WorldWideScience

Sample records for strong haplotype association

  1. Genome-wide association study identifies new HLA class II haplotypes strongly protective against narcolepsy

    DEFF Research Database (Denmark)

    Hor, Hyun; Kutalik, Zoltán; Dauvilliers, Yves

    2010-01-01

    Narcolepsy is a rare sleep disorder with the strongest human leukocyte antigen (HLA) association ever reported. Since the associated HLA-DRB1*1501-DQB1*0602 haplotype is common in the general population (15-25%), it has been suggested that it is almost necessary but not sufficient for developing......*0602. We found association with a protective variant near HLA-DQA2 (rs2858884; P ... ratio = 0.02; P HLA haplotype suggests a virtually causal involvement of the HLA region in narcolepsy susceptibility....

  2. Genome-wide association study identifies new HLA class II haplotypes strongly protective against narcolepsy

    DEFF Research Database (Denmark)

    Hor, Hyun; Kutalik, Zoltán; Dauvilliers, Yves

    2010-01-01

    Narcolepsy is a rare sleep disorder with the strongest human leukocyte antigen (HLA) association ever reported. Since the associated HLA-DRB1*1501-DQB1*0602 haplotype is common in the general population (15-25%), it has been suggested that it is almost necessary but not sufficient for developing ...

  3. The 8.1 ancestral MHC haplotype is strongly associated with colorectal cancer risk.

    Science.gov (United States)

    Tóth, Eva Katalin; Kocsis, Judit; Madaras, Balázs; Bíró, Adrienn; Pocsai, Zsuzsa; Fust, George; Blaskó, Bernadett; Karádi, István; Adány, Róza; Laki, Judit

    2007-10-15

    Many recent data indicate that some alleles encoded in the central major histocompatibility complex (MHC) region (Class III) of short arm of chromosome 6 may modify the risk of cancer development. Therefore we determined 4 single nucleotide polymorphisms (SNPs) of this region (TNF-alpha -308 G > A, RAGE -429 T > C, HSP70-2 -1267 A > G, LTA 252 A > G) in genomic DNA samples from 183 Hungarian patients with colorectal cancer and 141 age matched control subjects representing the Hungarian population of the same age and gender. No significant differences were found in either SNP tested. When, however, three- or four-locus haplotypes consisting of known constituents of the so-called 8.1 ancestral haplotype (8.1AH) were considered, marked differences were observed. Frequency of TNF-alpha -308A, RAGE -429C, HSP70-2 -1267G, LTA 252G (8.1AH) haplotype was significantly (p = 0.006) more frequent (19.1%) among patients than in the controls (7.7%). Age- and gender-adjusted ratio of the 8.1AH carriers vs. non-carriers to have colorectal cancer was 2.514 (1.130-5.594). This risk was higher in cancer-indicate that carriers of the 8.1AH, encoding for an altered immune response and known to be associated with alterations of several immune functions and autoimmune diseases have an increased risk for some cancer types. These findings may contribute to better understanding how the defense mechanisms against tumors could be enhanced/strengthened. (c) 2007 Wiley-Liss, Inc.

  4. IL23R and IL12B SNPs and Haplotypes Strongly Associate with Crohn's Disease Risk in a New Zealand Population

    Directory of Open Access Journals (Sweden)

    Lynnette R. Ferguson

    2010-01-01

    Full Text Available DNA samples from 339 Crohn's disease (CD and 407 randomly selected controls from the Auckland (New Zealand IBD project, were genotyped for five common single nucleotide polymorphisms in IL-23R (rs11805303, rs7517847, rs1343151, rs11209026, and rs10889677 and two in IL-12B (rs1363670 and rs6887695. While the IL-12B variants did not show an overall association and other IL23R variants led to minor changes in the risk of CD, rs1343151 and/or rs7517847 variants in the IL-23R gene strongly reduced the risk of developing CD at both allelic and genotype levels. A significantly decreased risk of first diagnosis of childhood CD was observed in individuals carrying the A allele of rs1343151, or between 17–40 y in individuals carrying the G allele in rs7517847 of IL-23R. A significantly decreased risk of ileocolonic or structuring disease was observed in individuals carrying the A allele in either rs11209026 or rs1343151, or the G allele in rs7517847 of IL-23R, and when such individuals did develop the disease, they were unlikely to require a bowel resection. Certain haplotypes very strongly modified risk. There was evidence for interactions of IL-23R variants with the NOD2 wild-type (d/d genotype. Down-regulating the function of the IL-23R gene may decrease CD risk in the normal population.

  5. The most common mutation causing medium-chain acyl-CoA dehydrogenase deficiency is strongly associated with a particular haplotype in the region of the gene

    DEFF Research Database (Denmark)

    Kølvraa, S; Gregersen, N; Blakemore, A I

    1991-01-01

    RFLP haplotypes in the region containing the medium-chain acyl-CoA dehydrogenase (MCAD) gene on chromosome 1 have been determined in patients with MCAD deficiency. The RFLPs were detected after digestion of patient DNA with the enzymes BanII. PstI and TaqI and with an MCAD cDNA-clone as a probe....... Of 32 disease-causing alleles studied, 31 possessed the previously published A----G point-mutation at position 985 of the cDNA. This mutation has been shown to result in inactivity of the MCAD enzyme. In at least 30 of the 31 alleles carrying this G985 mutation a specific RFLP haplotype was present...

  6. IL23R and IL12B SNPs and Haplotypes Strongly Associate with Crohn's Disease Risk in a New Zealand Population

    OpenAIRE

    Ferguson, Lynnette R.; Han, Dug Yeo; Fraser, Alan G.; Huebner, Claudia; Lam, Wen Jiun; Morgan, Angharad R.

    2010-01-01

    DNA samples from 339 Crohn's disease (CD) and 407 randomly selected controls from the Auckland (New Zealand) IBD project, were genotyped for five common single nucleotide polymorphisms in IL-23R (rs11805303, rs7517847, rs1343151, rs11209026, and rs10889677) and two in IL-12B (rs1363670 and rs6887695). While the IL-12B variants did not show an overall association and other IL23R variants led to minor changes in the risk of CD, rs1343151 and/or rs7517847 variants in the IL-23R gene strongly re...

  7. SNV and haplotype analysis reveals new CSRP1 variants associated with growth and carcass traits.

    Science.gov (United States)

    He, Hua; Liu, Xiao-lin; Zhang, Hui-lin; Yang, Jing; Niu, Fu-biao; Li, Zhi-xiong; Liu, Yu; Chen, Ling

    2013-06-15

    The cysteine and glycine-rich protein 1 and 2 genes (CSRP1 and CSRP2) are an effective growth factor in promoting skeletal muscle growth in vitro and vivo. However, in cattle, the information on the CSRP1 and CSRP2 genes is very limited. The aim of this study was to examine the association of the CSRP1 and CSRP2 variants with growth and carcass traits in cattle breeds. Three single nucleotide variants (SNVs) were identified within the bovine CSRP1 gene, whereas CSRP2 gene has not detected any SNVs, using DNA pooled sequencing, PCR-RFLP, and forced PCR-RFLP methods. These SNVs include g. 801T>C (Intron 2), g. 46T>C (Exon 3) and g. 99C>G (Intron 3). Besides, we also investigated haplotype frequencies and linkage disequilibrium (LD) coefficients for three SNVs in all study populations. LD and haplotype structure of CSRP1 were different between breeds. The result of haplotype analysis demonstrated eight haplotype present in QC (Qinchuan) and one haplotype in CH (Chinese Holstein). Only haplotype 1 (TTC), shared by all two populations, comprised 10.74% and 100.00%, of all haplotypes observed in QC and CH, respectively. Haplotype 5 (CTC) had the highest haplotype frequencies in QC (30.98%) and haplotype 1 had the highest haplotype frequencies in CH (100.00%). The statistical analyses indicated that one single SNV and 19 combined haplotypes were significantly or highly significantly associated with growth and carcass traits in the QC cattle population (P<0.05 or P<0.01). Quantitative real-time PCR (qRT-PCR) analyses showed that the bovine CSRP1 and CSRP2 genes were widely expressed in many tissues. The results of this study suggest that the CSRP1 gene possibly is a strong candidate gene that affects growth and carcass traits in the Chinese beef cattle breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. [Construction of haplotype and haplotype block based on tag single nucleotide polymorphisms and their applications in association studies].

    Science.gov (United States)

    Gu, Ming-liang; Chu, Jia-you

    2007-12-01

    Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.

  9. The association of the JAK2 46/1 haplotype with non-splanchnic venous thrombosis.

    Science.gov (United States)

    Zerjavic, Katja; Zagradisnik, Boris; Lokar, Lidija; Krasevac, Marjana G; Vokac, Nadja K

    2013-08-01

    The inherited JAK2 46/1 haplotype is strongly associated with the development of myeloproliferative neoplasms (MPNs), and its increased frequency has also been reported in splanchnic venous thrombosis (SVT). In the present study, the role of the JAK2 46/1 haplotype in non-splanchnic venous thrombosis (non-SVT) was investigated. We genotyped 438 patients with non-SVT, 226 patients with MPNs and 459 healthy controls for three single nucleotide polymorphisms (SNPs) which tag the JAK2 46/1 haplotype (rs12342421 G>C, rs12343867 T>C and rs10974944 C>G). We found statistically significant association of the rs12342421 GC+CC genotypes (OR=1.40; p=0.023) and the rs12343867 TC+CC genotypes (OR=1.83; p=7.02 x 10(-5)) with non-SVT. We also found that the CC haplotype of these two SNPs was associated with an increased risk of the disease (OR=1.68; p=0.009). Stratification analysis indicated that the observed association of the JAK2 46/1 haplotype with non-SVT was probably largely free of confounding effect of thrombophilic risk factors. In addition, we established a strong association of SNPs rs12342421 and rs10974944 and their CG haplotype with MPNs and with JAK2 V617F-positive MPNs. This study provides statistical evidence that SNPs rs12342421 and rs12343867 are associated with an increased risk of non-SVT. Consistently, haplotypes of the SNPs were also associated with non-SVT risk, suggesting that inherited genetic variation in the JAK2 gene may play a role in the pathogenesis of non-SVT. Furthermore, the reported associations of the JAK2 46/1 haplotype with MPNs as well as with the occurrence of the JAK2 V617F mutation in MPNs were confirmed. © 2013.

  10. Musical aptitude is associated with AVPR1A-haplotypes.

    Directory of Open Access Journals (Sweden)

    Liisa T Ukkola

    Full Text Available Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A, serotonin transporter (SLC6A4, catecol-O-methyltranferase (COMT, dopamin receptor D2 (DRD2 and tyrosine hydroxylase 1 (TPH1, genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT and Carl Seashores tests for pitch (SP and for time (ST. Data on creativity in music (composing, improvising and/or arranging music was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2 = .84; composing h(2 = .40; arranging h(2 = .46; improvising h(2 = .62 in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (p<.0001. We discovered an overall haplotype association with AVPR1A gene (markers RS1 and RS3 and KMT (p = 0.0008; corrected p = 0.00002, SP (p = 0.0261; corrected p = 0.0072 and combined music test scores (COMB (p = 0.0056; corrected p = 0.0006. AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184 and COMB (p = 0.0083; corrected p = 0.0040 using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment

  11. Musical aptitude is associated with AVPR1A-haplotypes.

    Science.gov (United States)

    Ukkola, Liisa T; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-05-20

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h(2) = .84; composing h(2) = .40; arranging h(2) = .46; improvising h(2) = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior.

  12. Musical Aptitude Is Associated with AVPR1A-Haplotypes

    Science.gov (United States)

    Ukkola, Liisa T.; Onkamo, Päivi; Raijas, Pirre; Karma, Kai; Järvelä, Irma

    2009-01-01

    Artistic creativity forms the basis of music culture and music industry. Composing, improvising and arranging music are complex creative functions of the human brain, which biological value remains unknown. We hypothesized that practicing music is social communication that needs musical aptitude and even creativity in music. In order to understand the neurobiological basis of music in human evolution and communication we analyzed polymorphisms of the arginine vasopressin receptor 1A (AVPR1A), serotonin transporter (SLC6A4), catecol-O-methyltranferase (COMT), dopamin receptor D2 (DRD2) and tyrosine hydroxylase 1 (TPH1), genes associated with social bonding and cognitive functions in 19 Finnish families (n = 343 members) with professional musicians and/or active amateurs. All family members were tested for musical aptitude using the auditory structuring ability test (Karma Music test; KMT) and Carl Seashores tests for pitch (SP) and for time (ST). Data on creativity in music (composing, improvising and/or arranging music) was surveyed using a web-based questionnaire. Here we show for the first time that creative functions in music have a strong genetic component (h2 = .84; composing h2 = .40; arranging h2 = .46; improvising h2 = .62) in Finnish multigenerational families. We also show that high music test scores are significantly associated with creative functions in music (pmusic test scores (COMB) (p = 0.0056; corrected p = 0.0006). AVPR1A haplotype AVR+RS1 further suggested a positive association with ST (p = 0.0038; corrected p = 0.00184) and COMB (p = 0.0083; corrected p = 0.0040) using haplotype-based association test HBAT. The results suggest that the neurobiology of music perception and production is likely to be related to the pathways affecting intrinsic attachment behavior. PMID:19461995

  13. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features

    Directory of Open Access Journals (Sweden)

    Camille Ribeyre

    2018-02-01

    Full Text Available Human leukocyte antigen (HLA-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC. Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing, thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF binding sites and alternative splicing sites. HLA-G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a

  14. HLA-G Haplotypes Are Differentially Associated with Asthmatic Features.

    Science.gov (United States)

    Ribeyre, Camille; Carlini, Federico; René, Céline; Jordier, François; Picard, Christophe; Chiaroni, Jacques; Abi-Rached, Laurent; Gouret, Philippe; Marin, Grégory; Molinari, Nicolas; Chanez, Pascal; Paganini, Julien; Gras, Delphine; Di Cristofaro, Julie

    2018-01-01

    Human leukocyte antigen (HLA)-G, a HLA class Ib molecule, interacts with receptors on lymphocytes such as T cells, B cells, and natural killer cells to influence immune responses. Unlike classical HLA molecules, HLA-G expression is not found on all somatic cells, but restricted to tissue sites, including human bronchial epithelium cells (HBEC). Individual variation in HLA-G expression is linked to its genetic polymorphism and has been associated with many pathological situations such as asthma, which is characterized by epithelium abnormalities and inflammatory cell activation. Studies reported both higher and equivalent soluble HLA-G (sHLA-G) expression in different cohorts of asthmatic patients. In particular, we recently described impaired local expression of HLA-G and abnormal profiles for alternatively spliced isoforms in HBEC from asthmatic patients. sHLA-G dosage is challenging because of its many levels of polymorphism (dimerization, association with β2-microglobulin, and alternative splicing), thus many clinical studies focused on HLA-G single-nucleotide polymorphisms as predictive biomarkers, but few analyzed HLA-G haplotypes. Here, we aimed to characterize HLA-G haplotypes and describe their association with asthmatic clinical features and sHLA-G peripheral expression and to describe variations in transcription factor (TF) binding sites and alternative splicing sites. HLA - G haplotypes were differentially distributed in 330 healthy and 580 asthmatic individuals. Furthermore, HLA-G haplotypes were associated with asthmatic clinical features showed. However, we did not confirm an association between sHLA-G and genetic, biological, or clinical parameters. HLA-G haplotypes were phylogenetically split into distinct groups, with each group displaying particular variations in TF binding or RNA splicing sites that could reflect differential HLA-G qualitative or quantitative expression, with tissue-dependent specificities. Our results, based on a multicenter

  15. Association of LRP5 haplotypes with osteoporosis in Mexican women.

    Science.gov (United States)

    Falcón-Ramírez, Edith; Casas-Avila, Leonora; Cerda-Flores, Ricardo M; Castro-Hernández, Clementina; Rubio-Lightbourn, Julieta; Velázquez-Cruz, Rafael; Diez-G, Pilar; Peñaloza-Espinosa, Rosenda; Valdés-Flores, Margarita

    2013-03-01

    Osteoporosis is a common health problem in Mexico, so it is essential to investigate the status of different gene polymorphisms that could serve as genetic susceptibility markers in the Mexican population. Genes with a role in bone metabolism are excellent candidates for association studies. In this study were determined the allelic and genotypic frequencies of four polymorphic markers (C/T rs3736228, G/A rs4988321, T/C rs627174 and T/C rs901824) in the low-density lipoprotein receptor-related protein 5 gene (LRP5) and their association with osteoporosis in 100 pos-menopausal osteoporotic Mexican women and their controls, using real time-PCR and TaqMan probes. Only the G/A polymorphism (rs4988321, Val667Met) showed significant differences (p = 0.039) when genotype frequencies were compared. However, when the haplotypes of these four polymorphisms were analyzed, interesting associations became evident. The CGTT haplotype showed significant association with low risk of osteoporosis (OR 0.629; p = 0.007; [95 % CI, 0.448-0.884]), whereas the TACT haplotype was significantly associated with a higher risk of osteoporosis (OR 7.965; p = 0.006; [95 % CI, 1.557-54.775]). Our results supported the association of LRP5 with osteoporosis and showed the potential value of LRP5 haplotypes to identify risk of osteoporosis in Mexican population.

  16. Association of specific haplotype of TNFα with Helicobacter pylori ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 87; Issue 3. Association of specific haplotype of TNF with Helicobacter pylori-mediated duodenal ulcer in eastern Indian population. Meenakshi Chakravorty Dipanjana Datta De Abhijit Choudhury Amal Santra Susanta Roychoudhury. Research Note Volume 87 Issue 3 ...

  17. Global haplotype partitioning for maximal associated SNP pairs.

    Science.gov (United States)

    Katanforoush, Ali; Sadeghi, Mehdi; Pezeshk, Hamid; Elahi, Elahe

    2009-08-27

    Global partitioning based on pairwise associations of SNPs has not previously been used to define haplotype blocks within genomes. Here, we define an association index based on LD between SNP pairs. We use the Fisher's exact test to assess the statistical significance of the LD estimator. By this test, each SNP pair is characterized as associated, independent, or not-statistically-significant. We set limits on the maximum acceptable proportion of independent pairs within all blocks and search for the partitioning with maximal proportion of associated SNP pairs. Essentially, this model is reduced to a constrained optimization problem, the solution of which is obtained by iterating a dynamic programming algorithm. In comparison with other methods, our algorithm reports blocks of larger average size. Nevertheless, the haplotype diversity within the blocks is captured by a small number of tagSNPs. Resampling HapMap haplotypes under a block-based model of recombination showed that our algorithm is robust in reproducing the same partitioning for recombinant samples. Our algorithm performed better than previously reported models in a case-control association study aimed at mapping a single locus trait, based on simulation results that were evaluated by a block-based statistical test. Compared to methods of haplotype block partitioning, we performed best on detection of recombination hotspots. Our proposed method divides chromosomes into the regions within which allelic associations of SNP pairs are maximized. This approach presents a native design for dimension reduction in genome-wide association studies. Our results show that the pairwise allelic association of SNPs can describe various features of genomic variation, in particular recombination hotspots.

  18. Global haplotype partitioning for maximal associated SNP pairs

    Directory of Open Access Journals (Sweden)

    Pezeshk Hamid

    2009-08-01

    Full Text Available Abstract Background Global partitioning based on pairwise associations of SNPs has not previously been used to define haplotype blocks within genomes. Here, we define an association index based on LD between SNP pairs. We use the Fisher's exact test to assess the statistical significance of the LD estimator. By this test, each SNP pair is characterized as associated, independent, or not-statistically-significant. We set limits on the maximum acceptable proportion of independent pairs within all blocks and search for the partitioning with maximal proportion of associated SNP pairs. Essentially, this model is reduced to a constrained optimization problem, the solution of which is obtained by iterating a dynamic programming algorithm. Results In comparison with other methods, our algorithm reports blocks of larger average size. Nevertheless, the haplotype diversity within the blocks is captured by a small number of tagSNPs. Resampling HapMap haplotypes under a block-based model of recombination showed that our algorithm is robust in reproducing the same partitioning for recombinant samples. Our algorithm performed better than previously reported models in a case-control association study aimed at mapping a single locus trait, based on simulation results that were evaluated by a block-based statistical test. Compared to methods of haplotype block partitioning, we performed best on detection of recombination hotspots. Conclusion Our proposed method divides chromosomes into the regions within which allelic associations of SNP pairs are maximized. This approach presents a native design for dimension reduction in genome-wide association studies. Our results show that the pairwise allelic association of SNPs can describe various features of genomic variation, in particular recombination hotspots.

  19. A systematic search for SNPs/haplotypes associated with disease phenotypes using a haplotype-based stepwise procedure

    Directory of Open Access Journals (Sweden)

    Andriesen Jessica

    2008-12-01

    Full Text Available Abstract Background Genotyping technologies enable us to genotype multiple Single Nucleotide Polymorphisms (SNPs within selected genes/regions, providing data for haplotype association analysis. While haplotype-based association analysis is powerful for detecting untyped causal alleles in linkage-disequilibrium (LD with neighboring SNPs/haplotypes, the inclusion of extraneous SNPs could reduce its power by increasing the number of haplotypes with each additional SNP. Methods Here, we propose a haplotype-based stepwise procedure (HBSP to eliminate extraneous SNPs. To evaluate its properties, we applied HBSP to both simulated and real data, generated from a study of genetic associations of the bactericidal/permeability-increasing (BPI gene with pulmonary function in a cohort of patients following bone marrow transplantation. Results Under the null hypothesis, use of the HBSP gave results that retained the desired false positive error rates when multiple comparisons were considered. Under various alternative hypotheses, HBSP had adequate power to detect modest genetic associations in case-control studies with 500, 1,000 or 2,000 subjects. In the current application, HBSP led to the identification of two specific SNPs with a positive validation. Conclusion These results demonstrate that HBSP retains the essence of haplotype-based association analysis while improving analytic power by excluding extraneous SNPs. Minimizing the number of SNPs also enables simpler interpretation and more cost-effective applications.

  20. Genome-wide association studies using haplotypes and individual SNPs in Simmental cattle.

    Directory of Open Access Journals (Sweden)

    Yang Wu

    Full Text Available Recent advances in high-throughput genotyping technologies have provided the opportunity to map genes using associations between complex traits and markers. Genome-wide association studies (GWAS based on either a single marker or haplotype have identified genetic variants and underlying genetic mechanisms of quantitative traits. Prompted by the achievements of studies examining economic traits in cattle and to verify the consistency of these two methods using real data, the current study was conducted to construct the haplotype structure in the bovine genome and to detect relevant genes genuinely affecting a carcass trait and a meat quality trait. Using the Illumina BovineHD BeadChip, 942 young bulls with genotyping data were introduced as a reference population to identify the genes in the beef cattle genome significantly associated with foreshank weight and triglyceride levels. In total, 92,553 haplotype blocks were detected in the genome. The regions of high linkage disequilibrium extended up to approximately 200 kb, and the size of haplotype blocks ranged from 22 bp to 199,266 bp. Additionally, the individual SNP analysis and the haplotype-based analysis detected similar regions and common SNPs for these two representative traits. A total of 12 and 7 SNPs in the bovine genome were significantly associated with foreshank weight and triglyceride levels, respectively. By comparison, 4 and 5 haplotype blocks containing the majority of significant SNPs were strongly associated with foreshank weight and triglyceride levels, respectively. In addition, 36 SNPs with high linkage disequilibrium were detected in the GNAQ gene, a potential hotspot that may play a crucial role for regulating carcass trait components.

  1. Extended HLA-D region haplotype associated with celiac disease

    Energy Technology Data Exchange (ETDEWEB)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II ..beta..-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this ..beta..-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP ..beta..-chain. This celiac disease-associated HLA-DP ..beta..-chain gene was flanked by HLA-DP ..cap alpha..-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DP..cap alpha..-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP ..cap alpha..- and ..beta..-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion.

  2. Extended HLA-D region haplotype associated with celiac disease

    International Nuclear Information System (INIS)

    Howell, M.D.; Smith, J.R.; Austin, R.K.; Kelleher, D.; Nepom, G.T.; Volk, B.; Kagnoff, M.F.

    1988-01-01

    Celiac disease has one of the strongest associations with HLA (human leukocyte antigen) class II markers of the known HLA-linked diseases. This association is primarily with the class II serologic specificities HLA-DR3 and -DQw2. The authors previously described a restriction fragment length polymorphism (RFLP) characterized by the presence of a 4.0-kilobase Rsa I fragment derived from an HLA class II β-chain gene, which distinguishes the class II HLA haplotype of celiac disease patients from those of many serologically matched controls. They now report the isolation of this β-chain gene from a bacteriophage genomic library constructed from the DNA of a celiac disease patient. Based on restriction mapping and differential hybridization with class II cDNA and oligonucleotide probes, this gene was identified as one encoding an HLA-DP β-chain. This celiac disease-associated HLA-DP β-chain gene was flanked by HLA-DP α-chain genes and, therefore, was probably in its normal chromosomal location. The HLA-DPα-chain genes of celiac disease patients also were studied by RFLP analysis. Celiac disease is associated with a subset of HLA-DR3, -DQw2 haplotypes characterized by HLA-DP α- and β-chain gene RFLPs. Within the celiac-disease patient population, the joint segregation of these HLA-DP genes with those encoding the serologic specificities HLA-DR3 and -DQw2 indicates: (i) that the class II HLA haplotype associated with celiac disease is extended throughout the entire HLA-D region, and (ii) that celiac-disease susceptibility genes may reside as far centromeric on this haplotype as the HLA-DP subregion

  3. Susceptible and Protective Associations of HLA Alleles and Haplotypes with Cervical Cancer in South India.

    Science.gov (United States)

    Rathika, Chinniah; Murali, Vijayan; Dhivakar, Mani; Kamaraj, Raju; Malini, Ravi Padma; Ramgopal, Sivanadham; Balakrishnan, Karuppiah

    2016-01-01

    Human leukocyte antigen (HLA) genes have been implicated in cervical cancer in several populations. To study the predispositions of HLA alleles/haplotypes with cervical cancer. Clinically diagnosed and PAP smear confirmed cervical cancer patients (n 48) and age matched controls (n 47) were genotyped for HLA-A,-B,-DRB1* and DQB1* alleles by PCR-SSP methods. The frequencies of alleles DRB1*04 (OR=2.57), DRB1*15 (OR=2.04), DQB1*0301 (OR=4.91), DQB1*0601 (OR=2.21), B*15 (OR=13.03) and B*07 (OR=6.23) were higher in cervical cancer patients than in the controls. The frequencies of alleles DRB1*10 (OR=0.22) and B*35 (OR=0.19) were decreased. Strong disease associations were observed for haplotypes DRB1*15-DQB1*0601 (OR=6.56; HLA-C* typing of 8 patients who possessed a unique three locus haplotype 'A*11-B*07-DRB1*04' (8/48; 16.66%; OR=6.51; cancer. Strong susceptible associations were documented for HLA alleles B*15, B*07, DRB1*04, DRB1*15, DQB1*0301, DQB1*0601 and haplotypes DRB1*15-DQB1*0601 and DRB1*14-DQB1*0501. Further, protective associations were evidenced for alleles B*35 and DRB1*10 and haplotypes A*11-B*35 and DRB1*10-DQB1*0501 with cervical cancer in South India.

  4. Inducible nitric oxide synthase haplotype associated with migraine and aura.

    Science.gov (United States)

    de O S Mansur, Thiago; Gonçalves, Flavia M; Martins-Oliveira, Alisson; Speciali, Jose G; Dach, Fabiola; Lacchini, Riccardo; Tanus-Santos, Jose E

    2012-05-01

    Migraine is a complex neurological disorder with a clear neurogenic inflammatory component apparently including enhanced nitric oxide (NO) formation. Excessive NO amounts possibly contributing to migraine are derived from increased expression and activity of inducible NO synthase (iNOS). We tested the hypothesis that two functional, clinically relevant iNOS genetic polymorphisms (C(-1026)A-rs2779249 and G2087A-rs2297518) are associated with migraine with or without aura. We studied 142 healthy women without migraine (control group) and 200 women with migraine divided into two groups: 148 with migraine without aura (MWA) and 52 with aura (MA). Genotypes were determined by real-time polymerase chain reaction using the Taqman(®) allele discrimination assays. The PHASE 2.1 software was used to estimate the haplotypes. The A allele for the G2087A polymorphism was more commonly found in the MA group than in the MWA group (28 vs. 18%; P 0.05). The haplotype combining both A alleles for the two polymorphisms was more commonly found in the MA group than in the control group or in the MWA group (19 vs. 10 or 8%; P = 0.0245 or 0.0027, respectively). Our findings indicate that the G2087A and the C(-1026)A polymorphism in the iNOS gene affect the susceptibility to migraine with aura when their effects are combined within haplotypes, whereas the G2087A affects the susceptibility to aura in migraine patients. These finding may have therapeutic implications when examining the effects of selective iNOS inhibitors.

  5. The LRC haplotype project: a resource for killer immunoglobulin-like receptor-linked association studies

    Science.gov (United States)

    Horton, R.; Coggill, P.; Miretti, M. M.; Sambrook, J. G.; Traherne, J. A.; Ward, R.; Sims, S.; Palmer, S.; Sehra, H.; Harrow, J.; Rogers, J.; Carrington, M.; Trowsdale, J.; Beck, S.

    2009-01-01

    There is increasing evidence for epistatic interactions between gene products (e.g. KIR) encoded within the Leukocyte Receptor Complex (LRC) with those (e.g. HLA) of the Major Histocompatibility Complex (MHC), resulting in susceptibility to disease. Identification of such associations at the DNA level requires comprehensive knowledge of the genetic variation and haplotype structure of the underlying loci. The LRC haplotype project aims to provide this knowledge by sequencing common LRC haplotypes. PMID:17092261

  6. Chronic inflammatory state in sickle cell anemia patients is associated with HBB(*)S haplotype.

    Science.gov (United States)

    Bandeira, Izabel C J; Rocha, Lillianne B S; Barbosa, Maritza C; Elias, Darcielle B D; Querioz, José A N; Freitas, Max Vitor Carioca; Gonçalves, Romélia P

    2014-02-01

    The chronic inflammatory state in sickle cell anemia (SCA) is associated with several factors such as the following: endothelial damage; increased production of reactive oxygen species; hemolysis; increased expression of adhesion molecules by leukocytes, erythrocytes, and platelets; and increased production of proinflammatory cytokines. Genetic characteristics affecting the clinical severity of SCA include variations in the hemoglobin F (HbF) level, coexistence of alpha-thalassemia, and the haplotype associated with the HbS gene. The different haplotypes of SCA are Bantu, Benin, Senegal, Cameroon, and Arab-Indian. These haplotypes are associated with ethnic groups and also based on the geographical origin. Studies have shown that the Bantu haplotype is associated with higher incidence of clinical complications than the other haplotypes and is therefore considered to have the worst prognosis. This study aimed to evaluate the profile of the proinflammatory cytokines interleukin-6, tumor necrosis factor-α, and interleukin-17 in patients with SCA and also to assess the haplotypes associated with beta globin cluster S (HBB(*)S). We analyzed a total of 62 patients who had SCA and had been treated with hydroxyurea; they had received a dose ranging between 15 and 25 (20.0±0.6)mg/kg/day for 6-60 (18±3.4)months; their data were compared with those for 30 normal individuals. The presence of HbS was detected and the haplotypes of the beta S gene cluster were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Our study demonstrated that SCA patients have increased inflammatory profile when compared to the healthy individuals. Further, analysis of the association between the haplotypes and inflammatory profile showed that the levels of IL-6 and TNF-α were greater in subjects with the Bantu/Bantu haplotype than in subjects with the Benin/Benin haplotype. The Bantu/Benin haplotype individuals had lower levels of cytokines than those with

  7. ParaHaplo 2.0: a program package for haplotype-estimation and haplotype-based whole-genome association study using parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2010-06-01

    Full Text Available Abstract Background The use of haplotype-based association tests can improve the power of genome-wide association studies. Since the observed genotypes are unordered pairs of alleles, haplotype phase must be inferred. However, estimating haplotype phase is time consuming. When millions of single-nucleotide polymorphisms (SNPs are analyzed in genome-wide association study, faster methods for haplotype estimation are required. Methods We developed a program package for parallel computation of haplotype estimation. Our program package, ParaHaplo 2.0, is intended for use in workstation clusters using the Intel Message Passing Interface (MPI. We compared the performance of our algorithm to that of the regular permutation test on both Japanese in Tokyo, Japan and Han Chinese in Beijing, China of the HapMap dataset. Results Parallel version of ParaHaplo 2.0 can estimate haplotypes 100 times faster than a non-parallel version of the ParaHaplo. Conclusion ParaHaplo 2.0 is an invaluable tool for conducting haplotype-based genome-wide association studies (GWAS. The need for fast haplotype estimation using parallel computing will become increasingly important as the data sizes of such projects continue to increase. The executable binaries and program sources of ParaHaplo are available at the following address: http://en.sourceforge.jp/projects/parallelgwas/releases/

  8. The systemic lupus erythematosus IRF5 risk haplotype is associated with systemic sclerosis.

    Directory of Open Access Journals (Sweden)

    F David Carmona

    Full Text Available Systemic sclerosis (SSc is a fibrotic autoimmune disease in which the genetic component plays an important role. One of the strongest SSc association signals outside the human leukocyte antigen (HLA region corresponds to interferon (IFN regulatory factor 5 (IRF5, a major regulator of the type I IFN pathway. In this study we aimed to evaluate whether three different haplotypic blocks within this locus, which have been shown to alter the protein function influencing systemic lupus erythematosus (SLE susceptibility, are involved in SSc susceptibility and clinical phenotypes. For that purpose, we genotyped one representative single-nucleotide polymorphism (SNP of each block (rs10488631, rs2004640, and rs4728142 in a total of 3,361 SSc patients and 4,012 unaffected controls of Caucasian origin from Spain, Germany, The Netherlands, Italy and United Kingdom. A meta-analysis of the allele frequencies was performed to analyse the overall effect of these IRF5 genetic variants on SSc. Allelic combination and dependency tests were also carried out. The three SNPs showed strong associations with the global disease (rs4728142: P  = 1.34×10(-8, OR  = 1.22, CI 95%  = 1.14-1.30; rs2004640: P  = 4.60×10(-7, OR  = 0.84, CI 95%  = 0.78-0.90; rs10488631: P  = 7.53×10(-20, OR  = 1.63, CI 95%  = 1.47-1.81. However, the association of rs2004640 with SSc was not independent of rs4728142 (conditioned P  = 0.598. The haplotype containing the risk alleles (rs4728142*A-rs2004640*T-rs10488631*C: P  = 9.04×10(-22, OR  = 1.75, CI 95%  = 1.56-1.97 better explained the observed association (likelihood P-value  = 1.48×10(-4, suggesting an additive effect of the three haplotypic blocks. No statistical significance was observed in the comparisons amongst SSc patients with and without the main clinical characteristics. Our data clearly indicate that the SLE risk haplotype also influences SSc predisposition, and that this

  9. The Systemic Lupus Erythematosus IRF5 Risk Haplotype Is Associated with Systemic Sclerosis

    Science.gov (United States)

    Beretta, Lorenzo; Simeón, Carmen P.; Carreira, Patricia E.; Callejas, José Luis; Fernández-Castro, Mónica; Sáez-Comet, Luis; Beltrán, Emma; Camps, María Teresa; Egurbide, María Victoria; Airó, Paolo; Scorza, Raffaella; Lunardi, Claudio; Hunzelmann, Nicolas; Riemekasten, Gabriela; Witte, Torsten; Kreuter, Alexander; Distler, Jörg H. W.; Madhok, Rajan; Shiels, Paul; van Laar, Jacob M.; Fonseca, Carmen; Denton, Christopher; Herrick, Ariane; Worthington, Jane; Schuerwegh, Annemie J.; Vonk, Madelon C.; Voskuyl, Alexandre E.; Radstake, Timothy R. D. J.; Martín, Javier

    2013-01-01

    Systemic sclerosis (SSc) is a fibrotic autoimmune disease in which the genetic component plays an important role. One of the strongest SSc association signals outside the human leukocyte antigen (HLA) region corresponds to interferon (IFN) regulatory factor 5 (IRF5), a major regulator of the type I IFN pathway. In this study we aimed to evaluate whether three different haplotypic blocks within this locus, which have been shown to alter the protein function influencing systemic lupus erythematosus (SLE) susceptibility, are involved in SSc susceptibility and clinical phenotypes. For that purpose, we genotyped one representative single-nucleotide polymorphism (SNP) of each block (rs10488631, rs2004640, and rs4728142) in a total of 3,361 SSc patients and 4,012 unaffected controls of Caucasian origin from Spain, Germany, The Netherlands, Italy and United Kingdom. A meta-analysis of the allele frequencies was performed to analyse the overall effect of these IRF5 genetic variants on SSc. Allelic combination and dependency tests were also carried out. The three SNPs showed strong associations with the global disease (rs4728142: P  = 1.34×10−8, OR  = 1.22, CI 95%  = 1.14–1.30; rs2004640: P  = 4.60×10−7, OR  = 0.84, CI 95%  = 0.78–0.90; rs10488631: P  = 7.53×10−20, OR  = 1.63, CI 95%  = 1.47–1.81). However, the association of rs2004640 with SSc was not independent of rs4728142 (conditioned P  = 0.598). The haplotype containing the risk alleles (rs4728142*A-rs2004640*T-rs10488631*C: P  = 9.04×10−22, OR  = 1.75, CI 95%  = 1.56–1.97) better explained the observed association (likelihood P-value  = 1.48×10−4), suggesting an additive effect of the three haplotypic blocks. No statistical significance was observed in the comparisons amongst SSc patients with and without the main clinical characteristics. Our data clearly indicate that the SLE risk haplotype also influences SSc predisposition, and that

  10. Haplotypes of the porcine peroxisome proliferator-activated receptor delta gene are associated with backfat thickness

    Directory of Open Access Journals (Sweden)

    Blöcker Helmut

    2009-11-01

    Full Text Available Abstract Background Peroxisome proliferator-activated receptor delta belongs to the nuclear receptor superfamily of ligand-inducible transcription factors. It is a key regulator of lipid metabolism. The peroxisome proliferator-activated receptor delta gene (PPARD has been assigned to a region on porcine chromosome 7, which harbours a quantitative trait locus for backfat. Thus, PPARD is considered a functional and positional candidate gene for backfat thickness. The purpose of this study was to test this candidate gene hypothesis in a cross of breeds that were highly divergent in lipid deposition characteristics. Results Screening for genetic variation in porcine PPARD revealed only silent mutations. Nevertheless, significant associations between PPARD haplotypes and backfat thickness were observed in the F2 generation of the Mangalitsa × Piétrain cross as well as a commercial German Landrace population. Haplotype 5 is associated with increased backfat in F2 Mangalitsa × Piétrain pigs, whereas haplotype 4 is associated with lower backfat thickness in the German Landrace population. Haplotype 4 and 5 carry the same alleles at all but one SNP. Interestingly, the opposite effects of PPARD haplotypes 4 and 5 on backfat thickness are reflected by opposite effects of these two haplotypes on PPAR-δ mRNA levels. Haplotype 4 significantly increases PPAR-δ mRNA levels, whereas haplotype 5 decreases mRNA levels of PPAR-δ. Conclusion This study provides evidence for an association between PPARD and backfat thickness. The association is substantiated by mRNA quantification. Further studies are required to clarify, whether the observed associations are caused by PPARD or are the result of linkage disequilibrium with a causal variant in a neighbouring gene.

  11. KIR haplotypes are associated with late-onset type 1 diabetes in European-American families.

    Science.gov (United States)

    Traherne, J A; Jiang, W; Valdes, A M; Hollenbach, J A; Jayaraman, J; Lane, J A; Johnson, C; Trowsdale, J; Noble, J A

    2016-01-01

    Classical human leukocyte antigens (HLA) genes confer the strongest, but not the only, genetic susceptibility to type 1 diabetes. Killer cell immunoglobulin-like receptors (KIR), on natural killer (NK) cells, bind ligands including class I HLA. We examined presence or absence, with copy number, of KIR loci in 1698 individuals, from 339 multiplex type 1 diabetes families, from the Human Biological Data Interchange, previously genotyped for HLA. Combining family data with KIR copy number information allowed assignment of haplotypes using identity by descent. This is the first disease study to use KIR copy number typing and unambiguously define haplotypes by gene transmission. KIR A1 haplotypes were positively associated with T1D in the subset of patients without the high T1D risk HLA genotype, DR3/DR4 (odds ratio=1.29, P=0.0096). The data point to a role for KIR in type 1 diabetes risk in late-onset patients. In the top quartile (age of onset>14), KIR A2 haplotype was overtransmitted (63.4%, odds ratio=1.73, P=0.024) and KIR B haplotypes were undertransmitted (41.1%, odds ratio=0.70, P=0.0052) to patients. The data suggest that inhibitory 'A' haplotypes are predisposing and stimulatory 'B' haplotypes confer protection in both DR3/DR4-negative and late-onset patient groups.

  12. Association of HLA-DQA1*03011-DQB1*0301 haplotype with the development of respiratory scleroma.

    Science.gov (United States)

    Sánchez-Marín, Luis Alberto; Bross-Soriano, Daniel; Arrieta, José; Kawa-Karasik, Simón; Martínez-Vilchis, Víctor; Jiménez-Lucio, Rocío; Olivo-Díaz, Angélica

    2007-03-01

    Respiratory scleroma (RS) is a progressive, chronic, granulomatous disease caused by Klebsiella rhinoscleromatis. There is only one report of RS association with HLA-DQ3. In this study, molecular association of HLA class II and RS was determined. Nine RS patients and 163 healthy controls were compared. DQA1, DQB1, and DRB1 loci were typed. Statistical analysis demonstrated association between DQB1*0301 and susceptibility to RS (P(c) = 0.004). Haplotype analysis showed an association of DQA1*03011-DQB1*0301 (P = 1.21E-19) and DRB1*0407-DQA1*03011-DQB1*0301 (P = 0.0002). Results established that DQA1*03011-DQB1*0301 haplotype is a strong risk factor for development of RS.

  13. Endothelial Nitric Oxide Synthase Haplotypes Are Associated with Preeclampsia in Maya Mestizo Women

    Science.gov (United States)

    Díaz-Olguín, Lizbeth; Coral-Vázquez, Ramón Mauricio; Canto-Cetina, Thelma; Canizales-Quinteros, Samuel; Ramírez Regalado, Belem; Fernández, Genny; Canto, Patricia

    2011-01-01

    Preeclampsia is a specific disease of pregnancy and believed to have a genetic component. The aim of this study was to investigate if three polymorphisms in eNOS or their haplotypes are associated with preeclampsia in Maya mestizo women. A case-control study was performed where 127 preeclamptic patients and 263 controls were included. Genotyped and haplotypes for the -768T→C, intron 4 variants, Glu298Asp of eNOS were determined by PCR and real-time PCR allelic discrimination. Logistic regression analysis with adjustment for age and body mass index (BMI) was used to test for associations between genotype and preeclampsia under recessive, codominant and dominant models. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r2, and haplotype analysis was conducted. Women homozygous for the Asp298 allele showed an association of preeclampsia. In addition, analysis of the haplotype frequencies revealed that the -786C-4b-Asp298 haplotype was significantly more frequent in preeclamptic patients than in controls (0.143 vs. 0.041, respectively; OR = 3.01; 95% CI = 1.74–5.23; P = 2.9 × 10−4). Despite the Asp298 genotype in a recessive model associated with the presence of preeclampsia in Maya mestizo women, we believe that in this population the -786C-4b-Asp298 haplotype is a better genetic marker. PMID:21897002

  14. VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

    Energy Technology Data Exchange (ETDEWEB)

    Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

    1994-09-01

    The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

  15. Comprehensive linkage and association analyses identify haplotype, near to the TNFSF15 gene, significantly associated with spondyloarthritis.

    Directory of Open Access Journals (Sweden)

    Elena Zinovieva

    2009-06-01

    Full Text Available Spondyloarthritis (SpA is a chronic inflammatory disorder with a strong genetic predisposition dominated by the role of HLA-B27. However, the contribution of other genes to the disease susceptibility has been clearly demonstrated. We previously reported significant evidence of linkage of SpA to chromosome 9q31-34. The current study aimed to characterize this locus, named SPA2. First, we performed a fine linkage mapping of SPA2 (24 cM with 28 microsatellite markers in 149 multiplex families, which allowed us to reduce the area of investigation to an 18 cM (13 Mb locus delimited by the markers D9S279 and D9S112. Second, we constructed a linkage disequilibrium (LD map of this region with 1,536 tag single-nucleotide polymorphisms (SNPs in 136 families (263 patients. The association was assessed using a transmission disequilibrium test. One tag SNP, rs4979459, yielded a significant P-value (4.9 x 10(-5. Third, we performed an extension association study with rs4979459 and 30 surrounding SNPs in LD with it, in 287 families (668 patients, and in a sample of 139 cases and 163 controls. Strong association was observed in both familial and case/control datasets for several SNPs. In the replication study, carried with 8 SNPs in an independent sample of 232 cases and 149 controls, one SNP, rs6478105, yielded a nominal P-value<3 x 10(-2. Pooled case/control study (371 cases and 312 controls as well as combined analysis of extension and replication data showed very significant association (P<5 x 10(-4 for 6 of the 8 latter markers (rs7849556, rs10817669, rs10759734, rs6478105, rs10982396, and rs10733612. Finally, haplotype association investigations identified a strongly associated haplotype (P<8.8 x 10(-5 consisting of these 6 SNPs and located in the direct vicinity of the TNFSF15 gene. In conclusion, we have identified within the SPA2 locus a haplotype strongly associated with predisposition to SpA which is located near to TNFSF15, one of the major

  16. Haplotype block structure and its applications to association studies: power and study designs.

    Science.gov (United States)

    Zhang, Kui; Calabrese, Peter; Nordborg, Magnus; Sun, Fengzhu

    2002-12-01

    Recent studies have shown that the human genome has a haplotype block structure, such that it can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of single-nucleotide polymorphisms (SNPs), referred to as "tag SNPs," can be used to distinguish a large fraction of the haplotypes. These tag SNPs can potentially be extremely useful for association studies, in that it may not be necessary to genotype all SNPs; however, this depends on how much power is lost. Here we develop a simulation study to quantitatively assess the power loss for a variety of study designs, including case-control designs and case-parental control designs. First, a number of data sets containing case-parental or case-control samples are generated on the basis of a disease model. Second, a small fraction of case and control individuals in each data set are genotyped at all the loci, and a dynamic programming algorithm is used to determine the haplotype blocks and the tag SNPs based on the genotypes of the sampled individuals. Third, the statistical power of tests was evaluated on the basis of three kinds of data: (1) all of the SNPs and the corresponding haplotypes, (2) the tag SNPs and the corresponding haplotypes, and (3) the same number of randomly chosen SNPs as the number of tag SNPs and the corresponding haplotypes. We study the power of different association tests with a variety of disease models and block-partitioning criteria. Our study indicates that the genotyping efforts can be significantly reduced by the tag SNPs, without much loss of power. Depending on the specific haplotype block-partitioning algorithm and the disease model, when the identified tag SNPs are only 25% of all the SNPs, the power is reduced by only 4%, on average, compared with a power loss of approximately 12% when the same number of randomly chosen SNPs is used in a two-locus haplotype analysis. When the identified tag SNPs are approximately 14% of all the SNPs, the

  17. PADI4 Haplotypes in Association with RA Mexican Patients, a New Prospect for Antigen Modulation

    Directory of Open Access Journals (Sweden)

    Maria Guadalupe Zavala-Cerna

    2013-01-01

    Full Text Available Peptidyl arginine deiminase IV (PAD 4 is the responsible enzyme for a posttranslational modification called citrullination, originating the antigenic determinant recognized by anti-cyclic citrullinated peptide antibodies (ACPA. Four SNPs (single nucleotide polymorphisms have been described in PADI4 gene to form a susceptibility haplotype for rheumatoid arthritis (RA; nevertheless, results in association studies appear contradictory in different populations. The aim of the study was to analyze if the presence of three SNPs in PADI4 gene susceptibility haplotype (GTG is associated with ACPA positivity in patients with RA. This was a cross-sectional study that included 86 RA patients and 98 healthy controls. Polymorphisms PADI4_89, PADI4_90, and PADI4_92 in the PADI4 gene were genotyped. The susceptibility haplotype (GTG was more frequent in RA patients; interestingly, we found a new haplotype associated with RA with a higher frequency (GTC. There were no associations between polymorphisms and high scores in Spanish HAQ-DI and DAS-28, but we did find an association between RARBIS index and PADI4_89, PADI4_90 polymorphisms. We could not confirm an association between susceptibility haplotype presence and ACPA positivity. Further evidence about proteomic expression of this gene will determine its participation in antigenic generation and autoimmunity.

  18. Association between HIV-1 tropism and CCR5 human haplotype E in a Caucasian population.

    Science.gov (United States)

    Huik, Kristi; Avi, Radko; Uibopuu, Helen; Pauskar, Merit; Margus, Tõnu; Karki, Tõnis; Krispin, Tõnu; Kool, Piret; Rüütel, Kristi; Talu, Ave; Abel-Ollo, Katri; Uusküla, Anneli; Carrillo, Andrew; He, Weijing; Ahuja, Sunil K; Lutsar, Irja

    2014-07-01

    The influence of the diversity of CCR5 on HIV susceptibility and disease progression has been clearly demonstrated but how the variability of this gene influences the HIV tropism is poorly understood. We investigated whether CCR5 haplotypes are associated with HIV tropism in a Caucasian population. We evaluated 161 HIV-positive subjects in a cross-sectional study. CCR5 haplotypes were derived after genotyping 9 CCR2-CCR5 polymorphisms. The HIV subtype was determined by phylogenetic analysis using the maximum likelihood method and viral tropism by the genotypic tropism assay (geno2pheno). Associations between CCR5 haplotypes and viral tropism were determined using logistic regression analyses. Samples from 500 blood donors were used to evaluate the representativeness of HIV-positives in terms of CCR5 haplotype distribution. The distribution of CCR5 haplotypes was similar in HIV-positive subjects and blood donors. The majority of viruses (93.8%) belonged to HIV-1 CRF06_cpx; 7.5% were X4, and the remaining were R5 tropic. X4 tropic viruses were over represented among people with CCR5 human haplotype E (HHE) compared with those without this haplotype (13.0% vs 1.4%; P = 0.006). People possessing CCR5 HHE had 11 times increased odds (odds ratio = 11.00; 95% confidence interval: 1.38 to 87.38) of having X4 tropic viruses than those with non-HHE. After adjusting for antiretroviral (ARV) therapy, neither the presence of HHE nor the use of ARV was associated with X4 tropic viruses. Our results suggest that CCR5 HHE and ARV treatment might be associated with the presence of HIV-1 X4 tropic viruses.

  19. Functional epistasis on a common MHC haplotype associated with multiple sclerosis

    DEFF Research Database (Denmark)

    Gregersen, Jon Waarst; Kranc, Kamil R; Ke, Xiayi

    2006-01-01

    Genes in the major histocompatibility complex (MHC) encode proteins important in activating antigen-specific immune responses. Alleles at adjacent MHC loci are often in strong linkage disequilibrium; however, little is known about the mechanisms responsible for this linkage disequilibrium. Here we...... report that the human MHC HLA-DR2 haplotype, which predisposes to multiple sclerosis, shows more extensive linkage disequilibrium than other common caucasian HLA haplotypes in the DR region and thus seems likely to have been maintained through positive selection. Characterization of two multiple...

  20. Association of CAPN10 SNPs and haplotypes with polycystic ovary syndrome among South Indian Women.

    Directory of Open Access Journals (Sweden)

    Shilpi Dasgupta

    Full Text Available Polycystic Ovary Syndrome (PCOS is known to be characterized by metabolic disorder in which hyperinsulinemia and peripheral insulin resistance are central features. Given the physiological overlap between PCOS and type-2 diabetes (T2DM, and calpain 10 gene (CAPN10 being a strong candidate for T2DM, a number of studies have analyzed CAPN10 SNPs among PCOS women yielding contradictory results. Our study is first of its kind to investigate the association pattern of CAPN10 polymorphisms (UCSNP-44, 43, 56, 19 and 63 with PCOS among Indian women. 250 PCOS cases and 299 controls from Southern India were recruited for this study. Allele and genotype frequencies of the SNPs were determined and compared between the cases and controls. Results show significant association of UCSNP-44 genotype CC with PCOS (p = 0.007 with highly significant odds ratio when compared to TC (OR = 2.51, p = 0.003, 95% CI = 1.37-4.61 as well as TT (OR = 1.94, p = 0.016, 95% CI = 1.13-3.34. While the haplotype carrying the SNP-44 and SNP-19 variants (21121 exhibited a 2 fold increase in the risk for PCOS (OR = 2.37, p = 0.03, the haplotype containing SNP-56 and SNP-19 variants (11221 seems to have a protective role against PCOS (OR = 0.20, p = 0.004. Our results support the earlier evidence for a possible role of UCSNP-44 of the CAPN10 gene in the manifestation of PCOS.

  1. Computational intelligence in bioinformatics: SNP/haplotype data in genetic association study for common diseases.

    Science.gov (United States)

    Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan

    2009-09-01

    Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.

  2. Association between Osteopontin Promoter Gene Polymorphisms and Haplotypes with Risk of Diabetic Nephropathy

    Directory of Open Access Journals (Sweden)

    Balneek Singh Cheema

    2015-06-01

    Full Text Available Background: Osteopontin (OPN C-443T promoter polymorphism has been shown as a genetic risk factor for diabetic nephropathy (DN in type 2 diabetic patients (T2D. Methods: In the present study we investigated the association of three functional promoter gene polymorphisms C-443T, delG-156G, and G-66T and their haplotypes with the risk of DN and estimated Glomerular Filtration Rate (eGFR in Asian Indians T2D patients using Real time PCR based Taqman assay. A total of 1165 T2D patients, belonging to two independently ascertained Indian Asian cohorts, were genotyped for three OPN promoter polymorphisms C-443T (rs11730582, delG-156G (rs17524488 and G-66T (rs28357094. Results: -156G allele and GG genotypes (delG-156G and haplotypes G-C-G and T-C-G (G-66T, C-443T, delG-156G were associated with decreased risk of DN and higher eGFR. Haplotype G-T-delG and T-T-delG (G-66T, C-443T, delG-156G were identified as risk haplotypes, as shown by lower eGFR. Conclusion: This is the first study to report an association of OPN promoter gene polymorphisms; G-66T and delG-156G and their haplotypes with DN in T2D. Our results suggest an association between OPN promoter gene polymorphisms and their haplotypes with DN.

  3. High frequency of intermediate alleles on Huntington disease-associated haplotypes in British Columbia's general population.

    Science.gov (United States)

    Semaka, Alicia; Kay, Chris; Doty, Crystal N; Collins, Jennifer A; Tam, Natalie; Hayden, Michael R

    2013-12-01

    Intermediate alleles (27-35 CAG, IAs) for Huntington disease (HD) usually do not confer the disease phenotype but are prone to CAG repeat instability. Consequently, offspring are at-risk of inheriting an expanded allele in the HD range (≥36 CAG). IAs that expand into a new mutation have been hypothesized to be more susceptible to instability compared to IAs identified on the non-HD side of a family from the general population. Frequency estimates for IAs are limited and have largely been determined using clinical samples of HD or related disorders, which may result in an ascertainment bias. This study aimed to establish the frequency of IAs in a sample of a British Columbia's (B.C.) general population with no known association to HD and examine the haplotype of new mutation and general population IAs. CAG sizing was performed on 1,600 DNA samples from B.C.'s general population. Haplotypes were determined using 22 tagging SNPs across the HTT gene. 5.8% of individuals were found to have an IA, of which 60% were on HD-associated haplotypes. There was no difference in the haplotype distribution of new mutation and general population IAs. These findings suggest that IAs are relatively frequent in the general population and are often found on haplotypes associated with expanded CAG lengths. There is likely no difference in the propensity of new mutation and general population IAs to expand into the disease range given that they are both found on disease-associated haplotypes. These findings have important implications for clinical practice. © 2013 Wiley Periodicals, Inc.

  4. HLA-DRB1 shared epitope-dependent DR-DQ haplotypes are associated with both anti-CCP-positive and -negative rheumatoid arthritis in Chinese Han.

    Directory of Open Access Journals (Sweden)

    Xu Liu

    Full Text Available The association between Human Leukocyte Antigen (HLA class II and rheumatoid arthritis (RA has been extensively studied, but few reported DR-DQ haplotype. Here we investigated the association of HLA-DRB1, DQA1, DQB1, and DR-DQ haplotypes with RA susceptibility and with anti-CCP antibodies in 281 RA patients and 297 control in Han population. High-resolution genotyping were performed. The HLA-DRB1 shared epitope (SE-encoding allele *0405 displayed the most significant RA association (P = 1.35×10(-6. The grouped DRB1 SE alleles showed great association with RA (P = 3.88×10(-13. The DRB1 DRRAA alleles displayed significant protective effects (P = 0.021. The SE-dependent DR-DQ haplotype SE-DQ3/4/5 remained strong association with both anti-CCP -positive (P = 3.71×10(-13 and -negative RA (P = 3.89×10(-5. Our study revealed that SE alleles and its haplotypes SE-DQ3/4/5 were highly associated with RA susceptibility in Han population. The SE-DQ3/4/5 haplotypes were associated with both anti-CCP positive RA and -negative RA.

  5. A Genome-Wide Association Study for Agronomic Traits in Soybean Using SNP Markers and SNP-Based Haplotype Analysis.

    Directory of Open Access Journals (Sweden)

    Rodrigo Iván Contreras-Soto

    Full Text Available Mapping quantitative trait loci through the use of linkage disequilibrium (LD in populations of unrelated individuals provides a valuable approach for dissecting the genetic basis of complex traits in soybean (Glycine max. The haplotype-based genome-wide association study (GWAS has now been proposed as a complementary approach to intensify benefits from LD, which enable to assess the genetic determinants of agronomic traits. In this study a GWAS was undertaken to identify genomic regions that control 100-seed weight (SW, plant height (PH and seed yield (SY in a soybean association mapping panel using single nucleotide polymorphism (SNP markers and haplotype information. The soybean cultivars (N = 169 were field-evaluated across four locations of southern Brazil. The genome-wide haplotype association analysis (941 haplotypes identified eleven, seventeen and fifty-nine SNP-based haplotypes significantly associated with SY, SW and PH, respectively. Although most marker-trait associations were environment and trait specific, stable haplotype associations were identified for SY and SW across environments (i.e., haplotypes Gm12_Hap12. The haplotype block 42 on Chr19 (Gm19_Hap42 was confirmed to be associated with PH in two environments. These findings enable us to refine the breeding strategy for tropical soybean, which confirm that haplotype-based GWAS can provide new insights on the genetic determinants that are not captured by the single-marker approach.

  6. Identification of haplotypes at the Rsv4 genomic region in soybean associated with durable resistance to soybean mosaic virus.

    Science.gov (United States)

    Ilut, Daniel C; Lipka, Alexander E; Jeong, Namhee; Bae, Dong Nyuk; Kim, Dong Hyun; Kim, Ji Hong; Redekar, Neelam; Yang, Kiwoung; Park, Won; Kang, Sung-Taeg; Kim, Namshin; Moon, Jung-Kyung; Saghai Maroof, M A; Gore, Michael A; Jeong, Soon-Chun

    2016-03-01

    Discovery of new germplasm sources and identification of haplotypes for the durable Soybean mosaic virus resistance gene, Rsv 4, provide novel resources for map-based cloning and genetic improvement efforts in soybean. The Soybean mosaic virus (SMV) resistance locus Rsv4 is of interest because it provides a durable type of resistance in soybean [Glycine max (L.) Merr.]. To better understand its molecular basis, we used a population of 309 BC3F2 individuals to fine-map Rsv4 to a ~120 kb interval and leveraged this genetic information in a second study to identify accessions 'Haman' and 'Ilpumgeomjeong' as new sources of Rsv4. These two accessions along with three other Rsv4 and 14 rsv4 accessions were used to examine the patterns of nucleotide diversity at the Rsv4 region based on high-depth resequencing data. Through a targeted association analysis of these 19 accessions within the ~120 kb interval, a cluster of four intergenic single-nucleotide polymorphisms (SNPs) was found to perfectly associate with SMV resistance. Interestingly, this ~120 kb interval did not contain any genes similar to previously characterized dominant disease resistance genes. Therefore, a haplotype analysis was used to further resolve the association signal to a ~94 kb region, which also resulted in the identification of at least two Rsv4 haplotypes. A haplotype phylogenetic analysis of this region suggests that the Rsv4 locus in G. max is recently introgressed from G. soja. This integrated study provides a strong foundation for efforts focused on the cloning of this durable virus resistance gene and marker-assisted selection of Rsv4-mediated SMV resistance in soybean breeding programs.

  7. Endothelial Nitric Oxide Synthase Haplotypes Are Associated with Preeclampsia in Maya Mestizo Women

    Directory of Open Access Journals (Sweden)

    Lizbeth Díaz-Olguín

    2011-01-01

    Full Text Available Preeclampsia is a specific disease of pregnancy and believed to have a genetic component. The aim of this study was to investigate if three polymorphisms in eNOS or their haplotypes are associated with preeclampsia in Maya mestizo women.

  8. SNP and haplotype analysis reveal IGF2 variants associated with growth traits in Chinese Qinchuan cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Zhan, Zhao-Yang; Li, Xin-Yi; Wu, Sheng-Ru; Sun, Yu-Jia; Xue, Jing; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Jia, Yu-Tang; Chen, Hong

    2014-02-01

    Insulin-like growth factor 2 (IGF2) is a potent cell growth and differentiation factor and is implicated in mammals' growth and development. The objective of this study was to evaluate the effects of the mutations in the bovine IGF2 with growth traits in Chinese Qinchuan cattle. Four single nucleotide polymorphisms (SNPs) were detected of the bovine IGF2 by DNA pool sequencing and forced polymerase chain reaction-restriction fragment length polymorphism (forced PCR-RFLP) methods. We also investigated haplotype structure and linkage disequilibrium (LD) coefficients for four SNPs in 817 individuals representing two main cattle breeds from China. The result of haplotype analysis showed eight different haplotypes and 27 combined genotypes within the study population. The statistical analyses indicated that the four SNPs, combined genotypes and haplotypes are associated with the withers height, body length, chest breadth, chest depth and body weight in Qinchuan cattle population (P growth traits; the heterozygote diplotype was associated with higher growth traits compared to wild-type homozygote. Our results provide evidence that polymorphisms in the IGF2 gene are associated with growth traits, and may be used for marker-assisted selection in beef cattle breeding program.

  9. PAX6 Haplotypes Are Associated with High Myopia in Han Chinese

    Science.gov (United States)

    Jiang, Bo; Yap, Maurice K. H.; Leung, Kim Hung; Ng, Po Wah; Fung, Wai Yan; Lam, Wai Wa; Gu, Yang-shun; Yip, Shea Ping

    2011-01-01

    Background The paired box 6 (PAX6) gene is considered as a master gene for eye development. Linkage of myopia to the PAX6 region on chromosome 11p13 was shown in several studies, but the results for association between myopia and PAX6 were inconsistent so far. Methodology/Principal Findings We genotyped 16 single nucleotide polymorphisms (SNPs) in the PAX6 gene and its regulatory regions in an initial study for 300 high myopia cases and 300 controls (Group 1), and successfully replicated the positive results with another independent group of 299 high myopia cases and 299 controls (Group 2). Five SNPs were genotyped in the replication study. The spherical equivalent of subjects with high myopia was ≤−8.0 dioptres. The PLINK package was used for genetic data analysis. No association was found between each of the SNPs and high myopia. However, exhaustive sliding-window haplotype analysis highlighted an important role for rs12421026 because haplotypes containing this SNP were found to be associated with high myopia. The most significant results were given by the 4-SNP haplotype window consisting of rs2071754, rs3026393, rs1506 and rs12421026 (P = 3.54×10−10, 4.06×10−11 and 1.56×10−18 for Group 1, Group 2 and Combined Group, respectively) and the 3-SNP haplotype window composed of rs3026393, rs1506 and rs12421026 (P = 5.48×10−10, 7.93×10−12 and 6.28×10−23 for the three respective groups). The results remained significant after correction for multiple comparisons by permutations. The associated haplotyes found in a previous study were also successfully replicated in this study. Conclusions/Significance PAX6 haplotypes are associated with susceptibility to the development of high myopia in Chinese. The PAX6 locus plays a role in high myopia. PMID:21589860

  10. Dizygotic twinning is not associated with methylenetetrahydrofolate reductase haplotypes

    NARCIS (Netherlands)

    Montgomery, GW; Zhao, Z.Z.; Morley, K.I.; Marsh, A.J.; Boomsma, D.I.; Martin, N.G.; Duffy, DL

    2003-01-01

    Background: Folate metabolism is critical to embryonic development, influencing neural tube defects (NTD) and recurrent early pregnancy loss. Polymorphisms in 5,10-methylenetetrahydrofolate reductase (MTHFR) have been associated with dizygotic (DZ) twinning through pregnancy loss. Methods: The C677T

  11. Association of ATG16L1 gene haplotype with inflammatory bowel disease in Indians.

    Directory of Open Access Journals (Sweden)

    Srinivasan Pugazhendhi

    Full Text Available Inflammatory bowel disease (IBD is characterized by multigenic inheritance. Defects in autophagy related genes are considered to show genetic heterogeneity between populations. We evaluated the association of several single nucleotide polymorphisms (SNPs in the autophagy related 16 like 1 (ATG16L1 gene with IBD in Indians. The ATG16L1 gene was genotyped for ten different SNPs using DNA extracted from peripheral blood of 234 patients with Crohn's disease (CD, 249 patients with ulcerative colitis (UC and 393 healthy controls The SNPs rs2241880, rs4663396, rs3792106, rs10210302, rs3792109, rs2241877, rs6737398, rs11682898, rs4663402 and rs4663421 were genotyped using the Sequenom MassArray platform. PLINK was used for the association analysis and pairwise linkage disequilibrium (LD values. Haplotype analysis was done using Haploview. All SNPs were in Hardy Weinberg equilibrium in cases and controls. The G allele at rs6737398 exhibited a protective association with both CD and UC. The T allele at rs4663402 and C allele at rs4663421 were positively associated with CD and UC. The T allele at rs2241877 exhibited protective association with UC only. The AA genotype at rs4663402 and the GG genotype at rs4663421 were protectively associated with both CD and UC. Haplotype analysis revealed that all the SNPs in tight LD (D' = 0.76-1.0 and organized in a single haplotype block. Haplotype D was positively associated with IBD (P = 5.8 x 10-6 for CD and 0.002 for UC. SNPs in ATG16L1 were associated with IBD in Indian patients. The relevance to management of individual patients requires further study.

  12. Serum Klotho (but not haplotypes associate with the post-myocardial infarction status of older adults

    Directory of Open Access Journals (Sweden)

    Roberta S. Paula

    Full Text Available OBJECTIVES: The number of deaths from vascular diseases is incredibly high worldwide, and reliable markers for major events are still needed. The current cross-sectional study investigated the association of Klotho haplotypes and Klotho serum levels with classic risk factors and a clinical history of vascular events. METHODS: Clinical, anthropometric, biochemical and nutritional assessments were conducted with 168 older adults, complemented by genotyping (rs9536314 and rs9527025 and the detection of serum Klotho (ELISA. RESULTS: Klotho levels and haplotypes did not associate with most classic risk factors for vascular events, including markers such as C-reactive protein and homocysteine. A positive association was only found between Klotho levels and the previous occurrence of a myocardial infarction by both correlational (p=0.006 and variance analyses (p<0.001, and these associations were independent of the context. CONCLUSION: Our results suggest that serum Klotho is higher in individuals with a clinical history of myocardial infarction but not with a history of coronary artery disease or stroke. None of the Klotho haplotypes were associated with the variables investigated herein.

  13. Differences in meiotic recombination rates in childhood acute lymphoblastic leukemia at an MHC class II hotspot close to disease associated haplotypes.

    Directory of Open Access Journals (Sweden)

    Pamela Thompson

    Full Text Available Childhood Acute Lymphoblastic Leukemia (ALL is a malignant lymphoid disease of which B-cell precursor- (BCP and T-cell- (T ALL are subtypes. The role of alleles encoded by major histocompatibility loci (MHC have been examined in a number of previous studies and results indicating weak, multi-allele associations between the HLA-DPB1 locus and BCP-ALL suggested a role for immunosusceptibility and possibly infection. Two independent SNP association studies of ALL identified loci approximately 37 kb from one another and flanking a strong meiotic recombination hotspot (DNA3, adjacent to HLA-DOA and centromeric of HLA-DPB1. To determine the relationship between this observation and HLA-DPB1 associations, we constructed high density SNP haplotypes of the 316 kb region from HLA-DMB to COL11A2 in childhood ALL and controls using a UK GWAS data subset and the software PHASE. Of four haplotype blocks identified, predicted haplotypes in Block 1 (centromeric of DNA3 differed significantly between BCP-ALL and controls (P = 0.002 and in Block 4 (including HLA-DPB1 between T-ALL and controls (P = 0.049. Of specific common (>5% haplotypes in Block 1, two were less frequent in BCP-ALL, and in Block 4 a single haplotype was more frequent in T-ALL, compared to controls. Unexpectedly, we also observed apparent differences in ancestral meiotic recombination rates at DNA3, with BCP-ALL showing increased and T-ALL decreased levels compared to controls. In silico analysis using LDsplit sotware indicated that recombination rates at DNA3 are influenced by flanking loci, including SNPs identified in childhood ALL association studies. The observed differences in rates of meiotic recombination at this hotspot, and potentially others, may be a characteristic of childhood leukemia and contribute to disease susceptibility, alternatively they may reflect interactions between ALL-associated haplotypes in this region.

  14. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

    Science.gov (United States)

    Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin

    2016-01-01

    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  15. CpDNA haplotype variation reveals strong human influence on oak stands of the Veluwe forest in the Netherlands

    NARCIS (Netherlands)

    Buiteveld, J.; Koelewijn, H.P.

    2006-01-01

    We examined chloroplast DNA (cpDNA) variation in 78 oak stands of an important forest complex (the Veluwe) in The Netherlands. Based on historical maps and information oak stands were classified as planted or autochthonous. A genetic study by means of cpDNA haplotype characterisation was carried out

  16. HLA-G UTR haplotype conservation in the Malian population: association with soluble HLA-G.

    Directory of Open Access Journals (Sweden)

    Federico Carlini

    Full Text Available The HLA-G molecule plays an important role in immunomodulation. In a previous study carried out on a southern French population our team showed that HLA-G haplotypes, defined by SNPs in the coding region and specific SNPs located in 5'URR and 3'UTR regulatory regions, are associated with differential soluble HLA-G expression (sHLA-G. Furthermore, the structure of these HLA-G haplotypes appears to be conserved in geographically distant populations. The aim of our study is to confirm these expectations in a sub-Saharan African population and to explore additional factors, such as HLA-A alleles, that might influence sHLA-G expression. DNA and plasma samples were collected from 229 Malians; HLA-G and HLA-A genotyping were respectively performed by the Snap Shot® method and by Luminex™ technology. sHLA-G dosage was performed using an ELISA kit. HLA-G and HLA-A allelic and haplotypic frequencies were estimated using an EM algorithm from the Gene[Rate] program. Associations between genetic and non genetic parameters with sHLA-G were performed using a non-parametric test with GRAPH PAD Prism 5. Our results reveal a good conservation of the HLA-G UTR haplotype structure in populations with different origins and demographic histories. These UTR haplotypes appear to be involved in different sHLA-G expression patterns. Specifically, the UTR-2 haplotype was associated with low sHLA-G levels, displaying a dominant negative effect. Furthermore, an allelic effect of both HLA-G and HLA-A, as well as non genetic parameters, such as age and gender possibly linked to osteogenesis and sexual hormones, also seem to be involved in the modulation of sHLA-G. These data suggest that further investigation in larger cohorts and in populations from various ethnical backgrounds is necessary not only to detect new functional polymorphism in HLA-G regulatory regions, but also to reveal the extent of biological phenomena that influence sHLA-G secretion and this might

  17. Assessment of association between variants and haplotypes of the IGF2 gene in beef cattle.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Jing; Zhan, Zhao-Yang; Cao, Xiu-Kai; Sun, Yu-Jia; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-10-10

    Insulin-like growth factor 2 (IGF2) is a fetal growth and differentiation factor that plays an important role in muscle growth and in myoblast proliferation and differentiation. The aim of this study was to examine the association of the IGF2 polymorphism with growth traits in beef cattle breed. Four single nucleotide polymorphisms (SNPs: 1-4) were identified in the bovine IGF2 by sequencing pooled DNA samples (Pool-Seq) and forced polymerase chain reaction-restriction fragment length polymorphism (Forced PCR-RFLP) methods. The result of haplotype analysis of four SNPs showed that eight haplotypes and eighteen combined genotypes were revealed, and the linkage disequilibrium and evolutionary relationship were assessed in 1522 individuals representing four purebred cattle breeds from China. The statistical analyses indicated that the 4 SNPs and 18 combined genotypes or haplotypes are associated with the body weight at 18 and 24 months in Jiaxian cattle population (Pgrowth traits, and may be used for marker-assisted selection in beef cattle breeding program. © 2013.

  18. Analysis of Case-Control Association Studies: SNPs, Imputation and Haplotypes

    KAUST Repository

    Chatterjee, Nilanjan

    2009-11-01

    Although prospective logistic regression is the standard method of analysis for case-control data, it has been recently noted that in genetic epidemiologic studies one can use the "retrospective" likelihood to gain major power by incorporating various population genetics model assumptions such as Hardy-Weinberg-Equilibrium (HWE), gene-gene and gene-environment independence. In this article we review these modern methods and contrast them with the more classical approaches through two types of applications (i) association tests for typed and untyped single nucleotide polymorphisms (SNPs) and (ii) estimation of haplotype effects and haplotype-environment interactions in the presence of haplotype-phase ambiguity. We provide novel insights to existing methods by construction of various score-tests and pseudo-likelihoods. In addition, we describe a novel two-stage method for analysis of untyped SNPs that can use any flexible external algorithm for genotype imputation followed by a powerful association test based on the retrospective likelihood. We illustrate applications of the methods using simulated and real data. © Institute of Mathematical Statistics, 2009.

  19. Caucasian origin of disease associated HLA haplotypes in chinese blood donors with IgA deficiency.

    Science.gov (United States)

    Wang, Ning; Lu, Ping; Ling, Bing; Zhu, Ziyan; Hammarström, Lennart

    2014-02-01

    Selective immunoglobulin A deficiency (IgAD) is the most common primary immunodeficiency in Caucasians with a prevalence of 1:600. However, the prevalence of IgAD is markedly lower in East Asian countries but no genetic studies have been performed on IgAD individuals in the Mongoloid population. We investigated the prevalence of IgAD in a large number of Chinese blood donors (n = 39,015) in Shanghai, China. We measured immunoglobulin class, IgG subclass and anti-IgA serum levels among the IgAD donors. These donors were subsequently tissue typed and the allele frequency was compared with the Shanghai bone marrow donor HLA registry. Seventeen IgAD Chinese blood donors were identified, giving a prevalence of 1: 2,295. Two previously identified IgAD blood donor samples were added in the subsequent tests. Most IgAD donors had serum IgG levels above the normal range with no major IgG subclass deficiency and one donor was weakly positive for anti-IgA. Two-thirds of the Chinese IgAD donors carried Caucasian IgAD associated risk haplotypes, including DRB1*0301-DQB1*0201, DRB1*0701-DQB1*0202 and DRB1*0102-DQB1*0501, giving a significantly higher frequency of these haplotypes as compared to the Shanghai bone marrow donor HLA registry. The prevalence of IgAD in Chinese in this study is markedly lower than in Caucasians. This is the first study to investigate the genetics of IgAD in the Mongoloid population and two-thirds of the Chinese IgAD donors showed a mixture of Caucasian IgAD risk haplotypes. The low prevalence of IgAD could potentially be due to the low frequency of the disease associated risk haplotypes in China.

  20. DNA damage in leukocytes of sickle cell anemia patients is associated with hydroxyurea therapy and with HBB*S haplotype.

    Science.gov (United States)

    da Silva Rocha, Lilianne Brito; Dias Elias, Darcielle Bruna; Barbosa, Maritza Cavalcante; Bandeira, Izabel Cristina Justino; Gonçalves, Romélia Pinheiro

    2012-12-12

    Hydroxyurea (HU) is the primary pharmacologic agent for preventing the complications and improving the quality of life of sickle cell anemia (SCA) patients. Although HU has been associated with an increased risk of leukemia in some patients with myeloproliferative disorders, the mutagenic and carcinogenic potential of HU has not been established. This study used the alkaline comet assay to investigate DNA damage in peripheral blood leukocytes from 41 individuals with SCA treated with HU (SCAHU) and from 26 normal individuals. The presence of HbS and the analysis of the haplotypes of the beta S gene cluster were done by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The damage index (DI) in the SCAHU group was significantly higher than in controls (p20kg/m(2). No significant influence of mean HU dose was observed on DI (p=0.950). However, individuals who received a mean HU dose≥20mg/kg showed a higher DI than those who received less. Furthermore, an association was observed between DI damage and HBB*S gene haplotypes. DI values for the Bantu/Bantu haplotype was greater when compared to the Benin/Benin haplotype; and the Bantu/Benin haplotype had a DI lower than the Bantu/Bantu haplotype and greater than the Benin/Benin haplotype. Our results show that DNA damage in sickle cell anemia is associated not only with treatment with HU but also with genotype. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. An ancestral haplotype of the human PERIOD2 gene associates with reduced sensitivity to light-induced melatonin suppression.

    Directory of Open Access Journals (Sweden)

    Tokiho Akiyama

    Full Text Available Humans show various responses to the environmental stimulus in individual levels as "physiological variations." However, it has been unclear if these are caused by genetic variations. In this study, we examined the association between the physiological variation of response to light-stimulus and genetic polymorphisms. We collected physiological data from 43 subjects, including light-induced melatonin suppression, and performed haplotype analyses on the clock genes, PER2 and PER3, exhibiting geographical differentiation of allele frequencies. Among the haplotypes of PER3, no significant difference in light sensitivity was found. However, three common haplotypes of PER2 accounted for more than 96% of the chromosomes in subjects, and 1 of those 3 had a significantly low-sensitive response to light-stimulus (P < 0.05. The homozygote of the low-sensitive PER2 haplotype showed significantly lower percentages of melatonin suppression (P < 0.05, and the heterozygotes of the haplotypes varied their ratios, indicating that the physiological variation for light-sensitivity is evidently related to the PER2 polymorphism. Compared with global haplotype frequencies, the haplotype with a low-sensitive response was more frequent in Africans than in non-Africans, and came to the root in the phylogenetic tree, suggesting that the low light-sensitive haplotype is the ancestral type, whereas the other haplotypes with high sensitivity to light are the derived types. Hence, we speculate that the high light-sensitive haplotypes have spread throughout the world after the Out-of-Africa migration of modern humans.

  2. Colonization of America by Drosophila subobscura: association between Odh gene haplotypes, lethal genes and chromosomal arrangements.

    Science.gov (United States)

    Mestres, Francesc; Abad, Laura; Sabater-Muñoz, Beatriz; Latorre, Amparo; Serra, Luís

    2004-08-01

    The colonization of America by Drosophila subobscura has been a unique exper iment in nature that has allowed us to explore the effects of evolution on a continental scale. To analyze this evolutionary event, nucleotide sequences of the Odh (Octanol dehydrogenase) gene were obtained for 43 lethal chromosomal lines from colonizing populations of North America and 5 from South America, in addition to 5 chromosomal lines from Europe with different viabilities and 2 from laboratory marker stocks. Since 10 different Odh haplotypes were found in America, the minimum number of colonizers would be 5 (or 3 mated females). Only one Odh haplotype was found in American O(5) inversions confirming that only one copy of this inversion was included among the sample of colonizers. The same Odh haplotypes were detected in association with the same chromosomal arrangements and with identical lethal genes in both North and South America indicating that exactly the same chromosome types reached both hemispheres. These observations indicate that the two continental colonizations are not independent. They are derived from the same colonization event. The population from which the colonization started should contain the O(5) inversion, a non-negligible frequency of the O(3+4+7) arrangement and all other arrangements found in America. So far the only populations that fulfill all these requirements are those from Greece, indicating that these populations can be considered good candidates as a starting point for an in depth analysis of the origin of the American colonization by D. subobscura.

  3. A CCL5 Haplotype Is Associated with Low Seropositivity Rate of HCV Infection in People Who Inject Drugs.

    Directory of Open Access Journals (Sweden)

    Kristi Huik

    Full Text Available The role of CC chemokine receptor 5 (CCR5 and its ligand CCL5 on the pathogenesis of HIV infection has been well studied but not for HCV infection. Here, we investigated whether CCL5 haplotypes influence HIV and HCV seropositivity among 373 Caucasian people who inject drugs (PWID from Estonia.Study included 373 PWID; 56% were HIV seropositive, 44% HCV seropositive and 47% co-infected. Four CCL5 haplotypes (A-D were derived from three CCL5 polymorphisms (rs2107538/rs2280788/rs2280789 typed by Taqman allelic discrimination assays. The data of CCR5 haplotypes were used from our previous study. The association between CCL5 haplotypes with HIV and/or HCV seropositivity was determined using logistic regression analysis.Possessing CCL5 haplotype D (defined by rs2107538A/rs2280788G/rs2280789C decreased the odds of HCV seropositivity compared to those not possessing it (OR = 0.19; 95% CI 0.09-0.40, which remained significant after adjustment to co-variates (OR = 0.08; 95% CI 0.02-0.29. An association of this haplotype with HIV seropositivity was not found. In step-wise logistic regression with backward elimination CCL5 haplotype D and CCR5 HHG*1 had reduced odds for HCV seropositivity (OR = 0.28 95% CI 0.09-0.92; OR = 0.23 95% CI 0.08-0.68, respectively compared to those who did not possess these haplotypes, respectively.Our results suggest that among PWID CCL5 haplotype D and CCR5 HHG*1 independently protects against HCV. Our findings highlight the importance of CCL5 genetic variability and CCL5-CCR5 axis on the susceptibility to HCV.

  4. Association of the arginine vasopressin receptor 1A (AVPR1A) haplotypes with listening to music.

    Science.gov (United States)

    Ukkola-Vuoti, Liisa; Oikkonen, Jaana; Onkamo, Päivi; Karma, Kai; Raijas, Pirre; Järvelä, Irma

    2011-04-01

    Music is listened in all cultures. We hypothesize that willingness to produce and perceive sound and music is social communication that needs musical aptitude. Here, listening to music was surveyed using a web-based questionnaire and musical aptitude using the auditory structuring ability test (Karma Music test) and Carl Seashores tests for pitch and for time. Three highly polymorphic microsatellite markers (RS3, RS1 and AVR) of the arginine vasopressin receptor 1A (AVPR1A) gene, previously associated with social communication and attachment, were genotyped and analyzed in 31 Finnish families (n=437 members) using family-based association analysis. A positive association between the AVPR1A haplotype (RS1 and AVR) and active current listening to music (permuted P=0.0019) was observed. Other AVPR1A haplotype (RS3 and AVR) showed association with lifelong active listening to music (permuted P=0.0022). In addition to AVPR1A, two polymorphisms (5-HTTLPR and variable number of tandem repeat) of human serotonin transporter gene (SLC6A4), a candidate gene for many neuropsychiatric disorders and previously associated with emotional processing, were analyzed. No association between listening to music and the polymorphisms of SLC6A4 were detected. The results suggest that willingness to listen to music is related to neurobiological pathways affecting social affiliation and communication.

  5. Genetic analysis of completely sequenced disease-associated MHC haplotypes identifies shuffling of segments in recent human history.

    Directory of Open Access Journals (Sweden)

    James A Traherne

    2006-01-01

    Full Text Available The major histocompatibility complex (MHC is recognised as one of the most important genetic regions in relation to common human disease. Advancement in identification of MHC genes that confer susceptibility to disease requires greater knowledge of sequence variation across the complex. Highly duplicated and polymorphic regions of the human genome such as the MHC are, however, somewhat refractory to some whole-genome analysis methods. To address this issue, we are employing a bacterial artificial chromosome (BAC cloning strategy to sequence entire MHC haplotypes from consanguineous cell lines as part of the MHC Haplotype Project. Here we present 4.25 Mb of the human haplotype QBL (HLA-A26-B18-Cw5-DR3-DQ2 and compare it with the MHC reference haplotype and with a second haplotype, COX (HLA-A1-B8-Cw7-DR3-DQ2, that shares the same HLA-DRB1, -DQA1, and -DQB1 alleles. We have defined the complete gene, splice variant, and sequence variation contents of all three haplotypes, comprising over 259 annotated loci and over 20,000 single nucleotide polymorphisms (SNPs. Certain coding sequences vary significantly between different haplotypes, making them candidates for functional and disease-association studies. Analysis of the two DR3 haplotypes allowed delineation of the shared sequence between two HLA class II-related haplotypes differing in disease associations and the identification of at least one of the sites that mediated the original recombination event. The levels of variation across the MHC were similar to those seen for other HLA-disparate haplotypes, except for a 158-kb segment that contained the HLA-DRB1, -DQA1, and -DQB1 genes and showed very limited polymorphism compatible with identity-by-descent and relatively recent common ancestry (<3,400 generations. These results indicate that the differential disease associations of these two DR3 haplotypes are due to sequence variation outside this central 158-kb segment, and that shuffling of

  6. CHRNA7 haplotypes are associated with impaired attention in euthymic bipolar disorder.

    Science.gov (United States)

    Ancín, I; Cabranes, J A; Santos, J L; Sánchez-Morla, E; Vázquez-Álvarez, B; Rodríguez-Moya, L; Pousada-Casal, A; Fernández, C; Aparicio, A; Barabash, A

    2011-09-01

    Bipolar disorder (BD) patients show a deficit in sustained attention during euthymic periods. This deficit may be relevant for genetic studies in these patients. The α7 cholinergic receptor plays an important role in attentional deficit in humans and animal models. Moreover, there is evidence suggesting the role of the alpha 7 nicotinic cholinergic receptor subunit gene (CHRNA7) in BD susceptibility. The aim of the present study was to investigate the impact of CHRNA7 in sustained attention performance. We studied the association of a promoter variant (-86C/T) and three intronic polymorphisms, rs883473, rs6494223 and rs904952, in the non-duplicated region of CHRNA7 with sustained attention in 143 euthymic BD patients (based on DSM-IV criteria) and 101 healthy subjects. Sustained attention was assessed by the degraded stimulus (DS-CPT) version of Continuous Performance Test. Age, gender, years of education and IQ (WAIS vocabulary subtest) were controlled in the analyses as potential confounders. Several candidate polymorphisms showed significant associations with different measures of the neuropsychological task for bipolar group. The CTCT haplotype was associated with an improvement in the attentional task performance in the BD group (p ≤ 0.025). On the other hand, different low frequency haplotypes showed influence in bipolar attentional performance (p ≤ 0.026). A replication study using larger samples may be required for conclusive results. Our results point toward a slight association of CHRNA7 genotypes and haplotypes with sustained attention performance in euthymic patients with BD. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Extended LTA, TNF, LST1 and HLA gene haplotypes and their association with rubella vaccine-induced immunity.

    Directory of Open Access Journals (Sweden)

    Inna G Ovsyannikova

    2010-07-01

    Full Text Available Recent studies have suggested the importance of HLA genes in determining immune responses following rubella vaccine. The telomeric class III region of the HLA complex harbors several genes, including lymphotoxin alpha (LTA, tumor necrosis factor (TNF and leukocyte specific transcript -1 (LST1 genes, located between the class I B and class II DRB1 loci. Apart from HLA, little is known about the effect of this extended genetic region on HLA haplotypic backgrounds as applied to immune responses.We examined the association between immune responses and extended class I-class II-class III haplotypes among 714 healthy children after two doses of rubella vaccination. These extended haplotypes were then compared to the HLA-only haplotypes. The most significant association was observed between haplotypes extending across the HLA class I region, ten-SNP haplotypes, and the HLA class II region (i.e. A-C-B-LTA-TNF-LST1-DRB1-DQA1-DQB1-DPA1-DPB1 and rubella-specific antibodies (global p-value of 0.03. Associations were found between both extended A*02-C*03-B*15-AAAACGGGGC-DRB1*04-DQA1*03-DQB1*03-DPA1*01-DPB1*04 (p = 0.002 and HLA-only A*02-C*03-B*15-DRB1*04-DQA1*03-DQB1*03-DPA1*01-DPB1*04 haplotypes (p = 0.009 and higher levels of rubella antibodies. The class II HLA-only haplotype DRB1*13-DQA1*01-DQB1*06-DPA1*01-DPB1*04 (p = 0.04 lacking LTA-TNF-LST1 SNPs was associated with lower rubella antibody responses. Similarly, the class I-class II HLA-only A*01-C*07-B*08-DRB1*03-DQA1*05-DQB1*02-DPA1*01-DPB1*04 haplotype was associated with increased TNF-alpha secretion levels (p = 0.009. In contrast, the extended AAAACGGGGC-DRB1*01-DQA1*01-DQB1*05-DPA1*01-DPB1*04 (p = 0.01 haplotype was found to trend with decreased rubella-specific IL-6 secretion levels.These data suggest the importance of examining both HLA genes and genes in the class III region as part of the extended haplotypes useful in understanding genomic drivers regulating immune responses to rubella

  8. Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

    Directory of Open Access Journals (Sweden)

    Supachai Ekwattanakit

    2012-01-01

    Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

  9. Application of gene network analysis techniques identifies AXIN1/PDIA2 and endoglin haplotypes associated with bicuspid aortic valve.

    Directory of Open Access Journals (Sweden)

    Eric C Wooten

    2010-01-01

    Full Text Available Bicuspid Aortic Valve (BAV is a highly heritable congenital heart defect. The low frequency of BAV (1% of general population limits our ability to perform genome-wide association studies. We present the application of four a priori SNP selection techniques, reducing the multiple-testing penalty by restricting analysis to SNPs relevant to BAV in a genome-wide SNP dataset from a cohort of 68 BAV probands and 830 control subjects. Two knowledge-based approaches, CANDID and STRING, were used to systematically identify BAV genes, and their SNPs, from the published literature, microarray expression studies and a genome scan. We additionally tested Functionally Interpolating SNPs (fitSNPs present on the array; the fourth consisted of SNPs selected by Random Forests, a machine learning approach. These approaches reduced the multiple testing penalty by lowering the fraction of the genome probed to 0.19% of the total, while increasing the likelihood of studying SNPs within relevant BAV genes and pathways. Three loci were identified by CANDID, STRING, and fitSNPS. A haplotype within the AXIN1-PDIA2 locus (p-value of 2.926x10(-06 and a haplotype within the Endoglin gene (p-value of 5.881x10(-04 were found to be strongly associated with BAV. The Random Forests approach identified a SNP on chromosome 3 in association with BAV (p-value 5.061x10(-06. The results presented here support an important role for genetic variants in BAV and provide support for additional studies in well-powered cohorts. Further, these studies demonstrate that leveraging existing expression and genomic data in the context of GWAS studies can identify biologically relevant genes and pathways associated with a congenital heart defect.

  10. Serpin peptidase inhibitor (SERPINB5) haplotypes are associated with susceptibility to hepatocellular carcinoma

    Science.gov (United States)

    Yang, Shun-Fa; Yeh, Chao-Bin; Chou, Ying-Erh; Lee, Hsiang-Lin; Liu, Yu-Fan

    2016-05-01

    Hepatocellular carcinoma (HCC) represents the second leading cause of cancer-related death worldwide. The serpin peptidase inhibitor SERPINB5 is a tumour-suppressor gene that promotes the development of various cancers in humans. However, whether SERPINB5 gene variants play a role in HCC susceptibility remains unknown. In this study, we genotyped 6 SNPs of the SERPINB5 gene in an independent cohort from a replicate population comprising 302 cases and 590 controls. Additionally, patients who had at least one rs2289520 C allele in SERPINB5 tended to exhibit better liver function than patients with genotype GG (Child-Pugh grade A vs. B or C; P = 0.047). Next, haplotype blocks were reconstructed according to the linkage disequilibrium structure of the SERPINB5 gene. A haplotype “C-C-C” (rs17071138 + rs3744941 + rs8089204) in SERPINB5-correlated promoter showed a significant association with an increased HCC risk (AOR = 1.450 P = 0.031). Haplotypes “T-C-A” and “C-C-C” (rs2289519 + rs2289520 + rs1455555) located in the SERPINB5 coding region had a decreased (AOR = 0.744 P = 0.031) and increased (AOR = 1.981 P = 0.001) HCC risk, respectively. Finally, an additional integrated in silico analysis confirmed that these SNPs affected SERPINB5 expression and protein stability, which significantly correlated with tumour expression and subsequently with tumour development and aggressiveness. Taken together, our findings regarding these biomarkers provide a prediction model for risk assessment.

  11. Detection of Haplotypes Associated with Prenatal Death in Dairy Cattle and Identification of Deleterious Mutations in GART, SHBG and SLC37A2

    Science.gov (United States)

    Fritz, Sébastien; Capitan, Aurelien; Djari, Anis; Rodriguez, Sabrina C.; Barbat, Anne; Baur, Aurélia; Grohs, Cécile; Weiss, Bernard; Boussaha, Mekki; Esquerré, Diane; Klopp, Christophe; Rocha, Dominique; Boichard, Didier

    2013-01-01

    The regular decrease of female fertility over time is a major concern in modern dairy cattle industry. Only half of this decrease is explained by indirect response to selection on milk production, suggesting the existence of other factors such as embryonic lethal genetic defects. Genomic regions harboring recessive deleterious mutations were detected in three dairy cattle breeds by identifying frequent haplotypes (>1%) showing a deficit in homozygotes among Illumina Bovine 50k Beadchip haplotyping data from the French genomic selection database (47,878 Holstein, 16,833 Montbéliarde, and 11,466 Normande animals). Thirty-four candidate haplotypes (p<10−4) including previously reported regions associated with Brachyspina, CVM, HH1, and HH3 in Holstein breed were identified. Haplotype length varied from 1 to 4.8 Mb and frequencies from 1.7 up to 9%. A significant negative effect on calving rate, consistent in heifers and in lactating cows, was observed for 9 of these haplotypes in matings between carrier bulls and daughters of carrier sires, confirming their association with embryonic lethal mutations. Eight regions were further investigated using whole genome sequencing data from heterozygous bull carriers and control animals (45 animals in total). Six strong candidate causative mutations including polymorphisms previously reported in FANCI (Brachyspina), SLC35A3 (CVM), APAF1 (HH1) and three novel mutations with very damaging effect on the protein structure, according to SIFT and Polyphen-2, were detected in GART, SHBG and SLC37A2 genes. In conclusion, this study reveals a yet hidden consequence of the important inbreeding rate observed in intensively selected and specialized cattle breeds. Counter-selection of these mutations and management of matings will have positive consequences on female fertility in dairy cattle. PMID:23762392

  12. snp.plotter: an R-based SNP/haplotype association and linkage disequilibrium plotting package.

    Science.gov (United States)

    Luna, Augustin; Nicodemus, Kristin K

    2007-03-15

    snp.plotter is a newly developed R package which produces high-quality plots of results from genetic association studies. The main features of the package include options to display a linkage disequilibrium (LD) plot below the P-value plot using either the r2 or D' LD metric, to set the X-axis to equal spacing or to use the physical map of markers, and to specify plot labels, colors, symbols and LD heatmap color scheme. snp.plotter can plot single SNP and/or haplotype data and simultaneously plot multiple sets of results. R is a free software environment for statistical computing and graphics available for most platforms. The proposed package provides a simple way to convey both association and LD information in a single appealing graphic for genetic association studies. Downloadable R package and example datasets are available at http://cbdb.nimh.nih.gov/~kristin/snp.plotter.html and http://www.r-project.org.

  13. A single haplotype hyposensitive to light and requiring strong vernalization dominates Arabidopsis thaliana populations in Patagonia, Argentina.

    Science.gov (United States)

    Kasulin, Luciana; Rowan, Beth A; León, Rolando J C; Schuenemann, Verena J; Weigel, Detlef; Botto, Javier F

    2017-07-01

    The growing collection of sequenced or genotyped Arabidopsis thaliana accessions includes mostly individuals from the native Eurasian and N. African range and introduced North American populations. Here, we describe the genetic and phenotypic diversity, along with habitats and life history, of A. thaliana plants collected at the southernmost end of its worldwide distribution. Seed samples were harvested from plants growing in four sites within a ~3500-km 2 -area in Patagonia, Argentina, and represent the first germplasm to be collected in South America for this species. Whole-genome resequencing revealed that plants from the four sites and a Patagonia herbarium specimen collected in 1967 formed a single haplogroup (Pat), indicating that the phenotypic variation observed in the field reflected plastic responses to the environment. admixture and principal components analyses suggest that the ancestor of the Pat haplogroup either came from Italy or the Balkan/Caucasus regions of Eurasia. In the laboratory, plants from the Pat haplogroup were hyposensitive to continuous red (Rc) and shade light, with corresponding changes in the expression of phytochrome signalling genes. Pat had higher PIF3 and PIF5 and lower HY5 expression under Rc light; and lower expression of PIL1, ATHB2 and HFR1 under shade compared to Col-0. In addition, Pat plants had a strong vernalization requirement associated with high levels of FLC expression. We conclude that including Pat in studies of natural variation and in comparison with other introduced populations will provide additional information for association studies and allow for a more detailed assessment of the demographic events following colonization. © 2017 John Wiley & Sons Ltd.

  14. Novel Nucleotide Variations, Haplotypes Structure and Associations with Growth Related Traits of Goat AT Motif-Binding Factor ( Gene

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhang

    2015-10-01

    Full Text Available The AT motif-binding factor (ATBF1 not only interacts with protein inhibitor of activated signal transducer and activator of transcription 3 (STAT3 (PIAS3 to suppress STAT3 signaling regulating embryo early development and cell differentiation, but is required for early activation of the pituitary specific transcription factor 1 (Pit1 gene (also known as POU1F1 critically affecting mammalian growth and development. The goal of this study was to detect novel nucleotide variations and haplotypes structure of the ATBF1 gene, as well as to test their associations with growth-related traits in goats. Herein, a total of seven novel single nucleotide polymorphisms (SNPs (SNP 1-7 within this gene were found in two well-known Chinese native goat breeds. Haplotypes structure analysis demonstrated that there were four haplotypes in Hainan black goat while seventeen haplotypes in Xinong Saanen dairy goat, and both breeds only shared one haplotype (hap1. Association testing revealed that the SNP2, SNP5, SNP6, and SNP7 loci were also found to significantly associate with growth-related traits in goats, respectively. Moreover, one diplotype in Xinong Saanen dairy goats significantly linked to growth related traits. These preliminary findings not only would extend the spectrum of genetic variations of the goat ATBF1 gene, but also would contribute to implementing marker-assisted selection in genetics and breeding in goats.

  15. Strategies for haplotype-based association mapping in complex pedigreed populations

    DEFF Research Database (Denmark)

    Boleckova, J; Christensen, Ole Fredslund; Sørensen, Peter

    2012-01-01

    increases the number of parameters in the model, resulting in low accuracy of the estimates especially for the low-frequency haplotypes. Modeling of haplotype effects can be improved if they are assumed to be random effects, as only one parameter i.e. haplotype variance needs to be estimated compared......, 4, 6, 10 and 20. The simulated data resembled the Danish Holstein cattle pedigree representing a complex relationship structure and QTL effects of different sizes were simulated. We observed that the random haplotype models had high power and very low type I error rates (after Bonferroni correction...

  16. Haplotypes in CCR5-CCR2, CCL3 and CCL5 are associated with natural resistance to HIV-1 infection in a Colombian cohort.

    Science.gov (United States)

    Vega, Jorge A; Villegas-Ospina, Simón; Aguilar-Jiménez, Wbeimar; Rugeles, María T; Bedoya, Gabriel; Zapata, Wildeman

    2017-06-01

    Variants in genes encoding for HIV-1 co-receptors and their natural ligands have been individually associated to natural resistance to HIV-1 infection. However, the simultaneous presence of these variants has been poorly studied. To evaluate the association of single and multilocus haplotypes in genes coding for the viral co-receptors CCR5 and CCR2, and their ligands CCL3 and CCL5, with resistance or susceptibility to HIV-1 infection. Nine variants in CCR5-CCR2, two SNPs in CCL3 and two in CCL5 were genotyped by PCR-RFLP in 35 seropositive (cases) and 49 HIV-1-exposed seronegative Colombian individuals (controls). Haplotypes were inferred using the Arlequin software, and their frequency in individual or combined loci was compared between cases and controls by the chi-square test. A p' value ;0.05 after Bonferroni correction was considered significant. Homozygosis of the human haplogroup (HH) E was absent in controls and frequent in cases, showing a tendency to susceptibility. The haplotypes C-C and T-T in CCL3 were associated with susceptibility (p'=0.016) and resistance (p';0.0001) to HIV-1 infection, respectively. Finally, in multilocus analysis, the haplotype combinations formed by HHC in CCR5-CCR2, T-T in CCL3 and G-C in CCL5 were associated with resistance (p'=0.006). Our results suggest that specific combinations of variants in genes from the same signaling pathway can define an HIV-1 resistant phenotype. Despite our small sample size, our statistically significant associations suggest strong effects; however, these results should be further validated in larger cohorts.

  17. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  18. Polymorphisms and their Haplotype Combinations in the Lysozyme Gene Associated with the Production Traits of a Chinese Native Chicken Breed

    Directory of Open Access Journals (Sweden)

    LJ Yan

    Full Text Available ABSTRACT Animal lysozymes, which have been studied in many of invertebrate and vertebrate species, have been characterized and demonstrated to be immune-associated molecules, digestive enzymes and multifunctional molecules. The purpose of this study was to detect the connection between lysozyme-gene polymorphism and the production traits of a Chinese native chicken breed (Langshan chicken. Four single nucleotide mutation sites were identified: G345A, C1726T, G1836A, A1838G. By the linkage disequilibrium analysis, six haplotypes and 15haplotype combinations were depicted in the studied population. The statistical analysis demonstrated that the SNPs and the haplotype combinations are related to body weight at sixteen weeks of age in Langshan chickens (p<0.05, and those with combined haplotype Hap3-Hap6 (GA-TT-GG-AA presented higher body weight. Our study demonstrated that the SNPs and their haplotype combinations in the lysozyme gene were associated with the chicken production traits, and that SNPs can be used as a molecular marker for chicken marker-assisted selection.

  19. A Monomorphic Haplotype of Chromosome Ia Is Associated with Widespread Success in Clonal and Nonclonal Populations of Toxoplasma gondii

    Science.gov (United States)

    Khan, Asis; Miller, Natalie; Roos, David S.; Dubey, J. P.; Ajzenberg, Daniel; Dardé, Marie Laure; Ajioka, James W.; Rosenthal, Benjamin; Sibley, L. David

    2011-01-01

    ABSTRACT Toxoplasma gondii is a common parasite of animals that also causes a zoonotic infection in humans. Previous studies have revealed a strongly clonal population structure that is shared between North America and Europe, while South American strains show greater genetic diversity and evidence of sexual recombination. The common inheritance of a monomorphic version of chromosome Ia (referred to as ChrIa*) among three clonal lineages from North America and Europe suggests that inheritance of this chromosome might underlie their recent clonal expansion. To further examine the diversity and distribution of ChrIa, we have analyzed additional strains with greater geographic diversity. Our findings reveal that the same haplotype of ChrIa* is found in the clonal lineages from North America and Europe and in older lineages in South America, where sexual recombination is more common. Although lineages from all three continents harbor the same conserved ChrIa* haplotype, strains from North America and Europe are genetically separate from those in South America, and these respective geographic regions show limited evidence of recent mixing. Genome-wide, array-based profiling of polymorphisms provided evidence for an ancestral flow from particular older southern lineages that gave rise to the clonal lineages now dominant in the north. Collectively, these data indicate that ChrIa* is widespread among nonclonal strains in South America and has more recently been associated with clonal expansion of specific lineages in North America and Europe. These findings have significant implications for the spread of genetic loci influencing transmission and virulence in pathogen populations. PMID:22068979

  20. Analysis of associations between major histocompatibility complex (BoLA) class I haplotypes and subclinical mastitis of dairy cows

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Jensen, N. E.; Østergård, H.

    1995-01-01

    The associations between BoLA class I haplotypes and subclinical mastitis were investigated using information on 333 cows from three different breeds and crossbreeds from 14 dairy herds in Denmark. Somatic cell count and bacteriological status were used as markers for subclinical mastitis. Associ...

  1. Population-specific haplotype association of the postsynaptic density gene DLG4 with schizophrenia, in family-based association studies.

    Directory of Open Access Journals (Sweden)

    Shabeesh Balan

    Full Text Available The post-synaptic density (PSD of glutamatergic synapses harbors a multitude of proteins critical for maintaining synaptic dynamics. Alteration of protein expression levels in this matrix is a marked phenomenon of neuropsychiatric disorders including schizophrenia, where cognitive functions are impaired. To investigate the genetic relationship of genes expressed in the PSD with schizophrenia, a family-based association analysis of genetic variants in PSD genes such as DLG4, DLG1, PICK1 and MDM2, was performed, using Japanese samples (124 pedigrees, n = 376 subjects. Results showed a significant association of the rs17203281 variant from the DLG4 gene, with preferential transmission of the C allele (p = 0.02, although significance disappeared after correction for multiple testing. Replication analysis of this variant, found no association in a Chinese schizophrenia cohort (293 pedigrees, n = 1163 subjects or in a Japanese case-control sample (n = 4182 subjects. The DLG4 expression levels between postmortem brain samples from schizophrenia patients showed no significant changes from controls. Interestingly, a five marker haplotype in DLG4, involving rs2242449, rs17203281, rs390200, rs222853 and rs222837, was enriched in a population specific manner, where the sequences A-C-C-C-A and G-C-C-C-A accumulated in Japanese (p = 0.0009 and Chinese (p = 0.0007 schizophrenia pedigree samples, respectively. However, this could not be replicated in case-control samples. None of the variants in other examined candidate genes showed any significant association in these samples. The current study highlights a putative role for DLG4 in schizophrenia pathogenesis, evidenced by haplotype association, and warrants further dense screening for variants within these haplotypes.

  2. Tyrosinase-positive oculocutaneous albinism in Southern African blacks: P gene-associated haplotypes suggest a major mutation in the 5{prime} region of the gene

    Energy Technology Data Exchange (ETDEWEB)

    Ramsay, M.; Stevens, G.; Beukering, J. van [Univ. of the Witwatersrand, Johannesburg (South Africa)] [and others

    1994-09-01

    Tyrosinase-positive oculocutaneous albinism (ty-pos OCA) occurs with a prevalence of 1 in 3900 among Southern African (SA) blacks. The major contributors to morbidity and mortality are skin cancer and decreased visual acuity. Two distinct phenotypes occur, namely individuals with ephelides (darkly pigmented patches) and those without. There is complete concordance with regard to ephelus status among siblings. The disorder is linked to markers on chromosome 15q11.2-q12, and no obligatory cross-overs were observed with polymophic markers at the human homolog, P, of the mouse pink eyed dilute gene, p. Contrary to what has been shown for Caucasoid ty-pos OCA, this condition shows locus homogeneity among SA blacks. The P gene is an excellent candidate for ty-pos OCA and mutations in this gene will confirm its role in causing the common form of albinism in SA. Numerous P gene mutations have been described in other populations. In an attempt to detect mutations, the P gene cDNA was used to search for structural rearrangements or polymorphisms. Six polymorphisms (plR10/Scal, 912/Xbal, 912/HincII, 912/TaqI, 1412/TaqI [two systems] and 1412/HindIII) were detected with subclones of the P cDNA and haplotypes were determined in each family. None were clearly associated with an albinism-related rearrangement. However, strong linkage disequilibrium was observed with alleles at loci toward the 5{prime} region of the gene ({triangle}=0.65, 0.57 and 0.80 for the three polymorphisms detected with the 912 subclone), suggesting a major ty-pos OCA mutation in this region. Haplotype analysis provides evidence for a major mutation associated with the same haplotype in individuals with ephelides (8/12 OCA chromosomes) and those without ephelides (24:30). The presence of other ty-pos OCA associated haplotypes indicates several other less common mutations.

  3. Catechol O-methyltransferase (COMT) functional haplotype is associated with recurrence of affective symptoms: A prospective birth cohort study.

    Science.gov (United States)

    Koike, Shinsuke; Gaysina, Darya; Jones, Peter B; Wong, Andrew; Richards, Marcus

    2018-03-15

    Catechol-O-methyltransferase (COMT) polymorphisms play an essential role in dopamine availability in the brain. However, there has been no study investigating whether a functional four-SNP (rs6269-rs4633-rs4818-rs4680) haplotype is associated with affective symptoms over the life course. We tested this using 2093 members of the Medical Research Council National Survey of Health and Development (MRC NSHD), who had been followed up since birth in 1946, and had data for COMT genotypes, adolescent emotional problems (age 13-15) and at least one measure of adult affective symptoms at ages 36, 43, 53, or 60-64 years. First, differences in the levels of affective symptoms by the functional haplotype using SNPs rs6269, rs4818, and rs4680 were tested in a structural equation model framework. Second, interactions between affective symptoms by COMT haplotype were tested under an additive model. Finally, a quadratic regressor (haplotype 2 ) was used in a curvilinear model, to test for a possible inverted-U trend in affective symptoms according to COMT-related dopamine availability. Women had a significant interaction between COMT haplotypes and adolescent emotional problem on affective symptoms at age 53. Post hoc analysis showed a significant positive association between adolescent emotional problems and affective symptoms at age 53 years in the middle dopamine availability group (valA/valB or met/met; β = .11, p = .007). For men, no significant interactions were observed. Combination of the COMT functional haplotype model and inverted-U model may shed light on the effect of dopaminergic regulation on the trajectory of affective symptoms over the life course. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Association of interleukin-10 promoter haplotypes with disease susceptibility and IL-10 levels in Mexican patients with systemic lupus erythematosus.

    Science.gov (United States)

    Palafox-Sánchez, Claudia Azucena; Oregon-Romero, Edith; Salazar-Camarena, Diana Celeste; Valle, Yeminia Maribel; Machado-Contreras, Jesús René; Cruz, Alvaro; Orozco-López, Mariana; Orozco-Barocio, Gerardo; Vázquez-Del Mercado, Mónica; Muñoz-Valle, José Francisco

    2015-11-01

    Systemic lupus erythematosus (SLE) is the prototype autoimmune rheumatic disease. The etiology of this disease is incompletely understood; however, environmental factors and genetic predisposition are involved. Cytokine-mediated immunity plays a crucial role in the pathogenesis of SLE. We investigate the association of interleukin-10 (IL-10) promoter polymorphisms and their haplotypes in SLE patients from the western Mexico. One hundred and twenty-five SLE patients fulfilling the 1997 ACR criteria and 260 unrelated healthy subjects (HS), both Mexican mestizos, were genotyped for IL-10 -1082A>G, -819C>T, and -592C>A polymorphisms. Haplotypes were inferred using the expectation-maximization algorithm, then allele and haplotype distributions were compared between patients and HS, as well as patients with different clinical variables. We identified at -1082, -819, and -592 four predominant haplotypes ACC (43.70 % in patients vs 46.55 % in HS), ATA (21.45 vs 22.97 %), GCC (16.28 vs 14.21 %), and GTA (14.12 vs 14.12 %). The ATC haplotype was more frequent in SLE respect to HS, suggesting a risk effect (3.23 vs 1.05 %; OR 3.55, CI 1.14-11.11; p = 0.0293). SLE patient carriers of -592 CC genotype as well as the dominant model of inheritance showed higher sIL-10 respect to AA genotype, suggesting that -592 C allele is associated with increased production of the cytokine (p < 0.05). The ACC haplotype had higher IL-10 serum levels and higher values of Mexican version of the Systemic Lupus Erythematosus Disease Activity Index compared with the other haplotype carriers; however, no association was found regarding autoantibodies. Our data suggest that the IL-10 promoter haplotypes play an important role in the risk of developing SLE and influence the production of IL-10 in Mexican population. Nevertheless, further studies are required to analyze the expression of mRNA as well as to investigate the interacting epigenetic factors that could help to define the true contribution of

  5. IL6 and CRP haplotypes are associated with COPD risk and systemic inflammation: a case-control study

    Directory of Open Access Journals (Sweden)

    Passos Valéria

    2009-03-01

    Full Text Available Abstract Background Elevated circulating levels of C-reactive protein (CRP, interleukin (IL-6 and fibrinogen (FG have been repeatedly associated with many adverse outcomes in patients with chronic obstructive pulmonary disease (COPD. To date, it remains unclear whether and to what extent systemic inflammation is primary or secondary in the pathogenesis of COPD. The aim of this study was to examine the association between haplotypes of CRP, IL6 and FGB genes, systemic inflammation, COPD risk and COPD-related phenotypes (respiratory impairment, exercise capacity and body composition. Methods Eighteen SNPs in three genes, representing optimal haplotype-tagging sets, were genotyped in 355 COPD patients and 195 healthy smokers. Plasma levels of CRP, IL-6 and FG were measured in the total study group. Differences in haplotype distributions were tested using the global and haplotype-specific statistics. Results Raised plasma levels of CRP, IL-6 and fibrinogen were demonstrated in COPD patients. However, COPD population was very heterogeneous: about 40% of patients had no evidence of systemic inflammation (CRP CRP gene and CRP plasma levels (P = 0.0004 and IL6 gene and COPD (P = 0.003. Subsequent analysis has shown that IL6 haplotype H2, associated with an increased COPD risk (p = 0.004, OR = 4.82; 1.64 to 4.18, was also associated with very low CRP levels (p = 0.0005. None of the genes were associated with COPD-related phenotypes. Conclusion Our findings suggest that common genetic variation in CRP and IL6 genes may contribute to heterogeneity of COPD population associated with systemic inflammation.

  6. Haplotype of platelet receptor P2RY12 gene is associated with residual clopidogrel on-treatment platelet reactivity.

    Science.gov (United States)

    Nie, Xiao-Yan; Li, Jun-Lei; Zhang, Yong; Xu, Yang; Yang, Xue-Li; Fu, Yu; Liang, Guang-Kai; Lu, Yun; Liu, Jian; Shi, Lu-Wen

    To investigate a possible association between common variations of the P2RY12 and the residual clopidogrel on-treatment platelet reactivity after adjusting for the influence of CYP2C19 tested by thromboelastography (TEG). One hundred and eighty patients with acute coronary syndrome (ACS) treated with clopidogrel and aspirin were included and platelet function was assessed by TEG. Five selected P2RY12 single nucleotide polymorphisms (SNPs; rs6798347, rs6787801, rs6801273, rs6785930, and rs2046934), which cover the common variations in the P2RY12 gene and its regulatory regions, and three CYP2C19 SNPs ( * 2, * 3, * 17) were genotyped and possible haplotypes were analyzed. The high on-treatment platelet reactivity (HTPR) prevalence defined by a platelet inhibition rate <30% by TEG in adenosine diphosphate (ADP)-channel was 69 (38.33%). Six common haplotypes were inferred from four of the selected P2RY12 SNPs (denoted H 0 to H 5 ) according to the linkage disequilibrium R square (except for rs2046934). Haplotype H 1 showed a significantly lower incidence of HTPR than the reference haplotype (H 0 ) in the total study population while haplotypes H 1 and H 2 showed significantly lower incidences of HTPR than H 0 in the nonsmoker subgroup after adjusting for CYP2C19 effects and demographic characteristics. rs2046934 (T744C) did not show any significant association with HTPR. The combination of common P2RY12 variations including regulatory regions rather than rs2046934 (T744C) that related to pharmacodynamics of clopidogrel in patients with ACS was independently associated with residual on-clopidogrel platelet reactivity. This is apart from the established association of the CYP2C19. This association seemed more important in the subgroup defined by smoking.

  7. Association of HLA-G 3'UTR polymorphisms and haplotypes with severe sepsis in a Brazilian population.

    Science.gov (United States)

    Hahn, Eriza Cristina; Zambra, Francis Maria Báo; Kamada, Anselmo Jiro; Delongui, Francieli; Grion, Cíntia Magalhães Carvalho; Reiche, Edna Maria Vissoci; Chies, José Artur Bogo

    2017-11-01

    The human leukocyte antigen G (HLA-G) is a molecule involved in immune system modulation, acting in the maintenance of a state of immune tolerance. Some polymorphisms in the HLA-G gene 3' untranslated region (3'UTR) were associated to distinct levels of HLA-G expression and to sepsis development. In the present study, haplotypes and polymorphisms of the HLA-G 3'UTR were analyzed in Brazilian septic patients. The HLA-G 3'UTR was amplified by PCR, sequenced and eight polymorphisms were genotyped (the 14bp insertion/deletion, +3003T/C, +3010C/G, +3027A/C, +3035C/T, +3142G/C, +3187A/G and+3196C/G) in DNA samples from septic patients (with severe sepsis or septic shock) and controls. The haplotypes were inferred and association tests were performed through Chi square test and binary logistic regression. The+3027AC genotype was associated asa risk factor to sepsis development (OR 3.17, P Bonferroni 0.048). Further, the presence of the UTR-7 haplotype (OR 2.97, P Bonferroni 0.018), and of 14bp-Ins_+3142G_+3187A haplotype (OR 2.39, P Bonferroni 0.045) were associated with sepsis, conferring susceptibility. Our data confirm an important role of HLA-G 3'UTR polymorphisms in the development of severe forms of sepsis (severe sepsis and septic shock). The genotyping of HLA-G genetic variants and haplotypes could be useful as a prediction tool of increased risk to severe sepsis. Copyright © 2017 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  8. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees

    Science.gov (United States)

    Schöning, Caspar

    2017-01-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163

  9. Two extended haplotype blocks are associated with adaptation to high altitude habitats in East African honey bees.

    Science.gov (United States)

    Wallberg, Andreas; Schöning, Caspar; Webster, Matthew T; Hasselmann, Martin

    2017-05-01

    Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies.

  10. HLA alleles and HLA-B27 haplotypes associated with susceptibility and severity of ankylosing spondylitis in a Portuguese population.

    Science.gov (United States)

    Pimentel-Santos, F M; Matos, M; Ligeiro, D; Mourão, A F; Ribeiro, C; Costa, J; Santos, H; Barcelos, A; Pinto, P; Cruz, M; Sousa, E; Santos, R A; Fonseca, J E; Trindade, H; Guedes-Pinto, H; Branco, J C

    2013-12-01

    Human leukocyte antigen (HLA)-B27 is the mostly known major histocompatibility complex (MHC) gene associated with ankylosing spondylitis (AS). Nonetheless, there is substantial evidence that other MHC genes appear to be associated with the disease, although it has not yet been established whether these associations are driven by direct associations or by linkage disequilibrium (LD) mechanisms. We aimed to investigate the contributions of HLA class I and II alleles and B27-haplotypes for AS in a case-control study. A total of 188 HLA-B27 AS cases and 189 HLA-B27 healthy controls were selected and typed for HLA class I and II by the Luminex polymerase chain reaction-sequence specific oligonucleotide probe (PCR-SSOP) method. Allelic and haplotypic distributions were estimated by maximum likelihood method using Arlequin v3.11 and statistical analysis were performed by Stata10.1. No associations were found between non-HLA-B27 loci and AS susceptibility, but several associations were observed for phenotypic features of the disease. DRB1*08 was identified as a risk factor for uveitis and DQB1*04 seems to provide protection for AS severity (functional, metrological and radiological indexes). A*02/B27/C*02/DRB1*01/DQB1*05 [P<0.0001; odds ratio (OR) = 39.06; 95% confidence interval (CI) (2.34-651)] is the only haplotype that seems to confer susceptibility to AS. Moreover, the haplotype A*02/B27/C*01/DRB1*08/DQB1*04 seems to provide protection for disease functional and radiological repercussions. Our findings are compatible with the hypothesis that other genes within the HLA region besides HLA-B27 might play some role in AS susceptibility and severity. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. HLA Class II Allele, Haplotype, and Genotype Associations with Type 1 Diabetes in Benin: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Kaossarath A. Fagbemi

    2017-01-01

    Full Text Available Background. Several studies have reported the implication of HLA-DR/DQ loci in the susceptibility to type 1 diabetes (T1D. Since no such study has yet been performed in Benin, this pilot one aimed at assessing HLA class II allele, haplotype, and genotype associations with T1D. Material and Methods. Class II HLA genotyping was performed in 51 patients with T1D and 51 healthy unrelated controls by means of the PCR-SSP method. The diagnosis of T1D was set up according to American Diabetes Association criteria. Odds ratio (OR and its 95% confidence interval (95% CI were calculated to assess the associations between T1D and HLA alleles, haplotypes, and genotypes. Results. Participants were aged 1–24 years. T1D was significantly associated with DR3, DQA1∗05:01, DQB1∗02:01, and DR3-DR4. No significant associations were observed with DR4, DQB1∗03:02, and DQB1∗06:02. Conclusion. Certain HLA class II alleles, haplotypes, and genotypes were related to T1D and may be used as genetic susceptibility markers to T1D in Benin.

  12. Haplotype-based genome-wide association study identifies loci and candidate genes for milk yield in Holsteins.

    Directory of Open Access Journals (Sweden)

    Zhenliang Chen

    Full Text Available Since milk yield is a highly important economic trait in dairy cattle, the genome-wide association study (GWAS is vital to explain the genetic architecture underlying milk yield and to perform marker-assisted selection (MAS. In this study, we adopted a haplotype-based empirical Bayesian GWAS to identify the loci and candidate genes for milk yield. A total of 1 092 Holstein cows were sequenced by using the genotyping by genome reducing and sequencing (GGRS method. After filtering, 164 312 high-confidence SNPs and 13 476 haplotype blocks were identified to use for GWAS. The results indicated that 17 blocks were significantly associated with milk yield. We further identified the nearest gene of each haplotype block and annotated the genes with milk-associated quantitative trait locus (QTL intervals and ingenuity pathway analysis (IPA networks. Our analysis showed that four genes, DLGAP1, AP2B1, ITPR2 and THBS4, have relationships with milk yield, while another three, ARHGEF4, TDRD1 and KIF19, were inferred to have potential relationships. Additionally, a network derived from the IPA containing one inferred (ARHGEF4 and all four confirmed genes likely regulates milk yield. Our findings add to the understanding of identifying the causal genes underlying milk production traits and could guide follow up studies for further confirmation of the associated genes, pathways and biological networks.

  13. Identification of a type 1 diabetes-associated CD4 promoter haplotype with high constitutive activity

    DEFF Research Database (Denmark)

    Kristiansen, O P; Karlsen, A E; Larsen, Z M

    2004-01-01

    promoter activity and (2) the CD4-181G variant encodes higher stimulated promoter activity than the CD4-181C variant. This difference is in part neutralized in the frequently occurring CD4 promoter haplotypes by the more upstream genetic variants. Thus, we report functional impact of a novel CD4-181C/G SNP...

  14. RET haplotype, not linked to the C620R activating mutation, associated with Hirschsprung disease in a novel MEN2 family

    Directory of Open Access Journals (Sweden)

    Elisangela P. S. Quedas

    2012-01-01

    Full Text Available Hirschsprung disease is a congenital form of aganglionic megacolon that results from cristopathy. Hirschsprung disease usually occurs as a sporadic disease, although it may be associated with several inherited conditions, such as multiple endocrine neoplasia type 2. The rearranged during transfection (RET proto-oncogene is the major susceptibility gene for Hirschsprung disease, and germline mutations in RET have been reported in up to 50% of the inherited forms of Hirschsprung disease and in 15-20% of sporadic cases of Hirschsprung disease. The prevalence of Hirschsprung disease in multiple endocrine neoplasia type 2 cases was recently determined to be 7.5% and the cooccurrence of Hirschsprung disease and multiple endocrine neoplasia type 2 has been reported in at least 22 families so far. It was initially thought that Hirschsprung disease could be due to disturbances in apoptosis or due to a tendency of the mutated RET receptor to be retained in the Golgi apparatus. Presently, there is strong evidence favoring the hypothesis that specific inactivating haplotypes play a key role in the fetal development of congenital megacolon/Hirschsprung disease. In the present study, we report the genetic findings in a novel family with multiple endocrine neoplasia type 2: a specific RET haplotype was documented in patients with Hirschsprung disease associated with medullary thyroid carcinoma, but it was absent in patients with only medullary thyroid carcinoma. Despite the limited number of cases, the present data favor the hypothesis that specific haplotypes not linked to RET germline mutations are the genetic causes of Hirschsprung disease.

  15. Genomic association for sexual precocity in beef heifers using pre-selection of genes and haplotype reconstruction.

    Directory of Open Access Journals (Sweden)

    Luciana Takada

    Full Text Available Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth as fixed effect and parent of the animal (sire effect as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05 on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2, two in the Estrogen-related receptor gamma gene (ESRRG, and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A, Kell blood group complex subunit-related family (XKR4 and mannose-binding lectin genes (MBL-1 genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.

  16. [Association between CETP polymorphisms and haplotypes with dyslipidemia in Xinjiang Uygur and Kazak residents].

    Science.gov (United States)

    Hu, Y H; Liu, J M; Zhang, M; He, J; Yan, Y Z; Ma, J L; Ma, R L; Guo, H; Rui, D S; Sun, F; Mu, L L; Niu, Q; Ding, Y S; Zhang, J Y; Li, S G; Guo, S X

    2016-08-24

    To explore the relationship between the polymorphisms and haplotypes in the CETP gene and dyslipidemia among Xinjiang Kazak and Uygur residents. A population status survey was performed from 2010 to 2011 in Kashgar Xinjiang Uygur and Kazak residents, stratified cluster sampling method was used to select Uygur, Kazak residents with abnormal blood lipid values (n=367 and 345, respectively) as the dyslipidemia groups, and to select residents with normal lipid values as control group from the same area (n=374 and 390, respectively). SNaPshot technology was applied to detect the DNA of CETP gene rs3764261, rs1800775, rs708272 and rs5882 loci in all selected residents, and linkage disequilibrium analysis and haplotype construction were performed. (1) In Uygur residents, the dyslipidemia risk of rs708272 CT (OR=0.64, 95%CI 0.46-0.91, P=0.01) and TT genotype (OR=0.60, 95%CI 0.40-0.91, P=0.02) was significantly lower than CC genotype. Dyslipidemia risk of rs3764261 GT (OR=0.55, 95%CI 0.40-0.74, P=0.00) and TT genotype (OR=0.47, 95%CI 0.28-0.78, PDyslipidemia risk of the rs1800775 CC genotype was higher than AA genotype (OR=1.79, 95%CI 1.17-2.74, P=0.01). There was no statistical significance in CETP gene of the 4 genotype and allele frequency between the dyslipidemia and normal lipid groups in Kazak residents (all P>0.05). (2) In Uighur residents with dyslipidemia, HDL-C level was significantly higher in rs708272 TT genotype carriers than in CC and CT genotypes (all Pdyslipidemia and haplotype GACA, TATA and TATG will reduce the risk of dyslipidemia, while haplotype GATA, GCCA will increase the risk of dyslipidemia in Uygur residents. The four CETP polymorphisms are not related to the risk of dyslipidemia, but haplotype GCCG is related to increased risk of dyslipidemia in Kazakhs residents.

  17. Haplotype structure of the beta2-adrenergic receptor gene in 814 Danish Caucasian subjects and association with body mass index

    DEFF Research Database (Denmark)

    Jensen, Mette Kamp; Nielsen, Morten; Koefoed, Pernille

    2009-01-01

    . In the total population (mean age +/- SD: 50 +/- 16 years), BMI was not related to haplotype pairs, individual SNPs or allelic haplotypes. However, in subjects levels varied significantly between pairs of major haplotype groups (p = 0.014) but were not related...... with body mass index (BMI). The SNPs showed organization into 13 distinct haplotypes and 41 haplotype pairs. The study identified four common haplotypes: ACCCC (10.1 +/- 0.3 %), ACCCG (27.9 +/- 0.3 %), GCCAC (10.8 +/- 0.1 %) and GGCCG (41.0 +/- 0.2 %) (frequencies (SD), seen in 91 % of the population...... to individual SNPs. In subjects subjects (BMI

  18. Association of SNPs/haplotypes in promoter of TNF A and IL-10 gene together with life style factors in prostate cancer progression in Indian population.

    Science.gov (United States)

    Bandil, Kapil; Singhal, Pallavi; Dogra, Atika; Rawal, Sudhir K; Doval, D C; Varshney, Anil K; Bharadwaj, Mausumi

    2017-12-01

    Levels of proinflammatory (TNF A) and anti-inflammatory (IL-10) cytokines play a key role in the progression of inflammation as well as cancer disease. We were investigating the potential association of single-nucleotide polymorphisms (SNPs)/haplotypes in proinflammatory (TNF A) and anti-inflammatory (IL-10) cytokines locus with the development of PCa in Indian population. We had genotyped 235 BPH/PCa samples (130 BPH and 105 cancer) along with 115 control samples for proinflammatory (TNF A -238G/A and -308G/A) and anti-inflammatory (IL-10 -1082A/G, -819C/T and -592C/A) cytokines SNPs in the gene promoter region using ARMS-PCR method. Allelic frequencies of TNF A and IL-10 SNPs were found to be significantly associated with the risk of prostate cancer and BPH when compared to controls (p = 0.05). Further haplotypic analysis showed that two haplotypes of TNF A (AG and AA) and IL-10 gene (CCG and CTG) were serving as risk haplotypes for prostate cancer development. IL-10 risk haplotypes were found to be positively associated with aggressiveness of prostate cancer. We also noticed successively increasing percentage of TNF A and IL-10 risk haplotypes with life style habits like smoking (10 and 26%) and alcohol consuming (9 and 27%). According to our data, TNF A -238G>A and IL-10 -1082A>G, -819C>T and -592C>A may be associated with the development of prostate cancer and BPH. We could also notice higher frequency of TNF A and IL-10 risk haplotypes in smoker and alcohol user. Interestingly, IL-10 risk haplotype was positively associated with aggressiveness of tumor. This information can be used for the early diagnosis of disease and to improve tissue-specific treatment's efficacy which will be moving ultimately towards the discovery of personalized therapy.

  19. On the use of multifactor dimensionality reduction (MDR) and classification and regression tree (CART) to identify haplotype-haplotype interactions in genetic studies.

    Science.gov (United States)

    Hsieh, Ai-Ru; Hsiao, Ching-Lin; Chang, Su-Wei; Wang, Hui-Min; Fann, Cathy S J

    2011-02-01

    Haplotype-based approaches may have greater power than single-locus analyses when the SNPs are in strong linkage disequilibrium with the risk locus. To overcome potential complexities owing to large numbers of haplotypes in genetic studies, we evaluated two data mining approaches, multifactor dimensionality reduction (MDR) and classification and regression tree (CART), with the concept of haplotypes considering their haplotype uncertainty to detect haplotype-haplotype (HH) interactions. In evaluation of performance for detecting HH interactions, MDR had higher power than CART, but MDR gave a slightly higher type I error. Additionally, we performed an HH interaction analysis with a publicly available dataset of Parkinson's disease and confirmed previous findings that the RET proto-oncogene is associated with the disease. In this study, we showed that using HH interaction analysis is possible to assist researchers in gaining more insight into identifying genetic risk factors for complex diseases. Copyright © 2010 Elsevier Inc. All rights reserved.

  20. Lack of association between dopamine-β hydroxylase gene and a history of suicide attempt in schizophrenia: comparison of molecular and statistical haplotype analyses.

    Science.gov (United States)

    Howe, Aaron S; Leung, Tiffany; Bani-Fatemi, Ali; Souza, Renan; Tampakeras, Maria; Zai, Clement; Kennedy, James L; Strauss, John; De Luca, Vincenzo

    2014-06-01

    In the present study, we examined whether there was an association between dopamine-β hydroxylase (DBH) promoter polymorphisms (a 5'-ins/del and a GTn repeats) and a history of suicide attempt in 223 chronic schizophrenia individuals using statistical and molecular analyses. Within the genetic association study design, we compared the statistical haplotype phase with the molecular phase produced by the amplicon size analysis. The two DBH polymorphisms were analysed using the Applied Biosystem 3130 and the statistical analyses were carried out using UNPHASED v.3.1.5 and PHASE v.2.1.1 to determine the haplotype frequencies and infer the phase in each patient. Then, DBH polymorphisms were incorporated into the Haploscore analysis to test the association with a history of suicide attempt. In our sample, 62 individuals had a history of suicide attempt. There was no association between DBH polymorphisms and a history of suicide attempt across the different analytical strategies applied. There was no significant difference between the haplotype frequencies produced by the amplicon size analysis and statistical analytical strategies. However, some of the haplotype pairs inferred in the PHASE analysis were inconsistent with the molecular haplotype size measured by the ABI 3130. The amplicon size analysis proved to be the most accurate method using the haplotype as a possible genetic marker for future testing. Although the results were not significant, further molecular analyses of the DBH gene and other candidate genes can clarify the utility of the molecular phase in psychiatric genetics and personalized medicine.

  1. GSTO1*C/GSTO2*G haplotype is associated with risk of transitional cell carcinoma of urinary bladder.

    Science.gov (United States)

    Djukic, Tatjana; Simic, Tatjana; Radic, Tanja; Matic, Marija; Pljesa-Ercegovac, Marija; Suvakov, Sonja; Coric, Vesna; Pekmezovic, Tatjana; Novakovic, Ivana; Dragicevic, Dejan; Savic-Radojevic, Ana

    2015-04-01

    To clarify the role of genetic polymorphisms of GSTO1 (rs4925) and GSTO2 (rs156697) in individual susceptibility to urinary bladder cancer. Case-control study consisting of 187 patients with histologically confirmed transitional cell carcinoma (TCC) of urinary bladder and 140 age- and gender-matched cancer-free controls was carried out. Genotyping of GSTO1 and GSTO2 was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). We found that carriers of mutant GSTO2*G/G genotype were at increased risk of the development of TCC (OR 2.6, 95% CI 1.2-5.8, p = 0.041), while GSTO1 rs4925 polymorphism was not significantly associated with TCC risk (p = 0.450). According to smoking status, smokers with GSTO2*G/G genotype had significantly higher risk of TCC of urinary bladder (OR 4.3, 95% CI 1.6-11.2, p = 0.003) compared to wild-type carriers with no smoking history. We further analyzed the effects of GSTO1/GSTO2 haplotypes on TCC risk, based on the linkage disequilibrium found for GSTO1 (rs4925) and GSTO2 (rs156697) (D' = 0.309, p = 0.001). The study subjects with GSTO1*C/GSTO2*G (GSTO1 wild-type/GSTO2 mutant) haplotype were at the highest risk of the development of transitional cell carcinoma of urinary bladder (OR 2.8, 95% CI 1.5-5.2, p = 0.002). Our results indicate that GSTO1*C/GSTO2*G haplotype is associated with increased risk of TCC. The modifying effect of GSTO2*G/G genotype on individual susceptibility to TCC is more pronounced, when associated with smoking.

  2. Functional promoter haplotypes of the human FAS gene are associated with the phenotype of SLE characterized by thrombocytopenia

    DEFF Research Database (Denmark)

    Nolsøe, R L; Kelly, J A; Pociot, F

    2005-01-01

    Systemic lupus erythematosus (SLE) is an autoimmune disorder characterized by production of autoantibodies against intracellular antigens and tissue injury. Defective apoptosis of activated immune cells leads to the development of autoantibodies in SLE. FasL initiated apoptosis is central...... for peripheral tolerance. Fas deficiencies in humans and mice predispose toward systemic autoimmunity. SLE is conferred by many genes. The genetic effects may be concentrated by familial clustering or by stratifying of subphenotypes. We have tested polymorphisms and haplotypes in FAS and FASL for association...

  3. Low CD38 expression in lymphoblastoid cells and haplotypes are both associated with autism in a family-based study.

    Science.gov (United States)

    Lerer, Elad; Levi, Shlomit; Israel, Salomon; Yaari, Maya; Nemanov, Lubov; Mankuta, David; Nurit, Yirmiya; Ebstein, Richard P

    2010-12-01

    Impairments in social processes characterize one of the core deficits in autism spectrum disorders (ASD) and accumulating evidence suggests that oxytocin neurotransmission is implicated in mediating social adaptation in ASD. Using a mouse model, CD38, a transmembrane protein expressed in immune cells but also in brain, was found to be critical for social behavior via regulation of oxytocin secretion. This prompted us to both examine CD38 expression in human lymphoblastoid cell lines (LBC) as well as to test association between SNPs across the CD38 gene and ASD. LBC’s were derived from 44 ASD lines and 40 "unaffected" parents. Family-based association (UNPHASED) was examined by genotyping 11 tagging SNPs spanning the CD38 gene identified using HapMap data in 170 trios. An additional SNP (rs3796863) associated in a study by Munesue et al. with ASD was also genotyped. A highly significant reduction in CD38 expression was observed in immortalized lymphocytes derived from ASD subjects compared to their "unaffected" parents (F517.2, P50.00024, df51). Haplotype analysis showed significant association (permutation corrected) between three and seven locus haplotypes and DSM IV ASD in low functioning (IQ connection between oxytocin and ASD.

  4. SNP analyses of growth factor genes EGF, TGFβ-1, and HGF reveal haplotypic association of EGF with autism

    International Nuclear Information System (INIS)

    Toyoda, Takao; Nakamura, Kazuhiko; Yamada, Kazuo; Thanseem, Ismail; Anitha, Ayyappan; Suda, Shiro; Tsujii, Masatsugu; Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Miyachi, Taishi; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Kawai, Masayoshi; Sekine, Yoshimoto; Tsuchiya, Kenji; Sugihara, Gen-ichi; Ouchi, Yasuomi; Sugiyama, Toshiro; Takei, Nori; Yoshikawa, Takeo; Mori, Norio

    2007-01-01

    Autism is a pervasive neurodevelopmental disorder diagnosed in early childhood. Growth factors have been found to play a key role in the cellular differentiation and proliferation of the central and peripheral nervous systems. Epidermal growth factor (EGF) is detected in several regions of the developing and adult brain, where, it enhances the differentiation, maturation, and survival of a variety of neurons. Transforming growth factor-β (TGFβ) isoforms play an important role in neuronal survival, and the hepatocyte growth factor (HGF) has been shown to exhibit neurotrophic activity. We examined the association of EGF, TGFβ1, and HGF genes with autism, in a trio association study, using DNA samples from families recruited to the Autism Genetic Resource Exchange; 252 trios with a male offspring scored for autism were selected for the study. Transmission disequilibrium test revealed significant haplotypic association of EGF with autism. No significant SNP or haplotypic associations were observed for TGFβ1 or HGF. Given the role of EGF in brain and neuronal development, we suggest a possible role of EGF in the pathogenesis of autism

  5. Regression-based approach for testing the association between multi-region haplotype configuration and complex trait

    Directory of Open Access Journals (Sweden)

    Zhao Hongbo

    2009-09-01

    Full Text Available Abstract Background It is quite common that the genetic architecture of complex traits involves many genes and their interactions. Therefore, dealing with multiple unlinked genomic regions simultaneously is desirable. Results In this paper we develop a regression-based approach to assess the interactions of haplotypes that belong to different unlinked regions, and we use score statistics to test the null hypothesis of non-genetic association. Additionally, multiple marker combinations at each unlinked region are considered. The multiple tests are settled via the minP approach. The P value of the "best" multi-region multi-marker configuration is corrected via Monte-Carlo simulations. Through simulation studies, we assess the performance of the proposed approach and demonstrate its validity and power in testing for haplotype interaction association. Conclusion Our simulations showed that, for binary trait without covariates, our proposed methods prove to be equal and even more powerful than htr and hapcc which are part of the FAMHAP program. Additionally, our model can be applied to a wider variety of traits and allow adjustment for other covariates. To test the validity, our methods are applied to analyze the association between four unlinked candidate genes and pig meat quality.

  6. ParaHaplo: A program package for haplotype-based whole-genome association study using parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2009-10-01

    Full Text Available Abstract Background Since more than a million single-nucleotide polymorphisms (SNPs are analyzed in any given genome-wide association study (GWAS, performing multiple comparisons can be problematic. To cope with multiple-comparison problems in GWAS, haplotype-based algorithms were developed to correct for multiple comparisons at multiple SNP loci in linkage disequilibrium. A permutation test can also control problems inherent in multiple testing; however, both the calculation of exact probability and the execution of permutation tests are time-consuming. Faster methods for calculating exact probabilities and executing permutation tests are required. Methods We developed a set of computer programs for the parallel computation of accurate P-values in haplotype-based GWAS. Our program, ParaHaplo, is intended for workstation clusters using the Intel Message Passing Interface (MPI. We compared the performance of our algorithm to that of the regular permutation test on JPT and CHB of HapMap. Results ParaHaplo can detect smaller differences between 2 populations than SNP-based GWAS. We also found that parallel-computing techniques made ParaHaplo 100-fold faster than a non-parallel version of the program. Conclusion ParaHaplo is a useful tool in conducting haplotype-based GWAS. Since the data sizes of such projects continue to increase, the use of fast computations with parallel computing--such as that used in ParaHaplo--will become increasingly important. The executable binaries and program sources of ParaHaplo are available at the following address: http://sourceforge.jp/projects/parallelgwas/?_sl=1

  7. Associations of Haplotypes Upstream of IRS1 with Insulin Resistance, Type 2 Diabetes, Dyslipidemia, Preclinical Atherosclerosis, and Skeletal Muscle LOC646736 mRNA Levels

    Directory of Open Access Journals (Sweden)

    Selma M. Soyal

    2015-01-01

    Full Text Available The genomic region ~500 kb upstream of IRS1 has been implicated in insulin resistance, type 2 diabetes, adverse lipid profile, and cardiovascular risk. To gain further insight into this chromosomal region, we typed four SNPs in a cross-sectional cohort and subjects with type 2 diabetes recruited from the same geographic region. From 16 possible haplotypes, 6 haplotypes with frequencies >0.01 were observed. We identified one haplotype that was protective against insulin resistance (determined by HOMA-IR and fasting plasma insulin levels, type 2 diabetes, an adverse lipid profile, increased C-reactive protein, and asymptomatic atherosclerotic disease (assessed by intima media thickness of the common carotid arteries. BMI and total adipose tissue mass as well as visceral and subcutaneous adipose tissue mass did not differ between the reference and protective haplotypes. In 92 subjects, we observed an association of the protective haplotype with higher skeletal muscle mRNA levels of LOC646736, which is located in the same haplotype block as the informative SNPs and is mainly expressed in skeletal muscle, but only at very low levels in liver or adipose tissues. These data suggest a role for LOC646736 in human insulin resistance and warrant further studies on the functional effects of this locus.

  8. Epitopes recognized by CBV4 responding T cells: effect of type 1 diabetes and associated HLA-DR-DQ haplotypes

    International Nuclear Information System (INIS)

    Marttila, Jane; Hyoety, Heikki; Naentoe-Salonen, Kirsti; Simell, Olli; Ilonen, Jorma

    2004-01-01

    The present study aimed at characterizing the epitopes recognized by coxsackievirus B4 (CBV4)-specific T-cell lines established from 23 children with type 1 diabetes (T1D) and 29 healthy children with T1D risk-associated HLA genotypes. Responsiveness to VP1 region was dependent on the specific infection history as 55% of the T-cell lines from donors with neutralizing antibodies to CBV serotypes responded to VP1 peptides compared to none of the T-cell lines from other donors (P = 0.01). The pattern of recognized peptides was dependent of the HLA genotype. Forty-two percent of the T-cell lines from donors carrying the HLA-(DR4)-DQB1*0302 haplotype responded to VP1 peptides 71-80 compared to none of the T-cell lines from donors without this haplotype (P = 0.02). No evidence for the existence of diabetes-specific epitopes was found. Only few epitopes were exclusive recognized by T cells from diabetic children, and in each case only one or two T-cell lines were responding

  9. A population association study of vitamin D receptor gene polymorphisms and haplotypes with the risk of systemic lupus erythematosus in a Chinese population.

    Science.gov (United States)

    Chen, Xu-E; Chen, Pu; Chen, Shan-Shan; Lu, Jin; Ma, Ting; Shi, Guang; Zhou, Ya; Li, Ji; Sheng, Liang

    2017-06-01

    The aim of the study is to investigate the association of vitamin D receptor (VDR) gene polymorphism, additional gene-gene interaction, and haplotype combination with systemic lupus erythematosus (SLE) risk. Pairwise linkage disequilibrium (LD) analysis was conducted using SNPstats. The association between four SNPs within VDR gene and SLE risk was investigated by logistic regression. Generalized multifactor dimensionality reduction (GMDR) was used to analyze the interaction among four SNPs. Four SNPs within VDR gene were selected for genotyping in this study, including rs2228570, rs1544410, rs7975232, and rs731236. The T allele of rs2228570 and the G allele of the rs1544410 were associated with increased MM risk, adjusted ORs (95%CI) were 1.61(1.25-2.11) and 1.78 (1.34-2.23), respectively. GMDR analysis suggested a significant two-locus model (P = 0.0010) involving rs1544410 and rs2228570, and in this model, the cross-validation consistency was 10/10, and the testing accuracy was 62.70%. The haplotype analysis indicated that the most common haplotype was rs1544410-A and rs7975232-G haplotype, the frequencies of which were 0.4701 and 0.5467 in case and control group. Haplotype containing the rs1544410-G and rs7975232-T alleles were associated with increased SLE risk, OR (95%CI) = 2.08 (1.47-2.72), P risk.

  10. A common haplotype in the G-protein-coupled receptor gene GPR74 is associated with leanness and increased lipolysis

    DEFF Research Database (Denmark)

    Dahlman, Ingrid; Dicker, Andrea; Jiao, Hong

    2007-01-01

    with protection against obesity in two samples selected for obese and lean phenotypes (odds ratio for obesity 0.48 and 0.62; nominal P=.0014 and .014; n=1,013 and 1,423, respectively). In a population-based sample, it was associated with lower waist (P=.02) among 3,937 men and with obesity protection (odds ratio...... 0.36; P=.036) among those selected for obese or lean phenotypes. The ATAG haplotype was associated with increased adipocyte lipid mobilization (lipolysis) in vivo and in vitro. In human fat cells, GPR74 receptor stimulation and inhibition caused a significant and marked decrease and increase...... adipose tissue. The latter involves a cross-talk between GPR74 and beta -adrenoceptor signaling to lipolysis in fat cells....

  11. Establishment of six homozygous MHC-B haplotype populations associated with susceptibility to Marek's disease in Chinese specific pathogen-free BWEL chickens.

    Science.gov (United States)

    Gao, Caixia; Han, Lingxia; Han, Jianlin; Liu, Jiasen; Jiang, Qian; Guo, Dongchun; Qu, Liandong

    2015-01-01

    The highly polymorphic chicken major histocompatibility complex (MHC) is associated with different levels of immunologic responses to certain avian pathogens. MHC-B haplotype chickens are an important genetic resource for studying the genetic determination of pathogen resistance and susceptibility. The BWEL chicken population is the only specific pathogen-free (SPF) chickens bred and developed by the State Center of Poultry Genetic Resources of Laboratory Animals in China. In this study, we successfully established six homozygous MHC-B haplotype populations from the BWEL chickens using microsatellite marker technology, named as BW/G(1, 2, 3, 5, 6, 7) lines, and their molecular genotypes were matched to six serologically defined MHC-B haplotypes, B13, B15, B2, B5, B21 and B19, respectively. The sequences of BF genes exons 2 and 3 from four successive generations (F1-F4) of the BW/G(n) lines were completely consistent with those of serologically defined MHC-B haplotypes. Subsequently, six BW/G(n) line specific allo-antisera were prepared by immunization with red blood cells (RBCs) and hemagglutination tests results showed the BW/G(n) SPF chickens could be serologically differentiated. Additionally, susceptibility to Marek's disease (MD) in the BW/G3 (B2 haplotype) and BW/G7 (B19 haplotype) lines were determined by comparing mortality, macroscopic and histopathological lesions, and viral loads in feather pulp. The BW/G7 line showed greater genetic susceptibility to the very virulent MD virus (MDV) strain than the BW/G3 line. The establishment of MHC-B haplotype chicken populations associated with susceptibility to MD will be helpful for studying host immune responses and further developing the more effective vaccines in the context of MHC specificities, and they are also very useful for an understanding of MHC genes architecture and function. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Methylenetetrahydrofolate reductase genotypes and haplotypes associated with susceptibility to colorectal cancer in an eastern Chinese Han population.

    Science.gov (United States)

    Li, H; Xu, W L; Shen, H L; Chen, Q Y; Hui, L L; Long, L L; Zhu, X L

    2011-12-14

    Methylenetetrahydrofolate reductase (MTHFR) plays an important role in folate metabolism and is involved in DNA synthesis, DNA repair and DNA methylation. The two common functional polymorphisms of MTHFR, C677T and A1298C have been associated with several diseases, including cancer. We made a case-control study to analyze a possible association of MTHFR gene polymorphisms C677T and A1298C with risk for colorectal cancer in an eastern Chinese Han population of 137 patients with a confirmed histopathological diagnosis of CRC and 145 age- and gender-matched controls with no history of cancer. DNA was isolated from peripheral blood samples and the genotypes were determined by PCR-RFLP. The concentrations of folate in plasma were measured by chemiluminescence immunoassay. The MTHFR 677TT genotype had a protective effect against colorectal cancer, with an odds ratio (OR) = 0.467 (95% confidence interval (CI) = 0.225-0.966). The 1298CC genotype was significantly correlated with a reduced risk of colorectal cancer (OR = 0.192; 95%CI = 0.040-0.916). Compared with the MTHFR 677CC and MTHFR 1298 AA genotypes, for individuals who carried both MTHFR 677CC and 1298CC genotypes, the OR of colorectal cancer was 0.103 (95%CI = 0.012-0.900); among individuals who carried both MTHFR 677TT and 1298AC genotypes, the OR for risk of colorectal cancer was 0.169 (95%CI = 0.044-0.654). MTHFR 677TT+CT genotypes had a significantly lower plasma folate concentration than those with the MTHFR 677CC genotype. MTHFR 1298AC+CC genotypes had a lower plasma folate concentration than those with the MTHFR 1298AA genotype (P < 0.05). In conclusion, subjects with the MTHFR 677TT and MTHFR 1298CC genotypes appeared to have a significantly lower risk for colorectal cancer. MTHFR haplotypes 677CC/1298CC and 677TT/1298AC were less common in cases than in controls. These haplotypes, when compared to the most common haplotype 677CC/1298AA, were associated with a decreased risk for colorectal cancer. We

  13. Sudden Bilateral Sensorineural Hearing Loss Associated with HLA A1-B8-DR3 Haplotype

    Directory of Open Access Journals (Sweden)

    G. Psillas

    2013-01-01

    Full Text Available Sudden sensorineural hearing loss may be present as a symptom in systemic autoimmune diseases or may occur as a primary disorder without another organ involvement (autoimmune inner ear disease. The diagnosis of autoimmune inner ear disease is still predicated on clinical features, and to date specific diagnostic tests are not available. We report a case of bilateral sudden hearing loss, tinnitus, intense rotatory vertigo, and nausea in a female patient in which the clinical manifestations, in addition to raised levels of circulating immune complexes, antithyroglobulin antibodies, and the presence of the HLA A1-B8-DR3 haplotype, allowed us to hypothesize an autoimmune inner ear disease. Cyclosporine-A immunosuppressive treatment in addition to steroids helped in hearing recovery that occurred progressively with normalization of the hearing function after a five-month treatment. Cyclosporine-A could be proposed as a therapeutic option in case of autoimmune inner ear disease allowing the suspension of corticosteroids that, at high dose, expose patients to potentially serious adverse events.

  14. Human leucocyte antigens class II allele and haplotype association with Type 1 Diabetes in Madeira Island (Portugal).

    Science.gov (United States)

    Spínola, H; Lemos, A; Couto, A R; Parreira, B; Soares, M; Dutra, I; Bruges-Armas, J; Brehm, A; Abreu, S

    2017-12-01

    This study confirms for Madeira Island (Portugal) population the Type 1 Diabetes (T1D) susceptible and protective Human leucocyte antigens (HLA) markers previously reported in other populations and adds some local specificities. Among the strongest T1D HLA associations, stands out, as susceptible, the alleles DRB1*04:05 (OR = 7.3), DQB1*03:02 (OR = 6.1) and DQA1*03:03 (OR = 4.5), as well as the haplotypes DRB1*04:05-DQA1*03:03-DQB1*03:02 (OR = 100.9) and DRB1*04:04-DQA1*03:01-DQB1*03:02 (OR = 22.1), and DQB1*06:02 (OR = 0.07) and DRB1*15:01-DQA1*01:02-DQB1*06:02 (OR = 0.04) as protective. HLA-DQA1 positive for Arginine at position 52 (Arg52) (OR = 15.2) and HLA-DQB1 negative for Aspartic acid at the position 57 (Asp57) (OR = 9.0) alleles appear to be important genetic markers for T1D susceptibility, with higher odds ratio values than any single allele and than most of the haplotypes. Genotypes generated by the association of markers Arg52 DQA1 positive and Asp57 DQB1 negative increase T1D susceptibility much more than one would expected by a simple additive effect of those markers separately (OR = 26.9). This study also confirms an increased risk for DRB1*04/DRB1*03 heterozygote genotypes (OR = 16.8) and also a DRB1*04-DQA1*03:01-DQB1*03:02 haplotype susceptibility dependent on the DRB1*04 allele (DRB1*04:01, OR = 7.9; DRB1*04:02, OR = 3.2; DRB1*04:04, OR = 22.1). © 2017 John Wiley & Sons Ltd.

  15. Association of RET genetic polymorphisms and haplotypes with papillary thyroid carcinoma in the Portuguese population: a case-control study.

    Directory of Open Access Journals (Sweden)

    Marina Santos

    Full Text Available Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A, L769L (exon 13, rs1800861 T/G, S836S (exon 14, rs1800862 C/T, and S904S (exon 15, rs1800863 C/G. The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC when compared to controls (OR 1.57; 95% CI 1.05-2.35; p = 0.026. The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07-5.91; p = 0.029. No associations were found in follicular thyroid carcinoma (FTC. Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour.

  16. Association of RET Genetic Polymorphisms and Haplotypes with Papillary Thyroid Carcinoma in the Portuguese Population: A Case-Control Study

    Science.gov (United States)

    Santos, Marina; Azevedo, Teresa; Martins, Teresa; Rodrigues, Fernando J.; Lemos, Manuel C.

    2014-01-01

    Thyroid cancer has a multifactorial aetiology resulting from the interaction of genetic and environmental factors. Several low penetrance susceptibility genes have been identified but their effects often vary between different populations. Somatic point mutations and translocations of the REarranged during Transfection (RET) proto-oncogene are frequently found in thyroid cancer. The aim of this case-control study was to determine the effect of four well known RET single nucleotide polymorphisms (SNPs) on the risk for differentiated thyroid carcinoma. A total of 545 Portuguese patients and 543 controls were genotyped by PCR and restriction enzyme analysis, for the following SNPs: G691S (exon 11, rs1799939 G/A), L769L (exon 13, rs1800861 T/G), S836S (exon 14, rs1800862 C/T), and S904S (exon 15, rs1800863 C/G). The minor allele of S836S was overrepresented in patients with papillary thyroid carcinoma (PTC) when compared to controls (OR 1.57; 95% CI 1.05–2.35; p = 0.026). The GGTC haplotype was also overrepresented in PTC (OR 2.51; 95% CI 1.07–5.91; p = 0.029). No associations were found in follicular thyroid carcinoma (FTC). Multivariate logistic regression analysis showed no differences regarding gender, age at diagnosis, lymph node or distant metastasis. However, a near significant overrepresentation of the minor alleles of G691S and S904S was found in patients with tumours greater than 10 mm of diameter at diagnosis. These data suggest that the RET S836S polymorphism in exon 14 and the GGTC haplotype are risk factors for PTC, but not FTC, and that the G691S/S904S polymorphisms might be associated with tumour behaviour. PMID:25330015

  17. ParaHaplo 3.0: A program package for imputation and a haplotype-based whole-genome association study using hybrid parallel computing

    Directory of Open Access Journals (Sweden)

    Kamatani Naoyuki

    2011-05-01

    Full Text Available Abstract Background Use of missing genotype imputations and haplotype reconstructions are valuable in genome-wide association studies (GWASs. By modeling the patterns of linkage disequilibrium in a reference panel, genotypes not directly measured in the study samples can be imputed and used for GWASs. Since millions of single nucleotide polymorphisms need to be imputed in a GWAS, faster methods for genotype imputation and haplotype reconstruction are required. Results We developed a program package for parallel computation of genotype imputation and haplotype reconstruction. Our program package, ParaHaplo 3.0, is intended for use in workstation clusters using the Intel Message Passing Interface. We compared the performance of ParaHaplo 3.0 on the Japanese in Tokyo, Japan and Han Chinese in Beijing, and Chinese in the HapMap dataset. A parallel version of ParaHaplo 3.0 can conduct genotype imputation 20 times faster than a non-parallel version of ParaHaplo. Conclusions ParaHaplo 3.0 is an invaluable tool for conducting haplotype-based GWASs. The need for faster genotype imputation and haplotype reconstruction using parallel computing will become increasingly important as the data sizes of such projects continue to increase. ParaHaplo executable binaries and program sources are available at http://en.sourceforge.jp/projects/parallelgwas/releases/.

  18. [Association of haplotype formed on HLA-DRB1 and HLA-DQA1 alleles with outcomes of hepatitis B virus infection].

    Science.gov (United States)

    Lu, Liang-ping; Li, Xing-wang; Liu, Ying; Sun, Guo-chang; Chen, Zhi-hai; Zhu, Xi-lin; Hu, Quan-you; Li, Hui

    2006-08-01

    To assess the association of haplotype of HLA-DRB1 and HLA-DQA1 alleles with outcomes of hepatitis B virus infection in Han population of north China. Two hundred and seven chronic hepatitis B (HB) patients, two hundred and twelve chronic asymptomatic hepatitis B virus (HBV) carriers (HBV carrier) and one hundred and forty-eight self-limited HBV infection were investigated for HLA-DRB1 and HLA-DQA1 alleles by sequence specific-polymerase chain reaction (PCR-SSP). The frequency of DRB1*04-DQA1*0301 haplotype was 10.03% in self-limited HBV infection subjects, significantly higher than that in chronic HB patients (3.66%) (P=0.0005)ûthe frequency of DRB1*15/*16-DQA1*0102 haplotype was 6.80% in self-limited HBV infection subjects, significantly higher than 1.94% in chronic HB patients (P=0.0012) and 1.65% in asymptomatic HBV carriers (P=0.0004)ûwhile the frequency of DRB1*04-DQA1*0302 haplotype was 3.10% in chronic HB patients, higher than that in self-limited HBV infection subjects (0.39%) (P=0.0077). Individuals with different haplotypes composed of HLA-DRB1 and HLA-DQA1 might have different outcomes of HBV infection.

  19. Haplotypes from the SLC45A2 gene are associated with the presence of freckles and eye, hair and skin pigmentation in Brazil.

    Science.gov (United States)

    Fracasso, Nádia Carolina de Aguiar; de Andrade, Edilene Santos; Wiezel, Cláudia Emília Vieira; Andrade, Claudia Caixeta Franco; Zanão, Lídia Renata; da Silva, Mateus Spinelli; Marano, Leonardo Arduino; Donadi, Eduardo Antônio; C Castelli, Erick; Simões, Aguinaldo Luiz; Mendes-Junior, Celso Teixeira

    2017-03-01

    The Solute Carrier Family 45, Member 2 (SLC45A2) gene encodes the Membrane-Associated Transporter Protein (MATP), which mediates melanin synthesis by tyrosinase trafficking and proton transportation to melanosomes. At least two SLC45A2 coding SNPs [E272K (rs26722) and L374F (rs16891982)] were reported influencing normal variation of human pigmentation. Here we aimed at evaluating the influence of haplotypes of 12 SNPs within SLC45A2 in the determination of eye, hair and skin pigmentation in a highly admixed population sample and comparing their frequencies with the ones found in data retrieved from the 1000 Genomes Project. To achieve this goal, 12 SLC45A2 SNPs were evaluated in 288 unrelated individuals from the Ribeirão Preto city area, Southeastern Brazil. SNPs were genotyped by PCR-RFLP or Allele-specific PCR, followed by polyacrylamide gel electrophoresis. Haplotypes of each individual were inferred by two independent computational methods, PHASE and Partition-Ligation-Expectation-Maximization (PL-EM) algorithms, and 34 different haplotypes were identified. The hp9 haplotype was the most frequent (58.3%) and was associated with the presence of blond/red hair, pale skin, blue eyes and freckles. All haplotypes significantly associated with dark or light pigmentation features harbor the 374L and 374F alleles, respectively. These results emphasize the role played by haplotypes at SLC45A2 in the determination of pigmentation aspects of human populations and reinforce the relevance of SNP L374F in human pigmentation. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. Exploration of haplotype research consortium imputation for genome-wide association studies in 20,032 Generation Scotland participants.

    Science.gov (United States)

    Nagy, Reka; Boutin, Thibaud S; Marten, Jonathan; Huffman, Jennifer E; Kerr, Shona M; Campbell, Archie; Evenden, Louise; Gibson, Jude; Amador, Carmen; Howard, David M; Navarro, Pau; Morris, Andrew; Deary, Ian J; Hocking, Lynne J; Padmanabhan, Sandosh; Smith, Blair H; Joshi, Peter; Wilson, James F; Hastie, Nicholas D; Wright, Alan F; McIntosh, Andrew M; Porteous, David J; Haley, Chris S; Vitart, Veronique; Hayward, Caroline

    2017-03-07

    The Generation Scotland: Scottish Family Health Study (GS:SFHS) is a family-based population cohort with DNA, biological samples, socio-demographic, psychological and clinical data from approximately 24,000 adult volunteers across Scotland. Although data collection was cross-sectional, GS:SFHS became a prospective cohort due to of the ability to link to routine Electronic Health Record (EHR) data. Over 20,000 participants were selected for genotyping using a large genome-wide array. GS:SFHS was analysed using genome-wide association studies (GWAS) to test the effects of a large spectrum of variants, imputed using the Haplotype Research Consortium (HRC) dataset, on medically relevant traits measured directly or obtained from EHRs. The HRC dataset is the largest available haplotype reference panel for imputation of variants in populations of European ancestry and allows investigation of variants with low minor allele frequencies within the entire GS:SFHS genotyped cohort. Genome-wide associations were run on 20,032 individuals using both genotyped and HRC imputed data. We present results for a range of well-studied quantitative traits obtained from clinic visits and for serum urate measures obtained from data linkage to EHRs collected by the Scottish National Health Service. Results replicated known associations and additionally reveal novel findings, mainly with rare variants, validating the use of the HRC imputation panel. For example, we identified two new associations with fasting glucose at variants near to Y_RNA and WDR4 and four new associations with heart rate at SNPs within CSMD1 and ASPH, upstream of HTR1F and between PROKR2 and GPCPD1. All were driven by rare variants (minor allele frequencies in the range of 0.08-1%). Proof of principle for use of EHRs was verification of the highly significant association of urate levels with the well-established urate transporter SLC2A9. GS:SFHS provides genetic data on over 20,000 participants alongside a range of

  1. Haplotypes in the CRP Gene Associated with Increased BMI and Levels of CRP in Subjects with Type 2 Diabetes or Obesity from Southwestern Mexico

    Directory of Open Access Journals (Sweden)

    América Martínez-Calleja

    2012-01-01

    Full Text Available Objective. We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP, type 2 diabetes (T2D, obesity, and risk score of coronary heart disease. Methods. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. Results. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG was associated with increased levels of CRP (β=0.3; 95%CI: 0.1, 0.5; P=0.005 and haplotype 7 (TGGG with higher body mass index (BMI (β=0.2; 95%CI: 0.1, 0.3; P<0.001. The risk score for coronary heart disease was associated with increased levels of CRP, but not with any polymorphism or haplotype. Conclusions. The association between the TT genotype of SNP rs1130864 with obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.

  2. Interaction between a novel TGFB1 haplotype and CFTR genotype is associated with improved lung function in cystic fibrosis.

    Science.gov (United States)

    Bremer, Lindsay A; Blackman, Scott M; Vanscoy, Lori L; McDougal, Kathryn E; Bowers, Amanda; Naughton, Kathleen M; Cutler, David J; Cutting, Garry R

    2008-07-15

    Cystic fibrosis (CF), the most common lethal single gene disorder in Caucasians, is due to mutations in the CFTR gene. Twin and sibling analysis indicates that modifier genes, rather than allelic variation in CFTR, are responsible for most of the variability in severity of lung disease, the major cause of mortality in CF patients. We used a family-based approach to test for association between lung function and two functional SNPs (rs1800469, '-509' and rs1982073, 'codon 10') in the 5' region of transforming growth factor-beta1 (TGFB1), a putative CF modifier gene. Quantitative transmission disequilibrium testing of 472 CF patient-parent-parent trios revealed that both TGFB1 SNPs showed significant transmission distortion when patients were stratified by CFTR genotype. Although lung function and nutritional status are correlated in CF patients, there was no evidence of association between the TGFB1 SNPs and variation in nutritional status. Additional tagging SNPs (rs8179181, rs2278422, rs8110090, rs4803455 and rs1982072) that capture most of the diversity in TGFB1 were also typed but none showed association with variation in lung function. However, a haplotype composed of the -509 C and codon 10 T alleles along with the C allele of the 3' SNP rs8179181 was highly associated with increased lung function in patients grouped by CFTR genotype. These results demonstrate that TGFB1 is a modifier of CF lung disease and reveal a previously unrecognized beneficial effect of TGFB1 variants upon the pulmonary phenotype.

  3. Evaluation of Association Between HLA Class II DR4–DQ8 Haplotype and Type I Diabetes Mellitus in Children of East Azerbaijan State of Iran

    Directory of Open Access Journals (Sweden)

    Nasrin Sohrabi

    2015-04-01

    Full Text Available Purpose: Association between HLA-DR4–DQ8 haplotype and type 1 Diabetes Mellitus (DM-1A was investigated in children of East Azerbaijan state of Iran because such an association has not been previously studied in this population. Methods: HLA-typing was performed by polymerase chain reaction sequence-specific priming. For haplotype analysis, the logistic regression model was performed. Results: Of the three investigated alleles, the frequency of DRB1*0401 was significantly higher among patients compared with that in healthy subjects (76.74% vs. 23.26%. Conclusion: The findings of the current study are consistent with those of previous studies and show that DRB1*0401 is associated with DM-1A; the frequencies of the two other alleles were also higher among patients, although the differences were not statistically significant. Two haplotypes associated with these alleles were also surveyed, and DRB1*0401−-DQA1*0301−, and DRB1*0401−-DQA1*0301−-DQB1*0302− were the most frequent haplotypes among the patient group.

  4. Analysis of HLA-DRB1,DQA1,DQB1 haplotypes in Sardinian centenarians

    Science.gov (United States)

    Scola, Letizia; Lio, Domenico; Candore, Giuseppina; Forte, Giusi I.; Crivello, Antonio; Colonna-Romano, Giuseppina; Pes, Mario G.; Carru, Ciriaco; Ferrucci, Luigi; Deiana, Luca; Baggio, Giovannella; Franceschi, Claudio; Caruso, Calogero

    2009-01-01

    Some genetic determinants of longevity might reside in those polymorphisms for the immune system genes that regulate immune responses. Many longevity association studies focused their attention on HLA (the human MHC) polymorphisms, but discordant results have been obtained. Sardinians are a relatively isolate population and represent a suitable population for association studies. Some HLA-DR and DQ alleles form very stable haplotypes with a strong linkage disequilibrium. In a previous study on Sardinian centenarians we have suggested that HLA-DRB1∗15 allele might be marginally associated to longevity. HLA-DR,DQ haplotypes are in strong linkage disequilibrium and well conserved playing a role in the association to diseases. Hence, we have evaluated, by amplification refractory mutation system/polymerase chain reaction (ARMS-PCR) the HLADQA1 and HLA-DQB1 allele frequencies in 123 centenarians and 92 controls from Sardinia to assess whether the association to HLA-DRB1∗15 allele may be due to the other genes involved in the HLA-DR,DQ haplotypes. The frequencies of HLA-DQA1,DQB1 haplotypes were not significantly modified in centenarians. Nevertheless by evaluating the frequency of DRB1∗15 linked haplotypes, we observed a not significant increase in centenarians of HLA-DQA1∗01,DQB1∗05 and HLA-DQA1∗01,DQB1∗06 haplotypes. These data suggest that these haplotypes might have a role in determining life span expectancy and longevity. PMID:17714903

  5. IL10 GGC haplotype is positively and HLA-DQA1*05-DQB1*02 is negatively associated with radiographic progression in undifferentiated arthritis.

    Science.gov (United States)

    Ursum, Jennie; van der Weijden, Mignon A C; van Schaardenburg, Dirkjan; Prins, Arend P A; Dijkmans, Ben A C; Twisk, Jos W R; Crusius, Jakob B A; van der Horst-Bruinsma, Irene E

    2010-07-01

    In rheumatoid arthritis (RA), many genetic markers, such as the shared-epitope (SE) alleles, are described in association with radiographic progression, but limited data are available on undifferentiated arthritis (UA). We investigated whether single-nucleotide polymorphisms (SNP) and haplotypes in immune response genes and HLA class II alleles are associated with radiographic progression in patients with early UA. Progression of radiographic damage was determined in white Dutch patients with early UA after 2 years of followup. Severe progression was defined as an increase in Sharp/van der Heijde Score > or = 5 points after 2 years of followup. The remainder was classified as mild. These SNP were genotyped by Taqman technology: tumor necrosis factor (TNF) -1031, -863, -857, -308, -238; lymphotoxin-alpha (LTA) +368, +252; interleukin 10 (IL10) -2849, -1082, -819; IL1A -889, IL1B -31, +3953; and IL1RN +2018. Carriage of SE alleles and HLA-DQA1*05-DQB1*02 haplotype was established. These markers were analyzed in relation to radiographic progression. Forty-eight out of 151 patients with early UA had severe radiographic progression. Severe radiographic progression was associated with an increased carrier frequency of SE alleles (OR 5.12, 95% CI 2.0-13.1, p HLA-DQA1*05-DQB1*02 haplotype (OR 0.3, 95% CI, 0.1-0.8, p = 0.013) and with allele TNF -308A (OR 0.4, 95% CI, 0.2-0.9, p = 0.02). The SE and the IL10 GGC haplotype are associated with severe progression of radiographic damage, in contrast to the DQA1*05-DQB1*02 haplotype and the TNF -308A allele, which are associated with mild radiographic progression in early UA.

  6. DRB1*03:01 haplotypes: differential contribution to multiple sclerosis risk and specific association with the presence of intrathecal IgM bands.

    Directory of Open Access Journals (Sweden)

    Emilio G de la Concha

    Full Text Available BACKGROUND: Multiple sclerosis (MS is a multifactorial disease with a genetic basis. The strongest associations with the disease lie in the Human Leukocyte Antigen (HLA region. However, except for the DRB1*15:01 allele, the main risk factor associated to MS so far, no consistent effect has been described for any other variant. One example is HLA-DRB1*03:01, with a heterogeneous effect across populations and studies. We postulate that those discrepancies could be due to differences in the diverse haplotypes bearing that allele. Thus, we aimed at studying the association of DRB1*03:01 with MS susceptibility considering this allele globally and stratified by haplotypes. We also evaluated the association with the presence of oligoclonal IgM bands against myelin lipids (OCMB in cerebrospinal fluid. METHODS: Genotyping of HLA-B, -DRB1 and -DQA1 was performed in 1068 MS patients and 624 ethnically matched healthy controls. One hundred and thirty-nine MS patients were classified according to the presence (M+, 58 patients/absence (M-, 81 patients of OCMB. Comparisons between groups (MS patients vs. controls and M+ vs. M- were performed with the chi-square test or the Fisher exact test. RESULTS: Association of DRB1*03:01 with MS susceptibility was observed but with different haplotypic contribution, being the ancestral haplotype (AH 18.2 the one causing the highest risk. Comparisons between M+, M- and controls showed that the AH 18.2 was affecting only M+ individuals, conferring a risk similar to that caused by DRB1*15:01. CONCLUSIONS: The diverse DRB1*03:01-containing haplotypes contribute with different risk to MS susceptibility. The AH 18.2 causes the highest risk and affects only to individuals showing OCMB.

  7. Haplotype-based association analysis of general cognitive ability in Generation Scotland, the English Longitudinal Study of Ageing, and UK Biobank [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    David M. Howard

    2017-08-01

    Full Text Available Background: Cognitive ability is a heritable trait with a polygenic architecture, for which several associated variants have been identified using genotype-based and candidate gene approaches. Haplotype-based analyses are a complementary technique that take phased genotype data into account, and potentially provide greater statistical power to detect lower frequency variants. Methods: In the present analysis, three cohort studies (ntotal = 48,002 were utilised: Generation Scotland: Scottish Family Health Study (GS:SFHS, the English Longitudinal Study of Ageing (ELSA, and the UK Biobank. A genome-wide haplotype-based meta-analysis of cognitive ability was performed, as well as a targeted meta-analysis of several gene coding regions. Results: None of the assessed haplotypes provided evidence of a statistically significant association with cognitive ability in either the individual cohorts or the meta-analysis. Within the meta-analysis, the haplotype with the lowest observed P-value overlapped with the D-amino acid oxidase activator (DAOA gene coding region. This coding region has previously been associated with bipolar disorder, schizophrenia and Alzheimer’s disease, which have all been shown to impact upon cognitive ability. Another potentially interesting region highlighted within the current genome-wide association analysis (GS:SFHS: P = 4.09 x 10-7, was the butyrylcholinesterase (BCHE gene coding region. The protein encoded by BCHE has been shown to influence the progression of Alzheimer’s disease and its role in cognitive ability merits further investigation. Conclusions: Although no evidence was found for any haplotypes with a statistically significant association with cognitive ability, our results did provide further evidence that the genetic variants contributing to the variance of cognitive ability are likely to be of small effect.

  8. Mapping Haplotype-haplotype Interactions with Adaptive LASSO

    Directory of Open Access Journals (Sweden)

    Li Ming

    2010-08-01

    Full Text Available Abstract Background The genetic etiology of complex diseases in human has been commonly viewed as a complex process involving both genetic and environmental factors functioning in a complicated manner. Quite often the interactions among genetic variants play major roles in determining the susceptibility of an individual to a particular disease. Statistical methods for modeling interactions underlying complex diseases between single genetic variants (e.g. single nucleotide polymorphisms or SNPs have been extensively studied. Recently, haplotype-based analysis has gained its popularity among genetic association studies. When multiple sequence or haplotype interactions are involved in determining an individual's susceptibility to a disease, it presents daunting challenges in statistical modeling and testing of the interaction effects, largely due to the complicated higher order epistatic complexity. Results In this article, we propose a new strategy in modeling haplotype-haplotype interactions under the penalized logistic regression framework with adaptive L1-penalty. We consider interactions of sequence variants between haplotype blocks. The adaptive L1-penalty allows simultaneous effect estimation and variable selection in a single model. We propose a new parameter estimation method which estimates and selects parameters by the modified Gauss-Seidel method nested within the EM algorithm. Simulation studies show that it has low false positive rate and reasonable power in detecting haplotype interactions. The method is applied to test haplotype interactions involved in mother and offspring genome in a small for gestational age (SGA neonates data set, and significant interactions between different genomes are detected. Conclusions As demonstrated by the simulation studies and real data analysis, the approach developed provides an efficient tool for the modeling and testing of haplotype interactions. The implementation of the method in R codes can be

  9. Haplotype analysis of the germacrene A synthase gene and association with cynaropicrin content and biological activities in Cynara cardunculus.

    Science.gov (United States)

    Ferro, Ana Margarida; Ramos, Patrícia; Guerra, Ângela; Parreira, Paula; Brás, Teresa; Guerreiro, Olinda; Jerónimo, Eliana; Capel, Carmen; Capel, Juan; Yuste-Lisbona, Fernando J; Duarte, Maria F; Lozano, Rafael; Oliveira, M Margarida; Gonçalves, Sónia

    2018-04-01

    Cynara cardunculus: L. represents a natural source of terpenic compounds, with the predominant molecule being cynaropicrin. Cynaropicrin is gaining interest since it has been correlated to anti-hyperlipidaemia, antispasmodic and cytotoxicity activity against leukocyte cancer cells. The objective of this work was to screen a collection of C. cardunculus, from different origins, for new allelic variants in germacrene A synthase (GAS) gene involved in the cynaropicrin biosynthesis and correlate them with improved cynaropicrin content and biological activities. Using high-resolution melting, nine haplotypes were identified. The putative impact of the identified allelic variants in GAS protein was evaluated by bioinformatic tools and polymorphisms that putatively lead to protein conformational changes were described. Additionally, cynaropicrin and main pentacyclic triterpenes contents, and antithrombin, antimicrobial and antiproliferative activities were also determined in C. cardunculus leaf lipophilic-derived extracts. In this work we identified allelic variants with putative impact on GAS protein, which are significantly associated with cynaropicrin content and antiproliferative activity. The results obtained suggest that the identified polymorphisms should be explored as putative genetic markers correlated with biological properties in Cynara cardunculus.

  10. Association studies and legume synteny reveal haplotypes determining seed size in Vigna unguiculata

    Directory of Open Access Journals (Sweden)

    Mitchell R Lucas

    2013-04-01

    Full Text Available Highly specific seed market classes for cowpea and other grain legumes exists because grain is most commonly cooked and consumed whole. Size, shape, color, and texture are critical features of these market classes and breeders target development of cultivars for market acceptance. Resistance to biotic and abiotic stresses that are absent from elite breeding material are often introgressed through crosses to landraces or wild relatives. When crosses are made between parents with different grain quality characteristics, recovery of progeny with acceptable or enhanced grain quality is problematic. Thus genetic markers for grain quality traits can help in pyramiding genes needed for specific market classes. Allelic variation dictating the inheritance of seed size can be tagged and used to assist the selection of large-seeded lines. In this work we applied SNP genotyping and knowledge of legume synteny to characterize regions of the cowpea genome associated with seed size. These marker-trait associations will enable breeders to use marker based selection approaches to increase the frequency of progeny with large seed. For ~800 samples derived from eight bi-parental populations, QTL analysis was used to identify markers linked to ten trait determinants. In addition, the population structure of 171 samples from the USDA core collection was identified and incorporated into a genome-wide association study which supported more than half of the trait-associated regions important in the bi-parental populations. Seven of the total ten QTL were supported based on synteny to seed size associated regions identified in the related legume soybean. In addition to delivering markers linked to major trait determinants in the context of modern breeding, we provide an analysis of the diversity of the USDA core collection of cowpea to identify genepools, migrants, admixture, and duplicates.

  11. Association Studies and Legume Synteny Reveal Haplotypes Determining Seed Size in Vigna unguiculata.

    Science.gov (United States)

    Lucas, Mitchell R; Huynh, Bao-Lam; da Silva Vinholes, Patricia; Cisse, Ndiaga; Drabo, Issa; Ehlers, Jeffrey D; Roberts, Philip A; Close, Timothy J

    2013-01-01

    Highly specific seed market classes for cowpea and other grain legumes exist because grain is most commonly cooked and consumed whole. Size, shape, color, and texture are critical features of these market classes and breeders target development of cultivars for market acceptance. Resistance to biotic and abiotic stresses that are absent from elite breeding material are often introgressed through crosses to landraces or wild relatives. When crosses are made between parents with different grain quality characteristics, recovery of progeny with acceptable or enhanced grain quality is problematic. Thus genetic markers for grain quality traits can help in pyramiding genes needed for specific market classes. Allelic variation dictating the inheritance of seed size can be tagged and used to assist the selection of large seeded lines. In this work we applied 1,536-plex SNP genotyping and knowledge of legume synteny to characterize regions of the cowpea genome associated with seed size. These marker-trait associations will enable breeders to use marker-based selection approaches to increase the frequency of progeny with large seed. For 804 individuals derived from eight bi-parental populations, QTL analysis was used to identify markers linked to 10 trait determinants. In addition, the population structure of 171 samples from the USDA core collection was identified and incorporated into a genome-wide association study which supported more than half of the trait-associated regions important in the bi-parental populations. Seven of the total 10 QTLs were supported based on synteny to seed size associated regions identified in the related legume soybean. In addition to delivering markers linked to major trait determinants in the context of modern breeding, we provide an analysis of the diversity of the USDA core collection of cowpea to identify genepools, migrants, admixture, and duplicates.

  12. Linkage and association of haplotypes at the APOA1/C3/A4/A5 genecluster to familial combined hyperlipidemia

    Energy Technology Data Exchange (ETDEWEB)

    Eichenbaum-Voline, Sophie; Olivier, Michael; Jones, Emma L.; Naoumova, Rossitza P.; Jones, Bethan; Gau, Brian; Seed, Mary; Betteridge,D. John; Galton, David J.; Rubin, Edward M.; Scott, James; Shoulders,Carol C.; Pennacchio, Len A.

    2002-09-15

    Combined hyperlipidemia (CHL) is a common disorder of lipidmetabolism that leads to an increased risk of cardiovascular disease. Thelipid profile of CHL is characterised by high levels of atherogeniclipoproteins and low levels of high-density-lipoprotein-cholesterol.Apolipoprotein (APO) A5 is a newly discovered gene involved in lipidmetabolism located within 30kbp of the APOA1/C3/A4 gene cluster. Previousstudies have indicated that sequence variants in this cluster areassociated with increased plasma lipid levels. To establish whethervariation at the APOA5 gene contributes to the transmission of CHL, weperformed linkage and linkage disequilibrium (LD) tests on a large cohortof families (n=128) with familial CHL (FCHL). The linkage data producedevidence for linkage of the APOA1/C3/A4/A5 genomic interval to FCHL (NPL= 1.7, P = 0.042). The LD studies substantiated these data. Twoindependent rare alleles, APOA5c.56G and APOC3c.386G of this gene clusterwere over-transmitted in FCHL (P = 0.004 and 0.007, respectively), andthis was associated with a reduced transmission of the most commonAPOA1/C3/A4/A5 haplotype (frequency 0.4425) to affected subjects (P =0.013). The APOA5c.56G allele was associated with increased plasmatriglyceride levels in FCHL probands, whereas the second, andindependent, APOC3c.386G allele was associated with increased plasmatriglyceride levels in FCHL pedigree founders. Thus, this allele (or anallele in LD) may mark a quantitative trait associated with FCHL, as wellas representing a disease susceptibility locus for the condition. Thisstudy establishes that sequence variation in the APOA1/C3/A4/A5 genecluster contributes to the transmission of FCHL in a substantialproportion of affected families, and that these sequence variants mayalso contribute to the lipid abnormalities of the metabolic syndrome,which is present in up to 40 percent of persons with cardiovasculardisease.

  13. HLA-DQA1*0103-DQB1*0601 haplotype and Helicobacter pylori-positive gastric mucosa-associated lymphoid tissue lymphoma.

    Science.gov (United States)

    Kawahara, Yoshiro; Mizuno, Motowo; Yoshino, Tadashi; Yokota, Kenji; Oguma, Keiji; Okada, Hiroyuki; Fujiki, Shigeatsu; Shiratori, Yasushi

    2005-09-01

    Immune responses to Helicobacter pylori are important in the pathogenesis of gastric mucosa-associated lymphoid tissue (MALT) lymphoma. In this retrospective case study, we investigated whether certain alleles and haplotypes of major histocompatibility complex genes are associated with gastric MALT lymphoma and the efficacy of H pylori eradication therapy on the lymphoma. Blood samples were obtained from 18 patients with H pylori-positive gastric MALT lymphoma (5 men and 13 women; age range, 51-80 years), 30 patients with H pylori-positive non-ulcer dyspepsia (17 men and 13 women; age range, 37-77 years), and 30 patients with H pylori-negative non-ulcer dyspepsia (12 men and 18 women; age range, 37-77 years). HLA-DQA1 and DQB1 allele typing was performed by use of a polymerase chain reaction sequence-specific oligonucleotide procedure. All patients with MALT lymphoma were treated with H pylori eradication therapy and followed up by repeated endoscopy and biopsy. We found a significant increase in alleles HLA-DQA1*0103 and HLA-DQB1*0601, and a haplotype DQA1*0103-DQB1*0601, in MALT lymphoma patients when compared with non-ulcer dyspepsia patients who were either H pylori-positive or not and with a healthy control population. After H pylori eradication, the lymphomas regressed completely in all 10 patients who possessed the DQA1*0103-DQB1*0601 haplotype but in only 4 of the 8 without this haplotype (P = .023). DQA1*0103-DQB1*0601 haplotype-positive gastric MALT lymphoma is likely to respond to therapy by eradication of H pylori.

  14. In Vivo Characterization of Human APOA5 Haplotypes

    Energy Technology Data Exchange (ETDEWEB)

    Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey; Fruchart, Jamila; Pennacchio, Len A.

    2006-10-01

    Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allele (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.

  15. Haplotype block partitioning as a tool for dimensionality reduction in SNP association studies.

    Science.gov (United States)

    Pattaro, Cristian; Ruczinski, Ingo; Fallin, Danièle M; Parmigiani, Giovanni

    2008-08-29

    Identification of disease-related genes in association studies is challenged by the large number of SNPs typed. To address the dilution of power caused by high dimensionality, and to generate results that are biologically interpretable, it is critical to take into consideration spatial correlation of SNPs along the genome. With the goal of identifying true genetic associations, partitioning the genome according to spatial correlation can be a powerful and meaningful way to address this dimensionality problem. We developed and validated an MCMC Algorithm To Identify blocks of Linkage DisEquilibrium (MATILDE) for clustering contiguous SNPs, and a statistical testing framework to detect association using partitions as units of analysis. We compared its ability to detect true SNP associations to that of the most commonly used algorithm for block partitioning, as implemented in the Haploview and HapBlock software. Simulations were based on artificially assigning phenotypes to individuals with SNPs corresponding to region 14q11 of the HapMap database. When block partitioning is performed using MATILDE, the ability to correctly identify a disease SNP is higher, especially for small effects, than it is with the alternatives considered. Advantages can be both in terms of true positive findings and limiting the number of false discoveries. Finer partitions provided by LD-based methods or by marker-by-marker analysis are efficient only for detecting big effects, or in presence of large sample sizes. The probabilistic approach we propose offers several additional advantages, including: a) adapting the estimation of blocks to the population, technology, and sample size of the study; b) probabilistic assessment of uncertainty about block boundaries and about whether any two SNPs are in the same block; c) user selection of the probability threshold for assigning SNPs to the same block. We demonstrate that, in realistic scenarios, our adaptive, study-specific block partitioning

  16. Genome-Wide Association Study among Four Horse Breeds Identifies a Common Haplotype Associated with In Vitro CD3+ T Cell Susceptibility/Resistance to Equine Arteritis Virus Infection ▿

    Science.gov (United States)

    Go, Yun Young; Bailey, Ernest; Cook, Deborah G.; Coleman, Stephen J.; MacLeod, James N.; Chen, Kuey-Chu; Timoney, Peter J.; Balasuriya, Udeni B. R.

    2011-01-01

    Previously, we have shown that horses could be divided into susceptible and resistant groups based on an in vitro assay using dual-color flow cytometric analysis of CD3+ T cells infected with equine arteritis virus (EAV). Here, we demonstrate that the differences in in vitro susceptibility of equine CD3+ T lymphocytes to EAV infection have a genetic basis. To investigate the possible hereditary basis for this trait, we conducted a genome-wide association study (GWAS) to compare susceptible and resistant phenotypes. Testing of 267 DNA samples from four horse breeds that had a susceptible or a resistant CD3+ T lymphocyte phenotype using both Illumina Equine SNP50 BeadChip and Sequenom's MassARRAY system identified a common, genetically dominant haplotype associated with the susceptible phenotype in a region of equine chromosome 11 (ECA11), positions 49572804 to 49643932. The presence of a common haplotype indicates that the trait occurred in a common ancestor of all four breeds, suggesting that it may be segregated among other modern horse breeds. Biological pathway analysis revealed several cellular genes within this region of ECA11 encoding proteins associated with virus attachment and entry, cytoskeletal organization, and NF-κB pathways that may be associated with the trait responsible for the in vitro susceptibility/resistance of CD3+ T lymphocytes to EAV infection. The data presented in this study demonstrated a strong association of genetic markers with the trait, representing de facto proof that the trait is under genetic control. To our knowledge, this is the first GWAS of an equine infectious disease and the first GWAS of equine viral arteritis. PMID:21994447

  17. CYP19 Genetic Polymorphism Haplotype AASA Is Associated with a Poor Prognosis in Premenopausal Women with Lymph Node-Negative, Hormone Receptor-Positive Breast Cancer

    Directory of Open Access Journals (Sweden)

    Sung-Hsin Kuo

    2013-01-01

    Full Text Available Given the critical role of CYP19 in estrogen synthesis, we investigated the influence of CYP19 gene polymorphisms on the clinical outcome of lymph node- (LN- negative, hormone receptor- (HR- positive early breast cancers. Genotyping for the CYP19 polymorphisms rs4646 (A/C, rs1065779 (A/C, CYP19 (TTTAn (short allele/long (S/L allele using the 7 TTTA repeat polymorphism as the cut-off, and rs1870050 (A/C was performed on 296 patients with LN-negative, HR-positive breast cancers. All patients received adjuvant hormonal therapy. Associations were examined between these 4 genotypes and 6 common haplotypes of CYP19 and distant disease-free survival (DDFS, disease-free survival (DFS, and overall survival (OS. Patients were divided into the 6 subhaplotypes of CCLA (41.1%, AASA (17.1%, CASA (11.9%, CCLC (8.9%, CCSA (7.5%, AASC (8.9%, and others (4.6%. In premenopausal patients, haplotype AASA was significantly associated with a poor DDFS (adjusted hazard ratio (aHR, 3.3; P=0.001, DFS (aHR, 2.5; P=0.0008, and OS (aHR, 2.9; P=0.0004 after adjusting for age, tumor size, tumor grade, estrogen receptor status, progesterone receptor status, chemotherapy, pathology, adjuvant hormone therapy, menopausal status, and radiotherapy. Furthermore, haplotype AASA remained a negative prognostic factor for premenopausal patients receiving adjuvant chemotherapy in terms of DDFS (aHR, 4.5; P=0.0005, DFS (HR, 3.2; P=0.003, and OS (HR, 6.4; P=0.0009. However, in postmenopausal patients, haplotype AASA was not associated with a poor prognosis, whereas the AASC haplotype was significantly associated with a poor DFS (aHR, 3.1; P=0.03 and OS (aHR, 4.4; P=0.01. Our results indicate that, in patients with LN-negative, HR-positive breast cancers, genetic polymorphism haplotype AASA is associated with poor survival of premenopausal women but does not affect survival of postmenopausal women.

  18. Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia

    Directory of Open Access Journals (Sweden)

    Cristian Fong

    2013-01-01

    Full Text Available Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS and sickle cell hemoglobin trait (HbAS in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

  19. Differential effect of disease-associated ST8SIA2 haplotype on cerebral white matter diffusion properties in schizophrenia and healthy controls.

    Science.gov (United States)

    Fullerton, Janice M; Klauser, Paul; Lenroot, Rhoshel K; Shaw, Alex D; Overs, Bronwyn; Heath, Anna; Cairns, Murray J; Atkins, Joshua; Scott, Rodney; Schofield, Peter R; Weickert, Cyndi Shannon; Pantelis, Christos; Fornito, Alex; Whitford, Thomas J; Weickert, Thomas W; Zalesky, Andrew

    2018-01-22

    Brain white matter abnormalities are evident in individuals with schizophrenia, and also their first-degree relatives, suggesting that some alterations may relate to underlying genetic risk. The ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 (ST8SIA2) gene, which encodes the alpha-2,8-sialyltransferase 8B enzyme that aids neuronal migration and synaptic plasticity, was previously implicated as a schizophrenia susceptibility gene. This study examined the extent to which specific haplotypes in ST8SIA2 influence white matter microstructure using diffusion-weighted imaging of individuals with schizophrenia (n = 281) and healthy controls (n = 172), recruited across five Australian sites. Interactions between diagnostic status and the number of haplotype copies (0 or ≥1) were tested across all white matter voxels with cluster-based statistics. Fractional anisotropy (FA) in the right parietal lobe was found to show a significant interaction between diagnosis and ST8SIA2 protective haplotype (p matter fiber tracking revealed that the region-of-interest was traversed by portions of the superior longitudinal fasciculus, corona radiata, and posterior limb of internal capsule. Post hoc analysis revealed that reduced FA in this regional juncture correlated with reduced IQ in people with schizophrenia. The ST8SIA2 risk haplotype copy number did not show any differential effects on white matter. This study provides a link between a common disease-associated haplotype and specific changes in white matter microstructure, which may relate to resilience or risk for mental illness, providing further compelling evidence for involvement of ST8SIA2 in the pathophysiology of schizophrenia.

  20. Gender-specific association of methylenetetrahydrofolate reductase genotype and haplotype with the aggressiveness and prognosis of clear cell renal cell carcinoma in Japanese patients.

    Science.gov (United States)

    Sakano, Shigeru; Hinoda, Yuji; Okayama, Naoko; Kawai, Yoshihisa; Ito, Hideaki; Nagao, Kazuhiro; Hara, Takahiko; Matsuyama, Hideyasu

    2010-08-01

    To determine if the two common polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect tumour aggressiveness or prognosis of clear cell renal cell carcinoma (CCRCC) in Japanese patients. MTHFR C677T and A1298C polymorphisms have been reported to cause decreased enzyme activity, which reduces the quantity of methyl groups available for DNA methylation and leads to mis-incorporation of uracil into DNA, resulting in single-strand DNA breaks. These effects might induce the accumulation of several genetic changes, leading to the development and progression of CCRCC. Therefore, we investigated the associations between MTHFR genotypes and haplotypes and the clinicopathological characteristics and survival rates in 240 Japanese patients with histopathologically confirmed CCRCC. MTHFR C677T and A1298C were genotyped and haplotypes were analysed using appropriate software. The variant genotypes of MTHFR A1298C were significantly associated with some advanced characteristics of CCRCC in all patients, and these associations were stronger among men. However, among women, the variant genotypes of MTHFR C677T were associated with some advanced characteristics of CCRCC and the C677T variant genotypes or the 677T-1298A haplotype was significantly associated with decreased overall survival (P = 0.007 and P = 0.009, respectively). To our knowledge, this is the first report on the association between MTHFR polymorphisms and CCRCC aggressiveness or prognosis. These results suggest that the MTHFR genotypes and haplotype might be useful, in a gender-specific manner, as predictive factors for the clinical course of CCRCC. Furthermore, these findings will contribute to the understanding of the mechanisms underlying CCRCC progression.

  1. A haplotype of the norepinephrine transporter gene (SLC6A2) is associated with visual memory in attention-deficit/hyperactivity disorder.

    Science.gov (United States)

    Shang, Chi-Yung; Chiang, Huey-Ling; Gau, Susan Shur-Fen

    2015-04-03

    Attention-deficit/hyperactivity disorder (ADHD) is a common heritable childhood-onset psychiatric disorder with impaired visual memory. Based on the evidence from treatment effect of atomoxetine, which interacts directly with the norepinephrine transporter, on visual memory in children with ADHD, this study examined the linkage disequilibrium structure of the norepinephrine transporter gene (SLC6A2) and the association between SLC6A2 and ADHD and visual memory, a promising endophenotype for ADHD. This family-based association sample consisted of 382 probands with DSM-IV ADHD and their family members (n=1298 in total) of Han Chinese in Taiwan. Visual memory was assessed by the Pattern Recognition Memory (PRM) and Spatial Recognition Memory (SRM) tasks of the Cambridge Neuropsychological Test Automated Battery (CANTAB). We screened 21 polymorphisms across SLC6A2 and used the Family-Based Association Test (FBAT) to test the associations of SLC6A2 polymorphisms with ADHD and the PRM and SRM measures. In haplotype analyses, a haplotype rs36011 (T)/rs1566652 (G) was significantly associated with ADHD (minimal p=0.045) after adjustment for multiple testing. In quantitative analyses, this TG haplotype also demonstrated significant associations with visual memory measures, including mean latency of correct responses in PRM (minimal p=0.019), total correct responses in PRM (minimal p=0.018), and total correct responses in SRM (minimal p=0.015). Our novel finding of the haplotype rs36011 (T)/rs1566652 (G) as a novel genetic marker involved in both ADHD disease susceptibility and visual memory suggests that allelic variations in SLC6A2 could provide insight into the pathways leading from genotype to phenotype of ADHD. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Association of adiponectin gene polymorphism with adiponectin levels and risk for insulin resistance syndrome

    Directory of Open Access Journals (Sweden)

    Jai Prakash

    2015-01-01

    Conclusions: We observed the very strong association of the adiponectin 45-276 genotypes and haplotypes with adiponectin levels in healthy north Indian population and TG haplotypes also associated with metabolic parameters of the IR syndrome.

  3. The DQB1 *03:02 HLA haplotype is associated with increased risk of chronic pain after inguinal hernia surgery and lumbar disc herniation.

    Science.gov (United States)

    Dominguez, Cecilia A; Kalliomäki, Maija; Gunnarsson, Ulf; Moen, Aurora; Sandblom, Gabriel; Kockum, Ingrid; Lavant, Ewa; Olsson, Tomas; Nyberg, Fred; Rygh, Lars Jørgen; Røe, Cecilie; Gjerstad, Johannes; Gordh, Torsten; Piehl, Fredrik

    2013-03-01

    Neuropathic pain conditions are common after nerve injuries and are suggested to be regulated in part by genetic factors. We have previously demonstrated a strong genetic influence of the rat major histocompatibility complex on development of neuropathic pain behavior after peripheral nerve injury. In order to study if the corresponding human leukocyte antigen complex (HLA) also influences susceptibility to pain, we performed an association study in patients that had undergone surgery for inguinal hernia (n=189). One group had developed a chronic pain state following the surgical procedure, while the control group had undergone the same type of operation, without any persistent pain. HLA DRB1genotyping revealed a significantly increased proportion of patients in the pain group carrying DRB1*04 compared to patients in the pain-free group. Additional typing of the DQB1 gene further strengthened the association; carriers of the DQB1*03:02 allele together with DRB1*04 displayed an increased risk of postsurgery pain with an odds risk of 3.16 (1.61-6.22) compared to noncarriers. This finding was subsequently replicated in the clinical material of patients with lumbar disc herniation (n=258), where carriers of the DQB1*03:02 allele displayed a slower recovery and increased pain. In conclusion, we here for the first time demonstrate that there is an HLA-dependent risk of developing pain after surgery or lumbar disc herniation; mediated by the DRB1*04 - DQB1*03:02 haplotype. Further experimental and clinical studies are needed to fine-map the HLA effect and to address underlying mechanisms. Copyright © 2012 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  4. Elite Haplotypes of a Protein Kinase GeneTaSnRK2.3Associated with Important Agronomic Traits in Common Wheat.

    Science.gov (United States)

    Miao, Lili; Mao, Xinguo; Wang, Jingyi; Liu, Zicheng; Zhang, Bin; Li, Weiyu; Chang, Xiaoping; Reynolds, Matthew; Wang, Zhenhua; Jing, Ruilian

    2017-01-01

    Plant-specific protein kinase SnRK2s play crucial roles in response to various environmental stimuli. TaSnRK2.3 , a SnRK2 member, was involved in the response to multiple abiotic stresses in wheat. To facilitate the use of TaSnRK2.3 in wheat breeding, the three genomic sequences of TaSnRK2.3 , originating from the A, B, and D genomes of hexaploid wheat, were obtained. Sequence polymorphism assays showing 4 and 10 variations were detected at TaSnRK2.3-1A and at TaSnRK2.3-1B , respectively, yet no variation was identified at TaSnRK2.3-1D . Three haplotypes for A genome, and two main haplotypes for B genome of TaSnRK2.3 were identified in 32 genotypes. Functional markers (2.3AM1, 2.3AM2, 2.3BM1, 2.3BM2) were successfully developed to distinguish different haplotypes. Association analysis was performed with the general linear model in TASSEL 2.1. The results showed that both TaSnRK2.3-1A and TaSnRK2.3-1B were significantly associated with plant height (PH), length of peduncle and penultimate node, as well as 1,000-grain weight (TGW) under different environments. Additionally, TaSnRK2.3-1B was significantly associated with stem water-soluble carbohydrates at flowering and mid-grain filling stages. Hap -1A-1 had higher TGW and lower PH; Hap -1B-1 had higher TGW and stem water-soluble carbohydrates, as well as lower PH, thus the two haplotypes were considered as elite haplotypes. Geographic distribution and allelic frequencies indicated that the two preferred haplotypes Hap -1A-1 and Hap -1B-1 were positively selected in the process of Chinese wheat breeding. These results could be valuable for genetic improvement and germplasm enhancement using molecular marker assisted selection in wheat breeding.

  5. Type 2 diabetes associated variants of KCNQ1 strongly confer the risk of cardiovascular disease among the Saudi Arabian population

    Directory of Open Access Journals (Sweden)

    Maha S. Al-Shammari

    2017-08-01

    Full Text Available Abstract Genome-wide association studies have identified several loci associated with an increased risk for cardiovascular disease (CVD and type 2 diabetes (T2D. Polymorphisms within the KCNQ1 (potassium voltage-gated channel, KQT-like subfamily, member 1 gene are consistently associated with T2D in a number of populations. The current study was undertaken to evaluate the association of 3 polymorphisms of KCNQ1 (rs2237892, rs151290 and rs2237895 with T2D and/or CVD. Patients diagnosed with either T2D (320 patients, CVD (250 patients or both (60 patients and 516 healthy controls were genotyped by TaqMan assay run on a real time PCR thermocycler. A statistically significant association was found for SNPs rs151290 (OR = 1.76; 95%CI = 1.02-3.05; p = 0.0435 and rs2237895 (OR = 2.49; 95%CI = 1.72-3.61; p < 0.0001 with CVD. SNP rs151290 (OR = 7.43; 95%CI = 1.00-55.22; p = 0.0499 showed a strong association in patients with both T2D and CVD. None of the SNPs showed any significant association with T2D. Haploview analysis showed that the ACC (rs151290, rs2237892 and rs2237895 haplotype is the most significant risk allele combination for CVD, while CCA is the most significant risk haplotype for co-morbidity with T2D. KCNQ1 polymorphism at SNPs rs151290 and rs2237895 is strongly associated with CVD in this population, but presented no association with T2D.

  6. Evolutionary history of DLA class II haplotypes in canine diabetes mellitus through single nucleotide polymorphism genotyping.

    Science.gov (United States)

    Seddon, J M; Berggren, K T; Fleeman, L M

    2010-03-01

    Strong linkage disequilibrium (LD) is a characteristic of the major histocompatibility complex (MHC) region, as well as the genome in general in dogs as a consequence of demographic changes with domestication. Disease association studies of MHC haplotypes may be affected by high LD and the resultant shared genetic backgrounds of haplotypes giving associations with linked but non-causative mutations, and also by convergent haplotypes, in which combinations of alleles have arisen independently. This study provides preliminary tools for dog leukocyte antigen (DLA) class II haplotype analysis with 102 single nucleotide polymorphisms (SNPs) identified in 14.6 kb and genotyping of 20 of these SNPs to tag haplotypes in 60 dogs with diabetes mellitus and in 49 non-diabetic dogs. The pattern of LD and analysis of SNP patterns indicated combinations of exon 2 alleles have arisen through both recombination and convergence. For exon 2 haplotypes associated with susceptibility or protection from diabetes mellitus, a region of fixed differences in SNPs across the DQ region was observed, suggesting a region outside exon 2 may be implicated in disease association. Four new DQB1 promoter alleles restricted to diabetic dogs were identified, as well as a substitution difference in the X1 box of the DQB1 promoter that will potentially modify the effect of the protective haplotypes within diabetic dogs.

  7. Linkage disequilibrium with HLA-DRB1-DQB1 haplotypes explains the association of TNF-308G>A variant with type 1 diabetes in a Brazilian cohort.

    Science.gov (United States)

    Patente, Thiago A; Monteiro, Maria B; Vieira, Suzana M; Rossi da Silva, Maria E; Nery, Márcia; Queiroz, Márcia; Azevedo, Mirela J; Canani, Luis H; Parisi, Maria C; Pavin, Elizabeth J; Mainardi, Débora; Javor, Juraj; Velho, Gilberto; Coimbra, Cássio N; Corrêa-Giannella, Maria Lúcia

    2015-08-15

    A functional variant in the promoter region of the gene encoding tumor necrosis factor (TNF; rs1800629, -308G>A) showed to confer susceptibility to T1D. However, TNF rs1800629 was found, in several populations, to be in linkage disequilibrium with HLA susceptibility haplotypes to T1D. We evaluated the association of TNF rs1800629 with T1D in a cohort of Brazilian subjects, and assessed the impact of HLA susceptibility haplotypes in this association. 659 subjects with T1D and 539 control subjects were genotyped for TNF-308G>A variant. HLA-DRB1 and HLA-DQB1 genes were genotyped in a subset of 313 subjects with T1D and 139 control subjects. Associations with T1D were observed for the A-allele of rs1800629 (OR 1.69, 95% CI 1.33-2.15, p<0.0001, in a codominant model) and for 3 HLA haplotypes: DRB1*03:01-DQB1*02:01 (OR 5.37, 95% CI 3.23-8.59, p<0.0001), DRB1*04:01-DQB1*03:02 (OR 2.95, 95% CI 1.21-7.21, p=0.01) and DRB1*04:02-DQB1*03:02 (OR 2.14, 95% CI 1.02-4.50, p=0.04). Linkage disequilibrium was observed between TNF rs1800629 and HLA-DRB1 and HLA-DQB1 alleles. In a stepwise regression analysis HLA haplotypes, but not TNF rs1800629, remained independently associated with T1D. Our results do not support an independent effect of allelic variations of TNF in the genetic susceptibility to T1D. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Association of kinase insert domain-containing receptor (KDR gene polymorphism/ haplotypes with recurrent spontaneous abortion and genetic structure

    Directory of Open Access Journals (Sweden)

    Shiva Shahsavari

    2015-12-01

    Full Text Available Background: Recurrent spontaneous abortion is one of the diseases that can lead to physical, psychological, and, economical problems for both individuals and society. Recently a few numbers of genetic polymorphisms in kinase insert domain-containing receptor (KDR gene are examined that can endanger the life of the fetus in pregnant women. Objective: The risk of KDR gene polymorphisms was investigated in Iranian women with idiopathic recurrent spontaneous abortion (RSA. Materials and Methods: A case controlled study was performed. One hundred idiopathic recurrent spontaneous abortion patients with at least two consecutive pregnancy losses before 20 weeks of gestational age with normal karyotypes were included in the study. Also, 100 healthy women with at least one natural pregnancy were studied as control group. Two functional SNPs located in KDR gene; rs1870377 (Q472H, and rs2305948 (V297I as well as one tag SNP in the intron region (rs6838752 were genotyped by using PCR based restriction fragment length polymorphism (PCR-RFLP technique. Haplotype frequency was determined for these three SNPs’ genotypes. Analysis of genetic STRUCTURE and K means clustering were performed to study genetic variation. Results: Functional SNP (rs1870377 was highly linked to tag SNP (rs6838752 (D´ value=0. 214; χ2 = 16.44, p<0. 001. K means clustering showed that k = 8 as the best fit for the optimal number of genetic subgroups in our studied materials. This result was in agreement with Neighbor Joining cluster analysis. Conclusion: In our study, the allele and genotype frequencies were not associated with RSA between patient and control individuals. Inconsistent results in different populations with different allele frequencies among RSA patients and controls may be due to ethnic variation and used sample size.

  9. Haplotypes in the CRP gene associated with increased BMI and levels of CRP in subjects with type 2 diabetes or obesity from Southwestern Mexico.

    Science.gov (United States)

    Martínez-Calleja, América; Quiróz-Vargas, Irma; Parra-Rojas, Isela; Muñoz-Valle, José Francisco; Leyva-Vázquez, Marco A; Fernández-Tilapa, Gloria; Vences-Velázquez, Amalia; Cruz, Miguel; Salazar-Martínez, Eduardo; Flores-Alfaro, Eugenia

    2012-01-01

    We evaluated the association between four polymorphisms in the CRP gene with circulating levels of C-reactive protein (CRP), type 2 diabetes (T2D), obesity, and risk score of coronary heart disease. We studied 402 individuals and classified them into four groups: healthy, obese, T2D obese, and T2D without obesity, from Guerrero, Southwestern Mexico. Blood levels of CRP, glucose, cholesterol, triglycerides, and leukocytes were measured. Genotyping was performed by PCR/RFLP, and the risk score for coronary heart disease was determined by the Framingham's methodology. The TT genotype of SNP rs1130864 was associated with increased body mass index and T2D patients with obesity. We found that the haplotype 2 (TGAG) was associated with increased levels of CRP (β = 0.3; 95%CI: 0.1, 0.5; P = 0.005) and haplotype 7 (TGGG) with higher body mass index (BMI) (β = 0.2; 95%CI: 0.1, 0.3; P obesity and the haplotype 7 with BMI may explain how obesity and genetic predisposition increase the risk of diseases such as T2D in the population of Southwestern Mexico.

  10. DNA polymorphisms and haplotype patterns of transcription factors involved in barley endosperm development are associated with key agronomic traits

    Directory of Open Access Journals (Sweden)

    Stracke Silke

    2010-01-01

    Full Text Available Abstract Background Association mapping is receiving considerable attention in plant genetics for its potential to fine map quantitative trait loci (QTL, validate candidate genes, and identify alleles of interest. In the present study association mapping in barley (Hordeum vulgare L. is investigated by associating DNA polymorphisms with variation in grain quality traits, plant height, and flowering time to gain further understanding of gene functions involved in the control of these traits. We focused on the four loci BLZ1, BLZ2, BPBF and HvGAMYB that play a role in the regulation of B-hordein expression, the major fraction of the barley storage protein. The association was tested in a collection of 224 spring barley accessions using a two-stage mixed model approach. Results Within the sequenced fragments of four candidate genes we observed different levels of nucleotide diversity. The effect of selection on the candidate genes was tested by Tajima's D which revealed significant values for BLZ1, BLZ2, and BPBF in the subset of two-rowed barleys. Pair-wise LD estimates between the detected SNPs within each candidate gene revealed different intra-genic linkage patterns. On the basis of a more extensive examination of genomic regions surrounding the four candidate genes we found a sharp decrease of LD (r2 Significant marker-trait associations between SNP sites within BLZ1 and flowering time, BPBF and crude protein content and BPBF and starch content were detected. Most haplotypes occurred at frequencies BPBF was associated to crude protein content and starch content, BLZ2 showed association to thousand-grain weight and BLZ1 was found to be associated with flowering time and plant height. Conclusions Differences in nucleotide diversity and LD pattern within the candidate genes BLZ1, BLZ2, BPBF, and HvGAMYB reflect the impact of selection on the nucleotide sequence of the four candidate loci. Despite significant associations, the analysed candidate

  11. Haplotype diversity of VvTFL1A gene and association with cluster traits in grapevine (V. vinifera).

    Science.gov (United States)

    Fernandez, Lucie; Le Cunff, Loïc; Tello, Javier; Lacombe, Thierry; Boursiquot, Jean Michel; Fournier-Level, Alexandre; Bravo, Gema; Lalet, Sandrine; Torregrosa, Laurent; This, Patrice; Martinez-Zapater, José Miguel

    2014-08-05

    Interaction between TERMINAL FLOWER 1 (TFL1) and LEAFY (LFY) seem to determine the inflorescence architecture in Arabidopsis. In a parallel way, overexpression of VvTFL1A, a grapevine TFL1 homolog, causes delayed flowering and production of a ramose cluster in the reiterated reproductive meristem (RRM) somatic variant of cultivar Carignan. To analyze the possible contribution of this gene to cluster phenotypic variation in a diversity panel of cultivated grapevine (Vitis vinifera L. subsp. vinifera) its nucleotide diversity was characterized and association analyses among detected sequence polymorphisms and phenology and cluster traits was carried out. A total of 3.6 kb of the VvTFL1A gene, including its promoter, was sequenced in a core collection of 140 individuals designed to maximize phenotypic variation at agronomical relevant traits. Nucleotide variation for VvTFL1A within this collection was higher in the promoter and intron sequences than in the exon regions; where few polymorphisms were located in agreement with a high conservation of coding sequence. Characterization of the VvTFL1A haplotype network identified three major haplogroups, consistent with the geographic origins and the use of the cultivars that could correspond to three major ancestral alleles or evolutionary branches, based on the existence of mutations in linkage disequilibrium. Genetic association studies with cluster traits revealed the presence of major INDEL polymorphisms, explaining 16%, 13% and 25% of flowering time, cluster width and berry weight, respectively, and also structuring the three haplogroups. At least three major VvTFL1A haplogroups are present in cultivated grapevines, which are defined by the presence of three main polymorphism LD blocks and associated to characteristic phenotypic values for flowering time, cluster width and berry size. Phenotypic differences between haplogroups are consistent with differences observed between Eastern and Western grapevine cultivars and

  12. KIR haplotypes defined by segregation analysis in 59 Centre d'Etude Polymorphisme Humain (CEPH) families.

    Science.gov (United States)

    Martin, M P; Single, R M; Wilson, M J; Trowsdale, J; Carrington, M

    2008-12-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity. Variation at the locus is associated with an increasing number of human diseases, reminiscent of the HLA loci. Characterization of diversity at the KIR locus has progressed over the past several years, particularly since the sequence of entire KIR haplotypes have become available. To determine the extent of KIR haplotypic variability among individuals of northern European descent, we genotyped 59 CEPH families for presence/absence of all KIR genes and performed limited allelic subtyping at several KIR loci. A total of 20 unique haplotypes differing in gene content were identified, the most common of which was the previously defined A haplotype (f = 0.52). Several unusual haplotypes that probably arose as a consequence of unequal crossing over events were also identified. Linkage disequilibrium (LD) analysis indicated strong negative and positive LD between several pairs of genes, values that may be useful in determining haplotypic structure when family data are not available. These data provide a resource to aid in the interpretation of disease association data involving individuals of European descent.

  13. KIR haplotypes defined by segregation analysis in 59 Centre d’Etude Polymorphisme Humain (CEPH) families

    Science.gov (United States)

    Martin, M. P.; Single, R. M.; Wilson, M. J.; Trowsdale, J.

    2012-01-01

    The killer cell immunoglobulin-like receptor (KIR) gene cluster exhibits extensive allelic and haplotypic diversity. Variation at the locus is associated with an increasing number of human diseases, reminiscent of the HLA loci. Characterization of diversity at the KIR locus has progressed over the past several years, particularly since the sequence of entire KIR haplotypes have become available. To determine the extent of KIR haplotypic variability among individuals of northern European descent, we genotyped 59 CEPH families for presence/absence of all KIR genes and performed limited allelic subtyping at several KIR loci. A total of 20 unique haplotypes differing in gene content were identified, the most common of which was the previously defined A haplotype (f=0.52). Several unusual haplotypes that probably arose as a consequence of unequal crossing over events were also identified. Linkage disequilibrium (LD) analysis indicated strong negative and positive LD between several pairs of genes, values that may be useful in determining haplotypic structure when family data are not available. These data provide a resource to aid in the interpretation of disease association data involving individuals of European descent. PMID:18972110

  14. Estimating haplotype effects for survival data

    DEFF Research Database (Denmark)

    Scheike, Thomas; Martinussen, Torben; Silver, J

    2010-01-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplo...

  15. Maximum Likelihood Joint Tracking and Association in Strong Clutter

    Directory of Open Access Journals (Sweden)

    Leonid I. Perlovsky

    2013-01-01

    Full Text Available We have developed a maximum likelihood formulation for a joint detection, tracking and association problem. An efficient non-combinatorial algorithm for this problem is developed in case of strong clutter for radar data. By using an iterative procedure of the dynamic logic process “from vague-to-crisp” explained in the paper, the new tracker overcomes the combinatorial complexity of tracking in highly-cluttered scenarios and results in an orders-of-magnitude improvement in signal-to-clutter ratio.

  16. CRP genotype and haplotype associations with serum C-reactive protein level and DAS28 in untreated early rheumatoid arthritis patients

    DEFF Research Database (Denmark)

    Ammitzbøll, Christian Gytz; Steffensen, Rudi; Bøgsted, Martin

    2014-01-01

    investigated: rs11265257, rs1130864, rs1205, rs1800947, rs2808632, rs3093077 and rs876538. The genotype and haplotype associations with CRP and DAS28 levels were evaluated using linear regression analysis adjusted for age, sex and treatment. RESULTS: The minor allele of rs1205 C > T was associated......INTRODUCTION: Single-nucleotide polymorphisms (SNPs) in the CRP gene are implicated in the regulation of the constitutional C-reactive protein (CRP) expression and its response to proinflammatory stimuli. Previous reports suggest that these effects may have an impact on clinical decision...

  17. Mature habitats associated with genetic divergence despite strong dispersal ability in an arthropod

    Directory of Open Access Journals (Sweden)

    Taylor Derek J

    2007-04-01

    Full Text Available Abstract Background Populations may be bound by contemporary gene flow, selective sweeps, and extinction-recolonization processes. Indeed, existing molecular estimates indicate that species with low levels of gene flow are rare. However, strong priority effects and local selective regimes may hinder gene flow (despite dispersal sending populations on independent evolutionary trajectories. In this scenario (the monopolization hypothesis, population differentiation will increase with time and genealogical evidence should yield ample private haplotypes. Cyclical parthenogens (e.g. rotifers and cladocerans such as Daphnia have an increased capacity for rapid local adaptation and priority effects because sexual reproduction is followed by multiple generations of clonal selection and massive egg bank formation. We aimed to better understand the history of population differentiation and ongoing gene flow in Daphnia rosea s.l., by comparing population and regional divergences in mature unglaciated areas and younger previously glaciated areas. We also examined the timing and paths of colonization of previously-glaciated areas to assess the dispersal limitations of D. rosea s.l. We used DNA sequence variation (84 populations and >400 individuals at the mitochondrial ND2 and nuclear HSP90 loci from Holarctic populations for our genetic analyses. Results The genetic evidence indicated pronounced historical structure. Holarctic mtDNA phylogenies of D. rosea s.l. revealed three geographically restricted and divergent clades: European, Siberian and Japanese/American. The Japanese/American clade showed marked population genetic structure (FST > 0.8 that was weakly associated with geographic distance, and a high proportion of private haplotypes. Populations from older unglaciated habitats (i.e., Japan showed higher DNA sequence divergences than populations from presumed younger habitats (i.e. non-Beringian North America with nDNA and with mtDNA. Mismatch

  18. CRP and SAA1 Haplotypes Are Associated with Both C-Reactive Protein and Serum Amyloid A Levels: Role of Suppression Effects

    Directory of Open Access Journals (Sweden)

    Yu-Lin Ko

    2016-01-01

    Full Text Available To test the statistical association of the CRP and SAA1 locus variants with their corresponding circulating levels and metabolic and inflammatory biomarker levels by using mediation analysis, a sample population of 599 Taiwanese subjects was enrolled and five CRP and four SAA1 variants were genotyped. Correlation analysis revealed that C-reactive protein (CRP and serum amyloid A (SAA levels were significantly associated with multiple metabolic phenotypes and inflammatory marker levels. Our data further revealed a significant association of CRP and SAA1 variants with both CRP and SAA levels. Mediation analysis revealed that SAA levels suppressed the association between SAA1 genotypes/haplotypes and CRP levels and that CRP levels suppressed the association between CRP haplotypes and SAA levels. In conclusion, genetic variants at the CRP and SAA1 loci independently affect both CRP and SAA levels, and their respective circulating levels act as suppressors. These results provided further evidence of the role of the suppression effect in biological science and may partially explain the missing heritability in genetic association studies.

  19. Body-image dissatisfaction is strongly associated with chronic dysphoria.

    Science.gov (United States)

    Rosenström, Tom; Jokela, Markus; Hintsanen, Mirka; Josefsson, Kim; Juonala, Markus; Kivimäki, Mika; Pulkki-Råback, Laura; Viikari, Jorma S A; Hutri-Kähönen, Nina; Heinonen, Erkki; Raitakari, Olli T; Keltikangas-Järvinen, Liisa

    2013-09-05

    Individual depressive symptoms may contribute to the risk of chronic depression. This study aimed to explore which symptoms predict chronic dysphoria, a hallmark of depression. 1057 participants from the population-based Young Finns study were examined for four times during a 16-year period. Those with a modified Beck's Depression Inventory score in the upper third at all four screenings were considered to have chronic dysphoria (n=135). Participants with only one high depression score formed the reference group of transient dysphoria (n=179). Individual items of the Inventory were analyzed in terms of their association with dysphoria status and chronicity, controlling for potential confounding factors, such as personality assessed using the Temperament and Character Inventory. Body-image dissatisfaction was strongly associated with chronically elevated dysphoria (Bonferroni-corrected p=0.006). The degree of body-image dissatisfaction was associated with the probability for chronic dysphoria in a dose-response manner, with the estimated probability ranging from 0.01 to 0.60 as a function of item response. The association remained after adjustments for a wide range of personality characteristics. The study relied on self-reports of mood and personality, and lacked information on external opinion on participants appearances. The requirement of full time-series data may have resulted in attrition-related bias. Body-image dissatisfaction was a strong predictor of chronic depression characterized by dysphoria. This finding suggests that dysfunctional attitude towards oneself might represent a potentially important target for cognitive therapies and preventive interventions. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Discovery, validation and characterization of Erbb4 and Nrg1 haplotypes using data from three genome-wide association studies of schizophrenia.

    Directory of Open Access Journals (Sweden)

    Zeynep Sena Agim

    Full Text Available Schizophrenia is one of the most common and complex neuropsychiatric disorders, which is contributed both by genetic and environmental exposures. Recently, it is shown that NRG1-mediated ErbB4 signalling regulates many important cellular and molecular processes such as cellular growth, differentiation and death, particularly in myelin-producing cells, glia and neurons. Recent association studies have revealed genomic regions of NRG1 and ERBB4, which are significantly associated with risk of developing schizophrenia; however, inconsistencies exist in terms of validation of findings between distinct populations. In this study, we aim to validate the previously identified regions and to discover novel haplotypes of NRG1 and ERBB4 using logistic regression models and Haploview analyses in three independent datasets from GWAS conducted on European subjects, namely, CATIE, GAIN and nonGAIN. We identified a significant 6-kb block in ERBB4 between chromosome locations 212,156,823 and 212,162,848 in CATIE and GAIN datasets (p = 0.0206 and 0.0095, respectively. In NRG1, a significant 25-kb block, between 32,291,552 and 32,317,192, was associated with risk of schizophrenia in all CATIE, GAIN, and nonGAIN datasets (p = 0.0005, 0.0589, and 0.0143, respectively. Fine mapping and FastSNP analysis of genetic variation located within significantly associated regions proved the presence of binding sites for several transcription factors such as SRY, SOX5, CEPB, and ETS1. In this study, we have discovered and validated haplotypes of ERBB4 and NRG1 in three independent European populations. These findings suggest that these haplotypes play an important role in the development of schizophrenia by affecting transcription factor binding affinity.

  1. Strong association between earlier abuse and revictimization in youth.

    Science.gov (United States)

    Blom, Helena; Högberg, Ulf; Olofsson, Niclas; Danielsson, Ingela

    2014-07-14

    Violence victimization among youth is recognized as a public health problem. The objective was to analyze the risk pattern of emotional, physical, and sexual abuse during the past 12 months by gender, sociodemographic factors, health risk behaviors, and exposure to abuse before the age of 15, among young men and women attending youth health centers in Sweden. A cross-sectional survey was conducted using a nationally representative sample of youth health centers. A total of 2,250 young women and 920 young men aged 15-23 completed a self-administered questionnaire. Odds ratios (OR) and adjusted odds ratios (AOR) with 95% CI were calculated. A consistent and strong association was noted between exposure to all types of violence during the past year and victimization before the age of 15 for all types of violence for both women and men. The only exceptions were childhood sexual victimization and sexual violence during the past year for men. Younger age was associated with all violence exposure for the women and with emotional violence for the men. For the women, drug use was associated with all types of violence, while the association with hazardous alcohol use and not living with parents was restricted to physical and sexual violence exposure, present smoking was restricted to emotional and physical violence exposure, and partnership and living in urban areas were restricted to sexual violence. For men, not being partnered, hazardous alcohol consumption, and drug use meant increased risk for physical violence, while smoking and living in urban areas were associated with sexual violence. After adjustment, immigration had no association with violence exposure. Violence victimization in young men and women is often not a single experience. Findings underline the importance of early interventions among previously abused youth.

  2. Hydrochlorothiazide use is strongly associated with risk of lip cancer.

    Science.gov (United States)

    Pottegård, A; Hallas, J; Olesen, M; Svendsen, M T; Habel, L A; Friedman, G D; Friis, S

    2017-10-01

    The diuretic hydrochlorothiazide is amongst the most frequently prescribed drugs in the United States and Western Europe, but there is suggestive evidence that hydrochlorothiazide use increases the risk of lip cancer. To study the association between use of hydrochlorothiazide and squamous cell carcinoma of the lip. We conducted a case-control study using Danish nationwide registry data. From the Cancer Registry (2004-2012), we identified 633 case patients with squamous cell carcinoma (SCC) of the lip and matched them to 63 067 population controls using a risk-set sampling strategy. Hydrochlorothiazide use (1995-2012) was obtained from the Prescription Registry and defined according to cumulative use. Applying conditional logistic regression, we calculated odds ratios (ORs) for SCC lip cancer associated with hydrochlorothiazide use, adjusting for predefined potential confounders obtained from demographic, prescription and patient registries. Ever-use of hydrochlorothiazide was associated with an adjusted OR for SCC lip cancer of 2.1 (95% confidence interval (CI): 1.7-2.6), increasing to 3.9 (95%CI: 3.0-4.9) for high use (≥25 000 mg). There was a clear dose-response effect (P hydrochlorothiazide (≥100 000 mg) presenting an OR of 7.7 (95%CI: 5.7-10.5). No association with lip cancer was seen with use of other diuretics or nondiuretic antihypertensives. Assuming causality, we estimated that 11% of the SCC lip cancer cases could be attributed to hydrochlorothiazide use. Hydrochlorothiazide use is strongly associated with an increased risk of lip cancer. © 2017 The Authors. Journal of Internal Medicine published by John Wiley & Sons Ltd on behalf of Association for Publication of The Journal of Internal Medicine.

  3. De Novo Coding Variants Are Strongly Associated with Tourette Disorder

    DEFF Research Database (Denmark)

    Willsey, A Jeremy; Fernandez, Thomas V; Yu, Dongmei

    2017-01-01

    damaging missense) are overrepresented in probands (RR 1.37, p = 0.003). We identify four likely risk genes with multiple de novo damaging variants in unrelated probands: WWC1 (WW and C2 domain containing 1), CELSR3 (Cadherin EGF LAG seven-pass G-type receptor 3), NIPBL (Nipped-B-like), and FN1...... trios from the Tourette Syndrome Association International Consortium on Genetics (511 total). We observe strong and consistent evidence for the contribution of de novo likely gene-disrupting (LGD) variants (rate ratio [RR] 2.32, p = 0.002). Additionally, de novo damaging variants (LGD and probably...... (fibronectin 1). Overall, we estimate that de novo damaging variants in approximately 400 genes contribute risk in 12% of clinical cases. VIDEO ABSTRACT....

  4. A Haplotype Associated with Enhanced Mineralocorticoid Receptor Expression Facilitates the Stress-Induced Shift from “Cognitive” to “Habit” Learning

    Science.gov (United States)

    Reuter, Martin; Wacker, Jan; Felten, Andrea

    2017-01-01

    Abstract Stress induces a shift from hippocampus-dependent “cognitive” toward dorsal striatum-dependent “habit” memory. However, not all individuals are susceptible to this shift under stress. Based on pharmacological studies indicating a critical role of the mineralocorticoid receptor (MR) in the stress-induced bias toward dorsal striatal learning, we hypothesized that MR gene variants contribute to these individual differences. In two experiments, healthy participants were genotyped, exposed to a stressor or control manipulation and performed a learning task that can be solved using hippocampal or dorsal striatal systems, while electroencephalography (EEG; Experiment I) or functional magnetic resonance imaging (fMRI; Experiment II) measurements were taken. Stress led to a shift from hippocampal to dorsal striatal learning which was more pronounced in homo- and heterozygous carriers of a six single nucleotide polymorphisms (SNPs)-comprising haplotype containing the alleles of two MR SNPs associated with increased MR expression and transactivational activity (MR-2G/C C [rs2070951], MR-I180V A [rs5522]). This stress-induced shift toward habit memory was paralleled by an increased feedback-related negativity (FRN), which may reflect striatal processing, and increased caudate activation. Carriers of the MR haplotype showed a reduced P3a, an event-related potential thought to indicate cognitive processing, and reduced hippocampal activity after stress. Moreover, stress resulted in reduced amygdala-hippocampus connectivity and the decrease in amygdala connectivity to the parahippocampal cortex was particularly pronounced in MR haplotype carriers. Our findings indicate that genetic variants associated with enhanced MR expression facilitate a stress-induced shift from hippocampal toward dorsal striatal learning, most likely via impaired hippocampal processing and reduced amygdala-hippocampus cross talk, allowing the dorsal striatum to guide behavior under stress

  5. A genome-wide association study of production traits in a commercial population of Large White pigs: evidence of haplotypes affecting meat quality.

    Science.gov (United States)

    Sanchez, Marie-Pierre; Tribout, Thierry; Iannuccelli, Nathalie; Bouffaud, Marcel; Servin, Bertrand; Tenghe, Amabel; Dehais, Patrice; Muller, Nelly; Del Schneider, Maria Pilar; Mercat, Marie-José; Rogel-Gaillard, Claire; Milan, Denis; Bidanel, Jean-Pierre; Gilbert, Hélène

    2014-02-14

    Numerous quantitative trait loci (QTL) have been detected in pigs over the past 20 years using microsatellite markers. However, due to the low density of these markers, the accuracy of QTL location has generally been poor. Since 2009, the dense genome coverage provided by the Illumina PorcineSNP60 BeadChip has made it possible to more accurately map QTL using genome-wide association studies (GWAS). Our objective was to perform high-density GWAS in order to identify genomic regions and corresponding haplotypes associated with production traits in a French Large White population of pigs. Animals (385 Large White pigs from 106 sires) were genotyped using the PorcineSNP60 BeadChip and evaluated for 19 traits related to feed intake, growth, carcass composition and meat quality. Of the 64,432 SNPs on the chip, 44,412 were used for GWAS with an animal mixed model that included a regression coefficient for the tested SNPs and a genomic kinship matrix. SNP haplotype effects in QTL regions were then tested for association with phenotypes following phase reconstruction based on the Sscrofa10.2 pig genome assembly. Twenty-three QTL regions were identified on autosomes and their effects ranged from 0.25 to 0.75 phenotypic standard deviation units for feed intake and feed efficiency (four QTL), carcass (12 QTL) and meat quality traits (seven QTL). The 10 most significant QTL regions had effects on carcass (chromosomes 7, 10, 16, 17 and 18) and meat quality traits (two regions on chromosome 1 and one region on chromosomes 8, 9 and 13). Thirteen of the 23 QTL regions had not been previously described. A haplotype block of 183 kb on chromosome 1 (six SNPs) was identified and displayed three distinct haplotypes with significant (0.0001 meat quality traits. GWAS analyses with the PorcineSNP60 BeadChip enabled the detection of 23 QTL regions that affect feed consumption, carcass and meat quality traits in a LW population, of which 13 were novel QTL. The proportionally larger number

  6. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    Science.gov (United States)

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  7. Variation analysis and gene annotation of eight MHC haplotypes: the MHC Haplotype Project.

    Science.gov (United States)

    Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J; Almeida, Jeff; Forbes, Simon; Gilbert, James G R; Halls, Karen; Harrow, Jennifer L; Hart, Elizabeth; Howe, Kevin; Jackson, David K; Palmer, Sophie; Roberts, Anne N; Sims, Sarah; Stewart, C Andrew; Traherne, James A; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J; Elliott, John F; Sawcer, Stephen; Todd, John A; Trowsdale, John; Beck, Stephan

    2008-01-01

    The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine.

  8. Approximation properties of haplotype tagging

    Directory of Open Access Journals (Sweden)

    Dreiseitl Stephan

    2006-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are locations at which the genomic sequences of population members differ. Since these differences are known to follow patterns, disease association studies are facilitated by identifying SNPs that allow the unique identification of such patterns. This process, known as haplotype tagging, is formulated as a combinatorial optimization problem and analyzed in terms of complexity and approximation properties. Results It is shown that the tagging problem is NP-hard but approximable within 1 + ln((n2 - n/2 for n haplotypes but not approximable within (1 - ε ln(n/2 for any ε > 0 unless NP ⊂ DTIME(nlog log n. A simple, very easily implementable algorithm that exhibits the above upper bound on solution quality is presented. This algorithm has running time O((2m - p + 1 ≤ O(m(n2 - n/2 where p ≤ min(n, m for n haplotypes of size m. As we show that the approximation bound is asymptotically tight, the algorithm presented is optimal with respect to this asymptotic bound. Conclusion The haplotype tagging problem is hard, but approachable with a fast, practical, and surprisingly simple algorithm that cannot be significantly improved upon on a single processor machine. Hence, significant improvement in computatational efforts expended can only be expected if the computational effort is distributed and done in parallel.

  9. Age and haplotype variations within FADS1 interact and associate with alterations in fatty acid composition in human male cortical brain tissue.

    Directory of Open Access Journals (Sweden)

    Erika Freemantle

    Full Text Available Fatty acids (FA play an integral role in brain function and alterations have been implicated in a variety of complex neurological disorders. Several recent genomic studies have highlighted genetic variability in the fatty acid desaturase (FADS1/2/3 gene cluster as an important contributor to FA alterations in serum lipids as well as measures of FA desaturase index estimated by ratios of relevant FAs. The contribution to alterations of FAs within the brain by local synthesis is still a matter of debate. Thus, the impact of genetic variants in FADS genes on gene expression and brain FA levels is an important avenue to investigate.Analyses were performed on brain tissue from prefrontal cortex Brodmann area 47 (BA47 of 61 male subjects of French Canadian ancestry ranging in age from young adulthood to middle age (18-58 years old, with the exception of one teenager (15 years old. Haplotype tagging SNPs were selected using the publicly available HapMap genotyping dataset in conjunction with Haploview. DNA sequencing was performed by the Sanger method and gene expression was measured by quantitative real-time PCR. FAs in brain tissue were analysed by gas chromatography. Variants in the FADS1 gene region were sequenced and analyzed for their influence on both FADS gene expression and FAs in brain tissue.Our results suggest an association of the minor haplotype with alteration in estimated fatty acid desaturase activity. Analysis of the impact of DNA variants on expression and alternative transcripts of FADS1 and FADS2, however, showed no differences. Furthermore, there was a significant interaction between haplotype and age on certain brain FA levels.This study suggests that genetic variability in the FADS genes cluster, previously shown to be implicated in alterations in peripheral FA levels, may also affect FA composition in brain tissue, but not likely by local synthesis.

  10. Human leukocyte antigen (DR1)-DQB1*0501 and (DR15)-DQB1*0602 haplotypes are associated with humoral responses to early food allergens in children.

    Science.gov (United States)

    Savilahti, Emma M; Ilonen, Jorma; Kiviniemi, Minna; Saarinen, Kristiina M; Vaarala, Outi; Savilahti, Erkki

    2010-01-01

    Infants' immunological responses to cow's milk (CM) proteins, which in 2-3% result in allergy, may partially depend on genetic factors. We evaluated whether genes with immunological functions, i.e. human leukocyte antigen (HLA) II, the protein tyrosine phosphatase, non-receptor type 22 (PTPN22) and filaggrin, modulate immune responses to dietary antigens. We analyzed 14 HLA class II haplotypes, the PTPN22 1858 SNP (R620W allele) and 5 known filaggrin null mutations from blood samples of 87 patients with CM allergy (CMA) and 76 control subjects (age 8.0-9.3 years). Serum levels of IgA, IgG, IgG1 and IgG4 antibodies to beta-lactoglobulin, alpha-casein and ovalbumin were measured with enzyme-linked immunosorbent assay, levels of IgE antibodies to CM, ovalbumin and birch with UniCap (Phadia, Uppsala, Sweden). In children with CMA, the HLA (DR15)-DQB1*0602 haplotype was associated with high levels of beta-lactoglobulin-specific total IgG (p food allergens, whereas none of these genes was associated with CMA. Copyright 2009 S. Karger AG, Basel.

  11. Associations between RET tagSNPs and their haplotypes and susceptibility, clinical severity, and thyroid function in patients with differentiated thyroid cancer.

    Directory of Open Access Journals (Sweden)

    Caiyun He

    Full Text Available It is unclear whether common genetic variants of the RET proto-oncogene contribute to disease susceptibility, clinical severity, and thyroid function in differentiated thyroid cancer (DTC.A total of 300 DTC patients and 252 healthy controls were enrolled in this study. Seven RET tagging single nucleotide polymorphisms were genotyped using the KASPar platform.Subgroup analysis showed that concomitant thyroid benign diseases were less likely to occur in DTC subjects with the rs1799939 AG or AG plus AA genotypes (odds ratio (OR = 1.93 and 1.88, P = 0.009 and 0.011, respectively. A rare haplotype, CGGATAA, was associated statistically with a reduced risk of DTC (OR = 0.18, P = 0.001. Concerning the aggressive features of DTC, higher level of N stage was more likely to occur in subjects carrying the wild-type genotypes at rs1800860 site (for dominant model: OR = 0.48, P = 0.008. Another rare haplotype, CAAGCGT, conferred increased risk for the occurrence of distant metastasis (OR = 7.57, P = 0.009. Notably, higher thyroid stimulating hormone levels and lower parathyroid hormone levels were found in patients with rs2075912, rs2565200, and rs2742240 heterozygotes and rare homozygotes; similar results were observed between PTH levels and rs1800858.This study provided useful information on RET variants that should be subjected to further study.

  12. Associations between RET tagSNPs and their haplotypes and susceptibility, clinical severity, and thyroid function in patients with differentiated thyroid cancer.

    Science.gov (United States)

    He, Caiyun; Ma, Jiangjun; Jiang, Yongle; Su, Xuan; Zhang, Xiao; Chen, Weichao; Ye, Zulu; Deng, Tiancheng; Deng, Wenze; Yang, Ankui

    2017-01-01

    It is unclear whether common genetic variants of the RET proto-oncogene contribute to disease susceptibility, clinical severity, and thyroid function in differentiated thyroid cancer (DTC). A total of 300 DTC patients and 252 healthy controls were enrolled in this study. Seven RET tagging single nucleotide polymorphisms were genotyped using the KASPar platform. Subgroup analysis showed that concomitant thyroid benign diseases were less likely to occur in DTC subjects with the rs1799939 AG or AG plus AA genotypes (odds ratio (OR) = 1.93 and 1.88, P = 0.009 and 0.011, respectively). A rare haplotype, CGGATAA, was associated statistically with a reduced risk of DTC (OR = 0.18, P = 0.001). Concerning the aggressive features of DTC, higher level of N stage was more likely to occur in subjects carrying the wild-type genotypes at rs1800860 site (for dominant model: OR = 0.48, P = 0.008). Another rare haplotype, CAAGCGT, conferred increased risk for the occurrence of distant metastasis (OR = 7.57, P = 0.009). Notably, higher thyroid stimulating hormone levels and lower parathyroid hormone levels were found in patients with rs2075912, rs2565200, and rs2742240 heterozygotes and rare homozygotes; similar results were observed between PTH levels and rs1800858. This study provided useful information on RET variants that should be subjected to further study.

  13. Strobe sequence design for haplotype assembly

    Science.gov (United States)

    2011-01-01

    Background Humans are diploid, carrying two copies of each chromosome, one from each parent. Separating the paternal and maternal chromosomes is an important component of genetic analyses such as determining genetic association, inferring evolutionary scenarios, computing recombination rates, and detecting cis-regulatory events. As the pair of chromosomes are mostly identical to each other, linking together of alleles at heterozygous sites is sufficient to phase, or separate the two chromosomes. In Haplotype Assembly, the linking is done by sequenced fragments that overlap two heterozygous sites. While there has been a lot of research on correcting errors to achieve accurate haplotypes via assembly, relatively little work has been done on designing sequencing experiments to get long haplotypes. Here, we describe the different design parameters that can be adjusted with next generation and upcoming sequencing technologies, and study the impact of design choice on the length of the haplotype. Results We show that a number of parameters influence haplotype length, with the most significant one being the advance length (distance between two fragments of a clone). Given technologies like strobe sequencing that allow for large variations in advance lengths, we design and implement a simulated annealing algorithm to sample a large space of distributions over advance-lengths. Extensive simulations on individual genomic sequences suggest that a non-trivial distribution over advance lengths results a 1-2 order of magnitude improvement in median haplotype length. Conclusions Our results suggest that haplotyping of large, biologically important genomic regions is feasible with current technologies. PMID:21342554

  14. Matrix metalloproteinase3 gene promoter polymorphisms and their haplotypes are associated with gastric cancer risk in eastern Indian population.

    Science.gov (United States)

    Dey, Sanjib; Stalin, Sami; Gupta, Arnab; Saha, Debjit; Kesh, Kousik; Swarnakar, Snehasikta

    2012-10-01

    Single nucleotide polymorphisms (SNPs) of matrix metalloproteinase3 (MMP3) promoter in the development and progression of gastric cancer of whole stomach has never been investigated in any population. We conducted a hospital-based case-control study to explore the MMP3 SNPs and their haplotypes with the risk of gastric cancer for the first time in eastern Indian population. A total of 218 gastric cancer patients and 175 healthy controls were genotyped for MMP3-1612 5A/6A (rs3025058) by PCR-RFLP and rechecked 10% by DNA sequencing. MMP3-707 A/G (rs522616) and MMP3-375 C/G (rs617819) were genotyped by DNA sequencing among 209 patients and 154 controls. MMP3-1612 5A6A genotype (P = 0.026, odds ratio (OR) = 1.756, confidence interval (CI) = 1.070-2.883), combined 5A5A and 5A6A genotype (P = 0.015, OR = 1.791, CI = 1.122-2.858) and 5A allele (P = 0.002, OR = 1.75, CI = 1.21-2.53) and; MMP3-707 GG genotype (P = < 0.0001; OR = 9.612; 95% CI = 3.403-27.147), combined GG and AG genotype (P = 0.001, OR = 2.201, CI = 1.385-3.498) and G allele (P = <0.0001, OR = 2.189, CI = 1.582-3.033) conferred significant risk for gastric cancer development. Also, tobacco addicted individuals with combined 5A5A and 5A6A genotype (P = 0.005, OR = 2.952, CI = 1.377-6.327) at -1612 position of MMP3 promoter displayed a higher risk to gastric cancer development. The genotypic combinations of all three MMP3 promoter polymorphisms and their haplotypes with increasing risk allele in a dose-dependent manner showed a potential risk for developing gastric cancer. The analyses suggested that the MMP3-707 G/G and MMP3-1612 5A/6A polymorphisms are potential independent predictors of gastric cancer risk development. Copyright © 2011 Wiley Periodicals, Inc.

  15. Illusory Paschen curves associated with strongly electronegative gases

    DEFF Research Database (Denmark)

    McAllister, Iain Wilson

    1991-01-01

    Using analytical linear regression analysis, it is shown that, for a strongly electronegative gas, the (direct) breakdown voltage curve obtained with a moderately nonuniform field is effectively linear. For a strongly electronegative gas, breakdown voltage measurements made on a moderately...... nonuniform field test gap give rise to an apparently liner curve. The curve can be designated a Paschen curve, but the erroneous nature of this designation becomes apparent from a linear regression analysis of the experimental breakdown data...

  16. Association of CCR2-CCR5 haplotypes and CCL3L1 copy number with Kawasaki Disease, coronary artery lesions, and IVIG responses in Japanese children.

    Directory of Open Access Journals (Sweden)

    Manju Mamtani

    Full Text Available BACKGROUND: The etiology of Kawasaki Disease (KD is enigmatic, although an infectious cause is suspected. Polymorphisms in CC chemokine receptor 5 (CCR5 and/or its potent ligand CCL3L1 influence KD susceptibility in US, European and Korean populations. However, the influence of these variations on KD susceptibility, coronary artery lesions (CAL and response to intravenous immunoglobulin (IVIG in Japanese children, who have the highest incidence of KD, is unknown. METHODOLOGY/PRINCIPAL FINDINGS: We used unconditional logistic regression analyses to determine the associations of the copy number of the CCL3L1 gene-containing duplication and CCR2-CCR5 haplotypes in 133 Japanese KD cases [33 with CAL and 25 with resistance to IVIG] and 312 Japanese controls without a history of KD. We observed that the deviation from the population average of four CCL3L1 copies (i.e., four copies was associated with an increased risk of KD and IVIG resistance (adjusted odds ratio (OR=2.25, p=0.004 and OR=6.26, p=0.089, respectively. Heterozygosity for the CCR5 HHF*2 haplotype was associated with a reduced risk of both IVIG resistance (OR=0.21, p=0.026 and CAL development (OR=0.44, p=0.071. CONCLUSIONS/SIGNIFICANCE: The CCL3L1-CCR5 axis may play an important role in KD pathogenesis. In addition to clinical and laboratory parameters, genetic markers may also predict risk of CAL and resistance to IVIG.

  17. Polymorphisms in the LPL and CETP Genes and Haplotype in the ESR1 Gene Are Associated with Metabolic Syndrome in Women from Southwestern Mexico

    Directory of Open Access Journals (Sweden)

    José Ángel Cahua-Pablo

    2015-09-01

    Full Text Available Metabolic syndrome (MetS is a combination of metabolic disorders associated with an increased risk for cardiovascular disease (CVD. Studies in women reported associations between polymorphisms in ESR1, LPL and CETP genes and MetS. Our aim was to evaluate the association between variants in ESR1, LPL and CETP genes with MetS and its components. Four hundred and eighty women were analyzed, anthropometric features and biochemical profiles were evaluated, and genotyping was performed by real-time PCR. We found an association with elevated glucose levels (odds ratio (OR = 2.9; p = 0.013 in carrying the AA genotype of rs1884051 in the ESR1 gene compared with the GG genotype, and the CC genotype of rs328 in the LPL gene was associated with MetS compared to the CG or GG genotype (OR = 2.8; p = 0.04. Moreover, the GA genotype of rs708272 in the CETP gene is associated with MetS compared to the GG or AA genotype (OR = 1.8; p = 0.006. In addition the ACTCCG haplotype in the ESR1 gene is associated with a decrease in the risk of MetS (OR = 0.02; p < 0.001. In conclusion, our results show the involvement of the variants of ESR1, LPL and CETP genes in metabolic events related to MetS or some of its features.

  18. Suggestive evidence for association between L-type voltage-gated calcium channel (CACNA1C) gene haplotypes and bipolar disorder in Latinos: a family-based association study

    Science.gov (United States)

    Gonzalez, Suzanne; Xu, Chun; Ramirez, Mercedes; Zavala, Juan; Armas, Regina; Contreras, Salvador A; Contreras, Javier; Dassori, Albana; Leach, Robin J; Flores, Deborah; Jerez, Alvaro; Raventós, Henriette; Ontiveros, Alfonso; Nicolini, Humberto; Escamilla, Michael

    2013-01-01

    Objectives Through recent genome-wide association studies (GWAS), several groups have reported significant association between variants in the alpha 1C subunit of the L-type voltage-gated calcium channel (CACNA1C) and bipolar disorder (BP) in European and European-American cohorts. We performed a family-based association study to determine whether CACNA1C is associated with BP in the Latino population. Methods This study consisted of 913 individuals from 215 Latino pedigrees recruited from the United States, Mexico, Guatemala, and Costa Rica. The Illumina GoldenGate Genotyping Assay was used to genotype 58 single-nucleotide polymorphisms (SNPs) that spanned a 602.9 kb region encompassing the CACNA1C gene including two SNPs (rs7297582 and rs1006737) previously shown to associate with BP. Individual SNP and haplotype association analyses were performed using Family-Based Association Test (version 2.0.3) and Haploview (version 4.2) software. Results An eight-locus haplotype block that included these two markers showed significant association with BP (global marker permuted p = 0.0018) in the Latino population. For individual SNPs, this sample had insufficient power (10%) to detect associations with SNPs with minor effect (odds ratio = 1.15). Conclusions Although we were not able to replicate findings of association between individual CACNA1C SNPs rs7297582 and rs1006737 and BP, we were able to replicate the GWAS signal reported for CACNA1C through a haplotype analysis that encompassed these previously reported significant SNPs. These results provide additional evidence that CACNA1C is associated with BP and provides the first evidence that variations in this gene might play a role in the pathogenesis of this disorder in the Latino population. PMID:23437964

  19. Strong association between myotonic dystrophy type 2 and autoimmune diseases.

    NARCIS (Netherlands)

    Tieleman, A.A.; Broeder, A. den; Logt, A. van de; Engelen, B.G.M. van

    2009-01-01

    BACKGROUND: Myotonic dystrophy type 2 (DM2) is a dominantly inherited multisystem disorder, characterised by progressive proximal weakness, myotonia, cataracts and cardiac conduction abnormalities. Our clinical impression of an association between DM2 and autoimmune diseases or autoantibody

  20. HLA haplotypes in primary sclerosing cholangitis patients of admixed and non-European ancestry.

    Science.gov (United States)

    Henriksen, E K K; Viken, M K; Wittig, M; Holm, K; Folseraas, T; Mucha, S; Melum, E; Hov, J R; Lazaridis, K N; Juran, B D; Chazouillères, O; Färkkilä, M; Gotthardt, D N; Invernizzi, P; Carbone, M; Hirschfield, G M; Rushbrook, S M; Goode, E; Ponsioen, C Y; Weersma, R K; Eksteen, B; Yimam, K K; Gordon, S C; Goldberg, D; Yu, L; Bowlus, C L; Franke, A; Lie, B A; Karlsen, T H

    2017-10-01

    Primary sclerosing cholangitis (PSC) is strongly associated with several human leukocyte antigen (HLA) haplotypes. Due to extensive linkage disequilibrium and multiple polymorphic candidate genes in the HLA complex, identifying the alleles responsible for these associations has proven difficult. We aimed to evaluate whether studying populations of admixed or non-European descent could help in defining the causative HLA alleles. When assessing haplotypes carrying HLA-DRB1*13:01 (hypothesized to specifically increase the susceptibility to chronic cholangitis), we observed that every haplotype in the Scandinavian PSC population carried HLA-DQB1*06:03. In contrast, only 65% of HLA-DRB1*13:01 haplotypes in an admixed/non-European PSC population carried this allele, suggesting that further assessments of the PSC-associated haplotype HLA-DRB1*13:01-DQA1*01:03-DQB1*06:03 in admixed or multi-ethnic populations could aid in identifying the causative allele. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Association of IL1B -511C/-31T haplotype and Helicobacter pylori vacA genotypes with gastric ulcer and chronic gastritis

    Directory of Open Access Journals (Sweden)

    Fernández-Tilapa Gloria

    2010-10-01

    Full Text Available Abstract Background The association between proinflammatory cytokine gene polymorphisms and gastric diseases related to Helicobacter pylori varies by population and geographic area. Our objective was to determine if the IL-1B -511 T>C and -31 C>T polymorphisms and H. pylori vacA genotypes are associated with risk of chronic gastritis and gastric ulcer in a Mexican population. Methods We conducted endoscopic studies in 128 patients with symptoms of dyspepsia. We took two biopsies from the body, antrum, or ulcer edge from each patient, and classified our histopathological findings according to the Sydney System. H. pylori infection and vacA genotyping were accomplished via PCR from total DNA of the gastric biopsies. We confirmed the presence of anti-H. pylori serum IgG and IgM in 102 control subjects. In both case subjects and control subjects, the IL-1B -511 T>C polymorphism was genotyped by PCR-RFLPs and the IL-1B -31 C>T polymorphism was genotyped by pyrosequencing. Results Sixty-two point seven (62.7% of the 102 control subjects were H. pylori-seropositive. Among the case subjects, 100 were diagnosed with chronic gastritis and 28 with gastric ulcer. We found that 77% of the patients with chronic gastritis and 85.7% of the patients with gastric ulcer were H. pylori-positive. The predominant H. pylori genotype was vacA s1m1 (58.4% and the most frequent subtype was vacA s1. The -511 TC, (rs16944 -511 T>C genotype and the -511C allele were associated with chronic gastritis (OR = 3.1, 95% CI = 1.4-6.8 and OR = 3.0, 95% CI = 1.4-6.0, respectively. The subjects carrying -31T (rs1143627 -31 C>T were found to be at a higher risk of having chronic gastritis (OR = 2.8, 95% CI = 1.3-5.8. The IL-1B -511C/-31T haplotype was associated with chronic gastritis (OR = 2.1, 95% CI = 1.2-3.8 but not with gastric ulcer. Conclusions The H. pylori vacA genotypes identified herein were similar to those reported for other regions of Mexico. The vacA s1m1 genotype was

  2. Diabetes mellitus is strongly associated with tuberculosis in Indonesia.

    NARCIS (Netherlands)

    Alisjahbana, B.; Crevel, R. van; Sahiratmadja, E.; Heijer, M. den; Maya, A.; Istriana, E.; Danusantoso, H.; Ottenhoff, T.H.; Nelwan, R.H.; Meer, J.W.M. van der

    2006-01-01

    SETTING: Diabetes mellitus is a known risk factor for tuberculosis (TB), but no studies have been reported from South-East Asia, which has a high burden of TB and a rapidly growing prevalence of diabetes. OBJECTIVE: To examine if and to what extent diabetes is associated with an increased risk of TB

  3. Atmospheric circulation patterns associated with strong wind events in Catalonia

    Directory of Open Access Journals (Sweden)

    J. C. Peña

    2011-01-01

    Full Text Available The benefit of having a daily synoptic weather type catalogue and even more, a detailed catalogue for high impact weather events is well recognised by both climatologist and meteorologist communities. In this way the Meteorological Service of Catalonia (SMC has produced some accurate classifications for extreme events, such as hailstorms or strong winds (SW. Within the framework of the MEDEX project, the SMC has been collaborating to increase the level of awareness about these events. Following this line of work, the aim of this study is to characterise the SW events in Catalonia.

    According to the guidelines of the MEDEX project we worked with its SW event database for the period June 1995 to May 2004. We also used the period 2005–2009 to test the methodology. The methodology is based on principal component, cluster and discriminant analyses and applied to four variables: SLP, temperature at 850 hPa and geopotential at 500 hPa on a synoptic-scale and local gust wind. We worked with ERA-Interim reanalysis and applied discriminant analysis to test the quality of the methodology and to classify the events of the validation period.

    We found seven patterns for the SW events. The strongest event corresponds to NW-Flow with the Azores Anticyclone and the passing of a low pressure through the Pyrenees. This methodology has distinguished the summer events in an independent cluster. The results obtained encourage us to follow this line of work.

  4. Hydrochlorothiazide use is strongly associated with risk of lip cancer

    DEFF Research Database (Denmark)

    Pottegård, A; Hallas, J; Olesen, M

    2017-01-01

    Background: The diuretic hydrochlorothiazide is amongst the most frequently prescribed drugs in the United States and Western Europe, but there is suggestive evidence that hydrochlorothiazide use increases the risk of lip cancer. Objectives: To study the association between use of hydrochlorothia......Background: The diuretic hydrochlorothiazide is amongst the most frequently prescribed drugs in the United States and Western Europe, but there is suggestive evidence that hydrochlorothiazide use increases the risk of lip cancer. Objectives: To study the association between use...... of hydrochlorothiazide and squamous cell carcinoma of the lip. Methods: We conducted a case-control study using Danish nationwide registry data. From the Cancer Registry (2004-2012), we identified 633 case patients with squamous cell carcinoma (SCC) of the lip and matched them to 63 067 population controls using a risk......-set sampling strategy. Hydrochlorothiazide use (1995-2012) was obtained from the Prescription Registry and defined according to cumulative use. Applying conditional logistic regression, we calculated odds ratios (ORs) for SCC lip cancer associated with hydrochlorothiazide use, adjusting for predefined...

  5. Unique Allelic eQTL Clusters in Human MHC Haplotypes.

    Science.gov (United States)

    Lam, Tze Hau; Shen, Meixin; Tay, Matthew Zirui; Ren, Ee Chee

    2017-08-07

    The control of gene regulation within the major histocompatibility complex (MHC) remains poorly understood, despite several expression quantitative trait loci (eQTL) studies revealing an association of MHC gene expression with independent tag-single nucleotide polymorphisms (SNPs). MHC haplotype variation may exert a greater effect on gene expression phenotype than specific single variants. To explore the effect of MHC haplotype sequence diversity on gene expression phenotypes across the MHC, we examined the MHC transcriptomic landscape at haplotype-specific resolution for three prominent MHC haplotypes (A2-B46-DR9, A33-B58-DR3, and A1-B8-DR3) derived from MHC-homozygous B-lymphoblastoid cell lines (B-LCLs). We demonstrate that MHC-wide gene expression patterns are dictated by underlying haplotypes, and identify 36 differentially expressed genes. By mapping these haplotype sequence variations to known eQTL, we provide evidence that unique allelic combinations of eQTL, embedded within haplotypes, are correlated with the level of expression of 17 genes. Interestingly, the influence of haplotype sequence on gene expression is not homogenous across the MHC. We show that haplotype sequence polymorphisms within or proximate to HLA-A, HLA-C, C4A, and HLA-DRB regions exert haplotype-specific gene regulatory effects, whereas the expression of genes in other parts of the MHC region are not affected by the haplotype sequence. Overall, we demonstrate that MHC haplotype sequence diversity can impact phenotypic outcome via the alteration of transcriptional variability, indicating that a haplotype-based approach is fundamental for the assessment of trait associations in the MHC. Copyright © 2017 Lam et al.

  6. On strongly J -clean rings associated with polynomial identity g ( x =0

    Directory of Open Access Journals (Sweden)

    Hamid Haj seyyed javadi

    2014-05-01

    Full Text Available In this paper‎, ‎we introduce the new notion of strongly $J $-clean rings associated with polynomial identity $g(x=0$‎, ‎as a generalization of strongly $ J $-clean rings‎. ‎We denote strongly $J $-clean rings associated with polynomial identity $g(x=0$ by strongly $ g(x $-$J $-clean rings‎. ‎Next‎, ‎we investigate some properties of strongly $ g(x $-$ J $-clean.

  7. The polymorphism and haplotypes of PIN1 gene are associated with the risk of lung cancer in Southern and Eastern Chinese populations.

    Science.gov (United States)

    Lu, Jiachun; Yang, Lei; Zhao, Hongjun; Liu, Bin; Li, Yinyan; Wu, Hongxia; Li, Qingchu; Zeng, Bohang; Wang, Yunnan; Ji, Weidong; Zhou, Yifeng

    2011-11-01

    Peptidyl-prolyl cis/trans isomerase (PPIase), PIN1, has been found to be a critical catalyst that involves in multiple oncogenic signaling pathways. Recently, several putative functional polymorphisms of the PIN1 gene have been identified to be associated with cancer risk. In this study, we tested the hypothesis that two common polymorphisms, c.-842G>C (rs2233678) and c.-667C>T (rs2233679), in the PIN1 promoter are associated with risk of lung cancer. In two independent case-control studies of 1,559 lung cancer cases and 1,679 controls conducted in Southern and Eastern Chinese population, we found that compared with the most common c.-842GG genotype, the carriers of c.-842C variant genotypes (GC + CC) had a decreased risk of lung cancer (odds ratio [OR] = 0.63, 95% confidence interval [CI] = 0.51-0.78, p = 1.13 × 10(-5) ). Although no association was observed between the c.-667C>T polymorphism and cancer risk, we found that the haplotype "C-C" had a greater protective effect (OR = 0.39, 95% CI = 0.23-0.67, p = 5.03 × 10(-4) ). The stratification analysis showed that the protective role of c.-842C variants was more pronounced in current smokers (p = 4.45 × 10(-5) ), especially in male smokers (p = 6.71 × 10(-6) ) and in those who smoked more than 20 pack-years (p = 2.30 × 10(-5) ) and the c.-842C variant genotypes interacted with smoking status (P(interaction) = 0.019) or pack-years smoked (P(interaction) = 0.008) on reducing cancer risk. Further functional assay revealed that the c.-842C variant allele had a lower transcription activity in luciferase assay and a lower DNA-binding ability with nuclear proteins, and low transcription activity in western blot assay. In conclusions, our data suggest that functional c.-842C variants and haplotype "C-C" in the PIN1 promoter contribute to decreased risk of lung cancer by diminishing the promoter activity, which may be susceptibility biomarkers for lung cancer. © 2011 Wiley Periodicals, Inc.

  8. Polymorphic HLA-C Receptors Balance the Functional Characteristics of KIR Haplotypes.

    Science.gov (United States)

    Hilton, Hugo G; Guethlein, Lisbeth A; Goyos, Ana; Nemat-Gorgani, Neda; Bushnell, David A; Norman, Paul J; Parham, Peter

    2015-10-01

    The human killer cell Ig-like receptor (KIR) locus comprises two groups of KIR haplotypes, termed A and B. These are present in all human populations but with different relative frequencies, suggesting they have different functional properties that underlie their balancing selection. We studied the genomic organization and functional properties of the alleles of the inhibitory and activating HLA-C receptors encoded by KIR haplotypes. Because every HLA-C allotype functions as a ligand for KIR, the interactions between KIR and HLA-C dominate the HLA class I-mediated regulation of human NK cells. The C2 epitope is recognized by inhibitory KIR2DL1 and activating KIR2DS1, whereas the C1 epitope is recognized by inhibitory KIR2DL2 and KIR2DL3. This study shows that the KIR2DL1, KIR2DS1, and KIR2DL2/3 alleles form distinctive phylogenetic clades that associate with specific KIR haplotypes. KIR A haplotypes are characterized by KIR2DL1 alleles that encode strong inhibitory C2 receptors and KIR2DL3 alleles encoding weak inhibitory C1 receptors. In striking contrast, KIR B haplotypes are characterized by KIR2DL1 alleles that encode weak inhibitory C2 receptors and KIR2DL2 alleles encoding strong inhibitory C1 receptors. The wide-ranging properties of KIR allotypes arise from substitutions throughout the KIR molecule. Such substitutions can influence cell surface expression, as well as the avidity and specificity for HLA-C ligands. Consistent with the crucial role of inhibitory HLA-C receptors in self-recognition, as well as NK cell education and response, most KIR haplotypes have both a functional C1 and C2 receptor, despite the considerable variation that occurs in ligand recognition and surface expression. Copyright © 2015 by The American Association of Immunologists, Inc.

  9. Haplotype-based stratification of Huntington's disease.

    Science.gov (United States)

    Chao, Michael J; Gillis, Tammy; Atwal, Ranjit S; Mysore, Jayalakshmi Srinidhi; Arjomand, Jamshid; Harold, Denise; Holmans, Peter; Jones, Lesley; Orth, Michael; Myers, Richard H; Kwak, Seung; Wheeler, Vanessa C; MacDonald, Marcy E; Gusella, James F; Lee, Jong-Min

    2017-11-01

    Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by expansion of a CAG trinucleotide repeat in HTT, resulting in an extended polyglutamine tract in huntingtin. We and others have previously determined that the HD-causing expansion occurs on multiple different haplotype backbones, reflecting more than one ancestral origin of the same type of mutation. In view of the therapeutic potential of mutant allele-specific gene silencing, we have compared and integrated two major systems of HTT haplotype definition, combining data from 74 sequence variants to identify the most frequent disease-associated and control chromosome backbones and revealing that there is potential for additional resolution of HD haplotypes. We have used the large collection of 4078 heterozygous HD subjects analyzed in our recent genome-wide association study of HD age at onset to estimate the frequency of these haplotypes in European subjects, finding that common genetic variation at HTT can distinguish the normal and CAG-expanded chromosomes for more than 95% of European HD individuals. As a resource for the HD research community, we have also determined the haplotypes present in a series of publicly available HD subject-derived fibroblasts, induced pluripotent cells, and embryonic stem cells in order to facilitate efforts to develop inclusive methods of allele-specific HTT silencing applicable to most HD patients. Our data providing genetic guidance for therapeutic gene-based targeting will significantly contribute to the developments of rational treatments and implementation of precision medicine in HD.

  10. Maternal inheritance of deltamethrin resistance in the salmon louse Lepeophtheirus salmonis (Krøyer is associated with unique mtDNA haplotypes.

    Directory of Open Access Journals (Sweden)

    Greta Carmona-Antoñanzas

    levels in IoA-00 but not IoA-02 parasites. The maternal inheritance of deltamethrin resistance and its association with mitochondrial haplotypes suggests that pyrethroid toxicity in L. salmonis may involve molecular targets encoded by mitochondrial genes.

  11. Estimating haplotype effects for survival data.

    Science.gov (United States)

    Scheike, Thomas H; Martinussen, Torben; Silver, Jeremy D

    2010-09-01

    Genetic association studies often investigate the effect of haplotypes on an outcome of interest. Haplotypes are not observed directly, and this complicates the inclusion of such effects in survival models. We describe a new estimating equations approach for Cox's regression model to assess haplotype effects for survival data. These estimating equations are simple to implement and avoid the use of the EM algorithm, which may be slow in the context of the semiparametric Cox model with incomplete covariate information. These estimating equations also lead to easily computable, direct estimators of standard errors, and thus overcome some of the difficulty in obtaining variance estimators based on the EM algorithm in this setting. We also develop an easily implemented goodness-of-fit procedure for Cox's regression model including haplotype effects. Finally, we apply the procedures presented in this article to investigate possible haplotype effects of the PAF-receptor on cardiovascular events in patients with coronary artery disease, and compare our results to those based on the EM algorithm. © 2009, The International Biometric Society.

  12. Linkage disequilibrium pattern of the ATM gene in breast cancer patients and controls; association of SNPs and haplotypes to radio-sensitivity and post-lumpectomy local recurrence

    International Nuclear Information System (INIS)

    Edvardsen, Hege; Tefre, Toril; Jansen, Laila; Vu, Phuong; Haffty, Bruce G; Fosså, Sophie D; Kristensen, Vessela N; Børresen-Dale, Anne-Lise

    2007-01-01

    The ATM protein is activated as a result of ionizing radiation, and genetic variants of the ATM gene may therefore affect the level of radiation-induced damage. Individuals heterozygous for ATM mutations have been reported to have an increased risk of malignancy, especially breast cancer. Norwegian breast cancer patients (272) treated with radiation (252 of which were evaluated for radiation-induced adverse side effects), 95 Norwegian women with no known history of cancer and 95 American breast cancer patients treated with radiation (44 of which developed ipsilateral breast tumour recurrence, IBTR) were screened for sequence variations in all exons of the ATM gene as well as known intronic variants by denaturating high performance liquid chromatography (dHPLC) followed by sequencing to determine the nature of the variant. A total of 56 variants were identified in the three materials combined. A borderline significant association with breast cancer risk was found for the 1229 T>C (Val>Ala) substitution in exon 11 (P-value 0.055) between the Norwegian controls and breast cancer patients as well as a borderline significant difference in haplotype distribution (P-value 0.06). Adverse side effects, such as: development of costal fractures and telangiectasias, subcutaneous and lung fibrosis, pleural thickening and atrophy were evaluated in the Norwegian patients. Significant associations were found for several of the identified variants such as rs1800058 (Leu > Phe) where a decrease in minor allele frequency was found with increasing level of adverse side effects for the clinical end-points pleural thickening and lung fibrosis, thus giving a protective effect. Overall our results indicate a role for variation in the ATM gene both for risk of developing breast cancer, and in radiation induced adverse side effects. No association could be found between risk of developing ipsilateral breast tumour recurrence and any of the sequence variants found in the American patient

  13. Linkage disequilibrium pattern of the ATM gene in breast cancer patients and controls; association of SNPs and haplotypes to radio-sensitivity and post-lumpectomy local recurrence

    Directory of Open Access Journals (Sweden)

    Fosså Sophie D

    2007-07-01

    Full Text Available Abstract Background The ATM protein is activated as a result of ionizing radiation, and genetic variants of the ATM gene may therefore affect the level of radiation-induced damage. Individuals heterozygous for ATM mutations have been reported to have an increased risk of malignancy, especially breast cancer. Materials and methods Norwegian breast cancer patients (272 treated with radiation (252 of which were evaluated for radiation-induced adverse side effects, 95 Norwegian women with no known history of cancer and 95 American breast cancer patients treated with radiation (44 of which developed ipsilateral breast tumour recurrence, IBTR were screened for sequence variations in all exons of the ATM gene as well as known intronic variants by denaturating high performance liquid chromatography (dHPLC followed by sequencing to determine the nature of the variant. Results and Conclusion A total of 56 variants were identified in the three materials combined. A borderline significant association with breast cancer risk was found for the 1229 T>C (Val>Ala substitution in exon 11 (P-value 0.055 between the Norwegian controls and breast cancer patients as well as a borderline significant difference in haplotype distribution (P-value 0.06. Adverse side effects, such as: development of costal fractures and telangiectasias, subcutaneous and lung fibrosis, pleural thickening and atrophy were evaluated in the Norwegian patients. Significant associations were found for several of the identified variants such as rs1800058 (Leu > Phe where a decrease in minor allele frequency was found with increasing level of adverse side effects for the clinical end-points pleural thickening and lung fibrosis, thus giving a protective effect. Overall our results indicate a role for variation in the ATM gene both for risk of developing breast cancer, and in radiation induced adverse side effects. No association could be found between risk of developing ipsilateral breast tumour

  14. Association analysis of bovine Foxa2 gene single sequence variant and haplotype combinations with growth traits in Chinese cattle.

    Science.gov (United States)

    Liu, Mei; Li, Mijie; Wang, Shaoqiang; Xu, Yao; Lan, Xianyong; Li, Zhuanjian; Lei, Chuzhao; Yang, Dongying; Jia, Yutang; Chen, Hong

    2014-02-25

    Forkhead box A2 (Foxa2) has been recognized as one of the most potent transcriptional activators that is implicated in the control of feeding behavior and energy homeostasis. However, similar researches about the effects of genetic variations of Foxa2 gene on growth traits are lacking. Therefore, this study detected Foxa2 gene polymorphisms by DNA pool sequencing, PCR-RFLP and PCR-ACRS methods in 822 individuals from three Chinese cattle breeds. The results showed that four sequence variants (SVs) were screened, including two mutations (SV1, g. 7005 C>T and SV2, g. 7044 C>G) in intron 4, one mutation (SV3, g. 8449 A>G) in exon 5 and one mutation (SV4, g. 8537 T>C) in the 3'UTR. Notably, association analysis of the single mutations with growth traits in total individuals (at 24months) revealed that significant statistical difference was found in four SVs, and SV4 locus was highly significantly associated with growth traits throughout all three breeds (PFoxa2 gene that was predictive of molecular markers in cattle breeding for the first time. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. HLA-DRB1*07:01-HLA-DQA1*02:01-HLA-DQB1*02:02 haplotype is associated with a high risk of asparaginase hypersensitivity in acute lymphoblastic leukemia.

    Science.gov (United States)

    Kutszegi, Nóra; Yang, Xiaoqing; Gézsi, András; Schermann, Géza; Erdélyi, Dániel J; Semsei, Ágnes F; Gábor, Krisztina M; Sági, Judit C; Kovács, Gábor T; Falus, András; Zhang, Hongyun; Szalai, Csaba

    2017-09-01

    Hypersensitivity reactions are the most frequent dose-limiting adverse reactions to Escherichia coli -derived asparaginase in pediatric acute lymphoblastic leukemia (ALL) patients. The aim of the present study was to identify associations between sequence-based Human Leukocyte Antigen Class II region alleles and asparaginase hypersensitivity in a Hungarian ALL population. Four-digit typing of HLA-DRB1 and HLA-DQB1 loci was performed in 359 pediatric ALL patients by using next-generation sequencing method. Based on genotypic data of the two loci, haplotype reconstruction was carried out. In order to investigate the possible role of the HLA-DQ complex, the HLA-DQA1 alleles were also inferred. Multivariate logistic regression analysis and a Bayesian network-based approach were applied to identify relevant genetic risk factors of asparaginase hypersensitivity. Patients with HLA-DRB1*07:01 and HLA-DQB1*02:02 alleles had significantly higher risk of developing asparaginase hypersensitivity compared to non-carriers [ P =4.56×10 -5 ; OR=2.86 (1.73-4.75) and P =1.85×10 -4 ; OR=2.99 (1.68-5.31); n=359, respectively]. After haplotype reconstruction, the HLA-DRB1*07:01-HLA-DQB1*02:02 haplotype was associated with an increased risk. After inferring the HLA-DQA1 alleles the HLA-DRB1*07:01-HLA-DQA1*02:01-HLA-DQB1*02:02 haplotype was associated with the highest risk of asparaginase hypersensitivity [ P =1.22×10 -5 ; OR=5.00 (2.43-10.29); n=257]. Significantly fewer T-cell ALL patients carried the HLA-DQB1*02:02 allele and the associated haplotype than did pre-B-cell ALL patients (6.5%; vs. 19.2%, respectively; P =0.047). In conclusion, we identified a haplotype in the Human Leukocyte Antigen Class II region associated with a higher risk of asparaginase hypersensitivity. Our results confirm that variations in HLA-D region might influence the development of asparaginase hypersensitivity. Copyright© 2017 Ferrata Storti Foundation.

  16. The association of the HLA-A*24:02, B*39:01 and B*39:06 alleles with type 1 diabetes is restricted to specific HLA-DR/DQ haplotypes in Finns.

    Science.gov (United States)

    Mikk, M-L; Heikkinen, T; El-Amir, M I; Kiviniemi, M; Laine, A-P; Härkönen, T; Veijola, R; Toppari, J; Knip, M; Ilonen, J

    2017-04-01

    We analysed the previously reported association of the HLA-A*24:02, B*18 and B*39 alleles with type 1 diabetes and diabetes associated autoimmunity in the Finnish population applying HLA-DR/DQ stratification. Haplotype transmission was analysed in 2424 nuclear families from the Finnish Paediatric Diabetes Register. Survival analysis was applied to study the development of islet autoantibodies and further progression to clinical diabetes in the prospective follow-up cohort from the Finnish Type 1 Diabetes Prediction and Prevention (DIPP) Study. The subjects were genotyped for specific HLA class I alleles by sequence-specific hybridization using lanthanide labelled nucleotide probes. The HLA-B*39:06 allele was found almost exclusively on the (DR8)-DQB1*04 haplotype in which its presence changed the disease risk status of the whole haplotype from neutral to predisposing. The HLA-A*24:02 and the B*39:01 alleles increased the diabetes-associated risk of the DRB1*04:04-DQA1*03-DQB1*03:02 haplotype but the alleles were in linkage disequilibrium and no independent effect could be detected. Within the DIPP cohort, neither the A*24:02 nor the B*39:01 allele were associated with seroconversion but were in contrast associated with increased progression from seroconversion to clinical disease. The independent predisposing effect of the HLA-B*39:06 allele with type 1 diabetes was confirmed in the Finnish population but the association of the A*24:02 and B*39:01 alleles remained inconclusive whilst both A*24:02 and B*39:01 affected the progression rate from seroconversion to autoantibody positivity to overt type 1 diabetes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR

    Directory of Open Access Journals (Sweden)

    Tyson Jess

    2012-12-01

    Full Text Available Abstract Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  18. Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.

    Science.gov (United States)

    Tyson, Jess; Armour, John A L

    2012-12-11

    Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.

  19. Polymorphism in the upstream regulatory region of DQA1 genes and DRB1, QAP, DQA1, and DQB1 haplotypes in the German population.

    Science.gov (United States)

    Haas, J P; Kimura, A; Andreas, A; Hochberger, M; Keller, E; Brünnler, G; Bettinotti, M P; Nevinny-Stickel, C; Hildebrandt, B; Sierp, G

    1994-01-01

    Polymorphism in the URR of the MHC class II DQA1 gene defines ten different alleles named QAP. Oligotyping for the alleles of DRB1, QAP, DQA1, and DQB1 have been performed in 210 unrelated healthy controls from Germany. Moreover, 83 HTCs from the Tenth IHWS have been tested. Four point loci haplotypes (DRB1, QAP, DQA1, and DQB1) have been analyzed in the unrelated healthy population sample. Computer analysis of the linkage disequilibria leads to the conclusion that QAP alleles are in strong linkage disequilibrium with alleles either the DQA1 or the DRB1 locus. One typical ("common") haplotype was found to be associated with each DRB1 allele in the majority (86%) of the tested persons. Apart from that, 25 other less frequent ("unusual") haplotypes, with an overall frequency of 14% have been defined. Some of these "unusual" MHC class II haplotypes were found to differ only in the regulatory alleles of DQA1 (QAP alleles) while they are identical for the alleles coding for structural elements (DRB1, DQA1, and DQB1). Most of the "unusual" haplotypes were found to carry HLA-DQ6. Assuming that "unusual" (= rare) haplotypes have arisen from "common" (= frequent) haplotypes by point mutation and recombination, we propose the existence of three recombination sites in the MHC DR-DQ region: one between DRB1 and QAP, the second between QAP and DQA1, and the third between DQA1 and DQB1.

  20. Structural insertion/deletion variation in IRF5 is associated with a risk haplotype and defines the precise IRF5 isoforms expressed in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Kozyrev, Sergey V; Lewén, Susanna; Reddy, Prasad M V Linga

    2007-01-01

    interaction domain. The insertion segregates in the risk haplotype with the high expression allele of a poly(A) site SNP no. rs10954213 and the exon 1B donor splice allele of the 5'-UTR SNP no. rs2004640. The poly(A) polymorphism correlated with levels of IRF5 in cells stimulated with interferon...

  1. Haplotype association between haptoglobin (Hp2 and Hp promoter SNP (A-61C may explain previous controversy of haptoglobin and malaria protection.

    Directory of Open Access Journals (Sweden)

    Sharon E Cox

    2007-04-01

    Full Text Available Malaria is one of the strongest recent selective pressures on the human genome, as evidenced by the high levels of varying haemoglobinopathies in human populations-despite the increased risk of mortality in the homozygous states. Previously, functional polymorphisms of Hp, coded by the co-dominant alleles Hp1 and Hp2, have been variously associated with several infectious diseases, including malaria susceptibility.Risk of a clinical malarial episode over the course of a malarial transmission season was assessed using active surveillance in a cohort of Gambian children aged 10-72 months. We report for the first time that the major haplotype for the A-61C mutant allele in the promoter of haptoglobin (Hp-an acute phase protein that clears haemoglobin released from haemolysis of red cells-is associated with protection from malarial infection in older children, (children aged >or=36 months, >500 parasites/ul and temperature >37.5 degrees C; OR = 0.42; [95% CI 0.24-0.73] p = 0.002 (lr test for interaction, or=36 months, p = 0.014. Protection was also observed using two other definitions, including temperature >37.5 degrees C, dipstick positive, plus clinical judgement of malaria blinded to dipstick result (all ages, OR = 0.48, [95% CI 0.30-0.78] p = 0.003; >or=36 months, OR = 0.31, [95% CI 0.15-0.62] p = 0.001. A similar level of protection was observed for the known protective genetic variant, sickle cell trait (HbAS.We propose that previous conflicting results between Hp phenotypes/genotypes and malaria susceptibility may be explained by differing prevalence of the A-61C SNP in the populations studied, which we found to be highly associated with the Hp2 allele. We report the -61C allele to be associated with decreased Hp protein levels (independent of Hp phenotype, confirming in vitro studies. Decreased Hp expression may lead to increased oxidant stress and increased red cell turnover, and facilitate the development of acquired immunity, similar to

  2. Building a Strong Library Association: A Case of the Ghana Library ...

    African Journals Online (AJOL)

    The author explores ways of building a strong library association with specific reference to the Ghana Library Association. The paper states that library associations represent librarians and libraries that provide valuable services to them and their communities. The different types of library associations are discussed.

  3. MHC haplotype diversity in Persian Arabian horses determined using polymorphic microsatellites.

    Science.gov (United States)

    Sadeghi, R; Moradi-Shahrbabak, Mohammad; Miraei Ashtiani, S R; Miller, D C; Antczak, Douglas F

    2017-11-23

    Previous research on the equine major histocompatibility complex (MHC) demonstrated strong correlations between haplotypes defined by polymorphic intra-MHC microsatellites and haplotypes defined using classical serology. Here, we estimated MHC diversity in a sample of 124 Arabian horses from an endangered strain native to Iran (Persian Asil Arabians), using a validated 10-marker microsatellite panel. In a group of 66 horses related as parent-offspring pairs or half-sibling groups, we defined 51 MHC haplotypes, 49 of which were new. In 47 of the remaining 58 unrelated horses, we could assign one previously identified MHC haplotype, and by default, we gave provisional haplotype status to the remaining constellation of microsatellite alleles. In these horses, we found 21 haplotypes that we had previously defined and 31 provisional haplotypes, two of which had been identified in an earlier study. This gave a total of 78 new MHC haplotypes. The final 11 horses were MHC heterozygotes that we could not phase using information from any of the previously validated or provisional haplotypes. However, we could determine that these horses carried a total of 22 different undefined haplotypes. In the overall population sample, we detected three homozygous horses and one maternally inherited recombinant from 21 informative segregations. Virtually all of the horses tested were MHC heterozygotes, and most unrelated horses (98%) were heterozygous for rare microsatellite-defined haplotypes found less than three times in the sampled horses. This is evidence for a very high level of MHC haplotype variation in the Persian Asil Arabian horse.

  4. Are markers of inflammation more strongly associated with risk for fatal than for nonfatal vascular events?

    LENUS (Irish Health Repository)

    Sattar, Naveed

    2009-06-23

    Circulating inflammatory markers may more strongly relate to risk of fatal versus nonfatal cardiovascular disease (CVD) events, but robust prospective evidence is lacking. We tested whether interleukin (IL)-6, C-reactive protein (CRP), and fibrinogen more strongly associate with fatal compared to nonfatal myocardial infarction (MI) and stroke.

  5. Are molecular haplotypes worth the time and expense? A cost-effective method for applying molecular haplotypes.

    Directory of Open Access Journals (Sweden)

    Mark A Levenstien

    2006-08-01

    Full Text Available Because current molecular haplotyping methods are expensive and not amenable to automation, many researchers rely on statistical methods to infer haplotype pairs from multilocus genotypes, and subsequently treat these inferred haplotype pairs as observations. These procedures are prone to haplotype misclassification. We examine the effect of these misclassification errors on the false-positive rate and power for two association tests. These tests include the standard likelihood ratio test (LRTstd and a likelihood ratio test that employs a double-sampling approach to allow for the misclassification inherent in the haplotype inference procedure (LRTae. We aim to determine the cost-benefit relationship of increasing the proportion of individuals with molecular haplotype measurements in addition to genotypes to raise the power gain of the LRTae over the LRTstd. This analysis should provide a guideline for determining the minimum number of molecular haplotypes required for desired power. Our simulations under the null hypothesis of equal haplotype frequencies in cases and controls indicate that (1 for each statistic, permutation methods maintain the correct type I error; (2 specific multilocus genotypes that are misclassified as the incorrect haplotype pair are consistently misclassified throughout each entire dataset; and (3 our simulations under the alternative hypothesis showed a significant power gain for the LRTae over the LRTstd for a subset of the parameter settings. Permutation methods should be used exclusively to determine significance for each statistic. For fixed cost, the power gain of the LRTae over the LRTstd varied depending on the relative costs of genotyping, molecular haplotyping, and phenotyping. The LRTae showed the greatest benefit over the LRTstd when the cost of phenotyping was very high relative to the cost of genotyping. This situation is likely to occur in a replication study as opposed to a whole-genome association study.

  6. [The role of different KIR haplotypes in haplo-identical hematopoietic stem cell transplantation].

    Science.gov (United States)

    Bao, Xiaojing; He, Jun; Wang, Miao; Yuan, Xiaoni; Li, Yang; Zhang, Tengteng; Li, Lingjie; Chen, Luyao; Wu, Depei

    2016-01-01

    To investigate the role of different immunoglobulin- like receptor (KIR)haplotypes in haplo- identical hematopoietic stem cell transplantation (HSCT). Killer cell KIR genotyping was performed on 468 individuals from 156 unrelated families by PCR-SSP. A total of 624 KIR haplotypes from the parents were used for haplotype analysis. Ninety-two patients received haplo-identical HSCT from one of the parents. The family study showed segregation of one A haplotype and at least 20 unique B haplotypes. The frequency of haplotype A was 72.92% (455/624). The most commonly observed haplotypes in group B were B1, B2, and B3, present at a frequency of 10.26%, 5.77%, and 4.48%, respectively. Compared to KIR gene matched donors (n=17), grafts from KIR gene mismatched donors (n= 14) had a positive effect on survival after haplo- identical HSCT for AML/MDS patients (OS: 88.2%vs 42.9%,P=0.015; RFS: 88.2%vs 35.7%,P=0.007). No effect was observed for ALL/NHL patients (OS: 76.0%vs 75.0%,P=0.727; RFS: 68.0%vs 65.0%,P=0.866). A significantly lower survival rate was observed for transplants from AA (n=52) and AB1/AB2 donors (n=15), compared to other group Bx donors (n=25) (OS: 53.3%vs 96.0%,P=0.017; RFS: 53.3%vs 92.0%,P=0.019). Meanwhile, the risk of relapse was much higher in AA group (n=52) compared to Bx group (n=40) (25.0%vs 5.0%,P=0.009). A higher risk of TRM was observed in AB1/AB2 group (P=0.012). In addition, transplant from donors carried Cen-B was associated with an increased survival compared with Cen-A homozygous donors (OS: 94.7%vs 68.5%,P=0.036; RFS: 89.5%vs 64.4%,P=0.045). Overall, KIR genotyping and haplotype analyses should be useful for selection of the most optimal donors with favorable KIR gene grafts. KIR gene mismatch donors should be preferred for AML/MDS patients. Selecting donors carried Cen- B and avoiding the selection of donors of KIR genotype AA/AB1/AB2 was strongly advisable for haplo-identical HSCT.

  7. Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.

    Science.gov (United States)

    Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N

    2017-01-01

    Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast

  8. Highly conserved extended haplotypes of the major histocompatibility complex and their relationship to multiple sclerosis susceptibility.

    Directory of Open Access Journals (Sweden)

    Douglas S Goodin

    Full Text Available To determine the relationship between highly-conserved extended-haplotypes (CEHs in the major histocompatibility complex (MHC and MS-susceptibility.Among the ~200 MS-susceptibility regions, which are known from genome-wide analyses of single nucleotide polymorphisms (SNPs, the MHC accounts for roughly a third of the currently explained variance and the strongest MS-associations are for certain Class II alleles (e.g., HLA-DRB1*15:01; HLA-DRB1*03:01; and HLA-DRB1*13:03, which frequently reside on CEHs within the MHC.Autosomal SNPs (441,547 from 11,376 MS cases and 18,872 controls in the WTCCC dataset were phased. The most significant MS associated SNP haplotype was composed of 11 SNPs in the MHC Class II region surrounding the HLA-DRB1 gene. We also phased alleles at the HLA-A, HLA-C, HLA-B, HLA-DRB1, and HLA-DQB1 loci. This data was used to probe the relationship between CEHs and MS susceptibility.We phased a total of 59,884 extended haplotypes (HLA-A, HLA-C, HLA-B, HLA-DRB1, HLA-DQB1 and SNP haplotypes from 29,942 individuals. Of these, 10,078 unique extended haplotypes were identified. The 10 most common CEHs accounted for 22% (13,302 of the total. By contrast, the 8,446 least common extended haplotypes also accounted for approximately 20% (12,298 of the total. This extreme frequency-disparity among extended haplotypes necessarily complicates interpretation of reported disease-associations with specific HLA alleles. In particular, the HLA motif HLA-DRB1*15:01~HLA-DQB1*06:02 is strongly associated with MS risk. Nevertheless, although this motif is almost always found on the a1 SNP haplotype, it can rarely be found on others (e.g., a27 and a36, and, in these cases, it seems to have no apparent disease-association (OR = 0.7; CI = 0.3-1.3 and OR = 0.7; CI = 0.2-2.2, respectively. Furthermore, single copy carriers of the a1 SNP-haplotype without this HLA motif still have an increased disease risk (OR = 2.2; CI = 1.2-3.8. In addition, even among the

  9. A case report of fulminant type 1 diabetes mellitus associated with drug-induced hypersensitivity syndrome in an elderly patient with coxsackie B4 virus infection and human leukocyte antigen-A24 haplotype.

    Science.gov (United States)

    Takeno, Ayumu; Kanazawa, Ippei; Morita, Miwa; Takedani, Kai; Miyake, Hitomi; Yamamoto, Masahiro; Nogami, Kyoko; Kaneko, Sakae; Sugimoto, Toshitsugu

    2018-01-30

    Drug-induced hypersensitivity syndrome (DIHS) is a severe systemic adverse drug reaction. Previous studies showed that DIHS is associated with the onset of fulminant type 1 diabetes mellitus (FT1D). Although genetic background and abnormalities in immune response or viral infection are considered to be associated with pathogenesis of FT1D, it remains unclear whether virus infection and specific human leukocyte antigen (HLA) typing are involved in DIHS-associated FT1D. Here, we report a case of a 78-year-old female patient with FT1D after DIHS treatment. She was diagnosed as DIHS caused by carbamazepine, and treatment with predonisolone was initiated. After 46 days from the occurrence of DIHS, she was admitted to our hospital because of type 1 diabetes mellitus and diabetic ketoacidosis. Although her Hemoglobin A1c (HbA1c) was elevated by predonisolone treatment (HbA1c: 9.2%), we diagnosed her as fulminant type 1 diabetes mellitus considering the abrupt onset of the ketoacidosis. Her general condition was improved by treatment with fluid infusion and insulin administration. During her clinical course, the infection of coxsackie B4 virus was observed. In addition, the examination of HLA typing showed HLA-A24 haplotype. These findings suggest that the coxsackie B4 virus infection may be involved in the pathogenesis of DIHS-induced FT1D, and that HLA-A24 haplotype might relate to DIHS-associated FT1D.

  10. Haplotype allelic classes for detecting ongoing positive selection

    Directory of Open Access Journals (Sweden)

    Lefebvre Jean-François

    2010-01-01

    Full Text Available Abstract Background Natural selection eliminates detrimental and favors advantageous phenotypes. This process leaves characteristic signatures in underlying genomic segments that can be recognized through deviations in allelic or haplotypic frequency spectra. To provide an identifiable signature of recent positive selection that can be detected by comparison with the background distribution, we introduced a new way of looking at genomic polymorphisms: haplotype allelic classes. Results The model combines segregating sites and haplotypic information in order to reveal useful data characteristics. We developed a summary statistic, Svd, to compare the distribution of the haplotypes carrying the selected allele with the distribution of the remaining ones. Coalescence simulations are used to study the distributions under standard population models assuming neutrality, demographic scenarios and selection models. To test, in practice, haplotype allelic class performance and the derived statistic in capturing deviation from neutrality due to positive selection, we analyzed haplotypic variation in detail in the locus of lactase persistence in the three HapMap Phase II populations. Conclusions We showed that the Svd statistic is less sensitive than other tests to confounding factors such as demography or recombination. Our approach succeeds in identifying candidate loci, such as the lactase-persistence locus, as targets of strong positive selection and provides a new tool complementary to other tests to study natural selection in genomic data.

  11. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-01-01

    Abstract Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited. We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms. In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D’ and r2 values were 0.883 and 0.143, respectively. In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs. PMID:27902594

  12. Phenotypic and genetic effects of recessive haplotypes on yield, longevity, and fertility.

    Science.gov (United States)

    Cole, J B; Null, D J; VanRaden, P M

    2016-09-01

    Phenotypes from the August 2015 US national genetic evaluation were used to compute phenotypic effects of 18 recessive haplotypes in Ayrshire (n=1), Brown Swiss (n=5), Holstein (n=10), and Jersey (n=2) cattle on milk, fat, and protein yields, somatic cell score (SCS), single-trait productive life (PL), daughter pregnancy rate (DPR), heifer conception rate (HCR), and cow conception rate (CCR). The haplotypes evaluated were Ayrshire haplotype 1, Brown Swiss haplotypes 1 and 2, spinal dysmyelination, spinal muscular atrophy, Weaver Syndrome, brachyspina, Holstein cholesterol deficiency, Holstein haplotypes 1 to 5, bovine leukocyte adhesion deficiency, complex vertebral malformation, mulefoot (syndactyly), and Jersey haplotypes 1 and 2. When causal variants are unknown and tests are based only on single nucleotide polymorphism haplotypes, it can sometimes be difficult to accurately determine carrier status. For example, 2 Holstein haplotypes for cholesterol deficiency have the same single nucleotide polymorphism genotype, but only one of them carries the causative mutation. Genotyped daughters of carrier bulls included in the analysis ranged from 8 for Weaver Syndrome to 17,869 for Holstein haplotype 3. Lactation records preadjusted for nongenetic factors and direct genomic values (DGV) were used to estimate phenotypic and genetic effects of recessive haplotypes, respectively. We found no phenotypic or genetic differences between carriers and noncarriers of Ayrshire or Brown Swiss defects. Several associations were noted for Holstein haplotypes, including fat and HCR for Holstein haplotype 0 carriers; milk, protein, SCS, PL, and fertility for Holstein haplotype 1; protein, PL, CCR, and HCR for Holstein haplotype 2; milk, protein, and fertility for Holstein haplotype 4; and protein yield and DPR for Holstein haplotype 5. There were no differences among bovine leukocyte adhesion deficiency carriers, but complex vertebral malformation affected fat yield and mulefoot

  13. <strong/>Costs and benefits of cold acclimation in field released DrosophilaAssociating laboratory and field results<strong>. strong>

    DEFF Research Database (Denmark)

    Overgaard, Johannes; Sørensen, Jesper Givskov; A. Hoffmann, Ary

    2008-01-01

    Physiological and evolutionary responses to thermal variation are often investigated under controlled laboratory conditions. However, this approach may fail to account for the complexity of natural environments. Here we investigated the costs and benefits of developmental or adult cold acclimation...... that the ability to locate a field resource has a genetic basis with a high heritability since only round of selection on parental flies (F0) revealed clear differences in the ability of offspring (F1 and F2) to locate field resources at cold temperatures. Again we found a poor association between field...... and laboratory performance emphasising the importance of testing thermal resistance under relevant/natural conditions....

  14. Strong association of the SNP rs17822931 with wet earwax and ...

    Indian Academy of Sciences (India)

    and Peking Union Medical College, Beijing 100005, People's Republic of China. 3Department of Human Genetics, Emory University School of Medicine, Atlanta, GA 30322, USA. [Shang D., Zhang X., Sun M., Wei Y. and Wen Y. 2013 Strong association of the SNP rs17822931 with wet earwax and bromhidrosis in a.

  15. Strong but variable associations between social dominance and clutch sex ratio in a colonial corvid

    NARCIS (Netherlands)

    Salomons, H. M.; Dijkstra, C.; Verhulst, S.

    2008-01-01

    We studied primary sex ratio of clutches in relation to social dominance for 6 years in a colony of free-living jackdaws, a small corvid. Social dominance was strongly associated with clutch sex ratio, with the difference in clutch sex ratio between the most and least dominant pairs being 30-40%. To

  16. The association between APOA5 haplotypes and plasma lipids is not modified by energy or fat intake: the Czech HAPIEE study.

    Science.gov (United States)

    Hubacek, J A; Peasey, A; Kubinova, R; Pikhart, H; Bobak, M

    2014-03-01

    Several smaller studies reported interactions between dietary factors and apolipoprotein A5 (APOA5) gene polymorphisms in determination of plasma lipids. We tested interactions between APOA5 haplotypes and dietary intake in determination of plasma triglycerides (TG) and other lipids. Participants (5487 males and females aged 45-69) were classified according to the number (0, 1, 2+) of minor APOA5 alleles (using T-1131 > C; rs662799 and Ser19 > Trp; rs3135506 polymorphisms) and into three groups of low (bottom 25%), medium (26th-75th percentile) and high (top 25%) of intake of total energy and total, saturated and polyunsaturated fats, assessed by food frequency questionnaire. The age-sex adjusted geometric means of plasma TG increased with the number of minor alleles, from 1.57 (standard error 0.01), to 1.79 (0.02) to 2.29 (0.10) mmol/L (p intake (p = 0.251). TG concentrations were highest in subjects with the combination of 2+ minor alleles and the highest energy intake (mean 2.59 [0.19], compared with 1.62 [0.03] in subjects with lowest energy intake and no minor allele) but the interaction between energy intake and APOA5 haplotypes was not statistically significant (p = 0.186). Analogous analyses with total, saturated and polyunsaturated fat intake yielded similar nonsignificant results. Effects of APOA5 and dietary intakes on total and HDL cholesterol were weaker and no interactions were significant. In this Slavic Caucasian population sample, we did not detect the hypothesized interaction between common SNPs within the APOA5 gene and diet in determination of blood lipids. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Dimensional Anxiety Mediates Linkage of GABRA2 Haplotypes With Alcoholism

    Science.gov (United States)

    Enoch, Mary-Anne; Schwartz, Lori; Albaugh, Bernard; Virkkunen, Matti; Goldman, David

    2015-01-01

    The GABAAα2 receptor gene (GABRA2) modulates anxiety and stress response. Three recent association studies implicate GABRA2 in alcoholism, however in these papers both common, opposite-configuration haplotypes in the region distal to intron3 predict risk. We have now replicated the GABRA2 association with alcoholism in 331 Plains Indian men and women and 461 Finnish Caucasian men. Using a dimensional measure of anxiety, harm avoidance (HA), we also found that the association with alcoholism is mediated, or moderated, by anxiety. Nine SNPs were genotyped revealing two haplotype blocks. Within the previously implicated block 2 region, we identified the two common, opposite-configuration risk haplotypes, A and B. Their frequencies differed markedly in Finns and Plains Indians. In both populations, most block 2 SNPs were significantly associated with alcoholism. The associations were due to increased frequencies of both homozygotes in alcoholics, indicating the possibility of alcoholic subtypes with opposite genotypes. Congruently, there was no significant haplotype association. Using HA as an indicator variable for anxiety, we found haplotype linkage to alcoholism with high and low dimensional anxiety, and to HA itself, in both populations. High HA alcoholics had the highest frequency of the more abundant haplotype (A in Finns, B in Plains Indians); low HA alcoholics had the highest frequency of the less abundant haplotype (B in Finns, A in Plains Indians) (Finns: P α0.007, OR α2.1, Plains Indians: P α0.040, OR α1.9). Non-alcoholics had intermediate frequencies. Our results suggest that within the distal GABRA2 region is a functional locus or loci that may differ between populations but that alters risk for alcoholism via the mediating action of anxiety. PMID:16874763

  18. Updated listing of haplotypes at the human phenylalanine hydroxylase (PAH) locus

    Energy Technology Data Exchange (ETDEWEB)

    Eisensmith, R.C.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (United States))

    1992-12-01

    Analysis of mutant PAH chromosomes has identified approximately 60 different single-base substitutions and deletions within the PAH locus. Nearly all of these molecular lesions are in strong linkage disequilibrium with specific RFLP haplotypes in different ethnic populations. Thus, haplotype analysis is not only useful for diagnostic purposes but is proving to be a valuable tool in population genetic studies of the origin and spread of phenylketonuria alleles in human populations. PCR-based methods have been developed to detect six of the eight polymorphic restriction sites used for determination of RFLP haplotypes at the PAH locus. A table of the proposed expanded haplotypes is given.

  19. Haplotype and genotype effects of the F7 gene on circulating factor VII, coagulation activation markers and incident coronary heart disease in UK men.

    Science.gov (United States)

    Ken-Dror, G; Drenos, F; Humphries, S E; Talmud, P J; Hingorani, A D; Kivimäki, M; Kumari, M; Bauer, K A; Morrissey, J H; Ireland, H A

    2010-11-01

    Evidence for the associations of single nucleotide polymorphisms (SNPs) in the F7 gene and factor (F)VII levels and with risk of coronary heart disease (CHD) is inconsistent. We examined whether F7 tagging SNPs (tSNPs) and haplotypes were associated with FVII levels, coagulation activation markers (CAMs) and CHD risk in two cohorts of UK men. Genotypes for eight SNPs and baseline levels of FVIIc, FVIIag and CAMs (including FVIIa) were determined in 2773 healthy men from the Second Northwick Park Heart Study (NPHS-II). A second cohort, Whitehall II study (WH-II, n = 4055), was used for replication analysis of FVIIc levels and CHD risk. In NPHS-II the minor alleles of three SNPs (rs555212, rs762635 and rs510317; haplotype H2) were associated with higher levels of FVIIag, FVIIc and FVIIa, whereas the minor allele for two SNPs (I/D323 and rs6046; haplotype H5) was associated with lower levels. Adjusted for classic risk factors, H2 carriers had a CHD hazard ratio of 1.34 [95% confidence interval (CI): 1.12-1.59; independent of FVIIc], whereas H5 carriers had a CHD risk of 1.29 (95% CI: 1.01-1.56; not independent of FVIIc) and significantly lower CAMs. Effects of haplotypes on FVIIc levels were replicated in WH-II, as was the association of H5 with higher CHD risk [pooled-estimate odds ratio (OR) 1.16 (1.00-1.36), P = 0.05], but surprisingly, H2 exhibited a reduced risk for CHD.  tSNPs in the F7 gene strongly influence FVII levels. The haplotype associated with low FVIIc level, with particularly reduced functional activity, was consistently associated with increased risk for CHD, whereas the haplotype associated with high FVIIc level was not. © 2010 International Society on Thrombosis and Haemostasis.

  20. Association between Eight Functional Polymorphisms and Haplotypes in the Cholesterol Ester Transfer Protein (CETP) Gene and Dyslipidemia in National Minority Adults in the Far West Region of China.

    Science.gov (United States)

    Guo, Shuxia; Hu, Yunhua; Ding, Yusong; Liu, Jiaming; Zhang, Mei; Ma, Rulin; Guo, Heng; Wang, Kui; He, Jia; Yan, Yizhong; Rui, Dongsheng; Sun, Feng; Mu, Lati; Niu, Qiang; Zhang, Jingyu; Li, Shugang

    2015-12-16

    We have investigated the relationship between the polymorphisms and haplotypes in the CETP gene, and dyslipidemia among the Xinjiang Kazak and Uyghur populations in China. A total of 712 patients with dyslipidemia and 764 control subjects of CETP gene polymorphism at rs12149545, rs3764261, rs1800775, rs711752, rs708272, rs289714, rs5882, and rs1801706 loci were studied by the Snapshot method, linkage disequilibrium analysis and haplotype construction. The results are as follows: (1) the minor allele of eight loci of frequencies in the two groups were different from other results of similar studies in other countries; (2) In the linear regression analysis, the HDL-C levels of rs708272 TT, rs1800775 AA, rs289714 CC and rs711752 AA genotypes were significantly higher than those of other genotypes, however, the rs3764261 GG and rs12149545 GG genotypes were significantly lower than those of other genotypes in the two ethnic groups. The HDL-C levels of the rs12149545 GG genotype were lower than those of other genotypes; (3) in the control group, the rs708272 CT genotype of TG levels were lower than in the CC genotype, the T genotype of LDL-C levels were lower than in the CC genotype, and the HDL-C levels were higher than in the CT genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype, the rs711752 AG genotype of TG levels were lower than in the GG genotype, the AA genotype LDL-C levels were lower than in the GG genotype, and the HDL-C levels were higher than in the AG genotype; the rs1800775 AC genotype of TG levels were higher than in the AA genotype. In the dyslipidemia group, the rs708272 TT genotype of TC and LDL-C levels were higher than in the CT genotype and the rs3764261 TT genotype of TC levels were higher than in the GG genotype. The rs711752 AA genotype of TC and LDL-C levels were higher than in the AG genotype, and the rs12149545 AA genotype of TC and LDL-C levels were higher than in the GG genotype; (4) perfect Linkage

  1. Strong human association with plant invasion success for Trifolium introductions to New Zealand.

    Science.gov (United States)

    Gravuer, Kelly; Sullivan, Jon J; Williams, Peter A; Duncan, Richard P

    2008-04-29

    It has proven difficult, when focused only on biological determinants, to explain why some plant species become naturalized in or invade new locations, whereas others fail. We analyzed the invasion of Trifolium (true clover) species into New Zealand, assessing a range of human, biogeographic, and biological influences at three key invasion stages: introduction, naturalization, and spread. We used sparse principal component analysis (SPCA) to define suites of related attributes and aggregated boosted trees to model relationships with invasion outcomes. Human and biogeographic attributes were strongly associated with success at all stages. Whereas biogeographic attributes, notably large native range, were consistently associated with success, different human factors appeared to favor success at different stages, such as presence in early trade/immigration hotspots (introduction), intentional large-scale planting (naturalization), and frequent presence as a seed contaminant (relative spread rate). Biological traits were less strongly associated with success for introduction and spread and little if at all for naturalization; we found that tall perennials with long flowering periods were more frequently selected for introduction, whereas species with extended flowering in New Zealand spread more rapidly. In addition to causal relationships, the importance of human factors may reflect indirect associations, including ecological traits associated with both human use and invasion. Nevertheless, our results highlight key roles that humans can play in facilitating plant invasion via two pathways: (i) commercial introduction leading to widespread planting and concomitant naturalization and spread and (ii) unintentional introduction and spread of species associated with human activities, such as seed contaminants.

  2. Phenotypic plasticity in an ant with strong caste-genotype association.

    Science.gov (United States)

    Kuhn, Alexandre; Darras, Hugo; Aron, Serge

    2018-01-01

    Caste determination in social Hymenoptera (whether a female egg develops into a reproductive queen or a sterile worker) is a remarkable example of phenotypic plasticity where females with highly similar genomes exhibit striking differences in morphology and behaviour. This phenotypic dichotomy is typically influenced by environmental factors. However, recent studies have revealed a strong caste-genotype association in hybridogenetic ants: workers are all interlineage hybrids while queens are all purebred, suggesting that female caste fate is genetically determined. Using the hybridogenetic ant Cataglyphis mauritanica , we show that under laboratory conditions, purebred offspring develop into reproductive queens but occasionally give rise to workers. Moreover, while hybrids typically become workers, juvenile hormone treatment can switch their developmental pathway to the reproductive caste. These results indicate that phenotypic plasticity has been retained in an ant with a strong caste-genotype association, despite its lack of expression in natural conditions. © 2018 The Author(s).

  3. The rare HLA-DQA1*03-DQB1*02 haplotype confers susceptibility to type 1 diabetes in whites and is preferentially associated with early clinical disease onset in male subjects.

    Science.gov (United States)

    van Autreve, Jan E; Weets, Ilse; Gulbis, Béatrice; Vertongen, Françoise; Gorus, Frans K; van der Auwera, Bart J

    2004-07-01

    The heterozygous combination of DQA1*03-DQB1*0302 (DQ8) and DQA1*05-DQB1*0201 (DQ2) confers the highest known HLA-DQ-linked risk for type 1 diabetes, suggesting a role for transcomplementation. The trans-heterodimer encoded by DQA1*03 and DQB1*02 is also rarely observed in cis in whites. Islet antibody-positive diabetic patients (P; n = 2,238) and control subjects (C; n = 2,223) of white descent were genotyped by a HLA-DQA1-DQB1 dot-blot method. The presence of the DQA1*03-DQB1*02 haplotype was observed in 22 patients (1%) versus 6 controls (0.3%) (odds ratio [OR] = 3.7, p = 0.005). It was more prevalent in whites of Northern African descent, but both in European (n = 3,813) and in Northern African whites (n = 648), the DQA1*03-DQB1*02 haplotype tended to be associated with diabetes (respectively, P 0.3% vs. C 0.03%, OR = 12.2, p = 0.005; and P 2.1% vs. C 0.6%, OR = 3.8, p = 0.03). DRB1 typing revealed that DQA1*03-DQB1*02 is usually associated with the DRB1*0405 risk allele in European patients and with DRB1*0405, DRB1*07 and DRB1*09 in Northern African whites. Like in DQ2/DQ8-positive patients, the presence of DQA1*03-DQB1*02 is preferentially associated with younger age at clinical onset than in other genotypes, but unlike in subjects carrying DQ2/DQ8, earlier clinical manifestation was mostly restricted to male subjects, often carrying DR3 and/or DQB1*02 on the other chromosome. These results are compatible with an effect of cis-encoded heterodimers or with previously suggested interactions of X-linked genetic factors with (DR3-)DQB1*02 haplotypes.

  4. HLA-B14 subtyping by semi-nested PCR-SSP and haplotype distribution in a Spanish population.

    Science.gov (United States)

    Santos, S; Balas, A; Lillo, R; Garcia-Sanchez, F; Merino, J L; Vicario, J L

    1997-12-01

    HLA-B14 serological subtyping is very limited probably due to the internal position of the unique amino acid residue that differentiates B64 and B65 molecules. In order to carry out an accurate B14 subtyping we have designed a semi-nested PCR-SSP procedure that can differentiate B*1401 and B*1402 in any HLA-A, -B or -C antigen combination. A panel of 133 B14-positive and 31 B14-negative healthy and unrelated Spanish individuals were studied. Additionally, 45 B14-bearing haplotypes (-A,-B,-C,-DRB1,-DRB3/DRB4/DRB5,-DQA1,- DQB1) were available through family studies. The relative frequencies of HLA-B14 subtypes were 74% for B*1402 and 26% for B*1401, in agreement with those found in other Central European populations, but differing from those in Wales, where the relative presence of B64 goes to 41%. A total of 11/17 and 18/28 different haplotypes for B*1401 and B*1402, respectively, were identified. Both alleles showed the strongest association to Cw8 (43/45), indicating a primary ancestral B14-Cw8 association. However, B14 subtypes evidenced very distinguishable haplotype distributions. B*1401 is strongly associated with the common HLA class II haplotype DRB1*0701-DQA1*0201-DQB1*02 (13/17), while B*1402 is mainly associated to DRB1*0102 (16/28). Three major haplotypes were identified: A32-Cw8-B*1401-DR7-DQ2 (5/17), A33-Cw8-B*1402-DRB1*0102-DQ5 (5/28) and A2-Cw8-B*1402-DRB1*0102-DQ5 (5/28).

  5. Are markers of inflammation more strongly associated with risk for fatal than for nonfatal vascular events?

    Directory of Open Access Journals (Sweden)

    Naveed Sattar

    2009-06-01

    Full Text Available BACKGROUND: Circulating inflammatory markers may more strongly relate to risk of fatal versus nonfatal cardiovascular disease (CVD events, but robust prospective evidence is lacking. We tested whether interleukin (IL-6, C-reactive protein (CRP, and fibrinogen more strongly associate with fatal compared to nonfatal myocardial infarction (MI and stroke. METHODS AND FINDINGS: In the Prospective Study of Pravastatin in the Elderly at Risk (PROSPER, baseline inflammatory markers in up to 5,680 men and women aged 70-82 y were related to risk for endpoints; nonfatal CVD (i.e., nonfatal MI and nonfatal stroke [n = 672], fatal CVD (n = 190, death from other CV causes (n = 38, and non-CVD mortality (n = 300, over 3.2-y follow-up. Elevations in baseline IL-6 levels were significantly (p = 0.0009; competing risks model analysis more strongly associated with fatal CVD (hazard ratio [HR] for 1 log unit increase in IL-6 1.75, 95% confidence interval [CI] 1.44-2.12 than with risk of nonfatal CVD (1.17, 95% CI 1.04-1.31, in analyses adjusted for treatment allocation. The findings were consistent in a fully adjusted model. These broad trends were similar for CRP and, to a lesser extent, for fibrinogen. The results were also similar in placebo and statin recipients (i.e., no interaction. The C-statistic for fatal CVD using traditional risk factors was significantly (+0.017; p<0.0001 improved by inclusion of IL-6 but not so for nonfatal CVD events (p = 0.20. CONCLUSIONS: In PROSPER, inflammatory markers, in particular IL-6 and CRP, are more strongly associated with risk of fatal vascular events than nonfatal vascular events. These novel observations may have important implications for better understanding aetiology of CVD mortality, and have potential clinical relevance.

  6. Modeling coverage gaps in haplotype frequencies via Bayesian inference to improve stem cell donor selection.

    Science.gov (United States)

    Louzoun, Yoram; Alter, Idan; Gragert, Loren; Albrecht, Mark; Maiers, Martin

    2018-05-01

    Regardless of sampling depth, accurate genotype imputation is limited in regions of high polymorphism which often have a heavy-tailed haplotype frequency distribution. Many rare haplotypes are thus unobserved. Statistical methods to improve imputation by extending reference haplotype distributions using linkage disequilibrium patterns that relate allele and haplotype frequencies have not yet been explored. In the field of unrelated stem cell transplantation, imputation of highly polymorphic human leukocyte antigen (HLA) genes has an important application in identifying the best-matched stem cell donor when searching large registries totaling over 28,000,000 donors worldwide. Despite these large registry sizes, a significant proportion of searched patients present novel HLA haplotypes. Supporting this observation, HLA population genetic models have indicated that many extant HLA haplotypes remain unobserved. The absent haplotypes are a significant cause of error in haplotype matching. We have applied a Bayesian inference methodology for extending haplotype frequency distributions, using a model where new haplotypes are created by recombination of observed alleles. Applications of this joint probability model offer significant improvement in frequency distribution estimates over the best existing alternative methods, as we illustrate using five-locus HLA frequency data from the National Marrow Donor Program registry. Transplant matching algorithms and disease association studies involving phasing and imputation of rare variants may benefit from this statistical inference framework.

  7. Detecting structure of haplotypes and local ancestry

    Science.gov (United States)

    We present a two-layer hidden Markov model to detect the structure of haplotypes for unrelated individuals. This allows us to model two scales of linkage disequilibrium (one within a group of haplotypes and one between groups), thereby taking advantage of rich haplotype information to infer local an...

  8. Visual evoked potentials show strong positive association with intracranial pressure in patients with cryptococcal meningitis

    Directory of Open Access Journals (Sweden)

    Marcelo Adriano da Cunha Silva Vieira

    2015-04-01

    Full Text Available Objective : To verify the relationship between intracranial pressure and flash visual evoked potentials (F-VEP in patients with cryptococcal meningitis. Method The sample included adults diagnosed with cryptococcal meningitis admitted at a reference hospital for infectious diseases. The patients were subjected to F-VEP tests shortly before lumbar puncture. The Pearson’s linear correlation coefficient was calculated and the linear regression analysis was performed. Results : Eighteen individuals were subjected to a total of 69 lumbar punctures preceded by F-VEP tests. At the first lumbar puncture performed in each patient, N2 latency exhibited a strong positive correlation with intracranial pressure (r = 0.83; CI = 0.60 - 0.94; p < 0.0001. The direction of this relationship was maintained in subsequent punctures. Conclusion : The intracranial pressure measured by spinal tap manometry showed strong positive association with the N2 latency F-VEP in patients with cryptococcal meningitis.

  9. Scabies is strongly associated with acute rheumatic fever in a cohort study of Auckland children.

    Science.gov (United States)

    Thornley, Simon; Marshall, Roger; Jarrett, Paul; Sundborn, Gerhard; Reynolds, Edwin; Schofield, Grant

    2018-02-14

    This study sought to determine whether scabies infection is associated with acute rheumatic fever (ARF) or chronic rheumatic heart disease (CRHD). A cohort study was undertaken using health records of children aged 3-12 years attending an oral health service for the first time. Subjects were then linked to hospital diagnoses of scabies and ARF or CRHD. A total of 213 957 children free of rheumatic heart disease at baseline were available for analysis. During a mean follow-up time of 5.1 years, 440 children were diagnosed with ARF or CRHD in hospital records. Children diagnosed with scabies during follow-up were 23 times more likely to develop ARF or CRHD, compared with children who had no scabies diagnosis. After adjustment for confounders in a Cox model, the association reduced but remained strong (adjusted hazard ratio: 8.98; 95% confidence interval: 6.33-20.2). In an analysis restricted to children hospitalised at least once during follow-up, the adjusted hazard ratio for the same comparison was 3.43 (95% confidence interval: 1.85-6.37). A recent diagnosis of scabies from hospital records is strongly associated with a subsequent diagnosis of ARF. Further investigation of the role that scabies infestation may play in the aetiology of ARF is warranted. © 2018 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  10. Strong ion gap is associated with mortality in pediatric burn injuries.

    Science.gov (United States)

    Sen, Soman; Wiktor, Arek; Berndtson, Allison; Greenhalgh, David; Palmieri, Tina

    2014-01-01

    Severe burn injury produces significant tissue damage, resulting in metabolic acidosis. Current methods of acid-base evaluation are based on dependent variables that may not be accurate after burn injury. The strong ion method of acid-base evaluation is based on independent variables and may accurately predict outcomes in severely burn-injured patients. The authors hypothesize that an increased strong ion gap present on admission will be associated with mortality in severely burn-injured pediatric patients. A retrospective chart review was performed of burn-injured pediatric patients with a TBSA 20% or greater. Data collected included age, TBSA burn injury, mechanism of injury, survival, ventilator days, hospital length of stay, intensive care unit length of stay, and admission laboratory values. Apparent and effective strong ion difference (SIDa, SIDe) were calculated. The strong ion gap (SIG) was determined as the difference between SIDa and SIDe. A total of 48 patients were included in the study. Mean age (years) and TBSA were 7.9 ± 0.8 years and 56.8 ± 2.6%. Eleven patients (23%) died. Mean TBSA for survivors (54.2 ± 2.9%) did not significantly differ from that of nonsurvivors (65.7 ± 5.34%). Ten patients suffered inhalation injury, which was associated with an odds ratio of 10.1* for mortality. Mean SIDa was 44.2 ± 3.2 for the entire study population. Survivors had a significantly lower SIDa (36.6 ± 0.5) than nonsurvivors (59.7 ± 13*). Mean SIDe for all patients was (25 ± 0.7) and did not differ significantly between survivors (24.7 ± 0.7) and nonsurvivors (25.8 ± 2). SIG for nonsurvivors (33.91 ± 14*) was significantly higher than for survivors (14.9 ± 0.3). Controlling for both TBSA and inhalation injury, death was associated with both an increased SIDa (B = 19.3*) and SIG (B = 17.3*). SIG is increased in severely burn-injured pediatric patients, indicating the presence of metabolic acidosis. Furthermore, an increased SIG is significantly

  11. Wind speed and direction shears with associated vertical motion during strong surface winds

    Science.gov (United States)

    Alexander, M. B.; Camp, D. W.

    1984-01-01

    Strong surface winds recorded at the NASA 150-Meter Ground Winds Tower facility at Kennedy Space Center, Florida, are analyzed to present occurrences representative of wind shear and vertical motion known to be hazardous to the ascent and descent of conventional aircraft and the Space Shuttle. Graphical (percentage frequency distributions) and mathematical (maximum, mean, standard deviation) descriptions of wind speed and direction shears and associated updrafts and downdrafts are included as functions of six vertical layers and one horizontal distance for twenty 5-second intervals of parameters sampled simultaneously at the rate of ten per second during a period of high surface winds.

  12. HLA Haplotypes and Genotypes Frequencies in Brazilian Chronic Periodontitis Patients

    Science.gov (United States)

    Sippert, Emília Ângela; Silva, Cléverson de Oliveira e; Ayo, Christiane Maria; Marques, Silvia Barbosa Dutra; Visentainer, Jeane Eliete Laguila; Sell, Ana Maria

    2015-01-01

    Human leukocyte antigens (HLA) have a pivotal role in immune response and may be involved in antigen recognition of periodontal pathogens. However, the associations of HLA with chronic periodontitis (CP) have not been previously studied in the Brazilian population. In an attempt to clarify the issue of genetic predisposition to CP, we examined the distribution of HLA alleles, genotypes, and haplotypes in patients from Southern Brazil. One hundred and eight CP patients and 151 healthy and unrelated controls with age-, gender-, and ethnicity-matched were HLA investigated by polymerase chain reaction with sequence specific oligonucleotides. To exclude smoking as a predisposing factor, statistical analyses were performed in the total sample and in nonsmoking individuals. The significant results showed a positive association of the A∗02/HLA-B∗40 haplotype with CP (total samples: 4.2% versus 0%, P c = 0.03; nonsmokers: 4.3% versus 0%, P c = 0.23) and a lower frequency of HLA-B∗15/HLA-DRB1∗11 haplotype in CP compared to controls (total samples: 0.0% versus 4.3%, P c = 0.04; nonsmokers: 0 versus 5.1%, P c = 1.0). In conclusion, the HLA-A∗02/B∗40 haplotype may contribute to the development of CP, while HLA-B∗15/DRB1∗11 haplotype might indicate resistance to disease among Brazilians. PMID:26339134

  13. HLA Haplotypes and Genotypes Frequencies in Brazilian Chronic Periodontitis Patients

    Directory of Open Access Journals (Sweden)

    Emília Ângela Sippert

    2015-01-01

    Full Text Available Human leukocyte antigens (HLA have a pivotal role in immune response and may be involved in antigen recognition of periodontal pathogens. However, the associations of HLA with chronic periodontitis (CP have not been previously studied in the Brazilian population. In an attempt to clarify the issue of genetic predisposition to CP, we examined the distribution of HLA alleles, genotypes, and haplotypes in patients from Southern Brazil. One hundred and eight CP patients and 151 healthy and unrelated controls with age-, gender-, and ethnicity-matched were HLA investigated by polymerase chain reaction with sequence specific oligonucleotides. To exclude smoking as a predisposing factor, statistical analyses were performed in the total sample and in nonsmoking individuals. The significant results showed a positive association of the A∗02/HLA-B∗40 haplotype with CP (total samples: 4.2% versus 0%, Pc = 0.03; nonsmokers: 4.3% versus 0%, Pc = 0.23 and a lower frequency of HLA-B∗15/HLA-DRB1∗11 haplotype in CP compared to controls (total samples: 0.0% versus 4.3%, Pc = 0.04; nonsmokers: 0 versus 5.1%, Pc = 1.0. In conclusion, the HLA-A∗02/B∗40 haplotype may contribute to the development of CP, while HLA-B∗15/DRB1∗11 haplotype might indicate resistance to disease among Brazilians.

  14. HLA-G 3' UTR haplotypes and HIV vertical transmission.

    Science.gov (United States)

    Segat, Ludovica; Catamo, Eulalia; Fabris, Annalisa; Padovan, Lara; Morgutti, Marcello; Crovella, Sergio

    2009-09-10

    We evaluated the possible association of human leukocyte antigen-G (HLA-G) 3777G>C and 14-bp deletion/insertion (D/I) polymorphisms haplotypes and combined genotypes with perinatal HIV transmission in Brazilian children. The 3777G>C polymorphism alone has no effect on HIV vertical transmission but, when linked with the D allele, exerts a positive role in the protection. Indeed, we identified the DC HLA-G haplotype as significantly associated with a protective effect towards HIV vertical transmission.

  15. Inflammation, insulin resistance, and diabetes--Mendelian randomization using CRP haplotypes points upstream.

    Directory of Open Access Journals (Sweden)

    Eric J Brunner

    2008-08-01

    Full Text Available Raised C-reactive protein (CRP is a risk factor for type 2 diabetes. According to the Mendelian randomization method, the association is likely to be causal if genetic variants that affect CRP level are associated with markers of diabetes development and diabetes. Our objective was to examine the nature of the association between CRP phenotype and diabetes development using CRP haplotypes as instrumental variables.We genotyped three tagging SNPs (CRP + 2302G > A; CRP + 1444T > C; CRP + 4899T > G in the CRP gene and measured serum CRP in 5,274 men and women at mean ages 49 and 61 y (Whitehall II Study. Homeostasis model assessment-insulin resistance (HOMA-IR and hemoglobin A1c (HbA1c were measured at age 61 y. Diabetes was ascertained by glucose tolerance test and self-report. Common major haplotypes were strongly associated with serum CRP levels, but unrelated to obesity, blood pressure, and socioeconomic position, which may confound the association between CRP and diabetes risk. Serum CRP was associated with these potential confounding factors. After adjustment for age and sex, baseline serum CRP was associated with incident diabetes (hazard ratio = 1.39 [95% confidence interval 1.29-1.51], HOMA-IR, and HbA1c, but the associations were considerably attenuated on adjustment for potential confounding factors. In contrast, CRP haplotypes were not associated with HOMA-IR or HbA1c (p = 0.52-0.92. The associations of CRP with HOMA-IR and HbA1c were all null when examined using instrumental variables analysis, with genetic variants as the instrument for serum CRP. Instrumental variables estimates differed from the directly observed associations (p = 0.007-0.11. Pooled analysis of CRP haplotypes and diabetes in Whitehall II and Northwick Park Heart Study II produced null findings (p = 0.25-0.88. Analyses based on the Wellcome Trust Case Control Consortium (1,923 diabetes cases, 2,932 controls using three SNPs in tight linkage disequilibrium with our

  16. Common ataxia telangiectasia mutated haplotypes and risk of breast cancer: a nested case–control study

    International Nuclear Information System (INIS)

    Tamimi, Rulla M; Hankinson, Susan E; Spiegelman, Donna; Kraft, Peter; Colditz, Graham A; Hunter, David J

    2004-01-01

    The ataxia telangiectasia mutated (ATM) gene is a tumor suppressor gene with functions in cell cycle arrest, apoptosis, and repair of DNA double-strand breaks. Based on family studies, women heterozygous for mutations in the ATM gene are reported to have a fourfold to fivefold increased risk of breast cancer compared with noncarriers of the mutations, although not all studies have confirmed this association. Haplotype analysis has been suggested as an efficient method for investigating the role of common variation in the ATM gene and breast cancer. Five biallelic haplotype tagging single nucleotide polymorphisms are estimated to capture 99% of the haplotype diversity in Caucasian populations. We conducted a nested case–control study of breast cancer within the Nurses' Health Study cohort to address the role of common ATM haplotypes and breast cancer. Cases and controls were genotyped for five haplotype tagging single nucleotide polymorphisms. Haplotypes were predicted for 1309 cases and 1761 controls for which genotype information was available. Six unique haplotypes were predicted in this study, five of which occur at a frequency of 5% or greater. The overall distribution of haplotypes was not significantly different between cases and controls (χ 2 = 3.43, five degrees of freedom, P = 0.63). There was no evidence that common haplotypes of ATM are associated with breast cancer risk. Extensive single nucleotide polymorphism detection using the entire genomic sequence of ATM will be necessary to rule out less common variation in ATM and sporadic breast cancer risk

  17. Strong association between in-migration and HIV prevalence in urban sub-Saharan Africa.

    Science.gov (United States)

    Voeten, Hélène A C M; Vissers, Debby C J; Gregson, Simon; Zaba, Basia; White, Richard G; de Vlas, Sake J; Habbema, J Dik F

    2010-04-01

    Enormous variation exists in HIV prevalence between countries in sub-Saharan Africa. The contribution of migration to the spread of HIV has long been recognized, but its effect at the population level has never been assessed. In this ecological analysis, we explore how much variation in HIV prevalence in urban sub-Saharan Africa is explained by in-migration. We performed a linear regression to analyze the association between the proportion of recent in-migrants and HIV prevalence for men and women in urban areas, using 60 data points from 28 sub-Saharan African countries between 1987 and 2005. We found a strong association between recent in-migration and HIV prevalence for women (Pearson R = 57%, P Africa (R = 50%, P = 0.003). For both genders, the association was strongest between 1985 and 1994, slightly weaker between 1995 and 1999, and nonexistent as from 2000. The overall association for both men and women was not confounded by the developmental indicators GNI per capita, income inequalities, or adult literacy. Migration explains much of the variation in HIV spread in urban areas of sub-Saharan Africa, especially before the year 2000, after which HIV prevalences started to level off in many countries. Our findings suggest that migration is an important factor in the spread of HIV, especially in rapidly increasing epidemics. This may be of relevance to the current HIV epidemics in China and India.

  18. Somatic Variation of T-Cell Receptor Genes Strongly Associate with HLA Class Restriction.

    Directory of Open Access Journals (Sweden)

    Paul L Klarenbeek

    Full Text Available Every person carries a vast repertoire of CD4+ T-helper cells and CD8+ cytotoxic T cells for a healthy immune system. Somatic VDJ recombination at genomic loci that encode the T-cell receptor (TCR is a key step during T-cell development, but how a single T cell commits to become either CD4+ or CD8+ is poorly understood. To evaluate the influence of TCR sequence variation on CD4+/CD8+ lineage commitment, we sequenced rearranged TCRs for both α and β chains in naïve T cells isolated from healthy donors and investigated gene segment usage and recombination patterns in CD4+ and CD8+ T-cell subsets. Our data demonstrate that most V and J gene segments are strongly biased in the naïve CD4+ and CD8+ subsets with some segments increasing the odds of being CD4+ (or CD8+ up to five-fold. These V and J gene associations are highly reproducible across individuals and independent of classical HLA genotype, explaining ~11% of the observed variance in the CD4+ vs. CD8+ propensity. In addition, we identified a strong independent association of the electrostatic charge of the complementarity determining region 3 (CDR3 in both α and β chains, where a positively charged CDR3 is associated with CD4+ lineage and a negatively charged CDR3 with CD8+ lineage. Our findings suggest that somatic variation in different parts of the TCR influences T-cell lineage commitment in a predominantly additive fashion. This notion can help delineate how certain structural features of the TCR-peptide-HLA complex influence thymic selection.

  19. Native and European haplotypes of Phragmites Australis (common reed) in the central Platte River, Nebraska

    Science.gov (United States)

    Larson, D.L.; Galatowitsch, S.M.; Larson, J.L.

    2011-01-01

    Phragmites australis (common reed) is known to have occurred along the Platte River historically, but recent rapid increases in both distribution and density have begun to impact habitat for migrating sandhill cranes and nesting piping plovers and least terns. Invasiveness in Phragmites has been associated with the incursion of a European genotype (haplotype M) in other areas; determining the genotype of Phragmites along the central Platte River has implications for proper management of the river system. In 2008 we sampled Phragmites patches along the central Platte River from Lexington to Chapman, NE, stratified by bridge segments, to determine the current distribution of haplotype E (native) and haplotype M genotypes. In addition, we did a retrospective analysis of historical Phragmites collections from the central Platte watershed (1902-2006) at the Bessey Herbarium. Fresh tissue from the 2008 survey and dried tissue from the herbarium specimens were classified as haplotype M or E using the restriction fragment length polymorphism procedure. The European haplotype was predominant in the 2008 samples: only 14 Phragmites shoots were identified as native haplotype E; 224 were non-native haplotype M. The retrospective analysis revealed primarily native haplotype individuals. Only collections made in Lancaster County, near Lincoln, NE, were haplotype M, and the earliest of these was collected in 1973. ?? 2011 Copyright by the Center for Great Plains Studies, University of Nebraska-Lincoln.

  20. HLA-DQA1*03:02/DQB1*03:03:02 is strongly associated with susceptibility to childhood-onset ocular myasthenia gravis in Southern Han Chinese.

    Science.gov (United States)

    Zhu, Wen-Hua; Lu, Jia-Hong; Lin, Jie; Xi, Jian-Ying; Lu, Jun; Luo, Su-Shan; Qiao, Kai; Xiao, Bao-Guo; Lu, Chuan-Zhen; Zhao, Chong-Bo

    2012-06-15

    Our aim was to investigate the correlation between onset age, clinical features and HLA-DQA1/DQB1 genetic variability in myasthenia gravis (MG) patients in Southern Han Chinese. 205 MG patients and 100 controls were genotyped for HLA-DQA1 and -DQB1 using sequence-based typing (SBT) and analyzed for haplotype frequencies. Anti-acetylcholine receptor (AChR) autoantibodies were measured in all, and muscle-specific tyrosine kinase (MuSK) antibodies were tested in AChR antibody negative patients. HLA-DQA1/DQB1 haplotypes showed association only with childhood-onset MG. Haplotype DQA1*03:02/DQB1*03:03:02 (DQ9) was positively associated with the childhood-onset MG, while haplotype DQA1*02:01/DQB1*02:02 and DQA1*05:01:01/DQB1*02:01:01 (DQ2) were negatively associated with this group. Childhood-onset ocular MG patients had an extremely high phenotype frequency of DQ9 haplotype (90.1% of patients, 34.0% of controls, p≤0.0001, OR=17.8). The childhood-onset ocular MG in Southern Han Chinese may present a particular subgroup of distinct genetic background. Its correlation to the HLA haplotype DQA1*03:02/DQB1*03:03:02 might explain the phenotypic difference of MG between Han Chinese and Caucasians. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Inheritance of the 8.1 ancestral haplotype in recurrent pregnancy loss

    DEFF Research Database (Denmark)

    Kolte, Astrid M; Nielsen, Henriette S; Steffensen, Rudi

    2015-01-01

    BACKGROUND AND OBJECTIVES: The 8.1 ancestral haplotype (AH) (HLA-A1, C7, B8, C4AQ0, C4B1, DR3, DQ2) is a remarkably long and conserved haplotype in the human major histocompatibility complex. It has been associated with both beneficial and detrimental effects, consistent with antagonistic...

  2. The JAK2 46/1 haplotype in Budd-Chiari syndrome and portal vein thrombosis

    NARCIS (Netherlands)

    J.H. Smalberg (Jasper); S. Darwish Murad (Sarwa); E.M. Koehler (Edith); A. Plessier (Aurelie); S. Seijo (Susana); J. Trebicka (Jonel); M. Primignani (Massimo); M.P.M. de Maat (Moniek); J.C. García-Pagán (Juan Carlos); D.C. Valla (Dominique Charle); H.L.A. Janssen (Harry); F.W.G. Leebeek (Frank)

    2011-01-01

    textabstractThe germline JAK2 46/1 haplotype has been associated with the development of JAK2V617F-positive as well as JAK2V617F-negative myeloproliferative neoplasms (MPNs). In this study we examined the role of the 46/1 haplotype in the etiology and clinical presentation of patients with

  3. Genome-wide haplotype analysis of cis expression quantitative trait loci in monocytes.

    Directory of Open Access Journals (Sweden)

    Sophie Garnier

    Full Text Available In order to assess whether gene expression variability could be influenced by several SNPs acting in cis, either through additive or more complex haplotype effects, a systematic genome-wide search for cis haplotype expression quantitative trait loci (eQTL was conducted in a sample of 758 individuals, part of the Cardiogenics Transcriptomic Study, for which genome-wide monocyte expression and GWAS data were available. 19,805 RNA probes were assessed for cis haplotypic regulation through investigation of ~2,1 × 10(9 haplotypic combinations. 2,650 probes demonstrated haplotypic p-values >10(4-fold smaller than the best single SNP p-value. Replication of significant haplotype effects were tested for 412 probes for which SNPs (or proxies that defined the detected haplotypes were available in the Gutenberg Health Study composed of 1,374 individuals. At the Bonferroni correction level of 1.2 × 10(-4 (~0.05/412, 193 haplotypic signals replicated. 1000 G imputation was then conducted, and 105 haplotypic signals still remained more informative than imputed SNPs. In-depth analysis of these 105 cis eQTL revealed that at 76 loci genetic associations were compatible with additive effects of several SNPs, while for the 29 remaining regions data could be compatible with a more complex haplotypic pattern. As 24 of the 105 cis eQTL have previously been reported to be disease-associated loci, this work highlights the need for conducting haplotype-based and 1000 G imputed cis eQTL analysis before commencing functional studies at disease-associated loci.

  4. Erectile dysfunction among men with diabetes is strongly associated with premature ejaculation and reduced libido.

    Science.gov (United States)

    Malavige, Lasantha S; Jayaratne, Shanthilal D; Kathriarachchi, Samudra T; Sivayogan, Sivagurunathan; Fernando, Devaka J; Levy, Jonathan C

    2008-09-01

    = 3.3, CI = 1.2-8.8). ED was strongly associated with PE and reduced libido. Diabetic patients presenting with one of these three conditions should be screened for the other two.

  5. Prion gene haplotypes of U.S. cattle

    Directory of Open Access Journals (Sweden)

    Harhay Gregory P

    2006-11-01

    Full Text Available Abstract Background Bovine spongiform encephalopathy (BSE is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD and haplotype networks within the bovine prion gene (PRNP is important for 1 testing rare or common PRNP variation for an association with BSE and 2 interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb. PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb. Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle.

  6. Estimating KIR Haplotype Frequencies on a Cohort of 10,000 Individuals: A Comprehensive Study on Population Variations, Typing Resolutions, and Reference Haplotypes.

    Directory of Open Access Journals (Sweden)

    Cynthia Vierra-Green

    Full Text Available The killer cell immunoglobulin-like receptors (KIR mediate human natural killer (NK cell cytotoxicity via activating or inhibiting signals. Although informative and functional haplotype patterns have been reported, most genotyping has been performed at resolutions that are structurally ambiguous. In order to leverage structural information given low-resolution genotypes, we performed experiments to quantify the effects of population variations, reference haplotypes, and genotyping resolutions on population-level haplotype frequency estimations as well as predictions of individual haplotypes. We genotyped 10,157 unrelated individuals in 5 populations (518 African American[AFA], 258 Asian or Pacific Islander[API], 8,245 European[EUR], 1,073 Hispanic[HIS], and 63 Native American[NAM] for KIR gene presence/absence (PA, and additionally half of the AFA samples for KIR gene copy number variation (CNV. A custom EM algorithm was used to estimate haplotype frequencies for each population by interpretation in the context of three sets of reference haplotypes. The algorithm also assigns each individual the haplotype pairs of maximum likelihood. Generally, our haplotype frequency estimates agree with similar previous publications to within <5% difference for all haplotypes. The exception is that estimates for NAM from the U.S. showed higher frequency association of cB02 with tA01 (+14% instead of tB01 (-8.5% compared to a previous study of NAM from south of the U.S. The higher-resolution CNV genotyping on the AFA samples allowed unambiguous haplotype-pair assignments for the majority of individuals, resulting in a 22% higher median typing resolution score (TRS, which measures likelihood of self-match in the context of population-specific haplo- and geno-types. The use of TRS to quantify reduced ambiguity with CNV data clearly revealed the few individuals with ambiguous genotypes as outliers. It is observed that typing resolution and reference haplotype set

  7. Estimating KIR Haplotype Frequencies on a Cohort of 10,000 Individuals: A Comprehensive Study on Population Variations, Typing Resolutions, and Reference Haplotypes.

    Science.gov (United States)

    Vierra-Green, Cynthia; Roe, David; Jayaraman, Jyothi; Trowsdale, John; Traherne, James; Kuang, Rui; Spellman, Stephen; Maiers, Martin

    2016-01-01

    The killer cell immunoglobulin-like receptors (KIR) mediate human natural killer (NK) cell cytotoxicity via activating or inhibiting signals. Although informative and functional haplotype patterns have been reported, most genotyping has been performed at resolutions that are structurally ambiguous. In order to leverage structural information given low-resolution genotypes, we performed experiments to quantify the effects of population variations, reference haplotypes, and genotyping resolutions on population-level haplotype frequency estimations as well as predictions of individual haplotypes. We genotyped 10,157 unrelated individuals in 5 populations (518 African American[AFA], 258 Asian or Pacific Islander[API], 8,245 European[EUR], 1,073 Hispanic[HIS], and 63 Native American[NAM]) for KIR gene presence/absence (PA), and additionally half of the AFA samples for KIR gene copy number variation (CNV). A custom EM algorithm was used to estimate haplotype frequencies for each population by interpretation in the context of three sets of reference haplotypes. The algorithm also assigns each individual the haplotype pairs of maximum likelihood. Generally, our haplotype frequency estimates agree with similar previous publications to within <5% difference for all haplotypes. The exception is that estimates for NAM from the U.S. showed higher frequency association of cB02 with tA01 (+14%) instead of tB01 (-8.5%) compared to a previous study of NAM from south of the U.S. The higher-resolution CNV genotyping on the AFA samples allowed unambiguous haplotype-pair assignments for the majority of individuals, resulting in a 22% higher median typing resolution score (TRS), which measures likelihood of self-match in the context of population-specific haplo- and geno-types. The use of TRS to quantify reduced ambiguity with CNV data clearly revealed the few individuals with ambiguous genotypes as outliers. It is observed that typing resolution and reference haplotype set influence

  8. RET variants and haplotype analysis in a cohort of Czech patients with Hirschsprung disease.

    Directory of Open Access Journals (Sweden)

    Eliska Vaclavikova

    Full Text Available Hirschsprung disease (HSCR is a congenital aganglionosis of myenteric and submucosal plexuses in variable length of the intestine. This study investigated the influence and a possible modifying function of RET proto-oncogene's single nucleotide polymorphisms (SNPs and haplotypes in the development and phenotype of the disease in Czech patients. Genotyping of 14 SNPs was performed using TaqMan Genotyping Assays and direct sequencing. The frequencies of SNPs and generated haplotypes were statistically evaluated using chi-square test and the association with the risk of HSCR was estimated by odds ratio. SNP analysis revealed significant differences in frequencies of 11 polymorphic RET variants between 162 HSCR patients and 205 unaffected controls. Particularly variant alleles of rs1864410, rs2435357, rs2506004 (intron 1, rs1800858 (exon 2, rs1800861 (exon 13, and rs2565200 (intron 19 were strongly associated with increased risk of HSCR (p<0.00000 and were over-represented in males vs. females. Conversely, variant alleles of rs1800860, rs1799939 and rs1800863 (exons 7, 11, 15 had a protective role. The haploblock comprising variants in intron 1 and exon 2 was constructed. It represented a high risk of HSCR, however, the influence of other variants was also found after pruning from effect of this haploblock. Clustering patients according to genotype status in haploblock revealed a strong co-segregation with several SNPs and pointed out the differences between long and short form of HSCR. This study involved a large number of SNPs along the entire RET proto-oncogene with demonstration of their risk/protective role also in haplotype and diplotype analysis in the Czech population. The influence of some variant alleles on the aggressiveness of the disease and their role in gender manifestation differences was found. These data contribute to worldwide knowledge of the genetics of HSCR.

  9. Stool consistency is strongly associated with gut microbiota richness and composition, enterotypes and bacterial growth rates.

    Science.gov (United States)

    Vandeputte, Doris; Falony, Gwen; Vieira-Silva, Sara; Tito, Raul Y; Joossens, Marie; Raes, Jeroen

    2016-01-01

    The assessment of potentially confounding factors affecting colon microbiota composition is essential to the identification of robust microbiome based disease markers. Here, we investigate the link between gut microbiota variation and stool consistency using Bristol Stool Scale classification, which reflects faecal water content and activity, and is considered a proxy for intestinal colon transit time. Through 16S rDNA Illumina profiling of faecal samples of 53 healthy women, we evaluated associations between microbiome richness, Bacteroidetes:Firmicutes ratio, enterotypes, and genus abundance with self-reported, Bristol Stool Scale-based stool consistency. Each sample's microbiota growth potential was calculated to test whether transit time acts as a selective force on gut bacterial growth rates. Stool consistency strongly correlates with all known major microbiome markers. It is negatively correlated with species richness, positively associated to the Bacteroidetes:Firmicutes ratio, and linked to Akkermansia and Methanobrevibacter abundance. Enterotypes are distinctly distributed over the BSS-scores. Based on the correlations between microbiota growth potential and stool consistency scores within both enterotypes, we hypothesise that accelerated transit contributes to colon ecosystem differentiation. While shorter transit times can be linked to increased abundance of fast growing species in Ruminococcaceae-Bacteroides samples, hinting to a washout avoidance strategy of faster replication, this trend is absent in Prevotella-enterotyped individuals. Within this enterotype adherence to host tissue therefore appears to be a more likely bacterial strategy to cope with washout. The strength of the associations between stool consistency and species richness, enterotypes and community composition emphasises the crucial importance of stool consistency assessment in gut metagenome-wide association studies. Published by the BMJ Publishing Group Limited. For permission to

  10. Haplotype combination of the bovine PCSK1 gene sequence ...

    Indian Academy of Sciences (India)

    Haplotype combination of the bovine PCSK1 gene sequence variants and association with growth traits in Jiaxian cattle. JIAJIE SUN1,2, LIMIN SHAN2, CHUNLEI ZHANG2 and HONG CHEN1∗. 1College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology.

  11. Strong allelic association between Sjoegren-Larsson syndrome and D17S805

    Energy Technology Data Exchange (ETDEWEB)

    Pigg, M.; Jagell, S.; Sillen, A. [University Hospital, Uppsala (Sweden)] [and others

    1994-09-01

    Sjoegren-Larsson Syndrom (SLS) is characterized by congenital ichthyosis, spastic di- or tetraplegia and mental retardation. It is an autosomal recessive trait that has been described in many populations, but is particularly frequent in the northern part of Sweden. A defect in the enzyme fatty alcohol: NAD+ oxidoreductase (FAD) has been suggested, but the molecular mechanism has not been elucidated. Based on linkage analysis and allelic association, the disorder has now been mapped to chromosome 17. Meiotic recombinations suggests that the gene is flanked by D17S805 on the centromeric and D17S783 and D17S925 on the telomeric side. These three markers map to the same location in reference pedigrees. Strong allelic association (chi-square 60.28, p<0.0003) to D17S805 suggests that the mutation is located at a limited distance on the telomeric side of this marker. It is possible that the gene can be identified by functional complementation of SLS cells using YACs from this region. Alternatively, positional cloning should be possible in this presumable small area. The markers identified are close and informative enough to allow accurate genetic diagnosis.

  12. Common variants and haplotypes in the TF, TNF-a, and TMPRSS6 genes are associated with iron status in a female black South African population

    NARCIS (Netherlands)

    Gichohi-Wainaina, W.N.; Boonstra, A.; Swinkels, D.W.; Zimmermann, M.B.; Feskens, E.J.M.; Towers, G.W.

    2015-01-01

    Background: It is unknown whether single nucleotide polymorphisms (SNPs), associated with iron status in European and Asian populations, have the same relation within the African population. Objectives: We aimed to investigate associations of reported SNPs with iron markers in a South African

  13. Rapid growth and childhood obesity are strongly associated with lysoPC(14:0).

    Science.gov (United States)

    Rzehak, Peter; Hellmuth, Christian; Uhl, Olaf; Kirchberg, Franca F; Peissner, Wolfgang; Harder, Ulrike; Grote, Veit; Weber, Martina; Xhonneux, Annick; Langhendries, Jean-Paul; Ferre, Natalia; Closa-Monasterolo, Ricardo; Verduci, Elvira; Riva, Enrica; Socha, Piotr; Gruszfeld, Dariusz; Koletzko, Berthold

    2014-01-01

    Despite the growing interest in the early-origins-of-later-disease hypothesis, little is known about the metabolic underpinnings linking infant weight gain and childhood obesity. To discover biomarkers reflective of weight change in the first 6 months and overweight/obesity at age 6 years via a targeted metabolomics approach. This analysis comprised 726 infants from a European multicenter randomized trial (Childhood Obesity Programme, CHOP) for whom plasma blood samples at age 6 months and anthropometric data up to the age of 6 years were available. 'Rapid growth' was defined as a positive difference in weight within the first 6 months of life standardized to WHO growth standards. Weight change was regressed on each of 168 metabolites (acylcarnitines, lysophosphatidylcholines, sphingomyelins, and amino acids). Metabolites significant after Bonferroni's correction were tested as predictors of later overweight/obesity. Among the overall 19 significant metabolites, 4 were associated with rapid growth and 15 were associated with a less-than-ideal weight change. After adjusting for feeding group, only the lysophosphatidylcholine LPCaC14:0 remained significantly associated with rapid weight gain (β = 0.18). Only LPCaC14:0 at age 6 months was predictive of overweight/obesity at age 6 years (OR 1.33; 95% CI 1.04-1.69). LPCa14:0 is strongly related to rapid growth in infancy and childhood overweight/obesity. This suggests that LPCaC14:0 levels may represent a metabolically programmed effect of infant weight gain on the later obesity risk. However, these results require confirmation by independent cohorts. © 2014 S. Karger AG, Basel.

  14. Self-Reported Visual Perceptual Abnormalities Are Strongly Associated with Core Clinical Features in Psychotic Disorders.

    Science.gov (United States)

    Keane, Brian P; Cruz, Lisa N; Paterno, Danielle; Silverstein, Steven M

    2018-01-01

    Past studies using the Bonn Scale for the Assessment of Basic Symptoms (hereafter, Bonn Scale) have shown that self-reported perceptual/cognitive disturbances reveal which persons have or will soon develop schizophrenia. Here, we focused specifically on the clinical value of self-reported visual perceptual abnormalities (VPAs) since they are underexplored and have been associated with suicidal ideation, negative symptoms, and objective visual dysfunction. Using the 17 Bonn Scale vision items, we cross-sectionally investigated lifetime occurrence of VPAs in 21 first-episode psychosis and 22 chronic schizophrenia/schizoaffective disorder (SZ/SA) patients. Relationships were probed between VPAs and illness duration, symptom severity, current functioning, premorbid functioning, diagnosis, and age of onset. Increased VPAs were associated with: earlier age of onset; more delusions, hallucinations, bizarre behavior, and depressive symptoms; and worse premorbid social functioning, especially in the childhood and early adolescent phases. SZ/SA participants endorsed more VPAs as compared to those with schizophreniform or psychotic disorder-NOS, especially in the perception of color, bodies, faces, object movement, and double/reversed vision. The range of self-reported VPAs was strikingly similar between first-episode and chronic patients and did not depend on the type or amount of antipsychotic medication. As a comparative benchmark, lifetime occurrence of visual hallucinations did not depend on diagnosis and was linked only to poor premorbid social functioning. A brief 17-item interview derived from the Bonn Scale is strongly associated with core clinical features in schizophrenia. VPAs hold promise for clarifying diagnosis, predicting outcome, and guiding neurocognitive investigations.

  15. Two Orangutan Species Have Evolved DifferentKIRAlleles and Haplotypes.

    Science.gov (United States)

    Guethlein, Lisbeth A; Norman, Paul J; Heijmans, Corinne M C; de Groot, Natasja G; Hilton, Hugo G; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E; Parham, Peter

    2017-04-15

    The immune and reproductive functions of human NK cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell Ig-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping, and data mining from the Great Ape Genome Project, we characterized the KIR alleles and haplotypes for panels of 10 Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between 5 and 10 KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean specific, one is Sumatran specific, and five are shared. Of 12 KIR gene-content haplotypes, 5 are Bornean specific, 5 are Sumatran specific, and 2 are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean specific, 65 are Sumatran specific, and 10 are shared. Copyright © 2017 by The American Association of Immunologists, Inc.

  16. An intronic LINE-1 insertion in MERTK is strongly associated with retinopathy in Swedish Vallhund dogs.

    Directory of Open Access Journals (Sweden)

    Richard Everson

    Full Text Available The domestic dog segregates a significant number of inherited progressive retinal diseases, several of which mirror human retinal diseases and which are collectively termed progressive retinal atrophy (PRA. In 2014, a novel form of PRA was reported in the Swedish Vallhund breed, and the disease was mapped to canine chromosome 17. The causal mutation was not identified, but expression analyses of the retinas of affected Vallhunds demonstrated a 6-fold increased expression of the MERTK gene compared to unaffected dogs. Using 24 retinopathy cases and 97 controls with no clinical signs of retinopathy, we replicated the chromosome 17 association in Swedish Vallhunds from the UK and aimed to elucidate the causal variant underlying this association using whole genome sequencing (WGS of an affected dog. This revealed a 6-8 kb insertion in intron 1 of MERTK that was not present in WGS of 49 dogs of other breeds. Sequencing and BLASTN analysis of the inserted segment was consistent with the insertion comprising a full-length intact LINE-1 retroelement. Testing of the LINE-1 insertion for association with retinopathy in the UK set of 24 cases and 97 controls revealed a strong statistical association (P-value 6.0 x 10-11 that was subsequently replicated in the original Finnish study set (49 cases and 89 controls (P-value 4.3 x 10-19. In a pooled analysis of both studies (73 cases and 186 controls, the LINE-1 insertion was associated with a ~20-fold increased risk of retinopathy (odds ratio 23.41, 95% confidence intervals 10.99-49.86, P-value 1.3 x 10-27. Our study adds further support for regulatory disruption of MERTK in Swedish Vallhund retinopathy; however, further work is required to establish a functional overexpression model. Future work to characterise the mechanism by which this intronic mutation disrupts gene regulation will further improve the understanding of MERTK biology and its role in retinal function.

  17. The putative oncogene Pim-1 in the mouse: its linkage and variation among t haplotypes.

    Science.gov (United States)

    Nadeau, J H; Phillips, S J

    1987-11-01

    Pim-1, a putative oncogene involved in T-cell lymphomagenesis, was mapped between the pseudo-alpha globin gene Hba-4ps and the alpha-crystallin gene Crya-1 on mouse chromosome 17 and therefore within the t complex. Pim-1 restriction fragment variants were identified among t haplotypes. Analysis of restriction fragment sizes obtained with 12 endonucleases demonstrated that the Pim-1 genes in some t haplotypes were indistinguishable from the sizes for the Pim-1b allele in BALB/c inbred mice. There are now three genes, Pim-1, Crya-1 and H-2 I-E, that vary among independently derived t haplotypes and that have indistinguishable alleles in t haplotypes and inbred strains. These genes are closely linked within the distal inversion of the t complex. Because it is unlikely that these variants arose independently in t haplotypes and their wild-type homologues, we propose that an exchange of chromosomal segments, probably through double crossingover, was responsible for indistinguishable Pim-1 genes shared by certain t haplotypes and their wild-type homologues. There was, however, no apparent association between variant alleles of these three genes among t haplotypes as would be expected if a single exchange introduced these alleles into t haplotypes. If these variant alleles can be shown to be identical to the wild-type allele, then lack of association suggests that multiple exchanges have occurred during the evolution of the t complex.

  18. Streptomyces clavuligerus shows a strong association between TCA cycle intermediate accumulation and clavulanic acid biosynthesis.

    Science.gov (United States)

    Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto

    2018-05-01

    Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.

  19. Strong and consistent natural selection associated with armour reduction in sticklebacks.

    Science.gov (United States)

    LE Rouzic, Arnaud; Østbye, Kjartan; Klepaker, Tom O; Hansen, Thomas F; Bernatchez, Louis; Schluter, Dolph; Vøllestad, L Asbjørn

    2011-06-01

    Measuring the strength of natural selection is tremendously important in evolutionary biology, but remains a challenging task. In this work, we analyse the characteristics of selection for a morphological change (lateral-plate reduction) in the threespine stickleback Gasterosteus aculeatus. Adaptation to freshwater, leading with the reduction or loss of the bony lateral armour, has occurred in parallel on numerous occasions in this species. Completely-plated and low-plated sticklebacks were introduced into a pond, and the phenotypic changes were tracked for 20 years. Fish from the last generation were genotyped for the Ectodysplasin-A (Eda) locus, the major gene involved in armour development. We found a strong fitness advantage for the freshwater-type fish (on average, 20% fitness advantage for the freshwater morph, and 92% for the freshwater genotype). The trend is best explained by assuming that this fitness advantage is maximum at the beginning of the invasion and decreases with time. Such fitness differences provide a quantifiable example of rapid selection-driven phenotypic evolution associated with environmental change in a natural population. © 2011 Blackwell Publishing Ltd.

  20. Plasmodium falciparum isolates from Angola show the StctVMNT haplotype in the pfcrt gene

    Science.gov (United States)

    2010-01-01

    Background Effective treatment remains a mainstay of malaria control, but it is unfortunately strongly compromised by drug resistance, particularly in Plasmodium falciparum, the most important human malaria parasite. Although P. falciparum chemoresistance is well recognized all over the world, limited data are available on the distribution and prevalence of pfcrt and pfmdr1 haplotypes that mediate resistance to commonly used drugs and that show distinct geographic differences. Methods Plasmodium falciparum-infected blood samples collected in 2007 at four municipalities of Luanda, Angola, were genotyped using PCR and direct DNA sequencing. Single nucleotide polymorphisms in the P. falciparum pfcrt and pfmdr1 genes were assessed and haplotype prevalences were determined. Results and Discussion The most prevalent pfcrt haplotype was StctVMNT (representing amino acids at codons 72-76). This result was unexpected, since the StctVMNT haplotype has previously been seen mainly in parasites from South America and India. The CVIET, CVMNT and CVINT drug-resistance haplotypes were also found, and one previously undescribed haplotype (CVMDT) was detected. Regarding pfmdr1, the most prevalent haplotype was YEYSNVD (representing amino acids at codons 86, 130, 184, 1034, 1042, 1109 and 1246). Wild haplotypes for pfcrt and pfmdr1 were uncommon; 3% of field isolates harbored wild type pfcrt (CVMNK), whereas 21% had wild type pfmdr1 (NEYSNVD). The observed predominance of the StctVMNT haplotype in Angola could be a result of frequent travel between Brazil and Angola citizens in the context of selective pressure of heavy CQ use. Conclusions The high prevalence of the pfcrt SVMNT haplotype and the pfmdr1 86Y mutation confirm high-level chloroquine resistance and might suggest reduced efficacy of amodiaquine in Angola. Further studies must be encouraged to examine the in vitro sensitivity of pfcrt SVMNT parasites to artesunate and amodiaquine for better conclusive data. PMID:20565881

  1. High frequency of Plasmodium falciparum CICNI/SGEAA and CVIET haplotypes without association with resistance to sulfadoxine/pyrimethamine and chloroquine combination in the Daraweesh area, in Sudan

    DEFF Research Database (Denmark)

    A-Elbasit, I E; Khalil, I F; Elbashir, M I

    2008-01-01

    Estimation of the prevalence of the molecular markers of sulfadoxine/pyrimethamine (SP) and chloroquine (CQ) resistance and validation of the association of mutations with resistance in different settings is needed for local policy guidance and for contributing to a global map for anti-malarial d...... molecular markers needed before the deployment of SP/artesunate combination therapy in the Sudan....

  2. IL10 GGC haplotype is positively and HLA-DQA1*05-DQB1*02 is negatively associated with radiographic progression in undifferentiated arthritis

    NARCIS (Netherlands)

    Ursum, J.; van der Weijden, M.A.C.; van Schaardenburg, D.; Prins, A.P.; Dijkmans, B.A.C.; Twisk, J.W.R.; Crusius, J.B.A.; van der Horst-Bruinsma, I.E.

    2010-01-01

    Objective. In rheumatoid arthritis (RA), many genetic markers, such as the shared-epitope (SE) alleles, are described in association with radiographic progression, but limited data are available on undifferentiated arthritis (UA). We investigated whether single-nucleotide polymorphisms (SNP) and

  3. A common LRP4 haplotype is associated with bone mineral density and hip geometry in men-Data from the Odense Androgen Study (OAS)

    DEFF Research Database (Denmark)

    Boudin, Eveline; Steenackers, Ellen; Freitas, Fenna de

    2013-01-01

    by the association of rs6485702. We suggest, based on these results and the localisation of the variant in the third β-propeller domain of LRP4, that the variant has possibly a functional effect. Hereby, we conclude that common variation in the LRP4 gene determines hip and whole body BMD and thus confirm previous...

  4. Glucocorticoid receptor gene haplotypes are not associated with birth anthropometry, blood pressure, glucose and insulin concentrations, and body composition in subjects born small for gestational age

    NARCIS (Netherlands)

    L. Manenschijn (Laura); E.L.T. van den Akker (Erica); W.A. Ester (Wietske); R.W.J. Leunissen (Ralph); R.H. Willemsen (Ruben); E.F.C. van Rossum (Liesbeth); J.W. Koper (Jan); S.W.J. Lamberts (Steven); A.C.S. Hokken-Koelega (Anita)

    2010-01-01

    textabstractObjective: Smaller size at birth has been associated with an increased risk of metabolic and cardiovascular disorders in adult life. Fetal programing of the hypothalamic - pituitary - adrenal axis has been suggested as a possible explanation. Fetal glucocorticoid (GC) overexposure has

  5. Strong association of epidermal growth factor receptor status with breast cancer FDG uptake

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Joohee; Moon, Seung Hwan; Hyun, Seung Hyup; Cho, Young Seok; Choi, Joon Young; Kim, Byung-Tae; Lee, Kyung-Han [Sungkyunkwan University School of Medicine, Department of Nuclear Medicine, Samsung Medical Center, Seoul (Korea, Republic of); Lee, Eun Jeong [Seoul Medical Center, Department of Nuclear Medicine, Seoul (Korea, Republic of); Kim, Seokhwi [Sungkyunkwan University School of Medicine, Department of Pathology, Samsung Medical Center, Seoul (Korea, Republic of)

    2017-08-15

    Imaging tumor FDG uptake could complement breast cancer biomarkers of risk and treatment response. Although breast cancer FDG uptake is reputedly influenced by major biomarker states, the role of epidermal growth factor receptor (EGFR) expression remains largely unexplored. This is a retrospective study that included 499 patients with primary breast cancer at initial presentation. Tumor FDG uptake was measured on pretreatment PET/CT as maximum standardized uptake value (SUVmax), and biomarkers were assessed by immunohistochemistry of tumor tissue. Regression analysis was performed for predictors of high tumor FDG uptake (SUVmax ≥ 8.6). SUVmax was higher in ER- (36.5%; 11.2 ± 6.0 vs. 8.3 ± 5.3), PR- (42.3%; 10.9 ± 6.0 vs. 8.2 ± 5.2), and triple-negative tumors (19.8%; 12.0 ± 6.9 vs. 8.7 ± 5.2; all p < 0.0001). EGFR expression (28.5%) was more frequent in ER-, PR-, triple-negative, cytokeratin 5/6 (CK5/6) + and mutant P53 (mP53) + tumors (all p < 0.0001). EGFR+ was associated with higher SUVmax among all tumors (11.9 ± 6.0 vs. 8.3 ± 5.3), ER- tumors (p < 0.0001), PR- and + tumors (p < 0.0001 and 0.027), hormone receptor- and + tumors (p < 0.0001 and 0.004), human epidermal growth factor receptor 2 (HER2)- and + tumors (p < 0.0001 and 0.006), non-triple negative tumors (p < 0.0001), CK5/6- and + tumors (p = 0.021 and <0.0001), and mP53- and + tumors (p < 0.0001 and 0.008). Tumors had high FDG uptake in 73.2% of EGFR+ and 40.6% of EGFR- tumors. On regression analysis, significant multivariate predictors of high tumor FDG uptake were large size, EGFR+ and CK5/6+ for the entire subjects, and EGFR+ and CK5/6+ for ER- and hormone receptor negative subgroups. High FDG uptake was able to sub-stratify EGFR+ tumors that were more likely to be ER- and CK5/6+, and EGFR- tumors more likely to be mP53 +. Primary breast tumor FDG uptake is strongly influenced by EGFR status beyond that by other major biomarkers including hormone receptor and HER2 status, and EGFR

  6. Falciparum malaria in the north of Laos: the occurrence and implications of the Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene haplotype SVMNT

    DEFF Research Database (Denmark)

    Dittrich, Sabine; Alifrangis, Michael; Stohrer, Jörg M

    2005-01-01

    American/PNG -haplotype (SVMNT) on mainland Southeast Asia. SVMNT-haplotype and others might be associated with a decreased efficacy of Amodiaquine and could therefore be potential markers for of amodiaquine resistance (AQR). If there is a correlation between AQR and the SVMNT-haplotype as suggested, 31...

  7. Exploring climate niches of ponderosa pine (Pinus ponderosa Douglas ex Lawson) haplotypes in the western United States: Implications for evolutionary history and conservation

    Science.gov (United States)

    Shinneman, Douglas; Means, Robert E.; Potter, Kevin M.; Hipkins, Valerie D.

    2016-01-01

    Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with

  8. Exploring Climate Niches of Ponderosa Pine (Pinus ponderosa Douglas ex Lawson) Haplotypes in the Western United States: Implications for Evolutionary History and Conservation.

    Science.gov (United States)

    Shinneman, Douglas J; Means, Robert E; Potter, Kevin M; Hipkins, Valerie D

    2016-01-01

    Ponderosa pine (Pinus ponderosa Douglas ex Lawson) occupies montane environments throughout western North America, where it is both an ecologically and economically important tree species. A recent study using mitochondrial DNA analysis demonstrated substantial genetic variation among ponderosa pine populations in the western U.S., identifying 10 haplotypes with unique evolutionary lineages that generally correspond spatially with distributions of the Pacific (P. p. var. ponderosa) and Rocky Mountain (P. p. var. scopulorum) varieties. To elucidate the role of climate in shaping the phylogeographic history of ponderosa pine, we used nonparametric multiplicative regression to develop predictive climate niche models for two varieties and 10 haplotypes and to hindcast potential distribution of the varieties during the last glacial maximum (LGM), ~22,000 yr BP. Our climate niche models performed well for the varieties, but haplotype models were constrained in some cases by small datasets and unmeasured microclimate influences. The models suggest strong relationships between genetic lineages and climate. Particularly evident was the role of seasonal precipitation balance in most models, with winter- and summer-dominated precipitation regimes strongly associated with P. p. vars. ponderosa and scopulorum, respectively. Indeed, where present-day climate niches overlap between the varieties, introgression of two haplotypes also occurs along a steep clinal divide in western Montana. Reconstructed climate niches for the LGM suggest potentially suitable climate existed for the Pacific variety in the California Floristic province, the Great Basin, and Arizona highlands, while suitable climate for the Rocky Mountain variety may have existed across the southwestern interior highlands. These findings underscore potentially unique phylogeographic origins of modern ponderosa pine evolutionary lineages, including potential adaptations to Pleistocene climates associated with discrete

  9. Compound haplotypes at Xp11.23 and human population growth in Eurasia.

    Science.gov (United States)

    Alonso, S; Armour, J A L

    2004-09-01

    To investigate patterns of diversity and the evolutionary history of Eurasians, we have sequenced a 2.8 kb region at Xp11.23 in a sample of African and Eurasian chromosomes. This region is in a long intron of CLCN5 and is immediately flanked by a highly variable minisatellite, DXS255, and a human-specific Ta0 LINE. Compared to Africans, Eurasians showed a marked reduction in sequence diversity. The main Euro-Asiatic haplotype seems to be the ancestral haplotype for the whole sample. Coalescent simulations, including recombination and exponential growth, indicate a median length of strong linkage disequilibrium, up to approximately 9 kb for this area. The Ka/Ks ratio between the coding sequence of human CLCN5 and its mouse orthologue is much less than 1. This implies that the region sequenced is unlikely to be under the strong influence of positive selective processes on CLCN5, mutations in which have been associated with disorders such as Dent's disease. In contrast, a scenario based on a population bottleneck and exponential growth seems a more likely explanation for the reduced diversity observed in Eurasians. Coalescent analysis and linked minisatellite diversity (which reaches a gene diversity value greater than 98% in Eurasians) suggest an estimated age of origin of the Euro-Asiatic diversity compatible with a recent out-of-Africa model for colonization of Eurasia by modern Homo sapiens.

  10. Identification of susceptibility and protective major histocompatibility complex haplotypes in canine diabetes mellitus.

    Science.gov (United States)

    Kennedy, L J; Davison, L J; Barnes, A; Short, A D; Fretwell, N; Jones, C A; Lee, A C; Ollier, W E R; Catchpole, B

    2006-12-01

    Diabetes mellitus occurs spontaneously in dogs, which is believed to have an autoimmune component and to be a model of human latent autoimmune diabetes of adults (LADA). Some dog breeds (e.g. Samoyed) are particularly predisposed, whereas others (e.g. Boxer) are highly resistant. With the completion of the Dog Genome Assembly, comparative genomic studies of complex diseases in dogs, including diabetes, could provide an important investigative approach into such disorders. Type 1 diabetes in humans is strongly associated with major histocompatibility complex (MHC) class II polymorphisms. We have investigated whether canine dog leucocyte antigen (DLA) class II haplotypes are associated with diabetes. DNA from 460 cases and 1047 controls were genotyped for DLA-DRB1, DLA-DQA1 and DLA-DQB1 using sequence-based typing. Three DLA haplotypes, DRB1*009/DQA1*001/DQB1*008, DRB1*015/DQA1*0061/DQB1*023 and DRB1*002/DQA1*009/DQB1*001, were found at significantly increased frequency in cases with diabetes compared with controls. One DLA-DQ haplotype, DQA1*004/DQB1*013, was significantly reduced in cases with diabetes. Further analysis showed that DQA1 alleles carrying arginine at codon 55 of DQA1 were increased in dogs with diabetes. To our knowledge, this is the first report of a comparative study of MHC and diabetes in a non-rodent species. Since no laboratory model of LADA exists and dogs and humans share similar environments, further research into canine diabetes is warranted.

  11. HLA DRB1/DQB1 alleles and DRB1-DQB1 haplotypes and the risk of rheumatoid arthritis in Tunisians: a population-based case-control study.

    Science.gov (United States)

    Lagha, A; Messadi, A; Boussaidi, S; Kochbati, S; Tazeghdenti, A; Ghazouani, E; Almawi, W Y; Yacoubi-Loueslati, B

    2016-09-01

    Rheumatoid arthritis (RA) is an inflammatory disease, which affects synovial joints, and is influenced by environmental and genetic factors, in particular the human leucocyte antigen (HLA) system. In our study, we investigated the association of HLA class II DRB1 and DQB1 alleles and DRB1-DQB1 haplotypes with RA susceptibility in Tunisian subjects. Therefore, HLA class II low-resolution genotyping was done in 110 RA patients and 116 controls, with a HLA-DRB1*04 high-resolution typing. Our results showed a strong association between HLA-DRB1*04/DRB1*04:05 alleles and RA presence, which persisted after correcting for multiple comparisons (Pc HLA-DRB1*04:03 allele (Pc = 15.2 × 10-4). However, increased frequency of DQB1*05 (Pc = 0.020) and decreased frequency of DRB1*04:03 subtype (Pc = 0.032) were seen in RF+ patients than controls. Moreover, when RA patients were compared to controls, DRB1*04-DQB1*03 haplotype was associated with RA susceptibility in Tunisians (Pc = 16.8 × 10-5), independently of RF status. Conversely, DRB1*01 allele and DRB1*01-DQB1*05 haplotype was highly present in RF+ vs RF- groups (Pc HLA class II alleles and haplotypes association with RA susceptibility with secondary Sjögren's syndrome (sSS) showed a predisposing effect of DRB1*04 (Pc HLA-DRB1*04, specifically HLA-DRB1*04:05 subtype, and DRB1*04-DQB1*03 haplotype with RA susceptibility in Tunisians, independently of seropositivity or the sSS presence. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Mineralocorticoid receptor haplotype, estradiol, progesterone and emotional information processing.

    Science.gov (United States)

    Hamstra, Danielle A; de Kloet, E Ronald; Quataert, Ina; Jansen, Myrthe; Van der Does, Willem

    2017-02-01

    Carriers of MR-haplotype 1 and 3 (GA/CG; rs5522 and rs2070951) are more sensitive to the influence of oral contraceptives (OC) and menstrual cycle phase on emotional information processing than MR-haplotype 2 (CA) carriers. We investigated whether this effect is associated with estradiol (E2) and/or progesterone (P4) levels. Healthy MR-genotyped premenopausal women were tested twice in a counterbalanced design. Naturally cycling (NC) women were tested in the early-follicular and mid-luteal phase and OC-users during OC-intake and in the pill-free week. At both sessions E2 and P4 were assessed in saliva. Tests included implicit and explicit positive and negative affect, attentional blink accuracy, emotional memory, emotion recognition, and risky decision-making (gambling). MR-haplotype 2 homozygotes had higher implicit happiness scores than MR-haplotype 2 heterozygotes (p=0.031) and MR-haplotype 1/3 carriers (pinformation processing and P4 or E2 differed between sessions, as well as the moderating effects of the MR genotype. In the first session the MR-genotype moderated the influence of P4 on implicit anxiety (sr=-0.30; p=0.005): higher P4 was associated with reduction in implicit anxiety, but only in MR-haplotype 2 homozygotes (sr=-0.61; p=0.012). In the second session the MR-genotype moderated the influence of E2 on the recognition of facial expressions of happiness (sr=-0.21; p=0.035): only in MR-haplotype 1/3 higher E2 was correlated with happiness recognition (sr=0.29; p=0.005). In the second session higher E2 and P4 were negatively correlated with accuracy in lag2 trials of the attentional blink task (pinformation processing. This moderating effect may depend on the novelty of the situation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Mitochondrial DNA haplotypes induce differential patterns of DNA methylation that result in differential chromosomal gene expression patterns.

    Science.gov (United States)

    Lee, William T; Sun, Xin; Tsai, Te-Sha; Johnson, Jacqueline L; Gould, Jodee A; Garama, Daniel J; Gough, Daniel J; McKenzie, Matthew; Trounce, Ian A; St John, Justin C

    2017-01-01

    Mitochondrial DNA copy number is strictly regulated during development as naive cells differentiate into mature cells to ensure that specific cell types have sufficient copies of mitochondrial DNA to perform their specialised functions. Mitochondrial DNA haplotypes are defined as specific regions of mitochondrial DNA that cluster with other mitochondrial sequences to show the phylogenetic origins of maternal lineages. Mitochondrial DNA haplotypes are associated with a range of phenotypes and disease. To understand how mitochondrial DNA haplotypes induce these characteristics, we used four embryonic stem cell lines that have the same set of chromosomes but possess different mitochondrial DNA haplotypes. We show that mitochondrial DNA haplotypes influence changes in chromosomal gene expression and affinity for nuclear-encoded mitochondrial DNA replication factors to modulate mitochondrial DNA copy number, two events that act synchronously during differentiation. Global DNA methylation analysis showed that each haplotype induces distinct DNA methylation patterns, which, when modulated by DNA demethylation agents, resulted in skewed gene expression patterns that highlight the effectiveness of the new DNA methylation patterns established by each haplotype. The haplotypes differentially regulate α -ketoglutarate, a metabolite from the TCA cycle that modulates the TET family of proteins, which catalyse the transition from 5-methylcytosine, indicative of DNA methylation, to 5-hydroxymethylcytosine, indicative of DNA demethylation. Our outcomes show that mitochondrial DNA haplotypes differentially modulate chromosomal gene expression patterns of naive and differentiating cells by establishing mitochondrial DNA haplotype-specific DNA methylation patterns.

  14. Polymorphism at expressed DQ and DR loci in five common equine MHC haplotypes.

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A; Antczak, Douglas F

    2017-03-01

    The polymorphism of major histocompatibility complex (MHC) class II DQ and DR genes in five common equine leukocyte antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine bacterial artificial chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next generation sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse.

  15. Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes

    Science.gov (United States)

    Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.

    2016-01-01

    The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800

  16. Strong selective sweeps associated with ampliconic regions in great ape X chromosomes

    DEFF Research Database (Denmark)

    Nam, Kiwoong; Munch, Kasper; Hobolth, Asger

    2014-01-01

    The unique inheritance pattern of X chromosomes makes them preferential targets of adaptive evolution. We here investigate natural selection on the X chromosome in all species of great apes. We find that diversity is more strongly reduced around genes on the X compared with autosomes, and that a ......The unique inheritance pattern of X chromosomes makes them preferential targets of adaptive evolution. We here investigate natural selection on the X chromosome in all species of great apes. We find that diversity is more strongly reduced around genes on the X compared with autosomes...

  17. KIR2DS4 and Its Variant KIR1D Are Associated with Acute Graft-versus-Host Disease, Cytomegalovirus, and Overall Survival after Sibling-Related HLA-Matched Transplantation in Patients with Donors with KIR Gene Haplotype A.

    Science.gov (United States)

    Wu, Xiaojin; Yao, Yao; Bao, Xiaojing; Zhou, Huifeng; Tang, Xiaowen; Han, Yue; Ma, Xiao; Liu, Yuejun; Chen, Jia; Zhou, Haixia; Jing, Song; Gu, Bing; Xu, Yang; Sun, Aining; He, Jun; Wu, Depei

    2016-02-01

    Outcomes for hematopoietic stem cell transplantation (HSCT) in various donor and recipient killer immunoglobulin-like receptor (KIR) genotypes have been studied extensively. The associations between KIR2DS4 and its variant KIR1D with outcomes of HSCT from a sibling-related HLA-matched donor with KIR haplotype A have not been explored, however. To study this, we genotyped donor-recipient pairs and divided 165 recipients of HSCT from a KIR gene haplotype A donor into 3 groups: 2DS4+/2DS4+ (2 intact KIR2DS4 alleles), 2DS4+/1D+ (heterozygous), and 1D+/1D+ (homozygous for the deletion variant KIR1D). No difference in the recovery of neutrophils and platelets among the 3 groups was observed. The cumulative incidence of grade III-IV acute graft-versus-host disease (aGVHD) within day +100 was 28.94% in the 2DS4+/2DS4+ group, 14.11% in the 2DS4+/1D+ group, and 44.44% in the 1D+/1D+ group (P = .0159). Multivariate analysis identified 1D+/1D+ as an independent risk factor for aGVHD (hazard ratio [HR], 4.221; 95% confidence interval [CI], 1.470 to 12.124; P = .007). In contrast, the cumulative incidences of chronic GVHD, 3-year cumulative relapse, and treatment-related mortality did not differ significantly among the 3 groups. The rate of cytomegalovirus (CMV) reactivation was 46.96% in the 2DS4+/2DS4+ group, 20.16% in the 2DS4+/1D+ group, and 53.25% in the 1D+/1D+ group (P = .0017). Multivariate analysis identified 2DS4+/1D+ as an independent protective factor for CMV reactivation (HR, 0.268; 95% CI, 0.125 to 0.574; P = .001). Although overall survival (OS) did not differ among the groups in the first year, the 2DS4(+)/2DS4(+) group had significantly better OS than the other groups after 1 year (P = .0361). In patients with advanced-stage disease, the 3-year probability of disease-free survival was 51.06% in the 2DS4+/2DS4+ group, 34.01% in the 2DS4+/1D+ group, and 0% in the 1D+/1D+ group (P = .0314). Collectively, our data suggest that the KIR 2DS4/1D allelic variance

  18. Search for common haplotypes on chromosome 22q in patients with schizophrenia or bipolar disorder from the Faroe Islands

    DEFF Research Database (Denmark)

    Jorgensen, T H; Børglum, A D; Mors, O

    2002-01-01

    Chromosome 22q may harbor risk genes for schizophrenia and bipolar affective disorder. This is evidenced through genetic mapping studies, investigations of cytogenetic abnormalities, and direct examination of candidate genes. Patients with schizophrenia and bipolar affective disorder from the Faroe...... Islands were typed for 35 evenly distributed polymorphic markers on 22q in a search for shared risk genes in the two disorders. No single marker was strongly associated with either disease, but five two-marker segments that cluster within two regions on the chromosome have haplotypes occurring...

  19. Working with MRI: An investigation of occupational exposure to strong static magnetic fields and associated symptoms

    NARCIS (Netherlands)

    Schaap, K.

    2015-01-01

    Magnetic resonance imaging (MRI) makes use of electromagnetic fields in the non-ionizing radiation frequency ranges. One of them is a continuously present strong static magnetic field (SMF), which extends up to several meters around the scanner. Each time an MRI worker performs tasks near the

  20. HLA-G regulatory haplotypes and implantation outcome in couples who underwent assisted reproduction treatment.

    Science.gov (United States)

    Costa, Cynthia Hernandes; Gelmini, Georgia Fernanda; Wowk, Pryscilla Fanini; Mattar, Sibelle Botogosque; Vargas, Rafael Gustavo; Roxo, Valéria Maria Munhoz Sperandio; Schuffner, Alessandro; Bicalho, Maria da Graça

    2012-09-01

    The role of HLA-G in several clinical conditions related to reproduction has been investigated. Important polymorphisms have been found within the 5'URR and 3'UTR regions of the HLA-G promoter. The aim of the present study was to investigate 16 SNPs in the 5'URR and 14-bp insertion/deletion (ins/del) polymorphism located in the 3'UTR region of the HLA-G gene and its possible association with the implantation outcome in couples who underwent assisted reproduction treatments (ART). The case group was composed of 25 ART couples. Ninety-four couples with two or more term pregnancies composed the control group. Polymorphism haplotype frequencies of the HLA-G were determined for both groups. The Haplotype 5, Haplotype 8 and Haplotype 11 were absolute absence in ART couples. The HLA-G*01:01:02a, HLA-G*01:01:02b alleles and the 14-bp ins polymorphism, Haplotype 2, showed an increased frequency in case women and similar distribution between case and control men. However, this susceptibility haplotype is significantly presented in case women and in couple with failure implantation after treatment, which led us to suggest a maternal effect, associated with this haplotype, once their presence in women is related to a higher number of couples who underwent ART. Copyright © 2012. Published by Elsevier Inc.

  1. Estimating effects of rare haplotypes on failure time using a penalized Cox proportional hazards regression model

    Directory of Open Access Journals (Sweden)

    Tanck Michael WT

    2008-01-01

    Full Text Available Abstract Background This paper describes a likelihood approach to model the relation between failure time and haplotypes in studies with unrelated individuals where haplotype phase is unknown, while dealing with the problem of unstable estimates due to rare haplotypes by considering a penalized log-likelihood. Results The Cox model presented here incorporates the uncertainty related to the unknown phase of multiple heterozygous individuals as weights. Estimation is performed with an EM algorithm. In the E-step the weights are estimated, and in the M-step the parameter estimates are estimated by maximizing the expectation of the joint log-likelihood, and the baseline hazard function and haplotype frequencies are calculated. These steps are iterated until the parameter estimates converge. Two penalty functions are considered, namely the ridge penalty and a difference penalty, which is based on the assumption that similar haplotypes show similar effects. Simulations were conducted to investigate properties of the method, and the association between IL10 haplotypes and risk of target vessel revascularization was investigated in 2653 patients from the GENDER study. Conclusion Results from simulations and real data show that the penalized log-likelihood approach produces valid results, indicating that this method is of interest when studying the association between rare haplotypes and failure time in studies of unrelated individuals.

  2. Fetal hemoglobin in sickle cell anemia: The Arab-Indian haplotype and new therapeutic agents.

    Science.gov (United States)

    Habara, Alawi H; Shaikho, Elmutaz M; Steinberg, Martin H

    2017-11-01

    Fetal hemoglobin (HbF) has well-known tempering effects on the symptoms of sickle cell disease and its levels vary among patients with different haplotypes of the sickle hemoglobin gene. Compared with sickle cell anemia haplotypes found in patients of African descent, HbF levels in Saudi and Indian patients with the Arab-Indian (AI) haplotype exceed that in any other haplotype by nearly twofold. Genetic association studies have identified some loci associated with high HbF in the AI haplotype but these observations require functional confirmation. Saudi patients with the Benin haplotype have HbF levels almost twice as high as African patients with this haplotype but this difference is unexplained. Hydroxyurea is still the only FDA approved drug for HbF induction in sickle cell disease. While most patients treated with hydroxyurea have an increase in HbF and some clinical improvement, 10 to 20% of adults show little response to this agent. We review the genetic basis of HbF regulation focusing on sickle cell anemia in Saudi Arabia and discuss new drugs that can induce increased levels of HbF. © 2017 Wiley Periodicals, Inc.

  3. The influence of interleukin 7 receptor α chain haplotypes on outcome after allogeneic hematopoietic cell transplantation

    OpenAIRE

    Broux, Bieke; Shamim, Zaiba; Wang, Tao; Spellman, Stephen; Haagenson, Michael; Stinissen, Piet; Ryder, Lars Peter; Müller, Klaus; Hellings, Niels

    2014-01-01

    We investigated the influence of IL-7 receptor -chain (IL-7R) gene haplotypes in donors on the outcome of haematopoietic cell transplantation (HCT). Unlike the association between single donor SNPs and HCT outcome found previously, only trends towards association were found here, due to dilution' of SNPs into haplotypes. This project was funded by Hasselt University, Fonds voor Wetenschappelijk Onderzoek, Belgian Charcot Foundation, University Hospital Rigshospitalet Copenhagen, the Dagmar...

  4. Lack of evidence for selection favouring MHC haplotypes that combine high functional diversity.

    Science.gov (United States)

    Gaigher, Arnaud; Roulin, Alexandre; Gharib, Walid H; Taberlet, Pierre; Burri, Reto; Fumagalli, Luca

    2018-01-24

    High rates of gene duplication and the highest levels of functional allelic diversity in vertebrate genomes are the main hallmarks of the major histocompatibility complex (MHC), a multigene family with a primordial role in pathogen recognition. The usual tight linkage among MHC gene duplicates may provide an opportunity for the evolution of haplotypes that associate functionally divergent alleles and thus grant the transmission of optimal levels of diversity to coming generations. Even though such associations may be a crucial component of disease resistance, this hypothesis has been given little attention in wild populations. Here, we leveraged pedigree data from a barn owl (Tyto alba) population to characterize MHC haplotype structure across two MHC class I (MHC-I) and two MHC class IIB (MHC-IIB) duplicates, in order to test the hypothesis that haplotypes' genetic diversity is higher than expected from randomly associated alleles. After showing that MHC loci are tightly linked within classes, we found limited evidence for shifts towards MHC haplotypes combining high diversity. Neither amino acid nor functional within-haplotype diversity were significantly higher than in random sets of haplotypes, regardless of MHC class. Our results therefore provide no evidence for selection towards high-diversity MHC haplotypes in barn owls. Rather, high rates of concerted evolution may constrain the evolution of high-diversity haplotypes at MHC-I, while, in contrast, for MHC-IIB, fixed differences among loci may provide barn owls with already optimized functional diversity. This suggests that at the MHC-I and MHC-IIB respectively, different evolutionary dynamics may govern the evolution of within-haplotype diversity.

  5. High procedure volume is strongly associated with improved survival after lung cancer surgery

    DEFF Research Database (Denmark)

    Lüchtenborg, Margreet; Riaz, Sharma P; Coupland, Victoria H

    2013-01-01

    Studies have reported an association between hospital volume and survival for non-small-cell lung cancer (NSCLC). We explored this association in England, accounting for case mix and propensity to resect....

  6. A phased SNP-based classification of sickle cell anemia HBB haplotypes.

    Science.gov (United States)

    Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H

    2017-08-11

    Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.

  7. Strong association of the SNP rs17822931 with wet earwax and ...

    Indian Academy of Sciences (India)

    Wet earwax is a dominant Mendelian trait associated with the. GA/GG genotype of SNP rs17822931 in the ABCC11 gene. It is also often associated with the axillary odour (bromhidro- sis). To investigate their possible relationship we genotyped rs17822931 in a Chinese family affected with axillary odour. Direct sequencing ...

  8. The gambler's fallacy is associated with weak affective decision making but strong cognitive ability.

    Directory of Open Access Journals (Sweden)

    Gui Xue

    Full Text Available Humans demonstrate an inherent bias towards making maladaptive decisions, as shown by a phenomenon known as the gambler's fallacy (GF. The GF has been traditionally considered as a heuristic bias supported by the fast and automatic intuition system, which can be overcome by the reasoning system. The present study examined an intriguing hypothesis, based on emerging evidence from neuroscience research, that the GF might be attributed to a weak affective but strong cognitive decision making mechanism. With data from a large sample of college students, we found that individuals' use of the GF strategy was positively correlated with their general intelligence and executive function, such as working memory and conflict resolution, but negatively correlated with their affective decision making capacities, as measured by the Iowa Gambling Task. Our result provides a novel insight into the mechanisms underlying the GF, which highlights the significant role of affective mechanisms in adaptive decision-making.

  9. The Gambler’s Fallacy Is Associated with Weak Affective Decision Making but Strong Cognitive Ability

    Science.gov (United States)

    Xue, Gui; He, Qinghua; Lei, Xuemei; Chen, Chunhui; Liu, Yuyun; Chen, Chuansheng; Lu, Zhong-Lin; Dong, Qi; Bechara, Antoine

    2012-01-01

    Humans demonstrate an inherent bias towards making maladaptive decisions, as shown by a phenomenon known as the gambler’s fallacy (GF). The GF has been traditionally considered as a heuristic bias supported by the fast and automatic intuition system, which can be overcome by the reasoning system. The present study examined an intriguing hypothesis, based on emerging evidence from neuroscience research, that the GF might be attributed to a weak affective but strong cognitive decision making mechanism. With data from a large sample of college students, we found that individuals’ use of the GF strategy was positively correlated with their general intelligence and executive function, such as working memory and conflict resolution, but negatively correlated with their affective decision making capacities, as measured by the Iowa Gambling Task. Our result provides a novel insight into the mechanisms underlying the GF, which highlights the significant role of affective mechanisms in adaptive decision-making. PMID:23071701

  10. Bayesian genomic selection: the effect of haplotype lenghts and priors

    DEFF Research Database (Denmark)

    Villumsen, Trine Michelle; Janss, Luc

    2009-01-01

    Breeding values for animals with marker data are estimated using a genomic selection approach where data is analyzed using Bayesian multi-marker association models. Fourteen model scenarios with varying haplotype lengths, hyper parameter and prior distributions were compared to find the scenario...... expected to give the most correct genomic estimated breeding values for animals with marker information only. Five-fold cross validation was performed to assess the ability of models to estimate breeding values for animals in generation 3. In each of the five subsets, 20% of phenotypic records...... well. Correlations were 0.77-0.89 and predicted breeding values were biased. In addition the models seemed to over fit the genomic part of the variation. Highest correlations and most unbiased results were obtained when SNP markers were joined into haplotypes. Especially the scenarios with 5-SNP...

  11. Psychiatric disorders in Ehlers-Danlos syndrome are frequent, diverse and strongly associated with pain.

    Science.gov (United States)

    Hershenfeld, Samantha Aliza; Wasim, Syed; McNiven, Vanda; Parikh, Manasi; Majewski, Paula; Faghfoury, Hanna; So, Joyce

    2016-03-01

    Ehlers-Danlos syndromes (EDS) are a heterogeneous group of hereditary connective tissue disorders characterized by joint hypermobility, widespread musculoskeletal pain and tissue fragility. Psychiatric disorders and psychosocial impairment are common, yet poorly characterized, findings in EDS patients. We investigated the frequency and types of psychiatric disorders and their relationship to systemic manifestations in a cohort of 106 classic and hypermobility type EDS patients. In this retrospective study, extensive medical chart review was performed for patients referred at two genetics clinics who were diagnosed with EDS. Statistical analysis was undertaken to determine the frequency of psychiatric disorders and association with systemic findings. Psychiatric disorders were found in 42.5% of the EDS cohort, with 22.7% of patients affected with 2 or more psychiatric diagnoses. Anxiety and depression were most commonly reported, with frequencies of 23.6 and 25.5%, respectively. A variety of other psychiatric diagnoses were also identified. Abdominal pain [odds ratio (OR) 7.38], neuropathic pain (OR 4.07), migraines (OR 5.21), joint pain (OR 2.85) and fatigue (OR 5.55) were significantly associated with the presence of a psychiatric disorder. The presence of any pain symptom was significantly associated with having a psychiatric disorder (OR 9.68). Muscle pain (OR 2.79), abdominal pain (OR 5.78), neuropathic pain (OR 3.91), migraines (OR 2.63) and fatigue (OR 3.78) were significantly associated with having an anxiety or mood disorder. Joint hypermobility and the classic dermatological features of EDS showed no significant association with having a psychiatric disorder. Our findings demonstrate a high frequency of psychiatric disorders and an association with pain symptoms in EDS.

  12. Regular exercise is strongly associated with anticipated success for reducing health risks.

    Science.gov (United States)

    Wasson, John H

    2014-01-01

    Regular exercise is a healthy behavior associated with desirable benefits. Regular exercise also makes manifest 2 fundamental behaviors-a choice and the discipline to continuously act on that choice. This cross-sectional analysis of more than 10 000 adults examines the association of regular exercise with unhealthy behaviors. Compared with people who are more regularly exercising, nonexercisers are less likely to choose to change an unhealthy habit. Nonexercisers are also much less likely to be confident of their success when they do choose a habit to change. Regular exercise seems to be a gateway behavior for reducing other unhealthy habits.

  13. Familial Longevity Is Associated With Higher TSH Secretion and Strong TSH-fT3 Relationship

    DEFF Research Database (Denmark)

    Jansen, Steffy W; Roelfsema, Ferdinand; van der Spoel, Evie

    2015-01-01

    CONTEXT: Longevity is associated with changes in circulating levels of thyroid hormone (TH) and/or TSH in animals and humans, but underlying mechanisms remain elusive. OBJECTIVE: We explored in 38 offspring of nonagenarian participants from the Leiden Longevity Study, who are enriched for longevity...... properties of TSH. The temporal relationship between TSH and free T3 at zero delay was higher in offspring (0.48 ± 0.2) compared with partners (0.26 ± 0.4) (P = .05), but the feedback and forward interplay between TSH and TH did not differ. CONCLUSIONS: Familial longevity is associated with increased basal...

  14. Combined genotype and haplotype distributions of MTHFR C677T and A1298C polymorphisms: A cross-sectional descriptive study of 13,473 Chinese adult women.

    Science.gov (United States)

    Fan, Shujun; Yang, Boyi; Zhi, Xueyuan; Wang, Yanxun; Zheng, Quanmei; Sun, Guifan

    2016-11-01

    Methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms are, independently and/or in combination, associated with many disorders. However, data on the combined genotype and haplotype distributions of the 2 polymorphisms in Chinese population were limited.We recruited 13,473 adult women from 9 Chinese provinces, collected buccal cell samples, and determined genotypes, to estimate the combined genotype and haplotype distributions of the MTHFR C677T and A1298C polymorphisms.In the total sample, the 6 common combined genotypes were CT/AA (29.5%), TT/AA (21.9%), CC/AA (15.4%), CC/AC (14.9%), CT/AC (13.7%), and CC/CC (3.4%); the 3 frequent haplotypes were 677T-1298A (43.6%), 677C-1298A (37.9%), and 677C-1298C (17.6%). Importantly, we observed that there were 51 (0.4%) individuals with the CT/CC genotype, 92 (0.7%) with the TT/AC genotype, 17 (0.1%) with the TT/CC genotype, and that the frequency of the 677T-1298C haplotype was 0.9%. In addition, the prevalence of some combined genotypes and haplotypes varied among populations residing in different areas and even showed apparent geographical gradients. Further linkage disequilibrium analysis showed that the D' and r values were 0.883 and 0.143, respectively.In summary, the findings of our study provide further strong evidence that the MTHFR C677T and A1298C polymorphisms are usually in trans and occasionally in cis configurations. The frequencies of mutant genotype combinations were relatively higher in Chinese population than other populations, and showed geographical variations. These baseline data would be useful for future related studies and for developing health management programs.

  15. Neighborhood deprivation is strongly associated with participation in a population-based health check.

    Directory of Open Access Journals (Sweden)

    Anne Mette Bender

    Full Text Available We sought to examine whether neighborhood deprivation is associated with participation in a large population-based health check. Such analyses will help answer the question whether health checks, which are designed to meet the needs of residents in deprived neighborhoods, may increase participation and prove to be more effective in preventing disease. In Europe, no study has previously looked at the association between neighborhood deprivation and participation in a population-based health check.The study population comprised 12,768 persons invited for a health check including screening for ischemic heart disease and lifestyle counseling. The study population was randomly drawn from a population of 179,097 persons living in 73 neighborhoods in Denmark. Data on neighborhood deprivation (percentage with basic education, with low income and not in work and individual socioeconomic position were retrieved from national administrative registers. Multilevel regression analyses with log links and binary distributions were conducted to obtain relative risks, intraclass correlation coefficients and proportional change in variance.Large differences between neighborhoods existed in both deprivation levels and neighborhood health check participation rate (mean 53%; range 35-84%. In multilevel analyses adjusted for age and sex, higher levels of all three indicators of neighborhood deprivation and a deprivation score were associated with lower participation in a dose-response fashion. Persons living in the most deprived neighborhoods had up to 37% decreased probability of participating compared to those living in the least deprived neighborhoods. Inclusion of individual socioeconomic position in the model attenuated the neighborhood deprivation coefficients, but all except for income deprivation remained statistically significant.Neighborhood deprivation was associated with participation in a population-based health check in a dose-response manner, in which

  16. Associations Between Participant Ratings of PREP for Strong Bonds and Marital Outcomes 1 Year Postintervention.

    Science.gov (United States)

    Allen, Elizabeth S; Post, Kristina M; Markman, Howard J; Rhoades, Galena K; Stanley, Scott M

    2017-07-01

    After completing a relationship education program, collecting participant evaluations of the program is common practice. These are generally used as an index of "consumer satisfaction" with the program, with implications for feasibility and quality. Rarely have these ratings been used as predictors of changes in marital quality, although such feedback may be the only data providers collect or have immediate access to when considering the success of their efforts. To better understand the utility of such ratings to predict outcomes, we evaluated links between participant ratings and changes in self-reported marital satisfaction and communication scores one year later for a sample of 191 Army couples who had participated in a relationship education program delivered by Army chaplains (PREP for Strong Bonds). Overall ratings of general satisfaction with the program and the leader did not predict changes in marital outcomes one year later, whereas higher ratings of how much was learned, program helpfulness, increased similarity in outlook regarding Army life, and helpfulness of communication skills training predicted greater change in communication skills one year later. Higher ratings of items reflecting intent to invest more time in the relationship, and increased confidence in constructive communication and working as a team with the spouse predicted greater increases in both marital satisfaction and communication skills one year later. The constructs of intention and confidence (akin to perceived behavioral control) suggest that the Theory of Planned Behavior may be particularly useful when considering which Army couples will show ongoing benefit after relationship education.

  17. Vitamin D Receptor Gene Polymorphisms and Haplotypes in Hungarian Patients with Idiopathic Inflammatory Myopathy

    Directory of Open Access Journals (Sweden)

    Levente Bodoki

    2015-01-01

    Full Text Available Idiopathic inflammatory myopathies are autoimmune diseases characterized by symmetrical proximal muscle weakness. Our aim was to identify a correlation between VDR polymorphisms or haplotypes and myositis. We studied VDR-BsmI, VDR-ApaI, VDR-TaqI, and VDR-FokI polymorphisms and haplotypes in 89 Hungarian poly-/dermatomyositis patients (69 females and 93 controls (52 females. We did not obtain any significant differences for VDR-FokI, BsmI, ApaI, and TaqI genotypes and allele frequencies between patients with myositis and healthy individuals. There was no association of VDR polymorphisms with clinical manifestations and laboratory profiles in myositis patients. Men with myositis had a significantly different distribution of BB, Bb, and bb genotypes than female patients, control male individuals, and the entire control group. Distribution of TT, Tt, and tt genotypes was significantly different in males than in females in patient group. According to four-marker haplotype prevalence, frequencies of sixteen possible haplotypes showed significant differences between patient and control groups. The three most frequent haplotypes in patients were the fbAt, FBaT, and fbAT. Our findings may reveal that there is a significant association: Bb and Tt genotypes can be associated with myositis in the Hungarian population we studied. We underline the importance of our result in the estimated prevalence of four-marker haplotypes.

  18. Is the Number of Different MRI Findings More Strongly Associated with Low Back Pain Than Single MRI Findings?

    DEFF Research Database (Denmark)

    Hancock, Mark J; Kjaer, Per; Kent, Peter

    2017-01-01

    STUDY DESIGN: A cross-sectional and longitudinal analysis using 2 different data sets OBJECTIVE.: To investigate if the number of different MRI findings present is more strongly associated with low back pain (LBP) than single MRI findings. SUMMARY OF BACKGROUND DATA: Most previous studies have....... The outcome for the cross-sectional study was presence of LBP during the last year. The outcome for the longitudinal study was days to recurrence of activity limiting LBP. In both data sets we created an aggregate score of the number of different MRI findings present in each individual and assessed...... investigated the associations between single MRI findings and back pain rather than investigating combinations of MRI findings. If different individuals have different pathoanatomic sources contributing to their pain, then combinations of MRI findings may be more strongly associated with LBP. METHODS...

  19. Neighborhood deprivation is strongly associated with participation in a population-based health check

    DEFF Research Database (Denmark)

    Bender, Anne Mette; Kawachi, Ichiro; Jørgensen, Torben

    2015-01-01

    BACKGROUND: We sought to examine whether neighborhood deprivation is associated with participation in a large population-based health check. Such analyses will help answer the question whether health checks, which are designed to meet the needs of residents in deprived neighborhoods, may increase...... screening for ischemic heart disease and lifestyle counseling. The study population was randomly drawn from a population of 179,097 persons living in 73 neighborhoods in Denmark. Data on neighborhood deprivation (percentage with basic education, with low income and not in work) and individual socioeconomic...... in both deprivation levels and neighborhood health check participation rate (mean 53%; range 35-84%). In multilevel analyses adjusted for age and sex, higher levels of all three indicators of neighborhood deprivation and a deprivation score were associated with lower participation in a dose...

  20. Diverticulitis and Crohn's disease have distinct but overlapping tumor necrosis superfamily 15 haplotypes.

    Science.gov (United States)

    Connelly, Tara M; Choi, Christine S; Berg, Arthur S; Harris, Leonard; Coble, Joel; Koltun, Walter A

    2017-06-15

    Diverticulitis (DD) and Crohn's disease (CD) have overlapping features including bowel structuring, inflammation, and infection. Tumor necrosis superfamily 15 (TNFSF15) is an immunoregulatory, anti-angiogenic gene. CD has been previously associated with a haplotype of five TNFSF15 single-nucleotide polymorphism alleles: rs3810936 (G allele), rs6478108 (A), rs6478109 (G), rs7848647 (G), and rs7869487 (A). We aimed to determine the TNFSF15 risk haplotype for DD versus controls with a subgroup analysis of youthful DD patients (aged ≤55 y) versus older controls (aged ≥55 y). A total of 148 diverticulitis patients (90 aged ≤55 y) and 200 controls (87 aged ≥55 y) were genotyped using our custom-designed Illumina Veracode microarray chip. Genotypes from rs3810936, rs6478108, rs6478109, rs7848647, rs7869487 and two additional TNFSF15 single nucleotide polymorphisms, rs3810936 and rs11554257, were analyzed. PHASE version 2.1, R with HaploStats and the Broad Institute's Haploview program were used for statistics and imputed haplotype frequency. Permutation corrected for multiple comparisons. The CD GAGGA haplotype was significantly associated with diverticulitis (P = 0.03) in the all DD versus all controls comparison. A second haplotype, rs6478108 (A), rs6478109 (G), rs7869487 (A), and rs4263839 (G), was also associated with DD in this cohort (P = 0.025). A third haplotype rs6478108 (A), rs6478109 (G), rs7848647 (G) and rs7869487 (A), rs4263839 (G) was demonstrated in the DD 55 comparison (P = 0.045). Distinct but overlapping TNFSF15 haplotypes were demonstrated in diverticulitis patients versus healthy controls when compared with the known Crohn's risk haplotype suggesting similar but distinct genetic predispositions. This study strengthens the role for a genetic predisposition to diverticulitis that involves the TNFSF15 gene. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Neonatal thalamic hemorrhage is strongly associated with electrical status epilepticus in slow wave sleep.

    Science.gov (United States)

    Kersbergen, Karina J; de Vries, Linda S; Leijten, Frans S S; Braun, Kees P J; Nievelstein, Rutger A J; Groenendaal, Floris; Benders, Manon J N L; Jansen, Floor E

    2013-04-01

    Thalamic hemorrhage has been associated with neonatal cerebral sinovenous thrombosis (CSVT), especially when the straight sinus is involved, and often presents with neonatal seizures. Early thalamic injury has previously been shown to predispose to epilepsy and electrical status epilepticus in slow wave sleep (ESES). The objective of this study was to assess the prevalence of sleep-induced epileptic electroencephalography (EEG) abnormalities and postneonatal epilepsy after neonatal thalamic hemorrhage associated with CSVT, in the absence of more widespread cerebral damage. Between 2003 and 2008 15 neonates were diagnosed with a thalamic hemorrhage due to suspected or proven CSVT. Neurodevelopment and the history of seizures were assessed at follow-up in the outpatient clinic in all 14 survivors (age 2-9 years). Whole-night or sleep-deprived EEG recordings were obtained to assess the prevalence of interictal epileptiform activity (EA) and calculate a sleep-induced spike and wave index (SWI). Three children were diagnosed with classic ESES (SWI >85%). Two children had ESES spectrum disorder (SWI between 50% and 85%), and in two children significant sleep-induced epileptiform activity (SIEA) was noted (SWI between 25% and 50%). Two other children were diagnosed with focal epilepsy, in the absence of sleep-induced epileptiform EEG abnormalities. Five children (age 2-7 years) had normal EEG recordings at follow-up. Deficits in neurodevelopment were seen significantly more often in children with ESES, ESES spectrum, or SIEA. Neonates with thalamic hemorrhage associated with straight sinus thrombosis, without evidence of more widespread cerebral damage, are at high risk of developing ESES (spectrum) disorder (35%), SIEA (14%), or focal epilepsy (14%). Electrographic abnormalities may already be present prior to recognition of cognitive deficits. Early diagnosis may guide parents and caregivers, and subsequent treatment may improve neurodevelopmental outcome. Routine

  2. An algorithm for inferring complex haplotypes in a region of copy-number variation.

    Science.gov (United States)

    Kato, Mamoru; Nakamura, Yusuke; Tsunoda, Tatsuhiko

    2008-08-01

    Recent studies have extensively examined the large-scale genetic variants in the human genome known as copy-number variations (CNVs), and the universality of CNVs in normal individuals, along with their functional importance, has been increasingly recognized. However, the absence of a method to accurately infer alleles or haplotypes within a CNV region from high-throughput experimental data hampers the finer analyses of CNV properties and applications to disease-association studies. Here we developed an algorithm to infer complex haplotypes within a CNV region by using data obtained from high-throughput experimental platforms. We applied this algorithm to experimental data and estimated the population frequencies of haplotypes that can yield information on both sequences and numbers of DNA copies. These results suggested that the analysis of such complex haplotypes is essential for accurately detecting genetic differences within a CNV region between population groups.

  3. Onset polarity in bipolar disorder: A strong association between first depressive episode and suicide attempts.

    Science.gov (United States)

    Cremaschi, Laura; Dell'Osso, Bernardo; Vismara, Matteo; Dobrea, Cristina; Buoli, Massimiliano; Ketter, Terence A; Altamura, A Carlo

    2017-02-01

    The role of onset polarity (OP) in patients with bipolar disorder (BD) has been increasingly investigated over the last few years, for its clinical, prognostic, and therapeutic implications. The present study sought to assess whether OP was associated with specific correlates, in particular with a differential suicidal risk in BD patients. A sample of 362 recovered BD patients was dichotomized by OP: depressed (DO) or elevated onset (EO: hypomanic/manic/mixed). Socio-demographic and clinical variables were compared between the subgroups. Additionally, binary logistic regression was performed to assess features associated with OP. DO compared with EO patients had older current age and were more often female, but less often single and unemployed. Clinically, DO versus EO had a more than doubled rate of suicide attempts, as well as significantly higher rates of BD II diagnosis, lifetime stressful events, current psychotropics and antidepressants use, longer duration of the most recent episode (more often depressive), but lower rates of psychosis and involuntary commitments. Retrospective design limiting the accurate assessment of total number of prior episodes of each polarity. Our results support the influence of OP on BD course and outcome. Moreover, in light of the relationship between DO and a higher rate of suicide attempts, further investigation may help clinicians in identifying patients at higher risk of suicide attempts. Copyright © 2016. Published by Elsevier B.V.

  4. Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent

    International Nuclear Information System (INIS)

    Cavallone, Luca; Arcand, Suzanna L; Maugard, Christine; Ghadirian, Parviz; Mes-Masson, Anne-Marie; Provencher, Diane; Tonin, Patricia N

    2008-01-01

    The TP53 polymorphisms Arg72Pro (Ex4+199 G>C) and Ins16 (IVS3+24 ins16) have been proposed to modify risk of breast cancer associated with germline BRCA1 and BRCA2 mutations. Allele frequencies of these polymorphisms were investigated to determine if they modify risk in BRCA mutation carriers in breast cancer cases drawn from French Canadian cancer families, a population shown to exhibit strong founder effects. The frequencies of the TP53 alleles, genotypes and haplotypes of 157 index breast cancer cases comprised of 42 BRCA1 mutation carriers, 57 BRCA2 mutation carriers, and 58 BRCA mutation-negative cases, where each case was drawn from independently ascertained families were compared. The effect of TP53 variants on the age of diagnosis was also investigated for these groups. The TP53 polymorphisms were also investigated in 112 women of French Canadian descent with no personal history of cancer. The BRCA mutation-positive groups had the highest frequency of homozygous carriers of the 72Pro allele compared with mutation-negative group. The TP53 polymorphisms exhibited linkage disequilibrium (p < 0.001), where the 72Arg and Ins16minus alleles occurred in strong disequilibrium. The highest frequency of carriers of Ins16minus-72Arg haplotype occurred in the BRCA mutation-negative groups. The BRCA1 mutation carriers homozygous for the 72Pro allele had the youngest ages of diagnosis of breast cancer. However none of these observations were statistically significant. In contrast, the BRCA2 mutation carriers homozygous for the 72Pro allele had a significantly older age of diagnosis of breast cancer (p = 0.018). Moreover, in this group, the mean age of diagnosis of breast cancer in carriers of the Ins16minus-72Arg haplotype was significantly younger than that of the individuals who did not this carry this haplotype (p = 0.009). We observed no significant association of breast cancer risk with TP53 genetic variants based on BRCA1/2 mutation carrier status. Although the

  5. Copy number variation leads to considerable diversity for B but not A haplotypes of the human KIR genes encoding NK cell receptors.

    Science.gov (United States)

    Jiang, Wei; Johnson, Chris; Jayaraman, Jyothi; Simecek, Nikol; Noble, Janelle; Moffatt, Miriam F; Cookson, William O; Trowsdale, John; Traherne, James A

    2012-10-01

    The KIR complex appears to be evolving rapidly in humans, and more than 50 different haplotypes have been described, ranging from four to 14 KIR loci. Previously it has been suggested that most KIR haplotypes consist of framework genes, present in all individuals, which bracket a variable number of other genes. We used a new technique to type 793 families from the United Kingdom and United States for both the presence/absence of all individual KIR genes as well as copy number and found that KIR haplotypes are even more complex. It is striking that all KIR loci are subject to copy number variation (CNV), including the so-called framework genes, but CNV is much more frequent in KIR B haplotypes than KIR A haplotypes. These two basic KIR haplotype groups, A and B, appear to be following different evolutionary trajectories. Despite the great diversity, there are 11 common haplotypes, derived by reciprocal recombination near KIR2DL4, which collectively account for 94% of KIR haplotypes determined in Caucasian samples. These haplotypes could be derived from combinations of just three centromeic and two telomeric motifs, simplifying disease analysis for these haplotypes. The remaining 6% of haplotypes displayed novel examples of expansion and contraction of numbers of loci. Conventional KIR typing misses much of this additional complexity, with important implications for studying the genetics of disease association with KIR that can now be explored by CNV analysis.

  6. Complete MHC Haplotype Sequencing for Common Disease Gene Mapping

    Science.gov (United States)

    Stewart, C. Andrew; Horton, Roger; Allcock, Richard J.N.; Ashurst, Jennifer L.; Atrazhev, Alexey M.; Coggill, Penny; Dunham, Ian; Forbes, Simon; Halls, Karen; Howson, Joanna M.M.; Humphray, Sean J.; Hunt, Sarah; Mungall, Andrew J.; Osoegawa, Kazutoyo; Palmer, Sophie; Roberts, Anne N.; Rogers, Jane; Sims, Sarah; Wang, Yu; Wilming, Laurens G.; Elliott, John F.; de Jong, Pieter J.; Sawcer, Stephen; Todd, John A.; Trowsdale, John; Beck, Stephan

    2004-01-01

    The future systematic mapping of variants that confer susceptibility to common diseases requires the construction of a fully informative polymorphism map. Ideally, every base pair of the genome would be sequenced in many individuals. Here, we report 4.75 Mb of contiguous sequence for each of two common haplotypes of the major histocompatibility complex (MHC), to which susceptibility to >100 diseases has been mapped. The autoimmune disease-associated-haplotypes HLA-A3-B7-Cw7-DR15 and HLA-A1-B8-Cw7-DR3 were sequenced in their entirety through a bacterial artificial chromosome (BAC) cloning strategy using the consanguineous cell lines PGF and COX, respectively. The two sequences were annotated to encompass all described splice variants of expressed genes. We defined the complete variation content of the two haplotypes, revealing >18,000 variations between them. Average SNP densities ranged from less than one SNP per kilobase to >60. Acquisition of complete and accurate sequence data over polymorphic regions such as the MHC from large-insert cloned DNA provides a definitive resource for the construction of informative genetic maps, and avoids the limitation of chromosome regions that are refractory to PCR amplification. PMID:15140828

  7. Repeat interruptions in spinocerebellar ataxia type 10 expansions are strongly associated with epileptic seizures

    Science.gov (United States)

    McFarland, Karen N.; Liu, Jilin; Landrian, Ivette; Zeng, Desmond; Raskin, Salmo; Moscovich, Mariana; Gatto, Emilia M.; Ochoa, Adriana; Teive, Hélio A. G.; Rasmussen, Astrid; Ashizawa, Tetsuo

    2014-01-01

    Spinocerebellar ataxia type 10 (SCA10), an autosomal dominant neurodegenerative disorder, is the result of a non-coding, pentanucleotide repeat expansion within intron 9 of the Ataxin 10 gene. SCA10 patients present with pure cerebellar ataxia; yet, some families also have a high incidence of epilepsy. SCA10 expansions containing penta- and heptanucleotide interruption motifs, termed “ATCCT interruptions,” experience large contractions during germline transmission, particularly in paternal lineages. At the same time, these alleles confer an earlier age at onset which contradicts traditional rules of genetic anticipation in repeat expansions. Previously, ATCCT interruptions have been associated with a higher prevalence of epileptic seizures in one Mexican-American SCA10 family. In a large cohort of SCA10 families, we analyzed whether ATCCT interruptions confers a greater risk for developing seizures in these families. Notably, we find that the presence of repeat interruptions within the SCA10 expansion confers a 6.3-fold increase in the risk of an SCA10 patient developing epilepsy (6.2-fold when considering patients of Mexican ancestry only) and a 13.7-fold increase in having a positive family history of epilepsy (10.5-fold when considering patients of Mexican ancestry only). We conclude that the presence of repeat interruptions in SCA10 repeat expansion indicates a significant risk for the epilepsy phenotype and should be considered during genetic counseling. PMID:24318420

  8. Severity of rhinitis and wheezing is strongly associated in preschoolers: A population-based study.

    Science.gov (United States)

    Pereira, Ana Margarida; Morais-Almeida, Mário; Santos, Natacha; Nunes, Carlos; Bousquet, Jean; Fonseca, João Almeida

    2015-11-01

    In preschool children, no study assessed the relation between wheezing and rhinitis severity. Our aims were to estimate the prevalence of current wheezing (CW) in preschoolers and to study the association between CW and current rhinitis (CR), considering its severity/persistency. This is a cross-sectional, nationwide, population-based study including a representative sample of 5003 Portuguese children aged 3-5 years. Data were collected by a face-to-face interview with caregivers using an adapted ISAAC questionnaire. CW was defined as presence of ≥1 wheezing episode in the previous 12 months. Rhinitis severity/persistency was classified according to Allergic Rhinitis and its Impact on Asthma. Current wheezing prevalence was 24.5% [95% CI 23.3-25.7]; 9.4% of the participants had ≥4 wheezing episodes in the previous year. Children with CR had an odds ratio (OR) of 4.0 [95% CI 3.4-4.5] for CW; it was highest for children with moderate-severe persistent rhinitis (11.5 [95% CI 8.1-16.3]), even after adjusting for possible confounders. Wheezers with CR reported more wheezing treatment use (p = 0.024) than those without CR. There was a trend for a higher number of wheezing episodes with more persistent and severe nasal disease - 48.4% of children with moderate-severe persistent rhinitis had >4 wheezing episodes vs. 28.9% in moderate-severe intermittent, 20.0% in mild persistent, 10.8% in mild intermittent, and 3.6% in those without CR; p rhinitis, especially moderate-severe persistent disease. Preschoolers with both CW and rhinitis seem to have a more severe phenotype, emphasizing the need for concurrent evaluation of nasal and bronchial symptoms even in small children. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Household income is strongly associated with health-related quality of life among Japanese men but not women.

    Science.gov (United States)

    Yamazaki, S; Fukuhara, S; Suzukamo, Y

    2005-07-01

    As socio-economic status (SES) strongly reflects individual economic status, evaluating the association between SES and health could provide information that is important for planning integrated economic and public health policies. We examined the association between annual household income as a measure of SES and the eight scale scores of the Medical Outcomes Study Short Form-36 Health Survey (SF-36) as a quantifier of health-related quality of life (HRQOL) in Japan. Cross-sectional survey. Data were from the SF-36 national survey in Japan. A total of 4500 people aged 16 years or older were selected from the entire population of Japan using stratified-random sampling, and 3395 responded to the survey. Men with lower levels of annual household income had lower scores in all SF-36 domains. However, only 'general health perceptions' and 'social functioning' showed statistically significant trends among the women surveyed. In the subgroup of women working full-time, there were no domains that showed significant trends. A strong association exists between annual household income and SF-36 scores among men, but there is only a limited association among women. The employment and economic policies that affect annual household income potentially influence HRQOL.

  10. A strong pelvic floor is associated with higher rates of sexual activity in women with pelvic floor disorders

    Science.gov (United States)

    Kanter, Gregg; Rogers, Rebecca G; Pauls, Rachel N; Kammerer-Doak, Dorothy; Thakar, Ranee

    2015-01-01

    Introduction and Hypothesis We evaluated the associations between pelvic floor muscle strength and tone with sexual activity and sexual function in women with pelvic floor disorders. Methods This was a secondary analysis of a multicenter study of women with pelvic floor disorders from the US and UK performed to validate the Pelvic Organ Prolapse/Incontinence Sexual Questionnaire, IUGA-Revised (PISQ-IR). Participants were surveyed about whether they were sexually active and completed the PISQ-IR and Female Sexual Function Index (FSFI) questionnaires to assess sexual function. Physical exams included assessment of pelvic floor strength by the Oxford Grading Scale, and assessment of pelvic floor tone per ICS guidelines. Results The cohort of 585 women was middle aged (mean age 54.9 +/−12.1) with 395 (67.5%) reporting sexual activity. Women with a strong pelvic floor (n=275) were more likely to report sexual activity than women with weak strength (n=280) (75.3 vs. 61.8%, ppelvic floor tone was not associated with sexual activity (68.8 vs. 60.2%, normal vs. hypoactive, p=0.08). After multivariable analysis, a strong pelvic floor remained predictive of sexual activity (OR 1.89, CI 1.18–3.03, ppelvic floor was associated with higher scores on the PISQ-IR domain of condition impact (Parameter Estimate 0.20+/−0.09, P=0.04), and FSFI orgasm domain (PE 0.51+/−0.17, P=0.004). Conclusion A strong pelvic floor is associated with higher rates of sexual activity as well as higher sexual function scores on the condition impact domain of the PISQ-IR and orgasm domain of the FSFI. PMID:25994625

  11. Antifolate drug resistance: Novel mutations and haplotype ...

    Indian Academy of Sciences (India)

    A total of 249 fever cases from Arunachal Pradesh, NEIndia, were screened for malaria, and of these, 75 were found to be positive for Plasmodium falciparum. Samples weresequenced and analysed with the help of BioEdit and ClustalW. Three novel point mutations were found in the dhps genewith 10 haplotypes along ...

  12. Tropospheric mid-latitude geopotential wave characteristics associated with strong wind events in the North Atlantic/European region

    Science.gov (United States)

    Wild, Simon; Simmonds, Ian; Leckebusch, Gregor C.

    2015-04-01

    The variability of strong synoptic scale wind events in the mid-latitudes have long been linked to baroclinic wave activity in the mid troposphere. Previous studies have also shown that greater amplitudes of planetary waves in the mid troposphere are likely to increase the occurrence of regional extremes in temperature and precipitation. In this study we examine whether characteristics of planetary and synoptic mid-latitude waves show systematic anomalies in the North Atlantic/ European region which can be related to the occurrence of a strong surface wind event. We will mainly focus on two questions: 1) Do amplitudes for waves with different wave lengths show a systematic anomaly when a strong wind event occurs? 2) Can phases of the individual wave components be detected that favour strong wind events? In order to decompose the mid-tropospheric flow into longitudinal waves we employ the fast Fourier transform to the meridional mean of the geopotential height in 500hPa between 35° and 60°N for i) the entire latitude belt and ii) for a North Atlantic/European sector (36°W to 36°E). Our definition of strong wind events is based on the Storm Severity Index (SSI) alongside a wind tracking algorithm identifying areas of exceedances of the local 98th percentile of the 10m wind speed. First results using ERA-Interim Reanalysis from 1979 - 2014 for the extended winter season (ONDJFM) for the 50 most intense strong wind systems with respect to the SSI reveal a greater amplitude for all investigated wave numbers. Especially waves with wave lengths below 2000km show an increase of about 25% of the daily standard deviation on average. The distribution of wave phases for the different wave numbers with respect to the location of a strong wind event shows a less homogenous picture. There is however a high proportion of events that can be associated with phases around 3π/4 and 5π/4 of waves with lengths of around 6000km, equivalent to wave number 5 on a planetary scale

  13. The effect of genealogy-based haplotypes on genomic prediction

    DEFF Research Database (Denmark)

    Edriss, Vahid; Fernando, Rohan L.; Su, Guosheng

    2013-01-01

    on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using...... local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (pi) of the haplotype covariates had zero effect......, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some...

  14. Characterization of N-acetyltransferase 1 and 2 polymorphisms and haplotype analysis for inflammatory bowel disease and sporadic colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Cobbs Gary A

    2007-05-01

    Full Text Available Abstract Background N-acetyltransferase 1 (NAT1 and 2 (NAT2 are polymorphic isoenzymes responsible for the metabolism of numerous drugs and carcinogens. Acetylation catalyzed by NAT1 and NAT2 are important in metabolic activation of arylamines to electrophilic intermediates that initiate carcinogenesis. Inflammatory bowel diseases (IBD consist of Crohn's disease (CD and ulcerative colitis (UC, both are associated with increased colorectal cancer (CRC risk. We hypothesized that NAT1 and/or NAT2 polymorphisms contribute to the increased cancer evident in IBD. Methods A case control study was performed with 729 Caucasian participants, 123 CRC, 201 CD, 167 UC, 15 IBD dysplasia/cancer and 223 controls. NAT1 and NAT2 genotyping were performed using Taqman based techniques. Eight single nucleotide polymorphisms (SNPs were characterized for NAT1 and 7 SNPs for NAT2. Haplotype frequencies were estimated using an Expectation-Maximization (EM method. Disease groups were compared to a control group for the frequencies at each individual SNP separately. The same groups were compared for the frequencies of NAT1 and NAT2 haplotypes and deduced NAT2 phenotypes. Results No statistically significant differences were found for any comparison. Strong linkage disequilibrium was present among both the NAT1 SNPs and the NAT2 SNPs. Conclusion This study did not demonstrate an association between NAT1 and NAT2 polymorphisms and IBD or sporadic CRC, although power calculations indicate this study had sufficient sample size to detect differences in frequency as small as 0.05 to 0.15 depending on SNP or haplotype.

  15. F8 haplotype and inhibitor risk: results from the Hemophilia Inhibitor Genetics Study (HIGS) Combined Cohort

    Science.gov (United States)

    Schwarz, John; Astermark, Jan; Menius, Erika D.; Carrington, Mary; Donfield, Sharyne M.; Gomperts, Edward D.; Nelson, George W.; Oldenburg, Johannes; Pavlova, Anna; Shapiro, Amy D.; Winkler, Cheryl A.; Berntorp, Erik

    2012-01-01

    Background Ancestral background, specifically African descent, confers higher risk for development of inhibitory antibodies to factor VIII (FVIII) in hemophilia A. It has been suggested that differences in the distribution of factor VIII gene (F8) haplotypes, and mismatch between endogenous F8 haplotypes and those comprising products used for treatment could contribute to risk. Design and Methods Data from the HIGS Combined Cohort were used to determine the association between F8 haplotype 3 (H3) vs. haplotypes 1 and 2 (H1+H2) and inhibitor risk among individuals of genetically-determined African descent. Other variables known to affect inhibitor risk including type of F8 mutation and HLA were included in the analysis. A second research question regarding risk related to mismatch in endogenous F8 haplotype and recombinant FVIII products used for treatment was addressed. Results H3 was associated with higher inhibitor risk among those genetically-identified (N=49) as of African ancestry, but the association did not remain significant after adjustment for F8 mutation type and the HLA variables. Among subjects of all racial ancestries enrolled in HIGS who reported early use of recombinant products (N=223), mismatch in endogenous haplotype and the FVIII proteins constituting the products used did not confer greater risk for inhibitor development. Conclusion H3 was not an independent predictor of inhibitor risk. Further, our findings did not support a higher risk of inhibitors in the presence of a haplotype mismatch between the FVIII molecule infused and that of the individual. PMID:22958194

  16. Haplotypes of catechol-O-methyltransferase modulate intelligence-related brain white matter integrity.

    Science.gov (United States)

    Liu, Bing; Li, Jun; Yu, Chunshui; Li, Yonghui; Liu, Yong; Song, Ming; Fan, Ming; Li, Kuncheng; Jiang, Tianzi

    2010-03-01

    Twin studies have indicated a common genetic origin for intelligence and for variations in brain morphology. Our previous diffusion tensor imaging studies found an association between intelligence and white matter integrity of specific brain regions or tracts. However, specific genetic determinants of the white matter integrity of these brain regions and tracts are still unclear. In this study, we assess whether and how catechol-O-methyltransferase (COMT) gene polymorphisms affect brain white matter integrity. We genotyped twelve single nucleotide polymorphisms (SNPs) within the COMT gene and performed haplotype analyses on data from 79 healthy subjects. Our subjects had the same three major COMT haplotypes (termed the HPS, APS and LPS haplotypes) as previous studies have reported as regulating significantly different levels of enzymatic activity and dopamine. We used the mean fractional anisotropy (FA) values from four regions and five tracts of interest to assess the effect of COMT polymorphisms, including the well-studied val158met SNP and the three main haplotypes that we had identified, on intelligence-related white matter integrity. We identified an association between the mean FA values of two regions in the bilateral prefrontal lobes and the COMT haplotypes, rather than between them and val158met. The haplotype-FA value associations modulated nonlinearly and fit an inverted U-model. Our findings suggest that COMT haplotypes can nonlinearly modulate the intelligence-related white matter integrity of the prefrontal lobes by more significantly influencing prefrontal dopamine variations than does val158met. Copyright (c) 2009 Elsevier Inc. All rights reserved.

  17. Psychobehavioural Factors Are More Strongly Associated with Successful Weight Management Than Predetermined Satiety Effect or Other Characteristics of Diet

    Directory of Open Access Journals (Sweden)

    Leila Karhunen

    2012-01-01

    Full Text Available This study aimed to investigate factors associated with weight management, especially whether satiety value of food as a part of a weight-maintenance diet would affect self-regulation of food intake and weight management. Altogether 82 obese subjects completed the study consisting of weight-loss and weight-maintenance (WM periods. During the WM, subjects were randomized into higher- and lower-satiety food groups. No differences were observed in the changes in body weight, energy intake, or eating behaviour between the groups, even despite the different macronutrient compositions of the diets. However, when regarding all study subjects, success in WM was most strongly associated with a greater increase in the flexible control of eating and experience of greater easiness of WM and control of food intake and a greater decrease in uncontrollable eating and psychological distress. Psychobehavioural factors seem to be more strongly associated with successful weight management than the predetermined satiety effect or other characteristics of the diet.

  18. Polymorphism of the DQA1 promoter region (QAP) and DRB1, QAP, DQA1, DQB1 haplotypes in systemic lupus erythematosus. SLE Study Group members.

    Science.gov (United States)

    Yao, Z; Kimura, A; Hartung, K; Haas, P J; Volgger, A; Brünnler, G; Bönisch, J; Albert, E D

    1993-01-01

    We have investigated the DNA polymorphism for the DQA1 promoter region (QAP) and HLA-class II DRB1, DQA1, and DQB1 genes in 178 central European patients with Systemic lupus erythematosus (SLE) using polymerase chain reaction and Dig-ddUTP labeled oligonucleotides. Increased frequencies of DRB1*02 and *03 are confirmed by DNA typing. In addition, the frequencies of DQA1*0501, *0102 and DQB1*0201, *0602 alleles are increased in the patients as compared to controls. The strongest association to SLE is found with DRB1*03 and DOB1*0201 alleles (p QAP variants. Increased frequencies of QAP1.2 and QAP4.1 are observed in patients as compared to controls (p QAP variants and DQA1, DRB1 alleles. Certain QAP variants are completely associated with DQA1 and DRB1 alleles, whereas others can combine with different DQA1 and DRB1 alleles. All DRB1*02-positive patients and controls carry QAP1.2, and all DRB1*03-positive patients and controls carry QAP4.1. Conversely, the QAP1.2 variant appears only in DRB1*02 haplotypes, while the QAP4.1 variant can be observed in DRB1*03, *11, and *1303 haplotypes. Based on the strong linkage disequilibria between DRB1-DQA1-DQB1 genes and between DRB1-QAP-DQA1, we have deduced the four-point haplotypes for DRB1-QAP-DQA1-DQB1 in patients and controls. Two haplotypes DRB1*02-QAP1.2-DQA1*0102-DQB1*0602 and DRB1*03-QAP4.1-DQA1*0501-DQB1*0201 are significantly increased in patients as compared to controls (p QAP, DQA1, and DQB1 as well as the investigation of the deduced DRB1-QAP-DQA1-DQB1 haplotypes leads to the conclusion that QAP4.1 and DQA1*0501 on the DR3 haplotypes are probably not involved in SLE susceptibility.(ABSTRACT TRUNCATED AT 400 WORDS)

  19. Characterisation of the genomic architecture of human chromosome 17q and evaluation of different methods for haplotype block definition

    Directory of Open Access Journals (Sweden)

    Ollier William

    2005-04-01

    Full Text Available Abstract Background The selection of markers in association studies can be informed through the use of haplotype blocks. Recent reports have determined the genomic architecture of chromosomal segments through different haplotype block definitions based on linkage disequilibrium (LD measures or haplotype diversity criteria. The relative applicability of distinct block definitions to association studies, however, remains unclear. We compared different block definitions in 6.1 Mb of chromosome 17q in 189 unrelated healthy individuals. Using 137 single nucleotide polymorphisms (SNPs, at a median spacing of 15.5 kb, we constructed haplotype block maps using published methods and additional methods we have developed. Haplotype tagging SNPs (htSNPs were identified for each map. Results Blocks were found to be shorter and coverage of the region limited with methods based on LD measures, compared to the method based on haplotype diversity. Although the distribution of blocks was highly variable, the number of SNPs that needed to be typed in order to capture the maximum number of haplotypes was consistent. Conclusion For the marker spacing used in this study, choice of block definition is not important when used as an initial screen of the region to identify htSNPs. However, choice of block definition has consequences for the downstream interpretation of association study results.

  20. Haplotype-based allele mining in the Japan-MAGIC rice population.

    Science.gov (United States)

    Ogawa, Daisuke; Yamamoto, Eiji; Ohtani, Toshikazu; Kanno, Noriko; Tsunematsu, Hiroshi; Nonoue, Yasunori; Yano, Masahiro; Yamamoto, Toshio; Yonemaru, Jun-Ichi

    2018-03-12

    Multi-parent advanced generation inter-cross (MAGIC) lines have broader genetic variation than bi-parental recombinant inbred lines. Genome-wide association study (GWAS) using high number of DNA polymorphisms such as single-nucleotide polymorphisms (SNPs) is a popular tool for allele mining in MAGIC populations, in which the associations of phenotypes with SNPs are investigated; however, the effects of haplotypes from multiple founders on phenotypes are not considered. Here, we describe an improved method of allele mining using the newly developed Japan-MAGIC (JAM) population, which is derived from eight high-yielding rice cultivars in Japan. To obtain information on the haplotypes in the JAM lines, we predicted the haplotype blocks in the whole chromosomes using 16,345 SNPs identified via genotyping-by-sequencing analysis. Using haplotype-based GWAS, we clearly detected the loci controlling the glutinous endosperm and culm length traits. Information on the alleles of the eight founders, which was based on the effects of mutations revealed by the analysis of next-generation sequencing data, was used to narrow down the candidate genes and reveal the associations between alleles and phenotypes. The haplotype-based allele mining (HAM) proposed in this study is a promising approach to the detection of allelic variation in genes controlling agronomic traits in MAGIC populations.

  1. Psychobehavioural Factors Are More Strongly Associated with Successful Weight Management Than Predetermined Satiety Effect or Other Characteristics of Diet

    DEFF Research Database (Denmark)

    Karhunen, Leila; Lyly, Marika; Lapveteläinen, Anja

    2012-01-01

    This study aimed to investigate factors associated with weight management, especially whether satiety value of food as a part of a weight-maintenance diet would affect self-regulation of food intake and weight management. Altogether 82 obese subjects completed the study consisting of weight...... factors seem to be more strongly associated with successful weight management than the predetermined satiety effect or other characteristics of the diet.......-loss and weight-maintenance (WM) periods. During theWM, subjects were randomized into higher- and lower-satiety food groups. No differences were observed in the changes in body weight, energy intake, or eating behaviour between the groups, even despite the different macronutrient compositions of the diets...

  2. A missense mutation in growth differentiation factor 9 (GDF9 is strongly associated with litter size in sheep

    Directory of Open Access Journals (Sweden)

    Våge Dag I

    2013-01-01

    Full Text Available Abstract Background A genome wide association study for litter size in Norwegian White Sheep (NWS was conducted using the recently developed ovine 50K SNP chip from Illumina. After genotyping 378 progeny tested artificial insemination (AI rams, a GWAS analysis was performed on estimated breeding values (EBVs for litter size. Results A QTL-region was identified on sheep chromosome 5, close to the growth differentiation factor 9 (GDF9, which is known to be a strong candidate gene for increased ovulation rate/litter size. Sequencing of the GDF9 coding region in the most extreme sires (high and low BLUP values revealed a single nucleotide polymorphism (c.1111G>A, responsible for a Val→Met substitution at position 371 (V371M. This polymorphism has previously been identified in Belclare and Cambridge sheep, but was not found to be associated with fertility. In our NWS-population the c.1111G>A SNP showed stronger association with litter size than any other single SNP on the Illumina 50K ovine SNP chip. Based on the estimated breeding values, daughters of AI rams homozygous for c.1111A will produce minimum 0.46 - 0.57 additional lambs compared to daughters of wild-type rams. Conclusion We have identified a missense mutation in the bioactive part of the GDF9 protein that shows strong association with litter size in NWS. Based on the NWS breeding history and the marked increase in the c.1111A allele frequency in the AI ram population since 1983, we hypothesize that c.1111A allele originate from Finnish landrace imported to Norway around 1970. Because of the widespread use of Finnish landrace and the fact that the ewes homozygous for the c.1111A allele are reported to be fertile, we expect the commercial impact of this mutation to be high.

  3. HLA-DRB1-DQB1 haplotypes confer susceptibility and resistance to multiple sclerosis in Sardinia.

    Directory of Open Access Journals (Sweden)

    Eleonora Cocco

    Full Text Available INTRODUCTION: Genetic predisposition to multiple sclerosis (MS in Sardinia (Italy has been associated with five DRB1*-DQB1* haplotypes of the human leukocyte antigen (HLA. Given the complexity of these associations, an in-depth re-analysis was performed with the specific aims of confirming the haplotype associations; establishing the independence of the associated haplotypes; and assessing patients' genotypic risk of developing MS. METHODS AND RESULTS: A transmission disequilibrium test (TDT of the DRB1*-DQB1* haplotypes in 943 trio families, confirmed a higher than expected transmission rate (over-transmission of the *13:03-*03:01 (OR = 2.9, P = 7.6×10(-3, *04:05-*03:01 (OR = 2.4, P = 4.4×10(-6 and *03:01-*02:01 (OR = 2.1, P = 1.0×10(-15 haplotype. In contrast, the *16:01-*05:02 (OR = 0.5, P = 5.4×10(-11 and the *15:02-*06:01 (OR = 0.3, P = 1.5×10(-3 haplotypes exhibited a lower than expected transmission rate (under-transmission. The independence of the transmission of each positively and negatively associated haplotype was confirmed relative to all positively associated haplotypes, and to the negatively associated *16:01-*05:02 haplotype. In patients, carriage of two predisposing haplotypes, or of protective haplotypes, respectively increased or decreased the patient's risk of developing MS. The risk of MS followed a multiplicative model of genotypes, which was, in order of decreasing ORs: *04:05-*0301/*03:01-*02:01 (OR = 4.5; *03:01-*02:01/*03:01-*02:01 (OR = 4.1; and the *16:01-*05:02/*16:01-*0502 (OR = 0.2 genotypes. Analysis of DRB1 and DQB1 protein chain residues showed that the Val/Gly residue at position 86 of the DRB1 chain was the only difference between the protective *16:01- *15:02 alleles and the predisposing *15:01 one. Similarly, the Ala/Val residue at position 38 of the DQB1 chain differentiated the positively associated *06:02 allele and the negatively associated *05

  4. Strong association of MRI meniscal derangement and bone marrow lesions in knee osteoarthritis: data from the osteoarthritis initiative.

    Science.gov (United States)

    Lo, G H; Hunter, D J; Nevitt, M; Lynch, J; McAlindon, T E

    2009-06-01

    Meniscal damage is common in knee Osteoarthritis (OA) and predictive of structural progression, suggesting that their disruption plays a role in the development of OA. The bone marrow lesion (BML) is associated with pain and is a strong risk factor for structural progression. These lesions are associated with abnormal loading in a knee joint. Therefore, our hypothesis was that in those with symptomatic knee OA, large BMLs would be associated with ipsi-compartmental meniscal derangement. This was a cross-sectional study of a subsample of the Osteoarthritis Initiative where one set of magnetic resonance (MR) images from each participant was scored for tibiofemoral BMLs and meniscal derangement. We performed chi-squared tests comparing the prevalence of large BMLs in those with ipsi-compartmental meniscal derangement and those without. 160 Participants had a mean age of 61 (+/-9.9), mean BMI of 30.3 (+/-4.7) and 50% were female. 79% of medial and 39% of lateral menisci showed MRI (Magnetic Resonance Imaging) derangement. In those with medial meniscal MRI derangement, 44% had large medial BMLs while in those without medial meniscal derangement, 0% had large BMLs. Similar results were seen in the lateral compartment. Medial and lateral MRI meniscal derangement are highly prevalent in symptomatic knee OA and BMLs are highly associated with ipsi-compartmental MRI meniscal derangement.

  5. Skin colonisation at the catheter exit site is strongly associated with catheter colonisation and catheter-related sepsis.

    Science.gov (United States)

    Ponnusamy, Vennila; Perperoglou, Aris; Venkatesh, Vidheya; Curley, Anna; Brown, Nicholas; Tremlett, Catherine; Clarke, Paul

    2014-12-01

    The commonest mode of catheter colonisation is via the extraluminal route with skin bacteria. Catheter-related sepsis causes significant mortality and morbidity in neonates. Our aim was to study the relationships between culture-positive catheter exit site skin swabs, percutaneous central venous catheter segments and blood to determine the magnitude of associations between exit site skin colonisation, catheter colonisation and catheter-related sepsis. In a prospective study, an exit site skin swab and three formerly in vivo catheter segments (proximal, middle and tip) were taken for culture at catheter removal. In those neonates who were clinically unwell at catheter removal, a peripheral blood culture was also collected. Univariate and multivariate analyses were used to study associations. Skin swabs were culture positive in 39 (21%) of 187 catheter removals. With a culture-positive skin swab, the risk of associated catheter colonisation was nearly eight times higher (OR: 7.84, 95% CI: 3.59-17.15) and the risk of definite catheter-related sepsis with the same organism was nearly 10 times higher (OR 9.86, 95% CI: 3.13-31.00). Culture-positive skin swabs from the catheter exit site were strongly associated with catheter colonisation and with definite catheter-related sepsis with the same organism. These data provide further evidence supporting catheter colonisation via the extraluminal route and highlight the importance of optimising skin disinfection before catheter insertion. ©2014 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  6. Assembly and analysis of 100 full MHC haplotypes from the Danish population

    DEFF Research Database (Denmark)

    Jensen, Jacob M.; Villesen, Palle; Friborg, Rune M.

    2017-01-01

    Genes in the major histocompatibility complex (MHC, also known as HLA) play a critical role in the immune response and variation within the extended 4-Mb region shows association with major risks of many diseases. Yet, deciphering the underlying causes of these associations is difficult because...... the MHC is the most polymorphic region of the genome with a complex linkage disequilibrium structure. Here, we reconstruct full MHC haplotypes from de novo assembled trios without relying on a reference genome and perform evolutionary analyses. We report 100 full MHC haplotypes and call a large set...

  7. Variation in Genes Related to Cochlear Biology Is Strongly Associated with Adult-Onset Deafness in Border Collies

    Science.gov (United States)

    Ruhe, Alison L.; Erdman, Carolyn A.; Robertson, Kathryn R.; Webb, Aubrey A.; Williams, D. Colette; Chang, Melanie L.; Hytönen, Marjo K.; Lohi, Hannes; Hamilton, Steven P.; Neff, Mark W.

    2012-01-01

    Domestic dogs can suffer from hearing losses that can have profound impacts on working ability and quality of life. We have identified a type of adult-onset hearing loss in Border Collies that appears to have a genetic cause, with an earlier age of onset (3–5 years) than typically expected for aging dogs (8–10 years). Studying this complex trait within pure breeds of dog may greatly increase our ability to identify genomic regions associated with risk of hearing impairment in dogs and in humans. We performed a genome-wide association study (GWAS) to detect loci underlying adult-onset deafness in a sample of 20 affected and 28 control Border Collies. We identified a region on canine chromosome 6 that demonstrates extended support for association surrounding SNP Chr6.25819273 (p-value = 1.09×10−13). To further localize disease-associated variants, targeted next-generation sequencing (NGS) of one affected and two unaffected dogs was performed. Through additional validation based on targeted genotyping of additional cases (n = 23 total) and controls (n = 101 total) and an independent replication cohort of 16 cases and 265 controls, we identified variants in USP31 that were strongly associated with adult-onset deafness in Border Collies, suggesting the involvement of the NF-κB pathway. We found additional support for involvement of RBBP6, which is critical for cochlear development. These findings highlight the utility of GWAS–guided fine-mapping of genetic loci using targeted NGS to study hereditary disorders of the domestic dog that may be analogous to human disorders. PMID:23028339

  8. Variation in genes related to cochlear biology is strongly associated with adult-onset deafness in border collies.

    Directory of Open Access Journals (Sweden)

    Jennifer S Yokoyama

    2012-09-01

    Full Text Available Domestic dogs can suffer from hearing losses that can have profound impacts on working ability and quality of life. We have identified a type of adult-onset hearing loss in Border Collies that appears to have a genetic cause, with an earlier age of onset (3-5 years than typically expected for aging dogs (8-10 years. Studying this complex trait within pure breeds of dog may greatly increase our ability to identify genomic regions associated with risk of hearing impairment in dogs and in humans. We performed a genome-wide association study (GWAS to detect loci underlying adult-onset deafness in a sample of 20 affected and 28 control Border Collies. We identified a region on canine chromosome 6 that demonstrates extended support for association surrounding SNP Chr6.25819273 (p-value = 1.09 × 10(-13. To further localize disease-associated variants, targeted next-generation sequencing (NGS of one affected and two unaffected dogs was performed. Through additional validation based on targeted genotyping of additional cases (n = 23 total and controls (n = 101 total and an independent replication cohort of 16 cases and 265 controls, we identified variants in USP31 that were strongly associated with adult-onset deafness in Border Collies, suggesting the involvement of the NF-κB pathway. We found additional support for involvement of RBBP6, which is critical for cochlear development. These findings highlight the utility of GWAS-guided fine-mapping of genetic loci using targeted NGS to study hereditary disorders of the domestic dog that may be analogous to human disorders.

  9. Are alcohol outlet densities strongly associated with alcohol-related outcomes? A critical review of recent evidence.

    Science.gov (United States)

    Gmel, Gerhard; Holmes, John; Studer, Joseph

    2015-06-29

    There have been reviews on the association between density of alcohol outlets and harm including studies published up to December 2008. Since then the number of publications has increased dramatically. The study reviews the more recent studies with regard to their utility to inform policy. A systematic review found more than 160 relevant studies (published between January 2009 and October 2014). The review focused on: (i) outlet density and assaultive or intimate partner violence; (ii) studies including individual level data; or (iii) 'natural experiments'. Despite overall evidence for an association between density and harm, there is little evidence on causal direction (i.e. whether demand leads to more supply or increased availability increases alcohol use and harm). When outlet types (e.g. bars, supermarkets) are analysed separately, studies are too methodologically diverse and partly contradictory to permit firm conclusions besides those pertaining to high outlet densities in areas such as entertainment districts. Outlet density commonly had little effect on individual-level alcohol use, and the few 'natural experiments' on restricting densities showed little or no effects. Although outlet densities are likely to be positively related to alcohol use and harm, few policy recommendations can be given as effects vary across study areas, outlet types and outlet cluster size. Future studies should examine in detail outlet types, compare different outcomes associated with different strengths of association with alcohol, analyse non-linear effects and compare different methodologies. Purely aggregate-level studies examining total outlet density only should be abandoned. [Gmel G, Holmes J, Studer J. Are alcohol outlet densities strongly associated with alcohol-related outcomes? A critical review of recent evidence. Drug Alcohol Rev 2015]. © 2015 Australasian Professional Society on Alcohol and other Drugs.

  10. Experimental Support That Natural Selection Has Shaped the Latitudinal Distribution of Mitochondrial Haplotypes in Australian Drosophila melanogaster.

    Science.gov (United States)

    Camus, M Florencia; Wolff, Jonci N; Sgrò, Carla M; Dowling, Damian K

    2017-10-01

    Cellular metabolism is regulated by enzyme complexes within the mitochondrion, the function of which are sensitive to the prevailing temperature. Such thermal sensitivity, coupled with the observation that population frequencies of mitochondrial haplotypes tend to associate with latitude, altitude, or climatic regions across species distributions, led to the hypothesis that thermal selection has played a role in shaping standing variation in the mitochondrial DNA (mtDNA) sequence. This hypothesis, however, remains controversial, and requires evidence that the distribution of haplotypes observed in nature corresponds with the capacity of these haplotypes to confer differences in thermal tolerance. Specifically, haplotypes predominating in tropical climates are predicted to encode increased tolerance to heat stress, but decreased tolerance to cold stress. We present direct evidence for these predictions, using mtDNA haplotypes sampled from the Australian distribution of Drosophila melanogaster. We show that the ability of flies to tolerate extreme thermal challenges is affected by sequence variation across mtDNA haplotypes, and that the thermal performance associated with each haplotype corresponds with its latitudinal prevalence. The haplotype that predominates at low (subtropical) latitudes confers greater resilience to heat stress, but lower resilience to cold stress, than haplotypes predominating at higher (temperate) latitudes. We explore molecular mechanisms that might underlie these responses, presenting evidence that the effects are in part regulated by SNPs that do not change the protein sequence. Our findings suggest that standing variation in the mitochondrial genome can be shaped by thermal selection, and could therefore contribute to evolutionary adaptation under climatic stress. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e

  11. A strong association between non-musculoskeletal symptoms and musculoskeletal pain symptoms: results from a population study

    Directory of Open Access Journals (Sweden)

    Tschudi-Madsen Hedda

    2011-12-01

    Full Text Available Abstract Background There is a lack of knowledge about the pattern of symptom reporting in the general population as most research focuses on specific diseases or symptoms. The number of musculoskeletal pain sites is a strong predictor for disability pensioning and, hence, is considered to be an important dimension in symptom reporting. The simple method of counting symptoms might also be applicable to non-musculoskeletal symptoms, rendering further dimensions in describing individual and public health. In a general population, we aimed to explore the association between self-reported non-musculoskeletal symptoms and the number of pain sites. Methods With a cross-sectional design, the Standardised Nordic Questionnaire and the Subjective Health Complaints Inventory were used to record pain at ten different body sites and 13 non-musculoskeletal symptoms, respectively, among seven age groups in Ullensaker, Norway (n = 3,227. Results Results showed a strong, almost linear relationship between the number of non-musculoskeletal symptoms and the number of pain sites (r = 0.55. The number and type of non-musculoskeletal symptoms had an almost equal explanatory power in the number of pain sites reported (27.1% vs. 28.2%. Conclusion The linear association between the number of non-musculoskeletal and musculoskeletal symptoms might indicate that the symptoms share common characteristics and even common underlying causal factors. The total burden of symptoms as determined by the number of symptoms reported might be an interesting generic indicator of health and well-being, as well as present and future functioning. Research on symptom reporting might also be an alternative pathway to describe and, possibly, understand the medically unexplained multisymptom conditions.

  12. HLA class II linkage disequilibrium and haplotype evolution in the Cayapa Indians of Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Trachtenberg, E.A.; Erlich, H.A. [Roche Molecular Systems, Alameda, CA (United States); Klitz, W. [Univ. of California, Berkeley, CA (United States)] [and others

    1995-08-01

    DNA-based typing of the HLA class II loci in a sample of the Cayapa Indians of Ecuador reveals several lines of evidence that selection has operated to maintain and to diversify the existing level of polymorphism in the class II region. As has been noticed for other Native American groups, the overall level of polymorphism at the DRB1, DQA1, DQB1, and DPB1 loci is reduced relative to that found in other human populations. Nonetheless, the relative eveness in the distribution of allele frequencies at each of the four loci points to the role of balancing selection in the maintenance of the polymorphism. The DQA1 and DQB1 loci, in particular, have near-maximum departures from the neutrality model, which suggests that balancing selection has been especially strong in these cases. Several novel DQA1-DQB1 haplotypes and the discovery of a new DRB1 allele demonstrate an evolutionary tendency favoring the diversification of class II alleles and haplotypes. The recombination interval between the centromeric DPB1 locus and the other class II loci will, in the absence of other forces such as selection, reduce disequilibrium across this region. However, nearly all common alleles were found to be part of DR-DP haplotypes in strong disequilibrium, consistent with the recent action of selection acting on these haplotypes in the Cayapa. 50 refs., 3 figs., 3 tabs.

  13. Genome-Wide Pharmacogenomic Study on Methadone Maintenance Treatment Identifies SNP rs17180299 and Multiple Haplotypes on CYP2B6, SPON1, and GSG1L Associated with Plasma Concentrations of Methadone R- and S-enantiomers in Heroin-Dependent Patients

    Science.gov (United States)

    Yang, Hsin-Chou; Chu, Shih-Kai; Huang, Chieh-Liang; Kuo, Hsiang-Wei; Wang, Sheng-Chang; Liu, Sheng-Wen; Ho, Ing-Kang; Liu, Yu-Li

    2016-01-01

    Methadone maintenance treatment (MMT) is commonly used for controlling opioid dependence, preventing withdrawal symptoms, and improving the quality of life of heroin-dependent patients. A steady-state plasma concentration of methadone enantiomers, a measure of methadone metabolism, is an index of treatment response and efficacy of MMT. Although the methadone metabolism pathway has been partially revealed, no genome-wide pharmacogenomic study has been performed to identify genetic determinants and characterize genetic mechanisms for the plasma concentrations of methadone R- and S-enantiomers. This study was the first genome-wide pharmacogenomic study to identify genes associated with the plasma concentrations of methadone R- and S-enantiomers and their respective metabolites in a methadone maintenance cohort. After data quality control was ensured, a dataset of 344 heroin-dependent patients in the Han Chinese population of Taiwan who underwent MMT was analyzed. Genome-wide single-locus and haplotype-based association tests were performed to analyze four quantitative traits: the plasma concentrations of methadone R- and S-enantiomers and their respective metabolites. A significant single nucleotide polymorphism (SNP), rs17180299 (raw p = 2.24 × 10−8), was identified, accounting for 9.541% of the variation in the plasma concentration of the methadone R-enantiomer. In addition, 17 haplotypes were identified on SPON1, GSG1L, and CYP450 genes associated with the plasma concentration of methadone S-enantiomer. These haplotypes accounted for approximately one-fourth of the variation of the overall S-methadone plasma concentration. The association between the S-methadone plasma concentration and CYP2B6, SPON1, and GSG1L were replicated in another independent study. A gene expression experiment revealed that CYP2B6, SPON1, and GSG1L can be activated concomitantly through a constitutive androstane receptor (CAR) activation pathway. In conclusion, this study revealed new

  14. Hapl-o-Mat: open-source software for HLA haplotype frequency estimation from ambiguous and heterogeneous data.

    Science.gov (United States)

    Schäfer, Christian; Schmidt, Alexander H; Sauter, Jürgen

    2017-05-30

    Knowledge of HLA haplotypes is helpful in many settings as disease association studies, population genetics, or hematopoietic stem cell transplantation. Regarding the recruitment of unrelated hematopoietic stem cell donors, HLA haplotype frequencies of specific populations are used to optimize both donor searches for individual patients and strategic donor registry planning. However, the estimation of haplotype frequencies from HLA genotyping data is challenged by the large amount of genotype data, the complex HLA nomenclature, and the heterogeneous and ambiguous nature of typing records. To meet these challenges, we have developed the open-source software Hapl-o-Mat. It estimates haplotype frequencies from population data including an arbitrary number of loci using an expectation-maximization algorithm. Its key features are the processing of different HLA typing resolutions within a given population sample and the handling of ambiguities recorded via multiple allele codes or genotype list strings. Implemented in C++, Hapl-o-Mat facilitates efficient haplotype frequency estimation from large amounts of genotype data. We demonstrate its accuracy and performance on the basis of artificial and real genotype data. Hapl-o-Mat is a versatile and efficient software for HLA haplotype frequency estimation. Its capability of processing various forms of HLA genotype data allows for a straightforward haplotype frequency estimation from typing records usually found in stem cell donor registries.

  15. Genomic-assisted haplotype analysis and the development of high-throughput SNP markers for salinity tolerance in soybean

    Science.gov (United States)

    Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.

    2016-01-01

    Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337

  16. Fundamental problem of forensic mathematics--the evidential value of a rare haplotype.

    Science.gov (United States)

    Brenner, Charles H

    2010-10-01

    Y-chromosomal and mitochondrial haplotyping offer special advantages for criminal (and other) identification. For different reasons, each of them is sometimes detectable in a crime stain for which autosomal typing fails. But they also present special problems, including a fundamental mathematical one: When a rare haplotype is shared between suspect and crime scene, how strong is the evidence linking the two? Assume a reference population sample is available which contains n-1 haplotypes. The most interesting situation as well as the most common one is that the crime scene haplotype was never observed in the population sample. The traditional tools of product rule and sample frequency are not useful when there are no components to multiply and the sample frequency is zero. A useful statistic is the fraction κ of the population sample that consists of "singletons" - of once-observed types. A simple argument shows that the probability for a random innocent suspect to match a previously unobserved crime scene type is (1-κ)/n - distinctly less than 1/n, likely ten times less. The robust validity of this model is confirmed by testing it against a range of population models. This paper hinges above all on one key insight: probability is not frequency. The common but erroneous "frequency" approach adopts population frequency as a surrogate for matching probability and attempts the intractable problem of guessing how many instances exist of the specific haplotype at a certain crime. Probability, by contrast, depends by definition only on the available data. Hence if different haplotypes but with the same data occur in two different crimes, although the frequencies are different (and are hopelessly elusive), the matching probabilities are the same, and are not hard to find. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

  17. Lower frequency of the HLA-G UTR-4 haplotype in women with unexplained recurrent miscarriage.

    Science.gov (United States)

    Meuleman, T; Drabbels, J; van Lith, J M M; Dekkers, O M; Rozemuller, E; Cretu-Stancu, M; Claas, F H J; Bloemenkamp, K W M; Eikmans, M

    2018-04-01

    HLA-G expressed by trophoblasts at the fetal-maternal interface and its soluble form have immunomodulatory effects. HLA-G expression depends on the combination of DNA polymorphisms. We hypothesized that combinations of specific single nucleotide polymorphisms (SNPs) in the 3'untranslated region (3'UTR) of HLA-G play a role in unexplained recurrent miscarriage. In a case control design, 100 cases with at least three unexplained consecutive miscarriages prior to the 20th week of gestation were included. Cases were at time of the third miscarriage younger than 36 years, and they conceived all their pregnancies from the same partner. The control group included 89 women with an uneventful pregnancy. The association of HLA-G 3'UTR SNPs and specific HLA-G haplotype with recurrent miscarriage was studied with logistic regression. Odds ratios (OR) and 95% confidence intervals (95% CI) were reported. Individual SNPs were not significantly associated with recurrent miscarriage after correction for multiple comparisons. However, the presence of the UTR-4 haplotype, which included +3003C, was significantly lower in women with recurrent miscarriage (OR 0.4, 95% CI 0.2-0.8, p = 0.015). In conclusion, this is the first study to perform a comprehensive analysis of HLA-G SNPs and HLA-G haplotypes in a well-defined group of women with recurrent miscarriage and women with uneventful pregnancy. The UTR-4 haplotype was less frequently observed in women with recurrent miscarriage, suggesting an immunoregulatory role of this haplotype for continuation of the pregnancy without complications. Thus, association of HLA-G with recurrent miscarriage is not related to single polymorphisms in the 3'UTR, but is rather dependent on haplotypes. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Consumption of preserved egg, a high-lead-containing food, is strongly associated with depressive symptoms in Chinese adults.

    Science.gov (United States)

    Yu, Bin; Shao, Junwei; Yu, Fei; Zhang, Qing; Liu, Li; Meng, Ge; Wu, Hongmei; Xia, Yang; Bao, Xue; Gu, Yeqing; Shi, Hongbin; Sun, Shaomei; Wang, Xing; Zhou, Ming; Jia, Qiyu; Liu, Huijun; Wu, Yuntang; Niu, Kaijun

    2017-11-01

    Previous studies have demonstrated adverse mental health effects of Pb exposure. The purpose of this study is to investigate the relationship between consumption of preserved egg (PE), a high-Pb-containing food and depressive symptoms among adults in China. A sample of 25 213 adults (mean age 41·4 (sd 11·8) years; males, 53·9 %) in Tianjin, China, was studied in a cross-sectional analysis. Dietary intake including PE was assessed using a valid self-administered FFQ. Depressive symptoms were assessed using the Self-Rating Depression Scale (SDS). The association was estimated by OR using logistic regression models adjusted for multiple confounders. The prevalence of elevated depressive symptoms was 6·6 % (SDS≥50). Compared with the least frequent PE consumption (strongly associated with depressive symptoms among adults in China. These findings underscore the need to consider dietary Pb exposure as a risk factor for psychological distress.

  19. Haplotypes and Sequence Variation in the Ovine Adiponectin Gene (ADIPOQ

    Directory of Open Access Journals (Sweden)

    Qing-Ming An

    2015-11-01

    Full Text Available The adiponectin gene (ADIPOQ plays an important role in energy homeostasis. In this study five separate regions (regions 1 to 5 of ovine ADIPOQ were analysed using PCR-SSCP. Four different PCR-SSCP patterns (A1-D1, A2-D2 were detected in region-1 and region-2, respectively, with seven and six SNPs being revealed. In region-3, three different patterns (A3-C3 and three SNPs were observed. Two patterns (A4-B4, A5-B5 and two and one SNPs were observed in region-4 and region-5, respectively. In total, nineteen SNPs were detected, with five of them in the coding region and two (c.46T/C and c.515G/A putatively resulting in amino acid changes (p.Tyr16His and p.Lys172Arg. In region-1, -2 and -3 of 316 sheep from eight New Zealand breeds, variants A1, A2 and A3 were the most common, although variant frequencies differed in the eight breeds. Across region-1 and region-3, nine haplotypes were identified and haplotypes A1-A3, A1-C3, B1-A3 and B1-C3 were most common. These results indicate that the ADIPOQ gene is polymorphic and suggest that further analysis is required to see if the variation in the gene is associated with animal production traits.

  20. A Candidate Trans-acting Modulator of Fetal Hemoglobin Gene Expression in the Arab-Indian Haplotype of Sickle Cell Anemia

    Science.gov (United States)

    Vathipadiekal, Vinod; Farrell, John J.; Wang, Shuai; Edward, Heather L.; Shappell, Heather; Al-Rubaish, A.M.; Al-Muhanna, Fahad; Naserullah, Z.; Alsuliman, A.; Qutub, Hatem Othman; Simkin, Irene; Farrer, Lindsay A.; Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Mostoslavsky, Gustavo; Murphy, George J.; Patra, Pradeep.K.; Chui, David H.K.; Alsultan, Abdulrahman; Al-Ali, Amein K.; Sebastiani, Paola.; Steinberg, Martin. H.

    2016-01-01

    Fetal hemoglobin (HbF) levels are higher in the Arab-Indian (AI) β-globin gene haplotype of sickle cell anemia compared with African-origin haplotypes. To study genetic elements that effect HbF expression in the AI haplotype we completed whole genome sequencing in 14 Saudi AI haplotype sickle hemoglobin homozygotes—seven selected for low HbF (8.2±1.3%) and seven selected for high HbF (23.5±.2.6%). An intronic single nucleotide polymorphism (SNP) in ANTXR1, an anthrax toxin receptor (chromosome 2p13), was associated with HbF. These results were replicated in two independent Saudi AI haplotype cohorts of 120 and 139 patients, but not in 76 Saudi Benin haplotype, 894 African origin haplotype and 44 Arab Indian haplotype patients of Indian descent, suggesting that this association is effective only in the Saudi AI haplotype background. ANTXR1 variants explained 10% of the HbF variability compared with 8% for BCL11A. These two genes had independent, additive effects on HbF and together explained about 15% of HbF variability in Saudi AI sickle cell anemia patients. ANTXR1 was expressed at mRNA and protein levels in erythroid progenitors derived from induced pluripotent stem cells (iPSCs) and CD34+ cells. As CD34+ cells matured and their HbF decreased ANTXR1 expression increased; as iPSCs differentiated and their HbF increased, ANTXR1 expression decreased. Along with elements in cis to the HbF genes, ANTXR1 contributes to the variation in HbF in Saudi AI haplotype sickle cell anemia and is the first gene in trans to HBB that is associated with HbF only in carriers of the Saudi AI haplotype. PMID:27501013

  1. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

    2013-01-01

    haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased......Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...

  2. The interaction between coagulation factor 2 receptor and interleukin 6 haplotypes increases the risk of myocardial infarction in men.

    Directory of Open Access Journals (Sweden)

    Bruna Gigante

    Full Text Available The aim of the study was to investigate if the interaction between the coagulation factor 2 receptor (F2R and the interleukin 6 (IL6 haplotypes modulates the risk of myocardial infarction (MI in the Stockholm Heart Epidemiology Program (SHEEP. Seven SNPs at the F2R locus and three SNPs at the IL6 locus were genotyped. Haplotypes and haplotype pairs (IL6*F2R were generated. A logistic regression analysis was performed to analyze the association of the haplotypes and haplotype pairs with the MI risk. Presence of an interaction between the two haplotypes in each haplotype pair was calculated using two different methods: the statistical, on a multiplicative scale, which includes the cross product of the two factors into the logistic regression model; the biological, on an additive scale, which evaluates the relative risk associated with the joint presence of both factors. The ratio between the observed and the predicted effect of the joint exposure, the synergy index (S, indicates the presence of a synergy (S>1 or of an antagonism (S<1. None of the haplotypes within the two loci was associated with the risk of MI. Out of 22 different haplotype pairs, the haplotype pair 17 GGG*ADGTCCT was associated with an increased risk of MI with an OR (95%CI of 1.58 (1.05-2.41 (p = 0.02 in the crude and an OR of 1.72 (1.11-2.67 (p = 0.01 in the adjusted analysis. We observed the presence of an interaction on a multiplicative scale with an OR (95%CI of 2.24 (1.27-3.95 (p = 0.005 and a slight interactive effect between the two haplotypes on an additive scale with an OR (95%CI of 1.56 (1.02-2.37 (p = 0.03 and S of 1.66 (0.89-31. In conclusion, our results support the hypothesis that the interaction between these two functionally related genes may influence the risk of MI and suggest new mechanisms involved in the genetic susceptibility to MI.

  3. Haplotypes of bovine FoxO1 gene sequence variants and ...

    Indian Academy of Sciences (India)

    Haplotypes of bovine FoxO1 gene sequence variants and association with growth traits in Qinchuan cattle. YUJIA SUN1, JING XUE1, WENJIAO GUO1, MINGXUN LI1, YONGZHEN HUANG1, XIANYONG LAN1,. CHUZHAO LEI1, CHUNLEI ZHANG2 and HONG CHEN1∗. 1College of Animal Science and Technology, ...

  4. A continental view of pine-associated ectomycorrhizal fungal spore banks: a quiescent functional guild with a strong biogeographic pattern.

    Science.gov (United States)

    Glassman, Sydney I; Peay, Kabir G; Talbot, Jennifer M; Smith, Dylan P; Chung, Judy A; Taylor, John W; Vilgalys, Rytas; Bruns, Thomas D

    2015-03-01

    Ecologists have long acknowledged the importance of seed banks; yet, despite the fact that many plants rely on mycorrhizal fungi for survival and growth, the structure of ectomycorrhizal (ECM) fungal spore banks remains poorly understood. The primary goal of this study was to assess the geographic structure in pine-associated ECM fungal spore banks across the North American continent. Soils were collected from 19 plots in forests across North America. Fresh soils were pyrosequenced for fungal internal transcribed spacer (ITS) amplicons. Adjacent soil cores were dried and bioassayed with pine seedlings, and colonized roots were pyrosequenced to detect resistant propagules of ECM fungi. The results showed that ECM spore banks correlated strongly with biogeographic location, but not with the identity of congeneric plant hosts. Minimal community overlap was found between resident ECM fungi vs those in spore banks, and spore bank assemblages were relatively simple and dominated by Rhizopogon, Wilcoxina, Cenococcum, Thelephora, Tuber, Laccaria and Suillus. Similar to plant seed banks, ECM fungal spore banks are, in general, depauperate, and represent a small and rare subset of the mature forest soil fungal community. Yet, they may be extremely important in fungal colonization after large-scale disturbances such as clear cuts and forest fires. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  5. Anomalous ULF Emissions and Their Possible Association with the Strong Earthquakes in Sumatra, Indonesia, during 2007-2012

    Directory of Open Access Journals (Sweden)

    Suaidi Ahadi

    2015-03-01

    Full Text Available Eleven strong Sumatran earthquakes, with their epicenter less than 550 km away from the Kototabang (KTB geomagnetic station (2007-2012, were studied to examine the occurrence of anomalous ultra-low frequency emissions (ULF-EM. Anomalous ULF signals, possibly associated with the earthquake’s precursors, were determined by the Welch ratio SZ/SH at 0.06 Hz at the KTB station. These ULF anomalies were then compared with geomagnetic data observed from two reference stations in Darwin and Davao, to prevent misinterpretation of global geomagnetic disturbances as precursors. This study aims to analyze the relationship between earthquake magnitude and hypocenter radius, and seismic index against lead time during ULF-EM anomalies. We used the polarization ratio Welch method in terms of power spectrum density to evaluate the geomagnetic data by overlapping windows and applying fast Fourier transform (FFT. The results showed anomalous variations in onset and lead time, determined using the standard deviation controlling the SZ/SH power pattern. Our positive correlation between lead time of ULF emission and earthquake magnitude as well as between lead time and seismic index. It shows a negative correlation between hypocenter distances to KTB station against lead time.

  6. Subcutaneous fat accumulation in early infancy is more strongly associated with motor development and delay than muscle growth.

    Science.gov (United States)

    Kanazawa, H; Kawai, M; Niwa, F; Hasegawa, T; Iwanaga, K; Ohata, K; Tamaki, A; Heike, T

    2014-06-01

    Physical growth in neurologically healthy preterm infants affects motor development. This study investigated the separate relationships between muscle and fat in infancy and later motor development and physical growth. Muscle thickness and subcutaneous fat thickness of the anterior thigh were measured using ultrasound images obtained from neurologically healthy preterm infants at birth, 3, 6, 12 and 18 months' corrected age. We also obtained the Pediatric Evaluation of Disability Inventory and Alberta Infant Motor Scale scores at 18 months' corrected age to assess motor ability and motor delay. Thirty preterm infants completed the study protocol. There was a significant positive correlation between motor ability and increments in subcutaneous fat thickness during the first 3 and 6 months' corrected age (r = 0.48 and 0.40, p motor ability and muscle thickness growth in any of the periods. A secondary, logistic regression analysis showed that increments in subcutaneous fat thickness during the first 3 months were a protective factor for motor delay. Subcutaneous fat accumulation in early infancy is more strongly associated with motor development and delay than muscle growth. ©2014 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  7. Strong Association between Human and Animal Brucella Seropositivity in a Linked Study in Kenya, 2012–2013

    Science.gov (United States)

    Osoro, Eric Mogaka; Munyua, Peninah; Omulo, Sylvia; Ogola, Eric; Ade, Fredrick; Mbatha, Peter; Mbabu, Murithi; Ng'ang'a, Zipporah; Kairu, Salome; Maritim, Marybeth; Thumbi, Samuel M.; Bitek, Austine; Gaichugi, Stella; Rubin, Carol; Njenga, Kariuki; Guerra, Marta

    2015-01-01

    Brucellosis is a common bacterial zoonotic infection but data on the prevalence among humans and animals is limited in Kenya. A cross-sectional survey was conducted in three counties practicing different livestock production systems to simultaneously assess the seroprevalence of, and risk factors for brucellosis among humans and their livestock (cattle, sheep, camels, and goats). A two-stage cluster sampling method with random selection of sublocations and households was conducted. Blood samples were collected from humans and animals and tested for Brucella immunoglobulin G (IgG) antibodies. Human and animal individual seroprevalence was 16% and 8%, respectively. Household and herd seroprevalence ranged from 5% to 73% and 6% to 68%, respectively. There was a 6-fold odds of human seropositivity in households with a seropositive animal compared with those without. Risk factors for human seropositivity included regular ingestion of raw milk (adjusted odds ratio [aOR] = 3.5, 95% confidence interval [CI] = 2.8–4.4), exposure to goats (herding, milking, and feeding) (aOR = 3.1, 95% CI = 2.5–3.8), and handling of animal hides (aOR = 1.8, 95% CI = 1.5–2.2). Attaining at least high school education and above was a protective factor for human seropositivity (aOR = 0.3, 95% CI = 0.3–0.4). This linked study provides evidence of a strong association between human and animal seropositivity at the household level. PMID:26101275

  8. Initial epidemic area is strongly associated with the yearly extent of soybean rust spread in North America.

    Science.gov (United States)

    Mundt, Christopher C; Wallace, Larae D; Allen, Tom W; Hollier, Clayton A; Kemerait, Robert C; Sikora, Edward J

    2013-07-01

    Hosts of soybean rust ( Phakopsora pachyrhizi ) are sensitive to low temperatures, limiting this obligate parasite in the United States to overwintering sites in a restricted area along the Gulf Coast. This temperature sensitivity of soybean rust hosts allowed us to study spatial spread of epidemic invasions over similar territory for seven sequential years, 2005-2011. The epidemic front expanded slowly from early April through July, with the majority of expansion occurring from August through November. There was a 7.4-fold range of final epidemic extent (0.4 to 3.0 million km 2 ) from the year of smallest final disease extent (2011) to that of the largest (2007). The final epidemic area of each year was regressed against epidemic areas recorded at one-week intervals to determine the association of final epidemic extent with current epidemic extent. Coefficients of determination for these regressions varied between 0.44 to 0.62 during April and May. The correlation coefficients varied between 0.70 and 0.96 from early June through October, and then increased monotonically to 1.0 by year's end. Thus, the spatial extent of disease when the epidemics began rapid expansion may have been a crucial contributor to subsequent spread of soybean rust. Our analyses used presence/absence data at the county level to evaluate the spread of the epidemic front only; the subsequent local intensification of disease could be strongly influenced by other factors, including weather.

  9. A hidden Markov model for investigating recent positive selection through haplotype structure.

    Science.gov (United States)

    Chen, Hua; Hey, Jody; Slatkin, Montgomery

    2015-02-01

    Recent positive selection can increase the frequency of an advantageous mutant rapidly enough that a relatively long ancestral haplotype will be remained intact around it. We present a hidden Markov model (HMM) to identify such haplotype structures. With HMM identified haplotype structures, a population genetic model for the extent of ancestral haplotypes is then adopted for parameter inference of the selection intensity and the allele age. Simulations show that this method can detect selection under a wide range of conditions and has higher power than the existing frequency spectrum-based method. In addition, it provides good estimate of the selection coefficients and allele ages for strong selection. The method analyzes large data sets in a reasonable amount of running time. This method is applied to HapMap III data for a genome scan, and identifies a list of candidate regions putatively under recent positive selection. It is also applied to several genes known to be under recent positive selection, including the LCT, KITLG and TYRP1 genes in Northern Europeans, and OCA2 in East Asians, to estimate their allele ages and selection coefficients. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Altered transmission of maternal angiotensin II receptor haplotypes in fetal growth restriction.

    Science.gov (United States)

    Tower, Clare; Chappell, Sally; Acharya, Meera; Crane, Richard; Szolin, Stephanie; Symonds, Lyneth; Chevins, Helen; Kalsheker, Noor; Baker, Philip; Morgan, Linda

    2006-02-01

    Fetal growth restriction (FGR) predisposes to significant short- and long-term health problems. Epidemiological studies have suggested a role for inherited factors in its pathogenesis. The angiotensin II receptor genes, AGTR1 and AGTR2, are candidate genes because they mediate processes that are important for placentation. This study investigated AGTR1 and AGTR2 haplotypes and genotypes in FGR. A total of 107 families (father, mother, and baby) with FGR, and 101 families with normal pregnancies were genotyped at five sites in AGTR1 and six sites across AGTR2. All of the participants were white western Europeans. FGR was identified antenatally by ultrasound scans and confirmed postnatally by correcting the birth weight centile for gestation, infant sex, maternal height, weight, and parity. Fetal genes were investigated using transmission disequilibrium testing (TDT), and a case-control comparison of maternal haplotypes was conducted. FGR was associated with maternal (but not paternal) transmission of the AGTR1 haplotype (GenBank AF245699.1) g.4955T, g.5052T, g.5245C, g.5612A, and haplotype g.4955T, g.5052T, g.5245T, g.5612A. Haplotype g.4955A, g.5052G, g.5245T, g.5612G was undertransmitted (P = 0.002). TDT of the AGTR1 genotype showed undertransmission of maternal AGTR1 genotypes g.4955T>A (odds ratio (OR), 0.34 (95% confidence interval (CI), 0.14-0.86); P = 0.02), g.5052T>G (OR, 0.18 (0.06-0.48); PG (OR, 0.21 (0.08-0.55); P 0.10). This is the first study to show distortion of transmission of maternal AGTR1 haplotypes in FGR, which suggests that this gene plays a role in FGR. In particular, maternal-fetal gene sharing may be an important factor. 2006 Wiley-Liss, Inc.

  11. JC polyomavirus infection is strongly controlled by human leucocyte antigen class II variants.

    Science.gov (United States)

    Sundqvist, Emilie; Buck, Dorothea; Warnke, Clemens; Albrecht, Eva; Gieger, Christian; Khademi, Mohsen; Lima Bomfim, Izaura; Fogdell-Hahn, Anna; Link, Jenny; Alfredsson, Lars; Søndergaard, Helle Bach; Hillert, Jan; Oturai, Annette B; Hemmer, Bernhard; Hemme, Bernhard; Kockum, Ingrid; Olsson, Tomas

    2014-04-01

    JC polyomavirus (JCV) carriers with a compromised immune system, such as in HIV, or subjects on immune-modulating therapies, such as anti VLA-4 therapy may develop progressive multifocal leukoencephalopathy (PML) which is a lytic infection of oligodendrocytes in the brain. Serum antibodies to JCV mark infection occur only in 50-60% of infected individuals, and high JCV-antibody titers seem to increase the risk of developing PML. We here investigated the role of human leukocyte antigen (HLA), instrumental in immune defense in JCV antibody response. Anti-JCV antibody status, as a surrogate for JCV infection, were compared to HLA class I and II alleles in 1621 Scandinavian persons with MS and 1064 population-based Swedish controls and associations were replicated in 718 German persons with MS. HLA-alleles were determined by SNP imputation, sequence specific (SSP) kits and a reverse PCR sequence-specific oligonucleotide (PCR-SSO) method. An initial GWAS screen displayed a strong HLA class II region signal. The HLA-DRB1*15 haplotype was strongly negatively associated to JCV sero-status in Scandinavian MS cases (OR = 0.42, p = 7×10(-15)) and controls (OR = 0.53, p = 2×10(-5)). In contrast, the DQB1*06:03 haplotype was positively associated with JCV sero-status, in Scandinavian MS cases (OR = 1.63, p = 0.006), and controls (OR = 2.69, p = 1×10(-5)). The German dataset confirmed these findings (OR = 0.54, p = 1×10(-4) and OR = 1.58, p = 0.03 respectively for these haplotypes). HLA class II restricted immune responses, and hence CD4+ T cell immunity is pivotal for JCV infection control. Alleles within the HLA-DR1*15 haplotype are associated with a protective effect on JCV infection. Alleles within the DQB1*06:03 haplotype show an opposite association. These associations between JC virus antibody response and human leucocyte antigens supports the notion that CD4+ T cells are crucial in the immune defence to JCV and lays the

  12. JC polyomavirus infection is strongly controlled by human leucocyte antigen class II variants.

    Directory of Open Access Journals (Sweden)

    Emilie Sundqvist

    2014-04-01

    Full Text Available JC polyomavirus (JCV carriers with a compromised immune system, such as in HIV, or subjects on immune-modulating therapies, such as anti VLA-4 therapy may develop progressive multifocal leukoencephalopathy (PML which is a lytic infection of oligodendrocytes in the brain. Serum antibodies to JCV mark infection occur only in 50-60% of infected individuals, and high JCV-antibody titers seem to increase the risk of developing PML. We here investigated the role of human leukocyte antigen (HLA, instrumental in immune defense in JCV antibody response. Anti-JCV antibody status, as a surrogate for JCV infection, were compared to HLA class I and II alleles in 1621 Scandinavian persons with MS and 1064 population-based Swedish controls and associations were replicated in 718 German persons with MS. HLA-alleles were determined by SNP imputation, sequence specific (SSP kits and a reverse PCR sequence-specific oligonucleotide (PCR-SSO method. An initial GWAS screen displayed a strong HLA class II region signal. The HLA-DRB1*15 haplotype was strongly negatively associated to JCV sero-status in Scandinavian MS cases (OR = 0.42, p = 7×10(-15 and controls (OR = 0.53, p = 2×10(-5. In contrast, the DQB1*06:03 haplotype was positively associated with JCV sero-status, in Scandinavian MS cases (OR = 1.63, p = 0.006, and controls (OR = 2.69, p = 1×10(-5. The German dataset confirmed these findings (OR = 0.54, p = 1×10(-4 and OR = 1.58, p = 0.03 respectively for these haplotypes. HLA class II restricted immune responses, and hence CD4+ T cell immunity is pivotal for JCV infection control. Alleles within the HLA-DR1*15 haplotype are associated with a protective effect on JCV infection. Alleles within the DQB1*06:03 haplotype show an opposite association. These associations between JC virus antibody response and human leucocyte antigens supports the notion that CD4+ T cells are crucial in the immune defence to JCV and

  13. Oestrogen receptor α gene haplotype and postmenopausal breast cancer risk: a case control study

    International Nuclear Information System (INIS)

    Wedrén, Sara; Stiger, Fredrik; Persson, Ingemar; Baron, John; Weiderpass, Elisabete; Lovmar, Lovisa; Humphreys, Keith; Magnusson, Cecilia; Melhus, Håkan; Syvänen, Ann-Christine; Kindmark, Andreas; Landegren, Ulf; Fermér, Maria Lagerström

    2004-01-01

    Oestrogen receptor α, which mediates the effect of oestrogen in target tissues, is genetically polymorphic. Because breast cancer development is dependent on oestrogenic influence, we have investigated whether polymorphisms in the oestrogen receptor α gene (ESR1) are associated with breast cancer risk. We genotyped breast cancer cases and age-matched population controls for one microsatellite marker and four single-nucleotide polymorphisms (SNPs) in ESR1. The numbers of genotyped cases and controls for each marker were as follows: TA n , 1514 cases and 1514 controls; c.454-397C → T, 1557 cases and 1512 controls; c.454-351A → G, 1556 cases and 1512 controls; c.729C → T, 1562 cases and 1513 controls; c.975C → G, 1562 cases and 1513 controls. Using logistic regression models, we calculated odds ratios (ORs) and 95% confidence intervals (CIs). Haplotype effects were estimated in an exploratory analysis, using expectation-maximisation algorithms for case-control study data. There were no compelling associations between single polymorphic loci and breast cancer risk. In haplotype analyses, a common haplotype of the c.454-351A → G or c.454-397C → T and c.975C → G SNPs appeared to be associated with an increased risk for ductal breast cancer: one copy of the c.454-351A → G and c.975C → G haplotype entailed an OR of 1.19 (95% CI 1.06–1.33) and two copies with an OR of 1.42 (95% CI 1.15–1.77), compared with no copies, under a model of multiplicative penetrance. The association with the c.454-397C → T and c.975C → G haplotypes was similar. Our data indicated that these haplotypes were more influential in women with a high body mass index. Adjustment for multiple comparisons rendered the associations statistically non-significant. We found suggestions of an association between common haplotypes in ESR1 and the risk for ductal breast cancer that is stronger in heavy women

  14. Interleukin-10 haplotypes in Celiac Disease in the Spanish population.

    Science.gov (United States)

    Núñez, Concepción; Alecsandru, Diana; Varadé, Jezabel; Polanco, Isabel; Maluenda, Carlos; Fernández-Arquero, Miguel; de la Concha, Emilio G; Urcelay, Elena; Martínez, Alfonso

    2006-03-31

    Celiac disease (CD) is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10) is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs) and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02) status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  15. Interleukin-10 haplotypes in Celiac Disease in the Spanish population

    Directory of Open Access Journals (Sweden)

    Fernández-Arquero Miguel

    2006-03-01

    Full Text Available Abstract Background Celiac disease (CD is a chronic disorder characterized by a pathological inflammatory response after exposure to gluten in genetically susceptible individuals. The HLA complex accounts for less than half of the genetic component of the disease, and additional genes must be implicated. Interleukin-10 (IL-10 is an important regulator of mucosal immunity, and several reports have described alterations of IL-10 levels in celiac patients. The IL-10 gene is located on chromosome 1, and its promoter carries several single nucleotide polymorphisms (SNPs and microsatellites which have been associated to production levels. Our aim was to study the role of those polymorphisms in susceptibility to CD in our population. Methods A case-control and a familial study were performed. Positions -1082, -819 and -592 of the IL-10 promoter were typed by TaqMan and allele specific PCR. IL10R and IL10G microsatellites were amplified with labelled primers, and they were subsequently run on an automatic sequencer. In this study 446 patients and 573 controls were included, all of them white Spaniards. Extended haplotypes encompassing microsatellites and SNPs were obtained in families and estimated in controls by the Expectation-Maximization algorithm. Results No significant associations after Bonferroni correction were observed in the SNPs or any of the microsatellites. Stratification by HLA-DQ2 (DQA1*0501-DQB1*02 status did not alter the results. When extended haplotypes were analyzed, no differences were apparent either. Conclusion The IL-10 polymorphisms studied are not associated with celiac disease. Our data suggest that the IL-10 alteration seen in patients may be more consequence than cause of the disease.

  16. Improved Ventilatory Efficiency with Locomotor Muscle Afferent Inhibition is Strongly Associated with Leg Composition in Heart Failure.

    Science.gov (United States)

    Keller-Ross, Manda L; Johnson, Bruce D; Carter, Rickey E; Joyner, Michael J; Eisenach, John H; Curry, Timothy B; Olson, Thomas P

    2016-01-01

    Skeletal muscle atrophy contributes to increased afferent feedback (group III and IV) and may influence ventilatory control (high VE/VCO2 slope) in heart failure (HF). This study examined the influence of muscle mass on the change in VE/VCO2 with afferent neural block during exercise in HF. 17 participants [9 HF (60±6 yrs) and 8 controls (CTL) (63±7 yrs, mean±SD)] completed 3 sessions. Session 1: dual energy x-ray absorptiometry and graded cycle exercise to volitional fatigue. Sessions 2 and 3: 5 min of constant-work cycle exercise (65% of peak power) randomized to lumbar intrathecal injection of fentanyl (afferent blockade) or placebo. Ventilation (VE) and gas exchange (oxygen consumption, VO2; carbon dioxide production, VCO2) were measured. Peak work and VO2 were lower in HF (pLeg fat was greater in HF (34.4±3.0 and 26.3±1.8%) and leg muscle mass was lower in HF (63.0±2.8 and 70.4±1.8%, respectively, pleg muscle mass (r2=0.58, pleg fat mass (r2=0.73, pleg muscle mass had the greatest improvement in VE/VCO2 with afferent blockade with leg fat mass being the only predictor for the improvement in VE/VCO2 slope. Both leg muscle mass and fat mass are important contributors to ventilatory abnormalities and strongly associated to improvements in VE/VCO2 slope with locomotor afferent inhibition in HF. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  17. Mycolactone-Dependent Depletion of Endothelial Cell Thrombomodulin Is Strongly Associated with Fibrin Deposition in Buruli Ulcer Lesions.

    Directory of Open Access Journals (Sweden)

    Joy Ogbechi

    2015-07-01

    Full Text Available A well-known histopathological feature of diseased skin in Buruli ulcer (BU is coagulative necrosis caused by the Mycobacterium ulcerans macrolide exotoxin mycolactone. Since the underlying mechanism is not known, we have investigated the effect of mycolactone on endothelial cells, focussing on the expression of surface anticoagulant molecules involved in the protein C anticoagulant pathway. Congenital deficiencies in this natural anticoagulant pathway are known to induce thrombotic complications such as purpura fulimans and spontaneous necrosis. Mycolactone profoundly decreased thrombomodulin (TM expression on the surface of human dermal microvascular endothelial cells (HDMVEC at doses as low as 2 ng/ml and as early as 8 hrs after exposure. TM activates protein C by altering thrombin's substrate specificity, and exposure of HDMVEC to mycolactone for 24 hours resulted in an almost complete loss of the cells' ability to produce activated protein C. Loss of TM was shown to be due to a previously described mechanism involving mycolactone-dependent blockade of Sec61 translocation that results in proteasome-dependent degradation of newly synthesised ER-transiting proteins. Indeed, depletion from cells determined by live-cell imaging of cells stably expressing a recombinant TM-GFP fusion protein occurred at the known turnover rate. In order to determine the relevance of these findings to BU disease, immunohistochemistry of punch biopsies from 40 BU lesions (31 ulcers, nine plaques was performed. TM abundance was profoundly reduced in the subcutis of 78% of biopsies. Furthermore, it was confirmed that fibrin deposition is a common feature of BU lesions, particularly in the necrotic areas. These findings indicate that there is decreased ability to control thrombin generation in BU skin. Mycolactone's effects on normal endothelial cell function, including its ability to activate the protein C anticoagulant pathway are strongly associated with this

  18. Height and sex is strongly associated with radial augmentation index in Korean patients with never-treated hypertension

    Directory of Open Access Journals (Sweden)

    Ahn KT

    2016-04-01

    Full Text Available Kye Taek Ahn, Kwang-In Park, Mi Joo Kim, Jin Kyung Oh, Ji Hye Han, Hee Jin Kwon, Seon-Ah Jin, Jun-Hyung Kim, Jae-Hyeong Park, Jae-Hwan Lee, Si Wan Choi, In-Whan Seong, Jin-Ok Jeong Department of Internal Medicine, Division of Cardiology, Chungnam National University Hospital, Chungnam National University School of Medicine, Daejeon, Republic of Korea Objectives: Central hemodynamics may better represent the load imposed on the coronary and cerebral arteries and thereby bear a stronger relationship to cardiovascular outcomes. Methods: Patients who had confirmed hypertension as assessed by daytime 24-hour ambulatory blood pressure monitoring (≥135/85 mmHg were enrolled. Central blood pressure and radial augmentation index (AIx corrected for a heart rate of 75 bpm (radial AIx 75 were measured for all patients. We evaluated the association of age, height, and sex with central hemodynamics in patients with never-treated hypertension. Results: A total of 203 patients were enrolled, of whom men numbered 101 (49.7%. The median height of all patients was 162 cm, and mean age was 53.2 years. In the Pearson correlation analysis, regardless of sex difference (R=-0.627 for height, R=0.035 for age, P-value =0.005, a stronger relationship was observed between height and radial AIx 75 than between age and radial AIx 75. In the multiple regression analysis, the sex difference and height were strongly associated with elevated radial AIx 75 in all patients (adjusted R2=0.428, β=6.237, 95% confidence interval [CI] for women 1.480–10.995, P-value =0.011 and β=-0.632, 95% CI for height -0.929 to -0.335, P-value =0.009, respectively. Conclusion: In patients with never-treated hypertension, female sex and shorter height are the important risk factors of elevated radial AIx 75. Keywords: hypertension, augmentation index, height, sex

  19. Identification of the ancestral haplotype for apolipoprotein B suggests an African origin of Homo sapiens sapiens and traces their subsequent migration to Europe and the Pacific

    International Nuclear Information System (INIS)

    Rapacz, J.; Hasler-Rapacz, J.O.; Chen, L.; Wu, Mingjiuan; Schumaker, V.N.; Butler-Brunner, E.; Butler, R.

    1991-01-01

    The probable ancestral haplotype for human apolipoprotein B (apoB) has been identified through immunological analysis of chimpanzee and gorilla serum and sequence analysis of their DNA. Moreover, the frequency of this ancestral apoB haplotype among different human populations provides strong support for the African origin of Homo sapiens sapiens and their subsequent migration from Africa to Europe and to the Pacific. The approach used here for the identification of the ancestral human apoB haplotype is likely to be applicable to many other genes

  20. Identification of the ancestral haplotype for apolipoprotein B suggests an African origin of Homo sapiens sapiens and traces their subsequent migration to Europe and the Pacific

    Energy Technology Data Exchange (ETDEWEB)

    Rapacz, J.; Hasler-Rapacz, J.O. (Univ. of Wisconsin, Madison (United States)); Chen, L.; Wu, Mingjiuan; Schumaker, V.N. (Univ. of California, Los Angeles (United States)); Butler-Brunner, E.; Butler, R. (Swiss Red Cross Blood Transfusion Service, Bern (Switzerland))

    1991-02-15

    The probable ancestral haplotype for human apolipoprotein B (apoB) has been identified through immunological analysis of chimpanzee and gorilla serum and sequence analysis of their DNA. Moreover, the frequency of this ancestral apoB haplotype among different human populations provides strong support for the African origin of Homo sapiens sapiens and their subsequent migration from Africa to Europe and to the Pacific. The approach used here for the identification of the ancestral human apoB haplotype is likely to be applicable to many other genes.

  1. Strong signature of natural selection within an FHIT intron implicated in prostate cancer risk.

    Directory of Open Access Journals (Sweden)

    Yan Ding

    Full Text Available Previously, a candidate gene linkage approach on brother pairs affected with prostate cancer identified a locus of prostate cancer susceptibility at D3S1234 within the fragile histidine triad gene (FHIT, a tumor suppressor that induces apoptosis. Subsequent association tests on 16 SNPs spanning approximately 381 kb surrounding D3S1234 in Americans of European descent revealed significant evidence of association for a single SNP within intron 5 of FHIT. In the current study, re-sequencing and genotyping within a 28.5 kb region surrounding this SNP further delineated the association with prostate cancer risk to a 15 kb region. Multiple SNPs in sequences under evolutionary constraint within intron 5 of FHIT defined several related haplotypes with an increased risk of prostate cancer in European-Americans. Strong associations were detected for a risk haplotype defined by SNPs 138543, 142413, and 152494 in all cases (Pearson's chi(2 = 12.34, df 1, P = 0.00045 and for the homozygous risk haplotype defined by SNPs 144716, 142413, and 148444 in cases that shared 2 alleles identical by descent with their affected brothers (Pearson's chi(2 = 11.50, df 1, P = 0.00070. In addition to highly conserved sequences encompassing SNPs 148444 and 152413, population studies revealed strong signatures of natural selection for a 1 kb window covering the SNP 144716 in two human populations, the European American (pi = 0.0072, Tajima's D = 3.31, 14 SNPs and the Japanese (pi = 0.0049, Fay & Wu's H = 8.05, 14 SNPs, as well as in chimpanzees (Fay & Wu's H = 8.62, 12 SNPs. These results strongly support the involvement of the FHIT intronic region in an increased risk of prostate cancer.

  2. Inferring mechanisms of copy number change from haplotype structures at the human DEFA1A3 locus.

    Science.gov (United States)

    Black, Holly A; Khan, Fayeza F; Tyson, Jess; Al Armour, John

    2014-07-21

    The determination of structural haplotypes at copy number variable regions can indicate the mechanisms responsible for changes in copy number, as well as explain the relationship between gene copy number and expression. However, obtaining spatial information at regions displaying extensive copy number variation, such as the DEFA1A3 locus, is complex, because of the difficulty in the phasing and assembly of these regions. The DEFA1A3 locus is intriguing in that it falls within a region of high linkage disequilibrium, despite its high variability in copy number (n = 3-16); hence, the mechanisms responsible for changes in copy number at this locus are unclear. In this study, a region flanking the DEFA1A3 locus was sequenced across 120 independent haplotypes with European ancestry, identifying five common classes of DEFA1A3 haplotype. Assigning DEFA1A3 class to haplotypes within the 1000 Genomes project highlights a significant difference in DEFA1A3 class frequencies between populations with different ancestry. The features of each DEFA1A3 class, for example, the associated DEFA1A3 copy numbers, were initially assessed in a European cohort (n = 599) and replicated in the 1000 Genomes samples, showing within-class similarity, but between-class and between-population differences in the features of the DEFA1A3 locus. Emulsion haplotype fusion-PCR was used to generate 61 structural haplotypes at the DEFA1A3 locus, showing a high within-class similarity in structure. Structural haplotypes across the DEFA1A3 locus indicate that intra-allelic rearrangement is the predominant mechanism responsible for changes in DEFA1A3 copy number, explaining the conservation of linkage disequilibrium across the locus. The identification of common structural haplotypes at the DEFA1A3 locus could aid studies into how DEFA1A3 copy number influences expression, which is currently unclear.

  3. Maximum likelihood model based on minor allele frequencies and weighted Max-SAT formulation for haplotype assembly.

    Science.gov (United States)

    Mousavi, Sayyed R; Khodadadi, Ilnaz; Falsafain, Hossein; Nadimi, Reza; Ghadiri, Nasser

    2014-06-07

    Human haplotypes include essential information about SNPs, which in turn provide valuable information for such studies as finding relationships between some diseases and their potential genetic causes, e.g., for Genome Wide Association Studies. Due to expensiveness of directly determining haplotypes and recent progress in high throughput sequencing, there has been an increasing motivation for haplotype assembly, which is the problem of finding a pair of haplotypes from a set of aligned fragments. Although the problem has been extensively studied and a number of algorithms have already been proposed for the problem, more accurate methods are still beneficial because of high importance of the haplotypes information. In this paper, first, we develop a probabilistic model, that incorporates the Minor Allele Frequency (MAF) of SNP sites, which is missed in the existing maximum likelihood models. Then, we show that the probabilistic model will reduce to the Minimum Error Correction (MEC) model when the information of MAF is omitted and some approximations are made. This result provides a novel theoretical support for the MEC, despite some criticisms against it in the recent literature. Next, under the same approximations, we simplify the model to an extension of the MEC in which the information of MAF is used. Finally, we extend the haplotype assembly algorithm HapSAT by developing a weighted Max-SAT formulation for the simplified model, which is evaluated empirically with positive results. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Identification of Tribolium castaneum (Herbst) haplotypes, the pest of ...

    African Journals Online (AJOL)

    SARAH

    2016-07-31

    Jul 31, 2016 ... J. Appl. Biosci. 2016 Identification of Tribolium castaneum (Herbst) haplotypes, the pest of stocked millet in Senegal ... Keywords: Tribolium castaneum, Cytochrome b, haplotype, Senegal, identification, distribution. Journal of Applied Biosciences ... species or plant varieties. In Africa, especially in the Sahel ...

  5. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves.

    Science.gov (United States)

    Gray, Melissa M; Sutter, Nathan B; Ostrander, Elaine A; Wayne, Robert K

    2010-02-24

    A selective sweep containing the insulin-like growth factor 1 (IGF1) gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP) found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East.See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10.

  6. The IGF1 small dog haplotype is derived from Middle Eastern grey wolves

    Directory of Open Access Journals (Sweden)

    Ostrander Elaine A

    2010-02-01

    Full Text Available Abstract Background A selective sweep containing the insulin-like growth factor 1 (IGF1 gene is associated with size variation in domestic dogs. Intron 2 of IGF1 contains a SINE element and single nucleotide polymorphism (SNP found in all small dog breeds that is almost entirely absent from large breeds. In this study, we surveyed a large sample of grey wolf populations to better understand the ancestral pattern of variation at IGF1 with a particular focus on the distribution of the small dog haplotype and its relationship to the origin of the dog. Results We present DNA sequence data that confirms the absence of the derived small SNP allele in the intron 2 region of IGF1 in a large sample of grey wolves and further establishes the absence of a small dog associated SINE element in all wild canids and most large dog breeds. Grey wolf haplotypes from the Middle East have higher nucleotide diversity suggesting an origin there. Additionally, PCA and phylogenetic analyses suggests a closer kinship of the small domestic dog IGF1 haplotype with those from Middle Eastern grey wolves. Conclusions The absence of both the SINE element and SNP allele in grey wolves suggests that the mutation for small body size post-dates the domestication of dogs. However, because all small dogs possess these diagnostic mutations, the mutations likely arose early in the history of domestic dogs. Our results show that the small dog haplotype is closely related to those in Middle Eastern wolves and is consistent with an ancient origin of the small dog haplotype there. Thus, in concordance with past archeological studies, our molecular analysis is consistent with the early evolution of small size in dogs from the Middle East. See associated opinion by Driscoll and Macdonald: http://jbiol.com/content/9/2/10

  7. HapCol : Accurate and memory-efficient haplotype assembly from long reads

    NARCIS (Netherlands)

    Pirola, Yuri; Zaccaria, Simone; Dondi, Riccardo; Klau, Gunnar W.; Pisanti, Nadia; Bonizzoni, Paola

    2016-01-01

    Motivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from the advent

  8. HapCol: Accurate and Memory-efficient Haplotype Assembly from Long Reads

    NARCIS (Netherlands)

    Y. Pirola (Yuri); S. Zaccaria (Simone); R. Dondi (Riccardo); G.W. Klau (Gunnar); N. Pisanti (Nadia); P. Bonizzoni (Paola)

    2015-01-01

    htmlabstractMotivation: Haplotype assembly is the computational problem of reconstructing haplotypes in diploid organisms and is of fundamental importance for characterizing the effects of single-nucleotide polymorphisms on the expression of phenotypic traits. Haplotype assembly highly benefits from

  9. Haplotypes of the D{sub 2} dopamine receptor gene in higher and lower alcohol consuming subjects

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, X.; Ritchie, T.; Fitch, R.J. [UCLA, CA (United States)] [and others

    1994-09-01

    There is now a substantial body of evidence which indicates that the TaqI A D{sub 2} dopamine receptor (DRD2) minor (Al) allele is associated with alcoholism. In the present study, TaqI A DRD2 alleles and haplotypes of the DRD2 gene were determined in 307 Caucasian (non-Hispanic) subjects. These haplotypes are a combination of closely linked alleles in intron 6 and exon 7 and yield three haplotypes (1, 2, and 4) and six genotypes in Caucasians. The sample under study consisted of 54 individuals who consumed 200 or more alcoholic drinks per month (Group A) and 248 persons who drank less than 200 drinks per month (Group B). The results showed that the DRD2 A1 allele was significantly higher (P < 0.05) in Group A (48.2%) compared to group B (32.7%). Haplotype analysis in the same sample showed Group A having a significantly higher (P < 0.007) prevalence (28.4%) of the 1 haplotype than those in group B (14.0%). The results indicate both these genetic markers in the DRD2 gene are associated with higher alcohol consumption; however, the 1 haplotype appears to be a better marker for this behavior. In conclusion, haplotypes within the DRD2 gene and TaqI A DRD2 alleles (located 20-Kb from the 3{prime} coding region of this gene) are both associated with heavier alcohol consumption. These findings add further evidence to the importance of the gene in alcohol-related behaviors.

  10. Identification and genetic effect of haplotype in the bovine BMP7 gene.

    Science.gov (United States)

    Huang, Yong-Zhen; Wang, Xin-Lei; He, Hua; Lan, Xian-Yong; Lei, Chu-Zhao; Zhang, Chun-Lei; Chen, Hong

    2013-12-15

    Bone morphogenetic proteins (BMPs) are peptide growth factors belonging to the transforming growth factor-beta (TGF-β) superfamily, and some members of the BMP family support white adipocyte differentiation. In this study, we focused on the BMP7 which singularly promotes the differentiation of brown preadipocytes. Haplotypes involving 5 single nucleotide polymorphism (SNP) sites in the bovine BMP7 gene were identified and their effect on body weight was analyzed. 16 haplotypes and 18 combined haplotypes were revealed and the linkage disequilibrium was assessed in the cattle population with 602 individuals representing three main cattle breeds from China. The results showed that haplotypes 3, 10 and 14 were predominant and accounted for 75.64%, 69.85%, and 83.36% in Nanyang, Qinchuan and Jiaxian cattle breeds, respectively. The statistical analyses indicated that the SNP 1, 4, and 5 are associated with the body weight, body length, and heart girth at 12 and 24 months in Nanyang cattle population (Pgrowth traits, and may be utilized as a genetic marker in marker-assisted selection for beef cattle breeding programs. Copyright © 2013. Published by Elsevier B.V.

  11. Platinum nanoparticles strongly associated with graphitic carbon nitride as efficient co-catalysts for photocatalytic hydrogen evolution under visible light.

    Science.gov (United States)

    Shiraishi, Yasuhiro; Kofuji, Yusuke; Kanazawa, Shunsuke; Sakamoto, Hirokatsu; Ichikawa, Satoshi; Tanaka, Shunsuke; Hirai, Takayuki

    2014-12-14

    Platinum (Pt) nanoparticles with C3N4) by reduction at 673 K behave as efficient co-catalysts for photocatalytic hydrogen evolution under visible light (λ >420 nm). This is achieved by strong Pt-support interaction due to the high temperature treatment, which facilitates efficient transfer of photoformed conduction band electrons on g-C3N4 to Pt particles.

  12. CCR5 Haplotypes Influence HCV Serostatus in Caucasian Intravenous Drug Users

    Science.gov (United States)

    Huik, Kristi; Avi, Radko; Carrillo, Andrew; Harper, Nathan; Pauskar, Merit; Sadam, Maarja; Karki, Tõnis; Krispin, Tõnu; Kongo, Ulvi-Kaire; Jermilova, Tatiana; Rüütel, Kristi; Talu, Ave; Abel-Ollo, Katri; Uusküla, Anneli; Ahuja, Sunil K.; He, Weijing; Lutsar, Irja

    2013-01-01

    Background Up to 90% HIV-1 positive intravenous drug users (IDUs) are co-infected with HCV. Although best recognized for its function as a major co-receptor for cell entry of HIV, CC chemokine receptor 5 (CCR5) has also been implicated in the pathogenesis of HCV infection. Here, we investigated whether CCR5 haplotypes influence HIV-1 and HCV seropositivity among 373 Caucasian IDUs from Estonia. Methods Of these IDUs, 56% and 44% were HIV and HCV seropositive, respectively, and 47% were coinfected. 500 blood donors seronegative for HIV and HCV were also evaluated. CCR5 haplotypes (HHA to HHG*2) were derived after genotyping nine CCR2–CCR5 polymorphisms. The association between CCR5 haplotypes with HIV and/or HCV seropositivity was determined using logistic regression analysis. Co-variates included in the models were length of intravenous drug use, HBV serostatus and copy number of CCL3L1, the gene encoding the most potent HIV-suppressive chemokine and ligand for CCR5. Results Compared to IDUs seronegative for both HCV and HIV (HCV−/HIV-), IDUs who were HCV+/HIV- and HCV+/HIV+were 92% and 82%, respectively, less likely to possess the CCR5-HHG*1 haplotype, after controlling for co-variates (Padjusted = 1.89×10−4 and 0.003, respectively). This association was mostly due to subjects bearing the CCR5 HHE and HHG*1 haplotype pairs. Approximately 25% andHIV- IDUs and HCV−/HIV- blood donors, respectively, possessed the HHE/HHG*1 genotype. Conclusions Our findings suggest that HHG*1-bearing CCR5 genotypes influence HCV seropositivity in a group of Caucasian IDUs. PMID:23936229

  13. Effects of Bos taurus autosome 9-located quantitative trait loci haplotypes on the disease phenotypes of dairy cows with experimentally induced Escherichia coli mastitis

    DEFF Research Database (Denmark)

    Khatun, Momena; Sørensen, Peter; Jørgensen, Hanne Birgitte Hede

    2013-01-01

    Several quantitative trait loci (QTL) affecting mastitis incidence and mastitis-related traits such as somatic cell score exist in dairy cows. Previously, QTL haplotypes associated with susceptibility to Escherichia coli mastitis in Nordic Holstein-Friesian (HF) cows were identified on Bos taurus...... the HH group did. However, we also found interactions between the effects of haplotype and biopsy for body temperature, heart rate, and PMNL. In conclusion, when challenged with E. coli mastitis, HF cows with the specific Bos taurus autosome 9-located QTL haplotypes were associated with differences...

  14. Serum aspirin esterase is strongly associated with glucose and lipids in healthy subjects: different association patterns in subjects with type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Kotani Kazuhiko

    2010-07-01

    Full Text Available Abstract Background Aspirin esterase (AE activity can account for part of aspirin pharmacokinetics in the circulation, possibly being associated with the impairment of aspirin effectiveness as an inhibitor of platelet aggregation. Aims The study was aimed at investigating the correlations of serum AE activity with cholinesterase (ChE and metabolic variables in healthy subjects in comparison to subjects with type 2 diabetes mellitus (T2DM. Methods In cardiovascular disease-free T2DM subjects and healthy controls, the AE activity levels and/or the correlation patterns between AE and the other variables were analyzed. Results Neither AE nor ChE activities were higher in the subjects with T2DM. Serum AE activity strongly correlated with ChE as well as glucose/lipids variables such as total cholesterol and triglyceride in healthy subjects, while the correlations between AE and glucose/lipids variables were not present in T2DM subjects. Conclusions These data may reflect the pathophysiological changes between healthy and T2DM subjects. Our data may thus provide the basis for future studies to unravel the mechanisms.

  15. A haplotype-based analysis of the LRP5 gene in relation to osteoporosis phenotypes in Spanish postmenopausal women.

    Science.gov (United States)

    Agueda, Lídia; Bustamante, Mariona; Jurado, Susana; Garcia-Giralt, Natalia; Ciria, Manel; Saló, Guillem; Carreras, Ramon; Nogués, Xavier; Mellibovsky, Leonardo; Díez-Pérez, Adolfo; Grinberg, Daniel; Balcells, Susana

    2008-12-01

    LRP5 encodes the low-density lipoprotein receptor-related protein 5, a transmembrane protein involved in Wnt signaling. LRP5 is an important regulator of osteoblast growth and differentiation, affecting bone mass in vertebrates. Whether common variations in LRP5 are associated with normal BMD variation or osteoporotic phenotypes is of great relevance. We used a haplotype-based approach to search for common disease-associated variants in LRP5 in a cohort of 964 Spanish postmenopausal women. Twenty-four SNPs were selected, covering the LRP5 region, including the missense changes p.V667M and p.A1330V. The SNPs were genotyped and evaluated for association with BMD at the lumbar spine (LS) or femoral neck (FN) and with osteoporotic fracture, at single SNP and haplotype levels, by regression methods. Association with LS BMD was found for SNP 1, rs312009, located in the 5'-flanking region (p = 0.011, recessive model). SNP 6, rs2508836, in intron 1, was also associated with BMD, both at LS (p = 0.025, additive model) and FN (p = 0.031, recessive model). Two polymorphisms were associated with fracture: SNP 11, rs729635, in intron 1, and SNP 15, rs643892, in intron 5 (p = 0.007 additive model and p = 0.019 recessive model, respectively). Haplotype analyses did not provide additional information, except for haplotype "GC" of the block located at the 3'end of the gene. This haplotype spans intron 22 and the 3' untranslated region and was associated with FN BMD (p = 0.029, one copy of the haplotype versus none). In silico analyses showed that SNP 1 (rs312009) lies in a putative RUNX2 binding site. Electro-mobility shift assays confirmed RUNX2 binding to this site.

  16. Migration-selection balance and local adaptation of mitochondrial haplotypes in rufous-collared sparrows (Zonotrichia capensis) along an elevational gradient.

    Science.gov (United States)

    Cheviron, Zachary A; Brumfield, Robb T

    2009-06-01

    Variable selection pressures across heterogeneous landscapes can lead to local adaptation of populations. The extent of local adaptation depends on the interplay between natural selection and gene flow, but the nature of this relationship is complex. Gene flow can constrain local adaptation by eroding differentiation driven by natural selection, or local adaptation can itself constrain gene flow through selection against maladapted immigrants. Here we test for evidence that natural selection constrains gene flow among populations of a widespread passerine bird (Zonotrichia capensis) that are distributed along an elevational gradient in the Peruvian Andes. Using multilocus sequences and microsatellites screened in 142 individuals collected along a series of replicate transects, we found that mitochondrial gene flow was significantly reduced along elevational transects relative to latitudinal control transects. Nuclear gene flow, however, was not similarly reduced. Clines in mitochondrial haplotype frequency were strongly associated with transitions in environmental variables along the elevational transects, but this association was not observed for the nuclear markers. These results suggest that natural selection constrains mitochondrial gene flow along elevational gradients and that the mitonuclear discrepancy may be due to local adaptation of mitochondrial haplotypes.

  17. Five novel glucose-6-phosphate dehydrogenase deficiency haplotypes correlating with disease severity

    Directory of Open Access Journals (Sweden)

    Dallol Ashraf

    2012-09-01

    Full Text Available Abstract Background Glucose-6-phosphate dehydrogenase (G6PD, EC 1.1.1.49 deficiency is caused by one or more mutations in the G6PD gene on chromosome X. An association between enzyme levels and gene haplotypes remains to be established. Methods In this study, we determined G6PD enzyme levels and sequenced the coding region, including the intron-exon boundaries, in a group of individuals (163 males and 86 females who were referred to the clinic with suspected G6PD deficiency. The sequence data were analysed by physical linkage analysis and PHASE haplotype reconstruction. Results All previously reported G6PD missense changes, including the AURES, MEDITERRANEAN, A-, SIBARI, VIANGCHAN and ANANT, were identified in our cohort. The AURES mutation (p.Ile48Thr was the most common variant in the cohort (30% in males patients followed by the Mediterranean variant (p.Ser188Phe detectable in 17.79% in male patients. Variant forms of the A- mutation (p.Val68Met, p.Asn126Asp or a combination of both were detectable in 15.33% of the male patients. However, unique to this study, several of such mutations co-existed in the same patient as shown by physical linkage in males or PHASE haplotype reconstruction in females. Based on 6 non-synonymous variants of G6PD, 13 different haplotypes (13 in males, 8 in females were identified. Five of these were previously unreported (Jeddah A, B, C, D and E and were defined by previously unreported combinations of extant mutations where patients harbouring these haplotypes exhibited severe G6PD deficiency. Conclusions Our findings will help design a focused population screening approach and provide better management for G6PD deficiency patients.

  18. Simultaneous inference of haplotypes and alleles at a causal gene

    Directory of Open Access Journals (Sweden)

    Fabrice eLarribe

    2015-10-01

    Full Text Available We present a new methodology which jointly infers haplotypes and the causal alleles at a gene influencing a given trait. Often in human genetic studies, the available data consists of genotypes (series of genetic markers along the chromosomes and a phenotype. However, for many genetic analyses, one needs haplotypes instead of genotypes. Our methodology is not only able to estimate haplotypes conditionally on the disease status, but is also able to infer the alleles at the unknown disease locus. Some applications of our methodology are in genetic mapping and in genetic counselling.

  19. Fitchi: haplotype genealogy graphs based on the Fitch algorithm.

    Science.gov (United States)

    Matschiner, Michael

    2016-04-15

    : In population genetics and phylogeography, haplotype genealogy graphs are important tools for the visualization of population structure based on sequence data. In this type of graph, node sizes are often drawn in proportion to haplotype frequencies and edge lengths represent the minimum number of mutations separating adjacent nodes. I here present Fitchi, a new program that produces publication-ready haplotype genealogy graphs based on the Fitch algorithm. http://www.evoinformatics.eu/fitchi.htm : michaelmatschiner@mac.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. How we eat what we eat: identifying meal routines and practices most strongly associated with healthy and unhealthy dietary factors among young adults.

    Science.gov (United States)

    Laska, Melissa N; Hearst, Mary O; Lust, Katherine; Lytle, Leslie A; Story, Mary

    2015-08-01

    (i) To examine associations between young adults' meal routines and practices (e.g. food preparation, meal skipping, eating on the run) and key dietary indicators (fruit/vegetable, fast-food and sugar-sweetened beverage intakes) and (ii) to develop indices of protective and risky meal practices most strongly associated with diet. Cross-sectional survey. Minneapolis/St. Paul metropolitan area, Minnesota (USA). A diverse sample of community college and public university students (n 1013). Meal routines and practices most strongly associated with healthy dietary patterns were related to home food preparation (i.e. preparing meals at home, preparing meals with vegetables) and meal regularity (i.e. routine consumption of evening meals and breakfast). In contrast, factors most strongly associated with poor dietary patterns included eating on the run, using media while eating and purchasing foods/beverages on campus. A Protective Factors Index, summing selected protective meal routines and practices, was positively associated with fruit/vegetable consumption and negatively associated with fast-food and sugar-sweetened beverage consumption (PMeal routines and practices were significantly associated with young adults' dietary patterns, suggesting that ways in which individuals structure mealtimes and contextual characteristics of eating likely influence food choice. Thus, in addition to considering specific food choices, it also may be important to consider the context of mealtimes in developing dietary messaging and guidelines.

  1. Development of high-brightness ultrafast electron microscope for studying nanoscale dynamics associated with strongly correlated materials

    Science.gov (United States)

    Tao, Zhensheng

    Strongly correlated-electron materials are a class of materials that exhibit numerous intriguing emergent phenomena, including metal-to-insulator transition, colossal magnetoresistance, high-temperature superconductivity, etc. These phenomena are beyond the reach of the conventional solid state physics, which is based on the band theory. Instead, strong electron-electron correlations are found to play important roles, which leads to complicated interplay between different degrees of freedoms (charge, lattice, spins...). In this thesis, ultrafast electron diffraction (UED) is used to investigate the photo-induced ultrafast structural dynamics of strongly correlated materials, among which VO2 is taken as an exemplar system, one that reveals the fundamental physics behind photo-induced phase transitions, electron-electron correlation on nanometer scales, and the electron-phonon coupling in this exotic class of materials. The phenomena presented here are expected to have more general significance as they may reflect the physics to which other strongly correlated materials also conform. In polycrystalline VO2 thin films, the structural changes resulting from photoexcitation with femtosecond laser pulses with different wavelengths are observed to lead to non-thermal phase transitions, which require less energy compared to the phase transitions induced by thermal excitation. The details of the structural change are extracted from the UED results revealing stepwise atomic movements after photoexcitation, which suggests the phase transition starts with a dilation of the correlated d electrons. On the other hand, the structural phase transition is found to be decoupled from the metal-to-insulator transition when the sample dimension is reduced to the sub-micrometer scale, which is attributed to the interface charge doping effects from different substrates. A new phase (M3, monoclinic metallic phase) is distinguished, which has not been discussed by the existing theoretical

  2. Influence of βS-Globin Haplotypes and Hydroxyurea on Arginase I Levels in Sickle Cell Disease

    Directory of Open Access Journals (Sweden)

    J. A. Moreira

    2016-01-01

    Full Text Available Introduction. Sickle cell disease (SCD is characterized by hemoglobin S homozygosity, leading to hemolysis and vasoocclusion. The hemolysis releases arginase I, an enzyme that decreases the bioavailability of nitric oxide, worsening the symptoms. The different SCD haplotypes are related to clinical symptoms and varied hemoglobin F (HbF concentration. The aim of this study was to evaluate the impact of the βS gene haplotypes and HbF concentration on arginase I levels in SCD patients. Methods. Fifty SCD adult patients were enrolled in the study and 20 blood donors composed the control group. Arginase I was measured by ELISA. The βS haplotypes were identified by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. Statistical analyses were performed with GraphPad Prism program and the significance level was p<0.05. Results. Significant increase was observed in the arginase I levels in SCD patients compared to the control group (p<0.0001. The comparison between the levels of arginase I in three haplotypes groups showed a difference between the Bantu/Bantu × Bantu/Benin groups; Bantu/Bantu × Benin/Benin, independent of HU dosage. An inverse correlation with the arginase I levels and HbF concentration was observed. Conclusion. The results support the hypothesis that arginase I is associated with HbF concentration, also measured indirectly by the association with haplotypes.

  3. Correlation of chitinase 3-like 1 single nucleotide polymorphisms and haplotypes with uterine cervical cancer in Taiwanese women.

    Directory of Open Access Journals (Sweden)

    Yue-Shan Lin

    Full Text Available This study aimed to investigate the relationships of chitinase 3-like 1 (CHI3L1 single nucleotide polymorphisms (SNPs and haplotypes with the development of uterine cervical cancer in Taiwanese women. The SNPs frequencies and haplotypes were also correlated with the clinicopathologic variables of cervical cancer, cancer recurrence, and patient survival.Ninety-nine patients with invasive cancer and 61 with pre-cancerous lesions of the uterine cervix were compared to 310 healthy control subjects. Three SNPs rs6691378 (-1371, G/A, rs10399805 (-247, G/A and rs4950928 (-131, C/G in the promoter region, and one SNP rs880633 (+2950, T/C in exon 5 were analyzed by real time polymerase chain reaction and genotyping. The results showed that the mutant homozygous genotype AA of CHI3L1 SNP rs6691378 and AA of rs10399805, and haplotypes AACC and AACT increased the risk of developing pre-cancerous lesions and invasive cancer. The patients with these risk haplotypes had higher than stage I tumors, larger tumors, and vaginal invasion. In logistic regression model, they also tended to have poor survival event [p = 0.078; odds ratio (OR: 2.99, 95% confidence interval (CI: 0.89-10.08] and a higher probability of recurrence event (p = 0.081; OR: 3.07, 95% CI: 0.87-10.81. There was a significant association between the CHI3L1 risk haplotypes and probability of recurrence (p = 0.002; hazard ratio: 6.21, 95% CI: 1.90-20.41, and a marginal association between the risk haplotypes and overall survival (p = 0.051; hazard ratio: 3.76, 95% CI: 0.99-14.29 in the patients with SCC, using Cox proportional hazard model.The CHI3L1 SNPs rs6691378 and rs10399805 and CHI3L1 haplotypes all correlated with the development of cervical pre-cancerous lesions and invasive cancer. The cervical cancer patients with the CHI3L1 haplotypes AACC or AACT had poor clinicopathologic characteristics and poor recurrence and survival events. These risk haplotypes were associated with higher

  4. Genome-wide association study provides strong evidence of genes affecting the reproductive performance of Nellore beef cows.

    Science.gov (United States)

    Melo, Thaise Pinto de; de Camargo, Gregório Miguel Ferreira; de Albuquerque, Lucia Galvão; Carvalheiro, Roberto

    2017-01-01

    Reproductive traits are economically important for beef cattle production; however, these traits are still a bottleneck in indicine cattle since these animals typically reach puberty at older ages when compared to taurine breeds. In addition, reproductive traits are complex phenotypes, i.e., they are controlled by both the environment and many small-effect genes involved in different pathways. In this study, we conducted genome-wide association study (GWAS) and functional analyses to identify important genes and pathways associated with heifer rebreeding (HR) and with the number of calvings at 53 months of age (NC53) in Nellore cows. A total of 142,878 and 244,311 phenotypes for HR and NC53, respectively, and 2,925 animals genotyped with the Illumina Bovine HD panel (Illumina®, San Diego, CA, USA) were used in GWAS applying the weighted single-step GBLUP (WssGBLUP) method. Several genes associated with reproductive events were detected in the 20 most important 1Mb windows for both traits. Significant pathways for HR and NC53 were associated with lipid metabolism and immune processes, respectively. MHC class II genes, detected on chromosome 23 (window 25-26Mb) for NC53, were significantly associated with pregnancy success of Nellore cows. These genes have been proved previously to be associated with reproductive traits such as mate choice in other breeds and species. Our results suggest that genes associated with the reproductive traits HR and NC53 may be involved in embryo development in mammalian species. Furthermore, some genes associated with mate choice may affect pregnancy success in Nellore cattle.

  5. The influence of interleukin-7 receptor α-chain haplotypes on outcome after allogeneic hematopoietic cell transplantation

    DEFF Research Database (Denmark)

    Broux, B; Shamim, Z; Wang, T

    2014-01-01

    We investigated the influence of IL-7 receptor α-chain (IL-7Rα) gene haplotypes in donors on the outcome of haematopoietic cell transplantation (HCT). Unlike the association between single donor SNPs and HCT outcome found previously, only trends towards association were found here, due to 'dilution...

  6. Absence of Granzyme B Positive Tumour-Infiltrating Lymphocytes in Primary Melanoma Excisional Biopsies is Strongly Associated with the Presence of Sentinel Lymph Node Metastasis

    Directory of Open Access Journals (Sweden)

    I. S. van Houdt

    2009-01-01

    Full Text Available Background: Sentinel Lymph Node (SLN status is strongly related to clinical outcome in melanoma patients. In this study we investigated the possible association between the presence of activated and/or suppressive Tumour Infiltrating Lymphocytes (TILs and SLN status in clinically stage I/II melanoma patients.

  7. Property Values Associated with the Failure of Individual Links in a System with Multiple Weak and Strong Links.

    Energy Technology Data Exchange (ETDEWEB)

    Helton, Jon C. [Arizona State Univ., Tempe, AZ (United States); Brooks, Dusty Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Sallaberry, Cedric Jean-Marie. [Engineering Mechanics Corp. of Columbus, OH (United States)

    2018-02-01

    Representations are developed and illustrated for the distribution of link property values at the time of link failure in the presence of aleatory uncertainty in link properties. The following topics are considered: (i) defining properties for weak links and strong links, (ii) cumulative distribution functions (CDFs) for link failure time, (iii) integral-based derivation of CDFs for link property at time of link failure, (iv) sampling-based approximation of CDFs for link property at time of link failure, (v) verification of integral-based and sampling-based determinations of CDFs for link property at time of link failure, (vi) distributions of link properties conditional on time of link failure, and (vii) equivalence of two different integral-based derivations of CDFs for link property at time of link failure.

  8. De novo assembly of a haplotype-resolved human genome.

    Science.gov (United States)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun

    2015-06-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.

  9. De novo assembly of a haplotype-resolved human genome

    DEFF Research Database (Denmark)

    Cao, Hongzhi; Wu, Honglong; Luo, Ruibang

    2015-01-01

    The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome...... of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should...... shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb...

  10. Y-chromosome STR haplotypes in males from Greenland

    DEFF Research Database (Denmark)

    Hallenberg, Charlotte; Tomas Mas, Carmen; Simonsen, Bo

    2009-01-01

    A total of 272 males from Greenland were typed for 11 Y-chromosome STRs DYS19, DYS385a/b, DYS389-I, DYS389-II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438 and DYS439 with the PowerPlex Y System (Promega). A total of 146 different haplotypes were observed and the haplotype diversity was 0...

  11. BMP4 and FGF3 haplotypes increase the risk of tendinopathy in volleyball athletes.

    Science.gov (United States)

    Salles, José Inácio; Amaral, Marcus Vinícius; Aguiar, Diego Pinheiro; Lira, Daisy Anne; Quinelato, Valquiria; Bonato, Letícia Ladeira; Duarte, Maria Eugenia Leite; Vieira, Alexandre Rezende; Casado, Priscila Ladeira

    2015-03-01

    To investigate whether genetic variants can be correlated with tendinopathy in elite male volleyball athletes. Case-control study. Fifteen single nucleotide polymorphisms within BMP4, FGF3, FGF10, FGFR1 genes were investigated in 138 elite volleyball athletes, aged between 18 and 35 years, who undergo 4-5h of training per day: 52 with tendinopathy and 86 with no history of pain suggestive of tendinopathy in patellar, Achilles, shoulder, and hip abductors tendons. The clinical diagnostic criterion was progressive pain during training, confirmed by magnetic resonance image. Genomic DNA was obtained from saliva samples. Genetic markers were genotyped using TaqMan real-time PCR. Chi-square test compared genotypes and haplotype differences between groups. Multivariate logistic regression analyzed the significance of covariates and incidence of tendinopathy. Statistical analysis revealed participant age (p=0.005) and years of practice (p=0.004) were risk factors for tendinopathy. A significant association between BMP4 rs2761884 (p=0.03) and tendinopathy was observed. Athletes with a polymorphic genotype have 2.4 times more susceptibility to tendinopathy (OR=2.39; 95%CI=1.10-5.19). Also, association between disease and haplotype TTGGA in BMP4 (p=0.01) was observed. The FGF3 TGGTA haplotype showed a tendency of association with tendinopathy (p=0.05), and so did FGF10 rs900379. FGFR1 showed no association with disease. These findings indicate that haplotypes in BMP4 and FGF3 genes may contribute to the tendon disease process in elite volleyball athletes. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  12. Nonblack patients with sickle cell disease have African. beta. sup s gene cluster haplotypes

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Z.R.; Powars, D.R.; Williams, W.D. (Univ. of Southern California School of Medicine, Los Angeles (USA)); Kinney, T.R. (Duke Univ., Durham, NC (USA)); Schroeder, W.A. (California Institute of Technology, Pasadena (USA))

    1989-05-26

    Of 18 nonblack patients with sickle cell disease, 14 had sickle cell anemia, 2 had hemoglobin SC disease, and 2 had hemoglobin S-{beta}{sup o}-thalassemia. The {beta}{sup s} gene cluster haplotypes that were determined in 7 patients were of African origin and were identified as Central African Republic, Central African Republic minor II, Benin, and Senegal. The haplotype Central African Republic minor II was present on the {beta}{sup o}-thalassemia chromosome in 2 patients. None of 10 patients whose {alpha}-gene status was determined had {alpha}-thalassemia-2. These data strongly support the concept that the {beta}{sup s} gene on chromosome 11 of these individuals is of African origin and that the {alpha}-gene locus on chromosome 16 is of white or native American origin. The clinical severity of the disease in these nonblack patients is appropriate to their haplotype without {alpha}-thalassemia-2 and is comparable with that of black patients. All persons with congenital hemolytic anemia should be examined for the presence of sickle cell disease regardless of physical appearance or ethnic background.

  13. Y chromosomal haplotype characteristics of domestic sheep (Ovis aries) in China.

    Science.gov (United States)

    Wang, Yutao; Xu, Lei; Yan, Wei; Li, Shaobin; Wang, Jiqing; Liu, Xiu; Hu, Jiang; Luo, Yuzhu

    2015-07-10

    Investigations on the variation present at the male-specific Y chromosome region provide strong information to understand the origin and evolution of domestic sheep. One SNP OY1 (g.88A>G) in the upstream region of SRY gene, and the microsatellite SRYM18 locus within ovine Y chromosome were analyzed in one hundred and forty five samples collected from eleven breeds in China. SNP OY1 was analyzed using PCR-SSCP method and sequencing. Two different PCR-SSCP patterns represented two specific sequences with sequence analysis revealing SNP-OY1 (g.88A>G) were observed, while SNP A-OY1 showed the most common frequency (82.8%). Sequencing of the SRYM18 region revealed one novel size fragment (A2) with different repetitive units. Seven haplotypes (H4, H5, H6, H7, H8, H9 and H12) and two novel haplotypes (Ha and Hb) were established using combined genotype analysis. H6 showed the highest frequency (43.4%) across all breeds, and H8 showed the second frequency (24.1%). Ha was only found in one breed (Tan), while Hb was present in three breeds (Gansu alpine, White Suffolk and Duolang). Our findings reveal one novel allele in SRYM18 region and two novel male haplotypes of domestic sheep in China. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Lean Mass Appears to Be More Strongly Associated with Bone Health than Fat Mass in Urban Black South African Women.

    Science.gov (United States)

    Sotunde, O F; Kruger, H S; Wright, H H; Havemann-Nel, L; Kruger, I M; Wentzel-Viljoen, E; Kruger, A; Tieland, M

    2015-06-01

    To examine the association between body composition (fat mass, lean mass and body mass index, BMI) and bone health (bone mineral density, BMD and fracture risk) in urban black South African women. A cross sectional study examining associations between body composition, dietary intake (food frequency questionnaire), habitual physical activity (Activity energy expenditure (AEE) measured using an accelerometer with combined heart rate monitor and physical activity questionnaire) and bone health (BMD using dual-energy X ray absorptiometry, DXA and fracture risk). Urban community dwellers from Ikageng in the North-West Province of South Africa. One hundred and eighty nine (189) healthy postmenopausal women aged ≥43 years. Fat mass and lean mass were significantly associated with BMD and fracture risk when adjusted for potential confounders. However, lean mass and not fat mass remained significantly associated with femoral neck BMD (β = 0.49, p South African women. Our finding suggests that increasing lean mass rather than fat mass is beneficial to bone health. Our study emphasises the importance of positive lifestyle changes, intake of calcium from dairy and adequate weight to maintain and improve bone health of postmenopausal women.

  15. Short communication: casein haplotype variability in sicilian dairy goat breeds.

    Science.gov (United States)

    Gigli, I; Maizon, D O; Riggio, V; Sardina, M T; Portolano, B

    2008-09-01

    In the Mediterranean region, goat milk production is an important economic activity. In the present study, 4 casein genes were genotyped in 5 Sicilian goat breeds to 1) identify casein haplotypes present in the Argentata dell'Etna, Girgentana, Messinese, Derivata di Siria, and Maltese goat breeds; and 2) describe the structure of the Sicilian goat breeds based on casein haplotypes and allele frequencies. In a sample of 540 dairy goats, 67 different haplotypes with frequency >or=0.01 and 27 with frequency >or=0.03 were observed. The most common CSN1S1-CSN2-CSN1S2-CSN3 haplotype for Derivata di Siria and Maltese was FCFB (0.17 and 0.22, respectively), whereas for Argentata dell'Etna, Girgentana and Messinese was ACAB (0.06, 0.23, and 0.10, respectively). According to the haplotype reconstruction, Argentata dell'Etna, Girgentana, and Messinese breeds presented the most favorable haplotype for cheese production, because the casein concentration in milk of these breeds might be greater than that in Derivata di Siria and Maltese breeds. Based on a cluster analysis, the breeds formed 2 main groups: Derivata di Siria, and Maltese in one group, and Argentata dell'Etna and Messinese in the other; the Girgentana breed was between these groups but closer to the latter.

  16. Comparison of simultaneous variations of the ionospheric total electron content and geomagnetic field associated with strong earthquakes

    Directory of Open Access Journals (Sweden)

    Sh. Naaman

    2001-01-01

    Full Text Available In this paper, perturbations of the ionospheric Total Electron Content (TEC are compared with geomagnetic oscillations. Comparison is made for a few selected periods, some during earthquakes in California and Japan and others at quiet periods in Israel and California. Anomalies in TEC were extracted using Global Positioning System (GPS observations collected by GIL (GPS in Israel and the California permanent GPS networks. Geomagnetic data were collected in some regions where geomagnetic observatories and the GPS network overlaps. Sensitivity of the GPS method and basic wave characteristics of the ionospheric TEC perturbations are discussed. We study temporal variations of ionospheric TEC structures with highest reasonable spatial resolution around 50 km. Our results show no detectable TEC disturbances caused by right-lateral strike-slip earthquakes with minor vertical displacement. However, geomagnetic observations obtained at two observatories located in the epicenter zone of a strong dip-slip earthquake (Kyuchu, M = 6.2, 26 March 1997 revealed geomagnetic disturbances occurred 6–7 h before the earthquake.

  17. A new goniothalamin N-acylated aza-derivative strongly downregulates mediators of signaling transduction associated with pancreatic cancer aggressiveness.

    Science.gov (United States)

    Barcelos, Rosimeire Coura; Pelizzaro-Rocha, Karin Juliane; Pastre, Julio Cezar; Dias, Marina Pereira; Ferreira-Halder, Carmen Veríssima; Pilli, Ronaldo Aloise

    2014-11-24

    In this study, a novel concise series of molecules based on the structure of goniothalamin (1) was synthesized and evaluated against a highly metastatic human pancreatic cancer cell line (Panc-1). Among them, derivative 8 displayed a low IC50 value (2.7 μM) and its concentration for decreasing colony formation was 20-fold lower than goniothalamin (1). Both compounds reduced the levels of the receptor tyrosine kinase (AXL) and cyclin D1 which are known to be overexpressed in pancreatic cancer cells. Importantly, despite the fact that goniothalamin (1) and derivative 8 caused pancreatic cancer cell cycle arrest and cell death, only derivative 8 was able to downregulate pro-survival and proliferation pathways mediated by mitogen activated protein kinase ERK1/2. Another interesting finding was that Panc-1 cells treated with derivative 8 displayed a strong decrease in the transcription factor (c-Myc), hypoxia-inducible factor-1α (HIF-1α) and vascular endothelial growth factor (VEGF) protein levels. Notably, the molecular effects caused by derivative 8 might not be related to ROS generation, since no significant production of ROS was observed in low concentrations of this compound (from 1.5 up to 3 μM). Therefore, the downregulation of important mediators of pancreatic cancer aggressiveness by derivative 8 reveals its great potential for the development of new chemotherapeutic agents for pancreatic cancer treatment. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  18. Insights into HLA-G Genetics Provided by Worldwide Haplotype Diversity

    Science.gov (United States)

    Castelli, Erick C.; Ramalho, Jaqueline; Porto, Iane O. P.; Lima, Thálitta H. A.; Felício, Leandro P.; Sabbagh, Audrey; Donadi, Eduardo A.; Mendes-Junior, Celso T.

    2014-01-01

    Human leukocyte antigen G (HLA-G) belongs to the family of non-classical HLA class I genes, located within the major histocompatibility complex (MHC). HLA-G has been the target of most recent research regarding the function of class I non-classical genes. The main features that distinguish HLA-G from classical class I genes are (a) limited protein variability, (b) alternative splicing generating several membrane bound and soluble isoforms, (c) short cytoplasmic tail, (d) modulation of immune response (immune tolerance), and (e) restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments [promoter, coding, and 3′ untranslated region (UTR)]. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding, and 3′UTRs are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures. PMID:25339953

  19. HLA-E regulatory and coding region variability and haplotypes in a Brazilian population sample.

    Science.gov (United States)

    Ramalho, Jaqueline; Veiga-Castelli, Luciana C; Donadi, Eduardo A; Mendes-Junior, Celso T; Castelli, Erick C

    2017-11-01

    The HLA-E gene is characterized by low but wide expression on different tissues. HLA-E is considered a conserved gene, being one of the least polymorphic class I HLA genes. The HLA-E molecule interacts with Natural Killer cell receptors and T lymphocytes receptors, and might activate or inhibit immune responses depending on the peptide associated with HLA-E and with which receptors HLA-E interacts to. Variable sites within the HLA-E regulatory and coding segments may influence the gene function by modifying its expression pattern or encoded molecule, thus, influencing its interaction with receptors and the peptide. Here we propose an approach to evaluate the gene structure, haplotype pattern and the complete HLA-E variability, including regulatory (promoter and 3'UTR) and coding segments (with introns), by using massively parallel sequencing. We investigated the variability of 420 samples from a very admixed population such as Brazilians by using this approach. Considering a segment of about 7kb, 63 variable sites were detected, arranged into 75 extended haplotypes. We detected 37 different promoter sequences (but few frequent ones), 27 different coding sequences (15 representing new HLA-E alleles) and 12 haplotypes at the 3'UTR segment, two of them presenting a summed frequency of 90%. Despite the number of coding alleles, they encode mainly two different full-length molecules, known as E*01:01 and E*01:03, which corresponds to about 90% of all. In addition, differently from what has been previously observed for other non classical HLA genes, the relationship among the HLA-E promoter, coding and 3'UTR haplotypes is not straightforward because the same promoter and 3'UTR haplotypes were many times associated with different HLA-E coding haplotypes. This data reinforces the presence of only two main full-length HLA-E molecules encoded by the many HLA-E alleles detected in our population sample. In addition, this data does indicate that the distal HLA-E promoter is by

  20. C4 polymorphism and extended HLA haplotypes in Namibian San and Khoi and in South African Xhosa.

    Science.gov (United States)

    Creemers, P C; du Toit, E D

    1996-02-01

    We studied C4A and C4B polymorphisms and HLA-B and -DR associations in the San, Khoi and Xhosa. C4A and C4B alleles were determined using conventional protein allotyping methods. The C4A*3, C4B*1 haplotype had a high frequency (30-55%) in all populations. The frequency of C4A*3, C4B*Q0 was 7-19%. The C4A*Q0, C4B*1 haplotype was frequent (15%) in the Khoi but very rare in the San (P Xhosa (15%) but rare in the San and Khoi (P Xhosa. C4A alleles A*4, A*45, A*58, A*12, A*14, A*19 and the C4A*3 A*91 duplication were only found in the San/Khoi population group. In the San, fourteen extended haplotypes were found in a relatively high frequency (2-7%). In the Xhosa, one extended haplotype (B42, C4A*12 A*91, C4B*Q0, DR18) was found in a very high frequency (13%) and was characteristic for this group; five other extended haplotypes were found with a low frequency (< 3%).

  1. HLA-DQ Haplotypes Differ by Ethnicity in Patients with Childhood-onset Diabetes

    Science.gov (United States)

    Lipton, Rebecca B.; Drum, Melinda; Greeley, Siri Atma W.; Danielson, Kirstie K.; Bell, Graeme I.; Hagopian, William A.

    2012-01-01

    Aim To understand the etiology of childhood-onset diabetes, we examined genetic risk markers, autoantibodies (AB), and β-cell function in a mixed-race group of young patients. Methods 145 patients aged 0–17 at diagnosis (54% African American, 22% Caucasian, 16% Latino, 8% Mixed-Other) were studied at mean duration 6.9 ± 5.7 (range 0.1–28.5) years, including HLA-DQA1-DQB1 genotyping, stimulated C-peptide (CP), GAD and IA-2 antibodies (AB). Based on no residual β-cell function (CP−) and islet autoantibodies (AB+), 111 patients were classified with type 1 diabetes (T1DM); 22 were CP+ and AB− and thus considered to have type 2 diabetes (T2DM); 12 patients had features of both T1DM and T2DM, or mixed phenotype. Results Based on the presence of two high-risk HLA-DQA1/B1 haplotypes, 39% of African Americans, 81% of Caucasians, 70% of Latinos, and 67% of Mixed-Others, were at high genetic risk. In T1DM patients, 41% of African Americans, 80% of Caucasians, 73% of Latinos, and 63% of Mixed-Others were genetically susceptible. 31% of African Americans, including 29% of those with T1DM, could not be characterized because their haplotypes had unknown T1DM associations. These unusual haplotypes comprised 11% in T1DM, 14% in T2DM, and 8% of haplotypes in mixed phenotype patients. Conclusions 59% of childhood-onset T1DM patients were identified with high genetic risk based on known HLA-DQA1/B1 associations. Many non-Caucasian patients carry HLA-DQ alleles whose association with T1DM is undetermined. Genetic approaches can provide insights into the etiology and appropriate treatment of childhood-onset diabetes, but only if sufficient data are available in diverse ethnic groups. PMID:21418452

  2. Haplotype frequencies in a sub-region of chromosome 19q13.3, related to risk and prognosis of cancer, differ dramatically between ethnic groups

    DEFF Research Database (Denmark)

    Schierup, M.H.; Mailund, T.; Li, H.

    2009-01-01

    caused either by genetic drift overruling selection against the susceptibility variant or a positive selection for the same haplotype. The data does not allow us to distinguish between these two scenarios. The analysis suggests that the region is not involved in cancer risk in Africans...... response to external damaging agents and markers in it are associated with risk of several cancers. Methods: We downloaded the genotypes of all markers typed in the 19q13.3 region in the HapMap populations of European, Asian and African descent and inferred haplotypes. We combined the European Hap......Map individuals with a Danish breast cancer case-control data set and inferred the association between HapMap haplotypes and disease risk. Results: We found that the susceptibility haplotype in our European sample had increased from 2 to 50 percent very recently in the European population, and to almost the same...

  3. Variation in Genes Related to Cochlear Biology Is Strongly Associated with Adult-Onset Deafness in Border Collies

    OpenAIRE

    Yokoyama, Jennifer S.; Lam, Ernest T.; Ruhe, Alison L.; Erdman, Carolyn A.; Robertson, Kathryn R.; Webb, Aubrey A.; Williams, D. Colette; Chang, Melanie L.; Hytönen, Marjo K.; Lohi, Hannes; Hamilton, Steven P.; Neff, Mark W.

    2012-01-01

    Domestic dogs can suffer from hearing losses that can have profound impacts on working ability and quality of life. We have identified a type of adult-onset hearing loss in Border Collies that appears to have a genetic cause, with an earlier age of onset (3-5 years) than typically expected for aging dogs (8-10 years). Studying this complex trait within pure breeds of dog may greatly increase our ability to identify genomic regions associated with risk of hearing impairment in dogs and in huma...

  4. Production of the effector cytokine interleukin-17, rather than interferon-γ, is more strongly associated with autoimmune hemolytic anemia

    Science.gov (United States)

    Hall, Andrew M.; Zamzami, Omar M.; Whibley, Natasha; Hampsey, Daniel P.; Haggart, Anne M.; Vickers, Mark A.; Barker, Robert N.

    2012-01-01

    Background Interleukin-17A is the signature cytokine of the Th17 subset and drives inflammatory pathology, but its relevance to autoantibody-mediated diseases is unclear. Th1 cells secreting interferon-γ have been implicated in autoimmune hemolytic anemia, so the aim was to determine which cytokine is more closely associated with disease severity. Design and Methods Interferon-γ and interleukin-17A were measured in the sera of patients with autoimmune hemolytic anemia and healthy donors, and in peripheral blood mononuclear cell cultures stimulated with autologous red blood cells, or a panel of peptides spanning red blood cell autoantigen. Results Serum interleukin-17A, but not interferon-γ, was significantly raised in patients with autoimmune hemolytic anemia (P anemia. Interleukin-17A was also more prominent in the responses of peripheral blood mononuclear cells from patients with autoimmune hemolytic anemia to red blood cells, and, again unlike interferon-γ, significantly associated with more severe anemia (P hemolytic anemia, challenging the model that the disease is driven primarily by Th1 cells. This raises the possibility that Th17, rather than Th1, cells should be the target for therapy. PMID:22419580

  5. Strong Association between Plasma Dipeptidyl Peptidase-4 Activity and Impaired Cognitive Function in Elderly Population with Normal Glucose Tolerance.

    Science.gov (United States)

    Chen, Bo; Zheng, Tianpeng; Qin, Linyuan; Hu, Xueping; Zhang, Xiaoxi; Liu, Yihong; Liu, Hongbo; Qin, Shenghua; Li, Gang; Li, Qinghua

    2017-01-01

    Objective: Inflammation, oxidative stress, and decreased glucagon-like peptide-1 (GLP-1) are risk factors for cognitive impairment. Dipeptidyl peptidase-4 (DPP4) was identified as a novel adipokine capable of enhancing these risk factors. Hence, we investigated the relationship between plasma DPP4 activity and impaired cognitive function in elderly Chinese population with normal glucose tolerance (NGT). Methods: We performed a cross-sectional study using data from 1229 elderly participants (60 years or older) in Guilin. Plasma DPP4 activity, oxidative stress parameters, fasting active GLP-1, and inflammatory markers were measured in all participants. Impaired cognitive function was diagnosed according to the National Institute on Aging-Alzheimer's Association workgroups criteria. Results: Participants in the upper quartile of plasma DPP4 activity had higher C-reactive protein (CRP), interleukin-6 (IL-6), 8-iso-PGF2a, nitrotyrosine, and lower GLP-1 and Montreal Cognitive Assessment (MoCA) scores compared with those in the lowest quartile ( P population with NGT. The underlying mechanisms for this association may be partly attributed to the effect of DPP4 on oxidative stress. Plasma DPP4 activity might serve as a risk biomarker or therapeutic target for the prevention and treatment of impaired cognitive function.

  6. Strong associations between national prevalence of various STIs suggests sexual network connectivity is a common underpinning risk factor.

    Science.gov (United States)

    Kenyon, Chris

    2017-10-12

    If national peak Human Immunodeficiency Virus (HIV) prevalence is positively associated with the prevalence of other sexually transmitted infections (STIs) from before or early on in the HIV epidemics this would suggest common underlying drivers. Pearson's correlations were calculated between the prevalence of seven STIs at a country-level: chlamydia, gonorrhoea, trichomoniasis, syphilis, bacterial vaginosis, herpes simplex virus-2 (HSV-2) and HIV. The prevalence of all the STIs was highest in the sub-Saharan African region excluding chlamydia. The prevalence of all seven STIs were positively correlated excluding chlamydia. The correlations were strongest for HIV-HSV-2 (r = 0.85, P < 0.0001) and HSV-2-trichomoniasis (r = 0.82, P < 0.0001). Our results of a generally positive association between the prevalences of a range of STIs suggests that higher prevalences were driven by common underlying determinants. We review different types of evidence which suggest that differential sexual connectivity is a plausible common determinant.

  7. Obesity is more strongly associated with inappropriate eating behaviors than with mental health in older adults receiving congregate meals.

    Science.gov (United States)

    Porter, Kathryn N; Johnson, Mary Ann

    2011-01-01

    This study explored the relationships of inappropriate eating behaviors and mental health with obesity in congregate meal participants in Georgia (N = 120, mean age = 75 years, 75% female, 43% African American). Inappropriate eating behaviors were evaluated with the Three-Factor Eating Questionnaire (18 questions); mental health was assessed with the Depression Anxiety Stress Scale (21 questions); history of depression was assessed with the Behavioral Risk Factor Surveillance Survey; and height and weight were measured to calculate body mass index (BMI) and obesity (52% ≥ 30 kg/m(2)). In bivariate analyses, obesity was associated with cognitive restraint (rho = 0.49, p eating (rho = 0.22; p emotional eating (rho = 0.32, p eating behavior and mental health indices, only cognitive restraint and emotional eating were consistently associated with obesity (p eating behaviors, particularly cognitive restraint and emotional eating, may be important targets for future research and intervention. Additional research is needed to better understand how cognitive restraint and emotional eating contribute to obesity in this population so that interdisciplinary research and health care teams can appropriately prevent and manage obesity in congregate meal participants.

  8. Strongly Agree or Strongly Disagree?

    DEFF Research Database (Denmark)

    Carrizosa, Emilio; Nogales-Gómez, Amaya; Morales, Dolores Romero

    2016-01-01

    In linear classifiers, such as the Support Vector Machine (SVM), a score is associated with each feature and objects are assigned to classes based on the linear combination of the scores and the values of the features. Inspired by discrete psychometric scales, which measure the extent to which...... a factor is in agreement with a statement, we propose the Discrete Level Support Vector Machine (DILSVM) where the feature scores can only take on a discrete number of values, defined by the so-called feature rating levels. The DILSVM classifier benefits from interpretability and it has visual appeal...

  9. A common SLC26A4-linked haplotype underlying non-syndromic hearing loss with enlargement of the vestibular aqueduct

    DEFF Research Database (Denmark)

    Chattaraj, Parna; Munjal, Tina; Honda, Keiji

    2017-01-01

    BACKGROUND: Enlargement of the vestibular aqueduct (EVA) is the most common radiological abnormality in children with sensorineural hearing loss. Mutations in coding regions and splice sites of the SLC26A4 gene are often detected in Caucasians with EVA. Approximately one-fourth of patients with EVA.......0042). CONCLUSIONS: The CEVA haplotype causally contributes to most cases of Caucasian M1 EVA and, possibly, some cases of M0 EVA. The CEVA haplotype of SLC26A4 defines the most common allele associated with hereditary hearing loss in Caucasians. The diagnostic yield and prognostic utility of sequence analysis...

  10. Strong Association between Plasma Dipeptidyl Peptidase-4 Activity and Impaired Cognitive Function in Elderly Population with Normal Glucose Tolerance

    Directory of Open Access Journals (Sweden)

    Bo Chen

    2017-07-01

    Full Text Available Objective: Inflammation, oxidative stress, and decreased glucagon-like peptide-1 (GLP-1 are risk factors for cognitive impairment. Dipeptidyl peptidase-4 (DPP4 was identified as a novel adipokine capable of enhancing these risk factors. Hence, we investigated the relationship between plasma DPP4 activity and impaired cognitive function in elderly Chinese population with normal glucose tolerance (NGT.Methods: We performed a cross-sectional study using data from 1229 elderly participants (60 years or older in Guilin. Plasma DPP4 activity, oxidative stress parameters, fasting active GLP-1, and inflammatory markers were measured in all participants. Impaired cognitive function was diagnosed according to the National Institute on Aging-Alzheimer’s Association workgroups criteria.Results: Participants in the upper quartile of plasma DPP4 activity had higher C-reactive protein (CRP, interleukin-6 (IL-6, 8-iso-PGF2a, nitrotyrosine, and lower GLP-1 and Montreal Cognitive Assessment (MoCA scores compared with those in the lowest quartile (P < 0.001. The odds ratios (ORs for increased CRP, IL-6, 8-iso-PGF2a, nitrotyrosine, and decreased active GLP-1 were higher with increasing DPP4 quartiles after adjustment for confounders (all P < 0.001. In the highest DPP4 quartile, impaired cognitive function risk was higher (OR, 2.26; 95% confidence interval, 1.36–3.76 than in the lowest quartile after adjustment for potential confounders. The risk for impaired cognitive function increased more with higher levels of DPP4 activity, nitrotyrosine and 8-iso-PGF2a (P < 0.05, but not with higher IL-6, CRP or lower GLP-1.Conclusion: Plasma DPP4 activity is significantly and independently associated with impaired cognitive function, mainly executive, in elderly Chinese population with NGT. The underlying mechanisms for this association may be partly attributed to the effect of DPP4 on oxidative stress. Plasma DPP4 activity might serve as a risk biomarker or therapeutic

  11. Antimicrobial drug use in food-producing animals and associated human health risks: what, and how strong, is the evidence?

    Science.gov (United States)

    Hoelzer, Karin; Wong, Nora; Thomas, Joe; Talkington, Kathy; Jungman, Elizabeth; Coukell, Allan

    2017-07-04

    Antimicrobial resistance is a public health threat. Because antimicrobial consumption in food-producing animals contributes to the problem, policies restricting the inappropriate or unnecessary agricultural use of antimicrobial drugs are important. However, this link between agricultural antibiotic use and antibiotic resistance has remained contested by some, with potentially disruptive effects on efforts to move towards the judicious or prudent use of these drugs. The goal of this review is to systematically evaluate the types of evidence available for each step in the causal pathway from antimicrobial use on farms to human public health risk, and to evaluate the strength of evidence within a 'Grades of Recommendations Assessment, Development and Evaluation'(GRADE) framework. The review clearly demonstrates that there is compelling scientific evidence available to support each step in the causal pathway, from antimicrobial use on farms to a public health burden caused by infections with resistant pathogens. Importantly, the pathogen, antimicrobial drug and treatment regimen, and general setting (e.g., feed type) can have significant impacts on how quickly resistance emerges or spreads, for how long resistance may persist after antimicrobial exposures cease, and what public health impacts may be associated with antimicrobial use on farms. Therefore an exact quantification of the public health burden attributable to antimicrobial drug use in animal agriculture compared to other sources remains challenging. Even though more research is needed to close existing data gaps, obtain a better understanding of how antimicrobial drugs are actually used on farms or feedlots, and quantify the risk associated with antimicrobial use in animal agriculture, these findings reinforce the need to act now and restrict antibiotic use in animal agriculture to those instances necessary to ensure the health and well-being of the animals.

  12. Strong positive associations between seafood, vegetables, and alcohol with blood mercury and urinary arsenic levels in the Korean adult population.

    Science.gov (United States)

    Park, Sunmin; Lee, Byung-Kook

    2013-01-01

    Blood mercury and urinary arsenic levels are more than fivefold greater in the Korean population compared with those of the United States. This may be related to the foods people consumed. Therefore, we examined the associations between food categories and mercury and arsenic exposure in the Korean adult population. Data regarding nutritional, biochemical, and health-related parameters were obtained from a cross-sectional study, the 2008-2009 Korean National Health and Nutrition Examination Survey (3,404 men and women age ≥ 20 years). The log-transformed blood mercury and urinary arsenic levels were regressed against the frequency tertiles of each food group after covariate adjustment for sex, age, residence area, education level, smoking status, and drinking status using food-frequency data. Blood mercury levels in the high consumption groups compared to the low consumption groups were elevated by about 20 percents with salted fish, shellfish, whitefish, bluefish, and alcohol, and by about 9-14 percents with seaweeds, green vegetables, fruits and tea, whereas rice did not affect blood mercury levels. Urinary arsenic levels were markedly increased with consumption of rice, bluefish, salted fish, shellfish, whitefish, and seaweed, whereas they were moderately increased with consumption of grains, green and white vegetables, fruits, coffee, and alcohol. The remaining food categories tended to lower these levels only minimally. In conclusion, the typical Asian diet, which is high in rice, salted fish, shellfish, vegetables, alcoholic beverages, and tea, may be associated with greater blood mercury and urinary arsenic levels. This study suggests that mercury and arsenic contents should be monitored and controlled in soil and water used for agriculture to decrease health risks from heavy-metal contamination.

  13. Application of the Linux cluster for exhaustive window haplotype analysis using the FBAT and Unphased programs.

    Science.gov (United States)

    Mishima, Hiroyuki; Lidral, Andrew C; Ni, Jun

    2008-05-28

    Genetic association studies have been used to map disease-causing genes. A newly introduced statistical method, called exhaustive haplotype association study, analyzes genetic information consisting of different numbers and combinations of DNA sequence variations along a chromosome. Such studies involve a large number of statistical calculations and subsequently high computing power. It is possible to develop parallel algorithms and codes to perform the calculations on a high performance computing (HPC) system. However, most existing commonly-used statistic packages for genetic studies are non-parallel versions. Alternatively, one may use the cutting-edge technology of grid computing and its packages to conduct non-parallel genetic statistical packages on a centralized HPC system or distributed computing systems. In this paper, we report the utilization of a queuing scheduler built on the Grid Engine and run on a Rocks Linux cluster for our genetic statistical studies. Analysis of both consecutive and combinational window haplotypes was conducted by the FBAT (Laird et al., 2000) and Unphased (Dudbridge, 2003) programs. The dataset consisted of 26 loci from 277 extended families (1484 persons). Using the Rocks Linux cluster with 22 compute-nodes, FBAT jobs performed about 14.4-15.9 times faster, while Unphased jobs performed 1.1-18.6 times faster compared to the accumulated computation duration. Execution of exhaustive haplotype analysis using non-parallel software packages on a Linux-based system is an effective and efficient approach in terms of cost and performance.

  14. Shrinkage Estimators for Robust and Efficient Inference in Haplotype-Based Case-Control Studies

    KAUST Repository

    Chen, Yi-Hau

    2009-03-01

    Case-control association studies often aim to investigate the role of genes and gene-environment interactions in terms of the underlying haplotypes (i.e., the combinations of alleles at multiple genetic loci along chromosomal regions). The goal of this article is to develop robust but efficient approaches to the estimation of disease odds-ratio parameters associated with haplotypes and haplotype-environment interactions. We consider "shrinkage" estimation techniques that can adaptively relax the model assumptions of Hardy-Weinberg-Equilibrium and gene-environment independence required by recently proposed efficient "retrospective" methods. Our proposal involves first development of a novel retrospective approach to the analysis of case-control data, one that is robust to the nature of the gene-environment distribution in the underlying population. Next, it involves shrinkage of the robust retrospective estimator toward a more precise, but model-dependent, retrospective estimator using novel empirical Bayes and penalized regression techniques. Methods for variance estimation are proposed based on asymptotic theories. Simulations and two data examples illustrate both the robustness and efficiency of the proposed methods.

  15. Application of kernel principal component analysis and computational machine learning to exploration of metabolites strongly associated with diet.

    Science.gov (United States)

    Shiokawa, Yuka; Date, Yasuhiro; Kikuchi, Jun

    2018-02-21

    Computer-based technological innovation provides advancements in sophisticated and diverse analytical instruments, enabling massive amounts of data collection with relative ease. This is accompanied by a fast-growing demand for technological progress in data mining methods for analysis of big data derived from chemical and biological systems. From this perspective, use of a general "linear" multivariate analysis alone limits interpretations due to "non-linear" variations in metabolic data from living organisms. Here we describe a kernel principal component analysis (KPCA)-incorporated analytical approach for extracting useful information from metabolic profiling data. To overcome the limitation of important variable (metabolite) determinations, we incorporated a random forest conditional variable importance measure into our KPCA-based analytical approach to demonstrate the relative importance of metabolites. Using a market basket analysis, hippurate, the most important variable detected in the importance measure, was associated with high levels of some vitamins and minerals present in foods eaten the previous day, suggesting a relationship between increased hippurate and intake of a wide variety of vegetables and fruits. Therefore, the KPCA-incorporated analytical approach described herein enabled us to capture input-output responses, and should be useful not only for metabolic profiling but also for profiling in other areas of biological and environmental systems.

  16. Seismogenic ionospheric anomalies associated with the strong Indonesian earthquake occurred on 11 April 2012 (M = 8.5)

    Science.gov (United States)

    Pandey, Uma; Singh, Ashutosh K.; Kumar, Sanjay; Singh, A. K.

    2018-03-01

    Ionospheric perturbations in possible association with a major earthquake (EQ) (M = 8.5) which occurred in India-Oceania region are investigated by monitoring subionospheric propagation of VLF signals transmitted from the NWC transmitter (F = 19.8 kHz), Australia to a receiving station at Varanasi (geographic lat. 25.3°N, long 82.99°E), India. The EQ occurred on 11 April 2012 at 08:38:35 h UT (magnitude ≈ 8.5, depth = 10 km, and lat. = 2.3°N, long. = 93.0°E). A significant increase of few days before the EQ has been observed by using the VLF nighttime amplitude fluctuation method (fixed frequency transmitter signal). The analysis of total electron contents (TEC) derived from the global positioning system (GPS) at three different stations namely, Hyderabad (latitude 17.38°N, longitude 78.48°E), Singapore (latitude 1.37°N, longitude 103.84°E) and Port Blair (latitude 11.62°N, longitude 92.72°E) due to this EQ has also been presented. Significant perturbation in TEC data (enhancements and depletion) is noted before and after the main shock of the EQ. The possible mechanisms behind these perturbations due to EQ have also been discussed.

  17. hs-CRP is strongly associated with coronary heart disease (CHD): A data mining approach using decision tree algorithm.

    Science.gov (United States)

    Tayefi, Maryam; Tajfard, Mohammad; Saffar, Sara; Hanachi, Parichehr; Amirabadizadeh, Ali Reza; Esmaeily, Habibollah; Taghipour, Ali; Ferns, Gordon A; Moohebati, Mohsen; Ghayour-Mobarhan, Majid

    2017-04-01

    Coronary heart disease (CHD) is an important public health problem globally. Algorithms incorporating the assessment of clinical biomarkers together with several established traditional risk factors can help clinicians to predict CHD and support clinical decision making with respect to interventions. Decision tree (DT) is a data mining model for extracting hidden knowledge from large databases. We aimed to establish a predictive model for coronary heart disease using a decision tree algorithm. Here we used a dataset of 2346 individuals including 1159 healthy participants and 1187 participant who had undergone coronary angiography (405 participants with negative angiography and 782 participants with positive angiography). We entered 10 variables of a total 12 variables into the DT algorithm (including age, sex, FBG, TG, hs-CRP, TC, HDL, LDL, SBP and DBP). Our model could identify the associated risk factors of CHD with sensitivity, specificity, accuracy of 96%, 87%, 94% and respectively. Serum hs-CRP levels was at top of the tree in our model, following by FBG, gender and age. Our model appears to be an accurate, specific and sensitive model for identifying the presence of CHD, but will require validation in prospective studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Strong positive association of traditional Asian-style diets with blood cadmium and lead levels in the Korean adult population.

    Science.gov (United States)

    Park, Sunmin; Lee, Byung-Kook

    2013-12-01

    Blood lead and cadmium levels are more than twofold to fivefold higher in the Korean population compared to that of the USA. This may be related to the foods consumed. We examined which food categories are related to blood lead and cadmium levels in the Korean adult population using the 2008-2010 Korean National Health and Nutrition Examination Survey (n = 5504). High and moderate consumption of bread and crackers, potatoes, meat and meat products, milk and dairy products, and pizza and hamburger resulted in significantly lower odds ratios for blood lead levels than their low consumption. However, consumption of salted fish, white fish, green vegetables, white and yellow vegetables, coffee, and alcohol resulted in significantly higher odds ratios of blood lead and cadmium. In conclusion, the typical Asian diet based on rice, fish, vegetables, regular coffee, and alcoholic drinks may be associated with higher blood cadmium and lead levels. This study suggests that lead and cadmium contents should be monitored and controlled in agricultural products to reduce health risks from heavy metals.

  19. Different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease.

    Science.gov (United States)

    Alshiekh, S; Zhao, L P; Lernmark, Å; Geraghty, D E; Naluai, Å T; Agardh, D

    2017-08-01

    Celiac disease is associated with the HLA-DR3-DQA1*05:01-DQB1*02:01 and DR4-DQA1*03:01-DQB1*03:02 haplotypes. In addition, there are currently over 40 non-HLA loci associated with celiac disease. This study extends previous analyses on different HLA haplotypes in celiac disease using next generation targeted sequencing. Included were 143 patients with celiac disease and 135 non-celiac disease controls investigated at median 9.8 years (1.4-18.3 years). PCR-based amplification of HLA and sequencing with Illumina MiSeq technology were used for extended sequencing of the HLA class II haplotypes HLA-DRB1, DRB3, DRB4, DRB5, DQA1 and DQB1, respectively. Odds ratios were computed marginally for every allele and haplotype as the ratio of allelic frequency in patients and controls as ratio of exposure rates (RR), when comparing a null reference with equal exposure rates in cases and controls. Among the extended HLA haplotypes, the strongest risk haplotype for celiac disease was shown for DRB3*01:01:02 in linkage with DQA1*05:01-DQB1*02:01 (RR = 6.34; P-value celiac disease among non-Scandinavians (RR = 7.94; P = .011). The data also revealed 2 distinct celiac disease risk DR3-DQA1*05:01-DQB*02:01 haplotypes distinguished by either the DRB3*01:01:02 or DRB3*02:02:01 alleles, indicating that different DRB1*03:01-DQB1*02:01 haplotypes confer different risk for celiac disease. The associated risk of celiac disease for DR3-DRB3*01:01:02-DQA1*05:01-DQB1*02:01 is predominant among patients of Scandinavian ethnicity. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. CRF19_cpx is an Evolutionary fit HIV-1 Variant Strongly Associated With Rapid Progression to AIDS in Cuba.

    Science.gov (United States)

    Kouri, Vivian; Khouri, Ricardo; Alemán, Yoan; Abrahantes, Yeissel; Vercauteren, Jurgen; Pineda-Peña, Andrea-Clemencia; Theys, Kristof; Megens, Sarah; Moutschen, Michel; Pfeifer, Nico; Van Weyenbergh, Johan; Pérez, Ana B; Pérez, Jorge; Pérez, Lissette; Van Laethem, Kristel; Vandamme, Anne-Mieke

    2015-03-01

    Clinicians reported an increasing trend of rapid progression (RP) (AIDS within 3 years of infection) in Cuba. Recently infected patients were prospectively sampled, 52 RP at AIDS diagnosis (AIDS-RP) and 21 without AIDS in the same time frame (non-AIDS). 22 patients were sampled at AIDS diagnosis (chronic-AIDS) retrospectively assessed as > 3 years infected. Clinical, demographic, virological, epidemiological and immunological data were collected. Pol and env sequences were used for subtyping, transmission cluster analysis, and prediction of resistance, co-receptor use and evolutionary fitness. Host, immunological and viral predictors of RP were explored through data mining. Subtyping revealed 26 subtype B strains, 6 C, 6 CRF18_cpx, 9 CRF19_cpx, 29 BG-recombinants and other subtypes/URFs. All patients infected with CRF19 belonged to the AIDS-RP group. Data mining identified CRF19, oral candidiasis and RANTES levels as the strongest predictors of AIDS-RP. CRF19 was more frequently predicted to use the CXCR4 co-receptor, had higher fitness scores in the protease region, and patients had higher viral load at diagnosis. CRF19 is a recombinant of subtype D (C-part of Gag, PR, RT and nef), subtype A (N-part of Gag, Integrase, Env) and subtype G (Vif, Vpr, Vpu and C-part of Env). Since subtypes D and A have been associated with respectively faster and slower disease progression, our findings might indicate a fit PR driving high viral load, which in combination with co-infections may boost RANTES levels and thus CXCR4 use, potentially explaining the fast progression. We propose that CRF19 is evolutionary very fit and causing rapid progression to AIDS in many newly infected patients in Cuba.

  1. Dysfunctions of mitochondria in close association with strong perturbation of long noncoding RNAs expression in down syndrome.

    Science.gov (United States)

    Qiu, Jia-Jun; Liu, Yan-Na; Ren, Zhao-Rui; Yan, Jing-Bin

    2017-11-01

    Trisomy 21 is the most common chromosomal disorder and underlies Down syndrome. Epigenetics, such as DNA methylation and post-translational histone modifications, plays a vital role in Down syndrome. However, the functions of epigenetics-related long noncoding RNAs (lncRNAs), found to have an impact on neural diseases such as Alzheimer's disease, remain unknown in Down syndrome. In this study, we analyzed the RNA sequencing data from Down syndrome-induced pluripotent stem cells (iPSCs) and normal iPSCs. A large number of lncRNAs were identified differentially expressed in Down syndrome-iPSCs. Notably, stronger perturbation was shown in the expression of lncRNAs compared to protein coding genes (Kolmogorov-Smirnov test, PDown syndrome. Through gene set enrichment analysis and bi-clustering, we also found that most of the differential expressed lncRNAs were closely associated with mitochondrial functions (e.g. mitochondrion organization, P=3.21×10 -17 ; mitochondrial ATP synthesis coupled electron transport, P=1.73×10 -19 and mitochondrial membrane organization, P=4.04×10 -8 ). PCR-array and qRT-PCR results revealed that almost all genes related to mitochondria were down-regulated in Down syndrome-iPSCs, implying that mitochondria were dysfunctional in Down syndrome (e.g. ATP5B, Fold Change=-8.2317; COX6A1, Fold Change=-12.7788 and SLC25A17, Fold Change=-22.1296). All in all, our study indicated that a stronger perturbation of lncRNAs expression may lead to the dysfunction of mitochondria in Down syndrome. Copyright © 2017. Published by Elsevier Ltd.

  2. "HOOF-Print" Genotyping and Haplotype Inference Discriminates among Brucella spp Isolates From a Small Spatial Scale

    Science.gov (United States)

    We demonstrate that the “HOOF-Print” assay provides high power to discriminate among Brucella isolates collected on a small spatial scale (within Portugal). Additionally, we illustrate how haplotype identification using non-random association among markers allows resolution of B. melitensis biovars ...

  3. High-resolution haplotype block structure in the cattle genome

    Directory of Open Access Journals (Sweden)

    Choi Jungwoo

    2009-04-01

    Full Text Available Abstract Background The Bovine HapMap Consortium has generated assay panels to genotype ~30,000 single nucleotide polymorphisms (SNPs from 501 animals sampled from 19 worldwide taurine and indicine breeds, plus two outgroup species (Anoa and Water Buffalo. Within the larger set of SNPs we targeted 101 high density regions spanning up to 7.6 Mb with an average density of approximately one SNP per 4 kb, and characterized the linkage disequilibrium (LD and haplotype block structure within individual breeds and groups of breeds in relation to their geographic origin and use. Results From the 101 targeted high-density regions on bovine chromosomes 6, 14, and 25, between 57 and 95% of the SNPs were informative in the individual breeds. The regions of high LD extend up to ~100 kb and the size of haplotype blocks ranges between 30 bases and 75 kb (10.3 kb average. On the scale from 1–100 kb the extent of LD and haplotype block structure in cattle has high similarity to humans. The estimation of effective population sizes over the previous 10,000 generations conforms to two main events in cattle history: the initiation of cattle domestication (~12,000 years ago, and the intensification of population isolation and current population bottleneck that breeds have experienced worldwide within the last ~700 years. Haplotype block density correlation, block boundary discordances, and haplotype sharing analyses were consistent in revealing unexpected similarities between some beef and dairy breeds, making them non-differentiable. Clustering techniques permitted grouping of breeds into different clades given their similarities and dissimilarities in genetic structure. Conclusion This work presents the first high-resolution analysis of haplotype block structure in worldwide cattle samples. Several novel results were obtained. First, cattle and human share a high similarity in LD and haplotype block structure on the scale of 1–100 kb. Second, unexpected

  4. More powerful haplotype sharing by accounting for the mode of inheritance.

    Science.gov (United States)

    Ziegler, Andreas; Ewhida, Adel; Brendel, Michael; Kleensang, André

    2009-04-01

    The concept of haplotype sharing (HS) has received considerable attention recently, and several haplotype association methods have been proposed. Here, we extend the work of Beckmann and colleagues [2005 Hum. Hered. 59:67-78] who derived an HS statistic (BHS) as special case of Mantel's space-time clustering approach. The Mantel-type HS statistic correlates genetic similarity with phenotypic similarity across pairs of individuals. While phenotypic similarity is measured as the mean-corrected cross product of phenotypes, we propose to incorporate information of the underlying genetic model in the measurement of the genetic similarity. Specifically, for the recessive and dominant modes of inheritance we suggest the use of the minimum and maximum of shared length of haplotypes around a marker locus for pairs of individuals. If the underlying genetic model is unknown, we propose a model-free HS Mantel statistic using the max-test approach. We compare our novel HS statistics to BHS using simulated case-control data and illustrate its use by re-analyzing data from a candidate region of chromosome 18q from the Rheumatoid Arthritis (RA) Consortium. We demonstrate that our approach is point-wise valid and superior to BHS. In the re-analysis of the RA data, we identified three regions with point-wise P-values<0.005 containing six known genes (PMIP1, MC4R, PIGN, KIAA1468, TNFRSF11A and ZCCHC2) which might be worth follow-up.

  5. A general approach for haplotype phasing across the full spectrum of relatedness.

    Directory of Open Access Journals (Sweden)

    Jared O'Connell

    2014-04-01

    Full Text Available Many existing cohorts contain a range of relatedness between genotyped individuals, either by design or by chance. Haplotype estimation in such cohorts is a central step in many downstream analyses. Using genotypes from six cohorts from isolated populations and two cohorts from non-isolated populations, we have investigated the performance of different phasing methods designed for nominally 'unrelated' individuals. We find that SHAPEIT2 produces much lower switch error rates in all cohorts compared to other methods, including those designed specifically for isolated populations. In particular, when large amounts of IBD sharing is present, SHAPEIT2 infers close to perfect haplotypes. Based on these results we have developed a general strategy for phasing cohorts with any level of implicit or explicit relatedness between individuals. First SHAPEIT2 is run ignoring all explicit family information. We then apply a novel HMM method (duoHMM to combine the SHAPEIT2 haplotypes with any family information to infer the inheritance pattern of each meiosis at all sites across each chromosome. This allows the correction of switch errors, detection of recombination events and genotyping errors. We show that the method detects numbers of recombination events that align very well with expectations based on genetic maps, and that it infers far fewer spurious recombination events than Merlin. The method can also detect genotyping errors and infer recombination events in otherwise uninformative families, such as trios and duos. The detected recombination events can be used in association scans for recombination phenotypes. The method provides a simple and unified approach to haplotype estimation, that will be of interest to researchers in the fields of human, animal and plant genetics.

  6. Cystic fibrosis transmembrane regulator haplotypes in households of patients with cystic fibrosis.

    Science.gov (United States)

    Furgeri, Daniela Tenório; Marson, Fernando Augusto Lima; Correia, Cyntia Arivabeni Araújo; Ribeiro, José Dirceu; Bertuzzo, Carmen Sílvia

    2018-01-30

    Nearly 2000 mutations in the cystic fibrosis transmembrane regulator (CFTR) gene have been reported. The F508del mutation occurs in approximately 50-65% of patients with cystic fibrosis (CF). However, molecular diagnosis is not always possible. Therefore, silent polymorphisms can be used to label the mutant allele in households of patients with CF. To verify the haplotypes of four polymorphisms at the CFTR locus in households of patients with CF for pre-fertilization, pre-implantation, and prenatal indirect mutation diagnosis to provide better genetic counseling for families and patients with CF and to associate the genotypes/haplotypes with the F508del mutation screening. GATT polymorphism analysis was performed using direct polymerase chain reaction amplification, and the MP6-D9, TUB09 and TUB18 polymorphism analyses were performed using restriction fragment length polymorphism. Nine haplotypes were found in 37 CFTR alleles, and of those, 24 were linked with the F508del mutation and 13 with other CFTR mutations. The 6 (GATT), C (MP6-D9), G (TUB09), and C (TUB18) haplotypes showed the highest prevalence (48%) of the mutant CFTR allele and were linked to the F508del mutation (64%). In 43% of households analyzed, at least one informative polymorphism can be used for the indirect diagnostic test. CFTR polymorphisms are genetic markers that are useful for identifying the mutant CFTR alleles in households of patients with CF when it is not possible to establish the complete CFTR genotype. Moreover, the polymorphisms can be used for indirect CFTR mutation identification in cases of pre-fertilization, pre-implantation and prenatal analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Multiple microRNA regulation of lipoprotein lipase gene abolished by 3'UTR polymorphisms in a triglyceride-lowering haplotype harboring p.Ser474Ter.

    Science.gov (United States)

    Caussy, Cyrielle; Charrière, Sybil; Meirhaeghe, Aline; Dallongeville, Jean; Lefai, Etienne; Rome, Sophie; Cuerq, Charlotte; Euthine, Vanessa; Delay, Mireille; Marmontel, Oriane; Di Filippo, Mathilde; Lagarde, Michel; Moulin, Philippe; Marçais, Christophe

    2016-03-01

    Lipoprotein lipase (LPL) is a key enzyme in triglyceride (TG) metabolism. LPL gene single nucleotide polymorphisms (SNPs) are associated with TG concentrations however the functionality of many of these SNPs remains poorly understood. MicroRNAs (miR) exert post-transcriptional down-regulation and their target sequence on the 3'UTR may be altered by SNPs. We therefore investigated whether LPL 3'UTR SNPs could modulate plasma TG concentration through the alteration of miR binding-sites. We performed genetic association studies of LPL 3'UTR SNPs with TG concentrations in 271 type 2 diabetic patients and in general population samples (2997 individuals). A specific LPL haplotype (Hap4) was associated with lower plasma TG concentration (TG-0.18, IC95% [-0.30, -0.07] mmol/L or logTG-0.13, IC95% [-0.18, -0.08], p = 4.77·10(-8)) in the meta-analysis. Hap4 comprises seven 3'UTR SNP minor alleles and p.Ser474Ter (rs328) a well-documented nonsense mutation associated with low TG concentration although by an unknown mechanism so far. Bio-informatic studies identified several putative miRNA binding-sites on the wild-type Hap1 haplotype, lost on Hap4. Functional validation performed in HEK-293T cells using luciferase expression constructs with various LPL 3'UTR allele combinations demonstrated a binding of miR-29, miR-1277 and miR-410 on Hap1, lost on Hap4. This loss of specific miR binding-site in presence of Hap4 was independent of the allelic variation of p.Ser474Ter (rs328). We report the regulation of LPL by the miR-29, miR-1277 and miR-410 that is lost in presence of Hap4, a specific LPL TG-lowering haplotype. Consequently p.Ser474Ter association with TG concentration could be at least partially explained by its strong linkage disequilibrium with these functional 3'UTR SNPs. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Growth anomalies on the coral genera Acropora and Porites are strongly associated with host density and human population size across the Indo-Pacific.

    Directory of Open Access Journals (Sweden)

    Greta S Aeby

    Full Text Available Growth anomalies (GAs are common, tumor-like diseases that can cause significant morbidity and decreased fecundity in the major Indo-Pacific reef-building coral genera, Acropora and Porites. GAs are unusually tractable for testing hypotheses about drivers of coral disease because of their pan-Pacific distributions, relatively high occurrence, and unambiguous ease of identification. We modeled multiple disease-environment associations that may underlie the prevalence of Acropora growth anomalies (AGA (n = 304 surveys and Porites growth anomalies (PGA (n = 602 surveys from across the Indo-Pacific. Nine predictor variables were modeled, including coral host abundance, human population size, and sea surface temperature and ultra-violet radiation anomalies. Prevalence of both AGAs and PGAs were strongly host density-dependent. PGAs additionally showed strong positive associations with human population size. Although this association has been widely posited, this is one of the first broad-scale studies unambiguously linking a coral disease with human population size. These results emphasize that individual coral diseases can show relatively distinct patterns of association with environmental predictors, even in similar diseases (growth anomalies found on different host genera (Acropora vs. Porites. As human densities and environmental degradation increase globally, the prevalence of coral diseases like PGAs could increase accordingly, halted only perhaps by declines in host density below thresholds required for disease establishment.

  9. Growth anomalies on the coral genera Acropora and Porites are strongly associated with host density and human population size across the Indo-Pacific.

    Science.gov (United States)

    Aeby, Greta S; Williams, Gareth J; Franklin, Erik C; Haapkyla, Jessica; Harvell, C Drew; Neale, Stephen; Page, Cathie A; Raymundo, Laurie; Vargas-Ángel, Bernardo; Willis, Bette L; Work, Thierry M; Davy, Simon K

    2011-02-18

    Growth anomalies (GAs) are common, tumor-like diseases that can cause significant morbidity and decreased fecundity in the major Indo-Pacific reef-building coral genera, Acropora and Porites. GAs are unusually tractable for testing hypotheses about drivers of coral disease because of their pan-Pacific distributions, relatively high occurrence, and unambiguous ease of identification. We modeled multiple disease-environment associations that may underlie the prevalence of Acropora growth anomalies (AGA) (n = 304 surveys) and Porites growth anomalies (PGA) (n = 602 surveys) from across the Indo-Pacific. Nine predictor variables were modeled, including coral host abundance, human population size, and sea surface temperature and ultra-violet radiation anomalies. Prevalence of both AGAs and PGAs were strongly host density-dependent. PGAs additionally showed strong positive associations with human population size. Although this association has been widely posited, this is one of the first broad-scale studies unambiguously linking a coral disease with human population size. These results emphasize that individual coral diseases can show relatively distinct patterns of association with environmental predictors, even in similar diseases (growth anomalies) found on different host genera (Acropora vs. Porites). As human densities and environmental degradation increase globally, the prevalence of coral diseases like PGAs could increase accordingly, halted only perhaps by declines in host density below thresholds required for disease establishment.

  10. High resolution MRI of the breast at 3 T: which BI-RADS {sup registered} descriptors are most strongly associated with the diagnosis of breast cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Pinker-Domenig, K.; Helbich, T.H. [Medical University Vienna, Dept. of Radiology, Division of Molecular and Gender Imaging, Vienna (Austria); Bogner, W.; Gruber, S. [Medical University Vienna, Dept. of Radiology, MR Centre of Excellence, Vienna (Austria); Medical University Vienna, Dept. of Radiology, Vienna (Austria); Bickel, H. [Medical University Vienna, Dept. of Radiology, Division of Molecular and Gender Imaging, Vienna (Austria); Medical University Vienna, Dept. of Radiology, Vienna (Austria); Duffy, S. [Queen Mary University of London, Cancer Research UK Centre for Epidemiology, Mathematics and Statistics, Wolfson Institute of Preventive Medicine, Barts and The London School of Medicine and Dentistry, London (United Kingdom); Schernthaner, M. [Medical University Vienna, Dept. of Radiology, Vienna (Austria); Dubsky, P. [Medical University Vienna, Dept. of Surgery, Vienna (Austria); Pluschnig, U. [Medical University Vienna, Dept. of Internal Medicine, Division of Oncology, Vienna (Austria); Rudas, M. [Medical University Vienna, Clinical Institute of Pathology, Vienna (Austria); Trattnig, S. [Medical University Vienna, Dept. of Radiology, MR Centre of Excellence, Vienna (Austria)

    2012-02-15

    To identify which breast lesion descriptors in the ACR BI-RADS registered MRI lexicon are most strongly associated with the diagnosis of breast cancer when performing breast MR imaging at 3 T. 150 patients underwent breast MR imaging at 3 T. Lesion size, morphology and enhancement kinetics were assessed according to the BI-RADS {sup registered} classification. Sensitivity, specificity and diagnostic accuracy were assessed. The effects of the BI-RADS {sup registered} descriptors on sensitivity and specificity were evaluated. Data were analysed using logistic regression. Histopathological diagnoses were used as the standard of reference. The sensitivity, specificity and diagnostic accuracy of breast MRI at 3 T was 99%, 81% and 93%, respectively. In univariate analysis, the final diagnosis of malignancy was positively associated with irregular shape (p < 0.001), irregular margin (p < 0.001), heterogeneous enhancement (p < 0.001), Type 3 enhancement kinetics (p = 0.02), increasing patient age (p = 0.02) and larger lesion size (p < 0.001). In multivariate analysis, significant associations with malignancy remained for mass shape (p = 0.06), mass margin (p < 0.001), internal enhancement pattern (p = 0.03) and Type 3 enhancement kinetics (p = 0.06). The ACR BI-RADS {sup registered} breast lesion descriptors that are mostly strongly associated with breast cancer in breast MR imaging at 3 T are lesion shape, lesion margin, internal enhancement pattern and Type 3 enhancement kinetics. (orig.)

  11. Haplotyping a single triploid individual based on genetic algorithm.

    Science.gov (United States)

    Wu, Jingli; Chen, Xixi; Li, Xianchen

    2014-01-01

    The minimum error correction model is an important combinatorial model for haplotyping a single individual. In this article, triploid individual haplotype reconstruction problem is studied by using the model. A genetic algorithm based method GTIHR is presented for reconstructing the triploid individual haplotype. A novel coding method and an effectual hill-climbing operator are introduced for the GTIHR algorithm. This relatively short chromosome code can lead to a smaller solution space, which plays a positive role in speeding up the convergence process. The hill-climbing operator ensures algorithm GTIHR converge at a good solution quickly, and prevents premature convergence simultaneously. The experimental results prove that algorithm GTIHR can be implemented efficiently, and can get higher reconstruction rate than previous algorithms.

  12. Grouping preprocess for haplotype inference from SNP and CNV data

    International Nuclear Information System (INIS)

    Shindo, Hiroyuki; Chigira, Hiroshi; Nagaoka, Tomoyo; Inoue, Masato; Kamatani, Naoyuki

    2009-01-01

    The method of statistical haplotype inference is an indispensable technique in the field of medical science. The authors previously reported Hardy-Weinberg equilibrium-based haplotype inference that could manage single nucleotide polymorphism (SNP) data. We recently extended the method to cover copy number variation (CNV) data. Haplotype inference from mixed data is important because SNPs and CNVs are occasionally in linkage disequilibrium. The idea underlying the proposed method is simple, but the algorithm for it needs to be quite elaborate to reduce the calculation cost. Consequently, we have focused on the details on the algorithm in this study. Although the main advantage of the method is accuracy, in that it does not use any approximation, its main disadvantage is still the calculation cost, which is sometimes intractable for large data sets with missing values.

  13. ABCB1 haplotype and OPRM1 118A > G genotype interaction in methadone maintenance treatment pharmacogenetics

    Directory of Open Access Journals (Sweden)

    Barratt DT

    2012-04-01

    deviation 35 ± 5 versus 180 ± 65 mg/day, P < 0.01 and Ctrough (78 ± 22 versus 177 ± 97 ng/mL, P < 0.05 than ABCB1 wild-type subjects. Among subjects with the most common ABCB1 haplotype combination (wild-type with 61A:1199G:1236T:2677T:3435T, the OPRM1 118 A/G genotype was associated with a significantly higher Ctrough than 118 A/A (250 ± 126 versus 108 ± 36 ng/mL, P = 0.016. No ABCB1 haplotype group or OPRM1 genotype was associated with dose or Ctrough without taking into account confounding genetic variability at the other locus. Therefore, two interacting pharmacogenetic determinants of methadone maintenance treatment response were identified, ie, ABCB1, where variants are associated with lower methadone requirements, and OPRM1, where the variant is associated with higher methadone requirements.Conclusion: These opposing pharmacogenetic effects therefore need to be considered in combination when assessing methadone maintenance treatment pharmacogenetics.Keywords: methadone, opiate substitution treatment, ABCB1, P-glycoprotein, OPRM1, receptors, opioid, mu

  14. Association of specific haplotype of TNFα with Helicobacter pylori ...

    Indian Academy of Sciences (India)

    *For correspondence. E-mail: susanta@iicb.res.in; susanta rc@yahoo.co. in. the gastric mucosa. Polymorphisms in IL-1B, IL6, IL8 and. TNF-α have been reported to influence cytokine expression, thereby influencing inflammatory processes in response to infectious diseases (Graham 1997; Jordanides et al. 2000; El-.

  15. Association of specific haplotype of TNFα with Helicobacter pylori ...

    Indian Academy of Sciences (India)

    The controls (H. pylori in- fected without duodenal ulcer, H. pylori uninfected without duodenal ulcer) were normal healthy individuals who agreed to participate in this study. The diagnosis of duodenal ul- cer was established on the basis of conventional, clinical and endoscopic findings. No subjects had received treat-.

  16. Molecular characterization of a long range haplotype affecting protein yield and mastitis susceptibility in Norwegian Red cattle

    Directory of Open Access Journals (Sweden)

    Hayes Ben J

    2011-08-01

    Full Text Available Abstract Background Previous fine mapping studies in Norwegian Red cattle (NRC in the region 86-90.4 Mb on Bos taurus chromosome 6 (BTA6 has revealed a quantitative trait locus (QTL for protein yield (PY around 88 Mb and a QTL for clinical mastitis (CM around 90 Mb. The close proximity of these QTLs may partly explain the unfavorable genetic correlation between these two traits in NRC. A long range haplotype covering this region was introduced into the NRC population through the importation of a Holstein-Friesian bull (1606 Frasse from Sweden in the 1970s. It has been suggested that this haplotype has a favorable effect on milk protein content but an unfavorable effect on mastitis susceptibility. Selective breeding for milk production traits is likely to have increased the frequency of this haplotype in the NRC population. Results Association mapping for PY and CM in NRC was performed using genotypes from 556 SNPs throughout the region 86-97 Mb on BTA6 and daughter-yield-deviations (DYDs from 2601 bulls made available from the Norwegian dairy herd recording system. Highest test scores for PY were found for single-nucleotide polymorphisms (SNPs within and surrounding the genes CSN2 and CSN1S2, coding for the β-casein and αS2-casein proteins. High coverage re-sequencing by high throughput sequencing technology enabled molecular characterization of a long range haplotype from 1606 Frasse encompassing these two genes. Haplotype analysis of a large number of descendants from this bull indicated that the haplotype was not markedly disrupted by recombination in this region. The haplotype was associated with both increased milk protein content and increased susceptibility to mastitis, which might explain parts of the observed genetic correlation between PY and CM in NRC. Plausible causal polymorphisms affecting PY were detected in the promoter region and in the 5'-flanking UTR of CSN1S2. These polymorphisms could affect transcription or translation of

  17. Human leukocyte antigen class II (DRB1 and DQB1) alleles and haplotypes frequencies in patients with pemphigus vulgaris among the Serbian population.

    Science.gov (United States)

    Zivanovic, D; Bojic, S; Medenica, L; Andric, Z; Popadic, D

    2016-05-01

    The etiology of pemphigus vulgaris (PV) is multifactorial and includes genetic, environmental, hormonal, and immunological factors. Inheritance of certain Human class II leukocyte antigen (HLA) alleles is by far the best-established predisposing factor for the development of PV. Class II HLA alleles vary among racial/ethnic backgrounds. We have determined an association between HLA class II alleles and PV among the Serbian population. A total of 72 patients with confirmed diagnosis of PV were genotyped for HLA class II alleles. HLA frequencies were compared with unrelated healthy bone marrow donors. The statistical significance of differences between patients and controls was evaluated using Fisher's exact test. The DRB1*04 and DRB1*14 allelic groups were associated with PV (P adj = 4.45 × 10(-13) and 4.06 × 10(-19) respectively), while HLA-DRB1*11 was negatively associated with PV (P adj = 0.0067) suggesting a protective role. DRB1*04:02, DRB1*14:04, DQB1*03:02 and DQB1*05:03 alleles were shown to be strongly associated with PV (P adj = 1.63 × 10(-12), 5.20 × 10(-7), 1.28 × 10(-6), and 4.44 × 10(-5), respectively). The frequency of HLA DRB1*04-DQB1*03 and HLA DRB1*14-DQB1*05 haplotypes in PV patients was significantly higher than in controls (31.3% vs 8.8%, P adj =7.66 × 10(-8) and 30.6% vs 6.3%, P adj = 3.22 × 10(-10), respectively). At high-resolution level, statistical significance was observed in HLA-DRB1*04:02-DQB1*03:02 and HLA-DRB1*14:04-DQB1*05:03 haplotypes (P adj = 5.55 × 10(-12), and P adj = 3.91 × 10(-6), respectively). Our findings suggest that HLA-DRB1*04:02, DRB1*14:04, HLA-DQB1* 03:02 and DQB1*05:03 alleles and HLA-DRB1*04:02-DQB1*03:02 and HLA-DRB1*14:04-DQB1*05:03 haplotypes are genetic markers for susceptibility for PV, while DRB1*11 allelic group appears protective in Serbian population. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. PP130. ENOS tagging SNP haplotypes in hypertensive disorders of pregnancy.

    Science.gov (United States)

    Sandrim, V; Muniz, L; Luizon, M; Palei, A C; Lacchini, R; Duarte, G; Cavalli, R; Tanus-Santos, J E

    2012-07-01

    Haplotypes formed by polymorphisms (T-786C, rs2070744; a variable number of tandem repeats in intron 4, and Glu298Asp, rs1799983) of eNOS gene were associated previously with gestational hypertension (GH) and preeclampsia (PE). However, no study has explored the tagging SNPs rs743506 and rs7830 in these disorders. The aim of the current study was to compare the distribution of the genotypes and haplotypes formed by the two tagging SNPs or by the five eNOS polymorphisms mentioned among healthy pregnant GH and PE. We recruited 122 HP, 138 GH and 157 PE. Genotypes for the T-786C, the Glu298Asp and rs743506 polymorphisms were determined by Taqmanâ Allele Discrimination assays and fluorescence signals were measured on Chromo 4 Detector (Bio-Rad Laboratories, USA). Genotypes for the VNTR polymorphism in intron 4 and rs7830, however, were determined by PCR and fragment separation by electrophoresis in 8% polyacrylamide gels. Plasma aliquots were analyzed in triplicate for their nitrite content using an ozone-based chemiluminescence assay. The haplotype formed by the most common variants in each polymorphism "T b G A C" was more frequent in PE group compared to HP (P=0.00004), which may be explained by the higher linkage disequilibrium found in PE compared to GH and HP. Conversely, the haplotype "C b G G C" was more frequent in HP compared to PE (P=0.00113), which is supported by previous findings that demonstrated the association of the combination "C b G" with higher level of nitrite (NO marker). Our results suggest a protective effect of the haplotype "C b G G C" against the development of PE. This study was funded by the Fundação de Amparo a Pesquisa do Estado de Minas Gerais (FAPEMIG-Brazil), the Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and the Fundação de Amparo a Pesquisa do Estado de São Paulo (FAPESP-Brazil). Copyright © 2012. Published by Elsevier B.V.

  19. Common SNP-Based Haplotype Analysis of the 4p16.3 Huntington Disease Gene Region

    Science.gov (United States)

    Lee, Jong-Min; Gillis, Tammy; Mysore, Jayalakshmi Srinidhi; Ramos, Eliana Marisa; Myers, Richard H.; Hayden, Michael R.; Morrison, Patrick J.; Nance, Martha; Ross, Christopher A.; Margolis, Russell L.; Squitieri, Ferdinando; Griguoli, Annamaria; Di Donato, Stefano; Gomez-Tortosa, Estrella; Ayuso, Carmen; Suchowersky, Oksana; Trent, Ronald J.; McCusker, Elizabeth; Novelletto, Andrea; Frontali, Marina; Jones, Randi; Ashizawa, Tetsuo; Frank, Samuel; Saint-Hilaire, Marie-Helene; Hersch, Steven M.; Rosas, Herminia D.; Lucente, Diane; Harrison, Madaline B.; Zanko, Andrea; Abramson, Ruth K.; Marder, Karen; Sequeiros, Jorge; MacDonald, Marcy E.; Gusella, James F.

    2012-01-01

    Age at the onset of motor symptoms in Huntington disease (HD) is determined largely by the length of a CAG repeat expansion in HTT but is also influenced by other genetic factors. We tested whether common genetic variation near the mutation site is associated with differences in the distribution of expanded CAG alleles or age at the onset of motor symptoms. To define disease-associated single-nucleotide polymorphisms (SNPs), we compared 4p16.3 SNPs in HD subjects with population controls in a case:control strategy, which revealed that the strongest signals occurred at a great distance from the HD mutation as a result of “synthetic association” with SNP alleles that are of low frequency in population controls. Detailed analysis delineated a prominent ancestral haplotype that accounted for ∼50% of HD chromosomes and extended to at least 938 kb on about half of these. Together, the seven most abundant haplotypes accounted for ∼83% of HD chromosomes. Neither the extended shared haplotype nor the individual local HTT haplotypes were associated with altered CAG-repeat length distribution or residual age at the onset of motor symptoms, arguing against modification of these disease features by common cis-regulatory elements. Similarly, the 11 most frequent control haplotypes showed no trans-modifier effect on age at the onset of motor symptoms. Our results argue against common local regulatory variation as a factor influencing HD pathogenesis, suggesting that genetic modifiers be sought elsewhere in the genome. They also indicate that genome-wide association analysis with a small number of cases can be effective for regional localization of genetic defects, even when a founder effect accounts for only a fraction of the disorder. PMID:22387017

  20. 4G/5G