 2 figs.

  17. Phylogenetic relationships within indigenous Sudanese Cassia ...

    African Journals Online (AJOL)

    Random amplified polymorphic DNA (RAPD) markers were used to assess genetic diversity in Cassia senna (L.). RAPD technique was carried out in a set of 27 (C. senna (L.) genotypes collected from different regions of Sudan. A total of 27 polymorphisms (5.2 polymorphic markers per primer) out of 31 reproducible ...

  18. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    2007 Population structure of the malaria vector Anopheles dar- lingi in Rondonia, Brazilian Amazon, based on mitochondrial. DNA. Mem. Inst. Oswaldo Cruz 102, 953–958. Avise J. C. 2004 Molecular markers, natural history, and evolution,. 2nd edition. Sinauer, Sunderland, USA. Cameron S. L., Lambkin C. L., Barker S. C. ...

  19. Relaciones filogenéticas de las serpientes del género Conopsis con base en la morfología Phylogenetic relationships of the snake genus Conopsis based on morphology

    Directory of Open Access Journals (Sweden)

    Irene Goyenechea

    2009-12-01

    Full Text Available El género Conopsis es endémico de México y se distribuye desde Chihuahua hasta Oaxaca. Recientemente se estudió su taxonomía, al modificarse su nomenclatura en los últimos años. Estas serpientes colúbridas de hábitos enterradores pueden reconocerse por diversas características, entre las que destaca un surco en por lo menos 1 de los 3 últimos dientes maxilares. El género cuenta con 6 especies reconocidas: C. acuta, C. amphisticha, C. biserialis, C. lineata, C. megalodon y C. nasus. Estudios previos intentaron resolver la filogenia del género con base en caracteres morfológicos, pero debido al polimorfismo encontrado en ellos no hubo resolución. En este estudio se reevaluaron los caracteres morfológicos de Conopsis usando el método de frecuencias generalizadas para obtener una filogenia de las especies que componen el género. Los resultados obtenidos indican que se pueden recobrar las relaciones al interior del género usando el programa Fastmorphology, y que C. nasus y C. megalodon son grupos hermanos que junto con C. biserialis y C. amphisticha forman un clado. Conopsis acuta resultó el taxón más basal del género. Las relaciones de los grupos externos no se resuelven del todo pero los análisis indican que el grupo de los Sonorini no se sustenta.The snake genus Conopsis is endemic to Mexico and is found from Chihuahua to Oaxaca. It has been subject of study on its taxonomy due to recent modifications on its nomenclature. Now, this burrowing snake genus is diagnosed by several characters, standing out a groove in at least 1 of the 3-rear maxillary teeth. It comprises 6 known species: Conopsis acuta, Conopsis amphisticha, Conopsis biserialis, Conopsis lineata, Conopsis megalodon and Conopsis nasus. Previous works using morphological characters tried to solve the phylogenetic relationships between species in the genus but failed due to polymorphisms found in almost all characters studied. In this work those morphological

  20. Evolution of feeding specialization in Tanganyikan scale-eating cichlids: a molecular phylogenetic approach

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-10-01

    Full Text Available Abstract Background Cichlid fishes in Lake Tanganyika exhibit remarkable diversity in their feeding habits. Among them, seven species in the genus Perissodus are known for their unique feeding habit of scale eating with specialized feeding morphology and behaviour. Although the origin of the scale-eating habit has long been questioned, its evolutionary process is still unknown. In the present study, we conducted interspecific phylogenetic analyses for all nine known species in the tribe Perissodini (seven Perissodus and two Haplotaxodon species using amplified fragment length polymorphism (AFLP analyses of the nuclear DNA. On the basis of the resultant phylogenetic frameworks, the evolution of their feeding habits was traced using data from analyses of stomach contents, habitat depths, and observations of oral jaw tooth morphology. Results AFLP analyses resolved the phylogenetic relationships of the Perissodini, strongly supporting monophyly for each species. The character reconstruction of feeding ecology based on the AFLP tree suggested that scale eating evolved from general carnivorous feeding to highly specialized scale eating. Furthermore, scale eating is suggested to have evolved in deepwater habitats in the lake. Oral jaw tooth shape was also estimated to have diverged in step with specialization for scale eating. Conclusion The present evolutionary analyses of feeding ecology and morphology based on the obtained phylogenetic tree demonstrate for the first time the evolutionary process leading from generalised to highly specialized scale eating, with diversification in feeding morphology and behaviour among species.

  1. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Phylogenetic constrains on Polyporus umbellatus-Armillaria associations.

    Science.gov (United States)

    Xing, Xiaoke; Men, Jinxin; Guo, Shunxing

    2017-06-26

    It has been well established that some Armillaria species are symbionts of Polyporus umbellatus, However, little is known about the evolutionary history of P. umbellatus-Armillaria associations. In this research, we used an analysis based on the strength of the phylogenetic signal to investigate P. umbellatus-Armillaria associations in 57 sclerotial samples across 11 provinces of China. We isolated Armillaria strains from the invasion cavity inside the sclerotia of P. umbellatus and then phylogenetically analyzed these Armillaria isolates. We also tested the effect of P. umbellatus and Armillaria phylogenies on the P. umbellatus-Armillaria associations. We isolated forty-seven Armillaria strains from 26 P. umbellatus sclerotial samples. All Armillaria isolates were classified into the 5 phylogenetic lineages found in China except for one singleton. Among the 5 phylogenetic lineages, one lineage (lineage 8) was recognized by delimitation of an uncertain phylogenetic lineage in previous study. Results of simple Mantel test implied that phylogenetically related P. umbellatus populations tend to interact with phylogenetically related Armillaria species. Phylogenetic network analyses revealed that the interaction between P. umbellatus and Armillaria is significantly influenced by the phylogenetic relationships between the Armillaria species.

  3. Diversity and phylogenetic relationships of hemosporidian parasites in birds of Socorro Island, México, and their role in the re-introduction of the Socorro dove (Zenaida graysoni).

    Science.gov (United States)

    Carlson, Jenny S; Martínez-Gómez, Juan E; Valkiūnas, Gediminas; Loiseau, Claire; Bell, Douglas A; Sehgal, Ravinder N M

    2013-04-01

    The Socorro dove Zenaida graysoni , endemic to Socorro Island, was last reported in the wild in 1972. Fortunately, the species has been propagated in zoos in Europe and the United States, and plans are under way to re-introduce it to its native habitat. This will be the first known attempt to return a bird species extinct in the wild to its ancestral island. In order to assess the disease threats the Socorro dove may face, the avifauna of Socorro Island, with a specific focus on Socorro ground doves Columbina passerina socorroensis and mourning doves Zenaida macroura , as well as Socorro doves in captivity, were screened for blood parasites of the genera Plasmodium , Haemoproteus, Leucocytozoon, and Trypanosoma spp. We found Haemoproteus spp. in 17 (74%) of 23 Socorro ground doves, 23 (92%) of 25 mourning doves, and 3 (14%) of 21 northern mockingbirds; none of the other bird species showed infections. Here, we report the phylogenetic analysis of 19 distinct lineages of Haemoproteus spp. detected in birds of Socorro Island and compare their evolutionary relationships to parasites detected in the avifauna of the Galápagos Islands, continental Latin America, and Europe. Microscopic examination revealed 1 mourning dove infected with Plasmodium ( Haemamoeba ), thus underscoring the importance of using both PCR and microscopy when analyzing avian blood samples for hemosporidian parasites. The study confirms that the Socorro dove will most likely be exposed to Haemoproteus spp. that currently infect mourning doves and Socorro ground doves of Socorro Island. A monitoring program for both birds and vectors should be implemented to establish the prevalence of Plasmodium sp. and as a necessary conservation measure for critically endangered birds on the island.

  4. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    DEFF Research Database (Denmark)

    Willerslev, Eske; Gilbert, Tom; Binladen, Jonas

    2009-01-01

    reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i) The black/white, (ii) the woolly/Sumatran, and (iii) the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual......BACKGROUND: The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based) approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which...... genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir) has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae...

  5. Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe; Agaricales).

    Science.gov (United States)

    Matheny, P Brandon

    2005-04-01

    Approximately 3000 bp across 84 taxa have been analyzed for variable regions of RPB1, RPB2, and nLSU-rDNA to infer phylogenetic relationships in the large ectomycorrhizal mushroom genus Inocybe (Agaricales; Basidiomycota). This study represents the first effort to combine variable regions of RPB1 and RPB2 with nLSU-rDNA for low-level phylogenetic studies in mushroom-forming fungi. Combination of the three loci increases non-parametric bootstrap support, Bayesian posterior probabilities, and resolution for numerous clades compared to separate gene analyses. These data suggest the evolution of at least five major lineages in Inocybe-the Inocybe clade, the Mallocybe clade, the Auritella clade, the Inosperma clade, and the Pseudosperma clade. Additionally, many clades nested within each major lineage are strongly supported. These results also suggest the family Crepiodataceae sensu stricto is sister to Inocybe. Recognition of Inocybe at the family level, the Inocybaceae, is recommended.

  6. Fast phylogenetic DNA barcoding

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Willerslev, Eske

    2008-01-01

    We present a heuristic approach to the DNA assignment problem based on phylogenetic inferences using constrained neighbour joining and non-parametric bootstrapping. We show that this method performs as well as the more computationally intensive full Bayesian approach in an analysis of 500 insect...... DNA sequences obtained from GenBank. We also analyse a previously published dataset of environmental DNA sequences from soil from New Zealand and Siberia, and use these data to illustrate the fact that statistical approaches to the DNA assignment problem allow for more appropriate criteria...... for determining the taxonomic level at which a particular DNA sequence can be assigned....

  7. Species coexistence: macroevolutionary relationships and the contingency of historical interactions.

    Science.gov (United States)

    Germain, Rachel M; Weir, Jason T; Gilbert, Benjamin

    2016-03-30

    Evolutionary biologists since Darwin have hypothesized that closely related species compete more intensely and are therefore less likely to coexist. However, recent theory posits that species diverge in two ways: either through the evolution of 'stabilizing differences' that promote coexistence by causing individuals to compete more strongly with conspecifics than individuals of other species, or through the evolution of 'fitness differences' that cause species to differ in competitive ability and lead to exclusion of the weaker competitor. We tested macroevolutionary patterns of divergence by competing pairs of annual plant species that differ in their phylogenetic relationships, and in whether they have historically occurred in the same region or different regions (sympatric versus allopatric occurrence). For sympatrically occurring species pairs, stabilizing differences rapidly increased with phylogenetic distance. However, fitness differences also increased with phylogenetic distance, resulting in coexistence outcomes that were unpredictable based on phylogenetic relationships. For allopatric species, stabilizing differences showed no trend with phylogenetic distance, whereas fitness differences increased, causing coexistence to become less likely among distant relatives. Our results illustrate the role of species' historical interactions in shaping how phylogenetic relationships structure competitive dynamics, and offer an explanation for the evolution of invasion potential of non-native species. © 2016 The Author(s).

  8. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  9. Mixed Infections of Four Viruses, the Incidence and Phylogenetic Relationships of Sweet Potato Chlorotic Fleck Virus (Betaflexiviridae) Isolates in Wild Species and Sweetpotatoes in Uganda and Evidence of Distinct Isolates in East Africa.

    Science.gov (United States)

    Tugume, Arthur K; Mukasa, Settumba B; Valkonen, Jari P T

    2016-01-01

    Viruses infecting wild flora may have a significant negative impact on nearby crops, and vice-versa. Only limited information is available on wild species able to host economically important viruses that infect sweetpotatoes (Ipomoea batatas). In this study, Sweet potato chlorotic fleck virus (SPCFV; Carlavirus, Betaflexiviridae) and Sweet potato chlorotic stunt virus (SPCSV; Crinivirus, Closteroviridae) were surveyed in wild plants of family Convolvulaceae (genera Astripomoea, Ipomoea, Hewittia and Lepistemon) in Uganda. Plants belonging to 26 wild species, including annuals, biannuals and perennials from four agro-ecological zones, were observed for virus-like symptoms in 2004 and 2007 and sampled for virus testing. SPCFV was detected in 84 (2.9%) of 2864 plants tested from 17 species. SPCSV was detected in 66 (5.4%) of the 1224 plants from 12 species sampled in 2007. Some SPCSV-infected plants were also infected with Sweet potato feathery mottle virus (SPFMV; Potyvirus, Potyviridae; 1.3%), Sweet potato mild mottle virus (SPMMV; Ipomovirus, Potyviridae; 0.5%) or both (0.4%), but none of these three viruses were detected in SPCFV-infected plants. Co-infection of SPFMV with SPMMV was detected in 1.2% of plants sampled. Virus-like symptoms were observed in 367 wild plants (12.8%), of which 42 plants (11.4%) were negative for the viruses tested. Almost all (92.4%) the 419 sweetpotato plants sampled from fields close to the tested wild plants displayed virus-like symptoms, and 87.1% were infected with one or more of the four viruses. Phylogenetic and evolutionary analyses of the 3'-proximal genomic region of SPCFV, including the silencing suppressor (NaBP)- and coat protein (CP)-coding regions implicated strong purifying selection on the CP and NaBP, and that the SPCFV strains from East Africa are distinguishable from those from other continents. However, the strains from wild species and sweetpotato were indistinguishable, suggesting reciprocal movement of SPCFV

  10. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Directory of Open Access Journals (Sweden)

    Thiago Gonçalves-Souza

    Full Text Available An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables to the variation in spider body size and shape by comparing spiders at different scales: (i between bromeliads and dicot plants (i.e., habitat scale and (ii among bromeliads with distinct architectural features (i.e., microhabitat scale. We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species and ecological components (that express trait values independent of phylogenetic relationships. At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  11. Analyzing the Relationship of Strengths to Personality Preferences and Vocational Interests Utilizing Clifton StrengthsFinder, Myers-Briggs Type Indicator, and Strong Interest Inventory

    Science.gov (United States)

    Schenck, Paulette M.

    2009-01-01

    Throughout the history of vocational psychology, career counselors have constantly searched for, devised, and implemented practices and techniques to best prepare clients for the world of work. The purpose of this study was to explore the relationship between strengths to personality preference and vocational interests utilizing the Myers-Briggs…

  12. Mitochondrial DNA sequences and multiple data sets: a phylogenetic study of phytophagous beetles (Chrysomelidae: Ophraella).

    Science.gov (United States)

    Funk, D J; Futuyma, D J; Ortí, G; Meyer, A

    1995-07-01

    This paper presents the phylogenetic infrastructure for an integrated historical and experimental study of host use evolution in the chrysomelid leaf beetle genus Ophraella. We report the collection of sequence data from the 16S ribosomal RNA (446 bp) and the cytochrome oxidase subunit I (420 bp) mitochondrial genes from 12 species of Ophraella and two outgroups. Sequence analysis revealed a strong A + T nucleotide bias, high interspecific COI sequence divergences (up to 21.4%) that greatly exceeded those for 16S (up to 5.9%), high intraspecific COI divergences (up to 3.8%), a dearth of amino acid substitutions in COI, and differing substitution patterns in ribosomal stems and loops. Intraspecific variation in COI haplotypes generally supported the genealogical coherence of Ophraella lineages, while suggesting two cases of paraphyletic species. Separate phylogenetic analyses of 16S and COI data sets yielded largely congruent trees. A combined 16S + COI analysis yielded a single shortest tree under maximum parsimony that was identical to trees provided by successive approximations, neighbor-joining, and maximum-likelihood methods. This topology proved robust to various forms of weighting and most nodes were highly supported (by bootstrap analysis). Separate parsimony analyses of mtDNA and previously collected morphological and electromorphic data sets revealed congruent estimates of all cladistic relationships except those within one clade. Analysis of the pooled data sets in a combined approach additionally provided support for the basal placement of two species from this clade, although the topology for the remaining species was weakly supported and incongruent with the mtDNA tree. Each data set contained significantly structured phylogenetic signal with respect to this clade, and data sets exhibited limited conflict (character incongruence) with each other. The combined data set, however, was found to lack phylogenetic signal. These observations may imply that

  13. Phylogenetic analysis and temporal diversification of mosquitoes (Diptera: Culicidae) based on nuclear genes and morphology

    Science.gov (United States)

    2009-01-01

    Background Phylogenetic analyses provide a framework for examining the evolution of morphological and molecular diversity, interpreting patterns in biogeography, and achieving a stable classification. The generic and suprageneric relationships within mosquitoes (Diptera: Culicidae) are poorly resolved, making these subjects difficult to address. Results We carried out maximum parsimony and maximum likelihood, including Bayesian, analyses on a data set consisting of six nuclear genes and 80 morphological characters to assess their ability to resolve relationships among 25 genera. We also estimated divergence times based on sequence data and fossil calibration points, using Bayesian relaxed clock methods. Strong support was recovered for the basal position and monophyly of the subfamily Anophelinae and the tribes Aedini and Sabethini of subfamily Culicinae. Divergence times for major culicid lineages date to the early Cretaceous. Conclusions Deeper relationships within the family remain poorly resolved, suggesting the need for additional taxonomic sampling. Our results support the notion of rapid radiations early in the diversification of mosquitoes. PMID:20028549

  14. The Chloroplast Genome of Hyoscyamus niger and a Phylogenetic Study of the Tribe Hyoscyameae (Solanaceae)

    Science.gov (United States)

    Sanchez-Puerta, M. Virginia; Abbona, Cinthia Carolina

    2014-01-01

    The tribe Hyoscyameae (Solanaceae) is restricted to Eurasia and includes the genera Archihyoscyamus, Anisodus, Atropa, Atropanthe, Hyoscyamus, Physochlaina, Przewalskia and Scopolia. Even though the monophyly of Hyoscyameae is strongly supported, the relationships of the taxa within the tribe remain unclear. Chloroplast markers have been widely used to elucidate plant relationships at low taxonomic levels. Identification of variable chloroplast intergenic regions has been developed based on comparative genomics of chloroplast genomes, but these regions have a narrow phylogenetic utility. In this study, we present the chloroplast genome sequence of Hyoscyamus niger and make comparisons to other solanaceous plastid genomes in terms of gene order, gene and intron content, editing sites, origins of replication, repeats, and hypothetical open reading frames. We developed and sequenced three variable plastid markers from eight species to elucidate relationships within the tribe Hyoscyameae. The presence of a horizontally transferred intron in the mitochondrial cox1 gene of some species of the tribe is considered here a likely synapomorphy uniting five genera of the Hyoscyameae. Alternatively, the cox1 intron could be a homoplasious character acquired twice within the tribe. A homoplasious inversion in the intergenic plastid spacer trnC-psbM was recognized as a source of bias and removed from the data set used in the phylogenetic analyses. Almost 12 kb of plastid sequence data were not sufficient to completely resolve relationships among genera of Hyoscyameae but some clades were identified. Two alternative hypotheses of the evolution of the genera within the tribe are proposed. PMID:24851862

  15. Phylogenetic paleobiogeography of Late Ordovician Laurentian brachiopods

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bauer

    2014-12-01

    Full Text Available Phylogenetic biogeographic analysis of four brachiopod genera was used to uncover large-scale geologic drivers of Late Ordovician biogeographic differentiation in Laurentia. Previously generated phylogenetic hypotheses were converted into area cladograms, ancestral geographic ranges were optimized and speciation events characterized as via dispersal or vicariance, when possible. Area relationships were reconstructed using Lieberman-modified Brooks Parsimony Analysis. The resulting area cladograms indicate tectonic and oceanographic changes were the primary geologic drivers of biogeographic patterns within the focal taxa. The Taconic tectophase contributed to the separation of the Appalachian and Central basins as well as the two midcontinent basins, whereas sea level rise following the Boda Event promoted interbasinal dispersal. Three migration pathways into the Cincinnati Basin were recognized, which supports the multiple pathway hypothesis for the Richmondian Invasion.

  16. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  17. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  18. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  19. Tracking the evolutionary history of polyploidy in Fragaria L. (strawberry): new insights from phylogenetic analyses of low-copy nuclear genes.

    Science.gov (United States)

    Rousseau-Gueutin, M; Gaston, A; Aïnouche, A; Aïnouche, M L; Olbricht, K; Staudt, G; Richard, L; Denoyes-Rothan, B

    2009-06-01

    Phylogenetic utility of two nuclear genes (GBSSI-2 and DHAR) was explored in genus Fragaria in order to clarify phylogenetic relationships among taxa and to elucidate the origin of the polyploid species. Orthology of the amplified products was assessed by several methods. Our results strongly suggest the loss of one GBSSI duplicated copy (GBSSI-1) in the Fragariinae subtribe. Phylogenetic analyses provided new insights into the evolutionary history of Fragaria, such as evidence supporting the presence of three main diploid genomic pools in the genus and demonstrating the occurrence of independent events of polyploidisation. In addition, the data provide evidence supporting an allopolyploid origin of the hexaploid F. moschata, and the octoploids F. chiloensis, F. iturupensis and F. virginiana. Accordingly, a new pattern summarizing our present knowledge on the Fragaria evolutionary history is proposed. Additionally, sequence analyses also revealed relaxed constraints on homoeologous copies at high ploidy level, as demonstrated by deletion events within DHAR coding sequences of some allo-octoploid haplotypes.

  20. Highly Educated Men Establish Strong Emotional Links with Their Dogs: A Study with Monash Dog Owner Relationship Scale (MDORS) in Committed Spanish Dog Owners.

    Science.gov (United States)

    Calvo, Paula; Bowen, Jonathan; Bulbena, Antoni; Tobeña, Adolf; Fatjó, Jaume

    2016-01-01

    The characteristics of the human-animal bond may be influenced by both owner-related and dog-related factors. A study was designed to explore the existence of different dog ownership patterns and their related factors. We created an on line questionnaire that included demographic questions about the dog and the owner, a Spanish version of the Monash Dog Owner Relationship Scale (MDORS) and a validated measure of satisfaction with life (Cantril's ladder). We collected 1140 valid responses from adult dog owners, who were recruited using the client databases of Spanish veterinary practices. We explored the presence of groups within the population using Principal Components Analysis (PCA) of the MDORS variables combined with Hierarchical Cluster Analysis (HCA). Two groups were found; Group I having a higher level of emotional involvement with their dogs compared with Group II. Binary logistic regression was used to explore demographic factors that influenced group membership. Four variables were significantly associated with membership of Group I (pdog-ownership may be present within a population of owner-dog dyads, and that certain owner characteristics are associated with the type of owner-dog relationship. Future research could apply a similar approach to different types of sample population in order to identify specific patterns of dog-ownership.

  1. Highly Educated Men Establish Strong Emotional Links with Their Dogs: A Study with Monash Dog Owner Relationship Scale (MDORS) in Committed Spanish Dog Owners

    Science.gov (United States)

    Bulbena, Antoni; Tobeña, Adolf

    2016-01-01

    The characteristics of the human-animal bond may be influenced by both owner-related and dog-related factors. A study was designed to explore the existence of different dog ownership patterns and their related factors. We created an on line questionnaire that included demographic questions about the dog and the owner, a Spanish version of the Monash Dog Owner Relationship Scale (MDORS) and a validated measure of satisfaction with life (Cantril’s ladder). We collected 1140 valid responses from adult dog owners, who were recruited using the client databases of Spanish veterinary practices. We explored the presence of groups within the population using Principal Components Analysis (PCA) of the MDORS variables combined with Hierarchical Cluster Analysis (HCA). Two groups were found; Group I having a higher level of emotional involvement with their dogs compared with Group II. Binary logistic regression was used to explore demographic factors that influenced group membership. Four variables were significantly associated with membership of Group I (pdog-ownership may be present within a population of owner-dog dyads, and that certain owner characteristics are associated with the type of owner-dog relationship. Future research could apply a similar approach to different types of sample population in order to identify specific patterns of dog-ownership. PMID:28033397

  2. Insight into the strong aggregation-induced emission of low-conjugated racemic C6-unsubstituted tetrahydropyrimidines through crystal-structure-property relationship of polymorphs.

    Science.gov (United States)

    Zhu, Qiuhua; Zhang, Yilin; Nie, Han; Zhao, Zujin; Liu, Shuwen; Wong, Kam Sing; Tang, Ben Zhong

    2015-08-01

    Racemic C6-unsubstituted tetrahydropyrimidines (THPs) are a series of fluorophores with a strong aggregation-induced emission (AIE) effect. However, they do not possess the structural features of conventional AIE compounds. In order to understand their AIE mechanism, here, the influences of the molecular packing mode and the conformation on the optical properties of THPs were investigated using seven crystalline polymorphs of three THPs ( 1-3 ). The racemic THPs 1-3 have low-conjugated and highly flexible molecular structures, and hence show practically no emission in different organic solvents. However, the fluorescence quantum yields of their polymorphs are up to 93%, and the maximum excitation ( λ ex ) and emission ( λ em ) wavelengths of the polymorphs are long at 409 and 484 nm, respectively. Single-crystal structures and theoretical calculation of the HOMOs and LUMOs based on the molecular conformations of these polymorphs indicate that the polymorphs with the shortest λ ex and λ em values possess a RS -packing mode ( R - and S -enantiomers self-assemble as paired anti-parallel lines) and a more twisted conformation without through-space conjugation between the dicarboxylates, but the polymorphs with longer λ ex and λ em values adopt a RR / SS -packing mode ( R - and S -enantiomers self-assemble as unpaired zigzag lines) and a less twisted conformation with through-space conjugation between the dicarboxylates. The molecular conformations of 1-3 in all these polymorphs are stereo and more twisted than those in solution. Although 1-3 are poorly conjugated, the radiative rate constants ( k r ) of their polymorphs are as large as conventional fluorophores (0.41-1.03 × 10 8 s -1 ) because of improved electronic conjugation by both through-bond and through-space interactions. Based on the obtained results, it can be deduced that the strong AIE arises not only from the restriction of intramolecular motion but also from enhanced electronic coupling and

  3. Highly Educated Men Establish Strong Emotional Links with Their Dogs: A Study with Monash Dog Owner Relationship Scale (MDORS in Committed Spanish Dog Owners.

    Directory of Open Access Journals (Sweden)

    Paula Calvo

    Full Text Available The characteristics of the human-animal bond may be influenced by both owner-related and dog-related factors. A study was designed to explore the existence of different dog ownership patterns and their related factors. We created an on line questionnaire that included demographic questions about the dog and the owner, a Spanish version of the Monash Dog Owner Relationship Scale (MDORS and a validated measure of satisfaction with life (Cantril's ladder. We collected 1140 valid responses from adult dog owners, who were recruited using the client databases of Spanish veterinary practices. We explored the presence of groups within the population using Principal Components Analysis (PCA of the MDORS variables combined with Hierarchical Cluster Analysis (HCA. Two groups were found; Group I having a higher level of emotional involvement with their dogs compared with Group II. Binary logistic regression was used to explore demographic factors that influenced group membership. Four variables were significantly associated with membership of Group I (p<0.0001; male gender of the owner (OR = 32.36, high school level of maximum educational attainment (OR = 0.052, university level of maximum educational attainment (OR = 8.652, and owner Cantril's score (OR = 0.807. The results obtained from this convenience sample demonstrate that different patterns of dog-ownership may be present within a population of owner-dog dyads, and that certain owner characteristics are associated with the type of owner-dog relationship. Future research could apply a similar approach to different types of sample population in order to identify specific patterns of dog-ownership.

  4. Alcohol dehydrogenase-1B genotype (rs1229984) is a strong determinant of the relationship between body weight and alcohol intake in Japanese alcoholic men.

    Science.gov (United States)

    Yokoyama, Akira; Yokoyama, Tetsuji; Matsui, Toshifumi; Mizukami, Takeshi; Matsushita, Sachio; Higuchi, Susumu; Maruyama, Katsuya

    2013-07-01

    The calories in alcoholic beverages consumed by alcoholics are a major energy source and a strong modifier of their body weight. Genetic polymorphisms of alcohol dehydrogenase-1B (ADH1B) and aldehyde dehydrogenase-2 (ALDH2) affect susceptibility to alcoholism and may affect body weight via gene-associated differences in fuel utilization in alcoholics. We evaluated associations between ADH1B/ALDH2 genotypes and the body weight and body mass index (BMI) of 1,301 Japanese alcoholic men at the time of their first visit to an addiction center. Median (25th to 75th) caloric intake in the form of alcoholic beverages was 864 (588 to 1,176) kcal/d. Age-adjusted caloric intake did not differ according to ADH1B/ALDH2 genotypes. The body weight and BMI values showed that the ADH1B*2/*2 and *1/*2 carriers (n = 939) were significantly leaner than the ADH1B*1/*1 carriers (n = 362) irrespective of age, drinking, smoking, and dietary habits. The age-adjusted body weight values of the ADH1B*2/*2, ADH1B*1/*2, and ADH1B*1/*1 carriers were 58.4 ± 0.4, 58.7 ± 0.5, and 63.6 ± 0.5 kg, respectively (ADH1B*2 vs. ADH1B*1/*1 carriers, p body weight or BMI were observed. A multivariate analysis showed that BMI decreased by 0.35 per 10-year increase in age, by 1.73 in the presence of the ADH1B*2 allele, by 1.55 when the preferred beverage was whiskey, and by 0.19 per +10 cigarettes/d and that it increased by 0.10 per +22 g ethanol (EtOH)/d and by 0.41 per increase in category of frequency of milk intake (every day, occasionally, rarely, and never). The increase in BMI as alcohol consumption increased was significantly smaller in the ADH1B*2 group than in the ADH1B*1/*1 group (p = 0.002). ADH1B genotype was a strong determinant of body weight in the alcoholics. The more rapid EtOH elimination associated with the ADH1B*2 allele may result in less efficient utilization of EtOH as an energy source in alcoholics. Copyright © 2013 by the Research Society on Alcoholism.

  5. Osteología, taxonomía y relaciones filogenéticas de las ranas del género Telmatobufo (Leptodactylidae Osteology, taxonomy and phylogenetic relationships of the frog genus Telmatobufo (Leptodactylidae

    Directory of Open Access Journals (Sweden)

    J. RAMÓN FORMAS

    2001-06-01

    distance and Rogers' genetic distance were employed to assess the morphological and the genetical similarities among the three Telmatobufo species. Employing mtRNA12S sequences, in combination with polarized allelic frequencies of structural genes, and morphological (external and osteological characters, a hypothesis on the phylogenetic relationships of the Telmatobufo species is proposed, worked on principles of maximum parsimony and maximum likelihood. Finally, a reconstruction of the evolutionary history and speciation process of this group of endemic frogs of the temperate central southern Chilean forests is proposed

  6. From elemental tellurium to Ge2Sb2Te5 melts: High temperature dynamic and relaxation properties in relationship with the possible fragile to strong transition

    Science.gov (United States)

    Flores-Ruiz, H.; Micoulaut, M.

    2018-01-01

    We investigate the dynamic properties of Ge-Sb-Te phase change melts using first principles molecular dynamics with a special emphasis on the effect of tellurium composition on melt dynamics. From structural models and trajectories established previously [H. Flores-Ruiz et al., Phys. Rev. B 92, 134205 (2015)], we calculate the diffusion coefficients for the different species, the activation energies for diffusion, the Van Hove correlation, and the intermediate scattering functions able to substantiate the dynamics and relaxation behavior of the liquids as a function of temperature and composition that is also compared to experiment whenever possible. We find that the diffusion is mostly Arrhenius-like and that the addition of Ge/Sb atoms leads to a global decrease of the jump probability and to an increase in activated dynamics for diffusion. Relaxation behavior is analyzed and used in order to evaluate the possibility of a fragile to strong transition that is evidenced from the calculated high fragility (M = 129) of Ge2Sb2Te5 at high temperatures.

  7. Ten genes and two topologies: an exploration of higher relationships in skipper butterflies (Hesperiidae

    Directory of Open Access Journals (Sweden)

    Ranjit Kumar Sahoo

    2016-12-01

    Full Text Available Despite multiple attempts to infer the higher-level phylogenetic relationships of skipper butterflies (Family Hesperiidae, uncertainties in the deep clade relationships persist. The most recent phylogenetic analysis included fewer than 30% of known genera and data from three gene markers. Here we reconstruct the higher-level relationships with a rich sampling of ten nuclear and mitochondrial markers (7,726 bp from 270 genera and find two distinct but equally plausible topologies among subfamilies at the base of the tree. In one set of analyses, the nuclear markers suggest two contrasting topologies, one of which is supported by the mitochondrial dataset. However, another set of analyses suggests mito-nuclear conflict as the reason for topological incongruence. Neither topology is strongly supported, and we conclude that there is insufficient phylogenetic evidence in the molecular dataset to resolve these relationships. Nevertheless, taking morphological characters into consideration, we suggest that one of the topologies is more likely.

  8. Analysis of the relationship between genomic GC Content and patterns of base usage, codon usage and amino acid usage in prokaryotes: similar GC content adopts similar compositional frequencies regardless of the phylogenetic lineages.

    Directory of Open Access Journals (Sweden)

    Hui-Qi Zhou

    Full Text Available The GC contents of 2670 prokaryotic genomes that belong to diverse phylogenetic lineages were analyzed in this paper. These genomes had GC contents that ranged from 13.5% to 74.9%. We analyzed the distance of base frequencies at the three codon positions, codon frequencies, and amino acid compositions across genomes with respect to the differences in the GC content of these prokaryotic species. We found that although the phylogenetic lineages were remote among some species, a similar genomic GC content forced them to adopt similar base usage patterns at the three codon positions, codon usage patterns, and amino acid usage patterns. Our work demonstrates that in prokaryotic genomes: a base usage, codon usage, and amino acid usage change with GC content with a linear correlation; b the distance of each usage has a linear correlation with the GC content difference; and c GC content is more essential than phylogenetic lineage in determining base usage, codon usage, and amino acid usage. This work is exceptional in that we adopted intuitively graphic methods for all analyses, and we used these analyses to examine as many as 2670 prokaryotes. We hope that this work is helpful for understanding common features in the organization of microbial genomes.

  9. PhyloPat: phylogenetic pattern analysis of eukaryotic genes

    Directory of Open Access Journals (Sweden)

    de Vlieg Jacob

    2006-09-01

    Full Text Available Abstract Background Phylogenetic patterns show the presence or absence of certain genes or proteins in a set of species. They can also be used to determine sets of genes or proteins that occur only in certain evolutionary branches. Phylogenetic patterns analysis has routinely been applied to protein databases such as COG and OrthoMCL, but not upon gene databases. Here we present a tool named PhyloPat which allows the complete Ensembl gene database to be queried using phylogenetic patterns. Description PhyloPat is an easy-to-use webserver, which can be used