
Sample records for stripe rust caused

  1. Evidence for Increased Aggressiveness in a Recent Widespread Strain of Puccinia striiformis f. sp. tritici Causing Stripe Rust of Wheat

    DEFF Research Database (Denmark)

    Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S


    Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on vir...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments......Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...

  2. Physical Localization of a Locus from Agropyron cristatum Conferring Resistance to Stripe Rust in Common Wheat. (United States)

    Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui


    Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.

  3. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035 (United States)

    Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...

  4. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)


    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...

  5. Transfer of stripe rust resistance from Aegilops variabilis to bread ...

    African Journals Online (AJOL)

    In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...

  6. Leaf and stripe rust resistance among Ethiopian grown wheat ...

    African Journals Online (AJOL)

    The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...

  7. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM). (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank


    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  8. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei) and leaf rust (Puccinia hordei) in barley using nested association mapping (NAM) (United States)

    Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus


    The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232

  9. Identification of QTL conferring resistance to stripe rust (Puccinia striiformis f. sp. hordei and leaf rust (Puccinia hordei in barley using nested association mapping (NAM.

    Directory of Open Access Journals (Sweden)

    Thomas Vatter

    Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.

  10. Genetic characterisation of novel resistance alleles to stem rust and stripe rust in wheat-alien introgression lines


    Rahmatov, Mahbubjon


    Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...

  11. Partial resistance to stripe rust and its effect on sustainability of wheat yield

    International Nuclear Information System (INIS)

    Qamar, M.; Din, R.U.; Gardazi, D.A.


    Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use

  12. Introgression of leaf rust and stripe rust resistance from Sharon goatgrass (Aegilops sharonensis Eig) into bread wheat (Triticum aestivum L.). (United States)

    Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J


    Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.

  13. Remapping of the stripe rust resistance gene Yr10 in common wheat. (United States)

    Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin


    Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.

  14. Race-Specific Adult-Plant Resistance in Winter Wheat to Stripe Rust and Characterization of Pathogen Virulence Patterns. (United States)

    Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten


    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.

  15. Enhanced resistance to stripe rust disease in transgenic wheat expressing the rice chitinase gene RC24. (United States)

    Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin


    Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.

  16. Multi-location wheat stripe rust QTL analysis: genetic background and epistatic interactions. (United States)

    Vazquez, M Dolores; Zemetra, Robert; Peterson, C James; Chen, Xianming M; Heesacker, Adam; Mundt, Christopher C


    Epistasis and genetic background were important influences on expression of stripe rust resistance in two wheat RIL populations, one with resistance conditioned by two major genes and the other conditioned by several minor QTL. Stripe rust is a foliar disease of wheat (Triticum aestivum L.) caused by the air-borne fungus Puccinia striiformis f. sp. tritici and is present in most regions around the world where commercial wheat is grown. Breeding for durable resistance to stripe rust continues to be a priority, but also is a challenge due to the complexity of interactions among resistance genes and to the wide diversity and continuous evolution of the pathogen races. The goal of this study was to detect chromosomal regions for resistance to stripe rust in two winter wheat populations, 'Tubbs'/'NSA-98-0995' (T/N) and 'Einstein'/'Tubbs' (E/T), evaluated across seven environments and mapped with diversity array technology and simple sequence repeat markers covering polymorphic regions of ≈1480 and 1117 cM, respectively. Analysis of variance for phenotypic data revealed significant (P located in chromosomes 2AS and 6AL, with epistatic interaction between them, were responsible for the main phenotypic response. For the T/N population, eight QTL were identified, with those in chromosomes 2AL and 2BL accounting for the largest percentage of the phenotypic variance.

  17. Stripe rust and leaf rust resistance QTL mapping, epistatic interactions, and co-localization with stem rust resistance loci in spring wheat evaluated over three continents. (United States)

    Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S


    In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and

  18. Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.

    Directory of Open Access Journals (Sweden)

    Jinita Sthapit Kandel

    Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.

  19. Virulence and molecular characterization of experimental isolates of the stripe rust pathogen (Puccinia striiformis) indicate somatic recombination (United States)

    Puccinia striiformis causes stripe rust on wheat, barley, and grasses. Natural population studies have indicated that somatic recombination plays a possible role in the pathogen variation. To determine if somatic recombination can occur, susceptible wheat or barley plants were inoculated with mixe...

  20. Genome-Wide Association Mapping for Resistance to Leaf and Stripe Rust in Winter-Habit Hexaploid Wheat Landraces.

    Directory of Open Access Journals (Sweden)

    Albert Kertho

    Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.

  1. Mapping of stripe rust resistance QTL in Cappelle-Desprez × PBW343 RIL population effective in northern wheat belt of India. (United States)

    Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu


    Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.

  2. Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons

    International Nuclear Information System (INIS)

    Skorda, E.A.


    Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)

  3. Differential resistance to stripe rust (Puccinia striiformis) in collections of basin wild rye (Leymus cinereus) (United States)

    Frank M. Dugan; Michael J. Cashman; Richard C. Johnson; Meinan Wang; Chen Xianming


    Differential resistance to stripe rust (Puccinia striiformis) in a planting of 111 wild collections of Basin wild rye (Leymus cinereus) was noted 2011-2013. In 2011, rust severity was rated on a scale of 1-9. Much lighter infection in 2012 and 2013 was rated as the number of symptomatic leaves per plant divided by plant circumference (to adjust for plant size). Effect...

  4. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin


    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  5. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance. (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen


    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  6. Genetics of adult plant stripe rust resistance in CSP44, a selection ...

    Indian Academy of Sciences (India)


    areas of temperate zones (Johnson 1988). Yield losses can be considerable, ranging from about 40 per cent to com- plete destruction of the crop depending upon the growth stage at which the disease attacks. Using diverse genes for resistance against stripe rust disease is the most eco- nomical and environmentally safe ...

  7. Molecular mapping of Yr53, a new gene for stripe rust resistance in durum wheat accession PI 480148 and its transfer to common wheat (United States)

    Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...

  8. Mapping of quantitative adult plant field resistance to leaf rust and stripe rust in two European winter wheat populations reveals co-location of three QTL conferring resistance to both rust pathogens. (United States)

    Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann


    We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.

  9. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...

  10. Characterization of molecular diversity and genome-wide mapping of loci associated with resistance to stripe rust and stem rust in Ethiopian bread wheat accessions. (United States)

    Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O


    The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in

  11. Quantitative trait loci for resistance to stripe rust of wheat revealed using global field nurseries and opportunities for stacking resistance genes. (United States)

    Bokore, Firdissa E; Cuthbert, Richard D; Knox, Ron E; Randhawa, Harpinder S; Hiebert, Colin W; DePauw, Ron M; Singh, Asheesh K; Singh, Arti; Sharpe, Andrew G; N'Diaye, Amidou; Pozniak, Curtis J; McCartney, Curt; Ruan, Yuefeng; Berraies, Samia; Meyer, Brad; Munro, Catherine; Hay, Andy; Ammar, Karim; Huerta-Espino, Julio; Bhavani, Sridhar


    Quantitative trait loci controlling stripe rust resistance were identified in adapted Canadian spring wheat cultivars providing opportunity for breeders to stack loci using marker-assisted breeding. Stripe rust or yellow rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is a devastating disease of common wheat (Triticum aestivum L.) in many regions of the world. The objectives of this research were to identify and map quantitative trait loci (QTL) associated with stripe rust resistance in adapted Canadian spring wheat cultivars that are effective globally, and investigate opportunities for stacking resistance. Doubled haploid (DH) populations from the crosses Vesper/Lillian, Vesper/Stettler, Carberry/Vesper, Stettler/Red Fife and Carberry/AC Cadillac were phenotyped for stripe rust severity and infection response in field nurseries in Canada (Lethbridge and Swift Current), New Zealand (Lincoln), Mexico (Toluca) and Kenya (Njoro), and genotyped with SNP markers. Six QTL for stripe rust resistance in the population of Vesper/Lillian, five in Vesper/Stettler, seven in Stettler/Red Fife, four in Carberry/Vesper and nine in Carberry/AC Cadillac were identified. Lillian contributed stripe rust resistance QTL on chromosomes 4B, 5A, 6B and 7D, AC Cadillac on 2A, 2B, 3B and 5B, Carberry on 1A, 1B, 4A, 4B, 7A and 7D, Stettler on 1A, 2A, 3D, 4A, 5B and 6A, Red Fife on 2D, 3B and 4B, and Vesper on 1B, 2B and 7A. QTL on 1A, 1B, 2A, 2B, 3B, 4A, 4B, 5B, 7A and 7D were observed in multiple parents. The populations are compelling sources of recombination of many stripe rust resistance QTL for stacking disease resistance. Gene pyramiding should be possible with little chance of linkage drag of detrimental genes as the source parents were mostly adapted cultivars widely grown in Canada.

  12. Loci associated with resistance to stripe rust (Puccinia striiformis f. sp. tritici) in a core collection of spring wheat (Triticum aestivum) (United States)

    Bulli, Peter; Rynearson, Sheri; Chen, Xianming; Pumphrey, Michael


    Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst) remains one of the most significant diseases of wheat worldwide. We investigated stripe rust resistance by genome-wide association analysis (GWAS) in 959 spring wheat accessions from the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection, representing major global production environments. The panel was characterized for field resistance in multi-environment field trials and seedling resistance under greenhouse conditions. A genome-wide set of 5,619 informative SNP markers were used to examine the population structure, linkage disequilibrium and marker-trait associations in the germplasm panel. Based on model-based analysis of population structure and hierarchical Ward clustering algorithm, the accessions were clustered into two major subgroups. These subgroups were largely separated according to geographic origin and improvement status of the accessions. A significant correlation was observed between the population sub-clusters and response to stripe rust infection. We identified 11 and 7 genomic regions with significant associations with stripe rust resistance at adult plant and seedling stages, respectively, based on a false discovery rate multiple correction method. The regions harboring all, except three, of the QTL identified from the field and greenhouse studies overlap with positions of previously reported QTL. Further work should aim at validating the identified QTL using proper germplasm and populations to enhance their utility in marker assisted breeding. PMID:28591221

  13. [Prediction model of meteorological grade of wheat stripe rust in winter-reproductive area, Sichuan Basin, China]. (United States)

    Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi


    The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.

  14. Characterization and Mapping of Leaf Rust and Stripe Rust Resistance Loci in Hexaploid Wheat Lines UC1110 and PI610750 under Mexican Environments. (United States)

    Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P


    Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.

  15. Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives. (United States)

    Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang


    Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n  = 6 ×  = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n  = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n  = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.

  16. Effective genes for resistance to stripe rust and virulence of Puccinia ...

    African Journals Online (AJOL)

    The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

  17. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method (United States)

    Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang


    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464

  18. Identification and Severity Determination of Wheat Stripe Rust and Wheat Leaf Rust Based on Hyperspectral Data Acquired Using a Black-Paper-Based Measuring Method. (United States)

    Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang


    It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.

  19. Prediction of yield losses in wheat (triticum aestivum l.) caused by yellow rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Ahmad, S.; Afzal, M.; Noorka, I.R.; Iqbal, Z.; Akhtar, N.; Iiftikhar, Y.; Kamran, M.


    Thirty six genotypes were screened against yellow rust to check their level of susceptibility or resistance. Among 36 genotypes screened against yellow rust, 18 were susceptible, 6 were moderately susceptible to susceptible, 7 were moderately resistant to moderately susceptible and 5 genotypes remained resistant. Yield losses were predicted in wheat on the basis of varying level of yellow rust severities. It was observed that susceptible genotypes showed higher yield losses as compared to resistant genotypes. Maximum severity of 90% of yellow rust resulted in 54% to 55% calculated and predicted losses, respectively. While 40, 50, 60 and 70% disease severity of yellow rust caused 35-34%, 38-37%, 42-40% and 46-47% calculated and predicted losses, respectively. However, the decline in losses was observed as the genotypes changed their reaction from susceptible to moderate susceptible. Similarly, losses were diminished as the varieties/lines showed moderate resistant reaction from moderate susceptible. Minimum temperature and relative humidity remained positively correlated while the maximum temperature showed negative correlation with stripe rust severity. With the increase of minimum temperature and relative humidity a rise up in stripe rust infection was seen while as the maximum temperature increased stripe rust infection decreased on different genotypes. It may be concluded from the study that environmental factors played major role in the spread of the disease which result in yield losses. (author)

  20. Appraisal of wheat germplasm for adult plant resistance against stripe rust

    Directory of Open Access Journals (Sweden)

    Saleem Kamran


    Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines

  1. Characterization of the Wheat Stripe Rust (Puccinia striiformis f. sp. tritici) Fungal Effector Candidate PEC6 and Its Corresponding Host Targets

    DEFF Research Database (Denmark)

    Liu, Changhai

    Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... factor. By using the yeast two-hybrid system, the adenosine kinase (ADK) was identified as a host target of PEC6. Virus-induced gene silencing (VIGS) of ADK enhanced wheat susceptibility to stripe rust indicates that ADK is a positive regulator in plant defense. Based on EtHAn-mediated effector delivery......, seventy-two wheat landraces were screened to search for the presence of potential resistance (R) genes. Three landraces showed strong hypersensitive response (HR) when PEC6 was expressed in the cells, suggesting the presence of certain R gene(s) recognizing PEC6. However, these landraces did not show...

  2. Identification and characterization of pleiotropic and co-located resistance loci to leaf rust and stripe rust in bread wheat cultivar Sujata. (United States)

    Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P


    Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.

  3. Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat. (United States)

    Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E


    Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.

  4. Molecular implications from ssr markers for stripe rust (puccinia striiformis F.Sp. tritici) resistance gene in bread wheat line N95175

    International Nuclear Information System (INIS)

    Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.


    Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)

  5. Secretome Characterization and Correlation Analysis Reveal Putative Pathogenicity Mechanisms and Identify Candidate Avirulence Genes in the Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici. (United States)

    Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming


    Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms

  6. Genome-wide association mapping for stripe rust (Puccinia striiformis F. sp. tritici) in US Pacific Northwest winter wheat (Triticum aestivum L.). (United States)

    Naruoka, Y; Garland-Campbell, K A; Carter, A H


    Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.

  7. Influence of stripe rust infection on the photosynthetic characteristics and antioxidant system of susceptible and resistant wheat cultivars at the adult plant stage. (United States)

    Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu


    Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress.

  8. Characterization of Novel Gene Yr79 and Four Additional Quantitative Trait Loci for All-Stage and High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 182103. (United States)

    Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming


    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.

  9. Genetic effects for controlling stripe rust (Puccinia striiformis f. sp. tritici resistance in wheat through joint segregation analysis

    Directory of Open Access Journals (Sweden)

    Kalim Ullah


    Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.

  10. Wheat rusts in the United States in 2016 (United States)

    In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...

  11. Screening of wheat germplasm for the source of resistance against leaf and stripe rust under climatic conditions in Bhakkar

    International Nuclear Information System (INIS)

    Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.


    A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.

  12. Host status of false brome grass to the leaf rust fungus Puccinia brachypodii and the stripe rust fungus P. Striiformis

    NARCIS (Netherlands)

    Barbieri, M.; Marcel, T.C.; Niks, R.E.


    Purple false brome grass (Brachypodium distachyon) has recently emerged as a model system for temperate grasses and is also a potential model plant to investigate plant interactions with economically important pathogens such as rust fungi. We determined the host status of five Brachypodium species

  13. Wheat TaRab7 GTPase is part of the signaling pathway in responses to stripe rust and abiotic stimuli.

    Directory of Open Access Journals (Sweden)

    Furong Liu

    Full Text Available Small GTP-binding proteins function as regulators of specific intercellular fundamental biological processes. In this study, a small GTP-binding protein Rab7 gene, designated as TaRab7, was identified and characterized from a cDNA library of wheat leaves infected with Puccinia striiformis f. sp. tritici (Pst the wheat stripe rust pathogen. The gene was predicted to encode a protein of 206 amino acids, with a molecular mass of 23.13 KDa and an isoeletric point (pI of 5.13. Further analysis revealed the presence of a conserved signature that is characteristic of Rab7, and phylogenetic analysis demonstrated that TaRab7 has the highest similarity to a small GTP binding protein gene (BdRab7-like from Brachypodium distachyon. Quantitative real-time PCR assays revealed that the expression of TaRab7 was higher in the early stage of the incompatible interactions between wheat and Pst than in the compatible interaction, and the transcription level of TaRab7 was also highly induced by environmental stress stimuli. Furthermore, knocking down TaRab7 expression by virus induced gene silencing enhanced the susceptibility of wheat cv. Suwon 11 to an avirulent race CYR23. These results imply that TaRab7 plays an important role in the early stage of wheat-stripe rust fungus interaction and in stress tolerance.

  14. Mining centuries old in-situ conserved Turkish wheat landraces for grain yield and stripe rust resistance genes

    Directory of Open Access Journals (Sweden)

    Deepmala Sehgal


    Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.

  15. Rust scoring guide

    NARCIS (Netherlands)



    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust

  16. Rust scoring guide




    This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).

  17. Genome-wide association mapping reveals a rich genetic architecture of stripe rust resistance loci in emmer wheat (Triticum turgidum ssp. dicoccum). (United States)

    Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto


    SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.

  18. Isolation and molecular cytogenetic characterization of a wheat - Leymus mollis double monosomic addition line and its progenies with resistance to stripe rust. (United States)

    Yang, Xiaofei; Li, Xin; Wang, Changyou; Chen, Chunhuan; Tian, Zengrong; Ji, Wanquan


    A common wheat - Leymus mollis (2n = 4x = 28, NsNsXmXm) double monosomic addition line, M11003-4-3-8/13/15 (2n = 44 = 42T.a + L.m2 + L.m3), with stripe rust resistance was developed (where T.a represents Triticum aestivum chromosome, L.m represents L. mollis chromosome, and L.m2/3 represents L. mollis chromosome of homoeologous groups 2 and 3). The progenies of line M11003-4-3-8/13/15 were characterized by cytological observation, specific molecular markers, fluorescence in situ hybridization (FISH), and genomic in situ hybridization (GISH). Among the progenies, there existed five different types (I, II, III, IV, and V) of chromosome constitution, the formulas of which were 2n = 44 = 42T.a + 1L.m2 + 1L.m3, 2n = 43 = 42T.a + 1L.m2, 2n = 43 = 42T.a + 1L.m3, 2n = 42 = 42T.a, and 2n = 44 = 42T.a + 2L.m2, respectively. Field disease screening showed that types I and III showed high resistance to stripe rust, while types II, IV, and V were susceptible. Leymus mollis was almost immune to stripe rust, whereas the wheat parent, cultivar 7182, was susceptible. Therefore, we concluded that the stripe rust resistance originated from L. mollis. These various lines could be further fully exploited as important disease resistance materials to enrich wheat genetic resources.

  19. Molecular mapping of stripe rust resistance gene YrSE5756 in synthetic hexaploid wheat and its transfer to common wheat

    International Nuclear Information System (INIS)

    Wang, Y.J.; Wang, C.Y.; Zhang, H.


    Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)

  20. A change in temperature modulates defence to yellow (stripe) rust in wheat line UC1041 independently of resistance gene Yr36. (United States)

    Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J


    Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel

  1. Genetic analysis of rust resistance genes in global wheat cultivars: an overview

    International Nuclear Information System (INIS)

    Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod


    Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding

  2. Construction and characterization of a full-length cDNA library for the wheat stripe rust pathogen (Puccinia striiformis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Chen Xianming


    Full Text Available Abstract Background Puccinia striiformis is a plant pathogenic fungus causing stripe rust, one of the most important diseases on cereal crops and grasses worldwide. However, little is know about its genome and genes involved in the biology and pathogenicity of the pathogen. We initiated the functional genomic research of the fungus by constructing a full-length cDNA and determined functions of the first group of genes by sequence comparison of cDNA clones to genes reported in other fungi. Results A full-length cDNA library, consisting of 42,240 clones with an average cDNA insert of 1.9 kb, was constructed using urediniospores of race PST-78 of P. striiformis f. sp. tritici. From 196 sequenced cDNA clones, we determined functions of 73 clones (37.2%. In addition, 36 clones (18.4% had significant homology to hypothetical proteins, 37 clones (18.9% had some homology to genes in other fungi, and the remaining 50 clones (25.5% did not produce any hits. From the 73 clones with functions, we identified 51 different genes encoding protein products that are involved in amino acid metabolism, cell defense, cell cycle, cell signaling, cell structure and growth, energy cycle, lipid and nucleotide metabolism, protein modification, ribosomal protein complex, sugar metabolism, transcription factor, transport metabolism, and virulence/infection. Conclusion The full-length cDNA library is useful in identifying functional genes of P. striiformis.

  3. New Rust Disease of Korean Willow (Salix koreensis) Caused by Melampsora yezoensis, Unrecorded Pathogen in Korea. (United States)

    Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan


    During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.

  4. Characterisation of Triticum vavilovii-derived stripe rust resistance using genetic, cytogenetic and molecular analyses and its marker-assisted selection. (United States)

    Bariana, H. S.; Brown, G. N.; Ahmed, N. U.; Khatkar, S.; Conner, R. L.; Wellings, C. R.; Haley, S.; Sharp, P. J.; Laroche, A.


    Stripe rust resistance was identified in Triticum vavilovii( T. vaviloviiAus22498)-derived Russian wheat aphid (RWA)-resistant germplasm. Inheritance studies indicated monogenic control of resistance. The resistance gene was tentatively designated as Yrvav and was located on chromosome 1B by monosomic analysis. A close association (1.5+/-0.9% recombination) of Yrvav with a T. vavilovii-derived gliadin allele ( Gli-B1vav) placed it in chromosome arm 1BS. Yrvavwas allelic with Yr10. Tests with Yr10 avirulent and virulent pathotypes showed that Yrvav and Yr10 possess identical pathogenic specificity. Yrvav and Yr10 showed close genetic associations with alternate alleles at the Xpsp3000(microsatellite marker), Gli-B1 and Rg1 loci. Based on these observations Yrvav was named as Yr10vav. The close association between Xpsp3000 and Gli-B1 was also confirmed. The Yr10vav-linked Xpsp3000 allele (285 bp) was not present in 65 Australian cultivars, whereas seven Australian wheats lacking Yr10 carried the same Xpsp3000 allele (260 bp) as Yr10carrying wheat cultivar Moro. Xpsp3000 and/or Gli-B1 could be used in marker-assisted selection for pyramiding Yr10vavor Yr10 with other stripe rust resistance genes. Yr10vav was inherited independently of the T. vavilovii-derived RWA resistance.

  5. Genetics and molecular mapping of genes for race-specific all-stage resistance and non-race-specific high-temperature adult-plant resistance to stripe rust in spring wheat cultivar Alpowa. (United States)

    Lin, F; Chen, X M


    Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values

  6. Molecular mapping of a stripe rust resistance gene in wheat line C51

    Indian Academy of Sciences (India)


    Aug 18, 2014 ... This disease causes significant economic losses in terms of .... Development of STS markers. Primers of ..... reference manual, 3rd edition. Whitehead ... Proceedings of the 11th International Wheat Genetic Symposium, pp.

  7. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  8. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus. (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng


    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  9. Evaluation of sugarcane introgression lines for resistance to brown rust disease caused by Puccinia melanocephala


    Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang


    Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...

  10. Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyrhizi syd)

    International Nuclear Information System (INIS)

    Ratma, R.


    Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyhizi syd). Eleven soybean mutant lines of orba variety derived from gamma fungus disease in the wet season 1985/86 at the experimental station of Citayam, Bogor. Based on IWGSR rating system, soybean mutant lines No 18/PsJ was moderately resistant to rust fungus disease. The other mutant lines, 14/PsJ, 15/PsJ, 20/PsJ, 102/PsJ, 106/PsJ, 111/PsJ, 118/PsJ, 119/PsJ and 220/PsJ were susceptible. (author). 4 figs.; 8 refs

  11. Uromyces ciceris-arietini, the cause of chickpea rust: new hosts in the Trifolieae, Fabaceae (United States)

    Plants of Medicago polymorpha in Riverside and San Diego, California were collected with severe rust caused by Uromyces ciceris-arietini. Reported hosts of U. ciceris-arietini are Cicer arietinum (chickpea) and Medicago polyceratia. To confirm the potential new host range, a monouredinial isolate RM...

  12. First report of leaf rust of blueberry caused by Thekopsora minima in Mexico (United States)

    Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. As the area under blueberry cultivation increases, new diseases causing severe losses are appearing. Leaf rust is one of the most destructive diseases of blueberry in Mexico. Sori on t...

  13. First Report of Orange Rust of Sugarcane caused by Puccinia kuehnii in Ecuador (United States)

    Orange rust, Puccinia kuehnii (W. Krüger) E.J. Butler, is an important disease of sugarcane (complex hybrid of Saccharum L. species) that causes yield losses, and impacts breeding programs. Initially confined to the Asia-Oceania region (5), P. kuehnii was reported in Florida in June 2007 (2) and lat...

  14. Next generation sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of wheat stripe rust.

    Directory of Open Access Journals (Sweden)

    Dario Cantu

    Full Text Available BACKGROUND: The wheat stripe rust fungus (Puccinia striiformis f. sp. tritici, PST is responsible for significant yield losses in wheat production worldwide. In spite of its economic importance, the PST genomic sequence is not currently available. Fortunately Next Generation Sequencing (NGS has radically improved sequencing speed and efficiency with a great reduction in costs compared to traditional sequencing technologies. We used Illumina sequencing to rapidly access the genomic sequence of the highly virulent PST race 130 (PST-130. METHODOLOGY/PRINCIPAL FINDINGS: We obtained nearly 80 million high quality paired-end reads (>50x coverage that were assembled into 29,178 contigs (64.8 Mb, which provide an estimated coverage of at least 88% of the PST genes and are available through GenBank. Extensive micro-synteny with the Puccinia graminis f. sp. tritici (PGTG genome and high sequence similarity with annotated PGTG genes support the quality of the PST-130 contigs. We characterized the transposable elements present in the PST-130 contigs and using an ab initio gene prediction program we identified and tentatively annotated 22,815 putative coding sequences. We provide examples on the use of comparative approaches to improve gene annotation for both PST and PGTG and to identify candidate effectors. Finally, the assembled contigs provided an inventory of PST repetitive elements, which were annotated and deposited in Repbase. CONCLUSIONS/SIGNIFICANCE: The assembly of the PST-130 genome and the predicted proteins provide useful resources to rapidly identify and clone PST genes and their regulatory regions. Although the automatic gene prediction has limitations, we show that a comparative genomics approach using multiple rust species can greatly improve the quality of gene annotation in these species. The PST-130 sequence will also be useful for comparative studies within PST as more races are sequenced. This study illustrates the power of NGS for

  15. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity. (United States)

    Schwessinger, Benjamin; Sperschneider, Jana; Cuddy, William S; Garnica, Diana P; Miller, Marisa E; Taylor, Jennifer M; Dodds, Peter N; Figueroa, Melania; Park, Robert F; Rathjen, John P


    A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N 50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. IMPORTANCE Current representations of eukaryotic microbial genomes are haploid, hiding the genomic diversity intrinsic to diploid and polyploid life forms. This hidden diversity contributes to the organism's evolutionary potential and ability to adapt to stress conditions. Yet, it is

  16. Unlocking Diversity in Germplasm Collections via Genomic Selection: A Case Study Based on Quantitative Adult Plant Resistance to Stripe Rust in Spring Wheat. (United States)

    Muleta, Kebede T; Bulli, Peter; Zhang, Zhiwu; Chen, Xianming; Pumphrey, Michael


    Harnessing diversity from germplasm collections is more feasible today because of the development of lower-cost and higher-throughput genotyping methods. However, the cost of phenotyping is still generally high, so efficient methods of sampling and exploiting useful diversity are needed. Genomic selection (GS) has the potential to enhance the use of desirable genetic variation in germplasm collections through predicting the genomic estimated breeding values (GEBVs) for all traits that have been measured. Here, we evaluated the effects of various scenarios of population genetic properties and marker density on the accuracy of GEBVs in the context of applying GS for wheat ( L.) germplasm use. Empirical data for adult plant resistance to stripe rust ( f. sp. ) collected on 1163 spring wheat accessions and genotypic data based on the wheat 9K single nucleotide polymorphism (SNP) iSelect assay were used for various genomic prediction tests. Unsurprisingly, the results of the cross-validation tests demonstrated that prediction accuracy increased with an increase in training population size and marker density. It was evident that using all the available markers (5619) was unnecessary for capturing the trait variation in the germplasm collection, with no further gain in prediction accuracy beyond 1 SNP per 3.2 cM (∼1850 markers), which is close to the linkage disequilibrium decay rate in this population. Collectively, our results suggest that larger germplasm collections may be efficiently sampled via lower-density genotyping methods, whereas genetic relationships between the training and validation populations remain critical when exploiting GS to select from germplasm collections. Copyright © 2017 Crop Science Society of America.

  17. A Near-Complete Haplotype-Phased Genome of the Dikaryotic Wheat Stripe Rust Fungus Puccinia striiformis f. sp. tritici Reveals High Interhaplotype Diversity

    Directory of Open Access Journals (Sweden)

    Benjamin Schwessinger


    Full Text Available A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies.


    Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...

  19. Development and Molecular Cytogenetic Identification of a Novel Wheat-Leymus mollis Lm#7Ns (7D Disomic Substitution Line with Stripe Rust Resistance.

    Directory of Open Access Journals (Sweden)

    Xiaofei Yang

    Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.

  20. Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate. (United States)

    Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A


    Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.

  1. Determining yield loss caused by brown rust in production fields of sugarcane (United States)

    Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...

  2. The genome sequence and effector complement of the flax rust pathogen Melampsora lini

    Directory of Open Access Journals (Sweden)

    Adnane eNemri


    Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote

  3. The genome sequence and effector complement of the flax rust pathogen Melampsora lini. (United States)

    Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N


    Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their

  4. TaNAC1 acts as a negative regulator of stripe rust resistance in wheat, enhances susceptibility to Pseudomonas syringae, and promotes lateral root development in transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fengtao eWang


    Full Text Available Plant-specific NAC transcription factors constitute a large family and play important roles in regulating plant developmental processes and responses to environmental stresses, but only some of them have been investigated for effects on disease reaction in cereal crops. Virus-induced gene silencing (VIGS is an effective strategy for rapid functional analysis of genes in plant tissues. In this study, TaNAC1, encoding a new member of the NAC1 subgroup, was cloned from bread wheat and characterized. It is a transcription factor localized in the cell nucleus, and contains an activation domain in its C-terminal. TaNAC1 was strongly expressed in wheat roots and was involved in responses to infection by the obligate pathogen Puccinia striiformis f. sp. tritici and defense-related hormone treatments such as salicylic acid, methyl jasmonate and ethylene. Knockdown of TaNAC1 with barley stripe mosaic virus-induced gene silencing (BSMV-VIGS enhanced stripe rust resistance. TaNAC1-overexpression in Arabidopsis plants gave enhanced susceptibility, attenuated systemic-acquired resistance to Pseudomonas syringae DC3000, and promoted lateral root development. Jasmonic acid-signaling pathway genes PDF1.2 and ORA59 were constitutively expressed in transgenic plants. TaNAC1 overexpression suppressed the expression levels of resistance-related genes PR1 and PR2 involved in SA signaling and AtWRKY70, which functions as a connection node between the JA- and SA-signaling pathways. Collectively, TaNAC1 is a novel NAC member of the NAC1 subgroup, negatively regulates plant disease resistance, and may modulate plant JA- and SA-signaling defense cascades.

  5. First Report of Garlic Rust Caused by Puccinia allii on Allium sativum in Minnesota (United States)

    In July 2010, Allium sativum, cultivar German Extra Hardy Porcelain plants showing foliar symptoms typical of rust infection were brought to the Plant Disease Clinic at the University of Minnesota by a commercial grower from Fillmore county Minnesota. Infected leaves showed circular to oblong lesio...

  6. Rapid detection of Puccinia triticina causing leaf rust of wheat by PCR and loop mediated isothermal amplification. (United States)

    Manjunatha, C; Sharma, Sapna; Kulshreshtha, Deepika; Gupta, Sangeeta; Singh, Kartar; Bhardwaj, Subhash C; Aggarwal, Rashmi


    Leaf rust of wheat caused by Puccinia triticina has significant impact on wheat production worldwide. Effective and quick detection methodologies are required to mitigate yield loss and time constraints associated with monitoring and management of leaf rust of wheat. In the present study, detection of P. triticina has been simplified by developing a rapid, reliable, efficient and visual colorimetric method i.e., loop mediated isothermal amplification of DNA (LAMP). Based on in silico analysis of P. triticina genome, PTS68, a simple sequence repeat was found highly specific to leaf rust fungus. A marker (PtRA68) was developed and its specificity was validated through PCR technique which gave a unique and sharp band of 919 bp in P. triticina pathotypes only. A novel gene amplification method LAMP which enables visual detection of pathogen by naked eye was developed for leaf rust pathogen. A set of six primers was designed from specific region of P. triticina and conditions were optimised to complete the observation process in 60 minutes at 65o C. The assay developed in the study could detect presence of P. triticina on wheat at 24 hpi (pre-symptomatic stage) which was much earlier than PCR without requiring thermal cycler. Sensitivity of LAMP assay developed in the study was 100 fg which was more sensitive than conventional PCR (50 pg) and equivalent to qPCR (100 fg). The protocol developed in the study was utilized for detection of leaf rust infected samples collected from different wheat fields. LAMP based colorimetric detection assay showed sky blue color in positive reaction and violet color in negative reaction after addition of 120 μM hydroxyl napthol blue (HNB) solution to reaction mixture. Similarly, 0.6 mg Ethidium bromide/ml was added to LAMP products, placed on transilluminator to witness full brightness in positive reaction and no such brightness could be seen in negative reaction mixture. Further, LAMP products spread in a ladder like banding pattern in

  7. Tidal-Induced Ocean Dynamics as Cause of Enceladus' Tiger Stripe Pattern (United States)

    Vermeersen, B. L.; Maas, L. R.; van Oers, S.; Rabitti, A.; Jara-Orue, H.


    One of the most peculiar features on Saturn moon Enceladus is its so-called tiger stripe pattern at the geologically active South Polar Terrain (SPT), as first observed in detail by the Cassini spacecraft early 2005. It is generally assumed that the four almost parallel surface lines that constitute this pattern are faults in the icy surface overlying a confined salty water reservoir. Indeed, later Cassini observations have shown that salty water jets originate from the tiger stripes [e.g., Hansen et al., Science, 311, 1422-1425, 2006; Postberg et al., Nature, 474, 620-622, 2011]. The periodic activity of the tiger stripe faults shows a strong correlation with tidal forcing. Jets emanating from specific fault lines seem to be triggered at those places of the faults where tidal-induced stresses are largest immediately following closest orbital approach with Saturn [e.g., Hurford et al., Nature, 447, 292-294, 2007]. Thus jet activity seems to be directly induced by tidal forcing. However, this does not explain the characteristic regular pattern of the stripes themselves. Here we explore the possibility that this pattern is formed and maintained by induced, tidally and rotationally driven, fluid motions in the ocean underneath the icy surface of the tiger-stripe region. The remarkable spatial regularity of Enceladus' SPT fault lines is reminiscent of that observed at the surface of confined density-stratified fluids by the action of induced internal gravity waves. Theoretical analysis, numerical simulations and laboratory water tank experiments all indicate that wave attractors - particular limit orbits to which waves are focused in a fluid basin - naturally emerge in gravitationally (radial salt concentration or temperature differences) or rotationally stratified confined fluids as a function of forcing periodicity and fluid basin geometry [Maas et al., Nature, 338, 557-561, 1997]. We have found that ocean dynamical wave attractors induced by tidal-effective forcing

  8. Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean


    Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.


    Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...

  9. Detection of Puccinia kuehnii Causing Sugarcane Orange Rust with a Loop-Mediated Isothermal Amplification-Based Assay. (United States)

    Chandra, Amaresh; Keizerweerd, Amber T; Grisham, Michael P


    Puccinia kuehnii is a fungal pathogen that causes orange rust in sugarcane, which is now prevalent in many countries. At the early stage of disease, it is almost indistinguishable from brown rust, which is caused by Puccinia melanocephala. Although several PCR assays are available to detect these diseases, the loop-mediated isothermal amplification (LAMP)-based assay has been reported to be more economical and easier to perform. Under isothermal conditions, DNA is amplified with high specificity and rapidity. Moreover, visual judgment of color change without further post-amplification processing makes the method convenient. The present study was undertaken to detect P. kuehnii genomic DNA using four primers corresponding to a unique DNA sequence of P. kuehnii. The LAMP assay was found to be optimal when 8 mM MgSO4 was used and the reaction was incubated at 63 °C for 90 min. Positive samples showed a color change from orange to green upon SYBR Green I dye addition. Specificity of the LAMP test was checked with DNA of P. melanocephala, which showed no reaction. Sensitivity of the LAMP method was observed to be the same as real-time PCR at 0.1 ng, thus providing a rapid and more affordable option for early disease detection.

  10. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.


    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  11. Passive bookshelf faulting driven by gravitational spreading as the cause of the tiger-stripe-fracture formation and development in the South Polar Terrain of Enceladus (United States)

    Yin, A.; Pappalardo, R. T.


    Detailed photogeologic mapping of the tiger-stripe fractures in the South Polar Terrain (SPT) of Enceladus indicates that these structures are left-slip faults and terminate at hook-shaped fold-thrust zones and/or Y-shaped horsetail splay-fault zones. The semi-square-shaped tectonic domain that hosts the tiger-stripe faults is bounded by right-slip and left-slip faults on the north and south edges and fold-thrust and extensional zones on the western and eastern edges. We explain the above observations by a passive bookshelf-faulting model in which individual tiger-stripe faults are bounded by deformable wall rocks accommodating distributed deformation. Based on topographic data, we suggest that gravitational spreading had caused the SPT to spread unevenly from west to east. This process was accommodated by right-slip and left-slip faulting on the north and south sides and thrusting and extension along the eastern and southern margins of the tiger-stripe tectonic domain. The uneven spreading, expressed by a gradual northward increase in the number of extensional faults and thrusts/folds along the western and eastern margins, was accommodated by distributed right-slip simple shear across the whole tiger-stripe tectonic domain. This mode of deformation in turn resulted in the development of a passive bookshelf-fault system characterized by left-slip faulting on individual tiger-stripe fractures.

  12. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence. (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael


    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Tracking the distribution of Puccinia psidii genotypes that cause rust disease on diverse myrtaceous trees and shrubs (United States)

    Amy L. Ross-Davis; Rodrigo N. Graca; Acelino C. Alfenas; Tobin L. Peever; Jack W. Hanna; Janice Y. Uchida; Rob D. Hauff; Chris Y. Kadooka; Mee-Sook Kim; Phil G. Cannon; Shigetou Namba; Nami Minato; Sofia Simeto; Carlos A. Perez; Min B. Rayamajhi; Mauricio Moran; D. Jean Lodge; Marcela Arguedas; Rosario Medel-Ortiz; M. Armando Lopez-Ramirez; Paula Tennant; Morag Glen; Ned B. Klopfenstein


    Puccinia psidii Winter (Basidiomycota, Uredinales) is a biotrophic rust fungus that was first reported in Brazil from guava in 1884 (Psidium guajava; Winter 1884) and later from eucalypt in 1912 (Joffily 1944). Considered to be of neotropical origin, the rust has also been reported to infect diverse myrtaceous hosts elsewhere in South America, Central America, the...

  14. Visceral pentastomiasis caused by Armillifer armillatus in a captive striped hyena (Hyaena hyaena) in Chiang Mai Night Safari, Thailand. (United States)

    Dechkajorn, Sakorn; Nomsiri, Raksiri; Boonsri, Kittikorn; Sripakdee, Duanghatai; Sukontason, Kabkaew L; Wannasan, Anchalee; Chailangkarn, Sasisophin; Tiwananthagorn, Saruda


    Visceral pentastomiasis (porocephalosis) caused by Armillifer armillatus larvae was incidentally diagnosed in a female striped hyena (Hyaena hyaena) of unknown age which died unexpectedly in 2013. The hyena had been imported from Tanzania 8years earlier and have been since then in a zoo in Chiang Mai, northern Thailand. Pathological examination revealed visceral nymph migrans of pentastomes throughout the intestine, liver, diaphragm, omentum and mesentery, spleen, kidneys, and urinary bladder. Polymerase chain reaction and sequencing that targeted the pentastomid-specific 18S rRNA gene determined 100% identity with reference sequence for A. armillatus, suggesting that its ova can infect the hyena to serve as an intermediate host for the parasite. Further studies to identify the source of infection, its risk factors, and host range for A. armillatus are important to determine its zoonotic potential and to better prevent and manage the disease to protect animal and human health. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Inheritance and bulked segregant analysis of leaf rust and stem rust resistance genes in eight durum wheat genotypes (United States)

    Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...

  16. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages (United States)

    Ali, Sajid; Rodriguez-Algaba, Julian; Thach, Tine; Sørensen, Chris K.; Hansen, Jens G.; Lassen, Poul; Nazari, Kumarse; Hodson, David P.; Justesen, Annemarie F.; Hovmøller, Mogens S.


    We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s) or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009–2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales. PMID:28676811

  17. Yellow Rust Epidemics Worldwide Were Caused by Pathogen Races from Divergent Genetic Lineages

    Directory of Open Access Journals (Sweden)

    Sajid Ali


    Full Text Available We investigated whether the recent worldwide epidemics of wheat yellow rust were driven by races of few clonal lineage(s or populations of divergent races. Race phenotyping of 887 genetically diverse Puccinia striiformis isolates sampled in 35 countries during 2009–2015 revealed that these epidemics were often driven by races from few but highly divergent genetic lineages. PstS1 was predominant in North America; PstS2 in West Asia and North Africa; and both PstS1 and PstS2 in East Africa. PstS4 was prevalent in Northern Europe on triticale; PstS5 and PstS9 were prevalent in Central Asia; whereas PstS6 was prevalent in epidemics in East Africa. PstS7, PstS8 and PstS10 represented three genetic lineages prevalent in Europe. Races from other lineages were in low frequencies. Virulence to Yr9 and Yr27 was common in epidemics in Africa and Asia, while virulence to Yr17 and Yr32 were prevalent in Europe, corresponding to widely deployed resistance genes. The highest diversity was observed in South Asian populations, where frequent recombination has been reported, and no particular race was predominant in this area. The results are discussed in light of the role of invasions in shaping pathogen population across geographical regions. The results emphasized the lack of predictability of emergence of new races with high epidemic potential, which stresses the need for additional investments in population biology and surveillance activities of pathogens on global food crops, and assessments of disease vulnerability of host varieties prior to their deployment at larger scales.

  18. Sources of resistance to yellow rust and stem rust in wheat-alien introgressions


    Rahmatov, Mahbubjon


    Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...

  19. Molecular characterization of the rDNA-ITS sequence and a PCR diagnostic technique for Pileolaria terebinthi, the cause of pistachio rust

    Directory of Open Access Journals (Sweden)

    Hossein ALAEI


    Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.

  20. Commandra Blister Rust (United States)

    David W. Johnson


    Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.

  1. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora. (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans


    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  2. Rust disease of eucalypts, caused by Puccinia psidii, did not originate via host jump from guava in Brazil (United States)

    Rodrigo N. Graca; Amy L. Ross-Davis; Ned B. Klopfenstein; Mee-Sook Kim; Tobin L. Peever; Phil G. Cannon; Cristina P. Aun; Eduardo G. Mizubuti; Acelino C. Alfenas


    The rust fungus, Puccinia psidii, is a devastating pathogen of introduced eucalypts (Eucalyptus spp.) in Brazil where it was first observed in 1912. This pathogen is hypothesized to be endemic to South and Central America and to have first infected eucalypts via a host jump from native guava (Psidium guajava). Ten microsatellite markers were used to genotype 148 P....

  3. Introgression of a leaf rust resistance gene from Aegilops caudata to ...

    Indian Academy of Sciences (India)

    tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.

  4. Rust essentials

    CERN Document Server

    Balbaert, Ivo


    This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.

  5. Winnie Rust

    African Journals Online (AJOL)


    Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...

  6. Seeing Rust (United States)


    The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.

  7. Did transmission of Helicobacter pylori from humans cause a disease outbreak in a colony of Stripe-faced Dunnarts (Sminthopsis macroura?

    Directory of Open Access Journals (Sweden)

    Every Alison L


    Full Text Available Abstract Since the discovery that Helicobacter pylori causes a range of pathologies in the stomachs of infected humans, it has become apparent that Helicobacters are found in a diverse range of animal species where they are frequently associated with disease. In 2003 and 2004, there were two outbreaks of increased mortality associated with gastric bleeding and weight-loss in a captive colony of the Australian marsupial, the Stripe-faced Dunnart (Sminthopsis macroura. The presence of gastric pathology led to an investigation of potential Helicobacter pathogenesis in these animals. Histological examination revealed the presence of gastritis, and PCR analysis confirmed the presence of Helicobacter infection in the stomachs of these marsupials. Surprisingly, sequencing of 16S rRNA from these bacteria identified the species as H. pylori and PCR confirmed the strain to be positive for the important pathogenesis factor, cagA. We therefore describe, for the first time, an apparent reverse zoonotic infection of Stripe-faced Dunnarts with H. pylori. Already prone to pathological effects of stress (as experienced during breeding season, concomitant H. pylori infection appears to be a possible essential but not sufficient co-factor in prototypic gastric bleeding and weight loss in these marsupials. The Stripe-faced Dunnart could represent a new model for investigating Helicobacter-driven gastric pathology. Infections from their human handlers, specifically of H. pylori, may be a potential risk to captive colonies of marsupials.


    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  9. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...

  10. Utilization of the cropgro-soybean model to estimate yield loss caused by Asian rust in cultivars with different cycle

    Directory of Open Access Journals (Sweden)

    Rafael de Ávila Rodrigues


    Full Text Available In recent years, crop models have increasingly been used to simulate agricultural features. The DSSAT (Decision Support System for Agrotechnology Transfer is an important tool in modeling growth; however, one of its limitations is related to the unaccounted-for effect of diseases. Therefore, the goals of this study were to calibrate and validate the CSM CROPGRO-Soybean for the soybean cultivars M-SOY 6101 and MG/BR 46 (Conquista, analyze the performance and the effect of Asian soybean rust on these cultivars under the environmental conditions of Viçosa, Minas Gerais, Brazil. The experimental data for the evaluation, testing, and adjustment of the genetic coefficients for the cultivars, M-SOY 6101 and MG/BR 46 (Conquista, were obtained during the 2006/2007, 2007/2008 and 2009/2010 growing seasons. GLUE (Generalized Likelihood Uncertainty Estimation was used for the estimation of the genetic coefficients, and pedotransfer functions have been utilized to estimate the physical characteristics of the soil. For all of the sowing dates, the early season cultivar, M-SOY 6101, exhibited a lower variance in yield, which represents more stability with regard to the interannual climate variability, i.e., the farmers who use this cultivar will have in 50% of the crop years analyzed, a higher yield than a late-season cultivar. The MG/BR 46 (Conquista cultivar demonstrated a greater probability of obtaining higher yield in years with favorable weather conditions. However, in the presence of the Asian soybean rust, yield is heavily affected. The early cultivar, M-SOY 6101, showed a lower risk of being affected by the rust and consequently exhibited less yield loss considering the scenario D90 (condensation on the leaf surface occurs when the relative humidity is greater than or equal to 90%, for a sowing date of November 14.

  11. Inheritance of resistance to orange rust in sugarcane (United States)

    Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...

  12. Development of RAPD based markers for wheat rust resistance ...

    African Journals Online (AJOL)

    Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...

  13. Primeira ocorrência de ferrugem em capim-limão causada por Puccinia cymbopogonis no Brasil First report of the lemongrass rust fungi caused by Puccinia cymbopogonis in Brazil

    Directory of Open Access Journals (Sweden)

    João Batista Vida


    Full Text Available È registrada a primeira ocorrência de ferrugem em capim-limão (Cymbopogon citratus (DC. Stapf, causada por Puccinia cymbopogonis Mass., no Brasil, Estado do Paraná.It is reported the first occurrence of the lemongrass (Cymbopogon citratus (DC. Stapf rust fungi caused by Puccinia cymbopogonis Mass. in Brazil, State of Paraná.

  14. Rust transformation/rust compatible primers (United States)

    Emeric, Dario A.; Miller, Christopher E.


    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  15. Fusiform Rust of Southern Pines (United States)

    W. R. Phelps; F. L. Czabator


    Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...

  16. Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars (United States)

    Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...

  17. Inheritance and Bulked Segregant Analysis of Leaf Rust and Stem Rust Resistance in Durum Wheat Genotypes. (United States)

    Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis


    Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.

  18. Induced resistance to rust disease in lentil

    International Nuclear Information System (INIS)

    Paul, Amitava; Singh, D.P.


    Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)

  19. Characterization and comparative analysis of the genome of Puccinia sorghi Schwein, the causal agent of maize common rust. (United States)

    Rochi, Lucia; Diéguez, María José; Burguener, Germán; Darino, Martín Alejandro; Pergolesi, María Fernanda; Ingala, Lorena Romina; Cuyeu, Alba Romina; Turjanski, Adrián; Kreff, Enrique Domingo; Sacco, Francisco


    Rust fungi are one of the most devastating pathogens of crop plants. The biotrophic fungus Puccinia sorghi Schwein (Ps) is responsible for maize common rust, an endemic disease of maize (Zea mays L.) in Argentina that causes significant yield losses in corn production. In spite of this, the Ps genomic sequence was not available. We used Illumina sequencing to rapidly produce the 99.6Mbdraft genome sequence of Ps race RO10H11247, derived from a single-uredinial isolate from infected maize leaves collected in the Argentine Corn Belt Region during 2010. High quality reads were obtained from 200bppaired-end and 5000bpmate-paired libraries and assembled in 15,722 scaffolds. A pipeline which combined an ab initio program with homology-based models and homology to in planta enriched ESTs from four cereal pathogenic fungus (the three sequenced wheat rusts and Ustilago maydis) was used to identify 21,087 putative coding sequences, of which 1599 might be part of the Ps RO10H11247 secretome. Among the 458 highly conserved protein families from the euKaryotic Orthologous Groups (KOG) that occur in a wide range of eukaryotic organisms, 97.5% have at least one member with high homology in the Ps assembly (TBlastN, E-value⩽e-10) covering more than 50% of the length of the KOG protein. Comparative studies with the three sequenced wheat rust fungus, and microsynteny analysis involving Puccinia striiformis f. sp. tritici (Pst, wheat stripe rust fungus), support the quality achieved. The results presented here show the effectiveness of the Illumina strategy for sequencing dikaryotic genomes of non-model organisms and provides reliable DNA sequence information for genomic studies, including pathogenic mechanisms of this maize fungus and molecular marker design. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Genetic variability among the brown rust resistant and susceptible genotypes of sugarcane by RAPD technique (United States)

    Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...

  1. Lighting up superconducting stripes (United States)

    Ergeçen, Emre; Gedik, Nuh


    Cuprate superconductors display a plethora of complex phases as a function of temperature and carrier concentration, the understanding of which could provide clues into the mechanism of superconductivity. For example, when about one-eighth of the conduction electrons are removed from the copper oxygen planes in cuprates such as La2‑xBaxCuO4 (LBCO), the doped holes (missing electrons) organize into one-dimensional stripes (1). The bulk superconducting transition temperature (Tc) is greatly reduced, and just above Tc, electrical transport perpendicular to the planes (along the c axis) becomes resistive, but parallel to the copper oxygen planes, resistivity remains zero for a range of temperatures (2). It was proposed a decade ago (3) that this anisotropic behavior is caused by pair density waves (PDWs); superconducting Cooper pairs exist along the stripes within the planes but cannot tunnel to the adjacent layers. On page 575 of this issue, Rajasekaran et al. (4) now report detection of this state in LBCO using nonlinear reflection of high-intensity terahertz (THz) light.

  2. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi (United States)


    Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt), we have generated Expressed Sequence Tags (ESTs) by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores) and asexual (germinated urediniospores) stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum), 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs). Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt) and stripe rust, P. striiformis f. sp. tritici (Pst), and poplar

  3. Gene discovery in EST sequences from the wheat leaf rust fungus Puccinia triticina sexual spores, asexual spores and haustoria, compared to other rust and corn smut fungi

    Directory of Open Access Journals (Sweden)

    Wynhoven Brian


    Full Text Available Abstract Background Rust fungi are biotrophic basidiomycete plant pathogens that cause major diseases on plants and trees world-wide, affecting agriculture and forestry. Their biotrophic nature precludes many established molecular genetic manipulations and lines of research. The generation of genomic resources for these microbes is leading to novel insights into biology such as interactions with the hosts and guiding directions for breakthrough research in plant pathology. Results To support gene discovery and gene model verification in the genome of the wheat leaf rust fungus, Puccinia triticina (Pt, we have generated Expressed Sequence Tags (ESTs by sampling several life cycle stages. We focused on several spore stages and isolated haustorial structures from infected wheat, generating 17,684 ESTs. We produced sequences from both the sexual (pycniospores, aeciospores and teliospores and asexual (germinated urediniospores stages of the life cycle. From pycniospores and aeciospores, produced by infecting the alternate host, meadow rue (Thalictrum speciosissimum, 4,869 and 1,292 reads were generated, respectively. We generated 3,703 ESTs from teliospores produced on the senescent primary wheat host. Finally, we generated 6,817 reads from haustoria isolated from infected wheat as well as 1,003 sequences from germinated urediniospores. Along with 25,558 previously generated ESTs, we compiled a database of 13,328 non-redundant sequences (4,506 singlets and 8,822 contigs. Fungal genes were predicted using the EST version of the self-training GeneMarkS algorithm. To refine the EST database, we compared EST sequences by BLASTN to a set of 454 pyrosequencing-generated contigs and Sanger BAC-end sequences derived both from the Pt genome, and to ESTs and genome reads from wheat. A collection of 6,308 fungal genes was identified and compared to sequences of the cereal rusts, Puccinia graminis f. sp. tritici (Pgt and stripe rust, P. striiformis f. sp

  4. Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17 (United States)

    Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane


    Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...

  5. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi (United States)

    Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...

  6. The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research. (United States)

    McCook, Stuart; Vandermeer, John


    Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.

  7. Interacting genes in the pine-fusiform rust forest pathosystem (United States)

    H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li


    Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...

  8. White pines, blister rust, and management in the Southwest (United States)

    D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler


    White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...

  9. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  10. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases (United States)

    Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.


    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031

  11. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases. (United States)

    Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C


    A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  12. Evaluation of 19,460 Wheat Accessions Conserved in the Indian National Genebank to Identify New Sources of Resistance to Rust and Spot Blotch Diseases.

    Directory of Open Access Journals (Sweden)

    Sundeep Kumar

    Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.

  13. European Stars and Stripes

    National Research Council Canada - National Science Library

    Hendricks, Nancy


    The European Stars and Stripes (ES&S) organization publishes a daily newspaper, The Stars and Stripes, for DoD personnel stationed in Germany, Italy, the United Kingdom, and other DoD activities in the U.S. European Command...

  14. Porous Alumina Films with Width-Controllable Alumina Stripes

    Directory of Open Access Journals (Sweden)

    Huang Shi-Ming


    Full Text Available Abstract Porous alumina films had been fabricated by anodizing from aluminum films after an electropolishing procedure. Alumina stripes without pores can be distinguished on the surface of the porous alumina films. The width of the alumina stripes increases proportionally with the anodizing voltage. And the pores tend to be initiated close to the alumina stripes. These phenomena can be ascribed to the electric field distribution in the alumina barrier layer caused by the geometric structure of the aluminum surface.

  15. Porous Alumina Films with Width-Controllable Alumina Stripes (United States)


    Porous alumina films had been fabricated by anodizing from aluminum films after an electropolishing procedure. Alumina stripes without pores can be distinguished on the surface of the porous alumina films. The width of the alumina stripes increases proportionally with the anodizing voltage. And the pores tend to be initiated close to the alumina stripes. These phenomena can be ascribed to the electric field distribution in the alumina barrier layer caused by the geometric structure of the aluminum surface. PMID:21170406

  16. Spread, genetic variation and methods for the detection of Puccinia kuehnii, the causal agent of sugarcane orange rust. (United States)

    Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...

  17. Invasion of the striped mollusks

    International Nuclear Information System (INIS)



    Introduced to this country only five years ago, the prolific zebra mussel has infested the Great Lakes and has already begun to move into fresh waters beyond the region. Dense populations in utility water systems have caused serious problems, reducing plant efficiency and blocking lines used for cooling and fire fighting. Experts say the striped mollusk has the potential to become the industry's worst biological problem, possibly affecting 70% of US power plants. While it appears that the invader is here to stay, EPRI and others continue to develop and refine techniques to control mussel growth

  18. Nonhost resistance to rust pathogens – a continuation of continua

    Directory of Open Access Journals (Sweden)

    Jan eBettgenhaeuser


    Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  19. Nonhost resistance to rust pathogens – a continuation of continua (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.


    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270

  20. Nonhost resistance to rust pathogens - a continuation of continua. (United States)

    Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J


    The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.

  1. Wheat Rust Toolbox Related to New Initiatives on Yellow Rust

    DEFF Research Database (Denmark)

    Hansen, Jens Grønbech; Lassen, Poul

    :// The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat ( and EuroBlight ( The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...

  2. Transformation of the flax rust fungus, Melampsora lini: selection via silencing of an avirulence gene


    Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.


    Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...

  3. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing. (United States)

    Panwar, Vinay; Bakkeren, Guus


    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  4. Invasion of the striped mollusks

    Energy Technology Data Exchange (ETDEWEB)


    Introduced to this country only five years ago, the prolific zebra mussel has infested the Great Lakes and has already begun to move into fresh waters beyond the region. Dense populations in utility water systems have caused serious problems, reducing plant efficiency and blocking lines used for cooling and fire fighting. Experts say the striped mollusk has the potential to become the industry's worst biological problem, possibly affecting 70% of US power plants. While it appears that the invader is here to stay, EPRI and others continue to develop and refine techniques to control mussel growth. This article describes how the mollusk got here, reviews the problems it can cause and what is being done to mitigate the problems and control the growth and spread of the mollusk.

  5. Two distinct classes of QTL determine rust resistance in sorghum. (United States)

    Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David


    Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect

  6. Leaf rust of cultivated barley: pathology and control. (United States)

    Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder


    Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.

  7. Effector proteins of rust fungi. (United States)

    Petre, Benjamin; Joly, David L; Duplessis, Sébastien


    Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.

  8. Crown rust control on oats

    International Nuclear Information System (INIS)

    Frey, K.J.; Browning, J.A.; Simons, M.D.


    Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use

  9. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton


    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  10. Duplications and losses in gene families of rust pathogens highlight putative effectors. (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M


    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  11. Bulked fusiform rust inocula and Fr gene interactions in loblolly pine (United States)

    Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand


    Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.

  12. Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster (United States)

    Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...

  13. Current and future molecular approaches to investigate the white pine blister rust pathosystem (United States)

    B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein


    Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...

  14. Effect of orange rust on sugarcane breeding program at canal Point (United States)

    Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...

  15. Effect of fungicide on the development of wheat stem rust and yield ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...

  16. Utilization of a major brown rust resistance gene in sugarcane breeding (United States)

    Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...

  17. Detection, breeding, and selection of durable resistance to brown rust in sugarcane (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...

  18. Screening for sugarcane brown rust in first clonal stage of the Canal Point sugarcane breeding program (United States)

    Sugarcane (Saccharum spp.) brown rust (caused by Puccinia melanocephala H. & P. Sydow) was first reported in the United States in 1978 and is still one of great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize b...

  19. White pine blister rust resistance in limber pine: Evidence for a major gene (United States)

    A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns


    Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...

  20. Resistance to white pine blister rust in Pinus flexilis and P (United States)

    Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns


    The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...

  1. Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon (United States)

    Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...

  2. Wheat stem rust in South Africa: Current status and future research ...

    African Journals Online (AJOL)

    . In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...

  3. Improving File System Performance by Striping (United States)

    Lam, Terance L.; Kutler, Paul (Technical Monitor)


    This document discusses the performance and advantages of striped file systems on the SGI AD workstations. Performance of several striped file system configurations are compared and guidelines for optimal striping are recommended.

  4. Climate change impacts on coffee rust disease (United States)

    Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.


    Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.

  5. LMFBR thermal-striping evaluation

    International Nuclear Information System (INIS)

    Brunings, J.E.


    Thermal striping is defined as the fluctuating temperature field that is imposed on a structure when fluid streams at different temperatures mix in the vicinity of the structure surface. Because of the uncertainty in structural damage in LMFBR structures subject to thermal striping, EPRI has funded an effort for the Rockwell International Energy Systems Group to evaluate this problem. This interim report presents the following information: (1) a Thermal Striping Program Plan which identifies areas of analytic and experimental needs and presents a program of specific tasks to define damage experienced by ordinary materials of construction and to evaluate conservatism in the existing approach; (2) a description of the Thermal Striping Test Facility and its operation; and (3) results from the preliminary phase of testing to characterize the fluid environment to be applied in subsequent thermal striping damage experiments

  6. Essential Oils for Alternative Teak Rust Control

    Directory of Open Access Journals (Sweden)

    Pedro Raymundo Argüelles Osorio


    Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.

  7. Molecular Characterization of wheat stem rust races in Kenya (United States)

    Stem or black rust caused by Puccinia graminis f. sp. tritici (Pgt) Erikss. & Henning causes severe losses to wheat (Triticum aestivum L.), historically threatening global wheat production. Characterizing prevalent isolates of Pgt would enhance the knowledge of population dynamics and evolution of t...

  8. Exploding Stars and Stripes (United States)


    The discovery of a pattern of X-ray "stripes" in the remains of an exploded star may provide the first direct evidence that a cosmic event can accelerate particles to energies a hundred times higher than achieved by the most powerful particle accelerator on Earth. This result comes from a very long observation of the Tycho supernova remnant with NASA's Chandra X-ray Observatory. It could explain how some of the extremely energetic particles bombarding the Earth, called cosmic rays, are produced. "We've seen lots of intriguing structures in supernova remnants, but we've never seen stripes before," said Kristoffer Eriksen, a postdoctoral researcher at Rutgers University who led the study. "This made us think very hard about what's happening in the blast wave of this powerful explosion." This latest study from Chandra provides support for a theory about how magnetic fields can be dramatically amplified in such blast waves. In this theory, the magnetic fields become highly tangled and the motions of the particles very turbulent near the expanding supernova shock wave at the front edge of the supernova remnant. High-energy charged particles can bounce back and forth across the shock wave repeatedly, gaining energy with each crossing. Theoretical models of the motion of the most energetic particles -- which are mostly protons -- are predicted to leave a messy network of holes and dense walls corresponding to weak and strong regions of magnetic fields, respectively. The X-ray stripes discovered by the Chandra researchers are thought to be regions where the turbulence is greater and the magnetic fields more tangled than surrounding areas, and may be the walls predicted by the theory. Electrons become trapped in these regions and emit X-rays as they spiral around the magnetic field lines. However, the regular and almost periodic pattern of the X-ray stripes was not predicted by the theory. "It was a big surprise to find such a neatly arranged set of stripes," said co

  9. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat (United States)

    Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...

  10. Survey of evaluation methods for thermal striping in FBR structures

    International Nuclear Information System (INIS)

    Miura, Naoki; Nitta, Akito; Take, Kohji


    In the upper core structures or the sodium mixing tee of Fast Breeder Reactors, sodium mixing streams which are at different temperatures produce rapid temperature fluctuations, namely 'thermal striping', upon component surfaces, and it is apprehended that the high-cycle thermal fatigue causes the crack initiation and propagation. The thermal striping is one of the factors which is considered in FBR component design, however, the standard evaluation method has not built up yet because of the intricacy of that mechanism, the difficulty of an actual proof, the lack of data, and so on. In this report, it is intended to survey of the datails and the present situation of the evaluation method of crack initiation and propagation due to thermal striping, and study the appropriate method which will be made use of the rationalization of design. So it is ascertained that the method which use a quantitative prediction of crack propagation is optimum to evaluate the thermal striping phenomenon. (author)

  11. Protecting steel from rusting by rust. The mechanism of rust formation and its control

    International Nuclear Information System (INIS)

    Kimura, Masao


    Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)

  12. Assessing the variability of Red Stripe Disease in Louisiana sugarcane using precision agriculture methods (United States)

    Symptoms of red stripe disease caused by Acidovorax avenae subsp. avenae in Louisiana between 1985 and 2010 were limited to the leaf stripe form which caused no apparent yield loss. During 2010, the more severe top rot form was observed, and a study was initiated to investigate the distribution of r...

  13. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species (United States)

    Vaz Patto, Maria Carlota; Rubiales, Diego


    Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128

  14. Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species

    Directory of Open Access Journals (Sweden)

    Maria Carlota eVaz Patto


    Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.

  15. Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm. (United States)

    Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A


    Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.

  16. Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology. (United States)

    Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping


    While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P  rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P  rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.

  17. STRIPE: Remote Driving Using Limited Image Data (United States)

    Kay, Jennifer S.


    Driving a vehicle, either directly or remotely, is an inherently visual task. When heavy fog limits visibility, we reduce our car's speed to a slow crawl, even along very familiar roads. In teleoperation systems, an operator's view is limited to images provided by one or more cameras mounted on the remote vehicle. Traditional methods of vehicle teleoperation require that a real time stream of images is transmitted from the vehicle camera to the operator control station, and the operator steers the vehicle accordingly. For this type of teleoperation, the transmission link between the vehicle and operator workstation must be very high bandwidth (because of the high volume of images required) and very low latency (because delayed images can cause operators to steer incorrectly). In many situations, such a high-bandwidth, low-latency communication link is unavailable or even technically impossible to provide. Supervised TeleRobotics using Incremental Polyhedral Earth geometry, or STRIPE, is a teleoperation system for a robot vehicle that allows a human operator to accurately control the remote vehicle across very low bandwidth communication links, and communication links with large delays. In STRIPE, a single image from a camera mounted on the vehicle is transmitted to the operator workstation. The operator uses a mouse to pick a series of 'waypoints' in the image that define a path that the vehicle should follow. These 2D waypoints are then transmitted back to the vehicle, where they are used to compute the appropriate steering commands while the next image is being transmitted. STRIPE requires no advance knowledge of the terrain to be traversed, and can be used by novice operators with only minimal training. STRIPE is a unique combination of computer and human control. The computer must determine the 3D world path designated by the 2D waypoints and then accurately control the vehicle over rugged terrain. The human issues involve accurate path selection, and the

  18. An analysis of the risk of introduction of additional strains of the rust puccinia psidii Winter ('Ohi'a Rust) to Hawai'i (United States)

    Loope, Lloyd; La Rosa, Anne Marie


    In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant

  19. White pine blister rust resistance research in Minnesota and Wisconsin (United States)

    Andrew David; Paul Berrang; Carrie Pike


    The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...

  20. Sources of stem rust resistance in Ethiopian tetraploid wheat ...

    African Journals Online (AJOL)

    Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...

  1. White pine blister rust in the interior Mountain West (United States)

    Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle


    White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...

  2. Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii) (United States)

    Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas


    Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...

  3. HOW TO Identify White Pine Blister Rust and Remove Cankers (United States)

    Thomas H. Nicholls; Robert L. Anderson


    White pine blister rust (caused by the fungus Cronartium ribicola J. C. Fisch. ex Rabenh.) was introduced into the United States about 1900 and has since spread throughout the range of white pine. The disease intensity varies throughout the range but is normally most severe where late summers (July-September) are cool (below 67? F) and damp, conditions necessary for...

  4. Relationship of Soil Properties and Sugarcane Yields to Red Stripe in Louisiana. (United States)

    Johnson, Richard M; Grisham, Michael P; Warnke, Kathryn Z; Maggio, Jeri R


    Symptoms of red stripe disease caused by Acidovorax avenae subsp. avenae in Louisiana between 1985 and 2010 were limited to the leaf stripe form, which caused no apparent yield loss. During 2010, the more severe top rot form was observed, and a study was initiated to investigate the distribution of red stripe in the field and determine its effects on cane and sugar yields. Soil properties data, red stripe incidence, and sugarcane yields were all highly variable and were not randomly distributed in the field. Combined harvest data showed a negative correlation between yield components and red stripe incidence, with the strongest relationship between sucrose per metric ton and disease incidence. Red stripe incidence was positively correlated with several soil properties, including phosphorus, potassium, zinc, and calcium. Red stripe incidence also was found to increase with increasing nitrogen rate, with the greatest effects in heavy soils. Results also indicated that using red-stripe-infected cane as a seed source can significantly decrease shoot emergence, stalk population, and subsequent cane and sugar yields. These combined data suggest that red stripe disease can exhibit a highly variable rate of infection in commercial sugarcane fields and may also significantly decrease sugar yields.

  5. Identification of nine pathotype-specific genes conferring resistance to fusiform rust in loblolly pine (Pinus taeda L.) (United States)

    Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia


    Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...

  6. Distribution and frequency of Bru1, a major brown rust resistance gene, in the sugarcane world collection (United States)

    Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane worldwide. Molecular markers for a major brown rust resistance gene, Bru1, were used to screen a total of 1,282 clones in the World Collection of Sugarcane and Related Grasses (WCSRG) to determine the distribution and...

  7. Frequency and distribution of the brown rust resistance gene Bru1 and implications for the Louisiana sugarcane breeding programme (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is an important disease of sugarcane posing an increasing threat to sugarcane industries worldwide. A major gene, Bru1, has been shown to contribute a significant proportion of brown rust resistance in multiple sugarcane industries. The recent...

  8. Discovery of a novel stem rust resistance allele in durum wheat that exhibits differential reactions to Ug99 isolates (United States)

    Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...

  9. Genetic mapping of stem rust resistance to Puccinia graminis f. sp. tritici race TRTTF in the Canadian wheat cultivar 'Harvest' (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...

  10. The Stripe State in Cupratesa

    Directory of Open Access Journals (Sweden)

    Lee T.-K.


    Full Text Available Since the discovery of high temperature superconductors (HTS two decades ago, many anomalous properties have been reported. One of the most interesting properties is the possible existence of the stripe state consisting of one dimensional charge-density modulation coupled with some kind of spin ordering. X-ray and neutron scattering experiments and recently high resolution scanning tunneling microscopy have reported direct evidences of such a structure. In particular it has found in the La-Sr-Cu-O (LSCO family the existence of the half-doped stripe with average of half a hole in one charge modulation period below and about 1/8 hole density. These results have fueled the idea about the presence of these charge or spin density wave states competing with the superconducting phase in underdoped HTS. They may even contribute to the pairing mechanism. In this talk, we will demonstrate that the presence of these stripes is actually a natural consequence of the strongly interacting t-J model by using a variational approach which provides a good enough accuracy to address the subtle result. Furthermore we show that half-doped stripes could be stabilized in hole-doped systems if we assume a simple electron-phonon interaction to renormalize the electron mass. However we have not found any evidence to support half-doped stripes in electron-doped systems.

  11. Rusted Designs: The New Apron


    Swindells, Steve; Burcikova, Mila


    Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...

  12. Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.

    Directory of Open Access Journals (Sweden)

    Alfi Inayati


    Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.

  13. Detection, Occurrence, and Survey of Rice Stripe and Black-Streaked Dwarf Diseases in Zhejiang Province, China


    Heng-mu ZHANG; Hua-di WANG; Jian YANG; Michael J ADAMS; Jian-ping CHEN


    The major viral diseases that occur on rice plants in Zhejiang Province, eastern China, are stripe and rice black-streaked dwarf diseases. Rice stripe disease is only caused by rice stripe tenuivirus (RSV), while rice black-streaked dwarf disease can be caused by rice black-streaked dwarf fijivirus (RBSDV) and/or southern rice black-streaked dwarf fijivirus (SRBSDV). Here we review the characterization of these viruses, methods for their detection, and extensive surveys showing their occurren...

  14. Validação de escala diagramática para estimativa de desfolha provocada pela ferrugemasiática em soja Validation of diagrammatic scale for estimating defoliation caused by the Asian rust in soybeans

    Directory of Open Access Journals (Sweden)

    Mario Hirano


    Full Text Available Este estudo teve como objetivo avaliar a precisão e acurácia de avaliadores com o uso de escala diagramática, em estimativas de desfolha provocada por doenças em soja. A escala apresenta seis níveis de severidade de desfolha (5, 15, 45, 65, 85 e 100%. As imagens utilizadas para avaliação foram obtidas em parcelas atacadas por ferrugem asiática (Phakopsora pachyrhizi, apresentando diferentes níveis de desfolha. A validação foi feita por dez avaliadores, utilizando-se como parâmetro de comparação dados reais da área com cobertura foliar, obtidos através de processamento de imagens, nos softwares Paint Shop Pro 4, e Adobe Photoshop 7.0. Quando não foi utilizada a escala, os avaliadores apresentaram tendência de subestimar a severidade de desfolha nos níveis mais baixos e de superestimar em níveis altos. A acurácia e precisão dos avaliadores aumentaram com o auxílio da escala diagramática.This study aimed to evaluate the precision and accuracy of evaluators using diagrammatic scale to estimate defoliation caused by diseases in soybean. The scale had six levels of severity of defoliation (5, 15, 45, 65, 85 and 100%. The images used for evaluation were obtained in plots attacked by Asian soybean rust (Phakopsora pachyrhizi, presenting different levels of defoliation. The validation was performed by ten evaluators, comparing estimated data with the actual data of the area coverage leaf, obtained by processing images in Paint Shop Pro 4 software, and Adobe Photoshop 7.0. The evaluators presented tendency to underestimate the defoliation in the lower levels of severity and overestimate the defoliation in high levels of severity, when the scale was not used. The accuracy and precision of the evaluators increased with the use of the scale diagrammatic.

  15. Characterization of Brachypodium distachyon as a nonhost model against switchgrass rust pathogen Puccinia emaculata. (United States)

    Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S


    Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.

  16. Molecular mapping and improvement of leaf rust resistance in wheat breeding lines. (United States)

    Tsilo, Toi J; Kolmer, James A; Anderson, James A


    Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.

  17. Characterization of mild steel pre rusted and rust converted surfaces through advanced electrochemical analysis

    International Nuclear Information System (INIS)

    Riaz, F.; Rizvi, Z.H.; Arshad, K.


    The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)

  18. Screening for Sugarcane Brown Rust in the First Clonal Stage of the Canal Point Sugarcane Breeding Program

    Directory of Open Access Journals (Sweden)

    Duli Zhao


    Full Text Available Sugarcane (Saccharum spp. brown rust (caused by Puccinia melanocephala Syd. & P. Syd. was first reported in the United States in 1978 and is still one of the great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize breeding and selection strategies for disease resistance. Brown rust ratings were scaled from non-infection (0 to severe infection (4 with intervals of 0.5 and routinely recorded for genotypes in the first clonal selection stage of the Canal Point sugarcane breeding program in Florida. Data were collected from 14,272 and 12,661 genotypes and replicated check cultivars in 2012 and 2013, respectively. Mean rust rating, % infection, and severity in each family and progeny of female parent were determined, and their coefficients of variation (CV within and among families (females were estimated. Considerable variation exists in rust ratings among families or females. The families and female parents with high susceptibility or resistance to brown rust were identified and ranked. The findings of this study can help scientists to evaluate sugarcane crosses and parents for brown rust disease, to use desirable parents for crossing, and to improve genetic resistance to brown rust in breeding programs.

  19. Zebra: A striped network file system (United States)

    Hartman, John H.; Ousterhout, John K.


    The design of Zebra, a striped network file system, is presented. Zebra applies ideas from log-structured file system (LFS) and RAID research to network file systems, resulting in a network file system that has scalable performance, uses its servers efficiently even when its applications are using small files, and provides high availability. Zebra stripes file data across multiple servers, so that the file transfer rate is not limited by the performance of a single server. High availability is achieved by maintaining parity information for the file system. If a server fails its contents can be reconstructed using the contents of the remaining servers and the parity information. Zebra differs from existing striped file systems in the way it stripes file data: Zebra does not stripe on a per-file basis; instead it stripes the stream of bytes written by each client. Clients write to the servers in units called stripe fragments, which are analogous to segments in an LFS. Stripe fragments contain file blocks that were written recently, without regard to which file they belong. This method of striping has numerous advantages over per-file striping, including increased server efficiency, efficient parity computation, and elimination of parity update.

  20. Strategies for improving rust resistance in oats

    International Nuclear Information System (INIS)

    Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.


    During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)

  1. Using hierarchical clustering of secreted protein families to classify and rank candidate effectors of rust fungi.

    Directory of Open Access Journals (Sweden)

    Diane G O Saunders

    Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.

  2. Barberry rust survey – developing tools for diagnosis, analysis and data management

    DEFF Research Database (Denmark)

    Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring

    Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...

  3. Molecular mapping of a sunflower rust resistance gene from HAR6. (United States)

    Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A


    Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.

  4. Historic Rust College: Fulfilling a Mission. (United States)

    Hoffman, Carl


    Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…

  5. Screening oat populations for rust resistant mutants

    International Nuclear Information System (INIS)

    McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.


    In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)

  6. Multiple genotypes within aecial clusters in Puccinia graminis and Puccinia coronata: improved understanding of the biology of cereal rust fungi. (United States)

    Berlin, Anna; Samils, Berit; Andersson, Björn


    Cereal rust fungi ( Puccinia spp.) are among the most economically important plant pathogens. These fungi have a complex life cycle, including five spore stages and two hosts. They infect one grass host on which they reproduce clonally and cause the cereal rust diseases, while the alternate host is required for sexual reproduction. Although previous studies clearly demonstrate the importance of the alternate host in creating genetic diversity in cereal rust fungi, little is known about the amount of novel genotypes created in each successful completion of a sexual reproduction event. In this study, single sequence repeat markers were used to study the genotypic diversity within aecial clusters by genotyping individual aecial cups. Two common cereal rusts, Puccinia graminis causing stem rust and Puccinia coronata the causal agent of crown rust were investigated. We showed that under natural conditions, a single aecial cluster usually include several genotypes, either because a single pycnial cluster is fertilized by several different pycniospores, or because aecia within the cluster are derived from more than one fertilized adjoining pycnial cluster, or a combination of both. Our results imply that although sexual events in cereal rust fungi in most regions of the world are relatively rare, the events that occur may still significantly contribute to the genetic variation within the pathogen populations.

  7. Difference between Cr and Ni K-edge XANES spectra of rust layers formed on Fe-based binary alloys exposed to Cl-rich environment

    International Nuclear Information System (INIS)

    Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi


    The rust layer formed on weathering steel possesses a strong protective ability against corrosives in an atmospheres. This ability is related to the structure of the rust layer. The difference in the protective ability of a rust layer. The difference in the protective ability of a rust layer in a Cl-rich environment between conventional weathering steel containing Cr and advanced weathering steel containing Ni is believed to be caused by the differences in local structural and chemical properties between alloying elements. Cr and Ni, in the rust layer. In order to examine the effect of these alloying elements on the structure of the rust layer formed on steel in a Cl-rich environment, we have performed Cr and Ni K-edge X-ray absorption near-edge structure (XANES) measurements for the rust layer of Fe-Cr and Fe-Ni binary alloys exposed to a Cl-rich atmosphere using synchrotron radiation. The results of the Cr K-edge XANES measurements for the rust layer of Fe-Cr binary alloys show that the atomic geometry around Cr depends on the concentration of Cr. Therefore, it is expected that the local structure around Cr in the rust layer is unstable. On the other hand, from the results of the Ni K-edge XANES measurements for the rust layer of Fe-Ni binary alloys. Ni is considered to be positioned at a specific site in the crystal structure of a constituent of the rust layer, such as akaganeite or magnetite. As a consequence, Ni negligibly interacts with Cl - ions in the rust layer. (author)

  8. Relación entre Incidencia y Severidad de la Roya Asiática de la Soya Causada por Phakopsora pachyrhizi Sydow & Sydow Relationship Between Incidence and Severity of Asian Soybean Rust Caused by Phakopsora pachyrhizi Sydow & Sydow

    Directory of Open Access Journals (Sweden)

    Felipe Rafael Garcés Fiallos


    Full Text Available Se relaciona la incidencia con la severidad de la roya asiática de la soya, donde los valores generados por las ecuaciones pueden ser usados en cualquier estudio de este patosistema, proporcionando una herramienta para evaluar la incidencia como también la severidad. Se generaron gradientes de la enfermedad mediante el uso de fungicidas y momentos de aplicación, de manera preventiva y curativa. El experimento de campo con el cultivar Nidera 5909 RG, fue distribuido en bloques completos al azar. La intensidad de la roya asiática fue medida en los estratos inferior, medio y superior de la planta, a través de diferentes conteos de incidencia (porcentaje y severidad (lesiones cm-2, urédias cm-2 y porcentaje en folíolos. Las regresiones realizadas, presentaron una correlación significativa entre incidencia y severidad a 1% de probabilidad. Con los datos obtenidos, el evaluador puede escoger el método de cuantificación mas razonable o confiable a su criterio para otros trabajos de investigación o aplicar un determinado control de la enfermedad, utilizando las ecuaciones lineales generadas, facilitando el trabajo de cuantificar la roya asiática, bien se busque medir la incidencia (% o el número de lesiones cm-2, urédias cm-2 o severidad (%.Incidence is related to severity of the Asian soybean rust, where values generated by the equations can be used in any study of this pathosystem, providing a tool to evaluate incidence as well severity. Gradients of the disease were generated by means of the use of fungicides and moments of application, in a preventive and curative way. The field experiment with the cultivar Nidera RG 5909, was distributed in a randomized complete block. The intensity of Asian rust layers was measured in the lower, middle and top of the plant, through various counts of incidence (percentage and severity (lesions cm-2, uredinia cm-2 and percentage in leaflets. The regressions showed a significant correlation between

  9. First report of the white pine blister rust fungus, Cronartium ribicola, infecting Pinus flexilis on Pine Mountain, Humboldt National Forest, Elko County, northeastern Nevada, U.S.A. (United States)

    Detlev R. Vogler; Patricia E. Maloney; Tom Burt; Jacob W. Snelling


    In 2013, while surveying for five-needle white pine cone crops in northeastern Nevada, we observed white pine blister rust, caused by the rust pathogen Cronartium ribicola Fisch., infecting branches and stems of limber pines (Pinus flexilis James) on Pine Mountain (41.76975°N, 115.61622°W), Humboldt National Forest,...

  10. Blister rust resistance among 19 families of whitebark pine, Pinus albicaulis, from Oregon and Washington – early results from an artificial inoculation trial (United States)

    Angelia Kegley; Richard A. Sniezko; Robert Danchok; Douglas P. Savin


    Whitebark pine is considered one of the most susceptible white pine species to white pine blister rust, the disease caused by the non-native pathogen Cronartium ribicola. High mortality from blister rust and other factors in much of the range in the United States and Canada have raised serious concerns about the future viability of this high-...

  11. Determination of Radiographic Healing: An Assessment of Consistency Using RUST and Modified RUST in Metadiaphyseal Fractures. (United States)

    Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel


    To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate

  12. Innovative CO2 LASER-Based Pavement Striping and Stripe Removal (United States)


    This is a Technical Report of an FY2014 NDOT funded project on Innovative CO2 Laserbased Pavement Striping and Stripe Removal. The project was concerned with adopting the laser technology for pavement stripe and markers removal and inferring on its e...

  13. Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust

    Directory of Open Access Journals (Sweden)

    M. Jiriaie


    Full Text Available Introduction: Wheat is one of the major agricultural crops with respect to human nutrition. It is cultivated over a wide range of environments, because of wide adaptation to diverse environmental conditions. In Iran, 6.2 million hectares are under wheat cultivation, of which 33% is irrigated and 67% is rain-fed, the irrigated wheat growing areas (2 million hectares are located mostly in southern, central and east of Iran Production of crops is under the influence of plant genetic structure, environmental conditions and their interactions. Biotic and abiotic stresses are considered to lower production. Among the biotic stress, the fungal disease is the main factor limiting production of crop plants in hot and humid regions. Stripe rust was not a serious economic concern to the wheat industry for most of the 1990’s due to the use of resistant varieties. However, by 2003 it had developed into a significant issue, particularly as new path types evolved. Even in the dry years of 2003 and 2004, stripe rust cost growers significant income. Provide country's need for wheat as a strategic product, meanwhile, production is free from chemical fungicide is a high but achievable goal. So in order to achieve fertilizer and fungicide resources that in addition to having no adverse effects on consumers and the environment, has been economically able to provide nutrition need of crop plant, is very important. Materials and Methods: With this approach, to survey the effect of Mycorrhiza and Azospirillum in resistance to yellow rust in wheat cultivars, an experiment was conducted at the research station of the Shahid Chamran University of Ahvaz, Iran in 2012-13. The experimental design was factorial based on a randomized complete block design with three replications. The treatments include of Mycorrhiza fungi in three levels (without application of Mycorrhiza strain and using strain Glomus intraradices and Glomus mosseae, Azospirillum lipoferum bacterium in two

  14. Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL. (United States)

    Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S


    Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.

  15. Structure of titanium-doped goethite rust

    International Nuclear Information System (INIS)

    Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.


    To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel

  16. Genome-Wide Association Mapping of Leaf Rust Response in a Durum Wheat Worldwide Germplasm Collection. (United States)

    Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis


    Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.

  17. Molecular and genetic study of wheat rusts

    African Journals Online (AJOL)

    Nicholas Le Maitre

    Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.

  18. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)


    Aug 20, 2014 ... 3Present Address: Department of Agricultural, Food and Nutritional Science, University of Alberta, ... 4Crop Diseases Research Program, National Agricultural Research .... PCR amplified products were resolved on 1.5–3%.

  19. Genetic analysis and location of gene for resistance to stripe rust in ...

    Indian Academy of Sciences (India)


    Aug 6, 2013 ... Institute of Plant Protection, Chinese Academy of Agriculture Science, No 2, West ... The molecular marker Xbarc59 closely linked to the gene YrSD could be ... and a minor resistance gene postulated in it (Calonnec et al.

  20. Molecular mapping of stripe rust resistance gene Yr51 in chromosome 4AL of wheat

    Czech Academy of Sciences Publication Activity Database

    Randhawa, M.; Bansal, U.; Valárik, Miroslav; Klocová, Barbora; Doležel, Jaroslav; Bariana, H.


    Roč. 127, č. 2 (2014), s. 317-324 ISSN 0040-5752 R&D Projects: GA ČR GAP501/10/1740; GA MŠk(CZ) LO1204 Institutional support: RVO:61389030 Keywords : TRITICUM-AESTIVUM L. * DIVERSITY ARRAYS * MAP Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.790, year: 2014

  1. Allelic variation at loci controlling stripe rust resistance in spring wheat

    Indian Academy of Sciences (India)

    ... National Agricultural Research Centre, Islamabad 45500, Pakistan; National Institute for Genomics & Advanced Biotechnology, National Agricultural Research Centre, Park Road, Islamabad 45500, Pakistan; Department of Agricultural, Food and Nutritional Science, University of Alberta, Edmonton, AB T6G 2P5, Canada ...

  2. Rust Inhibitor And Fungicide For Cooling Systems (United States)

    Adams, James F.; Greer, D. Clay


    Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.

  3. A genome-wide association study of field and seedling response to stem rust pathogen races reveals combinations of race-specific resistance genes in North American spring wheat (United States)

    Stem rust of wheat caused by the fungal pathogen Puccinia graminis f. sp. tritici historically caused major yield losses of wheat worldwide. To understand the genetic basis of stem rust resistance in conventional North American spring wheat, genome-wide association analysis (GWAS) was conducted on a...

  4. Bulk temperature measurement in thermally striped pipe flows

    International Nuclear Information System (INIS)

    Lemure, N.; Olvera, J.R.; Ruggles, A.E.


    The hot leg flows in some Pressurized Water Reactor (PWR) designs have a temperature distribution across the pipe cross-section. This condition is often referred to as a thermally striped flow. Here, the bulk temperature measurement of pipe flows with thermal striping is explored. An experiment is conducted to examine the feasibility of using temperature measurements on the external surface of the pipe to estimate the bulk temperature of the flow. Simple mixing models are used to characterize the development of the temperature profile in the flow. Simple averaging techniques and Backward Propagating Neural Net are used to predict bulk temperature from the external temperature measurements. Accurate bulk temperatures can be predicted. However, some temperature distributions in the flow effectively mask the bulk temperature from the wall and cause significant error in the bulk temperature predicted using this technique

  5. Environment-Friendly Control of Pear Scab and Rust Using Lime Sulfur

    Directory of Open Access Journals (Sweden)

    Ju Hoon Cha


    Full Text Available Pear scab and rust are the major diseases causing severe epidemics in organic cultivation of pear trees. Incidences of pear scab and rust were compared in organically managed plots and conventionally managed plots to obtain optimum application schedule of environment-friendly control agents in organically managed plots. Organically cultural practice with 10 time-applications of lime sulfur and Bordeaux mixture showed higher than 40% of control efficacies of pear scab and rust compared to conventionally cultural practice. Organically cultural practice with 8 time-applications of lime sulfur considering weather condition showed higher than 30% of control efficacies of pear scab compared to conventionally cultural practice. The results suggest that proper application of environment-friendly control agents such as lime sulfur considering weather condition will enable effective control of the major diseases for organic cultivation of pear.

  6. Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris). (United States)

    Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R


    Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

  7. Are stripes beneficial? Dazzle camouflage influences perceived speed and hit rates.

    Directory of Open Access Journals (Sweden)

    Bettina von Helversen

    Full Text Available In the animal kingdom, camouflage refers to patterns that help potential prey avoid detection. Mostly camouflage is thought of as helping prey blend in with their background. In contrast, disruptive or dazzle patterns protect moving targets and have been suggested as an evolutionary force in shaping the dorsal patterns of animals. Dazzle patterns, such as stripes and zigzags, are thought to reduce the probability with which moving prey will be captured by impairing predators' perception of speed. We investigated how different patterns of stripes (longitudinal-i.e., parallel to movement direction-and vertical-i.e., perpendicular to movement direction affect the probability with which humans can hit moving objects and if differences in hitting probability are caused by a misperception of speed. A first experiment showed that longitudinally striped objects were hit more often than unicolored objects. However, vertically striped objects did not differ from unicolored objects. A second study examining the link between perceived speed and hitting probability showed that longitudinally and vertically striped objects were both perceived as moving faster and were hit more often than unicolored objects. In sum, our results provide evidence that striped patterns disrupt the perception of speed, which in turn influences how often objects are hit. However, the magnitude and the direction of the effects depend on additional factors such as speed and the task setup.

  8. Effectors from Wheat Rust Fungi Suppress Multiple Plant Defense Responses. (United States)

    Ramachandran, Sowmya R; Yin, Chuntao; Kud, Joanna; Tanaka, Kiwamu; Mahoney, Aaron K; Xiao, Fangming; Hulbert, Scot H


    Fungi that cause cereal rust diseases (genus Puccinia) are important pathogens of wheat globally. Upon infection, the fungus secretes a number of effector proteins. Although a large repository of putative effectors has been predicted using bioinformatic pipelines, the lack of available high-throughput effector screening systems has limited functional studies on these proteins. In this study, we mined the available transcriptomes of Puccinia graminis and P. striiformis to look for potential effectors that suppress host hypersensitive response (HR). Twenty small (wheat, confirming its activity in a homologous system. Overall, this study provides the first evidence for the presence of effectors in Puccinia species suppressing multiple plant defense responses.

  9. Somatic recombination in wheat stem rust leads to virulence for Ug99-effective SR50 resistance (United States)

    Race-specific resistance genes protect much of the global wheat crop from stem rust disease caused by Puccinia graminis f. sp. tritici (Pgt), but often break down due to evolution of new virulent pathogen races. To understand the molecular mechanisms of virulence evolution in Pgt we identified the p...

  10. Label-Free Detection of Soybean Rust Spores using Photonic Crystal Biosensors (United States)

    Soybean rust, caused by the fungus Phakopsora pachyrhizi, is one of the most devastating foliar diseases affecting soybeans grown worldwide. The disease was reported for the first time in the United States in 2004. Early spore detection, prior to the appearance of visible symptoms, is critical to ef...

  11. Sources of stem rust resistance in wheat-alien introgression lines (United States)

    Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...

  12. Identification of RAPD marker associated with brown rust resistance in sugarcane (United States)

    Susceptibility to brown rust caused by Puccinia melanocephala is a major reason for the withdrawal of sugarcane cultivars from production. An efficient way to control the disease is to breed cultivars with durable resistance. Our aim was to identify random amplified polymorphic DNA (RAPD) markers ...

  13. Genotyping Sugarcane for the Brown Rust Resistance Locus Bru1 Using Unlabeled Probe Melting (United States)

    Brown rust, caused by the fungus Puccinia melanocephala, is a major disease of sugarcane (Saccharum spp.) in Florida, Louisiana, and other sugarcane growing regions. The Bru1 locus has been used as a durable and effective source of resistance, and markers are available to select for the trait. The...

  14. Rust resistance in seedling families of Pinus albicaulis and Pinus strobiformis and implications for restoration (United States)

    R. A. Sniezko; A. Kegley; R. Danchok; J. Hamlin; J. Hill; D. Conklin


    Infection and mortality levels from Cronartium ribicola, the fungus causing white pine blister rust, are very high in parts of the geographic range of Pinus albicaulis (whitebark pine) and P. strobiformis (Southwestern white pine). Genetic resistance to this non-native fungus will be one of the key factors in maintaining or restoring populations of these species in...

  15. URS Brava – a new oat cultivar with partial resistance to crown rust

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Federizzi


    Full Text Available The cultivar URS Brava, obtained from a simple cross between the line ‘UFRGS 995078-2’ and the cultivar ‘URS 21’, shows high grain yield and stability, high grain quality, desirable agronomical traits and partial resistance to crown rust, caused by the fungus Puccinia coronata f. sp. avenae.

  16. Preempting the pathogen: Blister rust and proactive management of high-elevation pines (United States)

    Sue Miller; Anna Schoettle; Kelly Burns; Richard Sniezko; Patty Champ


    White pine blister rust has been spreading through western forests since 1910, causing widespread mortality in a group that includes some of the oldest and highest-elevation pines in the United States. The disease has recently reached Colorado and is expected to travel through the southern Rockies. Although it cannot be contained, RMRS researchers and collaborators are...

  17. Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823 (United States)

    Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance to P. pachyrhizi conditioned by Rpp genes has been found in numerous soybean accessions, and at...

  18. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39. (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  19. Limber pine forests on the leading edge of white pine blister rust distribution in Northern Colorado (United States)

    Jennifer G. Klutsch; Betsy A. Goodrich; Anna W. Schoettle


    The combined threats of the current mountain pine beetle (Dendroctonus ponderosae, MPB) epidemic with the imminent invasion of white pine blister rust (caused by the non-native fungus Cronartium ribicola, WPBR) in limber pine (Pinus flexilis) forests in northern Colorado threatens the limber pine's regeneration cycle and ecosystem function. Over one million...

  20. Stock characteristics of Hudson River striped bass

    International Nuclear Information System (INIS)

    Hoff, T.B.; McLaren, J.B.; Cooper, J.C.


    Striped bass, because of their tremendous popularity both commercially and recreationally, were a principal focus of the Hudson River power plant case. Between 1976 and 1979, over 23,000 age-II and older striped bass were studied as one facet of an extensive research program on the spring population in the Hudson River. Samples were collected from the overwintering as well as the spawning portion of the striped bass population, and included immature as well as mature fish. At least 12 age-groups contributed to spawning each year. Of these 12, age-groups III, IV, and V usually were most abundant, but the percentage of the population represented by any single age-group varied as the result of fluctuations in year-class strength. Males first became sexually mature at age II and females at age IV. Fast-growing individuals within a year class tended to mature earlier. Fecundity increased with the size of fish, reaching an observed maximum of about 3 million eggs per female. Although significant annual variations in maturity and growth were detected for Hudson River striped bass, there was no evidence of a consistent change in either variable that might be associated with increasing power plant operations and a reduction in striped bass abundance. Age at maturity and age structure are the two life history components that differ the most between the Hudson River population and other striped bass populations. 36 refs., 7 tabs

  1. Frequency of comandra blister rust infection episodes on lodgepole pine (United States)

    William R. Jacobi; Brian W. Geils; Jane E. Taylor


    Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...

  2. development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)


    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  3. Development of wheat germplasm for stem rust resistance in eastern ...

    African Journals Online (AJOL)

    Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...

  4. Molecular and genetic study of wheat rusts | Le Maitre | African ...

    African Journals Online (AJOL)

    Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...

  5. Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...

  6. Heritable, De Novo Resistance to Leaf Rust and Other Novel Traits in Selfed Descendants of Wheat Responding to Inoculation with Wheat Streak Mosaic Virus (United States)

    Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.


    Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941

  7. Assessing the Effects of Suomi NPP VIIRS M15/M16 Detector Radiometric Stability and Relative Spectral Response Variation on Striping

    Directory of Open Access Journals (Sweden)

    Zhuo Wang


    Full Text Available Modern satellite radiometers have many detectors with different relative spectral response (RSR. Effect of RSR differences on striping and the root cause of striping in sensor data record (SDR radiance and brightness temperature products have not been well studied. A previous study used MODTRAN radiative transfer model (RTM to analyze striping. In this study, we make efforts to find the possible root causes of striping. Line-by-Line RTM (LBLRTM is used to evaluate the effect of RSR difference on striping and the atmospheric dependency for VIIRS bands M15 and M16. The results show that previous study using MODTRAN is repeatable: the striping is related to the difference between band-averaged and detector-level RSR, and the BT difference has some atmospheric dependency. We also analyzed VIIRS earth view (EV data with several striping index methods. Since the EV data is complex, we further analyze the onboard calibration data. Analysis of Variance (ANOVA test shows that the noise along track direction is the major reason for striping. We also found evidence of correlation between solar diffuser (SD and blackbody (BB for detector 1 in M15. Digital Count Restoration (DCR and detector instability are possibly related to the striping in SD and EV data, but further analysis is needed. These findings can potentially lead to further SDR processing improvements.

  8. Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean

    Directory of Open Access Journals (Sweden)

    Oscar P. Hurtado-Gonzales


    Full Text Available Bean rust, caused by Uromyces appendiculatus, is a devastating disease of common bean (Phaseolus vulgaris in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3. An F2 population from the cross Pinto 114 (susceptible × Aurora (resistant with Ur-3 was evaluated for its reaction to four different races of U. appendiculatus. A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3. Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3. This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean.

  9. Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean. (United States)

    Hurtado-Gonzales, Oscar P; Valentini, Giseli; Gilio, Thiago A S; Martins, Alexandre M; Song, Qijian; Pastor-Corrales, Marcial A


    Bean rust, caused by Uromyces appendiculatus , is a devastating disease of common bean ( Phaseolus vulgaris ) in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3 An F 2 population from the cross Pinto 114 (susceptible) × Aurora (resistant with Ur-3 ) was evaluated for its reaction to four different races of U. appendiculatus A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3 Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3 This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean. Copyright © 2017 Hurtado-Gonzales et al.

  10. Protein modeling of yellow rust disease in wheat

    International Nuclear Information System (INIS)

    Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.


    Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)

  11. Identification of Green Rust in Groundwater

    DEFF Research Database (Denmark)

    Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud


    to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...

  12. Comparison of multi- and hyperspectral imaging data of leaf rust infected wheat plants (United States)

    Franke, Jonas; Menz, Gunter; Oerke, Erich-Christian; Rascher, Uwe


    In the context of precision agriculture, several recent studies have focused on detecting crop stress caused by pathogenic fungi. For this purpose, several sensor systems have been used to develop in-field-detection systems or to test possible applications of remote sensing. The objective of this research was to evaluate the potential of different sensor systems for multitemporal monitoring of leaf rust (puccinia recondita) infected wheat crops, with the aim of early detection of infected stands. A comparison between a hyperspectral (120 spectral bands) and a multispectral (3 spectral bands) imaging system shows the benefits and limitations of each approach. Reflectance data of leaf rust infected and fungicide treated control wheat stand boxes (1sqm each) were collected before and until 17 days after inoculation. Plants were grown under controlled conditions in the greenhouse and measurements were taken under consistent illumination conditions. The results of mixture tuned matched filtering analysis showed the suitability of hyperspectral data for early discrimination of leaf rust infected wheat crops due to their higher spectral sensitivity. Five days after inoculation leaf rust infected leaves were detected, although only slight visual symptoms appeared. A clear discrimination between infected and control stands was possible. Multispectral data showed a higher sensitivity to external factors like illumination conditions, causing poor classification accuracy. Nevertheless, if these factors could get under control, even multispectral data may serve a good indicator for infection severity.

  13. 75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties (United States)


    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...

  14. 76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties (United States)


    ...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...

  15. A survey of poplar (populus nigra rust and identification of fungal agent species with conventional and molecular approaches in Maragheh area of Iran.

    Directory of Open Access Journals (Sweden)

    Seyed Mohsen Damadi


    Full Text Available In a survey for rust diseases in Maragheh area rust symptoms were observed on poplars (Populus nigra in Maragheh city parks and orchards near the city. Uredinia and urediniospores typical of Melampsora were present on the underside of leaves. Paraphyses were clavate with walls evenly thick and Telia, formed on the leaves early in the autumn, were epiphyllous and subepidermal. DNA was extracted from urediniospores and the primers ITS1 and ITS4 were used to amplify the internal transcribed spacer region of the ribosomal DNA. Based on the key provided by Bagyanarayana and the species description by Pei and Shang, and the result of sequencing, the causal agent was identified as Melampsora allii-populina Kelb. Melampsora species are mainly determined based on their morphology, alternate hosts and telial host range. However, in most cases, only one or two spore stages could be found at the time of observation and there is no information of the alternate hosts. This is the first study of poplar rust disease to the species level in the area. Rust disease is likely to be the most important disease on poplar in this area. As poplar rust can cause severe damages to nursery plants and young trees, there must be further research to understand the epidemiology of the rust disease. A key question to be answered is whether the rust goes through a full life-cycle, possible via known alternate host Allium spp. or only uredinial and telial stages are present in the studied area.

  16. Rust dissolution and removal by iron-reducing bacteria: A potential rehabilitation of rusted equipment

    International Nuclear Information System (INIS)

    Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.


    Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.

  17. Zoete rust : Een muzikale soap-detective

    NARCIS (Netherlands)

    Maas, P.


    De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc

  18. Induced mutations for soybean rust resistance

    International Nuclear Information System (INIS)

    Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.


    Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)

  19. Non-Ribes alternate hosts of white pine blister rust: What this discovery means to whitebark pine (United States)

    Paul J. Zambino; Bryce A. Richardson; Geral I. McDonald; Ned B. Klopfenstein; Mee-Sook. Kim


    From early to present-day outbreaks, white pine blister rust caused by the fungus Cronartium ribicola, in combination with mountain pine beetle outbreaks and fire exclusion has caused ecosystem-wide effects for all five-needled pines (McDonald and Hoff 2001). To be successful, efforts to restore whitebark pine will require sound management decisions that incorporate an...

  20. Contact angle hysteresis on superhydrophobic stripes. (United States)

    Dubov, Alexander L; Mourran, Ahmed; Möller, Martin; Vinogradova, Olga I


    We study experimentally and discuss quantitatively the contact angle hysteresis on striped superhydrophobic surfaces as a function of a solid fraction, ϕS. It is shown that the receding regime is determined by a longitudinal sliding motion of the deformed contact line. Despite an anisotropy of the texture the receding contact angle remains isotropic, i.e., is practically the same in the longitudinal and transverse directions. The cosine of the receding angle grows nonlinearly with ϕS. To interpret this we develop a theoretical model, which shows that the value of the receding angle depends both on weak defects at smooth solid areas and on the strong defects due to the elastic energy of the deformed contact line, which scales as ϕS(2)lnϕS. The advancing contact angle was found to be anisotropic, except in a dilute regime, and its value is shown to be determined by the rolling motion of the drop. The cosine of the longitudinal advancing angle depends linearly on ϕS, but a satisfactory fit to the data can only be provided if we generalize the Cassie equation to account for weak defects. The cosine of the transverse advancing angle is much smaller and is maximized at ϕS ≃ 0.5. An explanation of its value can be obtained if we invoke an additional energy due to strong defects in this direction, which is shown to be caused by the adhesion of the drop on solid sectors and is proportional to ϕS(2). Finally, the contact angle hysteresis is found to be quite large and generally anisotropic, but it becomes isotropic when ϕS ≤ 0.2.

  1. Cytological and molecular analysis of nonhost resistance in rice to wheat powdery mildew and leaf rust pathogens. (United States)

    Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng


    Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.

  2. Induced mutations for tolerance of oats to crown rust

    International Nuclear Information System (INIS)

    Simons, M.D.; Frey, K.J.


    Seeds of three oat (Avena sativa and A. abyssinica) strains were treated with ethyl methanesulphonate (EMS), and crown rust (caused by Puccinia coronata var. avenae) tolerance ratios of M 5 -derived lines were compared with untreated checks. Tolerance ratios of mutant lines tended to be distributed in both plus and minus directions. No mutant oat line had a significant increase in grain yield, but many showed significantly depressed yields. With C.I. 6665, only five of 130 mutagen-derived lines were not significantly below the check for grain yield; one of these had significantly improved tolerance. Re-treatment of selected strains from a previous EMS treatment (original cultivar was Clintland-60) gave one M 5 -derived oat line (of 100 tested) that was equal to Clintland-60 in grain yield and sustained no damage from crown rust (i.e. it had a tolerance ratio of 100). EMS treatment of the highly susceptible tetraploid C.I. 2110 resulted in both significantly increased and reduced tolerance. (author)

  3. Modification of tolerance of oats to crown rust induced by chemical mutagens

    International Nuclear Information System (INIS)

    Simons, M.D.; Browning, J.A.; Frey, K.J.


    Seeds of crown rust (Puccinia coronata) susceptible cultivated oats (Avena sativa) were treated with the mutagenic chemical ethyl methanesulphonate (EMS), and pure lines derived from these treated seeds were tested in later generations for the relative amount of reduction in yield and seed weight caused by crown rust infection. In the absence of crown rust, the yield of most of the treated lines was greatly reduced. The overall means of the treated lines for both yield and seed weight response to infection were significantly lower than the control, but 10 lines significantly exceeded the control for yield response and 15 exceeded it for seed weight response. Recurrent EMS treatment of once-treated lines rated as tolerant resulted in groups of lines that were more tolerant, on the average, than groups of lines from recurrently treated lines rated as susceptible. A few of the recurrently treated individual lines derived from tolerant parents had a higher degree of tolerance than their parental lines. EMS treatment of diploid (A. strigosa) and tetraploid (A. abyssinica) oats resulted in groups of lines showing significant genetic variance for response to crown rust, indicating that treatment had induced real genetic change. A few diploid lines were a little more tolerant than their control, but none of the tetraploid lines showed any consistent improvement. (author)

  4. Flavonoid Accumulation Plays an Important Role in the Rust Resistance of Malus Plant Leaves

    Directory of Open Access Journals (Sweden)

    Yanfen Lu


    Full Text Available Cedar-apple rust (Gymnosporangium yamadai Miyabe is a fungal disease that causes substantial injury to apple trees and results in fruit with reduced size and quality and a lower commercial value. The molecular mechanisms underlying the primary and secondary metabolic effects of rust spots on the leaves of Malus apple cultivars are poorly understood. Using HPLC, we found that the contents of flavonoid compounds, especially anthocyanin and catechin, were significantly increased in rust-infected symptomatic tissue (RIT. The expression levels of structural genes and MYB transcription factors related to flavonoid biosynthesis were one- to seven-fold higher in the RIT. Among these genes, CHS, DFR, ANS, FLS and MYB10 showed more than a 10-fold increase, suggesting that these genes were expressed at significantly higher levels in the RIT. Hormone concentration assays showed that the levels of abscisic acid (ABA, ethylene (ETH, jasmonate (JA and salicylic acid (SA were higher in the RIT and were consistent with the expression levels of McNCED, McACS, McLOX and McNPR1, respectively. Our study explored the complicated crosstalk of the signal transduction pathways of ABA, ETH, JA and SA; the primary metabolism of glucose, sucrose, fructose and sorbitol; and the secondary metabolism of flavonoids involved in the rust resistance of Malus crabapple leaves.

  5. DNA methylation profiles correlated to striped bass sperm fertility (United States)

    Striped bass (Morone saxatilis) spermatozoa are used to fertilize in vitro the eggs of white bass (Morone chrysops) to produce the preferred hybrid for the striped bass aquaculture industry. Currently, only one source of domestic striped bass juveniles are available to growers that are not obtained ...

  6. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat. (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang


    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  7. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang


    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  8. Audiogram of a striped dolphin (Stenella coeruleoalba)

    NARCIS (Netherlands)

    Kastelein, R.A.; Hagedoorn, M.; Au, W.W.L.; Haan, de D.


    The underwater hearing sensitivity of a striped dolphin was measured in a pool using standard psycho-acoustic techniques. The go/no-go response paradigm and up¿down staircase psychometric method were used. Auditory sensitivity was measured by using 12 narrow-band frequency-modulated signals having

  9. Fermi-surface reconstruction by stripe order in cuprate superconductors (United States)

    Laliberté, Francis


    The origin of pairing in a superconductor resides in the underlying normal state. In the cuprate high-temperature superconductor YBCO, application of a magnetic field to suppress superconductivity reveals a ground state that appears to break the translational symmetry of the lattice, pointing to some density-wave order [1,2,3]. In another cuprate, Eu-LSCO, the onset of stripe order - a modulation of spin and charge densities - at low temperature is well established [4]. By a comparative study of thermoelectric transport in the cuprates YBCO and Eu-LSCO, we show that the two materials exhibit a very similar process of Fermi-surface reconstruction as a function of temperature and doping [5,6]. This strongly suggests that Fermi-surface reconstruction is caused by stripe order in both cases, compelling evidence that stripe order is a generic tendency of hole-doped cuprates.[4pt] Work done in collaboration with J. Chang, N. Doiron-Leyraud, E. Hassinger, R. Daou, D. LeBoeuf, M. Rondeau, B. J. Ramshaw, R. Liang, D. A. Bonn, W. N. Hardy, S. Pyon, T. Takayama, H. Takagi, I. Sheikin, L. Malone, C. Proust, K. Behnia and L. Taillefer.[4pt] [1] N. Doiron-Leyraud et al., Nature 447, 565 (2007).[0pt] [2] D. LeBoeuf et al., Nature 450, 533 (2007).[0pt] [3] D. LeBoeuf et al., Phys. Rev. B 83, 054506 (2011).[0pt] [4] J. Fink et al., Phys. Rev. B 83, 092503 (2011).[0pt] [5] J. Chang et al., Phys. Rev. Lett. 104, 057005 (2010).[0pt] [6] F. Lalibert'e et al., Nat. Commun. 2, 432 (2011).

  10. Breakup Behavior of a Capillary Bridge on a Hydrophobic Stripe Separating Two Hydrophilic Stripes (United States)

    Hartmann, Maximilian; Hardt, Steffen


    The breakup dynamics of a capillary bridge on a hydrophobic area between two liquid filaments occupying two parallel hydrophilic stripes is studied experimentally. In addition calculations with the finite-element software Surface Evolver are performed to obtain the corresponding stable minimal surfaces. Droplets of de-ionized water are placed on substrates with alternating hydrophilic and hydrophobic stripes of different width. Their volume decreases by evaporation. This results in a droplet shaped as the letter ``H'' covering two hydrophilic stripes separated by one hydrophobic stripe. The width of the capillary bridge d(t) on the hydrophobic stripe during the breakup process is observed using a high-speed camera mounted on a bright-field microscope. The results of the experiments and the numerical studies show that the critical width dcrit, indicating the point where the capillary bridge becomes unstable, mainly depends on the width ratio of the hydrophilic and hydrophobic stripes. It is found that the time derivative of d(t) first decreases after dcrit has been reached. The final breakup dynamics then follows a t 2 / 3 scaling. We kindly acknowledge the financial support by the German Research Foundation (DFG) within the Collaborative Research Centre 1194 ``Interaction of Transport and Wetting Processes'', Project A02a.

  11. Efeito de fungicidas cúpricos, aplicados isoladamente ou em combinação com mancozeb, na expressão de sintomas de fitotoxicidade e controle da ferrugem causada por Puccinia psidii em goiabeira Effect of copper fungicides, sprayed alone or in combination with mancozeb, in expression of phytotoxicity symptoms and rust control caused by Puccinia psidii in guava

    Directory of Open Access Journals (Sweden)

    Antonio de Goes


    used in Experiment 1, plus a treatment with tebucunazole in order to evaluate the rust control. In Experiment 1 none of the fungicides tested caused phytotoxicity symptoms and abortion of fruits less than 15 mm in diameter. The fungicides caused higher phytotoxicity in fruits between 25 and 35 mm but not in fruits larger than 40 mm diameter. Copper fungicides combined with mancozeb lead to a slight toxicity, but when applied the mancozeb alone did not lead to phytotoxicity sympton. In The Experiment 2, it was observed that copper fungicides applied alone were efficient to control rust as well as the combination of mancozeb and cuprous oxide or hydroxide and the fungicide tebuconazole.

  12. Post-epizootic chronic dolphin morbillivirus infection in Mediterranean striped dolphins Stenella coeruleoalba. (United States)

    Soto, Sara; Alba, Ana; Ganges, Llilianne; Vidal, Enric; Raga, Juan Antonio; Alegre, Ferrán; González, Beatriz; Medina, Pascual; Zorrilla, Irene; Martínez, Jorge; Marco, Alberto; Pérez, Mónica; Pérez, Blanca; Pérez de Vargas Mesas, Ana; Martínez Valverde, Rosa; Domingo, Mariano


    Dolphin morbillivirus (DMV) has caused 2 epizootics with high mortality rates on the Spanish Mediterranean coast, in 1990 and 2006-07, mainly affecting striped dolphins Stenella coeruleoalba. Following the first epizootic unusual DMV infections affecting only the central nervous system of striped dolphins were found, with histological features similar to subacute sclerosing panencephalitis and old dog encephalitis, the chronic latent localised infections caused by defective forms of measles virus and canine distemper virus, respectively. Between 2008 and 2010, monitoring by microscopic and immunohistochemical (IHC) studies of 118 striped dolphins stranded along Catalonia, the Valencia Region and Andalusia showed similar localised DMV nervous system infections in 25.0, 28.6 and 27.4% of cases, respectively, with no significant differences among regions or sex. The body length of DMV-infected dolphins was statistically greater than that of non-infected dolphins (196.5 vs. 160.5 cm; p dolphins with positive IHC-DMV had positive PCR results. All 6 cases were positive with the 78 bp RT-PCR. These findings contraindicate the use of the 429 bp RT-PCR protocol based on the P gene to detect this specific form of DMV. DMV localised nervous infection constitutes the most relevant single cause of stranding and death in Mediterranean striped dolphins in the years following a DMV epizootic, and it might even overwhelm the effects of the epizootic itself, at least in 2007.

  13. Waste management regroups units into Rust International

    International Nuclear Information System (INIS)

    Kirschner, E.


    Three Waste Management (Oak Brook, IL) subsidiaries have proposed merging units from Chemical Waste Management (CWM) and Wheelabrator Technologies with the Brand Companies (Park Ridge, IL). Waste Management says the new company, to be called Rust International, will become one of the US's largest environmental consulting and infrastructure organizations and will include design and construction services. Waste Management expects the merged company's 1993 revenues to reach $1.8 billion. It will be based in Birmingham, AL and have 12,000 employees

  14. Tolerance of Loblolly Pines to Fusiform Rust (United States)

    Charles H. Walkinshaw; James P. Barnett


    Loblolly pines (Pinus taeda L.) that were 8 to 17 yr old tolerated one to three fusiform rust (Cronartium quercuum [Berk.] Miyabe ex Shirai f. sp. fusiforme) galls in their stems.Families with four or more galls in their stems lost 2.5% or more of the trees by age 17.In living trees with less than four stem galls, diameter growth was comparable to...

  15. First report of the white pine blister rust pathogen, Cronartium ribicola, in Arizona (United States)

    M. L. Fairweather; Brian Geils


    White pine blister rust, caused by Cronartium ribicola J.C. Fisch., was found on southwestern white pine (Pinus flexilis James var. reflexa Engelm., synonym P. strobiformis Engelm.) near Hawley Lake, Arizona (Apache County, White Mountains, 34.024°N, 109.776°W, elevation 2,357 m) in April 2009. Although white pines in the Southwest (Arizona and New Mexico) have been...

  16. Structural studies on the development of soybean rust (Phakopsora pachyrhizi Syd.) in susceptible soybean leaves

    International Nuclear Information System (INIS)

    Koch, E.; Ebrahim-Nesbat, F.; Hoppe, H.H.


    Where soybeans are cultivated in the tropics, soybean rust may cause heavy crop losses. Resistance found so far was only of local and temporary value. More substantial breeding efforts are needed, but these may require a better understanding of the pathogen's biology and evolutionary capacity, the infection process and the host-pathogen relationships. The report deals with the infection process and the development of the fungus in a susceptible host variety. (author)

  17. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  18. Tandem selection for fusiform rust sisease resistance to develop a clonal elite breeding population of loblolly pine (United States)

    Steve McKeand; Saul Garcia; Josh Steiger; Jim Grissom; Ross Whetten; Fikret. Isik


    The elite breeding populations of loblolly pine (Pinus taeda L.) in the North Carolina State University Cooperative Tree Improvement Program are intensively managed for short-term genetic gain. Fusiform rust disease, caused by the fungus Cronartium quercuum f. sp. fusiforme, is the most economically...

  19. Status of white pine blister rust and seed collections in california's high-elevation white pine species (United States)

    J. Dunlap


    White pine blister rust (caused by the non-native pathogen Cronartium ribicola) reached northern California about 80 years ago. Over the years its spread southward had been primarily recorded on sugar pine. However, observations on its occurrence had also been reported in several of the higher elevation five-needled white pine species in California. Since the late...

  20. Identification and validation of single nucleotide polymorphic markers linked to Ug99 stem rust resistance in spring wheat (United States)

    Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...

  1. Molecular and cytogenetic characterization of a durum wheat Aegilops speltoides chromosome translocation conferring resistance to stem rust (United States)

    Stem rust is a serious disease of wheat that has caused historical epidemics, but it has not been a threat in recent decades in North America due to the eradication of the alternate host and deployment of resistant cultivars. However, the recent emergence of Ug99 (or race TTKS) poses a threat to glo...

  2. Genomic analysis of a novel gene conferring resistance to Ug99 stem rust in Triticum turgidum ssp. dicoccum (United States)

    Wheat production is threatened by the disease stem rust, which is caused by the biotrophic fungal pathogen Puccinia graminis Pers.:Pers. f. sp. tritici (Pgt). Among all known Pgt races, TTKSK (Ug99) and TRTTF are significant threats to North American wheat production due to their virulence against f...

  3. Crystal shapes on striped surface domains

    International Nuclear Information System (INIS)

    Valencia, Antoni


    The equilibrium shapes of a simple cubic crystal in contact with a planar chemically patterned substrate are studied theoretically using an effective interface model. The substrate is primarily made of lyophobic material and is patterned with a lyophilic (easily wettable) stripe domain. Three regimes can be distinguished for the equilibrium shapes of the crystal. The transitions between these regimes as the volume of the crystal is changed are continuous or discontinuous depending on the strength of the couplings between the crystal and the lyophilic and lyophobic surface domains. If the crystal grows through a series of states close to equilibrium, the discontinuous transitions correspond to growth instabilities. These transitions are compared with similar results that have been obtained for a volume of liquid wetting a lyophilic stripe domain

  4. The preparation of immunochromatographic stripe of methamphetamine

    International Nuclear Information System (INIS)

    Jiang Jing; Liu Yibing; Zhou Ling; Guo Weizheng


    A gold immunochromatographic assay (GICA) is developed for methamphetamine in urine. Colloidal gold is obtained by reducing the gold chloride with sodium citrate, and labeled methamphetamine monoclonal antibody. The drug or metabolite competes with the immobilized drug conjugate in the test area for the limited colloidal gold-labeled antibody complex in which the stripe is made to screen the drug abuser. This method has sensitivity of 1000 μg/L, and without cross-reaction with some drugs

  5. Occupational Noise Reduction in CNC Striping Process (United States)

    Mahmad Khairai, Kamarulzaman; Shamime Salleh, Nurul; Razlan Yusoff, Ahmad


    Occupational noise hearing loss with high level exposure is common occupational hazards. In CNC striping process, employee that exposed to high noise level for a long time as 8-hour contributes to hearing loss, create physical and psychological stress that reduce productivity. In this paper, CNC stripping process with high level noises are measured and reduced to the permissible noise exposure. First condition is all machines shutting down and second condition when all CNC machine under operations. For both conditions, noise exposures were measured to evaluate the noise problems and sources. After improvement made, the noise exposures were measured to evaluate the effectiveness of reduction. The initial average noise level at the first condition is 95.797 dB (A). After the pneumatic system with leakage was solved, the noise reduced to 55.517 dB (A). The average noise level at the second condition is 109.340 dB (A). After six machines were gathered at one area and cover that area with plastic curtain, the noise reduced to 95.209 dB (A). In conclusion, the noise level exposure in CNC striping machine is high and exceed the permissible noise exposure can be reduced to acceptable levels. The reduction of noise level in CNC striping processes enhanced productivity in the industry.

  6. Coprecipitation of Arsenate and Arsenite with Green Rust Minerals (United States)

    The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...

  7. Incomplete resistance to coffee leaf rust (Hemileia vastatrix)

    NARCIS (Netherlands)

    Eskes, A.B.


    Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales

  8. 29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...

    African Journals Online (AJOL)

    rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...

  9. Characterization of stem rust resistance gene Sr2 in Indian wheat ...

    African Journals Online (AJOL)

    Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...

  10. A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat. (United States)

    Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva


    A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.

  11. Direct visualization of the Campbell regime in superconducting stripes


    Kramer, R. B. G.; Ataklti, G. W.; Moshchalkov, V. V.; Silhanek, Alejandro


    A combination of scanning Hall microscopy and scanning ac-susceptibility measurements in superconducting stripes (ribbons) of width w < 10 mu m was used to observe the dimensional phase transitions of the vortex lattice and its stability under alternating fields. At low dc magnetic fields applied perpendicularly to the plane of the stripes, vortices form a one-dimensional chain at the center of the stripes. Above a certain field H*(w), the vortex chain splits in two parallel rows displaced la...

  12. Coherent quantum cascade laser micro-stripe arrays

    Directory of Open Access Journals (Sweden)

    G. M. de Naurois


    Full Text Available We have fabricated InP-based coherent quantum cascade laser micro-stripe arrays. Phase-locking is provided by evanescent coupling between adjacent stripes. Stripes are buried into semi-insulating iron doped InP. Lasing at room temperature is obtained at 8.4μm for stripe arrays comprising up to 16 emitters. Pure supermode emission is demonstrated via farfield measurements and simulations. The farfield pattern shows a dual-lobe emission, corroborating the predicted phase-locked antisymmetric supermode emission.

  13. Modeling and analyzing stripe patterns in fish skin (United States)

    Zheng, Yibo; Zhang, Lei; Wang, Yuan; Liang, Ping; Kang, Junjian


    The formation mechanism of stripe patterns in the skin of tropical fishes has been investigated by a coupled two variable reaction diffusion model. Two types of spatial inhomogeneities have been introduced into a homogenous system. Several Turing modes pumped by the Turing instability give rise to a simple stripe pattern. It is found that the Turing mechanism can only determine the wavelength of stripe pattern. The orientation of stripe pattern is determined by the spatial inhomogeneity. Our numerical results suggest that it may be the most possible mechanism for the forming process of fish skin patterns.

  14. 3D Measurement Technology by Structured Light Using Stripe-Edge-Based Gray Code

    International Nuclear Information System (INIS)

    Wu, H B; Chen, Y; Wu, M Y; Guan, C R; Yu, X Y


    The key problem of 3D vision measurement using triangle method based on structured light is to acquiring projecting angle of projecting light accurately. In order to acquire projecting angle thereby determine the corresponding relationship between sampling point and image point, method for encoding and decoding structured light based on stripe edge of Gray code is presented. The method encoded with Gray code stripe and decoded with stripe edge acquired by sub-pixel technology instead of pixel centre, so latter one-bit decoding error was removed. Accuracy of image sampling point location and correspondence between image sampling point and object sampling point achieved sub-pixel degree. In addition, measurement error caused by dividing projecting angle irregularly by even-width encoding stripe was analysed and corrected. Encoding and decoding principle and decoding equations were described. Finally, 3dsmax and Matlab software were used to simulate measurement system and reconstruct measured surface. Indicated by experimental results, measurement error is about 0.05%

  15. Whitebark pine mortality related to white pine blister rust, mountain pine beetle outbreak, and water availability (United States)

    Shanahan, Erin; Irvine, Kathryn M.; Thoma, David P.; Wilmoth, Siri K.; Ray, Andrew; Legg, Kristin; Shovic, Henry


    Whitebark pine (Pinus albicaulis) forests in the western United States have been adversely affected by an exotic pathogen (Cronartium ribicola, causal agent of white pine blister rust), insect outbreaks (Dendroctonus ponderosae, mountain pine beetle), and drought. We monitored individual trees from 2004 to 2013 and characterized stand-level biophysical conditions through a mountain pine beetle epidemic in the Greater Yellowstone Ecosystem. Specifically, we investigated associations between tree-level variables (duration and location of white pine blister rust infection, presence of mountain pine beetle, tree size, and potential interactions) with observations of individual whitebark pine tree mortality. Climate summaries indicated that cumulative growing degree days in years 2006–2008 likely contributed to a regionwide outbreak of mountain pine beetle prior to the observed peak in whitebark mortality in 2009. We show that larger whitebark pine trees were preferentially attacked and killed by mountain pine beetle and resulted in a regionwide shift to smaller size class trees. In addition, we found evidence that smaller size class trees with white pine blister rust infection experienced higher mortality than larger trees. This latter finding suggests that in the coming decades white pine blister rust may become the most probable cause of whitebark pine mortality. Our findings offered no evidence of an interactive effect of mountain pine beetle and white pine blister rust infection on whitebark pine mortality in the Greater Yellowstone Ecosystem. Interestingly, the probability of mortality was lower for larger trees attacked by mountain pine beetle in stands with higher evapotranspiration. Because evapotranspiration varies with climate and topoedaphic conditions across the region, we discuss the potential to use this improved understanding of biophysical influences on mortality to identify microrefugia that might contribute to successful whitebark pine conservation

  16. Modeling of the overwintering distribution of Puccinia striiformis f. sp. tritici based on meteorological data from 2001 to 2012 in China

    Directory of Open Access Journals (Sweden)

    Xiaojing WANG,Zhanhong MA,Yuying JIANG,Shouding SHI,Wancai LIU,Juan ZENG,Zhiwei ZHAO,Haiguang WANG


    Full Text Available Wheat stripe rust caused by Puccinia striiformis f. sp. tritici occurs widely in China and seriously affects wheat production. Global warming could profoundly impact the incidence and prevalence of low-temperature diseases such as stripe rust. Studies on the effects of temperature on the distribution of overwintering stripe rust could help us understand the incidence and prevalence of the disease and could also provide support for monitoring, forecasting and developing control strategies. An exponential model and a spherical model of the ordinary Kriging method in the ArcGIS platform were used to predict the overwintering regions of stripe rust based on the probability that the average temperature of the coldest month from December to February was higher than -6 or -7ºC from 2001 to 2012. The results showed that the areas with a probability between 70% and 90% were transition regions for the overwintering of stripe rust. Based on annual mean temperature of the coldest month from December to February for 2001 to 2012, overwintering distribution of stripe rust was likewise evaluated. The boundary for overwintering of stripe rust was consistent with the areas where the probability was predicted to be 70% to 90% for the overwintering distribution of stripe rust, but the boundary was shifted northward toward Beijing in North China. Some areas in Xinjiang, including Akto, Pishan, Hotan and Yutian, were also predicted to be suitable for the overwintering of stripe rust.

  17. Physical water treatment against calcification and rust

    International Nuclear Information System (INIS)

    Burger, A.


    In contrast to Germany, where the installation of small-sized, decentralised plants is still prefered, water supply companies in countries such as Denmark have already for some time successfully been using physical water treatment systems. Although the health and environmental benefits of this non-chemical method of water treatment are undisputed and its proper application is also economically beneficial, there is still a widerspread lack of information as to where such plants can be used. Consequently, older methods are often resorted to combatting calcification and rust. (orig.) [de

  18. Portfolio Optimization Using Particle Swarms with Stripes

    Directory of Open Access Journals (Sweden)

    Mario Villalobos Arias


    Full Text Available In this paper it is consider the Portfolio Optimization Problem developed by Markowitz [11]. The basic assumption is that the investor tries to maximize his/her profit and at the same time, wants to minimize the risk. This problem is usually solved using a scalarization approach (with one objective. Here it is solved it as a bi-objective  optimization problem. It uses a new version of the algorithm of Particle Swarm Optimization for Multi-Objective Problems to which it implemented a method of the stripes to improve dispersion.

  19. Relationship between sugarcane rust severity and soil properties in louisiana. (United States)

    Johnson, Richard M; Grisham, Michael P; Richard, Edward P


    ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.

  20. Host jumps shaped the diversity of extant rust fungi (Pucciniales). (United States)

    McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J


    The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  1. Measurement Error Affects Risk Estimates for Recruitment to the Hudson River Stock of Striped Bass

    Directory of Open Access Journals (Sweden)

    Dennis J. Dunning


    Full Text Available We examined the consequences of ignoring the distinction between measurement error and natural variability in an assessment of risk to the Hudson River stock of striped bass posed by entrainment at the Bowline Point, Indian Point, and Roseton power plants. Risk was defined as the probability that recruitment of age-1+ striped bass would decline by 80% or more, relative to the equilibrium value, at least once during the time periods examined (1, 5, 10, and 15 years. Measurement error, estimated using two abundance indices from independent beach seine surveys conducted on the Hudson River, accounted for 50% of the variability in one index and 56% of the variability in the other. If a measurement error of 50% was ignored and all of the variability in abundance was attributed to natural causes, the risk that recruitment of age-1+ striped bass would decline by 80% or more after 15 years was 0.308 at the current level of entrainment mortality (11%. However, the risk decreased almost tenfold (0.032 if a measurement error of 50% was considered. The change in risk attributable to decreasing the entrainment mortality rate from 11 to 0% was very small (0.009 and similar in magnitude to the change in risk associated with an action proposed in Amendment #5 to the Interstate Fishery Management Plan for Atlantic striped bass (0.006— an increase in the instantaneous fishing mortality rate from 0.33 to 0.4. The proposed increase in fishing mortality was not considered an adverse environmental impact, which suggests that potentially costly efforts to reduce entrainment mortality on the Hudson River stock of striped bass are not warranted.


    Directory of Open Access Journals (Sweden)



    Full Text Available The etiologic agent of the Asian soybean rust is the Phakopsora pachyrhizi, which causes a reduction in the photosynthetic leaf area and, consequently, in the crop yield. Chemical control is one of the main measures for its management. The objective of this work was to evaluate the efficacy and selectivity of the fluxapyroxad fungicide on controlling the Asian soybean rust, under the edaphoclimatic conditions of the Cerrado biome. The experiment was conducted in an area under no-tillage system, in the Agricultural Research Center, Rio Verde, Goias, Brazil, during the 2012/2013 crop season, using the cultivar NA7337. A randomized block experimental design was used, with twelve treatments and four replications. The treatments consisted of applications of fluxapyroxad (FX, pyraclostrobin (PT, epoxiconazole (EX and metconazole (MZ. The average severity of the disease in the plants reached 37% in the Control. All treatments with fungicides differed from the Control. Treatments 9, 10, 11 and 12 provided the greatest rates of soybean rust control. The treatments 10, 11 and 12 had the highest thousand grain weights, and the yields of the treatments 2, 3 and 11, despite higher than the Control, were lower than the treatments 4, 5, 6, 7, 8, 9, 10 and 12, which had statistically equal yields. The increasing in yield, compared to the Control, ranged from 10.05% (pyraclostrobin, epoxiconazole + pyraclostrobin + mineral oil to 30.55% (pyraclostrobin, pyraclostrobin + fluxapyroxad + mineral oil and pyraclostrobin + metconazole + mineral oil. The highest rates of soybean rust control were presented by fungicides containing fluxapyroxad.

  3. Incorporation of Monovalent Cations in Sulfate Green Rust

    DEFF Research Database (Denmark)

    Christiansen, B. C.; Dideriksen, K.; Katz, A.


    Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...

  4. Creation of variation in Basella for rust resistance through mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Makambila, C [Phytopathology Lab., Faculty of Sciences, Brazzaville (Congo)


    African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD{sub 50} for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs.

  5. Creation of variation in Basella for rust resistance through mutagenesis

    International Nuclear Information System (INIS)

    Makambila, C.


    African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD 50 for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs

  6. Identification and characterization of resistance to yellow rust and powdery mildew in wild emmer wheat and their transfer to bread wheat

    NARCIS (Netherlands)

    Silfhout, van C.H.


    In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major

  7. Slow rusting response of different wheat genotypes against the leaf rust in relation to epidemiological factors in Faisalabad

    International Nuclear Information System (INIS)

    Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.


    Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded

  8. Patterns of genomic variation in the poplar rust fungus Melampsora larici-populina identify pathogenesis-related factors

    Directory of Open Access Journals (Sweden)

    Antoine ePersoons


    Full Text Available Melampsora larici-populina is a fungal pathogen responsible for foliar rust disease on poplar trees, which causes damage to forest plantations worldwide, particularly in Northern Europe. The reference genome of the isolate 98AG31 was previously sequenced using a whole genome shotgun strategy, revealing a large genome of 101 megabases containing 16,399 predicted genes, which included secreted protein genes representing poplar rust candidate effectors. In the present study, the genomes of 15 isolates collected over the past 20 years throughout the French territory, representing distinct virulence profiles, were characterized by massively parallel sequencing to assess genetic variation in the poplar rust fungus. Comparison to the reference genome revealed striking structural variations. Analysis of coverage and sequencing depth identified large missing regions between isolates related to the mating type loci. More than 611,824 single-nucleotide polymorphism (SNP positions were uncovered overall, indicating a remarkable level of polymorphism. Based on the accumulation of non-synonymous substitutions in coding sequences and the relative frequencies of synonymous and non-synonymous polymorphisms (i.e. PN/PS, we identify candidate genes that may be involved in fungal pathogenesis. Correlation between non-synonymous SNPs in genes encoding secreted proteins and pathotypes of the studied isolates revealed candidate genes potentially related to virulences 1, 6 and 8 of the poplar rust fungus.

  9. Haplotype structure around Bru1 reveals a narrow genetic basis for brown rust resistance in modern sugarcane cultivars. (United States)

    Costet, L; Le Cunff, L; Royaert, S; Raboin, L-M; Hervouet, C; Toubi, L; Telismart, H; Garsmeur, O; Rousselle, Y; Pauquet, J; Nibouche, S; Glaszmann, J-C; Hoarau, J-Y; D'Hont, A


    Modern sugarcane cultivars (Saccharum spp., 2n = 100-130) are high polyploid, aneuploid and of interspecific origin. A major gene (Bru1) conferring resistance to brown rust, caused by the fungus Puccinia melanocephala, has been identified in cultivar R570. We analyzed 380 modern cultivars and breeding materials covering the worldwide diversity with 22 molecular markers genetically linked to Bru1 in R570 within a 8.2 cM segment. Our results revealed a strong LD in the Bru1 region and strong associations between most of the markers and rust resistance. Two PCR markers, that flank the Bru1-bearing segment, were found completely associated with one another and only in resistant clones representing efficient molecular diagnostic for Bru1. On this basis, Bru1 was inferred in 86 % of the 194 resistant sugarcane accessions, revealing that it constitutes the main source of brown rust resistance in modern cultivars. Bru1 PCR diagnostic markers should be particularly useful to identify cultivars with potentially alternative sources of resistance to diversify the basis of brown rust resistance in breeding programs.

  10. Correlation between the ripple phase and stripe domains in membranes. (United States)

    Bernchou, Uffe; Midtiby, Henrik; Ipsen, John Hjort; Simonsen, Adam Cohen


    We investigate the relationship between stripe domains and the ripple phase in membranes. These have previously been observed separately without being linked explicitly. Past results have demonstrated that solid and ripple phases exhibit rich textural patterns related to the orientational order of tilted lipids and the orientation of ripple corrugations. Here we reveal a highly complex network pattern of ripple and solid domains in DLPC, DPPC bilayers with structures covering length scales from 10 nm to 100 μm. Using spincoated double supported membranes we investigate domains by correlated AFM and fluorescence microscopy. Cooling experiments demonstrate the mode of nucleation and growth of stripe domains enriched in the fluorescent probe. Concurrent AFM imaging reveals that these stripe domains have a one-to-one correspondence with a rippled morphology running parallel to the stripe direction. Both thin and thick stripe domains are observed having ripple periods of 13.5±0.2 nm and 27.4±0.6 nm respectively. These are equivalent to previously observed asymmetric/equilibrium and symmetric/metastable ripple phases, respectively. Thin stripes grow from small solid domains and grow predominantly in length with a speed of ~3 times that of the thick stripes. Thick stripes grow by templating on the sides of thinner stripes or can emerge directly from the fluid phase. Bending and branching angles of stripes are in accordance with an underlying six fold lattice. We discuss mechanisms for the nucleation and growth of ripples and discuss a generic phase diagram that may partly rationalize the coexistence of metastable and stable phases. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Competing States in the t-J Model: Uniform d-Wave State versus Stripe State versus Stripe State

    NARCIS (Netherlands)

    Corboz, P.R.; Rice, T.M.; Troyer, M.


    Variational studies of the t-J model on the square lattice based on infinite projected-entangled pair states confirm an extremely close competition between a uniform d-wave superconducting state and different stripe states. The site-centered stripe with an in-phase d-wave order has an equal or only

  12. Rust types from JSON samples - Approximating type providers with procedural macros in Rust


    Vesteraas, Erik Andreas


    When programmers access external data in a statically typed programming language, they are often faced with a dilemma between convenient and type-safe access to the data. In the programming language F#, a concept called type providers has been proposed as a solution to this problem by having compiler support for libraries with the capability to generate types at compile time. This thesis presents "json_typegen", a project which aims to show the feasibility of similar solutions in the Rust pro...

  13. Induced resistance and gene expression in wheat against leaf rust ...

    African Journals Online (AJOL)



    May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.

  14. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Mona Singh


    Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.

  15. Wheat Rust Information Resources - Integrated tools and data for improved decision making

    DEFF Research Database (Denmark)

    Hodson, David; Hansen, Jens Grønbech; Lassen, Poul

    giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker ( and the Global Rust...

  16. Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test

    International Nuclear Information System (INIS)

    Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.


    We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.

  17. Mapping of Leaf Rust Resistance Genes and Molecular Characterization of the 2NS/2AS Translocation in the Wheat Cultivar Jagger. (United States)

    Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling


    Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.

  18. Distinct Nature of Static and Dynamic Magnetic Stripes in Cuprate Superconductors

    DEFF Research Database (Denmark)

    Jacobsen, H.; Holm, S. L.; Lăcătuşu, M. E.


    We present detailed neutron scattering studies of the static and dynamic stripes in an optimally doped high-Temperature superconductor, La2CuO4+y. We observe that the dynamic stripes do not disperse towards the static stripes in the limit of vanishing energy transfer. Therefore, the dynamic stripes...

  19. On the orientation of stripes in fish skin patterning. (United States)

    Míguez, David G; Muñuzuri, Alberto P


    This paper is focused on the study of the stripes orientation in the fish skin patterns. Based on microscopic observations of the pigment cells behavior at the embryonic stage, the key aspects of the pigmentation process are implemented in an experimental reaction-diffusion system. The experiment consists of a photosensitive Turing pattern of stripes growing directionally in one direction with controlled velocity. Different growth velocities of the system rearrange the stripes in the same three possible orientations observed in the skin of the colored fishes: parallel, oblique, and perpendicular. Our results suggest that the spreading velocity of the pigment cells in the fish dermis selects the orientation in the patterning processes.

  20. A mutagenesis-derived broad-spectrum disease resistance locus in wheat (United States)

    Wheat leaf rust, stem rust, stripe rust, and powdery mildew caused by the fungal pathogens Puccinia triticina, P. graminis f. sp. tritici, P. striiformis f. sp. tritici, and Blumeria graminis f. sp. tritici, respectively, are destructive diseases of wheat worldwide. The most effective and widely uti...

  1. Stripe order from the perspective of the Hubbard model

    Energy Technology Data Exchange (ETDEWEB)

    Devereaux, Thomas Peter


    A microscopic understanding of the strongly correlated physics of the cuprates must account for the translational and rotational symmetry breaking that is present across all cuprate families, commonly in the form of stripes. Here we investigate emergence of stripes in the Hubbard model, a minimal model believed to be relevant to the cuprate superconductors, using determinant quantum Monte Carlo (DQMC) simulations at finite temperatures and density matrix renormalization group (DMRG) ground state calculations. By varying temperature, doping, and model parameters, we characterize the extent of stripes throughout the phase diagram of the Hubbard model. Our results show that including the often neglected next-nearest-neighbor hopping leads to the absence of spin incommensurability upon electron-doping and nearly half-filled stripes upon hole-doping. The similarities of these findings to experimental results on both electron and hole-doped cuprate families support a unified description across a large portion of the cuprate phase diagram.

  2. Rust fungi on some poaceous weeds of wheat crops in Pakistan




    The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...

  3. Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula


    Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas


    Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...

  4. Assessment of potential impact of the Clinch River Breeder Reactor Plant thermal effluent on the Watts Bar Reservoir striped bass population

    International Nuclear Information System (INIS)

    Heuer, J.H.; McIntosh, D.; Ostrowski, P.; Tomljanovich, D.A.


    This report is an assessment of potential adverse impact to striped bass (Morone saxatilis) in Watts Bar Reservoir caused by thermal effluent from operation of the Clinch River Breeder Reactor Plant (CRBRP). The Clinch River arm of Watts Bar Reservoir is occupied by adult striped bass during the warmest months of the year. Concern was raised that operation of the CRBRP, specifically thermal discharges, could conflict with management of striped bass. In all cases examined the thermal plume becomes nearly imperceptible within a short distance from the discharge pipe (about 30 ft [10 m]) compared to river width (about 630 ft [190 m]). Under worst case conditions any presence of the plume in the main channel (opposite side of the river from the discharge) will be confined to the surface layer of the water. An ample portion of river cross sections containing ambient temperature water for passage or residence of adult striped bass will always be available in the vicinity of this thermal effluent. Although a small portion of river cross section would exceed the thermal tolerance of striped bass, the fish would naturally avoid this area and seek out adjacent cooler water. Therefore, it is concluded the CRBRP thermal effluent will not significantly affect the integrity of the striped bass thermal refuge in the Clinch River arm of Watts Bar Reservoir. At this time there is no need to consider alternative diffuser designs and thermal modeling. 8 references, 3 figures, 2 tables

  5. Genome-wide association study for Identification and validation of novel SNP markers for Sr6 stem rust resistance gene in bread wheat (United States)

    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat (Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of...

  6. De novo assembly and phasing of dikaryotic genomes from two isolates of Puccinia coronata f. sp. avenae, the causal agent of oat crown rust (United States)

    Oat crown rust, caused by the fungus Puccinia coronata f. sp. avenae (Pca), is a devastating disease that impacts worldwide oat production. For much of its life cycle Pca is dikaryotic with two separate haploid nuclei that may vary in virulence genotypes, which highlights the importance of understan...

  7. De novo assembly and phasing of dikaryotic genomes from two isolates of Puccini coronata f. sp. avenae, the causal agent of oat crown rust (United States)

    Marisa E. Miller; Ying Zhang; Vahid Omidvar; Jana Sperschneider; Benjamin Schwessinger; Castle Raley; Jonathan M. Palmer; Diana Garnica; Narayana Upadhyaya; John Rathjen; Jennifer M. Taylor; Robert F. Park; Peter N. Dodds; Cory D. Hirsch; Shahryar F. Kianian; Melania. Figueroa


    Oat crown rust, caused by the fungus Pucinnia coronata f. sp. avenae, is a devastating disease that impacts worldwide oat production. For much of its life cycle, P. coronata f. sp. avenae is dikaryotic, with two separate haploid nuclei that may vary in virulence genotype, highlighting...

  8. Below-ground plant parts emit herbivore-induced volatiles: olfactory responses of a predatory mite to tulip bulbs infested by rust mites

    NARCIS (Netherlands)

    Aratchige, N.S.; Lesna, I.; Sabelis, M.W.


    Although odour-mediated interactions among plants, spider mites and predatory mites have been extensively studied above-ground, belowground studies are in their infancy. In this paper, we investigate whether feeding by rust mites (Aceria tulipae) cause tulip bulbs to produce odours that attract

  9. Pathological changes associated with white striping in broiler breast muscles. (United States)

    Kuttappan, V A; Shivaprasad, H L; Shaw, D P; Valentine, B A; Hargis, B M; Clark, F D; McKee, S R; Owens, C M


    White striping is a condition in broiler chickens characterized grossly by the occurrence of white striations, seen parallel to the direction of muscle fibers, on broiler breast fillets and thighs. Based on visual evaluation of the intensity of white striping, breast fillets can be categorized into normal (NORM), moderate (MOD), and severe (SEV) categories. This study was undertaken to evaluate the details of changes in histology as well as proximate composition occurring in the fillets with respect to the 3 degrees of white striping. In experiment 1, representative breast fillets for each degree of white striping (n = 20) were collected from 45-d-old broilers, approximately 2 h postmortem. From each fillet, 2 skeletal muscle samples were obtained and fixed in 10% neutral buffered formalin. To identify and differentiate the histological changes, slides were prepared and stained using hematoxylin and eosin, Masson's Trichrome, and Oil Red O stains. In experiment 2, samples with 3 degrees of white striping were collected from 57-d-old birds for conducting proximate analysis. Major histopathological changes observed in the MOD and SEV samples consisted of loss of cross striations, variability in fiber size, floccular/vacuolar degeneration and lysis of fibers, mild mineralization, occasional regeneration (nuclear rowing and multinucleated cells), mononuclear cell infiltration, lipidosis, and interstitial inflammation and fibrosis. Microscopic lesions were visually scored for degeneration and necrosis, fibrosis, and lipidosis. The scale used to score the samples ranged from 0 (normal) to 3 (severe). There was an increase (P white striping increased from NORM to SEV. The results from the histopathological study were supported by the findings from proximate analysis confirming that the fat and protein contents of muscle increased (P white striping increased. In conclusion, the histopathological changes occurring in white striping indicate a degenerative myopathy that

  10. Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust

    International Nuclear Information System (INIS)

    Kiraly, Z.; Barabas, Z.


    Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)

  11. Post-deposition control of ferroelastic stripe domains and internal electric field by thermal treatment

    Energy Technology Data Exchange (ETDEWEB)

    Feigl, L.; Iwanowska, M.; Sandu, C. S.; Setter, N. [Ceramics Laboratory, EPFL-Swiss Federal Institute of Technology, Lausanne, CH-1015 Switzerland (Switzerland); Janolin, P.-E. [Laboratoire Structures, Propriétés et Modélisation des Solides, UMR CNRS-École Centrale Paris, Grande Voie des Vignes, 92295 Châtenay-Malabry Cedex (France); Yamada, T. [Department of Materials, Physics and Energy Engineering, Nagoya University, Nagoya 464-8603 (Japan); PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012 (Japan)


    The dependence of the formation of ferroelastic stripe domain patterns on the thermal history is investigated by detailed piezoresponse force microscopy and X-ray diffraction experiments after and during annealing of tensile strained tetragonal Pb(Ti,Zr)O{sub 3} epitaxial thin films on DyScO{sub 3} substrates. In particular, the ferroelastic pattern is reversibly interchanged between a cross-hatched and a stripe domain pattern if the films are cooled at different rates after annealing above the formation temperature of a-domains. Different types of 180° and non-180° patterns can be created, depending on the thermal treatment. The changes in the 180° domain structure and lattice parameters are attributed to a change of oxygen vacancy concentration, which results in a modification of the internal electric field and unit cell size, causing also a shift of T{sub C}. Thermal treatment is done on rhombohedral La:BiFeO{sub 3} thin films as well. It is observed that also in these films, appropriate heat treatment modifies the domain pattern and films with a stripe domain pattern can be created, confirming the general validity of the developed model.

  12. White pine blister rust in northern ldaho and western Montana: alternatives for integrated management (United States)

    Susan K. Hagle; Geral I. McDonald; Eugene A. Norby


    This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...

  13. Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...

    African Journals Online (AJOL)

    Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...

  14. Genetic characterization of stem rust resistance in a global spring wheat germplasm collection (United States)

    Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...

  15. Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae). (United States)

    Hernádez, José R; Aime, M Catherine; Newbry, Brad


    A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.

  16. New Seeds are Resistant to Wheat Stem Rust (Ug99) Multinational Programme Supported by FAO and IAEA

    International Nuclear Information System (INIS)


    Full text: A multinational effort supported by the International Atomic Energy Agency and the U.N. Food and Agriculture Organization marked a key milestone this week when a Kenyan university debuted two new varieties of disease-resistant wheat to the nation's farmers. Over the past two days, thousands of Kenyan farmers have visited Eldoret University in western Kenya for a two-day agriculture fair highlighting the latest farming technologies. Supporting the development of the new varieties were the IAEA's Technical Cooperation Department and the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture. They manage an interregional Technical Cooperation project to develop varieties of wheat that are resistant to a devastating type of fungus, causing a disease known as wheat stem rust. Wheat stem rust under control for over 30 years, but a resurgence of the disease was discovered in 1999 in Uganda that swiftly spread to neighbouring Kenya. The wheat stem rust, caused by the strain of the fungus known as Ug99, named after its place and year of origin, has since spread to Iran, Yemen and South Africa and threatens crops as far away as India as spores are carried by wind. Parasitic rusts threaten global wheat production, reducing plant growth and crop yields. The disease can destroy up to 70-100 percent of the yield of wheat crop if not prevented. 'Improving food security in developing countries through the use of nuclear techniques is an important priority of the IAEA', said IAEA Director General Yukiya Amano. 'I am pleased that we have been able to make an important contribution to fighting wheat rust'. 'Wheat rusts, particularly the Ug99 strain, are a major threat to food security because rust epidemics can result in devastating yield losses. This international project involving affected countries, plant scientists and breeders and international organizations is a major breakthrough. It clearly shows the benefits of FAO/IAEA collaboration and that

  17. Sustained eruptions on Enceladus explained by turbulent dissipation in tiger stripes (United States)

    Kite, Edwin S.; Rubin, Allan M.


    Spacecraft observations suggest that the plumes of Saturn’s moon Enceladus draw water from a subsurface ocean, but the sustainability of conduits linking ocean and surface is not understood. Observations show eruptions from “tiger stripe” fissures that are sustained (although tidally modulated) throughout each orbit, and since the 2005 discovery of the plumes. Peak plume flux lags peak tidal extension by ˜1 rad, suggestive of resonance. Here, we show that a model of the tiger stripes as tidally flexed slots that puncture the ice shell can simultaneously explain the persistence of the eruptions through the tidal cycle, the phase lag, and the total power output of the tiger stripe terrain, while suggesting that eruptions are maintained over geological timescales. The delay associated with flushing and refilling of O(1)-m-wide slots with ocean water causes erupted flux to lag tidal forcing and helps to buttress slots against closure, while tidally pumped in-slot flow leads to heating and mechanical disruption that staves off slot freezeout. Much narrower and much wider slots cannot be sustained. In the presence of long-lived slots, the 106-y average power output of the tiger stripes is buffered by a feedback between ice melt-back and subsidence to O(1010) W, which is similar to observed power output, suggesting long-term stability. Turbulent dissipation makes testable predictions for the final flybys of Enceladus by Cassini. Our model shows how open connections to an ocean can be reconciled with, and sustain, long-lived eruptions. Turbulent dissipation in long-lived slots helps maintain the ocean against freezing, maintains access by future Enceladus missions to ocean materials, and is plausibly the major energy source for tiger stripe activity.

  18. Tiger Stripes and Cassini ISS High-Resolution Imaging of Enceladus (United States)

    Helfenstein, Paul; Denk, T.; Giese, B.; McEwen, A. S.; Neukum, G.; Perry, J.; Porco, C. C.; Thomas, P. C.; Turtle, E.; Verbiscer, A.; Veverka, J.


    Deciphering the mechanisms of Enceladus’ plumes is one of the most important and challenging tasks for planetary science. Cassini has provided a wealth of data by remote and in-situ data collection, but fundamental details of the vents and their context remain elusive. Three flybys of Enceladus by Cassini in 2008, on August 11 (altitude: 50km), October 9 (30km), and October 31 (200 km) are designed to further our knowledge of Enceladus’ geology and geophysics. Anticipated data include images as good as 7 m/pixel of parts of the geologically active South Polar Terrain (SPT). We targeted six different known eruption sites (Spitale and Porco 2007, Nature 449, 695-697) along Cairo Sulcus, Baghdad Suclus, and Damascus Sulcus, as well as non-active portions of the the "tiger stripes" and bright grooved terrain in between. On each of the three flybys we also plan contiguous ISS broadband multi-spectral mosaics of the entire SPT region so that we can search for volcanically and tectonically driven temporal changes and construct detailed digital terrain maps. Previous images of the tiger stripes and other rift systems on Enceladus resolve geomorphic structures on hundred meter scales or larger. Within those resolution limits, tiger stripes are morphologically distinguished most strongly from comparably sized young looking rifts elsewhere on Enceladus by their prominent upturned flanks, the muted appearance of their surface relief, and their relative absence of distinct cliff faces, probably of solid ice along scarps. The anticipated new high-resolution images will provide critical structural details needed to identify the extent to which unique attributes of tiger stripes are caused by mantling by plume fallout, tectonic deformation, seismic disruption, or perhaps thermal processes. Here, we present a first analysis of the August 11 close flyby images.

  19. Painting rusted steel: The role of aluminum phosphosilicate

    International Nuclear Information System (INIS)

    Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.


    Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer

  20. Identification of New Resistance Loci to African Stem Rust Race TTKSK in Tetraploid Wheats Based on Linkage and Genome-Wide Association Mapping. (United States)

    Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M


    Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.

  1. Effects of sowing time on pink snow mould, leaf rust and winter damage in winter rye varieties in Finland

    Directory of Open Access Journals (Sweden)



    Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 1999–2001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;

  2. Simultaneous Transfer of Leaf Rust and Powdery Mildew Resistance Genes from Hexaploid Triticale Cultivar Sorento into Bread Wheat. (United States)

    Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie


    Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.

  3. Studies on stem and leaf rust resistance in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.


    Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)

  4. Induced mutations for resistance to leaf rust in wheat

    International Nuclear Information System (INIS)

    Borojevic, K.


    Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)

  5. Weather and Climate Indicators for Coffee Rust Disease (United States)

    Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.


    Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.

  6. Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods

    International Nuclear Information System (INIS)

    Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.


    Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)

  7. Efeito de herbicidas e fungicidas nas curvas de progresso e quantificação de danos causados pela ferrugem asiática da soja Effect of herbicides and fungicides on progress curves and damage quantification caused by soybean rust

    Directory of Open Access Journals (Sweden)

    Guy Mitsuyuki Tsumanuma


    regions around the world, where great losses were observed. Many variables are studied in the quantification of damage such as area under the disease progress curve (AUDPC, healthy leaf area absorption (HAA, healthy leaf area duration (HAD, in addition to disease progress curves. The present research aimed to evaluate the effect of several herbicides and fungicides on the progress of the disease and its implications for variables related to healthy leaf area and yield. The treatments were evaluated in two cultivars (MG/BR-46 Conquista e BRS Valiosa RR: 1. Control; 2. Control with herbicides; 3. Herbicides and pyraclostrobin (V4 + pyraclostrobin+ epoxiconazole (R2 and R5.1, 4. Herbicides and pyraclostrobin (V4 + epoxiconazole (R2 and R5.1. 5. Herbicides (V4 + pyraclostrobin + epoxiconazole (R2 and R5.1. The herbicides used in MG/BR-46 Conquista were sethoxydim, bentazon and chlorimuron-ethyl; in BRS Valiosa RR, glyphosate was used. The logistic was the model that best adapted to the mean severity ratings and the disease progress curve. At the bottom of canopy, position more favorable to this disease, the logistic model with variable rate was the model that better explain the data. The spraying of strobilurin's group associated with triazole (pyraclostrobin + epoxiconazole reduced the rate of asian rust development, in relation to the group of ergosterol biosynthesis inhibitors fungicide (epoxiconazole. The pyraclostrobin + epoxiconazole influenced the variables AUDPC, HAA and HAD, and these can be considered suitable to quantify damage caused by this disease. In MG/BR-46 Conquista, the herbicides action affects temporarily the leaf area, affecting indirectly the HAA and HAD variables.

  8. SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent

    Directory of Open Access Journals (Sweden)

    Lucas Mateus Rivero Rodrigues

    Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.

  9. Induced mutations for rust resistance in bread wheat

    International Nuclear Information System (INIS)

    Sawhney, R.N.


    Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)

  10. Use of gamma radiation for inducing rust resistance in soybean

    International Nuclear Information System (INIS)

    Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik


    Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982

  11. Visualization experimental investigation on long stripe coherent structure in small-scale rectangular channel

    International Nuclear Information System (INIS)

    Su Jiqiang; Sun Zhongning; Fan Guangming; Wang Shiming


    The long stripe coherent structure of the turbulent boundary layer in a small- scale vertical rectangular channel was observed by using hydrogen bubble flow trace visualization technique. The statistical properties of the long stripe in the experimental channel boundary layer were compared with that in the smooth flat plate boundary layer. The pitch characteristics were explained by the formation mechanism of the long stripe. It was analyzed that how the change of y + affected the distribution of the long stripe. In addition, the frequency characteristics of the long stripe were also investigated, and the correlation of the long stripe frequency in such a flow channel was obtained. (authors)

  12. Millijansky radio variability in SDSS stripe 82

    Energy Technology Data Exchange (ETDEWEB)

    Hodge, J. A.; Becker, R. H. [University of California, 1 Shields Avenue, Davis, CA 95616 (United States); White, R. L. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Richards, G. T., E-mail: [Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States)


    We report on a blind survey for extragalactic radio variability that was carried out by comparing two epochs of data from the Faint Images of the Radio Sky at Twenty centimeters survey with a third epoch from a new 1.4 GHz survey of SDSS Stripe 82. The three epochs are spaced seven years apart and have an overlapping area of 60 deg{sup 2}. We uncover 89 variable sources down to the millijansky level, 75 of which are newly identified, and we find no evidence for transient phenomena. This new sample of variable sources allows us to infer an upper limit to the mean characteristic timescale of active galactic nucleus radio variability of 14 yr. We find that only 1% of extragalactic sources have fractional variability f {sub var} > 3, while 44% of Galactic sources vary by this much. The variable sample contains a larger fraction of quasars than a comparable non-variable control sample, though the majority of the variable sources appear to be extended galaxies in the optical. This implies that either quasars are not the dominant contributor to the variability of the sample, or that the deep optical data allow us to detect the host galaxies of some low-z quasars. We use the new, higher resolution data to report on the morphology of the variable sources. Finally, we show that the fraction of sources that are variable remains constant or increases at low flux densities. This may imply that next generation radio surveys with telescopes like Australian Square Kilometer Array Pathfinder and MeerKAT will see a constant or even increasing fraction of variable sources down into the sub-millijansky regime.

  13. From stripe to slab confinement for DNA linearization in nanochannels (United States)

    Cifra, Peter; Benkova, Zuzana; Namer, Pavol

    We investigate suggested advantageous analysis in the linearization experiments with macromolecules confined in a stripe-like channel using Monte Carlo simulations. The enhanced chain extension in a stripe that is due to significant excluded volume interactions between monomers in two dimensions weakens on transition to experimentally feasible slit-like channel. Based on the chain extension-confinement strength dependence and the structure factor behavior for the chain in stripe we infer the excluded volume regime typical for two-dimensional systems. On transition to the slab geometry, the advantageous chain extension decreases and the Gaussian regime is observed for not very long semiflexible chains. The evidence for pseudo-ideality in confined chains is based on indicators such as the extension curves, variation of the extension with the persistence length or the structure factor. The slab behavior is observed when the stripe (originally of monomer thickness) reaches the thickness larger than cca 10nm in the third dimension. This maximum height of the slab to retain the advantage of the stripe is very low and this have implication for DNA linearization experiments. The presented analysis, however, has a broader relevance for confined polymers. Support from Slovak R&D Agency (SRDA-0451-11) is acknowledged.

  14. Coarsening of stripe patterns: variations with quench depth and scaling. (United States)

    Tripathi, Ashwani K; Kumar, Deepak


    The coarsening of stripe patterns when the system is evolved from random initial states is studied by varying the quench depth ε, which is a measure of distance from the transition point of the stripe phase. The dynamics of the growth of stripe order, which is characterized by two length scales, depends on the quench depth. The growth exponents of the two length scales vary continuously with ε. The decay exponents for free energy, stripe curvature, and densities of defects like grain boundaries and dislocations also show similar variation. This implies a breakdown of the standard picture of nonequilibrium dynamical scaling. In order to understand the variations with ε we propose an additional scaling with a length scale dependent on ε. The main contribution to this length scale comes from the "pinning potential," which is unique to systems where the order parameter is spatially periodic. The periodic order parameter gives rise to an ε-dependent potential, which can pin defects like grain boundaries, dislocations, etc. This additional scaling provides a compact description of variations of growth exponents with quench depth in terms of just one exponent for each of the length scales. The relaxation of free energy, stripe curvature, and the defect densities have also been related to these length scales. The study is done at zero temperature using Swift-Hohenberg equation in two dimensions.

  15. Evaluation of fatigue damage induced by thermal striping in a T junction using the three dimensional coupling method and frequency response method

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sun Hye; Choi, Jae boong; Kim, Moon Ki [Sungkyunkwan Univ., Seoul (Korea, Republic of); Huh, Nam Su [Seoul Nat' l Univ., Seoul (Korea, Republic of); Lee, Jin Ho [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)


    Thermal fatigue cracking induced by thermal stratification, cycling and striping have been observed in several PWR plants. Especially, thermal striping, the highly fluctuating thermal layer, became one of the significant problems, since it can cause un predicted high cycle thermal fatigue (HCTF) at piping systems. This problem are usually found in T junctions of energy cooling systems, where cold and hot flows with high level of turbulence mix together. Thermal striping can cause the networks of fatigue crack at the vicinity of weld parts and these cracks can propagate to significant depth in a relatively short time. Therefore, thermal striping and fatigue crack initiations should be predicted in advance to prevent the severe failure of piping systems. The final goal of this research is to develop a rational thermal and mechanical model considering thermohydraulic characteristics of thermal striping and an evaluation procedure to predict the initiation of thermal fatigue crack. As a first step, we evaluated the fatigue damage in a T junction using two widely used methods. Then, we analyzed the results of each method and conducted comparisons and verifications.

  16. Stripes and honeycomb lattice of quantized vortices in rotating two-component Bose-Einstein condensates (United States)

    Kasamatsu, Kenichi; Sakashita, Kouhei


    We study numerically the structure of a vortex lattice in rotating two-component Bose-Einstein condensates with equal atomic masses and equal intra- and intercomponent coupling strengths. The numerical simulations of the Gross-Pitaevskii equation show that the quantized vortices in this situation form lattice configuration accompanying vortex stripes, honeycomb lattices, and their complexes. This is a result of the degeneracy of the system for the SU(2) symmetric operation, which causes a continuous transformation between the above structures. In terms of the pseudospin representation, the complex lattice structures are identified as a hexagonal lattice of doubly winding half skyrmions.

  17. Antibiotic Treatment of Blister Rust Cankers in Eastern White Pine (United States)

    William R. Phelps; Ray Weber


    Cycloheximide (Acti-dione) and Phytoactin antibiotics, applied as basal stem treatments, aerial spray treatments, and complete foliar drenches were not effective in controlling blister rust cankers in eastern white pine. Cycloheximide was effective in suppressing canker activity and growth if directly applied to scarified cankers.

  18. Control of Bean Rust using Antibiotics Produced by Bacillus and ...

    African Journals Online (AJOL)

    Antibiotic culture filtrates produced by Bacillus (CA5) and Streptomyces spp. were tested for translocation and persistence when applied on snap beans inoculated with rust (Uromyces appendiculatus) in greenhouse pot experiments. The antibiotics were applied on the first trifoliate leaves and translocation was assessed as ...

  19. Blister rust control in the management of western white pine (United States)

    Kenneth P. Davis; Virgil D. Moss


    The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...

  20. Resistance of three interspecific white pine hybrids to blister rust (United States)

    R. Z. Callaham


    Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...

  1. Characteristics of Blister Rust Cankers on Eastern White Pine (United States)

    William R. Phelps; Ray Weber


    The growth, development, and sporulation of white pine blister rust cankers were studied on eastern white pine in Wisconsin and Minnesota. Three district canker types were identified on the basis of physical appearance, growth rate, and sporulation. Canker growth rate and sporulation decreased as tree size or age increased, and many cankers apparently became inactive...

  2. Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...

    Indian Academy of Sciences (India)

    Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...

  3. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...

  4. Reductive and sorptive properties of sulfate green rust (GRSO4)

    DEFF Research Database (Denmark)

    Nedel, Sorin

    The Fe(II), Fe(III) hydroxide containing sulfate in its structure, called sulfate green rust (GRSO4), can effectively reduce and convert contaminants to less mobile and less toxic forms. However, the ability of GRSO4 to remove positively charged species from solution, via sorption, is very limited...

  5. White pines, Ribes, and blister rust: integration and action (United States)

    R. S. Hunt; B. W. Geils; K. E. Hummer


    The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...

  6. White pines, Ribes, and blister rust: a review and synthesis (United States)

    Brian W. Geils; Kim E. Hummer; Richard S. Hunt


    For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...

  7. Screening of fungicides for the management of wattle rust ...

    African Journals Online (AJOL)

    % of the revenue from the species obtained from the timber and 15% from the bark. From 2012/13 a wattle rust disease has spread throughout the black wattle plantation area in KwaZulu-Natal and from 2015 it was recorded in southern ...

  8. Taxonomy, phylogeny, and coevolution of pines and their stem rusts (United States)

    C. I. Millar; B. B. Kinloch


    We review and reinterpret major events in the evolution of pines and their stem rusts using information from their taxonomy, genetics, biogeography, and fossil history. Understanding of pine evolution has been significantly revised in the last 20 years. Pines appear to have evolved early in the Mesozoic and to have diversified and migrated throughout middle latitudes...

  9. Marker-assisted pyramiding of Thinopyrumderived leaf rust ...

    Indian Academy of Sciences (India)


    Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.

  10. Roadway striping productivity data analysis for INDOT Greenfield and Crawfordsville districts. (United States)


    The main objective of the SPR3650 project is to provide an accurate overview of striping operation so that INDOT finds a way to : effectively save significant investment for purchasing new striping trucks in near future without compromising roadwa...

  11. Variation in the timing of reproduction of the four-striped field mouse ...

    African Journals Online (AJOL)

    Variation in the timing of reproduction of the four-striped field mouse, Rhabdomys pumilio , in ... Open Access DOWNLOAD FULL TEXT ... We used the four-striped field mouse, Rhabdomys pumilio (Sparrmann, 1784), to test the hypothesis that ...

  12. Distinguishing Patterns of Charge Order: Stripes or Checkerboards

    Energy Technology Data Exchange (ETDEWEB)

    Robertson, J.A.


    In two dimensions, quenched disorder always rounds transitions involving the breaking of spatial symmetries so, in practice, it can often be difficult to infer what form the symmetry breaking would take in the 'ideal,' zero disorder limit. We discuss methods of data analysis which can be useful for making such inferences, and apply them to the problem of determining whether the preferred order in the cuprates is 'stripes' or 'checkerboards.' In many cases we show that the experiments clearly indicate stripe order, while in others (where the observed correlation length is short), the answer is presently uncertain.

  13. Interactions between striped bass and other gamefish in reservoirs (United States)

    Miranda, Leandro E.; Raborn, Scott W.


    Competitive interactions among reservoir fishes may be pronounced because fish assemblages in these artificial environments have had little time to develop niche-partitioning strategies that alleviate negative interspecific interactions. Such interactions may at times have been intensified by introductions of predators such as striped bass Morone saxatilis, introduced to create additional fisheries and control pelagic clupeids. Possible interactions between existing fish assemblages and striped bass include predation and competition. While there is a perception among angler groups that predation by striped bass on co-existing game fish is significant, most studies have reported little or no predation on game fish my striped bass and have considered predation rare and inconsequential. Moreover, predation that occurs will likely be compensatory and fail to reduce overall game fish survival. Any indirect effect of striped bass predation by restricting prey-sized game fish to limited refuge sites remains unknown. Exploitative competition may be more common. Although infrequently, introduced striped bass have depleted prey resources shared with other piscivores, particularly when stocking rates have been high, when there is a high rate of natural reproduction, or when prey supply has plunged in response to environmental fluxes. Fluctuation in prey supply, associated with ordinary environmental variability, and associated time lages in prey supply and predator demand, preclude adjusting predator densities to exactly balance demand with supply. The frequency of low supply-demand rations varies across systems and exhibits seasonal trends. Nevertheless, chronic supply-demand imbalances are manageable where the predator assemblage is at least partially controlled through stocking, harvest regulations, or both. Because of the poor state of knowledge concerning the parameters defining balance and because uncontrollable annual fluctuations preclude exact management of

  14. Characterization and selection of location for resistance to sugarcane brown rust disease under cuban conditions

    Directory of Open Access Journals (Sweden)

    Joaquín Montalván Delgado


    Full Text Available The sugarcane brown rust disease is caused by fungus Puccinia melanocephala Sydow & P. Sydow and it is one of the more importance diseases. The environment where the sugarcane is cultivated is constituted by numerous factors and its combination contributes to the formation of different development and production conditions, what influences in the varietal disease resistance. With the objective of to characterize and to define the resistance tests location to the brown rust disease were carried out experiments in 6 location of the country. Eleven varieties and six patterns were studied. The climatic variables were analyzed during the period in each location and they were carried out evaluations in different ages of the plant and number of the leaves. The quantity of pustules, long of the most frequent pustules, size of the biggest pustules and area per - centage occupied by pustules were evaluated. The data were analyzed statistically. Differential behavior of the locations and the importance of the relative humidity and the temperatures in the manifestation of the disease symptoms were proven. All the locations were important although similarity exists between Matanzas and Villa Clara and between Camagüey and Holguín. Mayabeque and Santiago de Cuba didn’t present similarity with any other one. These 6 locations can be used for the resistance tests and to define the progenitors’ Santiago de Cuba, Holguín, Villa Clara and Mayabeque

  15. Contribution to Kinetics of Formation of White Rust on Galvanized Steel

    International Nuclear Information System (INIS)

    Han, D. J.; Pyun, Su Il; Hahn, Y. D.


    Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion

  16. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)


    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  17. Genetic Diversity and Association of EST-SSR and SCoT Markers with Rust Traits in Orchardgrass (Dactylis glomerata L.). (United States)

    Yan, Haidong; Zhang, Yu; Zeng, Bing; Yin, Guohua; Zhang, Xinquan; Ji, Yang; Huang, Linkai; Jiang, Xiaomei; Liu, Xinchun; Peng, Yan; Ma, Xiao; Yan, Yanhong


    Orchardgrass (Dactylis glomerata L.), is a well-known perennial forage species; however, rust diseases have caused a noticeable reduction in the quality and production of orchardgrass. In this study, genetic diversity was assessed and the marker-trait associations for rust were examined using 18 EST-SSR and 21 SCoT markers in 75 orchardgrass accessions. A high level of genetic diversity was detected in orchardgrass with an average genetic diversity index of 0.369. For the EST-SSR and SCoT markers, 164 and 289 total bands were obtained, of which 148 (90.24%) and 272 (94.12%) were polymorphic, respectively. Results from an AMOVA analysis showed that more genetic variance existed within populations (87.57%) than among populations (12.43%). Using a parameter marker index, the efficiencies of the EST-SSR and SCoT markers were compared to show that SCoTs have higher marker efficiency (8.07) than EST-SSRs (4.82). The results of a UPGMA cluster analysis and a STRUCTURE analysis were both correlated with the geographic distribution of the orchardgrass accessions. Linkage disequilibrium analysis revealed an average r² of 0.1627 across all band pairs, indicating a high extent of linkage disequilibrium in the material. An association analysis between the rust trait and 410 bands from the EST-SSR and SCoT markers using TASSEL software revealed 20 band panels were associated with the rust trait in both 2011 and 2012. The 20 bands obtained from association analysis could be used in breeding programs for lineage selection to prevent great losses of orchardgrass caused by rust, and provide valuable information for further association mapping using this collection of orchardgrass.

  18. Genome Sequence of Acidovorax avenae Strain T10_61 Associated with Sugarcane Red Stripe in Argentina (United States)

    Fontana, Cecilia A.; Bassi, Daniela; Puglisi, Edoardo; Salazar, Sergio M.; Vignolo, Graciela M.; Coccocelli, Pier S.


    Red stripe of sugarcane in Argentina is a bacterial disease caused by Acidovorax avenae. The genome sequence from the first isolate of this bacterium in Argentina is presented here. The draft genome of the A. avenae T10_61 strain contains 5,646,552 bp and has a G+C content of 68.6 mol%. PMID:26847889

  19. Structure and Charge Hopping Dynamics in Green Rust

    International Nuclear Information System (INIS)

    Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.


    Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.

  20. Hexagon and stripe patterns in dielectric barrier streamer discharge

    International Nuclear Information System (INIS)

    Dong Lifang; He Yafeng; Yin Zengqian; Chai Zhifang


    We present a specially designed dielectric barrier discharge (DBD) system for the study of pattern formation. Hexagon and stripe patterns have been observed in a streamer discharge in a DBD for the first time. The phase diagram of pattern types as a function of applied voltage is given

  1. Stripe domains in Fe-Zr-N nanocrystalline films

    NARCIS (Netherlands)

    Craus, C.B.; Craus, C.B.; Chezan, A.R.; Siekman, Martin Herman; Lodder, J.C.; Boerma, D.O.; Niesen, L.


    We report on the transition between a magnetic stripe domain structure and in-plane orientation of the spins, as a function of nitrogen content, for 500nm thick Fe-Zr-N films prepared by DC reactive sputtering on glass substrates. The saturation field decreases and the saturation magnetization

  2. Intervertebral Disk Disease in 3 Striped Skunks (Mephitis mephitis)

    NARCIS (Netherlands)

    Krauss, M.W.; Benato, L.; McDonnell, J.; Schoemaker, N.J.; Westerhof, I.; Bronson, E.; Gielen, I.; van Caelenberg, A.; Hellebuyck, T.; Meij, B.P.; de Decker, S.

    Objective To describe diagnostic findings, surgical technique, and outcome in 3 striped skunks (Mephitis mephitis) with a history of paraparesis. Study Design Case series. Animals Skunks (n = 3) with paraparesis. Methods Neurologic examination revealed upper motor neuron disease (T2–L2) in 2 skunks

  3. Stripe domains and magnetoresistance in thermally deposited nickel films

    International Nuclear Information System (INIS)

    Sparks, P.D.; Stern, N.P.; Snowden, D.S.; Kappus, B.A.; Checkelsky, J.G.; Harberger, S.S.; Fusello, A.M.; Eckert, J.C.


    We report a study of the domain structure and magnetoresistance of thermally deposited nickel films. For films thicker than 17 nm, we observe striped domains with period varying with film thickness as a power law with exponent 0.21±0.02 up to 120 nm thickness. There is a negative magnetoresistance for fields out of the plane

  4. Stripe domains and magnetoresistance in thermally deposited nickel films (United States)

    Sparks, P. D.; Stern, N. P.; Snowden, D. S.; Kappus, B. A.; Checkelsky, J. G.; Harberger, S. S.; Fusello, A. M.; Eckert, J. C.


    We report a study of the domain structure and magnetoresistance of thermally deposited nickel films. For films thicker than 17nm, we observe striped domains with period varying with film thickness as a power law with exponent 0.21+/-0.02 up to 120nm thickness. There is a negative magnetoresistance for fields out of the plane.

  5. Stripe domains and magnetoresistance in thermally deposited nickel films

    Energy Technology Data Exchange (ETDEWEB)

    Sparks, P.D. E-mail:; Stern, N.P.; Snowden, D.S.; Kappus, B.A.; Checkelsky, J.G.; Harberger, S.S.; Fusello, A.M.; Eckert, J.C


    We report a study of the domain structure and magnetoresistance of thermally deposited nickel films. For films thicker than 17 nm, we observe striped domains with period varying with film thickness as a power law with exponent 0.21{+-}0.02 up to 120 nm thickness. There is a negative magnetoresistance for fields out of the plane.

  6. Anatomical studies of the gastrointestinal tract of the striped sand ...

    African Journals Online (AJOL)

    A study was carried out on the gross anatomical, morphometric features and histology of the gastrointestinal tract of the Striped Sand Snake (Psammophis sibilans). Ten snakes (five males and five females) were euthanized and dissected for the study. The gastrointestinal tract appeared as a straight tubular organ from oral ...

  7. Siim Nestor soovitab : Supreme 7aastane. White Stripes / Siim Nestor

    Index Scriptorium Estoniae

    Nestor, Siim, 1974-


    Kolmik Supreme tähistab oma 7. tegutsemisaastat 24. juunil Von Krahlis, kus toimub ka Krecki debüütalbumi "If You Live" (väljaandjaks ettevõte Umblu) esitlus. Detroidi blues-rock duo White Stripes esitleb oma uut albumit "Get Behind Me Satan" 29. juunil Tallinnas klubis Hollywood

  8. Modulation of the innate immune responses in the striped ...

    African Journals Online (AJOL)

    Thus, most of the innate non-specific immune responses are inducible though they are constitutive of fish immune system exhibiting a basal level of activity even in the absence of pathogen challenge. Keywords: Aeromonas hydrophila, Experimental challenge, Innate immune response, Striped snakehead murrel ...

  9. Kinetics of structural rust transformation in environments containing chloride and SO2

    International Nuclear Information System (INIS)

    Rendon, J. L.; Valencia, A.


    The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs

  10. Inhibitory Effect of Camptothecin against Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae RS-2. (United States)

    Dong, Qiaolin; Luo, Ju; Qiu, Wen; Cai, Li; Anjum, Syed Ishtiaq; Li, Bin; Hou, Mingsheng; Xie, Guanlin; Sun, Guochang


    Camptothecin (CPT) has anticancer, antiviral, and antifungal properties. However, there is a dearth of information about antibacterial activity of CPT. Therefore, in this study, we investigated the inhibitory effect of CPT on Acidovorax avenae subsp. avenae strain RS-2, the pathogen of rice bacterial brown stripe, by measuring cell growth, DNA damage, cell membrane integrity, the expression of secretion systems, and topoisomerase-related genes, as well as the secretion of effector protein Hcp. Results indicated that CPT solutions at 0.05, 0.25, and 0.50 mg/mL inhibited the growth of strain RS-2 in vitro, while the inhibitory efficiency increased with an increase in CPT concentration, pH, and incubation time. Furthermore, CPT treatment affected bacterial growth and replication by causing membrane damage, which was evidenced by transmission electron microscopic observation and live/dead cell staining. In addition, quantitative real-time PCR analysis indicated that CPT treatment caused differential expression of eight secretion system-related genes and one topoisomerase-related gene, while the up-regulated expression of hcp could be justified by the increased secretion of Hcp based on the ELISA test. Overall, this study indicated that CPT has the potential to control the bacterial brown stripe pathogen of rice.

  11. Inhibitory Effect of Camptothecin against Rice Bacterial Brown Stripe Pathogen Acidovorax avenae subsp. avenae RS-2

    Directory of Open Access Journals (Sweden)

    Qiaolin Dong


    Full Text Available Camptothecin (CPT has anticancer, antiviral, and antifungal properties. However, there is a dearth of information about antibacterial activity of CPT. Therefore, in this study, we investigated the inhibitory effect of CPT on Acidovorax avenae subsp. avenae strain RS-2, the pathogen of rice bacterial brown stripe, by measuring cell growth, DNA damage, cell membrane integrity, the expression of secretion systems, and topoisomerase-related genes, as well as the secretion of effector protein Hcp. Results indicated that CPT solutions at 0.05, 0.25, and 0.50 mg/mL inhibited the growth of strain RS-2 in vitro, while the inhibitory efficiency increased with an increase in CPT concentration, pH, and incubation time. Furthermore, CPT treatment affected bacterial growth and replication by causing membrane damage, which was evidenced by transmission electron microscopic observation and live/dead cell staining. In addition, quantitative real-time PCR analysis indicated that CPT treatment caused differential expression of eight secretion system-related genes and one topoisomerase-related gene, while the up-regulated expression of hcp could be justified by the increased secretion of Hcp based on the ELISA test. Overall, this study indicated that CPT has the potential to control the bacterial brown stripe pathogen of rice.

  12. Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region


    AY, Hasan


    This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...

  13. Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat. (United States)

    Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S


    Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

  14. Changing the game: using integrative genomics to probe virulence mechanisms of the stem rust pathogen Puccinia graminis f. sp. tritici

    Directory of Open Access Journals (Sweden)

    Melania eFigueroa


    Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens

  15. Changing the Game: Using Integrative Genomics to Probe Virulence Mechanisms of the Stem Rust Pathogen Puccinia graminis f. sp. tritici. (United States)

    Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N


    The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust

  16. Comparative transcriptome analysis and identification of candidate effectors in two related rust species (Gymnosporangium yamadae and Gymnosporangium asiaticum). (United States)

    Tao, Si-Qi; Cao, Bin; Tian, Cheng-Ming; Liang, Ying-Mei


    Rust fungi constitute the largest group of plant fungal pathogens. However, a paucity of data, including genomic sequences, transcriptome sequences, and associated molecular markers, hinders the development of inhibitory compounds and prevents their analysis from an evolutionary perspective. Gymnosporangium yamadae and G. asiaticum are two closely related rust fungal species, which are ecologically and economically important pathogens that cause apple rust and pear rust, respectively, proved to be devastating to orchards. In this study, we investigated the transcriptomes of these two Gymnosporangium species during the telial stage of their lifecycles. The aim of this study was to understand the evolutionary patterns of these two related fungi and to identify genes that developed by selection. The transcriptomes of G. yamadae and G. asiaticum were generated from a mixture of RNA from three biological replicates of each species. We obtained 49,318 and 54,742 transcripts, with N50 values of 1957 and 1664, for G. yamadae and G. asiaticum, respectively. We also identified a repertoire of candidate effectors and other gene families associated with pathogenicity. A total of 4947 pairs of putative orthologues between the two species were identified. Estimation of the non-synonymous/synonymous substitution rate ratios for these orthologues identified 116 pairs with Ka/Ks values greater than1 that are under positive selection and 170 pairs with Ka/Ks values of 1 that are under neutral selection, whereas the remaining 4661 genes are subjected to purifying selection. We estimate that the divergence time between the two species is approximately 5.2 Mya. This study constitutes a de novo assembly and comparative analysis between the transcriptomes of the two rust species G. yamadae and G. asiaticum. The results identified several orthologous genes, and many expressed genes were identified by annotation. Our analysis of Ka/Ks ratios identified orthologous genes subjected to

  17. Dewetting of thin liquid films on chemically patterned substrates : front propatation along narrow lyophobic stripes and stripe arrays

    NARCIS (Netherlands)

    Brasjen, B.J.; Gu, H.; Darhuber, A.A.


    Using experiments and numerical simulations, we investigate the dewetting of thin liquid films on chemically patterned substrates. The patterns consist of long and narrow hydrophobic stripes, separated by larger hydrophilic domains. We characterize the morphology and dynamics of the dewetting front

  18. Influence of yellow rust infection on /sup 32/P transport in detached barley leaves

    Energy Technology Data Exchange (ETDEWEB)

    Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)


    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.

  19. Influence of yellow rust infextion on 32P transport in detached barley leaves

    International Nuclear Information System (INIS)

    Schubert, J.


    Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)

  20. Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea


    Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego


    Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...

  1. Distinct Nature of Static and Dynamic Magnetic Stripes in Cuprate Superconductors (United States)

    Jacobsen, H.; Holm, S. L.; Lǎcǎtuşu, M.-E.; Rømer, A. T.; Bertelsen, M.; Boehm, M.; Toft-Petersen, R.; Grivel, J.-C.; Emery, S. B.; Udby, L.; Wells, B. O.; Lefmann, K.


    We present detailed neutron scattering studies of the static and dynamic stripes in an optimally doped high-temperature superconductor, La2 CuO4 +y . We observe that the dynamic stripes do not disperse towards the static stripes in the limit of vanishing energy transfer. Therefore, the dynamic stripes observed in neutron scattering experiments are not the Goldstone modes associated with the broken symmetry of the simultaneously observed static stripes, and the signals originate from different domains in the sample. These observations support real-space electronic phase separation in the crystal, where the static stripes in one phase are pinned versions of the dynamic stripes in the other, having slightly different periods. Our results explain earlier observations of unusual dispersions in underdoped La2 -xSrx CuO4 (x =0.07 ) and La2 -xBax CuO4 (x =0.095 ).

  2. Expansion of the South China Sea basin: Constraints from magnetic anomaly stripes, sea floor topography, satellite gravity and submarine geothermics

    Directory of Open Access Journals (Sweden)

    Xuezhong Yu


    Full Text Available The widely distributed E–W-trending magnetic anomaly stripes in the central basin and the N–E-trending magnetic anomaly stripes in the southwest sub-basin provide the most important evidence for Neogene expansion of the South China Sea. The expansion mechanism remains, however, controversial because of the lack of direct drilling data, non-systematic marine magnetic survey data, and irregular magnetic anomaly stripes with two obvious directions. For example, researchers have inferred different ages and episodes of expansion for the central basin and southwest sub-basin. Major controversy centers on the order of basinal expansion and the mechanism of expansion for the entire South China Sea basin. This study attempts to constrain these problems from a comprehensive analysis of the seafloor topography, magnetic anomaly stripes, regional aeromagnetic data, satellite gravity, and submarine geothermics. The mapped seafloor terrain shows that the central basin is a north-south rectangle that is relatively shallow with many seamounts, whereas the southwest sub-basin is wide in northeast, gradually narrows to the southwest, and is relatively deeper with fewer seamounts. Many magnetic anomaly stripes are present in the central basin with variable dimensions and directions that are dominantly EW-trending, followed by the NE-, NW- and NS-trending. Conversely such stripes are few in the southwest sub-basin and mainly NE-trending. Regional magnetic data suggest that the NW-trending Ailaoshan-Red River fault extends into the South China Sea, links with the central fault zone in the South China Sea, which extends further southward to Reed Tablemount. Satellite gravity data show that both the central basin and southwest sub-basin are composed of oceanic crust. The Changlong seamount is particularly visible in the southwest sub-basin and extends eastward to the Zhenbei seamount. Also a low gravity anomaly zone coincides with the central fault zone in the sub

  3. Tidal-Induced Internal Ocean Waves as an Explanation for Enceladus' Tiger Stripe Pattern and Hotspot Activity (United States)

    Vermeersen, B. L. A.; Maas, L. R.; van Oers, S.; Rabitti, A.; Jara-Orue, H.


    One of the most peculiar features on Saturn moon Enceladus is its so-called tiger stripe pattern at the geologically active South Polar Terrain (SPT), as first observed in detail by the Cassini spacecraft early 2005. It is generally assumed that the four almost parallel surface lines that constitute this pattern are faults in the icy surface overlying a confined salty water reservoir. Indeed, later Cassini observations have shown that salty water jets originate from the tiger stripes [e.g., Hansen et al., Science, 311, 1422-1425, 2006; Postberg et al., Nature, 474, 620-622, 2011]. More recently, Porco et al. [Astron. J., 148:45, Sep. 2014] and Nimmo et al. [Astron. J., 148:46, Sep. 2014] have reported strong evidence that the geysers are not caused by frictional heating at the surface, but that geysers must originate deeper in Enceladus' interior. Tidal flexing models, like those of Hurford et al., Nature, 447, 292-294, 2007, give a good match for the brightness variations Cassini observes, but they seem to fail to reproduce the exact timing of plume brightening. Although jet activity is thus strongly connected to tidal forcing, another mechanism must be involved as well. Last year, we formulated the original idea [Vermeersen et al., AGU Fall Meeting 2013, abstract #P53B-1848] that the tiger stripe pattern is formed and maintained by induced, tidally and rotationally driven, wave-attractor motions in the ocean underneath the icy surface of the tiger-stripe region. Such wave-attractor motions are observed in water tank experiments in laboratories on Earth and in numerical experiments [Maas et al., Nature, 338, 557-561, 1997; Drijfhout and Maas, J. Phys. Oceanogr., 37, 2740-2763, 2007; Hazewinkel et al., Phys. Fluids, 22, 107102, 2010]. The latest observations by Porco et al. and Nimmo et al. seem to be in agreement with this tidal-induced wave attractor phenomenon, both with respect to tiger stripe pattern and with respect to timing of hotspot activity. However, in

  4. Magnetic property based characterization of rust on weathering steels

    International Nuclear Information System (INIS)

    Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.


    The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39

  5. Studies on general resistance to stem rust in wheat

    International Nuclear Information System (INIS)

    Knott, D.R.


    Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)

  6. Protective, curative and eradicative activities of fungicides against grapevine rust

    Directory of Open Access Journals (Sweden)

    Francislene Angelotti


    Full Text Available The protective, eradicative and curative activities of the fungicides azoxystrobin, tebuconazole, pyraclostrobin+metiram, and ciproconazole against grapevine rust, were determined in greenhouse. To evaluate the protective activity, leaves of potted ´Niagara´ (Vitis labrusca vines were artificially inoculated with an urediniospore suspension of Phakopsora euvitis four, eight or forteen days after fungicidal spray; and to evaluate the curative and eradicative activities, leaves were sprayed with fungicides two, four or eight days after inoculation. Disease severity was assessed 14 days after each inoculation. All tested fungicides present excellent preventive activity against grapevine rust; however, tebuconazole and ciproconazole provide better curative activity than azoxystrobin and pyraclostrobin+metiram. It was observed also that all tested fungicides significantly reduced the germination of urediniospore produced on sprayed leaves.

  7. Effect of solar radiation on severity of soybean rust. (United States)

    Young, Heather M; George, Sheeja; Narváez, Dario F; Srivastava, Pratibha; Schuerger, Andrew C; Wright, David L; Marois, James J


    Soybean rust (SBR), caused by Phakopsora pachyrhizi, is a damaging fungal disease of soybean (Glycine max). Although solar radiation can reduce SBR urediniospore survival, limited information is available on how solar radiation affects SBR progress within soybean canopies. Such information can aid in developing accurate SBR prediction models. To manipulate light penetration into soybean canopies, structures of shade cloth attenuating 30, 40, and 60% sunlight were constructed over soybean plots. In each plot, weekly evaluations of severity in lower, middle, and upper canopies, and daily temperature and relative humidity were recorded. Final plant height and leaf area index were also recorded for each plot. The correlation between amount of epicuticular wax and susceptibility of leaves in the lower, middle, and upper canopies was assessed with a detached leaf assay. Final disease severity was 46 to 150% greater in the lower canopy of all plots and in the middle canopy of 40 and 60% shaded plots. While daytime temperature within the canopy of nonshaded soybean was greater than shaded soybean by 2 to 3°C, temperatures recorded throughout typical evenings and mornings of the growing season in all treatments were within the range (10 to 28.5°C) for SBR development as was relative humidity. This indicates temperature and relative humidity were not limiting factors in this experiment. Epicuticular wax and disease severity in detached leaf assays from the upper canopy had significant negative correlation (P = 0.009, R = -0.84) regardless of shade treatment. In laboratory experiments, increasing simulated total solar radiation (UVA, UVB, and PAR) from 0.15 to 11.66 MJ m(-2) increased mortality of urediniospores from 2 to 91%. Variability in disease development across canopy heights in early planted soybean may be attributed to the effects of solar radiation not only on urediniospore viability, but also on plant height, leaf area index, and epicuticular wax, which influence

  8. Study of a low alloy steel rust using Moessbauer spectroscopy

    International Nuclear Information System (INIS)

    Maier, I.A.; Saragovi-Badler, C.; Labenski, F.


    Moessbauer spectroscopy has been used to analyze the internal and external rust layers of a weathering steel exposed for ten months to an urban-industrial atmosphere. Superparamagnetic α-FeOOH and γ-FeOOH were found in both layers. The external one also contained small sized delta-FeOOH and/or amorphous iron oxyhydroxide. These compounds were not present in the internal layer at this stage of the patina formation. (author)

  9. Influence of lactate ions on the formation of rust

    International Nuclear Information System (INIS)

    Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.


    The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH

  10. Expression of apoplast-targeted plant defensin MtDef4.2 confers resistance to leaf rust pathogen Puccinia triticina but does not affect mycorrhizal symbiosis in transgenic wheat. (United States)

    Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip


    Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.

  11. Rust in the Apollo 16 rocks. [hydration and oxidation processes in lunar environment (United States)

    Taylor, L. A.; Mao, H. K.; Bell, P. M.


    Apollo 16 samples of all four rock types and from all stations contain evidence for hydration and oxidation - i.e., the presence of hydrated iron oxide, probably goethite. Rock 66095 contains native FeNi grains with a characteristic intergrowth of schreibersite and, to lesser extents, of cohenite. Troilite also contains sphalerite. The goethite contains 1.5-4.6 wt.% chlorine and occurs mainly on the edges of FeNi metal, causing a rust color in the cracks and space around the native metal grains, which also contain abundant chlorine. This observation suggests the presence of lawrencite (FeCl2), a phase that deliquesces and oxidizes very rapidly upon exposure to water or to a moist atmosphere.

  12. Prediction and analysis of three gene families related to leaf rust (Puccinia triticina) resistance in wheat (Triticum aestivum L.). (United States)

    Peng, Fred Y; Yang, Rong-Cai


    The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for

  13. Induced mutations in beans and peas for resistance to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.


    Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)


    Directory of Open Access Journals (Sweden)

    H.-T. Gao


    Full Text Available Aim to striping noise brought by non-uniform response of remote sensing TDI CCD, a novel de-striping method based on statistical features of image histogram is put forward. By analysing the distribution of histograms,the centroid of histogram is selected to be an eigenvalue representing uniformity of ground objects,histogrammic centroid of whole image and each pixels are calculated first,the differences between them are regard as rough correction coefficients, then in order to avoid the sensitivity caused by single parameter and considering the strong continuity and pertinence of ground objects between two adjacent pixels,correlation coefficient of the histograms is introduces to reflect the similarities between them,fine correction coefficient is obtained by searching around the rough correction coefficient,additionally,in view of the influence of bright cloud on histogram,an automatic cloud detection based on multi-feature including grey level,texture,fractal dimension and edge is used to pre-process image.Two 0-level panchromatic images of SJ-9A satellite with obvious strip noise are processed by proposed method to evaluate the performance, results show that the visual quality of images are improved because the strip noise is entirely removed,we quantitatively analyse the result by calculating the non-uniformity ,which has reached about 1% and is better than histogram matching method.

  15. A perspective of leaf rust race fhprn and its impact on leaf rust resistance in pakistani wheat varieties

    International Nuclear Information System (INIS)

    Sohail, Y.


    Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)

  16. Stripe-PZT Sensor-Based Baseline-Free Crack Diagnosis in a Structure with a Welded Stiffener

    Directory of Open Access Journals (Sweden)

    Yun-Kyu An


    Full Text Available This paper proposes a stripe-PZT sensor-based baseline-free crack diagnosis technique in the heat affected zone (HAZ of a structure with a welded stiffener. The proposed technique enables one to identify and localize a crack in the HAZ using only current data measured using a stripe-PZT sensor. The use of the stripe-PZT sensor makes it possible to significantly improve the applicability to real structures and minimize man-made errors associated with the installation process by embedding multiple piezoelectric sensors onto a printed circuit board. Moreover, a new frequency-wavenumber analysis-based baseline-free crack diagnosis algorithm minimizes false alarms caused by environmental variations by avoiding simple comparison with the baseline data accumulated from the pristine condition of a target structure. The proposed technique is numerically as well as experimentally validated using a plate-like structure with a welded stiffener, reveling that it successfully identifies and localizes a crack in HAZ.

  17. Simulation study of a depth-encoding positron emission tomography detector inserting horizontal-striped glass between crystal layers (United States)

    Kim, Kyu Bom; Choi, Yong; Kang, Jihoon


    This study introduces a depth-encoding positron emission tomography (PET) detector inserting a horizontal-striped glass between the pixilated scintillation crystal layers. This design allows light spreading so that scintillation photons can travel only through the X direction and allows alteration in the light distribution so that it can generate a unique pattern diagram of the two-dimensional (2-D) flood histogram that identifies depth position as well as X-Y position of γ-ray interaction. A Monte Carlo simulation was conducted for the assessment of the depth of interaction (DOI)-PET detector. The traced light distribution for each event was converted into the 2-D flood histogram. Light loss caused by inserting the horizontal-striped glass between the crystal layers was estimated. Applicable weighting factors were examined for each DOI-PET detector. No considerable degradation of light loss was observed. The flood histogram, without overlapping of each crystal position, can be generated for the DOI detector based on each crystal block by inserting the horizontal-striped glass with a thickness of >1 mm and the modified resistive charge division networks with applicable weighting factors. This study demonstrated that the proposed DOI-PET detector can extract the three-dimensional γ-ray interaction position without considerable performance degradations of the PET detector from the 2-D flood histogram.

  18. Stripe-PZT Sensor-Based Baseline-Free Crack Diagnosis in a Structure with a Welded Stiffener. (United States)

    An, Yun-Kyu; Shen, Zhiqi; Wu, Zhishen


    This paper proposes a stripe-PZT sensor-based baseline-free crack diagnosis technique in the heat affected zone (HAZ) of a structure with a welded stiffener. The proposed technique enables one to identify and localize a crack in the HAZ using only current data measured using a stripe-PZT sensor. The use of the stripe-PZT sensor makes it possible to significantly improve the applicability to real structures and minimize man-made errors associated with the installation process by embedding multiple piezoelectric sensors onto a printed circuit board. Moreover, a new frequency-wavenumber analysis-based baseline-free crack diagnosis algorithm minimizes false alarms caused by environmental variations by avoiding simple comparison with the baseline data accumulated from the pristine condition of a target structure. The proposed technique is numerically as well as experimentally validated using a plate-like structure with a welded stiffener, reveling that it successfully identifies and localizes a crack in HAZ.

  19. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR. (United States)

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li


    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  20. Extraction and characterisation of gelatin from the skin of striped ...

    African Journals Online (AJOL)

    Functional properties of gelatin from skin of striped catfish with and without bleaching for 48 h by 5% H2O2 (w/v)) were studied. Gelatin from skin bleached with 5% H2O2 for 48 h showed the highest yield (16.18 g). Bleaching not only improved the colour of gelatin gel by increasing the L* (lightness)-value and decreasing ...

  1. Sensitivity of juvenile striped bass to chemicals used in aquaculture (United States)

    Bills, Terry D.; Marking, Leif L.; Howe, George E.


    Efforts to restore anadromous striped bass (Morone saxatilis) populations by the U.S. Fish and Wildlife Service and other agencies over the past 20 years have concentrated on hatchery culture to supplement dwindling natural reproduction. Adult fish captured for artificial spawning are stressed by handling and crowding in rearing ponds and are often exposed to therapeutants, anesthetics, disinfectants, and herbicides used in fish culture. We determined the toxicity of 17 fishery chemicals (chloramine-T, erythromycin, formalin, Hyamine 3500, Roccal, malachite green, sulfamerazine, benzocaine, etomidate, Finquel (MS-222) , metomidate, quinaldine sulfate, chlorine, potassium permanganate, Aquazine, copper sulfate, and Rodeo) to striped bass fry (average weight = 1 g) in reconstituted water (total hardness 40 mg/L) at 12 degree C. The 96-h LC50's (concentration calculated to produce 50% mortality in a population) ranged from 0.129 mg/L for malachite green to 340 mg/L for erythromycin. We also determined the effects of selected levels of water temperature, hardness, and pH on the toxicity of chloramine-T, formalin, malachite green, and Roccal. There were no differences in toxicity for any of the chemicals at any water quality variable tested except for chloramine-T, which was about 25 times more toxic in soft, acid water than in soft, alkaline water. Our data show that the striped bass is as sensitive to fishery chemicals as rainbow trout (Oncorhynchus mykiss), but is generally less resistant than bluegill (Lepomis macrochirus) and channel catfish (Ictalurus punctatus).


    Directory of Open Access Journals (Sweden)

    Egorychev Oleg Aleksandrovich


    Full Text Available The article represents a new outlook at the boundary-value problem of natural vibrations of a homogeneous pre-stressed orthotropic plate-stripe. In the paper, the motion equation represents a new approximate hyperbolic equation (rather than a parabolic equation used in the majority of papers covering the same problem describing the vibration of a homogeneous orthotropic plate-stripe. The proposed research is based on newly derived boundary conditions describing the pin-edge, rigid, and elastic (vertical types of fixing, as well as the boundary conditions applicable to the unfixed edge of the plate. The paper contemplates the application of the Laplace transformation and a non-standard representation of a homogeneous differential equation with fixed factors. The article proposes a detailed representation of the problem of natural vibrations of a homogeneous orthotropic plate-stripe if rigidly fixed at opposite sides; besides, the article also provides frequency equations (no conclusions describing the plate characterized by the following boundary conditions: rigid fixing at one side and pin-edge fixing at the opposite side; pin-edge fixing at one side and free (unfixed other side; rigid fixing at one side and elastic fixing at the other side. The results described in the article may be helpful if applied in the construction sector whenever flat structural elements are considered. Moreover, specialists in solid mechanics and theory of elasticity may benefit from the ideas proposed in the article.

  3. Morphology and AFLP markers suggest three Hordeum chilense ecotypes that differ in avoidance to rust fungi

    NARCIS (Netherlands)

    Vaz Patto, M.C.; Aardse, A.; Buntjer, J.; Rubiales, D.; Martin, A.; Niks, R.E.


    In Hordeum chilense Roem. & Schult., a high variation in the level of avoidance to infection of barley leaf rust (Puccinia hordei Otth) occurs. Probably resulting from the properties of the stomata, the rust germ tube overgrows stomata, and the infection process fails in an early stage. In the

  4. Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat (United States)

    In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...

  5. Genetic and environmental variation in rust frequency on mature mountain birch trees

    Energy Technology Data Exchange (ETDEWEB)

    Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)


    This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.

  6. Abnormal germling development by brown rust and powdery mildew on cer barley mutants

    NARCIS (Netherlands)

    Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.


    The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium

  7. Prescreening slash pine and Cronartium pedigrees for evaluation of complementary gene action in fusiform rust disease. (United States)

    H.E. Stelzer; Robert L. Doudrick; Thomas L. Kubisiak; C. Dana Nelson


    Single-urediniospore cultures of the fusiform rust fungus were used to inoculate seedlings from 10 full-sib families of a five-parent slash pine diallel at two different times in 1994. The presence or absence of fusiform rust galls was recorded for each inoculated seedling at 9 months postinoculation, and percent infection levels for each family-inoculum-time...

  8. Low average blister-rust infection rates may mean high control costs (United States)

    Robert Marty


    The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...

  9. Biology and pathology of Ribes and their implications for management of white pine blister rust (United States)

    P. J. Zambino


    Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...

  10. Detection of wheat stem rust race RRTTF in Ecuador in 2016 (United States)

    Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...


    Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...

  12. Blister rust in North America: What we have not learned in the past 100 years (United States)

    Eugene P. Van Arsdel; Brian W. Geils


    Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...


    Granular zerovalent iron has been proposed to be used as a medium in permeable reactive barriers (PRBs) to remove arsenic from contaminated groundwater. Iron(II, III) hydroxycarbonate green rust (carbonate green rust, or CGR) is a major corrosion product of zerovalent iron under ...

  14. Long-term changes in fusiform rust incidence in the southeastern United States (United States)

    KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey


    Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...

  15. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)

    Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...

  16. Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere

    International Nuclear Information System (INIS)

    Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.


    The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere

  17. Mechanical properties of the rust layer induced by impressed current method in reinforced mortar

    International Nuclear Information System (INIS)

    Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.


    This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer

  18. Comparative Analysis Highlights Variable Genome Content of Wheat Rusts and Divergence of the Mating Loci

    Directory of Open Access Journals (Sweden)

    Christina A. Cuomo


    Full Text Available Three members of the Puccinia genus, Puccinia triticina (Pt, P. striiformis f.sp. tritici (Pst, and P. graminis f.sp. tritici (Pgt, cause the most common and often most significant foliar diseases of wheat. While similar in biology and life cycle, each species is uniquely adapted and specialized. The genomes of Pt and Pst were sequenced and compared to that of Pgt to identify common and distinguishing gene content, to determine gene variation among wheat rust pathogens, other rust fungi, and basidiomycetes, and to identify genes of significance for infection. Pt had the largest genome of the three, estimated at 135 Mb with expansion due to mobile elements and repeats encompassing 50.9% of contig bases; in comparison, repeats occupy 31.5% for Pst and 36.5% for Pgt. We find all three genomes are highly heterozygous, with Pst [5.97 single nucleotide polymorphisms (SNPs/kb] nearly twice the level detected in Pt (2.57 SNPs/kb and that previously reported for Pgt. Of 1358 predicted effectors in Pt, 784 were found expressed across diverse life cycle stages including the sexual stage. Comparison to related fungi highlighted the expansion of gene families involved in transcriptional regulation and nucleotide binding, protein modification, and carbohydrate degradation enzymes. Two allelic homeodomain pairs, HD1 and HD2, were identified in each dikaryotic Puccinia species along with three pheromone receptor (STE3 mating-type genes, two of which are likely representing allelic specificities. The HD proteins were active in a heterologous Ustilago maydis mating assay and host-induced gene silencing (HIGS of the HD and STE3 alleles reduced wheat host infection.

  19. Correlation between RUST assessments of fracture healing to structural and biomechanical properties. (United States)

    Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul


    Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

  20. Microwave permeability of stripe patterned FeCoN thin film

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Yuping [Temasek Laboratories, National University of Singapore, 5A Engineering Drive 1, Singapore 117411 (Singapore); Yang, Yong, E-mail: [Temasek Laboratories, National University of Singapore, 5A Engineering Drive 1, Singapore 117411 (Singapore); Ma, Fusheng; Zong, Baoyu; Yang, Zhihong [Temasek Laboratories, National University of Singapore, 5A Engineering Drive 1, Singapore 117411 (Singapore); Ding, Jun [Department of Materials Science and Engineering, National University of Singapore, Singapore 117574 (Singapore)


    Magnetic stripe patterns are of great importance for microwave applications owing to their highly tunable microwave permeability by adjusting the geometrical dimensions. In this work, stripe patterned FeCoN films with 160 nm thickness are fabricated by using standard UV photolithography. Their microwave permeability are investigated systematically via both experiment and micromagnetic simulation. The good agreement between experimental and simulation results suggests that stripe width is crucial for the microwave magnetic properties of the stripe pattern. It is demonstrated by simulation that with increasing stripe width from 1 to 80 µm the initial permeability shows a continuous growth from about 8–322, whiles the resonance frequency drops dramatically from 18.7 to 3.1 GHz at 4 µm gap size. Smaller gap size would result in slightly increased initial permeability due to larger magnetic volume ratio, accompanied by decreased resonance frequency because of stronger magnetostatic interaction. Moreover, the experimental investigation on stripe length effect indicates that the stripe length should be kept as long as possible to achieve uniform bulk resonance mode and high permeability value. Insufficient stripe length would result in low frequency edge mode and decayed bulk mode. This study could provide valuable guidelines on the selection of proper geometry dimensions of FeCoN stripe patterns for high frequency applications. - Highlights: • This work presents a systematic study on permeability of FeCoN stripe pattern. • Geometrical parameters of the stripe pattern are systematically optimized. • Several important conclusions has been obtained. • The results offer guideline on FeCoN stripe patterns for high frequency applications.

  1. Molecular Cytogenetic Characterization of two Triticum-Secale-Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99. (United States)

    Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin


    Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  2. Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace. (United States)

    Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M


    A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.

  3. Discovery of a Novel Stem Rust Resistance Allele in Durum Wheat that Exhibits Differential Reactions to Ug99 Isolates

    Directory of Open Access Journals (Sweden)

    Jayaveeramuthu Nirmala


    Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.

  4. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat. (United States)

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus


    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Microsatellite markers linked to the locus of the watermelon fruit stripe pattern. (United States)

    Gama, R N C S; Santos, C A F; Dias, R C S; Alves, J C S F; Nogueira, T O


    Agronomic performance and external and internal appearance of watermelon (Citrullus lanatus) fruit are important traits that should be taken into consideration during the development of a new cultivar, as well as being the principal identification elements used by the consumer, which are based on the external appearance and quality of the fruit. Externally, the fruit can be characterized in terms of the shape, the color of the lower rind, and the presence of grooves and stripes, the stripes can be classified as clearly defined or diffuse. The objective of this study was to identify microsatellite markers linked to the stripe pattern of watermelon fruit to support watermelon improvement programs, with the selection of this characteristic in the plantlet stage. F1 and F2 populations, result of a cross between the cultivars BRS Opara (clearly defined stripes) and Pérola (diffuse stripes), were phenotyped for their fruit stripe pattern. The CTAB 2X protocol was used for DNA extraction and 116 microsatellite markers were examined in a group of F2 plants that had fruit with well-defined stripes and fruit with diffuse stripes. The microsatellite loci MCPI_05 and MCPI_16 exhibited a linkage to the stripe pattern at a distance of 1.5 and 1.8 cM, respectively, with LOD scores of 39.28 and 38.11, respectively, which were located on chromosome six of the watermelon genome. These markers can be used in marker-assisted selection in watermelon improvement programs, by various research institutions.

  6. Zebra Stripes through the Eyes of Their Predators, Zebras, and Humans.

    Directory of Open Access Journals (Sweden)

    Amanda D Melin

    Full Text Available The century-old idea that stripes make zebras cryptic to large carnivores has never been examined systematically. We evaluated this hypothesis by passing digital images of zebras through species-specific spatial and colour filters to simulate their appearance for the visual systems of zebras' primary predators and zebras themselves. We also measured stripe widths and luminance contrast to estimate the maximum distances from which lions, spotted hyaenas, and zebras can resolve stripes. We found that beyond ca. 50 m (daylight and 30 m (twilight zebra stripes are difficult for the estimated visual systems of large carnivores to resolve, but not humans. On moonless nights, stripes are difficult for all species to resolve beyond ca. 9 m. In open treeless habitats where zebras spend most time, zebras are as clearly identified by the lion visual system as are similar-sized ungulates, suggesting that stripes cannot confer crypsis by disrupting the zebra's outline. Stripes confer a minor advantage over solid pelage in masking body shape in woodlands, but the effect is stronger for humans than for predators. Zebras appear to be less able than humans to resolve stripes although they are better than their chief predators. In conclusion, compared to the uniform pelage of other sympatric herbivores it appears highly unlikely that stripes are a form of anti-predator camouflage.

  7. Screening and incorporation of rust resistance from Allium cepa into bunching onion (Allium fistulosum) via alien chromosome addition. (United States)

    Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi


    Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.

  8. An overview of sugarcane brown rust in Cuba

    Directory of Open Access Journals (Sweden)

    María La O

    Full Text Available ABSTRACT: Multiple pathogens affect sugarcane, among them Puccinia melanocephala, the causal agent of brown rust. This disease was first reported in Cuba in 1979 when it was responsible for a severe attack on the main sugarcane variety B4362. The aims of the present study were to give an overview of sugarcane brown rust in Cuba and show the current disease situation in the country. A retrospective analysis regard to sugarcane cultivar composition resistant to brown rust in Cuba was carried out. In addition 154 genotypes, including the most used progenitors in the breeding program and commercial varieties were evaluated under natural infection conditions. The identity of P. melanocephala was verified by Polymerase Chain Reaction (PCR and by sequencing the ITS1 region. After the introduction of P. melanocephala into Cuba, the susceptible variety, B4362, was replaced by Ja60-5 which remained resistant until 1998. Since 2002, a varietal policy supported by a governmental resolution establishing that any single cultivar cannot occupy more than 20 % of the production area for each production company, local area and province, has been applied. Out of the genotypes evaluated, 49 showed resistance to the disease and 35 intermediate behavior, while 39 were susceptible and 31, highly susceptible. P. melanocephala was detected by PCR in all symptomatic samples and its identify confirmed by sequencing the ITS1 region. The adopted measurement together with permanent phytosanitary monitoring and commercial release of resistant or intermediate cultivars succeeded in avoiding any new epidemic. Inoculum pressure was reduced, even on susceptible and highly susceptible varieties since, by resolution, they cannot occupy more than 10 % of the planted area.

  9. Effectiveness of carboxylic acids from Pichia membranifaciens against coffee rust

    Directory of Open Access Journals (Sweden)

    Rosa Laura Andrade Melchor

    Full Text Available ABSTRACT Coffee rust is a fungal disease that has affected every coffee-producing region in the world. Given that the effectivity of the protectant and systemic fungicides applied routinely to control the spread of the causative agent of the disease (Hemileia vastatrix has gradually diminished, besides are harmful to mammals and ecosystems, the objective of this work was to search for a mixture of harmless natural compounds with the potential to be applied in the field. So, a yeast strain producing a battery of long-chain carboxylic acids (CA with fungicide properties was isolated from soil of coffee crop and identified as Pichia membranifaciens by ITS sequencing. Culture conditions of the yeast were optimized and the CA in the solution were characterized by Gas Chromatography-Mass Spectrometry (GC-MS as ethyl formate (55.5 g L-1, octadecenoic acid (3.5 g L-1, propionic acid (7.2 g L-1, 3-(octadecanoyl-propionic acid (7.2 g L-1 and methyl acetate (8.4 g L-1. Randomized field studies were conducted in three different locations in Chiapas, México. Five treatments were tested including three concentrations of the CA solution (389, 584 and 778 ppm and copper oxychloride (5 000 ppm as conventional control. The initial coffee rust incidence averages varied between sites: Maravillas (3-9%, Santo Domingo (10-16% and Búcaro (16-22%. The treatments of CA solution proved to be effective at slowing down the progress of the rust disease even for the sites where initial incidence was high. Likewise, the CA solution reduced the viability of H. vastatrix spores, as assessed by fluorescence microscopy.

  10. Study of Rust Effect on the Corrosion Behavior of Reinforcement Steel Using Impedance Spectroscopy (United States)

    Bensabra, Hakim; Azzouz, Noureddine


    Most studies on corrosion of steel reinforcement in concrete are conducted on steel samples with polished surface (free of all oxides) in order to reproduce the same experimental conditions. However, before embedding in concrete, the steel bars are often covered with natural oxides (rust), which are formed during exposure to the atmosphere. The presence of this rust may affect the electrochemical behavior of steel rebar in concrete. In order to understand the effect of rust on the corrosion behavior of reinforcement steel, potentiodynamic and electrochemical impedance spectroscopy (EIS) tests were carried out in a simulated concrete pore solution using steel samples with two different surface conditions: polished and rusted samples. The obtained results have shown that the presence of rust on the steel bar has a negative effect on its corrosion behavior, with or without the presence of chlorides. This detrimental effect can be explained by the fact that the rust provokes a decrease of the electrolyte resistance at the metal-concrete interface and reduces the repassivating ability. In addition, the rust layer acts as a barrier against the hydroxyl ion diffusion, which prevents the realkalinization phenomenon.

  11. Plant-pathogen interactions: leaf physiology alterations in poplars infected with rust (Melampsora medusae). (United States)

    Gortari, Fermín; Guiamet, Juan José; Graciano, Corina


    Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  12. A reassessment of the risk of rust fungi developing resistance to fungicides. (United States)

    Oliver, Richard P


    Rust fungi are major pathogens of many annual and perennial crops. Crop protection is largely based on genetic and chemical control. Fungicide resistance is a significant issue that has affected many crop pathogens. Some pathogens have rapidly developed resistance and hence are regarded as high-risk species. Rust fungi have been classified as being low risk, in spite of sharing many relevant features with high-risk pathogens. An examination of the evidence suggests that rust fungi may be wrongly classified as low risk. Of the nine classes of fungicide to which resistance has developed, six are inactive against rusts. The three remaining classes are quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs) and succinate dehydrogenase inhibitors (SDHIs). QoIs have been protected by a recently discovered intron that renders resistant mutants unviable. Low levels of resistance have developed to DMIs, but with limited field significance. Older SDHI fungicides were inactive against rusts. Some of the SDHIs introduced since 2003 are active against rusts, so it may be that insufficient time has elapsed for resistance to develop, especially as SDHIs are generally sold in mixtures with other actives. It would therefore seem prudent to increase the level of vigilance for possible cases of resistance to established and new fungicides in rusts. © 2014 Society of Chemical Industry.

  13. Response to "Critical Assessment of the Evidence for Striped Nanoparticles".

    Directory of Open Access Journals (Sweden)

    Quy Khac Ong

    Full Text Available Stirling et al., (10.1371/journal.pone.0108482 presented an analysis on some of our publications on the formation of stripe-like domains on mixed-ligand coated gold nanoparticles. The authors shed doubts on some of our results however no valid argument is provided against what we have shown since our first publication: scanning tunneling microscopy (STM images of striped nanoparticles show stripe-like domains that are independent of imaging parameters and in particular of imaging speed. We have consistently ruled out the presence of artifacts by comparing sets of images acquired at different tip speeds, finding invariance of the stipe-like domains. Stirling and co-workers incorrectly analyzed this key control, using a different microscope and imaging conditions that do not compare to ours. We show here data proving that our approach is rigorous. Furthermore, we never solely relied on image analysis to draw our conclusions; we have always used the chemical nature of the particles to assess the veracity of our images. Stirling et al. do not provide any justification for the spacing of the features that we find on nanoparticles: ~1 nm for mixed ligand particles and ~ 0.5 nm for homoligand particles. Hence our two central arguments remain unmodified: independence from imaging parameters and dependence on ligand shell chemical composition. The paper report observations on our STM images; none is a sufficient condition to prove that our images are artifacts. We thoroughly addressed issues related to STM artifacts throughout our microscopy work. Stirling et al. provide guidelines for what they consider good STM images of nanoparticles, such images are indeed present in our literature. They conclude that the evidences we provided to date are insufficient, this is a departure from one of the authors' previous article which concluded that our images were composed of artifacts. Given that four independent laboratories have reproduced our measurements and

  14. Behavior and Body Patterns of the Larger Pacific Striped Octopus.

    Directory of Open Access Journals (Sweden)

    Roy L Caldwell

    Full Text Available Over thirty years ago anecdotal accounts of the undescribed Larger Pacific Striped Octopus suggested behaviors previously unknown for octopuses. Beak-to-beak mating, dens shared by mating pairs, inking during mating and extended spawning were mentioned in publications, and enticed generations of cephalopod biologists. In 2012-2014 we were able to obtain several live specimens of this species, which remains without a formal description. All of the unique behaviors listed above were observed for animals in aquaria and are discussed here. We describe the behavior, body color patterns, and postures of 24 adults maintained in captivity. Chromatophore patterns of hatchlings are also shown.

  15. Behavior and Body Patterns of the Larger Pacific Striped Octopus. (United States)

    Caldwell, Roy L; Ross, Richard; Rodaniche, Arcadio; Huffard, Christine L


    Over thirty years ago anecdotal accounts of the undescribed Larger Pacific Striped Octopus suggested behaviors previously unknown for octopuses. Beak-to-beak mating, dens shared by mating pairs, inking during mating and extended spawning were mentioned in publications, and enticed generations of cephalopod biologists. In 2012-2014 we were able to obtain several live specimens of this species, which remains without a formal description. All of the unique behaviors listed above were observed for animals in aquaria and are discussed here. We describe the behavior, body color patterns, and postures of 24 adults maintained in captivity. Chromatophore patterns of hatchlings are also shown.

  16. Unfolding of Vortices into Topological Stripes in a Multiferroic Material (United States)

    Wang, X.; Mostovoy, M.; Han, M. G.; Horibe, Y.; Aoki, T.; Zhu, Y.; Cheong, S.-W.


    Multiferroic hexagonal RMnO3 (R =rare earths) crystals exhibit dense networks of vortex lines at which six domain walls merge. While the domain walls can be readily moved with an applied electric field, the vortex cores so far have been impossible to control. Our experiments demonstrate that shear strain induces a Magnus-type force pulling vortices and antivortices in opposite directions and unfolding them into a topological stripe domain state. We discuss the analogy between this effect and the current-driven dynamics of vortices in superconductors and superfluids.

  17. Spatially correlated disorder in striped precursor magnetic modulations

    International Nuclear Information System (INIS)

    Porta, Marcel; Castan, Teresa; LLoveras, Pol; Planes, Antoni; Saxena, Avadh


    We use a Ginzburg-Landau model that includes long-range dipolar interactions and spatially correlated quenched-in disorder coupled to the local magnetization to study the properties of the precursor magnetic modulations as a function of the characteristics of the disorder. We find that although the modulation pattern is very robust and does not depend on details of the pair correlation function G(r), the scaling behaviour of the characteristic length of the striped magnetic modulations depends on the behaviour of G(r) for small values of r

  18. Creation and validation of a simulator for corneal rust ring removal. (United States)

    Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie


    To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.

  19. In vivo assessment of plant extracts for control of plant diseases: A sesquiterpene ketolactone isolated from Curcuma zedoaria suppresses wheat leaf rust. (United States)

    Han, Jae Woo; Shim, Sang Hee; Jang, Kyoung Soo; Choi, Yong Ho; Dang, Quang Le; Kim, Hun; Choi, Gyung Ja


    As an alternative to synthetic pesticides, natural materials such as plant extracts and microbes have been considered to control plant diseases. In this study, methanol extracts of 120 plants were explored for in vivo antifungal activity against Rhizoctonia solani, Botrytis cinerea, Phytophthora infestans, Puccinia triticina, and Blumeria graminis f. sp. hordei. Of the 120 plant extracts, eight plant extracts exhibited a disease control efficacy of more than 90% against at least one of five plant diseases. In particular, a methanol extract of Curcuma zedoaria rhizomes exhibited strong activity against wheat leaf rust caused by P. triticina. When the C. zedoaria methanol extracts were partitioned with various solvents, the layers of n-hexane, methylene chloride, and ethyl acetate showed disease control values of 100, 80, and 43%, respectively, against wheat leaf rust. From the C. zedoaria rhizome extracts, an antifungal substance was isolated and identified as a sesquiterpene ketolactone based on the mass and nuclear magnetic resonance spectral data. The active compound controlled the development of rice sheath blight, wheat leaf rust, and tomato late blight. Considering the in vivo antifungal activities of the sesquiterpene ketolactone and the C. zedoaria extracts, these results suggest that C. zedoaria can be used as a potent fungicide in organic agriculture.

  20. Recent invasion of world-wide wheat growing areas by two aggressive strains of Puccinia striiformis

    DEFF Research Database (Denmark)

    Walter, Stephanie; Ali, Sajid; Justesen, Annemarie Fejer


    The ever more frequent and severe large-scale epidemics of wheat yellow/stripe rust disease (caused by Puccinia striiformis) pose a severe threat to the world’s wheat production (Hovmøller et al. 2010). The onset of a new series of world-wide wheat yellow rust epidemics in 2000 has been linked...

  1. White pine blister rust resistance in North American, Asian and european species - results from artificial inoculartion trials in Oregon

    Directory of Open Access Journals (Sweden)

    R.A. Sniezko


    Full Text Available Dorena Genetic Resource Center (DGRC has used artificial inoculation trials to evaluate progenies of thousands of Pinus monticola and P. lambertiana selections from Oregon and Washington for resistance to white pine blister rust caused by Cronartium ribicola. In addition, early results are now available for P. albicaulis and P. strobiformis. DGRC has also recently evaluated seed orchard progenies of P. strobus, as well as bulked seedlots from P. armandii and P. peuce. The majority of P. monticola, P. lambertiana, P. albicaulis, and P. strobus progenies are very susceptible to blister rust. However, resistance exists in all these species. P. strobiformis showed relatively high levels of resistance for the eight progenies tested. Resistance in P. armandii was mainly reflected in the very low percentage of cankered seedlings; for P. peuce, the high percentage of cankered seedlings alive three years after inoculation was notable. R-genes are present in some of the North American five-needle pine species, but partial resistance traits (e.g. bark reaction will play a major role in breeding activities for P. monticola and P. lambertiana and will likely be the key to developing durable resistance.

  2. Color Fringes Bordering Black Stripes at the Bottom of a Swimming Pool (United States)

    Fuster, Gonzalo; Rojas, Roberto; Slüsarenko, Viktor


    We have observed a nice example of chromatic dispersion due to refraction in water, in the form of color fringes bordering the black stripes that exist at the bottom of a swimming pool. Here we give a qualitative description of the phenomenon, explaining the role of the black stripes and the dispersive index of refraction of water.

  3. 32 CFR Appendix E to Part 246 - Stars and Stripes (S&S) Board of Directors (United States)


    ... of directors shall monitor planning and execution of the S&S business activities. 2. The S&S board of... DEFENSE (CONTINUED) MISCELLANEOUS STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS Pt. 246, App. E Appendix E to Part 246—Stars and Stripes (S&S) Board of Directors A. Organization and Management...

  4. Genetics and mapping of the R₁₁ gene conferring resistance to recently emerged rust races, tightly linked to male fertility restoration, in sunflower (Helianthus annuus L.). (United States)

    Qi, L L; Seiler, G J; Vick, B A; Gulya, T J


    Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9

  5. Mice as stowaways? Colonization history of Danish striped field mice. (United States)

    Andersen, Liselotte Wesley; Jacobsen, Magnus; Vedel-Smith, Christina; Jensen, Thomas Secher


    Species from the steppe region of Eastern Europe likely colonized northwestern Europe in connection with agriculture after 6500 BP. The striped field mouse ( Apodemus agrarius Pallas, 1783), is a steppe-derived species often found in human crops. It is common on the southern Danish islands of Lolland and Falster, which have been isolated from mainland Europe since approximately 10 300-8000 BP. Thus, this species could have been brought in with humans in connection with agriculture, or it could be an earlier natural invader. We sequenced 86 full mitochondrial genomes from the northwestern range of the striped field mouse, analysed phylogenetic relationships and estimated divergence time. The results supported human-induced colonization of Denmark in the Subatlantic or Subboreal period. A newly discovered population from Central Jutland in Denmark diverged from Falster approximately 100-670 years ago, again favouring human introduction. One individual from Sweden turned out to be a recent introduction from Central Jutland. © 2017 The Author(s).

  6. REVIEW - Advances on molecular studies of the interaction soybean - Asian rust

    Directory of Open Access Journals (Sweden)

    Aguida Maria Alves Pereira Morales


    Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions

  7. Studies of the genetics of inheritance of stem rust resistance in ...

    African Journals Online (AJOL)



    May 22, 2013 ... increased production of wheat could help to ensure food and nutritional ... also characterized by genes with additive effects and non hypersensitive .... to create an artificial stem rust epidemic in the field (Hickey et al.,. 2012 ...

  8. Hyperfine interactions and structures of ferrous hydroxide and green rust II in sulfated aqueous media

    International Nuclear Information System (INIS)

    Olowe, A.A.; Genin, J.M.R.; Bauer, P.


    A sulfated ferrous hydroxide is obtained by mixing NaOH with melanterite depending on the R = [SO 4 -- ]/[OH - ] ratio and leading by oxidation to the green rust II transient compound. Hyperfine parameters are presented. (orig.)

  9. Nanostructure of protective rust layer on weathering steel examined using synchrotron radiation x-rays

    International Nuclear Information System (INIS)

    Yamashita, Masato; Uchida, Hitoshi; Konishi, Hiroyuki; Mizuki, Jun'ichiro


    The X-ray absorption fine structure (XAFS) spectrum of pure goethite around the Fe K absorption edge and that of the protective rust layer formed on weathering steel exposed for 17 years in an atmospheric environment around the Cr K edge, have been examined using synchrotron radiation X-rays. It was found that the rust layer on the weathering steel mainly consisted of Cr-goethite. By examining the fine structure at the Cr K edge and the Fe K edge, we concluded that Cr 3+ in the rust layer is coordinated with O 2- and is positioned in the double chains of vacant sites in the network of FeO 3 (OH) 3 octahedra in the goethite crystal. This Cr 3+ site indicates that the protective effect of the rust layer is due to the dense aggregation of fine crystals of Cr-goethite with cation selectivity. (author)


    Zerovalent iron is being used in permeable reactive barriers (PRBs) to remediate groundwater arsenic contamination. Iron(II, III) hydroxycarbonate green rust is a major corrosion product of zerovalent iron under anaerobic conditions. The interaction between arsenic and this green...

  11. Chemical reduction of rust on 2 1/4 Cr-1 Mo steel surface in sodium

    International Nuclear Information System (INIS)

    Yokota, N.; Shimoyashiki, S.


    Low-alloy Fe-2 1/4 Cr-1 Mo ferritic steel has been favored for the tube material of steam generators in fast breeder reactors (FBRs). However, this material rusts easily due to moisture condensation on its surface when left in air. Therefore, measures to prevent tube materials from rusting have been taken during manufacturing of the steam generators. When rust is present on tube surfaces, its oxygen and iron dissolve into liquid sodium. When the concentration of these impurities in the sodium increases rapidly, the cold traps can become choked locally and lose their removal ability. This work has been done, therefore, to clarify reduction processes of rust in sodium and to select optimum operating temperatures of steam generators in the initial operation

  12. Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.). (United States)

    Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L


    Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.

  13. 16 CFR 23.10 - Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant... (United States)


    ... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant,” etc. (a) It is unfair or deceptive to: (1) Use the terms “corrosion proof,” “noncorrosive... the product will be immune from rust and other forms of corrosion during the life expectancy of the...

  14. Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat. (United States)

    Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S


    We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.

  15. Sustracted library obtained from mutant sugarcane variety B 4362 resistant to rust


    María I. Oloriz; Luis Rojas; Víctor Gil; Elio Jiménez


    The hypersensitive response is one of the most powerful mechanisms for which the plants resist pathogen attack. Mutations carried out previously on the variety B4362, of sugarcane, originated five mutants that express this mechanism towards the attack of rust (Puccinia melanocephala Syd.). By means of a subtractive hybridization among the cDNA obtained starting from the resistant clone inoculated with rust and a pool of cDNA of the susceptible variety (B4362) inoculated and of the resistant c...

  16. Pushing the boundaries of resistance: insights from Brachypodium-rust interactions


    Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.


    The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...

  17. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules. (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John


    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  18. Genetics and mapping of a new leaf rust resistance gene in Triticum ...

    Indian Academy of Sciences (India)

    Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...

  19. Population structure of Chinese southwest wheat germplasms resistant to stripe rust and powdery mildew using the DArT-seq technique

    Directory of Open Access Journals (Sweden)

    Tianqing Chen


    Full Text Available ABSTRACT: Understanding genetic variability in existing wheat accessions is critical for collection, conservation and use of wheat germplasms. In this study, 138 Chinese southwest wheat accessions were investigated by genotyping using two resistance gene makers (Pm21 and Yr26 and DArT-seq technique. Finally, about 50% cultivars (lines amplified the specific allele for the Yr26 gene (Gwm11 and 40.6% for the Pm21 gene (SCAR1265. By DArT-seq analysis, 30,485 markers (6486 SNPs and 23999 DArTs were obtained with mean polymorphic information content (PIC value 0.33 and 0.28 for DArT and SNP marker, respectively. The mean Dice genetic similarity coefficient (GS was 0.72. Two consistent groups of wheat varieties were identified using principal coordinate analysis (PCoA at the level of both the chromosome 6AS and the whole-genome, respectively. Group I was composed of non-6VS/6AL translocation lines of different origins, while Group II was composed of 6VS/6AL translocation (T6VS/6AL lines, most of which carried the Yr26 and Pm21 genes and originated from Guizhou. Besides, a model-based population structure analysis revealed extensive admixture and further divided these wheat accessions into six subgroups (SG1, SG2, SG3, SG4, SG5 and SG6, based on their origin, pedigree or disease resistance. This information is useful for wheat breeding in southwestern China and association mapping for disease resistance using these wheat germplasms in future.

  20. A new early-warning system for stripe rust affecting wheat and triticale: Host-pathogen interactions under different environmental conditions

    DEFF Research Database (Denmark)

    Rodriguez Algaba, Julian; Justesen, Annemarie Fejer; Hovmøller, Mogens Støvring

    resistant it was susceptible under field conditions in March 2012. All Pst isolates from Tulus, obtained from multiple locations, were identified as the ‘Kranich’-race, and were avirulent on Tulus under experimental conditions. In May and June 2012 Tulus recovered on a country-wide scale and was resistant...

  1. Effects of rust in the crack face on crack detection based on Sonic-IR method

    International Nuclear Information System (INIS)

    Harai, Y.; Izumi, Y.; Tanabe, H.; Takamatsu, T.; Sakagami, T.


    Sonic-IR, which is based on the thermographic detection of the temperature rise due to frictional heating at the defect faces under ultrasonic excitation, has an advantage in the detection of closed and small defects. However, this method has a lot of nuclear factors relating to heat generation. In this study, effects of rust in the crack faces on the crack detection based on the sonic-IR method is experimentally investigated by using crack specimens. The heat generation by ultrasonic excitation was observed regularly during rust accelerated test using original device. The distribution of temperature change around the crack was changed with the progress of rust. This change in heat generation, it believed to be due to change in the contact state of the crack surface due to rust. As a result, it was found that heat generation by ultrasonic excitation is affected by rust in the crack faces. And it was also found that crack detection can be conducted by sonic-IR even if rust was generated in the crack faces. (author)

  2. Quantitative characterization of the atomic-scale structure of oxyhydroxides in rusts formed on steel surfaces

    International Nuclear Information System (INIS)

    Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.


    Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces

  3. In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections. (United States)

    Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G


    Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.

  4. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.


    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  5. Flavan-3-ols Are an Effective Chemical Defense against Rust Infection1[OPEN (United States)

    Unsicker, Sybille B.; Fellenberg, Christin; Schmidt, Axel


    Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar (Populus nigra), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(−)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus (Melampsora larici-populina) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen (Populus tremula × Populus alba) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134, on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. PMID:29070515

  6. Induced mutants in beans and peas resistant to rust

    International Nuclear Information System (INIS)

    Fadl, F.A.M.


    Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M 1 was cultivated in 1978

  7. A summary of information on the rust Puccinia psidii Winter (guava rust) with emphasis on means to prevent introduction of additional strains to Hawaii (United States)

    Loope, Lloyd


    The neotropical rust fungus Puccinia psidii(P. psidii) was originally described from the host common guava in its native Brazil but has been found since on hosts throughout the myrtle family (Myrtaceae), including a dramatic host jump to nonnative Eucalyptus plantations. Most rust fungi are able to live only on a very narrow range of host species. P. psidii is unusual both for having a broad host range and for the intensity of its damage to susceptible young growth. This rust first got a foothold in the United States in Florida more than three decades ago. The U.S. Department of Agriculture (USDA) has since considered it a nonactionable, nonreportable pest. Hawaii and Florida are the only two states with native species in the myrtle family. Over a period of 30 years, this rust has done little damage to any of the scattered native Myrtaceae in Florida, although the host range of the rust has gradually grown to about 30 mostly nonnative species in the family, apparently because of increasing genetic variety of the rust by repeated introductions. However, Florida’s native Myrtaceae are among the roughly 1,100 neotropical species that are largely resistant to P. psidii. The 3,000 species of non-neotropical Myrtaceae of the Pacific, Australia, Asia, and Africa are expected to prove much more vulnerable to P. psidii. Little is known about the genetics or genetic strains of P. psidii, although existing literature shows that there are numerous strains that have differential ability to infect suites of host plants.

  8. Molecular Cytogenetic Characterization of two Triticum–Secale–Thinopyrum Trigeneric Hybrids Exhibiting Superior Resistance to Fusarium Head Blight, Leaf Rust, and Stem Rust Race Ug99

    Directory of Open Access Journals (Sweden)

    Yi Dai


    Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.

  9. Magnetic stripes in the UCoGe superconductor

    Energy Technology Data Exchange (ETDEWEB)

    Mora, Pablo de la [Departemento de Fisica, Facultad de Ciencias, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-542, 04510 Mexico DF, Mexico and Institute de Investigacion en Materiales, Universidad Nacional Autonoma de Mexico, Campus Morelia (Mexico); Navarro, O, E-mail: delamora@unam.m [Instituto de Investigacion en Materiales, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-360, 04510 Mexico DF (Mexico)


    The magnetic superconductor UCoGe is analyzed with an electronic structure package, spin-orbit coupling and intra-atomic repulsion (via Hubbard U{sub H}) were included. The possibility of an antiferromagnetic configuration is studied, but it is found to be unstable, also the non-collinear magnetization seems to be ruled out. The magnetization is given mainly by the Co-atoms with M = 0.6 mu{sub B}/f.u. The U-atoms have two magnetic moments; M = 0.07 and 0.32 mu{sub B}/f.u. arranged in an alternated planes along the b-direction forming magnetic stripes.

  10. AlGaInAs narrow stripe selective growth on substrates patterned with different mask designs

    International Nuclear Information System (INIS)

    Feng, W; Pan, J Q; Yang, H; Hou, L P; Zhou, F; Zhao, L J; Zhu, H L; Wang, W


    We have performed a narrow stripe selective growth of oxide-free AlGaInAs waveguides on InP substrates patterned with pairs of SiO 2 mask stripes under optimized growth conditions. The mask stripe width varied from 0 to 40 μm, while the window region width between a pair of mask stripes was fixed at 1.5, 2.5 or 3.5 μm. Flat and smooth AlGaInAs waveguides covered by specific InP layers are successfully grown on substrates patterned with different mask designs. The thickness enhancement ratio and the photoluminescence (PL) spectrum of the AlGaInAs narrow stripe waveguides are strongly dependent on the mask stripe width and the window region width. In particular, a large PL wavelength shift of 79 nm and a PL FWHM of less than 64 meV are obtained simultaneously with a small mask stripe width varying from 0 to 40 μm when the window region width is 1.5 μm. We present some possible interpretations of the experimental observations in considering both the migration effect from a masked region and the lateral vapour diffusion effect

  11. Striped morphologies induced by magnetic impurities in d-wave superconductors

    International Nuclear Information System (INIS)

    Zuo Xianjun


    Research Highlights: → We investigate striped morphologies induced by magnetic impurities in d-wave superconductors (DSCs). → For the single-impurity and two-impurity cases, modulated checkerboard pattern and stripe-like structures are induced. → When more magnetic impurities are inserted, more complex modulated structures could be induced, including rectilinear and right-angled stripes and quantum-corral-like structures. → Impurities could induce complex striped morphologies in DSCs. - Abstract: We study striped morphologies induced by magnetic impurities in d-wave superconductors (DSCs) near optimal doping by self-consistently solving the Bogoliubov-de Gennes equations based on the t - t' - U - V model. For the single-impurity case, it is found that the stable ground state is a modulated checkerboard pattern. For the two-impurity case, the stripe-like structures in order parameters are induced due to the impurity-pinning effect. The modulations of DSC and charge orders share the same period of four lattice constants (4a), which is half the period of modulations in the coexisting spin order. Interestingly, when three or more impurities are inserted, the impurities could induce more complex striped morphologies due to quantum interference. Further experiments of magnetic impurity substitution in DSCs are expected to check these results.

  12. Influence of Rust Permeability on Corrosion of E690 Steel in Industrial and Non-industrial Marine Splash Zones (United States)

    Chen, Mindong; Pang, Kun; Liu, Zhiyong; Wu, Junsheng; Li, Xiaogang


    The corrosion behaviour of E690 steel in industrial and non-industrial marine splash environments was studied by environmental testing, morphology analysis, electrochemical measurements, and scanning Kelvin probe microscopy. Chloride and sulphide anions were found to diffuse across the rust layer following the evaporation of seawater splashed on the steel's surface. The cation-selective permeability of the rust layer resulted in an anion concentration gradient across the rust layer, which was more significant in the presence of sulphur dioxide. In addition, sulphur dioxide enhanced the formation of α-FeOOH, which led to the formation of distinct anode and cathode areas at the rust/steel interface.


    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE


    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  14. Striped Bass Spawning in Non-Estuarine Portions of the Savannah River

    Energy Technology Data Exchange (ETDEWEB)

    Martin, D.; Paller, M.


    Historically, the estuarine portions of the Savannah River have been considered to be the only portion of the river in which significant amounts of striped bass (Morone saxatilis) spawning normally occur. A reexamination of data from 1983 through 1985 shows a region between River Kilometers 144 and 253 where significant numbers of striped bass eggs and larvae occur with estimated total egg production near that currently produced in the estuarine reaches. It appears possible that there are two separate spawning populations of striped bass in the Savannah River.

  15. Magnonic quantum spin Hall state in the zigzag and stripe phases of the antiferromagnetic honeycomb lattice (United States)

    Lee, Ki Hoon; Chung, Suk Bum; Park, Kisoo; Park, Je-Geun


    We investigated the topological property of magnon bands in the collinear magnetic orders of zigzag and stripe phases for the antiferromagnetic honeycomb lattice and identified Berry curvature and symmetry constraints on the magnon band structure. Different symmetries of both zigzag and stripe phases lead to different topological properties, in particular, the magnon bands of the stripe phase being disentangled with a finite Dzyaloshinskii-Moriya (DM) term with nonzero spin Chern number. This is corroborated by calculating the spin Nernst effect. Our study establishes the existence of a nontrivial magnon band topology for all observed collinear antiferromagnetic honeycomb lattices in the presence of the DM term.

  16. Magnetic stripes and holes: Complex domain patterns in perforated films with weak perpendicular anisotropy

    Directory of Open Access Journals (Sweden)

    F. Valdés-Bango


    Full Text Available Hexagonal antidot arrays have been patterned on weak perpendicular magnetic anisotropy NdCo films by e-beam lithography and lift off. Domain structure has been characterized by Magnetic Force Microscopy at remanence. On a local length scale, of the order of stripe pattern period, domain configuration is controlled by edge effects within the stripe pattern: stripe domains meet the hole boundary at either perpendicular or parallel orientation. On a longer length scale, in-plane magnetostatic effects dominate the system: clear superdomains are observed in the patterned film with average in-plane magnetization along the easy directions of the antidot array, correlated over several antidot array cells.

  17. Magnetic stripes and holes: Complex domain patterns in perforated films with weak perpendicular anisotropy (United States)

    Valdés-Bango, F.; Vélez, M.; Alvarez-Prado, L. M.; Alameda, J. M.; Martín, J. I.


    Hexagonal antidot arrays have been patterned on weak perpendicular magnetic anisotropy NdCo films by e-beam lithography and lift off. Domain structure has been characterized by Magnetic Force Microscopy at remanence. On a local length scale, of the order of stripe pattern period, domain configuration is controlled by edge effects within the stripe pattern: stripe domains meet the hole boundary at either perpendicular or parallel orientation. On a longer length scale, in-plane magnetostatic effects dominate the system: clear superdomains are observed in the patterned film with average in-plane magnetization along the easy directions of the antidot array, correlated over several antidot array cells.

  18. Effectiveness of Fungicide on Soybean Rust in the Southeastern United States: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Mary Delaney


    Full Text Available Soybean rust (SBR, caused by the fungus Phakopsora pachyrhizi Sydow, has been of concern to soybean (Glycine max Merrill growers in the southern United States since its introduction in 2004. As this fungus develops, pustules become numerous on the underside of leaves, which then turn yellow and drop prematurely, resulting in fewer pods, and poorly developed seeds. Our objective was to evaluate the efficacy of fungicide use in controlling SBR by conducting a meta-analysis of 61 published and unpublished trials across the southern United States from 2004 to 2014. We analyzed fungicide efficacy based on factors such as specific classes of fungicide, active ingredients, number of fungicide applications, target growth stage upon initial application, level of disease pressure, and year of the study. Fungicides significantly increased yield and 100-seed weight and decreased the severity of SBR. The means of SBR severity, yield, and 100-seed weight in fungicide-treated plants were 9% (95% confidence interval: 2%, 21%, 128% (121%, 135%, and 121% (116%, 128%, respectively, of those calculated in the control plants. By using meta-analysis to analyze fungicide efficacy across multiple field trials, we were able to determine that one application of a strobilurin fungicide when plants were either beginning pod development (R3 or developing seeds (R5 was the most cost-effective approach to controlling SBR and increasing 100-seed weight.

  19. Evaluation of Local Wheat Cultivars Susceptibility to infection with Black Stem Rust

    International Nuclear Information System (INIS)

    Batta, Y.A.


    The present study was conducted to assess the susceptibility of seven local wheat cultivars from Palestine to infection with black stem rust caused by Puccinia graminis f. sp. tritici. Two techniques of disease inoculation were applied during bioassays: global inoculation of entire wheat plants with urediospores and localized inoculation with urediospores and localized inoculation with urediospores on wheat leaf-pieces incubated under humid conditions. Susceptibility of tested cultivars was evaluated according to disease scale based on number and size of typical unredial pustules that appeared after inoculation on entire plants or leaf pieces. Results obtained on bioassay of susceptibility and disease rating on entire plants indicated that Anbar, Kamata and Hetiya safra cultivars were the least susceptible to P. g. tritici infection, whereas Debiya beda cultivar was the most susceptible. The other tested cultivars such as Nab-El-Jama, sawda and Senf 870 were moderately susceptible. On leaf-pieces, Anbar and Kamatat were the least susceptible cultivars, whereas Debiya beda and Nab-El-Jamal were the most susceptible cultivars. The other tested cultivars such as Debiya swada, Senf 870 and Hetiya safra were moderately susceptible. Significant reductions were obtained for the size of unredial postules formed on leaf-pieces when inoculated in an unwounded state compared to the wounded indicating the importance of wounds during inoculation. The global results indicated the possibility of using above method of disease inoculating, scaling and rating for evaluation of wheat cultivars susceptibility for the eventual use in breeding program for resistant varieties in Palestine. (author)

  20. Rust and Thinning Management Effect on Cup Quality and Plant Performance for Two Cultivars of Coffea arabica L. (United States)

    Echeverria-Beirute, Fabian; Murray, Seth C; Klein, Patricia; Kerth, Chris; Miller, Rhonda; Bertrand, Benoit


    Beverage quality is a complex attribute of coffee ( Coffea arabica L.). Genotype (G), environment (E), management (M), postharvest processing, and roasting are all involved. However, little is known about how G × M interactions influence beverage quality. We investigated how yield and coffee leaf rust (CLR) disease (caused by Hemileia vastatrix Berk. et Br.) management affect cup quality and plant performance, in two coffee cultivars. Sensory and chemical analyses revealed that 10 of 70 attributes and 18 of 154 chemical volatile compounds were significantly affected by G and M. Remarkably, acetaminophen was found for the first time in roasted coffee and in higher concentrations under more stressful conditions. A principal component analysis described 87% of the variation in quality and plant overall performance. This study is a first step in understanding the complexity of the physiological, metabolic, and molecular changes in coffee production, which will be useful for the improvement of coffee cultivars.