WorldWideScience

Sample records for striking sequence homology

  1. Partial amino acid sequence of apolipoprotein(a) shows that it is homologous to plasminogen

    International Nuclear Information System (INIS)

    Eaton, D.L.; Fless, G.M.; Kohr, W.J.; McLean, J.W.; Xu, Q.T.; Miller, C.G.; Lawn, R.M.; Scanu, A.M.

    1987-01-01

    Apolipoprotein(a) [apo(a)] is a glycoprotein with M/sub r/ ∼ 280,000 that is disulfide linked to apolipoprotein B in lipoprotein(a) particles. Elevated plasma levels of lipoprotein(a) are correlated with atherosclerosis. Partial amino acid sequence of apo(a) shows that it has striking homology to plasminogen. Plasminogen is a plasma serine protease zymogen that consists of five homologous and tandemly repeated domains called kringles and a trypsin-like protease domain. The amino-terminal sequence obtained for apo(a) is homologous to the beginning of kringle 4 but not the amino terminus of plasminogen. Apo(a) was subjected to limited proteolysis by trypsin or V8 protease, and fragments generated were isolated and sequenced. Sequences obtained from several of these fragments are highly (77-100%) homologous to plasminogen residues 391-421, which reside within kringle 4. Analysis of these internal apo(a) sequences revealed that apo(a) may contain at least two kringle 4-like domains. A sequence obtained from another tryptic fragment also shows homology to the end of kringle 4 and the beginning of kringle 5. Sequence data obtained from the two tryptic fragments shows homology with the protease domain of plasminogen. One of these sequences is homologous to the sequences surrounding the activation site of plasminogen. Plasminogen is activated by the cleavage of a specific arginine residue by urokinase and tissue plasminogen activator; however, the corresponding site in apo(a) is a serine that would not be cleaved by tissue plasminogen activator or urokinase. Using a plasmin-specific assay, no proteolytic activity could be demonstrated for lipoprotein(a) particles. These results suggest that apo(a) contains kringle-like domains and an inactive protease domain

  2. Detecting false positive sequence homology: a machine learning approach.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M

    2016-02-24

    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  3. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

    Science.gov (United States)

    2012-01-01

    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence

  4. Using structure to explore the sequence alignment space of remote homologs.

    Science.gov (United States)

    Kuziemko, Andrew; Honig, Barry; Petrey, Donald

    2011-10-01

    Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP) are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  5. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  6. Using structure to explore the sequence alignment space of remote homologs.

    Directory of Open Access Journals (Sweden)

    Andrew Kuziemko

    2011-10-01

    Full Text Available Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  7. Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU

    2010-02-01

    Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

  8. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  9. Electromyographic Study of a Sequence of Yau-Man Kung Fu Palm Strikes with and without Impact.

    Science.gov (United States)

    Neto, Osmar Pinto; Magini, Marcio; Pacheco, Marcos T T

    2007-01-01

    IN MARTIAL ARTS AND CONTACT SPORTS, STRIKES ARE OFTEN TRAINED IN TWO DIFFERENT WAYS: with and without impacts. This study aims to compare the electromyographical activity (EMG) of the triceps brachii (TB), biceps brachii (BB) and brachioradialis (BR) muscles during strikes with and without impacts. Eight Yau-Man Kung Fu practitioners participated in the experiment. Each participant performed 5 sequences of 5 consecutive KF Yau-Man palm strikes with no impact intercalated with 5 sequences of 5 repetitions targeting a KF training shield. Surface EMG signals were obtained from the TB, BB, and RB for 3.0 seconds using an eight-channel module with a total amplifier gain of 2000 and sampled at 3500 Hz. The EMG analyses were done in the time (rms) and frequency (wavelet) domains. For the frequency domain, Morlet wavelet power spectra were obtained and an original method was used to quantify statistically significant regions on the power spectra. The results both in the time and frequency domains indicate a higher TB and BR muscle activity for the strikes with impacts. No significant difference was found for the BB in the two different scenarios. In addition, the results show that the wavelet power spectra pattern for the three analysed muscles obtained from the strikes with and without impacts were similar. Key pointsEMG analysis of a sequence of Kung Fu strikes demonstrates higher Triceps Brachii and Brachioradialis muscle activity for strikes with impact than strikes without impact.An original reliable method for quantifying EMG wavelet transform results is presented.EMG wavelet power spectra describe muscle roles during a Kung Fu sequence of strikes.

  10. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    Science.gov (United States)

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  11. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.

    Science.gov (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C

    2010-12-20

    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  12. Characterization of Aftershock Sequences from Large Strike-Slip Earthquakes Along Geometrically Complex Faults

    Science.gov (United States)

    Sexton, E.; Thomas, A.; Delbridge, B. G.

    2017-12-01

    Large earthquakes often exhibit complex slip distributions and occur along non-planar fault geometries, resulting in variable stress changes throughout the region of the fault hosting aftershocks. To better discern the role of geometric discontinuities on aftershock sequences, we compare areas of enhanced and reduced Coulomb failure stress and mean stress for systematic differences in the time dependence and productivity of these aftershock sequences. In strike-slip faults, releasing structures, including stepovers and bends, experience an increase in both Coulomb failure stress and mean stress during an earthquake, promoting fluid diffusion into the region and further failure. Conversely, Coulomb failure stress and mean stress decrease in restraining bends and stepovers in strike-slip faults, and fluids diffuse away from these areas, discouraging failure. We examine spatial differences in seismicity patterns along structurally complex strike-slip faults which have hosted large earthquakes, such as the 1992 Mw 7.3 Landers, the 2010 Mw 7.2 El-Mayor Cucapah, the 2014 Mw 6.0 South Napa, and the 2016 Mw 7.0 Kumamoto events. We characterize the behavior of these aftershock sequences with the Epidemic Type Aftershock-Sequence Model (ETAS). In this statistical model, the total occurrence rate of aftershocks induced by an earthquake is λ(t) = λ_0 + \\sum_{i:t_i

  13. HomPPI: a class of sequence homology based protein-protein interface prediction methods

    Directory of Open Access Journals (Sweden)

    Dobbs Drena

    2011-06-01

    Full Text Available Abstract Background Although homology-based methods are among the most widely used methods for predicting the structure and function of proteins, the question as to whether interface sequence conservation can be effectively exploited in predicting protein-protein interfaces has been a subject of debate. Results We studied more than 300,000 pair-wise alignments of protein sequences from structurally characterized protein complexes, including both obligate and transient complexes. We identified sequence similarity criteria required for accurate homology-based inference of interface residues in a query protein sequence. Based on these analyses, we developed HomPPI, a class of sequence homology-based methods for predicting protein-protein interface residues. We present two variants of HomPPI: (i NPS-HomPPI (Non partner-specific HomPPI, which can be used to predict interface residues of a query protein in the absence of knowledge of the interaction partner; and (ii PS-HomPPI (Partner-specific HomPPI, which can be used to predict the interface residues of a query protein with a specific target protein. Our experiments on a benchmark dataset of obligate homodimeric complexes show that NPS-HomPPI can reliably predict protein-protein interface residues in a given protein, with an average correlation coefficient (CC of 0.76, sensitivity of 0.83, and specificity of 0.78, when sequence homologs of the query protein can be reliably identified. NPS-HomPPI also reliably predicts the interface residues of intrinsically disordered proteins. Our experiments suggest that NPS-HomPPI is competitive with several state-of-the-art interface prediction servers including those that exploit the structure of the query proteins. The partner-specific classifier, PS-HomPPI can, on a large dataset of transient complexes, predict the interface residues of a query protein with a specific target, with a CC of 0.65, sensitivity of 0.69, and specificity of 0.70, when homologs of

  14. An HMM posterior decoder for sequence feature prediction that includes homology information

    DEFF Research Database (Denmark)

    Käll, Lukas; Krogh, Anders Stærmose; Sonnhammer, Erik L. L.

    2005-01-01

    Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines probabil......Motivation: When predicting sequence features like transmembrane topology, signal peptides, coil-coil structures, protein secondary structure or genes, extra support can be gained from homologs. Results: We present here a general hidden Markov model (HMM) decoding algorithm that combines......://phobius.cgb.ki.se/poly.html . An implementation of the algorithm is available on request from the authors....

  15. [Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

    Science.gov (United States)

    Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

    2013-04-01

    The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

  16. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles

    DEFF Research Database (Denmark)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole

    2010-01-01

    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.......0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models.......3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is...

  17. Structured methods and striking moments: using question sequences in "living" ways.

    Science.gov (United States)

    Lowe, Roger

    2005-03-01

    This article draws together two seemingly incompatible practices in social constructionist therapies: the use of structured questioning methods (associated with solution-focused and narrative therapies) and the poetic elaboration of "striking moments" (associated with conversational therapies). To what extent can we value and use both styles of practice? Beginning with practitioners' concerns about the use of structured question sequences, I explore possibilities for resituating these methods in different conceptual and metaphorical frames, selectively drawing on ideas from the philosophy of striking moments. The aim is not to reduce one therapeutic style to another, but to encourage the teaching and practice of structured methods in more creative, improvisational, and "living" ways.

  18. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru

    1989-01-01

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  19. GLASSgo – Automated and Reliable Detection of sRNA Homologs From a Single Input Sequence

    Directory of Open Access Journals (Sweden)

    Steffen C. Lott

    2018-04-01

    Full Text Available Bacterial small RNAs (sRNAs are important post-transcriptional regulators of gene expression. The functional and evolutionary characterization of sRNAs requires the identification of homologs, which is frequently challenging due to their heterogeneity, short length and partly, little sequence conservation. We developed the GLobal Automatic Small RNA Search go (GLASSgo algorithm to identify sRNA homologs in complex genomic databases starting from a single sequence. GLASSgo combines an iterative BLAST strategy with pairwise identity filtering and a graph-based clustering method that utilizes RNA secondary structure information. We tested the specificity, sensitivity and runtime of GLASSgo, BLAST and the combination RNAlien/cmsearch in a typical use case scenario on 40 bacterial sRNA families. The sensitivity of the tested methods was similar, while the specificity of GLASSgo and RNAlien/cmsearch was significantly higher than that of BLAST. GLASSgo was on average ∼87 times faster than RNAlien/cmsearch, and only ∼7.5 times slower than BLAST, which shows that GLASSgo optimizes the trade-off between speed and accuracy in the task of finding sRNA homologs. GLASSgo is fully automated, whereas BLAST often recovers only parts of homologs and RNAlien/cmsearch requires extensive additional bioinformatic work to get a comprehensive set of homologs. GLASSgo is available as an easy-to-use web server to find homologous sRNAs in large databases.

  20. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.

    1998-01-01

    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  1. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  2. ELECTROMYOGRAPHIC STUDY OF A SEQUENCE OF YAU-MAN KUNG FU PALM STRIKES WITH AND WITHOUT IMPACT

    Directory of Open Access Journals (Sweden)

    Osmar Pinto Neto

    2007-10-01

    Full Text Available In martial arts and contact sports, strikes are often trained in two different ways: with and without impacts. This study aims to compare the electromyographical activity (EMG of the triceps brachii (TB, biceps brachii (BB and brachioradialis (BR muscles during strikes with and without impacts. Eight Yau-Man Kung Fu practitioners participated in the experiment. Each participant performed 5 sequences of 5 consecutive KF Yau-Man palm strikes with no impact intercalated with 5 sequences of 5 repetitions targeting a KF training shield. Surface EMG signals were obtained from the TB, BB, and RB for 3.0 seconds using an eight-channel module with a total amplifier gain of 2000 and sampled at 3500 Hz. The EMG analyses were done in the time (rms and frequency (wavelet domains. For the frequency domain, Morlet wavelet power spectra were obtained and an original method was used to quantify statistically significant regions on the power spectra. The results both in the time and frequency domains indicate a higher TB and BR muscle activity for the strikes with impacts. No significant difference was found for the BB in the two different scenarios. In addition, the results show that the wavelet power spectra pattern for the three analysed muscles obtained from the strikes with and without impacts were similar

  3. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    International Nuclear Information System (INIS)

    Chang, Soo-Ik; Hammes, G.G.

    1989-01-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  4. Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

  5. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles.

    Science.gov (United States)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl

    2010-07-01

    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is web server is available at http://www.cbs.dtu.dk/services/CPHmodels/.

  6. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

    KAUST Repository

    Cui, Xuefeng

    2016-06-15

    Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. Method: We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence–structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. Results: We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM–HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods.

  7. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Directory of Open Access Journals (Sweden)

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  8. A sensitive short read homology search tool for paired-end read sequencing data.

    Science.gov (United States)

    Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai

    2017-10-16

    Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .

  9. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    Megeed, A.A.

    2011-01-01

    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  10. Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs

    NARCIS (Netherlands)

    Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M.

    The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange

  11. Protein backbone angle restraints from searching a database for chemical shift and sequence homology

    Energy Technology Data Exchange (ETDEWEB)

    Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    1999-03-15

    Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

  12. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  13. MIPS: a database for protein sequences, homology data and yeast genome information.

    Science.gov (United States)

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  14. Relative K-homology and normal operators

    DEFF Research Database (Denmark)

    Manuilov, Vladimir; Thomsen, Klaus

    2009-01-01

    -term exact sequence which generalizes the excision six-term exact sequence in the first variable of KK-theory. Subsequently we investigate the relative K-homology which arises from the group of relative extensions by specializing to abelian $C^*$-algebras. It turns out that this relative K-homology carries...

  15. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    Science.gov (United States)

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  16. Top-Down-Assisted Bottom-Up Method for Homologous Protein Sequencing: Hemoglobin from 33 Bird Species

    Science.gov (United States)

    Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.

    2015-11-01

    Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.

  17. The OGCleaner: filtering false-positive homology clusters.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

    2017-01-01

    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

    Science.gov (United States)

    Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

    2017-01-01

    Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

  19. Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

    Directory of Open Access Journals (Sweden)

    Mukul Sharma

    2017-01-01

    Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

  20. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    Science.gov (United States)

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  1. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

    KAUST Repository

    Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin

    2016-01-01

    Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment

  2. Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

    Directory of Open Access Journals (Sweden)

    Jaimie-Leigh Jonker

    Full Text Available Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes. It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa. Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes. Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa are more conserved within barnacles than others (20 kDa.

  3. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  4. Dualities in persistent (co)homology

    International Nuclear Information System (INIS)

    De Silva, Vin; Morozov, Dmitriy; Vejdemo-Johansson, Mikael

    2011-01-01

    We consider sequences of absolute and relative homology and cohomology groups that arise naturally for a filtered cell complex. We establish algebraic relationships between their persistence modules, and show that they contain equivalent information. We explain how one can use the existing algorithm for persistent homology to process any of the four modules, and relate it to a recently introduced persistent cohomology algorithm. We present experimental evidence for the practical efficiency of the latter algorithm

  5. Neural network and SVM classifiers accurately predict lipid binding proteins, irrespective of sequence homology.

    Science.gov (United States)

    Bakhtiarizadeh, Mohammad Reza; Moradi-Shahrbabak, Mohammad; Ebrahimi, Mansour; Ebrahimie, Esmaeil

    2014-09-07

    Due to the central roles of lipid binding proteins (LBPs) in many biological processes, sequence based identification of LBPs is of great interest. The major challenge is that LBPs are diverse in sequence, structure, and function which results in low accuracy of sequence homology based methods. Therefore, there is a need for developing alternative functional prediction methods irrespective of sequence similarity. To identify LBPs from non-LBPs, the performances of support vector machine (SVM) and neural network were compared in this study. Comprehensive protein features and various techniques were employed to create datasets. Five-fold cross-validation (CV) and independent evaluation (IE) tests were used to assess the validity of the two methods. The results indicated that SVM outperforms neural network. SVM achieved 89.28% (CV) and 89.55% (IE) overall accuracy in identification of LBPs from non-LBPs and 92.06% (CV) and 92.90% (IE) (in average) for classification of different LBPs classes. Increasing the number and the range of extracted protein features as well as optimization of the SVM parameters significantly increased the efficiency of LBPs class prediction in comparison to the only previous report in this field. Altogether, the results showed that the SVM algorithm can be run on broad, computationally calculated protein features and offers a promising tool in detection of LBPs classes. The proposed approach has the potential to integrate and improve the common sequence alignment based methods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. FastBLAST: homology relationships for millions of proteins.

    Directory of Open Access Journals (Sweden)

    Morgan N Price

    Full Text Available BACKGROUND: All-versus-all BLAST, which searches for homologous pairs of sequences in a database of proteins, is used to identify potential orthologs, to find new protein families, and to provide rapid access to these homology relationships. As DNA sequencing accelerates and data sets grow, all-versus-all BLAST has become computationally demanding. METHODOLOGY/PRINCIPAL FINDINGS: We present FastBLAST, a heuristic replacement for all-versus-all BLAST that relies on alignments of proteins to known families, obtained from tools such as PSI-BLAST and HMMer. FastBLAST avoids most of the work of all-versus-all BLAST by taking advantage of these alignments and by clustering similar sequences. FastBLAST runs in two stages: the first stage identifies additional families and aligns them, and the second stage quickly identifies the homologs of a query sequence, based on the alignments of the families, before generating pairwise alignments. On 6.53 million proteins from the non-redundant Genbank database ("NR", FastBLAST identifies new families 25 times faster than all-versus-all BLAST. Once the first stage is completed, FastBLAST identifies homologs for the average query in less than 5 seconds (8.6 times faster than BLAST and gives nearly identical results. For hits above 70 bits, FastBLAST identifies 98% of the top 3,250 hits per query. CONCLUSIONS/SIGNIFICANCE: FastBLAST enables research groups that do not have supercomputers to analyze large protein sequence data sets. FastBLAST is open source software and is available at http://microbesonline.org/fastblast.

  7. OCCURRENCE OF SMALL HOMOLOGOUS AND COMPLEMENTARY FRAGMENTS IN HUMAN VIRUS GENOMES AND THEIR POSSIBLE ROLE

    Directory of Open Access Journals (Sweden)

    E. P. Kharchenko

    2017-01-01

    Full Text Available With computer analysis occurrence of small homologous and complementary fragments (21 nucleotides in length has been studied in genomes of 14 human viruses causing most dangerous infections. The sample includes viruses with (+ and (– single stranded RNA and DNA-containing hepatitis A virus. Analysis of occurrence of homologous sequences has shown the existence two extreme situations. On the one hand, the same virus contains homologous sequences to almost all other viruses (for example, Ebola virus, severe acute respiratory syndrome-related coronavirus, and mumps virus, and numerous homologous sequences to the same other virus (especially in severe acute respiratory syndrome-related coronavirus to Dengue virus and in Ebola virus to poliovirus. On the other hand, there are rare occurrence and not numerous homologous sequences in genomes of other viruses (rubella virus, hepatitis A virus, and hepatitis B virus. Similar situation exists for occurrence of complementary sequences. Rubella virus, the genome of which has the high content of guanine and cytosine, has no complementary sequences to almost all other viruses. Most viruses have moderate level of occurrence for homologous and complementary sequences. Autocomplementary sequences are numerous in most viruses and one may suggest that the genome of single stranded RNA viruses has branched secondary structure. In addition to possible role in recombination among strains autocomplementary sequences could be regulators of translation rate of virus proteins and determine its optimal proportion in virion assembly with genome and mRNA folding. Occurrence of small homologous and complementary sequences in RNA- and DNA-containing viruses may be the result of multiple recombinations in the past and the present and determine their adaptation and variability. Recombination may take place in coinfection of human and/or common hosts. Inclusion of homologous and complementary sequences into genome could not

  8. Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture

    Science.gov (United States)

    Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens

    2013-01-01

    Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants

  9. Prefiltering Model for Homology Detection Algorithms on GPU.

    Science.gov (United States)

    Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier

    2016-01-01

    Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

  10. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  11. PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

    Science.gov (United States)

    Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

    2016-07-08

    The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Update Direct-Strike Lightning Environment for Stockpile-to-Target Sequence

    International Nuclear Information System (INIS)

    Uman, M.A.; Rakov, V.A.; Elisme, J.O.; Jordan, D.M.; Biagi, C.J.; Hill, J.D.

    2008-01-01

    The University of Florida has surveyed all relevant publications reporting lightning characteristics and presents here an up-to-date version of the direct-strike lightning environment specifications for nuclear weapons published in 1989 by R. J. Fisher and M. A. Uman. Further, we present functional expressions for current vs. time, current derivative vs. time, second current derivative vs. time, charge transfer vs. time, and action integral (specific energy) vs. time for first return strokes, for subsequent return strokes, and for continuing currents; and we give sets of constants for these expressions so that they yield approximately the median and extreme negative lightning parameters presented in this report. Expressions for the median negative lightning waveforms are plotted. Finally, we provide information on direct-strike lightning damage to metals such as stainless steel, which could be used as components of storage containers for nuclear waste materials; and we describe UF's new experimental research program to add to the sparse data base on the properties of positive lightning. Our literature survey, referred to above, is included in four Appendices. The following four sections (II, III, IV, and V) of this final report deal with related aspects of the research: Section II. Recommended Direct-Strike Median and Extreme Parameters; Section III. Time-Domain Waveforms for First Strokes, Subsequent Strokes, and Continuing Currents; Section IV. Damage to Metal Surfaces by Lightning Currents; and Section V. Measurement of the Characteristics of Positive Lightning. Results of the literature search used to derive the material in Section II and Section IV are found in the Appendices: Appendix 1. Return Stroke Current, Appendix 2. Continuing Current, Appendix 3. Positive Lightning, and Appendix 4. Lightning Damage to Metal Surfaces

  13. An artificial functional family filter in homolog searching in next-generation sequencing metagenomics.

    Directory of Open Access Journals (Sweden)

    Ruofei Du

    Full Text Available In functional metagenomics, BLAST homology search is a common method to classify metagenomic reads into protein/domain sequence families such as Clusters of Orthologous Groups of proteins (COGs in order to quantify the abundance of each COG in the community. The resulting functional profile of the community is then used in downstream analysis to correlate the change in abundance to environmental perturbation, clinical variation, and so on. However, the short read length coupled with next-generation sequencing technologies poses a barrier in this approach, essentially because similarity significance cannot be discerned by searching with short reads. Consequently, artificial functional families are produced, in which those with a large number of reads assigned decreases the accuracy of functional profile dramatically. There is no method available to address this problem. We intended to fill this gap in this paper. We revealed that BLAST similarity scores of homologues for short reads from COG protein members coding sequences are distributed differently from the scores of those derived elsewhere. We showed that, by choosing an appropriate score cut-off, we are able to filter out most artificial families and simultaneously to preserve sufficient information in order to build the functional profile. We also showed that, by incorporated application of BLAST and RPS-BLAST, some artificial families with large read counts can be further identified after the score cutoff filtration. Evaluated on three experimental metagenomic datasets with different coverages, we found that the proposed method is robust against read coverage and consistently outperforms the other E-value cutoff methods currently used in literatures.

  14. Sequence homolog-based molecular engineering for shifting the enzymatic pH optimum

    Directory of Open Access Journals (Sweden)

    Fuqiang Ma

    2016-09-01

    Full Text Available Cell-free synthetic biology system organizes multiple enzymes (parts from different sources to implement unnatural catalytic functions. Highly adaption between the catalytic parts is crucial for building up efficient artificial biosynthetic systems. Protein engineering is a powerful technology to tailor various enzymatic properties including catalytic efficiency, substrate specificity, temperature adaptation and even achieve new catalytic functions. However, altering enzymatic pH optimum still remains a challenging task. In this study, we proposed a novel sequence homolog-based protein engineering strategy for shifting the enzymatic pH optimum based on statistical analyses of sequence-function relationship data of enzyme family. By two statistical procedures, artificial neural networks (ANNs and least absolute shrinkage and selection operator (Lasso, five amino acids in GH11 xylanase family were identified to be related to the evolution of enzymatic pH optimum. Site-directed mutagenesis of a thermophilic xylanase from Caldicellulosiruptor bescii revealed that four out of five mutations could alter the enzymatic pH optima toward acidic condition without compromising the catalytic activity and thermostability. Combination of the positive mutants resulted in the best mutant M31 that decreased its pH optimum for 1.5 units and showed increased catalytic activity at pH < 5.0 compared to the wild-type enzyme. Structure analysis revealed that all the mutations are distant from the active center, which may be difficult to be identified by conventional rational design strategy. Interestingly, the four mutation sites are clustered at a certain region of the enzyme, suggesting a potential “hot zone” for regulating the pH optima of xylanases. This study provides an efficient method of modulating enzymatic pH optima based on statistical sequence analyses, which can facilitate the design and optimization of suitable catalytic parts for the construction

  15. CBH1 homologs and varian CBH1 cellulase

    Energy Technology Data Exchange (ETDEWEB)

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Neefe, Paulien

    2014-07-01

    Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

  16. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

    DEFF Research Database (Denmark)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

    2013-01-01

    as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur....... This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control...

  17. Geologic Inheritance and Earthquake Rupture Processes: The 1905 M ≥ 8 Tsetserleg-Bulnay Strike-Slip Earthquake Sequence, Mongolia

    Science.gov (United States)

    Choi, Jin-Hyuck; Klinger, Yann; Ferry, Matthieu; Ritz, Jean-François; Kurtz, Robin; Rizza, Magali; Bollinger, Laurent; Davaasambuu, Battogtokh; Tsend-Ayush, Nyambayar; Demberel, Sodnomsambuu

    2018-02-01

    In 1905, 14 days apart, two M 8 continental strike-slip earthquakes, the Tsetserleg and Bulnay earthquakes, occurred on the Bulnay fault system, in Mongolia. Together, they ruptured four individual faults, with a total length of 676 km. Using submetric optical satellite images "Pleiades" with ground resolution of 0.5 m, complemented by field observation, we mapped in detail the entire surface rupture associated with this earthquake sequence. Surface rupture along the main Bulnay fault is 388 km in length, striking nearly E-W. The rupture is formed by a series of fault segments that are 29 km long on average, separated by geometric discontinuities. Although there is a difference of about 2 m in the average slip between the western and eastern parts of the Bulnay rupture, along-fault slip variations are overall limited, resulting in a smooth slip distribution, except for local slip deficit at segment boundaries. We show that damage, including short branches and secondary faulting, associated with the rupture propagation, occurred significantly more often along the western part of the Bulnay rupture, while the eastern part of the rupture appears more localized and thus possibly structurally simpler. Eventually, the difference of slip between the western and eastern parts of the rupture is attributed to this difference of rupture localization, associated at first order with a lateral change in the local geology. Damage associated to rupture branching appears to be located asymmetrically along the extensional side of the strike-slip rupture and shows a strong dependence on structural geologic inheritance.

  18. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    Directory of Open Access Journals (Sweden)

    Apurva Barve

    2013-01-01

    Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  19. The 2012 Strike-slip Earthquake Sequence in Black Sea and its Link to the Caucasus Collision Zone

    Science.gov (United States)

    Tseng, T. L.; Hsu, C. H.; Legendre, C. P.; Jian, P. R.; Huang, B. S.; Karakhanian, A.; Chen, C. W.

    2016-12-01

    The Black Sea formed as a back-arc basin in Late Cretaceous to Paleogene with lots of extensional features. However, the Black Sea is now tectonically stable and absent of notable earthquakes except for the coastal region. In this study we invert regional waveforms of a new seismic array to constrain the focal mechanisms and depths of the 2012/12/23 earthquake sequence occurred in northeastern Black Sea basin that can provide unique estimates on the stress field in the region. The results show that the focal mechanisms for the main shock and 5 larger aftershocks are all strike-slip faulting and resembling with each other. The main rupture fall along the vertical dipping, NW-SE trending sinistral fault indicated by the lineation of most aftershocks. The fault strike and aftershock distribution are both consistent with the Shatsky Ridge, which is continental in nature but large normal faults was created by previous subsidence. The occurrence of 2012 earthquakes can be re-activated, as strike-slip, on one of the pre-existing normal fault cutting at depth nearly 20-30 km in the extended crust. Some of the aftershocks, including a larger one occurred 5 days later, are distributed toward NE direction 20 km away from main fault zone. Those events might be triggered by the main shock along a conjugate fault, which is surprisingly at the extension of proposed transform fault perpendicular to the rift axis of eastern Black Sea Basin. The focal mechanisms also indicate that the maximum compression in northeast Black Sea is at E-W direction, completely different from the N-S compression in the Caucasus and East Turkey controlled by Arabia-Eurasia collision. The origin of E-W maximum compression is probably the same as the secondary stress inferred from earthquakes in Racha region of the Greater Caucasus.

  20. A family of cell-adhering peptides homologous to fibrinogen C-termini

    International Nuclear Information System (INIS)

    Levy-Beladev, Liron; Levdansky, Lilia; Gaberman, Elena; Friedler, Assaf; Gorodetsky, Raphael

    2010-01-01

    Research highlights: → Cell-adhesive sequences homologous to fibrinogen C-termini exist in other proteins. → The extended homologous cell-adhesive C-termini peptides family is termed Haptides. → In membrane-like environment random coiled Haptides adopt a helical conformation. → Replacing positively charged residues with alanine reduces Haptides activity. -- Abstract: A family of cell-adhesive peptides homologous to sequences on different chains of fibrinogen was investigated. These homologous peptides, termed Haptides, include the peptides Cβ, preCγ, and CαE, corresponding to sequences on the C-termini of fibrinogen chains β, γ, and αE, respectively. Haptides do not affect cell survival and rate of proliferation of the normal cell types tested. The use of new sensitive assays of cell adhesion clearly demonstrated the ability of Haptides, bound to inert matrices, to mediate attachment of different matrix-dependent cell types including normal fibroblasts, endothelial, and smooth muscle cells. Here we present new active Haptides bearing homologous sequences derived from the C-termini of other proteins, such as angiopoietin 1 and 2, tenascins C and X, and microfibril-associated glycoprotein-4. The cell adhesion properties of all the Haptides were found to be associated mainly with their 11 N-terminal residues. Mutated preCγ peptides revealed that positively charged residues account for their attachment effect. These results suggest a mechanism of direct electrostatic interaction of Haptides with the cell membrane. The extended Haptides family may be applied in modulating adhesion of cells to scaffolds for tissue regeneration and for enhancement of nanoparticulate transfection into cells.

  1. Induction of homologous recombination in Saccharomyces cerevisiae.

    Science.gov (United States)

    Simon, J R; Moore, P D

    1988-09-01

    We have investigated the effects of UV irradiation of Saccharomyces cerevisiae in order to distinguish whether UV-induced recombination results from the induction of enzymes required for homologous recombination, or the production of substrate sites for recombination containing regions of DNA damage. We utilized split-dose experiments to investigate the induction of proteins required for survival, gene conversion, and mutation in a diploid strain of S. cerevisiae. We demonstrate that inducing doses of UV irradiation followed by a 6 h period of incubation render the cells resistant to challenge doses of UV irradiation. The effects of inducing and challenge doses of UV irradiation upon interchromosomal gene conversion and mutation are strictly additive. Using the yeast URA3 gene cloned in non-replicating single- and double-stranded plasmid vectors that integrate into chromosomal genes upon transformation, we show that UV irradiation of haploid yeast cells and homologous plasmid DNA sequences each stimulate homologous recombination approximately two-fold, and that these effects are additive. Non-specific DNA damage has little effect on the stimulation of homologous recombination, as shown by studies in which UV-irradiated heterologous DNA was included in transformation/recombination experiments. We further demonstrate that the effect of competing single- and double-stranded heterologous DNA sequences differs in UV-irradiated and unirradiated cells, suggesting an induction of recombinational machinery in UV-irradiated S. cerevisiae cells.

  2. A recurrent translocation is mediated by homologous recombination between HERV-H elements

    Directory of Open Access Journals (Sweden)

    Hermetz Karen E

    2012-01-01

    Full Text Available Abstract Background Chromosome rearrangements are caused by many mutational mechanisms; of these, recurrent rearrangements can be particularly informative for teasing apart DNA sequence-specific factors. Some recurrent translocations are mediated by homologous recombination between large blocks of segmental duplications on different chromosomes. Here we describe a recurrent unbalanced translocation casued by recombination between shorter homologous regions on chromosomes 4 and 18 in two unrelated children with intellectual disability. Results Array CGH resolved the breakpoints of the 6.97-Megabase (Mb loss of 18q and the 7.30-Mb gain of 4q. Sequencing across the translocation breakpoints revealed that both translocations occurred between 92%-identical human endogenous retrovirus (HERV elements in the same orientation on chromosomes 4 and 18. In addition, we find sequence variation in the chromosome 4 HERV that makes one allele more like the chromosome 18 HERV. Conclusions Homologous recombination between HERVs on the same chromosome is known to cause chromosome deletions, but this is the first report of interchromosomal HERV-HERV recombination leading to a translocation. It is possible that normal sequence variation in substrates of non-allelic homologous recombination (NAHR affects the alignment of recombining segments and influences the propensity to chromosome rearrangement.

  3. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  4. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

  5. SANSparallel: interactive homology search against Uniprot.

    Science.gov (United States)

    Somervuo, Panu; Holm, Liisa

    2015-07-01

    Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at http://ekhidna2.biocenter.helsinki.fi/cgi-bin/sans/sans.cgi. It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

    Science.gov (United States)

    Goonesekere, Nalin Cw

    2009-01-01

    The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

  7. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

    Directory of Open Access Journals (Sweden)

    Nalin CW Goonesekere

    2009-06-01

    Full Text Available Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP database. We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution matrices enhance the efficacy of detecting remote homologs. Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure

  8. Homology groups for particles on one-connected graphs

    Science.gov (United States)

    MaciÄ Żek, Tomasz; Sawicki, Adam

    2017-06-01

    We present a mathematical framework for describing the topology of configuration spaces for particles on one-connected graphs. In particular, we compute the homology groups over integers for different classes of one-connected graphs. Our approach is based on some fundamental combinatorial properties of the configuration spaces, Mayer-Vietoris sequences for different parts of configuration spaces, and some limited use of discrete Morse theory. As one of the results, we derive the closed-form formulae for ranks of the homology groups for indistinguishable particles on tree graphs. We also give a detailed discussion of the second homology group of the configuration space of both distinguishable and indistinguishable particles. Our motivation is the search for new kinds of quantum statistics.

  9. Clustering evolving proteins into homologous families.

    Science.gov (United States)

    Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A

    2013-04-08

    Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better

  10. p53 regulates the repair of DNA double-strand breaks by both homologous and non-homologous recombination

    International Nuclear Information System (INIS)

    Willers, H.; Powell, S.N.; Dahm-Daphi, J.

    2003-01-01

    Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function

  11. Comparative anatomy, evolution, and homologies of tetrapod hindlimb muscles, comparison with forelimb muscles, and deconstruction of the forelimb-hindlimb serial homology hypothesis.

    Science.gov (United States)

    Diogo, Rui; Molnar, Julia

    2014-06-01

    For more than two centuries, the idea that the forelimb and hindlimb are serially homologous structures has been accepted without serious question. This study presents the first detailed analysis of the evolution and homologies of all hindlimb muscles in representatives of each major tetrapod group and proposes a unifying nomenclature for these muscles. These data are compared with information obtained previously about the forelimb muscles of tetrapods and the muscles of other gnathostomes in order to address one of the most central and enigmatic questions in evolutionary and comparative anatomy: why are the pelvic and pectoral appendages of gnathostomes generally so similar to each other? An integrative analysis of the new myological data, combined with a review of recent paleontological, developmental, and genetic works and of older studies, does not support serial homology between the structures of these appendages. For instance, many of the strikingly similar forelimb and hindlimb muscles found in each major extant tetrapod taxon were acquired at different geological times and/or have different embryonic origins. These similar muscles are not serial homologues, but the result of evolutionary parallelism/convergence due to a complex interplay of ontogenetic, functional, topological, and phylogenetic constraints/factors. Copyright © 2014 Wiley Periodicals, Inc.

  12. Comparison of the degree of homology of DNA and quantity of repeated sequences in an intact plant and cell structure

    International Nuclear Information System (INIS)

    Solov'yan, V.T.; Kunaleh, V.A.; Shumnyl, V.K.; Vershinin, A.V.

    1986-01-01

    This paper attempts to assess the quantity of repeated sequences and degree of homology of DNA in the intact plant and two lines of callus tissue of Rauwolfia serpentina Benth maintained for 20 years, which differ among themselves in the level of biosynthesis of the pharmacologically valuable alkaloid ajmaline. The tritium-labeled repeats of plants and calli were used in direct and reverse hybridization on nitrocellulose filters. Hybridization of H 3-labeled repeats with phage 17 DNA was used as control. The radioactivity of filters after washing was measured in a liquid scintillation counter

  13. The lytic origin of herpesvirus papio is highly homologous to Epstein-Barr virus ori-Lyt: evolutionary conservation of transcriptional activation and replication signals.

    Science.gov (United States)

    Ryon, J J; Fixman, E D; Houchens, C; Zong, J; Lieberman, P M; Chang, Y N; Hayward, G S; Hayward, S D

    1993-01-01

    Herpesvirus papio (HVP) is a B-lymphotropic baboon virus with an estimated 40% homology to Epstein-Barr virus (EBV). We have cloned and sequenced ori-Lyt of herpesvirus papio and found a striking degree of nucleotide homology (89%) with ori-Lyt of EBV. Transcriptional elements form an integral part of EBV ori-Lyt. The promoter and enhancer domains of EBV ori-Lyt are conserved in herpesvirus papio. The EBV ori-Lyt promoter contains four binding sites for the EBV lytic cycle transactivator Zta, and the enhancer includes one Zta and two Rta response elements. All five of the Zta response elements and one of the Rta motifs are conserved in HVP ori-Lyt, and the HVP DS-L leftward promoter and the enhancer were activated in transient transfection assays by the EBV Zta and Rta transactivators. The EBV ori-Lyt enhancer contains a palindromic sequence, GGTCAGCTGACC, centered on a PvuII restriction site. This sequence, with a single base change, is also present in the HVP ori-Lyt enhancer. DNase I footprinting demonstrated that the PvuII sequence was bound by a protein present in a Raji nuclear extract. Mobility shift and competition assays using oligonucleotide probes identified this sequence as a binding site for the cellular transcription factor MLTF. Mutagenesis of the binding site indicated that MLTF contributes significantly to the constitutive activity of the ori-Lyt enhancer. The high degree of conservation of cis-acting signal sequences in HVP ori-Lyt was further emphasized by the finding that an HVP ori-Lyt-containing plasmid was replicated in Vero cells by a set of cotransfected EBV replication genes. The central domain of EBV ori-Lyt contains two related AT-rich palindromes, one of which is partially duplicated in the HVP sequence. The AT-rich palindromes are functionally important cis-acting motifs. Deletion of these palindromes severely diminished replication of an ori-Lyt target plasmid. Images PMID:8389916

  14. Striking Clepsydras

    Science.gov (United States)

    Nam, Moon-Hyon

    The term "Striking Clepsydra" is a shortened translation of the Korean name Jagyeongnu (自擊漏, tzu-chi lou in Chinese, literally "automatic-striking water-clock"). It was given to the two monumental time-keeping installations built by chief court engineer Yeong-sil Jang in AD 1432-38 under King Sejong (r. AD 1418-50) of the Joseon dynasty (1392-1910) in Seoul. These were housed separately in the Gyeongbok palace complex as major installations of the Royal Observatory Ganuidae equipped during 1432-38. One was the Striking Palace Clepsydra Borugangnu that was employed as the standard time-keeper from 1434, and the other was the Striking Heavenly Clepsydra Heumgyeonggangnu that was put into use not only as the symbol of Neo-Confucian ideology from 1438, but also as a demonstrational orrery and time-keeper. These were restored several times through the dynasty after loss by fires and warfare, and clepsydra-making technologies were succeeded by the development of armillary clocks in 1669. The National Palace Museum of Korea recreated the 1434 Striking Palace Clepsydra of King Sejong, and the replica was installed for permanent exhibition from November 2007.

  15. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

    Science.gov (United States)

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

    2017-11-17

    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  16. Lightning Often Strikes Twice

    Science.gov (United States)

    2005-01-01

    Contrary to popular misconception, lightning often strikes the same place twice. Certain conditions are just ripe for a bolt of electricity to come zapping down; and a lightning strike is powerful enough to do a lot of damage wherever it hits. NASA created the Accurate Location of Lightning Strikes technology to determine the ground strike point of lightning and prevent electrical damage in the immediate vicinity of the Space Shuttle launch pads at Kennedy Space Center. The area surrounding the launch pads is enmeshed in a network of electrical wires and components, and electronic equipment is highly susceptible to lightning strike damage. The accurate knowledge of the striking point is important so that crews can determine which equipment or system needs to be retested following a strike. Accurate to within a few yards, this technology can locate a lightning strike in the perimeter of the launch pad. As an added bonus, the engineers, then knowing where the lightning struck, can adjust the variables that may be attracting the lightning, to create a zone that will be less susceptible to future strikes.

  17. MollDE: a homology modeling framework you can click with.

    Science.gov (United States)

    Canutescu, Adrian A; Dunbrack, Roland L

    2005-06-15

    Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE. http://dunbrack.fccc.edu/molide/molide.php rl_dunbrack@fccc.edu.

  18. Investigating homology between proteins using energetic profiles.

    Science.gov (United States)

    Wrabl, James O; Hilser, Vincent J

    2010-03-26

    Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding) and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved local stability, may

  19. Investigating homology between proteins using energetic profiles.

    Directory of Open Access Journals (Sweden)

    James O Wrabl

    2010-03-01

    Full Text Available Accumulated experimental observations demonstrate that protein stability is often preserved upon conservative point mutation. In contrast, less is known about the effects of large sequence or structure changes on the stability of a particular fold. Almost completely unknown is the degree to which stability of different regions of a protein is generally preserved throughout evolution. In this work, these questions are addressed through thermodynamic analysis of a large representative sample of protein fold space based on remote, yet accepted, homology. More than 3,000 proteins were computationally analyzed using the structural-thermodynamic algorithm COREX/BEST. Estimated position-specific stability (i.e., local Gibbs free energy of folding and its component enthalpy and entropy were quantitatively compared between all proteins in the sample according to all-vs.-all pairwise structural alignment. It was discovered that the local stabilities of homologous pairs were significantly more correlated than those of non-homologous pairs, indicating that local stability was indeed generally conserved throughout evolution. However, the position-specific enthalpy and entropy underlying stability were less correlated, suggesting that the overall regional stability of a protein was more important than the thermodynamic mechanism utilized to achieve that stability. Finally, two different types of statistically exceptional evolutionary structure-thermodynamic relationships were noted. First, many homologous proteins contained regions of similar thermodynamics despite localized structure change, suggesting a thermodynamic mechanism enabling evolutionary fold change. Second, some homologous proteins with extremely similar structures nonetheless exhibited different local stabilities, a phenomenon previously observed experimentally in this laboratory. These two observations, in conjunction with the principal conclusion that homologous proteins generally conserved

  20. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    Directory of Open Access Journals (Sweden)

    Geisa P.C. Evaristo

    2015-09-01

    Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

  1. GPCR-SSFE: A comprehensive database of G-protein-coupled receptor template predictions and homology models

    Directory of Open Access Journals (Sweden)

    Kreuchwig Annika

    2011-05-01

    Full Text Available Abstract Background G protein-coupled receptors (GPCRs transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Description Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. Conclusions The data provided by GPCR-SSFE are useful for investigating

  2. GPCR-SSFE: a comprehensive database of G-protein-coupled receptor template predictions and homology models.

    Science.gov (United States)

    Worth, Catherine L; Kreuchwig, Annika; Kleinau, Gunnar; Krause, Gerd

    2011-05-23

    G protein-coupled receptors (GPCRs) transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. The data provided by GPCR-SSFE are useful for investigating general and detailed sequence-structure-function relationships

  3. Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques.

    Science.gov (United States)

    Staheli, Jeannette P; Dyen, Michael R; Deutsch, Gail H; Basom, Ryan S; Fitzgibbon, Matthew P; Lewis, Patrick; Barcy, Serge

    2016-08-01

    Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally

  4. Universal sequence map (USM of arbitrary discrete sequences

    Directory of Open Access Journals (Sweden)

    Almeida Jonas S

    2002-02-01

    Full Text Available Abstract Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM, is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR. The latter enables the representation of 4 unit type sequences (like DNA as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules.

  5. SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

    Directory of Open Access Journals (Sweden)

    M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

    2006-10-01

    Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

  6. Evolutionary distance from human homologs reflects allergenicity of animal food proteins.

    Science.gov (United States)

    Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare

    2007-12-01

    In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

  7. MetaGO: Predicting Gene Ontology of Non-homologous Proteins Through Low-Resolution Protein Structure Prediction and Protein-Protein Network Mapping.

    Science.gov (United States)

    Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang

    2018-03-10

    Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.

  8. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST

    OpenAIRE

    Goonesekere, Nalin CW

    2009-01-01

    Nalin CW GoonesekereDepartment of Chemistry and Biochemistry, University of Northern iowa, Cedar Falls, IA, USAAbstract: The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution ...

  9. Double Strand Break Repair, one mechanism can hide another: Alternative non-homologous end joining

    International Nuclear Information System (INIS)

    Rass, E.; Grabarz, A.; Bertrand, P.; Lopez, B.S.

    2012-01-01

    DNA double strand breaks are major cytotoxic lesions encountered by the cells. They can be induced by ionizing radiation or endogenous stress and can lead to genetic instability. Two mechanisms compete for the repair of DNA double strand breaks: homologous recombination and non-homologous end joining (NHEJ). Homologous recombination requires DNA sequences homology and is initiated by single strand resection. Recently, advances have been made concerning the major steps and proteins involved in resection. NHEJ, in contrast, does not require sequence homology. The existence of a DNA double strand break repair mechanism, independent of KU and ligase IV, the key proteins of the canonical non homologous end joining pathway, has been revealed lately and named alternative non homologous end joining. The hallmarks of this highly mutagenic pathway are deletions at repair junctions and frequent use of distal micro-homologies. This mechanism is also initiated by a single strand resection of the break. The aim of this review is firstly to present recent data on single strand resection, and secondly the alternative NHEJ pathway, including a discussion on the fidelity of NHEJ. Based on current knowledge, canonical NHEJ does not appear as an intrinsically mutagenic mechanism, but in contrast, as a conservative one. The structure of broken DNA ends actually dictates the quality repair of the alternative NHEJ and seems the actual responsible for the mutagenesis attributed beforehand to the canonical NHEJ. The existence of this novel DNA double strand breaks repair mechanism needs to be taken into account in the development of radiosensitizing strategies in order to optimise the efficiency of radiotherapy. (authors)

  10. Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement

    International Nuclear Information System (INIS)

    Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.

    1987-01-01

    cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells

  11. A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

    Science.gov (United States)

    Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

    2015-09-01

    Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  13. Statistical alignment: computational properties, homology testing and goodness-of-fit

    DEFF Research Database (Denmark)

    Hein, J; Wiuf, Carsten; Møller, Martin

    2000-01-01

    The model of insertions and deletions in biological sequences, first formulated by Thorne, Kishino, and Felsenstein in 1991 (the TKF91 model), provides a basis for performing alignment within a statistical framework. Here we investigate this model.Firstly, we show how to accelerate the statistical...... alignment algorithms several orders of magnitude. The main innovations are to confine likelihood calculations to a band close to the similarity based alignment, to get good initial guesses of the evolutionary parameters and to apply an efficient numerical optimisation algorithm for finding the maximum...... analysis.Secondly, we propose a new homology test based on this model, where homology means that an ancestor to a sequence pair can be found finitely far back in time. This test has statistical advantages relative to the traditional shuffle test for proteins.Finally, we describe a goodness-of-fit test...

  14. Identification of the porcine homologous of human disease causing trinucleotide repeat sequences

    DEFF Research Database (Denmark)

    Madsen, Lone Bruhn; Thomsen, Bo; Sølvsten, Christina Ane Elisabeth

    2007-01-01

    in this paper the identification of porcine noncoding and polyglutamine-encoding TNR regions and the comparison to the homologous TNRs from human, chimpanzee, dog, opossum, rat, and mouse. Several of the porcine TNR regions are highly polymorphic both within and between different breeds. The TNR regions...

  15. Identification of a novel MLPK homologous gene MLPKn1 and its expression analysis in Brassica oleracea.

    Science.gov (United States)

    Gao, Qiguo; Shi, Songmei; Liu, Yudong; Pu, Quanming; Liu, Xiaohuan; Zhang, Ying; Zhu, Liquan

    2016-09-01

    M locus protein kinase, one of the SRK-interacting proteins, is a necessary positive regulator for the self-incompatibility response in Brassica. In B. rapa, MLPK is expressed as two different transcripts, MLPKf1 and MLPKf2, and either isoform can complement the mlpk/mlpk mutation. The AtAPK1B gene has been considered to be the ortholog of BrMLPK, and AtAPK1B has no role in self-incompatibility (SI) response in A. thaliana SRK-SCR plants. Until now, what causes the MLPK and APK1B function difference during SI response in Brassica and A. thaliana SRKb-SCRb plants has remained unknown. Here, in addition to the reported MLPKf1/2, we identified the new MLPKf1 homologous gene MLPKn1 from B. oleracea. BoMLPKn1 and BoMLPKf1 shared nucleotide sequence identity as high as 84.3 %, and the most striking difference consisted in two fragment insertions in BoMLPKn1. BoMLPKn1 and BoMLPKf1 had a similar gene structure; both their deduced amino acid sequences contained a typical plant myristoylation consensus sequence and a Ser/Thr protein kinase domain. BoMLPKn1 was widely expressed in petal, sepal, anther, stigma and leaf. Genome-wide survey revealed that the B. oleracea genome contained three MLPK homologous genes: BoMLPKf1/2, BoMLPKn1 and Bol008343n. The B. rapa genome also contained three MLPK homologous genes, BrMLPKf1/2, BraMLPKn1 and Bra040929. Phylogenetic analysis revealed that BoMLPKf1/2 and BrMLPKf1/2 were phylogenetically more distant from AtAPK1A than Bol008343n, Bra040929, BraMLPKn1 and BoMLPKn1, Synteny analysis revealed that the B. oleracea chromosomal region containing BoMLPKn1 displayed high synteny with the A. thaliana chromosomal region containing APK1B, whereas the B. rapa chromosomal region containing BraMLPKn1 showed high synteny with the A. thaliana chromosomal region containing APK1B. Together, these results revealed that BoMLPKn1/BraMLPKn1, and not the formerly reported BoMLPKf1/2 (BrMLPKf1/2), was the orthologous genes of AtAPK1B, and no ortholog of Bo

  16. Productive homologous and non-homologous recombination of hepatitis C virus in cell culture

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Galli, Andrea; Li, Yi-Ping

    2013-01-01

    . In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a......) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13-36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6...

  17. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

    2016-03-02

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  18. Sequencing BPS spectra

    International Nuclear Information System (INIS)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

    2016-01-01

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  19. Homotopic Chain Maps Have Equal s-Homology and d-Homology

    Directory of Open Access Journals (Sweden)

    M. Z. Kazemi-Baneh

    2016-01-01

    Full Text Available The homotopy of chain maps on preabelian categories is investigated and the equality of standard homologies and d-homologies of homotopic chain maps is established. As a special case, if X and Y are the same homotopy type, then their nth d-homology R-modules are isomorphic, and if X is a contractible space, then its nth d-homology R-modules for n≠0 are trivial.

  20. Complementary DNA and derived amino acid sequence of the β subunit of human complement protein C8: identification of a close structural and ancestral relationship to the α subunit and C9

    International Nuclear Information System (INIS)

    Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.

    1987-01-01

    A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 47 5 , respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association

  1. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    Energy Technology Data Exchange (ETDEWEB)

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  2. BLAST and FASTA similarity searching for multiple sequence alignment.

    Science.gov (United States)

    Pearson, William R

    2014-01-01

    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

  3. The ubiquitin-homology protein, DAP-1, associates with tumor necrosis factor receptor (p60) death domain and induces apoptosis.

    Science.gov (United States)

    Liou, M L; Liou, H C

    1999-04-09

    The tumor necrosis factor receptor, p60 (TNF-R1), transduces death signals via the association of its cytoplasmic domain with several intracellular proteins. By screening a mammalian cDNA library using the yeast two-hybrid cloning technique, we isolated a ubiquitin-homology protein, DAP-1, which specifically interacts with the cytoplasmic death domain of TNF-R1. Sequence analysis reveals that DAP-1 shares striking sequence homology with the yeast SMT3 protein that is essential for the maintenance of chromosome integrity during mitosis (Meluh, P. B., and Koshland, D. (1995) Mol. Biol. Cell 6, 793-807). DAP-1 is nearly identical to PIC1, a protein that interacts with the PML tumor suppressor implicated in acute promyelocytic leukemia (Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E., and Freemont, P. S. (1996) Oncogene 13, 971-982), and the sentrin protein, which associates with the Fas death receptor (Okura, T., Gong, L., Kamitani, T., Wada, T., Okura, I., Wei, C. F., Chang, H. M., and Yeh, E. T. (1996) J. Immunol. 157, 4277-4281). The in vivo interaction between DAP-1 and TNF-R1 was further confirmed in mammalian cells. In transient transfection assays, overexpression of DAP-1 suppresses NF-kappaB/Rel activity in 293T cells, a human kidney embryonic carcinoma cell line. Overexpression of either DAP-1 or sentrin causes apoptosis of TNF-sensitive L929 fibroblast cell line, as well as TNF-resistant osteosarcoma cell line, U2OS. Furthermore, the dominant negative Fas-associated death domain protein (FADD) protein blocks the cell death induced by either DAP-1 or FADD. Collectively, these observations highly suggest a role for DAP-1 in mediating TNF-induced cell death signaling pathways, presumably through the recruitment of FADD death effector.

  4. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  5. A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology.

    Science.gov (United States)

    Durrant, Jacob D; Amaro, Rommie E; Xie, Lei; Urbaniak, Michael D; Ferguson, Michael A J; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E; McCammon, J Andrew

    2010-01-22

    Conventional drug design embraces the "one gene, one drug, one disease" philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology.

  6. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri

    2014-10-01

    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  7. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities

    DEFF Research Database (Denmark)

    Guardabassi, L.; Agersø, Yvonne

    2006-01-01

    -Ala : D-Ala ligase genes unrelated to vanA. In order to enhance detection of vanA-homologous genes, a third PCR step was added using primers targeting vanA in soil Paenibacillus. Sequencing of 25 clones obtained by this method allowed recovery of 23 novel sequences having 86-100% identity with van...

  8. The genome BLASTatlas - a GeneWiz extension for visualization of whole-genome homology

    DEFF Research Database (Denmark)

    Hallin, Peter Fischer; Binnewies, Tim Terence; Ussery, David

    2008-01-01

    ://www.cbs.dtu.dk/ws/BLASTatlas), where programming examples are available in Perl. By providing an interoperable method to carry out whole genome visualization of homology, this service offers bioinformaticians as well as biologists an easy-to-adopt workflow that can be directly called from the programming language of the user, hence......The development of fast and inexpensive methods for sequencing bacterial genomes has led to a wealth of data, often with many genomes being sequenced of the same species or closely related organisms. Thus, there is a need for visualization methods that will allow easy comparison of many sequenced...... genomes to a defined reference strain. The BLASTatlas is one such tool that is useful for mapping and visualizing whole genome homology of genes and proteins within a reference strain compared to other strains or species of one or more prokaryotic organisms. We provide examples of BLASTatlases, including...

  9. Gait Retraining From Rearfoot Strike to Forefoot Strike does not change Running Economy.

    Science.gov (United States)

    Roper, Jenevieve Lynn; Doerfler, Deborah; Kravitz, Len; Dufek, Janet S; Mermier, Christine

    2017-12-01

    Gait retraining is a method for management of patellofemoral pain, which is a common ailment among recreational runners. The present study investigated the effects of gait retraining from rearfoot strike to forefoot strike on running economy, heart rate, and respiratory exchange ratio immediately post-retraining and one-month post-retraining in recreational runners with patellofemoral pain. Knee pain was also measured. Sixteen participants (n=16) were randomly placed in the control (n=8) or experimental (n=8) group. A 10-minute treadmill RE test was performed by all subjects. The experimental group performed eight gait retraining running sessions where foot strike pattern was switched from rearfoot strike to forefoot strike, while the control group received no intervention. There were no significant differences for running economy (p=0.26), respiratory exchange ratio (p=0.258), or heart rate (p=0.248) between the groups. Knee pain reported on a visual analog scale was also significantly reduced (pstrike to forefoot strike did not affect running economy up to one-month post-retraining while reducing running-related patellofemoral pain. © Georg Thieme Verlag KG Stuttgart · New York.

  10. SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

    Directory of Open Access Journals (Sweden)

    Zhou Yuan Wu

    2013-07-01

    Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.

  11. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

    Science.gov (United States)

    Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

    2010-04-30

    Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

  12. Homological stabilizer codes

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Jonas T., E-mail: jonastyleranderson@gmail.com

    2013-03-15

    In this paper we define homological stabilizer codes on qubits which encompass codes such as Kitaev's toric code and the topological color codes. These codes are defined solely by the graphs they reside on. This feature allows us to use properties of topological graph theory to determine the graphs which are suitable as homological stabilizer codes. We then show that all toric codes are equivalent to homological stabilizer codes on 4-valent graphs. We show that the topological color codes and toric codes correspond to two distinct classes of graphs. We define the notion of label set equivalencies and show that under a small set of constraints the only homological stabilizer codes without local logical operators are equivalent to Kitaev's toric code or to the topological color codes. - Highlights: Black-Right-Pointing-Pointer We show that Kitaev's toric codes are equivalent to homological stabilizer codes on 4-valent graphs. Black-Right-Pointing-Pointer We show that toric codes and color codes correspond to homological stabilizer codes on distinct graphs. Black-Right-Pointing-Pointer We find and classify all 2D homological stabilizer codes. Black-Right-Pointing-Pointer We find optimal codes among the homological stabilizer codes.

  13. Gene Discovery through Genomic Sequencing of Brucella abortus

    Science.gov (United States)

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  14. Of Horse-Caterpillars and Homologies: Evolution of the Hippocampus and Its Name.

    Science.gov (United States)

    Butler, Ann B

    2017-01-01

    The hippocampus was first named in mammals based on the appearance of its gross morphological features, one end of it being fancied to resemble the head of a horse and the rest of it a silkworm, or caterpillar. A hippocampus, occupying the most medial part of the telencephalic pallium, has subsequently been identified in diverse nonmammalian taxa, but in which the "horse-caterpillar" morphology is lacking. While some strikingly similar functional similarities have been identified, questions of its homology ("sameness") across these taxa and about the very fundamental relationship of structure to function in central nervous system structures remain open. The hippocampal formation of amniotes participates in allocentric (external landmark) spatial navigation, memory, and attention to novel stimuli, and these functions generally are shared across amniotes despite variation in its morphological features. Substantially greater deviation in its morphology occurs in anamniotes, including amphibians and ray-finned fishes (actinopterygians), but its functions of allocentric spatial navigation and/or memory have been found to be preserved by studies in these taxa. Its shared functional roles cannot be used as evidence of structural homology, but given that other criteria indicate homology of the medial pallial derivative across these clades, the similar functions themselves may be regarded as homologous functions if they are based on the same cellular mechanisms and connections. The question arises as to whether the similar functions are performed by as yet undiscovered, shared morphological features or by different features that accomplish the same results via different mechanisms of neural function. © 2017 S. Karger AG, Basel.

  15. Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2015-05-01

    Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

  16. Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

    Directory of Open Access Journals (Sweden)

    Ujjwal Maulik

    Full Text Available Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon request.sarkar@labri.fr.

  17. In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

    Directory of Open Access Journals (Sweden)

    ERTUĞRUL FILIZ

    2014-04-01

    Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

  18. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  19. The 2016 Mihoub (north-central Algeria) earthquake sequence: Seismological and tectonic aspects

    Science.gov (United States)

    Khelif, M. F.; Yelles-Chaouche, A.; Benaissa, Z.; Semmane, F.; Beldjoudi, H.; Haned, A.; Issaadi, A.; Chami, A.; Chimouni, R.; Harbi, A.; Maouche, S.; Dabbouz, G.; Aidi, C.; Kherroubi, A.

    2018-06-01

    On 28 May 2016 at 23:54 (UTC), an Mw5.4 earthquake occurred in Mihoub village, Algeria, 60 km southeast of Algiers. This earthquake was the largest event in a sequence recorded from 10 April to 15 July 2016. In addition to the permanent national network, a temporary network was installed in the epicentral region after this shock. Recorded event locations allow us to give a general overview of the sequence and reveal the existence of two main fault segments. The first segment, on which the first event in the sequence was located, is near-vertical and trends E-W. The second fault plane, on which the largest event of the sequence was located, dips to the southeast and strikes NE-SW. A total of 46 well-constrained focal mechanisms were calculated. The events located on the E-W-striking fault segment show mainly right-lateral strike-slip (strike N70°E, dip 77° to the SSE, rake 150°). The events located on the NE-SW-striking segment show mainly reverse faulting (strike N60°E, dip 70° to the SE, rake 130°). We calculated the static stress change caused by the first event (Md4.9) of the sequence; the result shows that the fault plane of the largest event in the sequence (Mw5.4) and most of the aftershocks occurred within an area of increased Coulomb stress. Moreover, using the focal mechanisms calculated in this work, we estimated the orientations of the main axes of the local stress tensor ellipsoid. The results confirm previous findings that the general stress field in this area shows orientations aligned NNW-SSE to NW-SE. The 2016 Mihoub earthquake sequence study thus improves our understanding of seismic hazard in north-central Algeria.

  20. Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

    African Journals Online (AJOL)

    Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

  1. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  2. FBH1 helicase disrupts RAD51 filaments in vitro and modulates homologous recombination in mammalian cells

    DEFF Research Database (Denmark)

    Simandlova, Jitka; Zagelbaum, Jennifer; Payne, Miranda J

    2013-01-01

    Efficient repair of DNA double strand breaks and interstrand cross-links requires the homologous recombination (HR) pathway, a potentially error-free process that utilizes a homologous sequence as a repair template. A key player in HR is RAD51, the eukaryotic ortholog of bacterial RecA protein. RAD......51 can polymerize on DNA to form a nucleoprotein filament that facilitates both the search for the homologous DNA sequences and the subsequent DNA strand invasion required to initiate HR. Because of its pivotal role in HR, RAD51 is subject to numerous positive and negative regulatory influences...... filaments on DNA through its ssDNA translocase function. Consistent with this, a mutant mouse embryonic stem cell line with a deletion in the FBH1 helicase domain fails to limit RAD51 chromatin association and shows hyper-recombination. Our data are consistent with FBH1 restraining RAD51 DNA binding under...

  3. Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

    Directory of Open Access Journals (Sweden)

    Morrical Scott W

    2010-12-01

    Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

  4. An RNA secondary structure bias for non-homologous reverse transcriptase-mediated deletions in vivo

    DEFF Research Database (Denmark)

    Duch, Mogens; Carrasco, Maria L; Jespersen, Thomas

    2004-01-01

    Murine leukemia viruses harboring an internal ribosome entry site (IRES)-directed translational cassette are able to replicate, but undergo loss of heterologous sequences upon continued passage. While complete loss of heterologous sequences is favored when these are flanked by a direct repeat......, deletion mutants with junction sites within the heterologous cassette may also be retrieved, in particular from vectors without flanking repeats. Such deletion mutants were here used to investigate determinants of reverse transcriptase-mediated non-homologous recombination. Based upon previous structural...... result from template switching during first-strand cDNA synthesis and that the choice of acceptor sites for non-homologous recombination are guided by non-paired regions. Our results may have implications for recombination events taking place within structured regions of retroviral RNA genomes...

  5. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    Science.gov (United States)

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5

  6. Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause.

    Science.gov (United States)

    Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M

    2014-12-01

    A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  7. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

    Science.gov (United States)

    Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

    2016-11-01

    Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

  8. Murine mammary tumor virus pol-related sequences in human DNA: characterization and sequence comparison with the complete murine mammary tumor virus pol gene

    International Nuclear Information System (INIS)

    Deen, K.C.; Sweet, R.W.

    1986-01-01

    Sequences in the human genome with homology to the murine mammary tumor virus (MMTV) pol gene were isolated from a human phage library. Ten clones with extensive pol homology were shown to define five separate loci. These loci share common sequences immediately adjacent to the pol-like segments and, in addition, contain a related repeat element which bounds this region. This organization is suggestive of a proviral structure. The authors estimate that the human genome contains 30 to 40 copies of these pol-related sequences. The pol region of one of the cloned segments (HM16) and the complete MMTV pol gene were sequenced and compared. The nucleotide homology between these pol sequences is 52% and is concentrated in the terminal regions. The MMTV pol gene contains a single long open reading frame encoding 899 amino acids and is demarcated from the partially overlapping putative gag gene by termination codons and a shift in translational reading frame. The pol sequence of HM16 is multiply terminated but does contain open reading frames which encode 370, 105, and 112 amino acids residues in separate reading frames. The authors deduced a composite pol protein sequence for HM16 by aligning it to the MMTV pol gene and then compared these sequences with other retroviral pol protein sequences. Conserved sequences occur in both the amino and carboxyl regions which lie within the polymerase and endonuclease domains of pol, respectively

  9. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  10. Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

    International Nuclear Information System (INIS)

    Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.

    1987-01-01

    The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

  11. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

    2010-08-27

    Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  12. Allergenic characterization of a novel allergen, homologous to chymotrypsin, from german cockroach.

    Science.gov (United States)

    Jeong, Kyoung Yong; Son, Mina; Lee, Jae Hyun; Hong, Chein Soo; Park, Jung Won

    2015-05-01

    Cockroach feces are known to be rich in IgE-reactive components. Various protease allergens were identified by proteomic analysis of German cockroach fecal extract in a previous study. In this study, we characterized a novel allergen, a chymotrypsin-like serine protease. A cDNA sequence homologous to chymotrypsin was obtained by analysis of German cockroach expressed sequence tag (EST) clones. The recombinant chymotrypsins from the German cockroach and house dust mite (Der f 6) were expressed in Escherichia coli using the pEXP5NT/TOPO vector system, and their allergenicity was investigated by ELISA. The deduced amino acid sequence of German cockroach chymotrypsin showed 32.7 to 43.1% identity with mite group 3 (trypsin) and group 6 (chymotrypsin) allergens. Sera from 8 of 28 German cockroach allergy subjects (28.6%) showed IgE binding to the recombinant protein. IgE binding to the recombinant cockroach chymotrypsin was inhibited by house dust mite chymotrypsin Der f 6, while it minimally inhibited the German cockroach whole body extract. A novel allergen homologous to chymotrypsin was identified from the German cockroach and was cross-reactive with Der f 6.

  13. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Margaret L Hoang

    2010-12-01

    Full Text Available Genome rearrangements often result from non-allelic homologous recombination (NAHR between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  14. Women, transition and strikes in Serbia

    OpenAIRE

    Novaković, Nada G.

    2014-01-01

    The author, in a sociological way, describes and analyzes the concepts of transition, privatization and strikes in Serbia, particularly the place of women in it. It examines the most important economic and social causes and consequences of these phenomena. The main hypothesis is: women's strikes in the Serbian transition are less efficient than strikes and public protests of women in the developed world and the second Yugoslavia. A strike is a class conflict, in which the workers are fighting...

  15. Pure homology of algebraic varieties

    OpenAIRE

    Weber, Andrzej

    2003-01-01

    We show that for a complete complex algebraic variety the pure component of homology coincides with the image of intersection homology. Therefore pure homology is topologically invariant. To obtain slightly more general results we introduce "image homology" for noncomplete varieties.

  16. Stress distribution of metatarsals during forefoot strike versus rearfoot strike: A finite element study.

    Science.gov (United States)

    Li, Shudong; Zhang, Yan; Gu, Yaodong; Ren, James

    2017-12-01

    Due to the limitations of experimental approaches, comparison of the internal deformation and stresses of the human man foot between forefoot and rearfoot landing is not fully established. The objective of this work is to develop an effective FE modelling approach to comparatively study the stresses and energy in the foot during forefoot strike (FS) and rearfoot strike (RS). The stress level and rate of stress increase in the Metatarsals are established and the injury risk between these two landing styles is evaluated and discussed. A detailed subject specific FE foot model is developed and validated. A hexahedral dominated meshing scheme was applied on the surface of the foot bones and skin. An explicit solver (Abaqus/Explicit) was used to stimulate the transient landing process. The deformation and internal energy of the foot and stresses in the metatarsals are comparatively investigated. The results for forefoot strike tests showed an overall higher average stress level in the metatarsals during the entire landing cycle than that for rearfoot strike. The increase rate of the metatarsal stress from the 0.5 body weight (BW) to 2 BW load point is 30.76% for forefoot strike and 21.39% for rearfoot strike. The maximum rate of stress increase among the five metatarsals is observed on the 1st metatarsal in both landing modes. The results indicate that high stress level during forefoot landing phase may increase potential of metatarsal injuries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Germline progenitors escape the widespread phenomenon of homolog pairing during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available Homolog pairing, which plays a critical role in meiosis, poses a potential risk if it occurs in inappropriate tissues or between nonallelic sites, as it can lead to changes in gene expression, chromosome entanglements, and loss-of-heterozygosity due to mitotic recombination. This is particularly true in Drosophila, which supports organismal-wide pairing throughout development. Discovered over a century ago, such extensive pairing has led to the perception that germline pairing in the adult gonad is an extension of the pairing established during embryogenesis and, therefore, differs from the mechanism utilized in most species to initiate pairing specifically in the germline. Here, we show that, contrary to long-standing assumptions, Drosophila meiotic pairing in the gonad is not an extension of pairing established during embryogenesis. Instead, we find that homologous chromosomes are unpaired in primordial germ cells from the moment the germline can be distinguished from the soma in the embryo and remain unpaired even in the germline stem cells of the adult gonad. We further establish that pairing originates immediately after the stem cell stage. This pairing occurs well before the initiation of meiosis and, strikingly, continues through the several mitotic divisions preceding meiosis. These discoveries indicate that the spatial organization of the Drosophila genome differs between the germline and the soma from the earliest moments of development and thus argue that homolog pairing in the germline is an active process as versus a passive continuation of pairing established during embryogenesis.

  18. Foot-strike pattern and performance in a marathon.

    Science.gov (United States)

    Kasmer, Mark E; Liu, Xue-Cheng; Roberts, Kyle G; Valadao, Jason M

    2013-05-01

    To determine prevalence of heel strike in a midsize city marathon, if there is an association between foot-strike classification and race performance, and if there is an association between foot-strike classification and gender. Foot-strike classification (forefoot, midfoot, heel, or split strike), gender, and rank (position in race) were recorded at the 8.1-km mark for 2112 runners at the 2011 Milwaukee Lakefront Marathon. 1991 runners were classified by foot-strike pattern, revealing a heel-strike prevalence of 93.67% (n = 1865). A significant difference between foot-strike classification and performance was found using a Kruskal-Wallis test (P strike. No significant difference between foot-strike classification and gender was found using a Fisher exact test. In addition, subgroup analysis of the 126 non-heel strikers found no significant difference between shoe wear and performance using a Kruskal-Wallis test. The high prevalence of heel striking observed in this study reflects the foot-strike pattern of most mid-distance to long-distance runners and, more important, may predict their injury profile based on the biomechanics of a heel-strike running pattern. This knowledge can help clinicians appropriately diagnose, manage, and train modifications of injured runners.

  19. Lectures on functor homology

    CERN Document Server

    Touzé, Antoine

    2015-01-01

    This book features a series of lectures that explores three different fields in which functor homology (short for homological algebra in functor categories) has recently played a significant role. For each of these applications, the functor viewpoint provides both essential insights and new methods for tackling difficult mathematical problems. In the lectures by Aurélien Djament, polynomial functors appear as coefficients in the homology of infinite families of classical groups, e.g. general linear groups or symplectic groups, and their stabilization. Djament’s theorem states that this stable homology can be computed using only the homology with trivial coefficients and the manageable functor homology. The series includes an intriguing development of Scorichenko’s unpublished results. The lectures by Wilberd van der Kallen lead to the solution of the general cohomological finite generation problem, extending Hilbert’s fourteenth problem and its solution to the context of cohomology. The focus here is o...

  20. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    International Nuclear Information System (INIS)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.; Goldberg, E.

    1987-01-01

    The sequence and structure of human testis-specific L-lactate dehydrogenase [LDHC 4 , LDHX; (L)-lactate:NAD + oxidoreductase, EC 1.1.1.27] has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC 4 is as different from rodent LDHC 4 (73% homology) as it is from human LDHA 4 (76% homology) and porcine LDHB 4 (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC 4 and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC 4 reveals significant differences. Knowledge of the human LDHC 4 sequence will help design human-specific peptides useful in the development of a contraceptive vaccine

  1. Identification and Partial Characterization of Potential FtsL and FtsQ Homologs of Chlamydia

    Directory of Open Access Journals (Sweden)

    Scot P Ouellette

    2015-11-01

    Full Text Available Chlamydia is amongst the rare bacteria that lack the critical cell division protein FtsZ. By annotation, Chlamydia also lacks several other essential cell division proteins including the FtsLBQ complex that links the early (e.g. FtsZ and late (e.g. FtsI/Pbp3 components of the division machinery. Here, we report chlamydial FtsL and FtsQ homologs. Ct271 aligned well with E. coli FtsL and shared sequence homology with it, including a predicted leucine-zipper like motif. Based on in silico modeling, we show that Ct764 has structural homology to FtsQ in spite of little sequence similarity. Importantly, ct271/ftsL and ct764/ftsQ are present within all sequenced chlamydial genomes and are expressed during the replicative phase of the chlamydial developmental cycle, two key characteristics for a chlamydial cell division gene. GFP-Ct764 localized to the division septum of dividing transformed chlamydiae, and, importantly, over-expression inhibited chlamydial development. Using a bacterial two-hybrid approach, we show that Ct764 interacted with other components of the chlamydial division apparatus. However, Ct764 was not capable of complementing an E. coli FtsQ depletion strain in spite of its ability to interact with many of the same division proteins as E. coli FtsQ, suggesting that chlamydial FtsQ may function differently. We previously proposed that Chlamydia uses MreB and other rod-shape determining proteins as an alternative system for organizing the division site and its apparatus. Chlamydial FtsL and FtsQ homologs expand the number of identified chlamydial cell division proteins and suggest that Chlamydia has likely kept the late components of the division machinery while substituting the Mre system for the early components.

  2. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  3. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  4. 14 CFR 35.38 - Lightning strike.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Lightning strike. 35.38 Section 35.38... STANDARDS: PROPELLERS Tests and Inspections § 35.38 Lightning strike. The applicant must demonstrate, by... lightning strike without causing a major or hazardous propeller effect. The limit to which the propeller has...

  5. Strikes in Serbia since 2000 to 2005

    OpenAIRE

    Novaković Nada

    2005-01-01

    In this article author deals with main characteristics of strikes in Serbia within the period 2000–2005. Analysis starts with thesis that strike is open class conflict within class divided society. Therefore strike is radical form of trade union struggle for workers rights. Main questions in the analysis were: on social structure as a background of strikes, on organizations and trade unions included in it, on effects of strikes in Serbia in the given period. Main thesis of the article is that...

  6. Homology modelling and docking analysis of L-lactate dehydrogenase from Streptococcus thermopilus

    Directory of Open Access Journals (Sweden)

    Vukić Vladimir R.

    2016-01-01

    Full Text Available The aim of this research was to create a three-dimensional model of L-lactate dehydrogenase from the main yoghurt starter culture - Streptococcus thermopilus, to analyse its structural features and investigate substrate binding in the active site. NCBI BlastP was used against the Protein Data Bank database in order to identify the template for construction of homology models. Multiple sequence alignment was performed using the program MUSCULE within the UGENE 1.11.3 program. Homology models were constructed using the program Modeller v. 9.17. The obtained 3D model was verified by Ramachandran plots. Molecular docking simulations were performed using the program Surflex-Dock. The highest sequence similarity was observed with L-lactate dehydrogenase from Lactobacillus casei subsp. casei, with 69% identity. Therefore, its structure (PDB ID: 2ZQY:A was selected as a modelling template for homology modelling. Active residues are by sequence similarity predicted: S. thermophilus - HIS181 and S. aureus - HIS179. Binding energy of pyruvate to L-lactate dehydrogenase of S. thermopilus was - 7.874 kcal/mol. Pyruvate in L-lactate dehydrogenase of S. thermopilus makes H bonds with catalytic HIS181 (1.9 Å, as well as with THR235 (3.6 Å. Although our results indicate similar position of substrates between L-lactate dehydrogenase of S. thermopilus and S. aureus, differences in substrate distances and binding energy values could influence the reaction rate. Based on these results, the L-lactate dehydrogenase model proposed here could be used as a guide for further research, such as transition states of the reaction through molecular dynamics. [Projekat Ministarstva nauke Republike Srbije, br. III 46009

  7. Options with Extreme Strikes

    Directory of Open Access Journals (Sweden)

    Lingjiong Zhu

    2015-07-01

    Full Text Available In this short paper, we study the asymptotics for the price of call options for very large strikes and put options for very small strikes. The stock price is assumed to follow the Black–Scholes models. We analyze European, Asian, American, Parisian and perpetual options and conclude that the tail asymptotics for these option types fall into four scenarios.

  8. MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

    KAUST Repository

    Kosinski, Jan; Barbato, Alessandro; Tramontano, Anna

    2013-01-01

    SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

  9. MODexplorer: an integrated tool for exploring protein sequence, structure and function relationships.

    KAUST Repository

    Kosinski, Jan

    2013-02-08

    SUMMARY: MODexplorer is an integrated tool aimed at exploring the sequence, structural and functional diversity in protein families useful in homology modeling and in analyzing protein families in general. It takes as input either the sequence or the structure of a protein and provides alignments with its homologs along with a variety of structural and functional annotations through an interactive interface. The annotations include sequence conservation, similarity scores, ligand-, DNA- and RNA-binding sites, secondary structure, disorder, crystallographic structure resolution and quality scores of models implied by the alignments to the homologs of known structure. MODexplorer can be used to analyze sequence and structural conservation among the structures of similar proteins, to find structures of homologs solved in different conformational state or with different ligands and to transfer functional annotations. Furthermore, if the structure of the query is not known, MODexplorer can be used to select the modeling templates taking all this information into account and to build a comparative model. AVAILABILITY AND IMPLEMENTATION: Freely available on the web at http://modorama.biocomputing.it/modexplorer. Website implemented in HTML and JavaScript with all major browsers supported. SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online.

  10. Predicting the catalytic sites of isopenicillin N synthase (IPNS ...

    African Journals Online (AJOL)

    Isopenicillin N synthase (IPNS) related Non-haem iron-dependent oxygenases and oxidases (NHIDOX) demonstrated a striking structural conservativeness, even with low protein sequence homology. It is evident that these enzymes have an architecturally similar catalytic centre with active ligands lining the reactive pocket.

  11. Women, transition and strikes in Serbia

    Directory of Open Access Journals (Sweden)

    Novaković Nada G.

    2014-01-01

    Full Text Available The author, in a sociological way, describes and analyzes the concepts of transition, privatization and strikes in Serbia, particularly the place of women in it. It examines the most important economic and social causes and consequences of these phenomena. The main hypothesis is: women's strikes in the Serbian transition are less efficient than strikes and public protests of women in the developed world and the second Yugoslavia. A strike is a class conflict, in which the workers are fighting for their social and economic rights, threatened by the capitalist class. Elites in government and state authorities protect the interests of big capital at the detriment of the interests of the majority of workers. Exploring women's strikes in transition reveals the nature of the social and political system. Their strikes in enterprises, the blocking of public spaces and public protests are systemic, ie. class determined. As the transition was very fast, the resistance of the strikers was inefficient, and the protests of women became an expression of desperation against the loss of jobs and basic resources for lifehood. In short, this research is about the main causes, the organizational forms and the consequences of strikes in which the majority were women. For this purpose, the author chose to describe an array of strikes in the industries and the companies where women are most employed. The choice of strikes in the economic sector is not accidental, but a consequence of the fact that the women there were the most vulnerable. Women in public institutions and companies had much higher financial and social position. They are less likely to strike and publicly protested. After 2000, these strikes were more successful than worker's strikes in textile, food processing, manufacturing and trade. Relationship between the government and the public towards them was tainted by self-interest and selective. The main criterion for the selection of companies and

  12. Isolation, sequence identification and tissue expression profile of a ...

    African Journals Online (AJOL)

    The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

  13. [Physicians' strikes--ethical considerations].

    Science.gov (United States)

    Glick, Shimon; Schwarzfuchs, Dan

    2012-01-01

    Strikes in general represent a solution based on a form of coercion. Historically, the striker caused direct damage to his employer, who was responsible for the perceived unfair treatment of the employee. In the case of strikes in the public sector, the employer is generally not harmed, but innocent citizens suffer in order to pressure the government agencies, a questionable practice from an ethical viewpoint. Physicians' strikes have more serious ethical problems. They cause suffering and death to innocent citizens. They violate the ethical codes to which physicians have committed themselves as professionals, and they seriously impair the trust of the public in physicians. Better and more ethical ways to provide fair compensation for physicians must be employed, perhaps like those used for judges and members of the IDF.

  14. Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

    Science.gov (United States)

    Mello-Sampayo, T

    1973-01-01

    Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary

  15. The HMMER Web Server for Protein Sequence Similarity Search.

    Science.gov (United States)

    Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

    2017-12-08

    Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  16. A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models.

    Science.gov (United States)

    Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson

    2011-03-23

    Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

  17. Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

    Science.gov (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

    2018-01-01

    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

  18. Mod two homology and cohomology

    CERN Document Server

    Hausmann, Jean-Claude

    2014-01-01

    Cohomology and homology modulo 2 helps the reader grasp more readily the basics of a major tool in algebraic topology. Compared to a more general approach to (co)homology this refreshing approach has many pedagogical advantages: It leads more quickly to the essentials of the subject, An absence of signs and orientation considerations simplifies the theory, Computations and advanced applications can be presented at an earlier stage, Simple geometrical interpretations of (co)chains. Mod 2 (co)homology was developed in the first quarter of the twentieth century as an alternative to integral homology, before both became particular cases of (co)homology with arbitrary coefficients. The first chapters of this book may serve as a basis for a graduate-level introductory course to (co)homology. Simplicial and singular mod 2 (co)homology are introduced, with their products and Steenrod squares, as well as equivariant cohomology. Classical applications include Brouwer's fixed point theorem, Poincaré duality, Borsuk-Ula...

  19. Preemptive strikes: Fear, hope, and defensive aggression.

    Science.gov (United States)

    Halevy, Nir

    2017-02-01

    Preemptive strikes are costly and harmful. Existing models of defensive aggression focus narrowly on the role fear plays in motivating preemptive strikes. Theoretically integrating the literatures on conflict, decision making, and emotion, the current research investigated how specific emotions associated with certainty or uncertainty, including fear, anger, disgust, hope, and happiness, influence preemptive strikes. Study 1 demonstrated that hope negatively predicts defensive exits from relationships in choice dilemmas. Studies 2 and 3 experimentally manipulated risk of being attacked in an incentivized, interactive decision making task-the Preemptive Strike Game. Risk of being attacked fueled preemptive strikes; reduced feelings of hope partially mediated this effect in Study 3. Studies 4 and 5 investigated preemptive strikes under uncertainty (rather than risk). In Study 4, reasoning about the factors that make one trustful of others curbed preemptive strikes; cogitating about the factors that underlie discrete emotions, however, did not influence defensive aggression. Study 5 demonstrated that the valence and uncertainty appraisals of incidental emotions interact in shaping preemptive strikes. Specifically, recalling an autobiographical emotional experience that produced hope significantly decreased attack rates relative to fear, happiness, and a control condition. Fear, anger, disgust, and happiness were either unrelated to preemptive strikes or showed inconsistent relationships with preemptive strikes across the 5 studies. These findings shed light on how emotions shape defensive aggression, advance knowledge on strategic choice under risk and uncertainty, and demonstrate hope's positive effects on social interactions and relationships. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  20. HOMOLOGY BETWEEN SEGMENTS OF HUMAN HEMOSTATIC PROTEINS AND PROTEINS OF VIRUSES WHICH CAUSE ACUTE RESPIRATORY INFECTIONS OR DISEASES WITH SIMILAR SYMPTOMS

    Directory of Open Access Journals (Sweden)

    I. N. Zhilinskaya

    2017-01-01

    Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and www.nextprot.org databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

  1. Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

    Science.gov (United States)

    Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

    2000-05-01

    L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

  2. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  3. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates.

    Science.gov (United States)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher

    2013-11-01

    In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory practice in different PCR assays. We propose the inclusion of an analogous approach as a quality control system for multi-template PCR applications. The amplification controls must take into account the characteristics of multi-template PCR and be able to effectively monitor particular assay performance. This study demonstrated the efficiency of a model mixed template as an adequate external amplification control for a particular PCR application. The conditions of multi-template PCR do not allow implementation of a classic internal control; therefore we developed a convenient semi-internal control as an acceptable alternative. In order to evaluate the effects of inhibitors, a model multi-template mix was amplified in a mixture with DNAse-treated sample. Semi-internal control allowed establishment of intervals for robust PCR performance for different samples, thus enabling correct comparison of the samples. The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products. © 2013 Elsevier B.V. All rights reserved.

  4. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  5. Efficient Detection of Copy Number Mutations in PMS2 Exons with a Close Homolog.

    Science.gov (United States)

    Herman, Daniel S; Smith, Christina; Liu, Chang; Vaughn, Cecily P; Palaniappan, Selvi; Pritchard, Colin C; Shirts, Brian H

    2018-07-01

    Detection of 3' PMS2 copy-number mutations that cause Lynch syndrome is difficult because of highly homologous pseudogenes. To improve the accuracy and efficiency of clinical screening for these mutations, we developed a new method to analyze standard capture-based, next-generation sequencing data to identify deletions and duplications in PMS2 exons 9 to 15. The approach captures sequences using PMS2 targets, maps sequences randomly among regions with equal mapping quality, counts reads aligned to homologous exons and introns, and flags read count ratios outside of empirically derived reference ranges. The method was trained on 1352 samples, including 8 known positives, and tested on 719 samples, including 17 known positives. Clinical implementation of the first version of this method detected new mutations in the training (N = 7) and test (N = 2) sets that had not been identified by our initial clinical testing pipeline. The described final method showed complete sensitivity in both sample sets and false-positive rates of 5% (training) and 7% (test), dramatically decreasing the number of cases needing additional mutation evaluation. This approach leveraged the differences between gene and pseudogene to distinguish between PMS2 and PMS2CL copy-number mutations. These methods enable efficient and sensitive Lynch syndrome screening for 3' PMS2 copy-number mutations and may be applied similarly to other genomic regions with highly homologous pseudogenes. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  6. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  7. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  8. De novo transcriptome sequencing and sequence analysis of the malaria vector Anopheles sinensis (Diptera: Culicidae)

    Science.gov (United States)

    2014-01-01

    Background Anopheles sinensis is the major malaria vector in China and Southeast Asia. Vector control is one of the most effective measures to prevent malaria transmission. However, there is little transcriptome information available for the malaria vector. To better understand the biological basis of malaria transmission and to develop novel and effective means of vector control, there is a need to build a transcriptome dataset for functional genomics analysis by large-scale RNA sequencing (RNA-seq). Methods To provide a more comprehensive and complete transcriptome of An. sinensis, eggs, larvae, pupae, male adults and female adults RNA were pooled together for cDNA preparation, sequenced using the Illumina paired-end sequencing technology and assembled into unigenes. These unigenes were then analyzed in their genome mapping, functional annotation, homology, codon usage bias and simple sequence repeats (SSRs). Results Approximately 51.6 million clean reads were obtained, trimmed, and assembled into 38,504 unigenes with an average length of 571 bp, an N50 of 711 bp, and an average GC content 51.26%. Among them, 98.4% of unigenes could be mapped onto the reference genome, and 69% of unigenes could be annotated with known biological functions. Homology analysis identified certain numbers of An. sinensis unigenes that showed homology or being putative 1:1 orthologues with genomes of other Dipteran species. Codon usage bias was analyzed and 1,904 SSRs were detected, which will provide effective molecular markers for the population genetics of this species. Conclusions Our data and analysis provide the most comprehensive transcriptomic resource and characteristics currently available for An. sinensis, and will facilitate genetic, genomic studies, and further vector control of An. sinensis. PMID:25000941

  9. Protein Function Prediction Based on Sequence and Structure Information

    KAUST Repository

    Smaili, Fatima Z.

    2016-05-25

    The number of available protein sequences in public databases is increasing exponentially. However, a significant fraction of these sequences lack functional annotation which is essential to our understanding of how biological systems and processes operate. In this master thesis project, we worked on inferring protein functions based on the primary protein sequence. In the approach we follow, 3D models are first constructed using I-TASSER. Functions are then deduced by structurally matching these predicted models, using global and local similarities, through three independent enzyme commission (EC) and gene ontology (GO) function libraries. The method was tested on 250 “hard” proteins, which lack homologous templates in both structure and function libraries. The results show that this method outperforms the conventional prediction methods based on sequence similarity or threading. Additionally, our method could be improved even further by incorporating protein-protein interaction information. Overall, the method we use provides an efficient approach for automated functional annotation of non-homologous proteins, starting from their sequence.

  10. The colocalization transition of homologous chromosomes at meiosis

    Science.gov (United States)

    Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

    2008-06-01

    Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

  11. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    Directory of Open Access Journals (Sweden)

    Yushen Du

    2016-11-01

    Full Text Available Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp, we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available.

  12. Origin and spread of photosynthesis based upon conserved sequence features in key bacteriochlorophyll biosynthesis proteins.

    Science.gov (United States)

    Gupta, Radhey S

    2012-11-01

    The origin of photosynthesis and how this capability has spread to other bacterial phyla remain important unresolved questions. I describe here a number of conserved signature indels (CSIs) in key proteins involved in bacteriochlorophyll (Bchl) biosynthesis that provide important insights in these regards. The proteins BchL and BchX, which are essential for Bchl biosynthesis, are derived by gene duplication in a common ancestor of all phototrophs. More ancient gene duplication gave rise to the BchX-BchL proteins and the NifH protein of the nitrogenase complex. The sequence alignment of NifH-BchX-BchL proteins contain two CSIs that are uniquely shared by all NifH and BchX homologs, but not by any BchL homologs. These CSIs and phylogenetic analysis of NifH-BchX-BchL protein sequences strongly suggest that the BchX homologs are ancestral to BchL and that the Bchl-based anoxygenic photosynthesis originated prior to the chlorophyll (Chl)-based photosynthesis in cyanobacteria. Another CSI in the BchX-BchL sequence alignment that is uniquely shared by all BchX homologs and the BchL sequences from Heliobacteriaceae, but absent in all other BchL homologs, suggests that the BchL homologs from Heliobacteriaceae are primitive in comparison to all other photosynthetic lineages. Several other identified CSIs in the BchN homologs are commonly shared by all proteobacterial homologs and a clade consisting of the marine unicellular Cyanobacteria (Clade C). These CSIs in conjunction with the results of phylogenetic analyses and pair-wise sequence similarity on the BchL, BchN, and BchB proteins, where the homologs from Clade C Cyanobacteria and Proteobacteria exhibited close relationship, provide strong evidence that these two groups have incurred lateral gene transfers. Additionally, phylogenetic analyses and several CSIs in the BchL-N-B proteins that are uniquely shared by all Chlorobi and Chloroflexi homologs provide evidence that the genes for these proteins have also been

  13. High frequency of phylogenetically diverse reductive dehalogenase-homologous genes in deep subseafloor sedimentary metagenomes

    Directory of Open Access Journals (Sweden)

    Mikihiko eKawai

    2014-03-01

    Full Text Available Marine subsurface sediments on the Pacific margin harbor diverse microbial communities even at depths of several hundreds meters below the seafloor (mbsf or more. Previous PCR-based molecular analysis showed the presence of diverse reductive dehalogenase gene (rdhA homologs in marine subsurface sediment, suggesting that anaerobic respiration of organohalides is one of the possible energy-yielding pathways in the organic-rich sedimentary habitat. However, primer-independent molecular characterization of rdhA has remained to be demonstrated. Here, we studied the diversity and frequency of rdhA homologs by metagenomic analysis of five different depth horizons (0.8, 5.1, 18.6, 48.5 and 107.0 mbsf at Site C9001 off the Shimokita Peninsula of Japan. From all metagenomic pools, remarkably diverse rdhA-homologous sequences, some of which are affiliated with novel clusters, were observed with high frequency. As a comparison, we also examined frequency of dissimilatory sulfite reductase genes (dsrAB, key functional genes for microbial sulfate reduction. The dsrAB were also widely observed in the metagenomic pools whereas the frequency of dsrAB genes was generally smaller than that of rdhA-homologous genes. The phylogenetic composition of rdhA-homologous genes was similar among the five depth horizons. Our metagenomic data revealed that subseafloor rdhA homologs are more diverse than previously identified from PCR-based molecular studies. Spatial distribution of similar rdhA homologs across wide depositional ages indicates that the heterotrophic metabolic processes mediated by the genes can be ecologically important, functioning in the organic-rich subseafloor sedimentary biosphere.

  14. Gene mining a marama bean expressed sequence tags (ESTs ...

    African Journals Online (AJOL)

    The authors reported the identification of genes associated with embryonic development and microsatellite sequences. The future direction will entail characterization of these genes using gene over-expression and mutant assays. Key words: Namibia, simple sequence repeats (SSR), data mining, homology searches, ...

  15. Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.

    1983-01-01

    The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

  16. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  17. A bird strike handbook for base-level managers

    Science.gov (United States)

    Payson, R. P.; Vance, J. D.

    1984-09-01

    To help develop more awareness about bird strikes and bird strike reduction techniques, this thesis compiled all relevant information through an extensive literature search, review of base-level documents, and personal interviews. The final product--A Bird Strike Handbook for Base-Level Managers--provides information on bird strike statistics, methods to reduce the strike hazards, and means to obtain additional assistance. The handbook is organized for use by six major base agencies: Maintenance, Civil Engineering, Operations, Air Field Management, Safety, and Air Traffic Control. An appendix follows at the end.

  18. Analysis of the role of homology arms in gene-targeting vectors in human cells.

    Directory of Open Access Journals (Sweden)

    Ayako Ishii

    Full Text Available Random integration of targeting vectors into the genome is the primary obstacle in human somatic cell gene targeting. Non-homologous end-joining (NHEJ, a major pathway for repairing DNA double-strand breaks, is thought to be responsible for most random integration events; however, absence of DNA ligase IV (LIG4, the critical NHEJ ligase, does not significantly reduce random integration frequency of targeting vector in human cells, indicating robust integration events occurring via a LIG4-independent mechanism. To gain insights into the mechanism and robustness of LIG4-independent random integration, we employed various types of targeting vectors to examine their integration frequencies in LIG4-proficient and deficient human cell lines. We find that the integration frequency of targeting vector correlates well with the length of homology arms and with the amount of repetitive DNA sequences, especially SINEs, present in the arms. This correlation was prominent in LIG4-deficient cells, but was also seen in LIG4-proficient cells, thus providing evidence that LIG4-independent random integration occurs frequently even when NHEJ is functionally normal. Our results collectively suggest that random integration frequency of conventional targeting vectors is substantially influenced by homology arms, which typically harbor repetitive DNA sequences that serve to facilitate LIG4-independent random integration in human cells, regardless of the presence or absence of functional NHEJ.

  19. Sequence of human protamine 2 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Domenjoud, L; Fronia, C; Uhde, F; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors report the cloning and sequencing of a cDNA clone for human protamine 2 (hp2), isolated from a human testis cDNA library cloned in the vector {lambda}-gt11. A 66mer oligonucleotide, that corresponds to an amino acid sequence which is highly conserved between hp2 and mouse protamine 2 (mp2) served as hybridization probe. The homology between the amino acid sequence deduced from our cDNA and the published amino acid sequence for hp2 is 100%.

  20. Gene Discovery through Genomic Sequencing of Brucella abortus

    OpenAIRE

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposit...

  1. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

    Directory of Open Access Journals (Sweden)

    Marc Lenoir

    2015-10-01

    Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  2. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.

    Science.gov (United States)

    Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

    2015-10-23

    The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  3. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    Science.gov (United States)

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  4. Predicting timing of foot strike during running, independent of striking technique, using principal component analysis of joint angles.

    Science.gov (United States)

    Osis, Sean T; Hettinga, Blayne A; Leitch, Jessica; Ferber, Reed

    2014-08-22

    As 3-dimensional (3D) motion-capture for clinical gait analysis continues to evolve, new methods must be developed to improve the detection of gait cycle events based on kinematic data. Recently, the application of principal component analysis (PCA) to gait data has shown promise in detecting important biomechanical features. Therefore, the purpose of this study was to define a new foot strike detection method for a continuum of striking techniques, by applying PCA to joint angle waveforms. In accordance with Newtonian mechanics, it was hypothesized that transient features in the sagittal-plane accelerations of the lower extremity would be linked with the impulsive application of force to the foot at foot strike. Kinematic and kinetic data from treadmill running were selected for 154 subjects, from a database of gait biomechanics. Ankle, knee and hip sagittal plane angular acceleration kinematic curves were chained together to form a row input to a PCA matrix. A linear polynomial was calculated based on PCA scores, and a 10-fold cross-validation was performed to evaluate prediction accuracy against gold-standard foot strike as determined by a 10 N rise in the vertical ground reaction force. Results show 89-94% of all predicted foot strikes were within 4 frames (20 ms) of the gold standard with the largest error being 28 ms. It is concluded that this new foot strike detection is an improvement on existing methods and can be applied regardless of whether the runner exhibits a rearfoot, midfoot, or forefoot strike pattern. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Conservation of the glycoprotein B homologs of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) and Old World primate rhadinoviruses of chimpanzees and macaques

    Science.gov (United States)

    Bruce, A. Gregory; Horst, Jeremy A.; Rose, Timothy M.

    2016-01-01

    The envelope-associated glycoprotein B (gB) is highly conserved within the Herpesviridae and plays a critical role in viral entry. We analyzed the evolutionary conservation of sequence and structural motifs within the Kaposi’s sarcoma-associated herpesvirus (KSHV) gB and homologs of Old World primate rhadinoviruses belonging to the distinct RV1 and RV2 rhadinovirus lineages. In addition to gB homologs of rhadinoviruses infecting the pig-tailed and rhesus macaques, we cloned and sequenced gB homologs of RV1 and RV2 rhadinoviruses infecting chimpanzees. A structural model of the KSHV gB was determined, and functional motifs and sequence variants were mapped to the model structure. Conserved domains and motifs were identified, including an “RGD” motif that plays a critical role in KSHV binding and entry through the cellular integrin αVβ3. The RGD motif was only detected in RV1 rhadinoviruses suggesting an important difference in cell tropism between the two rhadinovirus lineages. PMID:27070755

  6. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey

    2010-01-01

    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  7. Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Gaomin Liu

    2018-05-01

    Full Text Available The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N-terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro, chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18 showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

  8. Acetylcholine Receptor: Complex of Homologous Subunits

    Science.gov (United States)

    Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.

    1980-06-01

    The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

  9. Differences in the phenotypic effects of mutations in homologous MrpA and MrpD subunits of the multi-subunit Mrp-type Na+/H+ antiporter.

    Science.gov (United States)

    Morino, Masato; Ogoda, Shinichiro; Krulwich, Terry Ann; Ito, Masahiro

    2017-01-01

    Mrp antiporters are the sole antiporters in the Cation/Proton Antiporter 3 family of transporter databases because of their unusual structural complexity, 6-7 hydrophobic proteins that function as a hetero-oligomeric complex. The two largest and homologous subunits, MrpA and MrpD, are essential for antiport activity and have direct roles in ion transport. They also show striking homology with proton-conducting, membrane-embedded Nuo subunits of respiratory chain complex I of bacteria, e.g., Escherichia coli. MrpA has the closest homology to the complex I NuoL subunit and MrpD has the closest homology to the complex I NuoM and N subunits. Here, introduction of mutations in MrpD, in residues that are also present in MrpA, led to defects in antiport function and/or complex formation. No significant phenotypes were detected in strains with mutations in corresponding residues of MrpA, but site-directed changes in the C-terminal region of MrpA had profound effects, showing that the MrpA C-terminal region has indispensable roles in antiport function. The results are consistent with a divergence in adaptations that support the roles of MrpA and MrpD in secondary antiport, as compared to later adaptations supporting homologs in primary proton pumping by the respiratory chain complex I.

  10. Foot strike patterns after obstacle clearance during running.

    Science.gov (United States)

    Scholten, Shane D; Stergiou, Nicholas; Hreljac, Alan; Houser, Jeremy; Blanke, Daniel; Alberts, L Russell

    2002-01-01

    Running over obstacles of sufficient height requires heel strike (HS) runners to make a transition in landing strategy to a forefoot (FF) strike, resulting in similar ground reaction force patterns to those observed while landing from a jump. Identification of the biomechanical variables that distinguish between the landing strategies may offer some insight into the reasons that the transition occurs. The purpose of this study was to investigate the difference in foot strike patterns and kinetic parameters of heel strike runners between level running and running over obstacles of various heights. Ten heel strike subjects ran at their self-selected pace under seven different conditions: unperturbed running (no obstacle) and over obstacles of six different heights (10%, 12.5%, 15%, 17.5%, 20%, and 22.5% of their standing height). The obstacle was placed directly before a Kistler force platform. Repeated measures ANOVAs were performed on the subject means of selected kinetic parameters. The statistical analysis revealed significant differences (P strike patterns were affected by the increased obstacle height. Between the 12.5% and 15% obstacle conditions, the group response changed from a heel strike to a forefoot strike pattern. At height > 15%, the pattern was more closely related to the foot strike patterns found in jumping activities. This strategy change may represent a gait transition effected as a mechanism to protect against increased impact forces. Greater involvement of the ankle and the calf muscles could have assisted in attenuating the increased impact forces while maintaining speed after clearing the obstacle.

  11. Strikes and solidarity: coalfield conflict in Britain, 1889-1966

    Energy Technology Data Exchange (ETDEWEB)

    Roy Church; Quentin Outram [University of East Anglia, Norwich (United Kingdom)

    2002-05-01

    This book investigates the history of strike activity in the British coal mining industry, a byword for industrial militancy since the late nineteenth century. Contents: 1. Interpreting coalfield conflict: focus and formulations; 2. Tradition and modernity: the mining industry 1889-1940; 3. Employers and workers: organizations and strategies; 4. Employers and workers: ideologies, attitudes and political orientations; 5. Configurations of strike activity; 6. Strike participation and solidarity before 1912; 7. Strikes, organization and consciousness in 1912 and after; 8. Conflictual context? The 'isolated mass' revisited; 9. Mining and modernity: size, sectionalism and solidarity; 10. The foundations of strike propensity; 11. Miners and management: agency and action; 12. Industrial relations and strikes after nationalization; 13. International perspectives; 14. Myths and realities: strikes, solidarity and 'militant miners'.

  12. Estimating the Impact of Bird Strikes

    NARCIS (Netherlands)

    Metz, I.C.; Muhlhausen, Thorsten; Ellerbroek, J.; Hoekstra, J.M.

    2018-01-01

    Bird strikes have the potential to cause severe damage to aircraft. Therefore, measures to reduce the risk of bird strikes are performed at airports. However, this risk is not limited to the airport but is increased in the arrival and departure corridors as well. Consequently, a significant amount

  13. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    Science.gov (United States)

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  14. 454 sequencing of pooled BAC clones on chromosome 3H of barley

    Directory of Open Access Journals (Sweden)

    Yamaji Nami

    2011-05-01

    Full Text Available Abstract Background Genome sequencing of barley has been delayed due to its large genome size (ca. 5,000Mbp. Among the fast sequencing systems, 454 liquid phase pyrosequencing provides the longest reads and is the most promising method for BAC clones. Here we report the results of pooled sequencing of BAC clones selected with ESTs genetically mapped to chromosome 3H. Results We sequenced pooled barley BAC clones using a 454 parallel genome sequencer. A PCR screening system based on primer sets derived from genetically mapped ESTs on chromosome 3H was used for clone selection in a BAC library developed from cultivar "Haruna Nijo". The DNA samples of 10 or 20 BAC clones were pooled and used for shotgun library development. The homology between contig sequences generated in each pooled library and mapped EST sequences was studied. The number of contigs assigned on chromosome 3H was 372. Their lengths ranged from 1,230 bp to 58,322 bp with an average 14,891 bp. Of these contigs, 240 showed homology and colinearity with the genome sequence of rice chromosome 1. A contig annotation browser supplemented with query search by unique sequence or genetic map position was developed. The identified contigs can be annotated with barley cDNAs and reference sequences on the browser. Homology analysis of these contigs with rice genes indicated that 1,239 rice genes can be assigned to barley contigs by the simple comparison of sequence lengths in both species. Of these genes, 492 are assigned to rice chromosome 1. Conclusions We demonstrate the efficiency of sequencing gene rich regions from barley chromosome 3H, with special reference to syntenic relationships with rice chromosome 1.

  15. Sequence homology: A poor predictive value for profilins cross-reactivity

    Directory of Open Access Journals (Sweden)

    Pazouki Nazanin

    2005-09-01

    Full Text Available Summary Background Profilins are highly cross-reactive allergens which bind IgE antibodies of almost 20% of plant-allergic patients. This study is aimed at investigating cross-reactivity of melon profilin with other plant profilins and the role of the linear and conformational epitopes in human IgE cross-reactivity. Methods Seventeen patients with melon allergy were selected based on clinical history and a positive skin prick test to melon extract. Melon profilin has been cloned and expressed in E. coli. The IgE binding and cross-reactivity of the recombinant profilin were measured by ELISA and inhibition ELISA. The amino acid sequence of melon profilin was compared with other profilin sequences. A combination of chemical cleavage and immunoblotting techniques were used to define the role of conformational and linear epitopes in IgE binding. Comparative modeling was used to construct three-dimensional models of profilins and to assess theoretical impact of amino acid differences on conformational structure. Results Profilin was identified as a major IgE-binding component of melon. Alignment of amino acid sequences of melon profilin with other profilins showed the most identity with watermelon profilin. This melon profilin showed substantial cross-reactivity with the tomato, peach, grape and Cynodon dactylon (Bermuda grass pollen profilins. Cantaloupe, watermelon, banana and Poa pratensis (Kentucky blue grass displayed no notable inhibition. Our experiments also indicated human IgE only react with complete melon profilin. Immunoblotting analysis with rabbit polyclonal antibody shows the reaction of the antibody to the fragmented and complete melon profilin. Although, the well-known linear epitope of profilins were identical in melon and watermelon, comparison of three-dimensional models of watermelon and melon profilins indicated amino acid differences influence the electric potential and accessibility of the solvent-accessible surface of

  16. Homologous Recombination and Xylella fastidiosa Host-Pathogen Associations in South America.

    Science.gov (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Lopes, João R S; Muller, Christiane; Almeida, Rodrigo P P

    2017-03-01

    Homologous recombination affects the evolution of bacteria such as Xylella fastidiosa, a naturally competent plant pathogen that requires insect vectors for dispersal. This bacterial species is taxonomically divided into subspecies, with phylogenetic clusters within subspecies that are host specific. One subspecies, pauca, is primarily limited to South America, with the exception of recently reported strains in Europe and Costa Rica. Despite the economic importance of X. fastidiosa subsp. pauca in South America, little is known about its genetic diversity. Multilocus sequence typing (MLST) has previously identified six sequence types (ST) among plant samples collected in Brazil (both subsp. pauca and multiplex). Here, we report on a survey of X. fastidiosa genetic diversity (MLST based) performed in six regions in Brazil and two in Argentina, by sampling five different plant species. In addition to the six previously reported ST, seven new subsp. pauca and two new subsp. multiplex ST were identified. The presence of subsp. multiplex in South America is considered to be the consequence of a single introduction from its native range in North America more than 80 years ago. Different phylogenetic approaches clustered the South American ST into four groups, with strains infecting citrus (subsp. pauca); coffee and olive (subsp. pauca); coffee, hibiscus, and plum (subsp. pauca); and plum (subsp. multiplex). In areas where these different genetic clusters occurred sympatrically, we found evidence of homologous recombination in the form of bidirectional allelic exchange between subspp. pauca and multiplex. In fact, the only strain of subsp. pauca isolated from a plum host had an allele that originated from subsp. multiplex. These signatures of bidirectional homologous recombination between endemic and introduced ST indicate that gene flow occurs in short evolutionary time frames in X. fastidiosa, despite the ecological isolation (i.e., host plant species) of genotypes.

  17. Protein 3D structure computed from evolutionary sequence variation.

    Directory of Open Access Journals (Sweden)

    Debora S Marks

    Full Text Available The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing.In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy.We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues, including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7-4.8 Å C(α-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org. This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of

  18. The effect of hand dominance on martial arts strikes.

    Science.gov (United States)

    Neto, Osmar Pinto; Silva, Jansen Henrique; Marzullo, Ana Carolina de Miranda; Bolander, Richard P; Bir, Cynthia A

    2012-08-01

    The main goal of this study was to compare dominant and non-dominant martial arts palm strikes under different circumstances that usually happen during martial arts and combative sports applications. Seven highly experienced (10±5 years) right hand dominant Kung Fu practitioners performed strikes with both hands, stances with left or right lead legs, and with the possibility or not of stepping towards the target (moving stance). Peak force was greater for the dominant hand strikes (1593.76±703.45 N vs. 1042.28±374.16 N; p<.001), whereas no difference was found in accuracy between the hands (p=.141). Additionally, peak force was greater for the strikes with moving stance (1448.75±686.01 N vs. 1201.80±547.98 N; p=.002) and left lead leg stance (1378.06±705.48 N vs. 1269.96±547.08 N). Furthermore, the difference in peak force between strikes with moving and stationary stances was statistically significant only for the strikes performed with a left lead leg stance (p=.007). Hand speed was higher for the dominant hand strikes (5.82±1.08 m/s vs. 5.24±0.78 m/s; p=.001) and for the strikes with moving stance (5.79±1.01 m/s vs. 5.29±0.90 m/s; p<.001). The difference in hand speed between right and left hand strikes was only significant for strikes with moving stance. In summary, our results suggest that the stronger palm strike for a right-handed practitioner is a right hand strike on a left lead leg stance moving towards the target. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. BIRD/WILDLIFE STRIKE CONTROL FOR SAFER AIR ...

    African Journals Online (AJOL)

    Osondu

    2012-06-05

    Jun 5, 2012 ... Keywords: bird/wildlife, strike, aviation, hazard, control. Introduction ... Ethiopian Journal of Environmental Studies and Management EJESM Vol. 5 No. 3 2012 .... Aircraft Bird. Strike Avoidance Rader System (ABARS) and.

  20. Determine the Foot Strike Pattern Using Inertial Sensors

    Directory of Open Access Journals (Sweden)

    Tzyy-Yuang Shiang

    2016-01-01

    Full Text Available From biomechanical point of view, strike pattern plays an important role in preventing potential injury risk in running. Traditionally, strike pattern determination was conducted by using 3D motion analysis system with cameras. However, the procedure is costly and not convenient. With the rapid development of technology, sensors have been applied in sport science field lately. Therefore, this study was designed to determine the algorithm that can identify landing strategies with a wearable sensor. Six healthy male participants were recruited to perform heel and forefoot strike strategies at 7, 10, and 13 km/h speeds. The kinematic data were collected by Vicon 3D motion analysis system and 2 inertial measurement units (IMU attached on the dorsal side of both shoes. The data of each foot strike were gathered for pitch angle and strike index analysis. Comparing the strike index from IMU with the pitch angle from Vicon system, our results showed that both signals exhibited highly correlated changes between different strike patterns in the sagittal plane (r=0.98. Based on the findings, the IMU sensors showed potential capabilities and could be extended beyond the context of sport science to other fields, including clinical applications.

  1. Geometric homology revisited

    OpenAIRE

    Ruffino, Fabio Ferrari

    2013-01-01

    Given a cohomology theory, there is a well-known abstract way to define the dual homology theory using the theory of spectra. In [4] the author provides a more geometric construction of the homology theory, using a generalization of the bordism groups. Such a generalization involves in its definition the vector bundle modification, which is a particular case of the Gysin map. In this paper we provide a more natural variant of that construction, which replaces the vector bundle modification wi...

  2. A decade of U.S. Air Force bat strikes

    Science.gov (United States)

    Peurach, Suzanne C.; Dove, Carla J.; Stepko, Laura

    2009-01-01

    From 1997 through 2007, 821 bat strikes were reported to the U.S. Air Force (USAF) Safety Center by aircraft personnel or ground crew and sent to the National Museum of Natural History, Smithsonian Institution, for identification. Many samples were identified by macroscopic and or microscopic comparisons with bat specimens housed in the museum and augmented during the last 2 years by DNA analysis. Bat remains from USAF strikes during this period were received at the museum from 40 states in the United States and from 20 countries. We confirmed that 46% of the strikes were caused by bats, but we did not identify them further; we identified 5% only to the family or genus level, and 49% to the species level. Fifty-five of the 101 bat-strike samples submitted for DNA analysis have been identified to the species level. Twenty-five bat species have been recorded striking USAF planes worldwide. The Brazilian free-tailed bat (Tadarida brasiliensis; n = 173) is the species most commonly identified in USAF strike impacts, followed by the red bat (Lasiurus borealis; n = 83). Bat strikes peak during the spring and fall, with >57% occurring from August through October; 82% of the reports that included time of strike were recorded between 2100 and 0900 hours. More than 12% of the bat strikes were reported at >300 m above ground level (AGL). Although $825,000 and >50% of this sum was attributable to 5 bat-strike incidents. Only 5 bats from the 10 most damaging bat strikes were identified to the species level, either because we did not receive remains with the reports or the sample was insufficient for identification.

  3. The morphology of strike-slip faults - Examples from the San Andreas Fault, California

    Science.gov (United States)

    Bilham, Roger; King, Geoffrey

    1989-01-01

    The dilatational strains associated with vertical faults embedded in a horizontal plate are examined in the framework of fault kinematics and simple displacement boundary conditions. Using boundary element methods, a sequence of examples of dilatational strain fields associated with commonly occurring strike-slip fault zone features (bends, offsets, finite rupture lengths, and nonuniform slip distributions) is derived. The combinations of these strain fields are then used to examine the Parkfield region of the San Andreas fault system in central California.

  4. 2002 Bird Strike Committee USA/Canada Conference

    National Research Council Canada - National Science Library

    Dolbeer, Richard

    2002-01-01

    Over 380 people from 20 countries and 17 exhibitors attended the 4th annual joint meeting of Bird Strike Committee-USA and Bird Strike Committee Canada in Sacramento, California on October 21-24, 2002...

  5. Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

    NARCIS (Netherlands)

    Al-Shahib, A.; Breitling, R.; Gilbert, D.

    2005-01-01

    Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

  6. Protein remote homology detection based on bidirectional long short-term memory.

    Science.gov (United States)

    Li, Shumin; Chen, Junjie; Liu, Bin

    2017-10-10

    Protein remote homology detection plays a vital role in studies of protein structures and functions. Almost all of the traditional machine leaning methods require fixed length features to represent the protein sequences. However, it is never an easy task to extract the discriminative features with limited knowledge of proteins. On the other hand, deep learning technique has demonstrated its advantage in automatically learning representations. It is worthwhile to explore the applications of deep learning techniques to the protein remote homology detection. In this study, we employ the Bidirectional Long Short-Term Memory (BLSTM) to learn effective features from pseudo proteins, also propose a predictor called ProDec-BLSTM: it includes input layer, bidirectional LSTM, time distributed dense layer and output layer. This neural network can automatically extract the discriminative features by using bidirectional LSTM and the time distributed dense layer. Experimental results on a widely-used benchmark dataset show that ProDec-BLSTM outperforms other related methods in terms of both the mean ROC and mean ROC50 scores. This promising result shows that ProDec-BLSTM is a useful tool for protein remote homology detection. Furthermore, the hidden patterns learnt by ProDec-BLSTM can be interpreted and visualized, and therefore, additional useful information can be obtained.

  7. Primary structure of human pancreatic protease E determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Shen, W.; Fletcher, T.S.; Largman, C.

    1987-01-01

    Although protease E was isolated from human pancreas over 10 years ago, its amino acid sequence and relationship to the elastases have not been established. The authors report the isolation of a cDNA clone for human pancreatic protease E and determination of the nucleic acid sequence coding for the protein. The deduced amino acid sequence contains all of the features common to serine proteases. The substrate binding region is highly homologous to those of porcine and rat elastases 1, explaining the similar specificity for alanine reported for protease E and these elastases. However, the amino acid sequence outside the substrate binding region is less than 50% conserved, and there is a striking difference in the overall net charge for protease E (6-) and elastases 1 (8+). These findings confirm that protease E is a new member of the serine protease family. They have attempted to identify amino acid residues important for the interaction between elastases and elastin by examining the amino acid sequence differences between elastases and protease E. In addition to the large number of surface charge changes which are outside the substrate binding region, there are several changes which might be crucial for elastolysis: Leu-73/Arg-73; Arg-217A/Ala-217A; Arg-65A/Gln-65A; and the presence of two new cysteine residues (Cys-98 and Cys-99B) which computer modeling studies predict could form a new disulfide bond, not previously observed for serine proteases. They also present evidence which suggests that human pancreas does not synthesize a basic, alanine-specific elastase similar to porcine elastase 1

  8. Homologous Recombination—Experimental Systems, Analysis and Significance

    Science.gov (United States)

    Kuzminov, Andrei

    2014-01-01

    Homologous recombination is the most complex of all recombination events that shape genomes and produce material for evolution. Homologous recombination events are exchanges between DNA molecules in the lengthy regions of shared identity, catalyzed by a group of dedicated enzymes. There is a variety of experimental systems in E. coli and Salmonella to detect homologous recombination events of several different kinds. Genetic analysis of homologous recombination reveals three separate phases of this process: pre-synapsis (the early phase), synapsis (homologous strand exchange) and post-synapsis (the late phase). In E. coli, there are at least two independent pathway of the early phase and at least two independent pathways of the late phase. All this complexity is incongruent with the originally ascribed role of homologous recombination as accelerator of genome evolution: there is simply not enough duplication and repetition in enterobacterial genomes for homologous recombination to have a detectable evolutionary role, and therefore not enough selection to maintain such a complexity. At the same time, the mechanisms of homologous recombination are uniquely suited for repair of complex DNA lesions called chromosomal lesions. In fact, the two major classes of chromosomal lesions are recognized and processed by the two individual pathways at the early phase of homologous recombination. It follows, therefore, that homologous recombination events are occasional reflections of the continual recombinational repair, made possible in cases of natural or artificial genome redundancy. PMID:26442506

  9. Comparative analysis of the prion protein gene sequences in African lion.

    Science.gov (United States)

    Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

    2006-10-01

    The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

  10. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  11. Wavelet transform analysis of electromyography kung fu strikes data.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina de Miranda

    2009-11-01

    In martial arts and contact sports strikes are performed at near maximum speeds. For that reason, electromyography (EMG) analysis of such movements is non-trivial. This paper has three main goals: firstly, to investigate the differences in the EMG activity of muscles during strikes performed with and without impacts; secondly, to assess the advantages of using Sum of Significant Power (SSP) values instead of root mean square (rms) values when analyzing EMG data; and lastly to introduce a new method of calculating median frequency values using wavelet transforms (WMDF). EMG data of the deltoid anterior (DA), triceps brachii (TB) and brachioradialis (BR) muscles were collected from eight Kung Fu practitioners during strikes performed with and without impacts. SSP results indicated significant higher muscle activity (p = 0.023) for the strikes with impact. WMDF results, on the other hand, indicated significant lower values (p = 0. 007) for the strikes with impact. SSP results presented higher sensitivity than rms to quantify important signal differences and, at the same time, presented lower inter-subject coefficient of variations. The result of increase in SSP values and decrease in WMDF may suggest better synchronization of motor units for the strikes with impact performed by the experienced Kung Fu practitioners. Key PointsThe results show higher muscle activity and lower electromyography median frequencies for strikes with impact compared to strikes without.SSP results presented higher sensitivity and lower inter-subject coefficient of variations than rms results.Kung Fu palm strikes with impact may present better motor units' synchronization than strikes without.

  12. When Push Comes to Shove: Strikes in Higher Education.

    Science.gov (United States)

    Magney, John

    2002-01-01

    To provide a better sense of how academic unions handle a strike situation, examines six unions who, between 1996 and 2000, went through strikes. Discusses the key issues and outcomes of the strikes. (EV)

  13. Lower limb joint angles and ground reaction forces in forefoot strike and rearfoot strike runners during overground downhill and uphill running.

    Science.gov (United States)

    Kowalski, Erik; Li, Jing Xian

    2016-11-01

    This study investigated the normal and parallel ground reaction forces during downhill and uphill running in habitual forefoot strike and habitual rearfoot strike (RFS) runners. Fifteen habitual forefoot strike and 15 habitual RFS recreational male runners ran at 3 m/s ± 5% during level, uphill and downhill overground running on a ramp mounted at 6° and 9°. Results showed that forefoot strike runners had no visible impact peak in all running conditions, while the impact peaks only decreased during the uphill conditions in RFS runners. Active peaks decreased during the downhill conditions in forefoot strike runners while active loading rates increased during downhill conditions in RFS runners. Compared to the level condition, parallel braking peaks were larger during downhill conditions and parallel propulsive peaks were larger during uphill conditions. Combined with previous biomechanics studies, our findings suggest that forefoot strike running may be an effective strategy to reduce impacts, especially during downhill running. These findings may have further implications towards injury management and prevention.

  14. Using SQL Databases for Sequence Similarity Searching and Analysis.

    Science.gov (United States)

    Pearson, William R; Mackey, Aaron J

    2017-09-13

    Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  15. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

    Science.gov (United States)

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

    2018-01-23

    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  16. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    Directory of Open Access Journals (Sweden)

    Lee DT

    2007-02-01

    Full Text Available Abstract Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL http://biocomp.iis.sinica.edu.tw/phylomlogo.

  17. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  18. Patellofemoral joint stress during running with alterations in foot strike pattern.

    Science.gov (United States)

    Vannatta, Charles Nathan; Kernozek, Thomas W

    2015-05-01

    This study aimed to quantify differences in patellofemoral joint stress that may occur when healthy runners alter their foot strike pattern from their habitual rearfoot strike to a forefoot strike to gain insight on the potential etiology and treatment methods of patellofemoral pain. Sixteen healthy female runners completed 20 running trials in a controlled laboratory setting under rearfoot strike and forefoot strike conditions. Kinetic and kinematic data were used to drive a static optimization technique to estimate individual muscle forces to input into a model of the patellofemoral joint to estimate joint stress during running. Peak patellofemoral joint stress and the stress-time integral over stance phase decreased by 27% and 12%, respectively, in the forefoot strike condition (P forefoot strike condition (P forefoot strike (P forefoot strike condition (P strike pattern to a forefoot strike results in consistent reductions in patellofemoral joint stress independent of changes in step length. Thus, implementation of forefoot strike training programs may be warranted in the treatment of runners with patellofemoral pain. However, it is suggested that the transition to a forefoot strike pattern should be completed in a graduated manner.

  19. Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

    Science.gov (United States)

    Mackey, Aaron J; Pearson, William R

    2004-10-01

    Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

  20. Lectures on homology with internal symmetries

    International Nuclear Information System (INIS)

    Solovyov, Yu.

    1993-09-01

    Homology with internal symmetries is a natural generalization of cyclic homology introduced, independently, by Connes and Tsygan, which has turned out to be a very useful tool in a number of problems of algebra, geometry topology, analysis and mathematical physics. It suffices to say cycling homology and cohomology are successfully applied in the index theory of elliptic operators on foliations, in the description of the homotopy type of pseudoisotopy spaces, in the theory of characteristic classes in algebraic K-theory. They are also applied in noncommutative differential geometry and in the cohomology of Lie algebras, the branches of mathematics which brought them to life in the first place. Essentially, we consider dihedral homology, which was successfully applied for the description of the homology type of groups of homeomorphisms and diffeomorphisms of simply connected manifolds. (author). 27 refs

  1. Martial arts striking hand peak acceleration, accuracy and consistency.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina De Miranda; Bolander, Richard P; Bir, Cynthia A

    2013-01-01

    The goal of this paper was to investigate the possible trade-off between peak hand acceleration and accuracy and consistency of hand strikes performed by martial artists of different training experiences. Ten male martial artists with training experience ranging from one to nine years volunteered to participate in the experiment. Each participant performed 12 maximum effort goal-directed strikes. Hand acceleration during the strikes was obtained using a tri-axial accelerometer block. A pressure sensor matrix was used to determine the accuracy and consistency of the strikes. Accuracy was estimated by the radial distance between the centroid of each subject's 12 strikes and the target, whereas consistency was estimated by the square root of the 12 strikes mean squared distance from their centroid. We found that training experience was significantly correlated to hand peak acceleration prior to impact (r(2)=0.456, p =0.032) and accuracy (r(2)=0. 621, p=0.012). These correlations suggest that more experienced participants exhibited higher hand peak accelerations and at the same time were more accurate. Training experience, however, was not correlated to consistency (r(2)=0.085, p=0.413). Overall, our results suggest that martial arts training may lead practitioners to achieve higher striking hand accelerations with better accuracy and no change in striking consistency.

  2. Orthotic intervention in forefoot and rearfoot strike running patterns.

    Science.gov (United States)

    Stackhouse, Carrie Laughton; Davis, Irene McClay; Hamill, Joseph

    2004-01-01

    To compare the differential effect of custom orthoses on the lower extremity mechanics of a forefoot and rearfoot strike pattern. Fifteen subjects ran with both a forefoot and a rearfoot strike pattern with and without orthoses. Lower extremity kinematic and kinetic variables were compared between strike pattern and orthotic conditions. Foot orthoses have been shown to be effective in controlling excessive rearfoot motion in rearfoot strikers. The effect of orthotic intervention on rearfoot motion in forefoot strikers has not been previously reported. Five trials were collected for each condition. Peak rearfoot eversion, eversion excursion, eversion velocity, peak inversion moment, and inversion work were compared between conditions. Kinematic variables in the sagittal plane of the rearfoot and in the frontal and sagittal plane of the knee were also determined. Increased rearfoot excursions and velocities and decreased peak eversion were noted in the forefoot strike pattern compared to the rearfoot strike pattern. Orthotic intervention, however,did not significantly change rearfoot motion in either strike pattern. Reductions in internal rotation and abduction of the knee were noted with orthotic intervention. Foot orthoses do not differentially effect rearfoot motion of a rearfoot strike and a forefoot strike running pattern. Orthotic intervention has a larger and more systematic effect on rearfoot kinetics compared to rearfoot kinematics.

  3. VARIATION OF STRIKE INCENTIVES IN DEEP REDUCTIONS; FINAL

    International Nuclear Information System (INIS)

    G.H. CANAVAN

    2001-01-01

    This note studies the sensitivity of strike incentives to deep offensive force reductions using exchange, cost, and game theoretic decision models derived and discussed in companion reports. As forces fall, weapon allocations shift from military to high value targets, with the shift being half complete at about 1,000 weapons. By 500 weapons, the first and second strikes are almost totally on high value. The dominant cost for striking first is that of damage to one's high value, which is near total absent other constraints, and hence proportional to preferences for survival of high value. Changes in military costs are largely offsetting, so total first strike costs change little. The resulting costs at decision nodes are well above the costs of inaction, so the preferred course is inaction for all offensive reductions studied. As the dominant cost for striking first is proportional to the preference for survival of high value. There is a wide gap between the first strike cost and that of inaction for the parameters studied here. These conclusions should be insensitive to significant reductions in the preference for survival of high value, which is the most sensitive parameter

  4. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  5. Improving model construction of profile HMMs for remote homology detection through structural alignment

    Directory of Open Access Journals (Sweden)

    Zaverucha Gerson

    2007-11-01

    Full Text Available Abstract Background Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. Results We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. Conclusion We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  6. Improving model construction of profile HMMs for remote homology detection through structural alignment.

    Science.gov (United States)

    Bernardes, Juliana S; Dávila, Alberto M R; Costa, Vítor S; Zaverucha, Gerson

    2007-11-09

    Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs) are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  7. Compositional Homology and Creative Thinking

    Directory of Open Access Journals (Sweden)

    Salvatore Tedesco

    2015-05-01

    Full Text Available The concept of homology is the most solid theoretical basis elaborated by the morphological thinking during its history. The enucleation of some general criteria for the interpretation of homology is today a fundamental tool for life sciences, and for restoring their own opening to the question of qualitative innovation that arose so powerfully in the original Darwinian project. The aim of this paper is to verify the possible uses of the concept of compositional homology in order to provide of an adequate understanding of the dynamics of creative thinking.

  8. Rational Homological Stability for Automorphisms of Manifolds

    DEFF Research Database (Denmark)

    Grey, Matthias

    In this thesis we prove rational homological stability for the classifying spaces of the homotopy automorphisms and block di↵eomorphisms of iterated connected sums of products of spheres of a certain connectivity.The results in particular apply to the manifolds       Npg,q  = (#g(Sp x Sq)) - int...... with coefficients in the homology of the universal covering, which is studied using rational homology theory. The result for the block di↵eomorphisms is deduced from the homological stability for the homotopy automorphisms upon using Surgery theory. Themain theorems of this thesis extend the homological stability...

  9. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation.

    Science.gov (United States)

    Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K

    2017-07-01

    To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

  10. Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Mikhail Nefedov

    2011-01-01

    Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

  11. In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining

    Science.gov (United States)

    Geisinger, Jonathan M.; Turan, Sören; Hernandez, Sophia; Spector, Laura P.; Calos, Michele P.

    2016-01-01

    The CRISPR/Cas9 system facilitates precise DNA modifications by generating RNA-guided blunt-ended double-strand breaks. We demonstrate that guide RNA pairs generate deletions that are repaired with a high level of precision by non-homologous end-joining in mammalian cells. We present a method called knock-in blunt ligation for exploiting these breaks to insert exogenous PCR-generated sequences in a homology-independent manner without loss of additional nucleotides. This method is useful for making precise additions to the genome such as insertions of marker gene cassettes or functional elements, without the need for homology arms. We successfully utilized this method in human and mouse cells to insert fluorescent protein cassettes into various loci, with efficiencies up to 36% in HEK293 cells without selection. We also created versions of Cas9 fused to the FKBP12-L106P destabilization domain in an effort to improve Cas9 performance. Our in vivo blunt-end cloning method and destabilization-domain-fused Cas9 variant increase the repertoire of precision genome engineering approaches. PMID:26762978

  12. Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins.

    Science.gov (United States)

    Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R

    2018-02-01

    This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

  13. Homology in Electromagnetic Boundary Value Problems

    Directory of Open Access Journals (Sweden)

    Pellikka Matti

    2010-01-01

    Full Text Available We discuss how homology computation can be exploited in computational electromagnetism. We represent various cellular mesh reduction techniques, which enable the computation of generators of homology spaces in an acceptable time. Furthermore, we show how the generators can be used for setting up and analysis of an electromagnetic boundary value problem. The aim is to provide a rationale for homology computation in electromagnetic modeling software.

  14. Joint stiffness and running economy during imposed forefoot strike before and after a long run in rearfoot strike runners.

    Science.gov (United States)

    Melcher, Daniel A; Paquette, Max R; Schilling, Brian K; Bloomer, Richard J

    2017-12-01

    Research has focused on the effects of acute strike pattern modifications on lower extremity joint stiffness and running economy (RE). Strike pattern modifications on running biomechanics have mostly been studied while runners complete short running bouts. This study examined the effects of an imposed forefoot strike (FFS) on RE and ankle and knee joint stiffness before and after a long run in habitual rearfoot strike (RFS) runners. Joint kinetics and RE were collected before and after a long run. Sagittal joint kinetics were computed from kinematic and ground reaction force data that were collected during over-ground running trials in 13 male runners. RE was measured during treadmill running. Knee flexion range of motion, knee extensor moment and ankle joint stiffness were lower while plantarflexor moment and knee joint stiffness were greater during imposed FFS compared with RFS. The long run did not influence the difference in ankle and knee joint stiffness between strike patterns. Runners were more economical during RFS than imposed FFS and RE was not influenced by the long run. These findings suggest that using a FFS pattern towards the end of a long run may not be mechanically or metabolically beneficial for well-trained male RFS runners.

  15. [Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain].

    Science.gov (United States)

    Wu, Qinggang; Zhang, Jingping; Zhao, Chuncheng; Zhu, Jianguo

    2008-09-01

    Cloning and sequencing of the papA gene from uropathogenic Escherichia coli 4030 strain to investigate the differences of the sequences of the papA of UPEC4030 strain and the ones of related genes, in order to make whether or not it was a new genotype. Cloning and sequencing methods were used to analyze the sequence of the papA of UPEC4030 strain in comparison with related sequences. The sequence analysis of papA revealed a 722 bp gene and encode 192 amino acid polypeptide. The overall homology of the papA genes between UPEC4030 and the standard strains of ten F types were 36.11%-77.95% and 22.20%-78.34% at nucleotide and deduced amino acid levels. The homology between the sequence of the reverse primers and the corresponding sequence of UPEC4030 papA was 10%-66.67%. The results confirmed that UPEC4030 strain contained a novel papA variant. UPEC4030 strain could contain an unknown papA variant or the novel genotype. The pathogenic mechanism and epidemiology related need to be further studied.

  16. Evaluating the Effects of a Bird Strike Advisory System

    NARCIS (Netherlands)

    Metz, I.C.; Mühlhausen, T; Ellerbroek, J.; Hoekstra, J.M.

    2016-01-01

    Bird strikes have operational impacts and cause economic loss to the aviation industry. In the worst case, the damages resulting from bird strikes lead to crashes. The highest risk for bird strikes lies in the area below 3000 ft and thus mainly in airport environments. Despite intense efforts from

  17. Debunking the viper's strike: harmless snakes kill a common assumption.

    Science.gov (United States)

    Penning, David A; Sawvel, Baxter; Moon, Brad R

    2016-03-01

    To survive, organisms must avoid predation and acquire nutrients and energy. Sensory systems must correctly differentiate between potential predators and prey, and elicit behaviours that adjust distances accordingly. For snakes, strikes can serve both purposes. Vipers are thought to have the fastest strikes among snakes. However, strike performance has been measured in very few species, especially non-vipers. We measured defensive strike performance in harmless Texas ratsnakes and two species of vipers, western cottonmouths and western diamond-backed rattlesnakes, using high-speed video recordings. We show that ratsnake strike performance matches or exceeds that of vipers. In contrast with the literature over the past century, vipers do not represent the pinnacle of strike performance in snakes. Both harmless and venomous snakes can strike with very high accelerations that have two key consequences: the accelerations exceed values that can cause loss of consciousness in other animals, such as the accelerations experienced by jet pilots during extreme manoeuvres, and they make the strikes faster than the sensory and motor responses of mammalian prey and predators. Both harmless and venomous snakes can strike faster than the blink of an eye and often reach a target before it can move. © 2016 The Author(s).

  18. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  19. The genomic sequence of the Chinese hamster ovary (CHO)-K1 cell line

    DEFF Research Database (Denmark)

    Xu, Xun; Pan, Shengkai; Liu, Xin

    2011-01-01

    Chinese hamster ovary (CHO)-derived cell lines are the preferred host cells for the production of therapeutic proteins. Here we present a draft genomic sequence of the CHO-K1 ancestral cell line. The assembly comprises 2.45 Gb of genomic sequence, with 24,383 predicted genes. We associate most....... Homologs of most human glycosylation-associated genes are present in the CHO-K1 genome, although 141 of these homologs are not expressed under exponential growth conditions. Many important viral entry genes are also present in the genome but not expressed, which may explain the unusual viral resistance...... property of CHO cell lines. We discuss how the availability of this genome sequence may facilitate genome-scale science for the optimization of biopharmaceutical protein production....

  20. Foot strike and injury rates in endurance runners: a retrospective study.

    Science.gov (United States)

    Daoud, Adam I; Geissler, Gary J; Wang, Frank; Saretsky, Jason; Daoud, Yahya A; Lieberman, Daniel E

    2012-07-01

    This retrospective study tests if runners who habitually forefoot strike have different rates of injury than runners who habitually rearfoot strike. We measured the strike characteristics of middle- and long-distance runners from a collegiate cross-country team and quantified their history of injury, including the incidence and rate of specific injuries, the severity of each injury, and the rate of mild, moderate, and severe injuries per mile run. Of the 52 runners studied, 36 (69%) primarily used a rearfoot strike and 16 (31%) primarily used a forefoot strike. Approximately 74% of runners experienced a moderate or severe injury each year, but those who habitually rearfoot strike had approximately twice the rate of repetitive stress injuries than individuals who habitually forefoot strike. Traumatic injury rates were not significantly different between the two groups. A generalized linear model showed that strike type, sex, race distance, and average miles per week each correlate significantly (P strike have significantly higher rates of repetitive stress injury than those who mostly forefoot strike. This study does not test the causal bases for this general difference. One hypothesis, which requires further research, is that the absence of a marked impact peak in the ground reaction force during a forefoot strike compared with a rearfoot strike may contribute to lower rates of injuries in habitual forefoot strikers.

  1. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  2. Lightning Strike in Pregnancy With Fetal Injury.

    Science.gov (United States)

    Galster, Kellen; Hodnick, Ryan; Berkeley, Ross P

    2016-06-01

    Injuries from lightning strikes are an infrequent occurrence, and are only rarely noted to involve pregnant victims. Only 13 cases of lightning strike in pregnancy have been previously described in the medical literature, along with 7 additional cases discovered within news media reports. This case report presents a novel case of lightning-associated injury in a patient in the third trimester of pregnancy, resulting in fetal ischemic brain injury and long-term morbidity, and reviews the mechanics of lightning strikes along with common injury patterns of which emergency providers should be aware. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  3. effects of strike cost on economic development in nigeria

    African Journals Online (AJOL)

    USER

    same firm, in other firms even in other industries (Kempner, 1980). For example ... The main purpose of this paper is to examine the strike cost and productivity in. Nigeria. ... Obnoxious Policies: Workers do go on strike when management makes obnoxious ... ASUU had to go on strike; the FGN had rescinded the decision.

  4. Homologous series of induced early mutants in indican rice. Pt.1. The production of homologous series of early mutants

    International Nuclear Information System (INIS)

    Chen Xiulan; Yang Hefeng; He Zhentian; Han Yuepeng; Liu Xueyu

    1999-01-01

    The percentage of homologous series of early mutants induced from the same Indican rice variety were almost the same (1.37%∼1.64%) in 1983∼1993, but the ones from the different eco-typical varieties were different. The early variety was 0.73%, the mid variety was 1.51%, and the late variety was 1.97%. The percentage of homologous series of early mutants from the varieties with the same pedigree and relationship were similar, but the one from the cog nation were lower than those from distant varieties. There are basic laws and characters in the homologous series of early mutants: 1. The inhibited phenotype is the basic of the homologous series of early mutants; 2. The production of the homologous series of early mutants is closely related with the growing period of the parent; 3. The parallel mutation of the stem and leaves are simultaneously happened with the variation of early or late maturing; 4. The occurrence of the homologous series of early mutants is in a state of imbalance. According to the law of parallel variability, the production of homologous series of early mutants can be predicted as long as the parents' classification of plant, pedigree and ecological type are identified. Therefore, the early breeding can be guided by the law of homologous series of early mutants

  5. Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C

    1997-12-01

    Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.

  6. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  7. Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

    Science.gov (United States)

    Abraham, Anup; Chandler, Douglas E

    2017-10-01

    Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

  8. Forward to the Past: Strikes and Striking as Dialogue by other ...

    African Journals Online (AJOL)

    In Nigeria, from the colonial period to the present, the employment of strikes and protests by nationalists, Nigerian workers and civil society groups has been established as one of the potent means of conveying viewpoints, positions as well as the demand for equality, fairness, social justice and reforms. It has been used as ...

  9. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  10. Sequence Exchange between Homologous NB-LRR Genes Converts Virus Resistance into Nematode Resistance, and Vice Versa.

    Science.gov (United States)

    Slootweg, Erik; Koropacka, Kamila; Roosien, Jan; Dees, Robert; Overmars, Hein; Lankhorst, Rene Klein; van Schaik, Casper; Pomp, Rikus; Bouwman, Liesbeth; Helder, Johannes; Schots, Arjen; Bakker, Jaap; Smant, Geert; Goverse, Aska

    2017-09-01

    Plants have evolved a limited repertoire of NB-LRR disease resistance ( R ) genes to protect themselves against myriad pathogens. This limitation is thought to be counterbalanced by the rapid evolution of NB-LRR proteins, as only a few sequence changes have been shown to be sufficient to alter resistance specificities toward novel strains of a pathogen. However, little is known about the flexibility of NB-LRR R genes to switch resistance specificities between phylogenetically unrelated pathogens. To investigate this, we created domain swaps between the close homologs Gpa2 and Rx1 , which confer resistance in potato ( Solanum tuberosum ) to the cyst nematode Globodera pallida and Potato virus X , respectively. The genetic fusion of the CC-NB-ARC of Gpa2 with the LRR of Rx1 (Gpa2 CN /Rx1 L ) results in autoactivity, but lowering the protein levels restored its specific activation response, including extreme resistance to Potato virus X in potato shoots. The reciprocal chimera (Rx1 CN /Gpa2 L ) shows a loss-of-function phenotype, but exchange of the first three LRRs of Gpa2 by the corresponding region of Rx1 was sufficient to regain a wild-type resistance response to G. pallida in the roots. These data demonstrate that exchanging the recognition moiety in the LRR is sufficient to convert extreme virus resistance in the leaves into mild nematode resistance in the roots, and vice versa. In addition, we show that the CC-NB-ARC can operate independently of the recognition specificities defined by the LRR domain, either aboveground or belowground. These data show the versatility of NB-LRR genes to generate resistance to unrelated pathogens with completely different lifestyles and routes of invasion. © 2017 American Society of Plant Biologists. All Rights Reserved.

  11. In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline.

    Directory of Open Access Journals (Sweden)

    Nima Najand

    Full Text Available We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    Science.gov (United States)

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  14. "Thunderstruck": penetrating thoracic injury from lightning strike.

    Science.gov (United States)

    van Waes, Oscar J F; van de Woestijne, Pieter C; Halm, Jens A

    2014-04-01

    Lightning strike victims are rarely presented at an emergency department. Burns are often the primary focus. This case report describes the improvised explosive device like-injury to the thorax due to lightning strike and its treatment, which has not been described prior in (kerauno)medicine. Penetrating injury due to blast from lightning strike is extremely rare. These "shrapnel" injuries should however be ruled out in all patients struck by lightning. Copyright © 2013 American College of Emergency Physicians. Published by Mosby, Inc. All rights reserved.

  15. Option Strike Price and Managerial Investment Decisions

    Institute of Scientific and Technical Information of China (English)

    刘鸿雁; 张维

    2003-01-01

    The manager′s investment decisions is modeled when the manager is risk-averse and has stock options as compensation. It is found that the strike price of options is crucial to the investment incentives of managers, and that the correct value, or interval of values, of managerial stock option strike price can bring stockholder and manager interests in agreement.

  16. Selective anticancer activity of a hexapeptide with sequence homology to a non-kinase domain of Cyclin Dependent Kinase 4

    Directory of Open Access Journals (Sweden)

    Agarwala Usha

    2011-06-01

    Full Text Available Abstract Background Cyclin-dependent kinases 2, 4 and 6 (Cdk2, Cdk4, Cdk6 are closely structurally homologous proteins which are classically understood to control the transition from the G1 to the S-phases of the cell cycle by combining with their appropriate cyclin D or cyclin E partners to form kinase-active holoenzymes. Deregulation of Cdk4 is widespread in human cancer, CDK4 gene knockout is highly protective against chemical and oncogene-mediated epithelial carcinogenesis, despite the continued presence of CDK2 and CDK6; and overexpresssion of Cdk4 promotes skin carcinogenesis. Surprisingly, however, Cdk4 kinase inhibitors have not yet fulfilled their expectation as 'blockbuster' anticancer agents. Resistance to inhibition of Cdk4 kinase in some cases could potentially be due to a non-kinase activity, as recently reported with epidermal growth factor receptor. Results A search for a potential functional site of non-kinase activity present in Cdk4 but not Cdk2 or Cdk6 revealed a previously-unidentified loop on the outside of the C'-terminal non-kinase domain of Cdk4, containing a central amino-acid sequence, Pro-Arg-Gly-Pro-Arg-Pro (PRGPRP. An isolated hexapeptide with this sequence and its cyclic amphiphilic congeners are selectively lethal at high doses to a wide range of human cancer cell lines whilst sparing normal diploid keratinocytes and fibroblasts. Treated cancer cells do not exhibit the wide variability of dose response typically seen with other anticancer agents. Cancer cell killing by PRGPRP, in a cyclic amphiphilic cassette, requires cells to be in cycle but does not perturb cell cycle distribution and is accompanied by altered relative Cdk4/Cdk1 expression and selective decrease in ATP levels. Morphological features of apoptosis are absent and cancer cell death does not appear to involve autophagy. Conclusion These findings suggest a potential new paradigm for the development of broad-spectrum cancer specific therapeutics with

  17. Homologous SV40 RNA trans-splicing: Special case or prime example of viral RNA trans-splicing?

    Directory of Open Access Journals (Sweden)

    Sushmita Poddar

    2014-06-01

    Full Text Available To date the Simian Virus 40 (SV40 is the only proven example of a virus that recruits the mechanism of RNA trans-splicing to diversify its sequences and gene products. Thereby, two identical viral transcripts are efficiently joined by homologous trans-splicing triggering the formation of a highly transforming 100 kDa super T antigen. Sequences of other viruses including HIV-1 and the human adenovirus type 5 were reported to be involved in heterologous trans-splicing towards cellular or viral sequences but the meaning of these events remains unclear. We computationally and experimentally investigated molecular features associated with viral RNA trans-splicing and identified a common pattern: Viral RNA trans-splicing occurs between strong cryptic or regular viral splice sites and strong regular or cryptic splice sites of the trans-splice partner sequences. The majority of these splice sites are supported by exonic splice enhancers. Splice sites that could compete with the trans-splicing sites for cis-splice reactions are weaker or inexistent. Finally, all but one of the trans-splice reactions seem to be facilitated by one or more complementary binding domains of 11 to 16 nucleotides in length which, however occur with a statistical probability close to one for the given length of the involved sequences. The chimeric RNAs generated via heterologous viral RNA trans-splicing either did not lead to fusion proteins or led to proteins of unknown function. Our data suggest that distinct viral RNAs are highly susceptible to trans-splicing and that heterologous viral trans-splicing, unlike homologous SV40 trans-splicing, represents a chance event.

  18. Coding sequence of human rho cDNAs clone 6 and clone 9

    Energy Technology Data Exchange (ETDEWEB)

    Chardin, P; Madaule, P; Tavitian, A

    1988-03-25

    The authors have isolated human cDNAs including the complete coding sequence for two rho proteins corresponding to the incomplete isolates previously described as clone 6 and clone 9. The deduced a.a. sequences, when compared to the a.a. sequence deduced from clone 12 cDNA, show that there are in human at least three highly homologous rho genes. They suggest that clone 12 be named rhoA, clone 6 : rhoB and clone 9 : rhoC. RhoA, B and C proteins display approx. 30% a.a. identity with ras proteins,. mainly clustered in four highly homologous internal regions corresponding to the GTP binding site; however at least one significant difference is found; the 3 rho proteins have an Alanine in position corresponding to ras Glycine 13, suggesting that rho and ras proteins might have slightly different biochemical properties.

  19. Effects of footwear and strike type on running economy.

    Science.gov (United States)

    Perl, Daniel P; Daoud, Adam I; Lieberman, Daniel E

    2012-07-01

    This study tests if running economy differs in minimal shoes versus standard running shoes with cushioned elevated heels and arch supports and in forefoot versus rearfoot strike gaits. We measured the cost of transport (mL O(2)·kg(-1)·m(-1)) in subjects who habitually run in minimal shoes or barefoot while they were running at 3.0 m·s(-1) on a treadmill during forefoot and rearfoot striking while wearing minimal and standard shoes, controlling for shoe mass and stride frequency. Force and kinematic data were collected when subjects were shod and barefoot to quantify differences in knee flexion, arch strain, plantar flexor force production, and Achilles tendon-triceps surae strain. After controlling for stride frequency and shoe mass, runners were 2.41% more economical in the minimal-shoe condition when forefoot striking and 3.32% more economical in the minimal-shoe condition when rearfoot striking (P forefoot and rearfoot striking did not differ significantly in cost for either minimal- or standard-shoe running. Arch strain was not measured in the shod condition but was significantly greater during forefoot than rearfoot striking when barefoot. Plantar flexor force output was significantly higher in forefoot than in rearfoot striking and in barefoot than in shod running. Achilles tendon-triceps surae strain and knee flexion were also lower in barefoot than in standard-shoe running. Minimally shod runners are modestly but significantly more economical than traditionally shod runners regardless of strike type, after controlling for shoe mass and stride frequency. The likely cause of this difference is more elastic energy storage and release in the lower extremity during minimal-shoe running.

  20. Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

    NARCIS (Netherlands)

    D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)

    1994-01-01

    textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

  1. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  2. Colored Kauffman homology and super-A-polynomials

    International Nuclear Information System (INIS)

    Nawata, Satoshi; Ramadevi, P.; Zodinmawia

    2014-01-01

    We study the structural properties of colored Kauffman homologies of knots. Quadruple-gradings play an essential role in revealing the differential structure of colored Kauffman homology. Using the differential structure, the Kauffman homologies carrying the symmetric tensor products of the vector representation for the trefoil and the figure-eight are determined. In addition, making use of relations from representation theory, we also obtain the HOMFLY homologies colored by rectangular Young tableaux with two rows for these knots. Furthermore, the notion of super-A-polynomials is extended in order to encompass two-parameter deformations of PSL(2,ℂ) character varieties

  3. Establishment of screening technique for mutant cell and analysis of base sequence in the mutation

    International Nuclear Information System (INIS)

    Sofuni, Toshio; Nomi, Takehiko; Yamada, Masami; Masumura, Kenichi

    2000-01-01

    This research project aimed to establish an easy and quick detection method for radiation-induced mutation using molecular-biological techniques and an effective analyzing method for the molecular changes in base sequence. In this year, Spi mutants derived from γ-radiation exposed mouse were analyzed by PCR method and DNA sequence method. Male transgenic mice were exposed to γ-ray at 5,10, 50 Gy and the transgene was taken out from the genome DNA from the spleen in vivo packaging method. Spi mutant plaques were obtained by infecting the recovered phage to E. coli. Sequence analysis for the mutants was made using ALFred DNA sequencer and SequiTherm TM Long-Red Cycle sequencing kit. Sequence analysis was carried out for 41 of 50 independent Spi mutants obtained. The deletions were classified into 4 groups; Group 1 included 15 mutants that were characterized with a large deletion (43 bp-10 kb) with a short homologous sequence. Group 2 included 11 mutants of a large deletion having no homologous sequence at the connecting region. Group 3 included 11 mutants having a short deletion of less than 20 bp, which occurred in the non-repetitive sequence of gam gene and possibly caused by oxidative breakage of DNA or recombination of DNA fragment produced by the breakage. Group 4 included 4 mutants having deletions as short as 20 bp or less in the repetitive sequence of gam gene, resulting in an alteration of the reading frame. Thus, the synthesis of Gam protein was terminated by the appearance of TGA between code 13 and 14 of redB gene, leading to inactivation of gam gene and redBA gene. These results indicated that most of Spi mutants had a deletion in red/gam region and the deletions in more than half mutants occurred in homologous sequences as short as 8 bp. (M.N.)

  4. Protein secondary structure prediction for a single-sequence using hidden semi-Markov models

    Directory of Open Access Journals (Sweden)

    Borodovsky Mark

    2006-03-01

    Full Text Available Abstract Background The accuracy of protein secondary structure prediction has been improving steadily towards the 88% estimated theoretical limit. There are two types of prediction algorithms: Single-sequence prediction algorithms imply that information about other (homologous proteins is not available, while algorithms of the second type imply that information about homologous proteins is available, and use it intensively. The single-sequence algorithms could make an important contribution to studies of proteins with no detected homologs, however the accuracy of protein secondary structure prediction from a single-sequence is not as high as when the additional evolutionary information is present. Results In this paper, we further refine and extend the hidden semi-Markov model (HSMM initially considered in the BSPSS algorithm. We introduce an improved residue dependency model by considering the patterns of statistically significant amino acid correlation at structural segment borders. We also derive models that specialize on different sections of the dependency structure and incorporate them into HSMM. In addition, we implement an iterative training method to refine estimates of HSMM parameters. The three-state-per-residue accuracy and other accuracy measures of the new method, IPSSP, are shown to be comparable or better than ones for BSPSS as well as for PSIPRED, tested under the single-sequence condition. Conclusions We have shown that new dependency models and training methods bring further improvements to single-sequence protein secondary structure prediction. The results are obtained under cross-validation conditions using a dataset with no pair of sequences having significant sequence similarity. As new sequences are added to the database it is possible to augment the dependency structure and obtain even higher accuracy. Current and future advances should contribute to the improvement of function prediction for orphan proteins inscrutable

  5. VIP and its homologous increase vascular conductance in certain endocrine and exocrine glands

    International Nuclear Information System (INIS)

    Huffman, L.J.; Connors, J.M.; Hedge, G.A.

    1988-01-01

    The effects of vasoactive intestinal peptide (VIP) and related structural homologues on tissue vascular conductances were investigated in anesthetized male rats. VIP, peptide histidine isoleucine (PHI), secretin, growth hormone-releasing factor (GHRF), gastric inhibitory peptide (GIP), or saline was infused intravenously over 4 min. Tissue blood flows were measured during this time by use of 141 Ce-labeled microspheres. Circulating thyrotropin (TSH), triiodothyronine (T 3 ), and thyroxine (T 4 ) levels were determined before and at 20 min and 2 h after treatment. Marked increases in thyroid, pancreatic, and salivary gland vascular Cs occurred during peptide infusion with the order of potency correlating with the degree of structural homology to VIP. PHI and secretin produced maximal increases in vascular Cs, which were the same as those obtained with VIP. Circulating TSH, T 3 , and T 4 levels were not different from values in saline-infused rats after peptide treatments that caused striking increases in thyroid vascular C. These observations indicate that the vascular beds of certain endocrine and exocrine glands are responsive to the vasodilatory action of VIP and related homologues with the order of potency corresponding to the degree of structural homology to VIP. These results are also consistent with the proposal that structural homologues of VIP act at the same vascular receptor as VIP. Alternative, the involvement of different vascular receptors, acting through the same mechanism at a level beyond the receptor site, cannot be excluded

  6. Induction of human immunodeficiency virus (HIV-1 envelope specific cell-mediated immunity by a non-homologous synthetic peptide.

    Directory of Open Access Journals (Sweden)

    Ammar Achour

    2007-11-01

    Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.

  7. No allelic variation in genes with high gliadin homology in patients with celiac disease and type 1 diabetes

    DEFF Research Database (Denmark)

    Nielsen, Christian; Hansen, Dorte; Husby, Steffen

    2004-01-01

    recognize gluten-derived peptides in which specific glutamine residues are deamidated to glutamic acid by tissue transglutaminase. Recently, intestinally expressed human genes with high homology to DQ2-gliadin celiac T-cell epitopes have been identified. Single or double point mutations which would increase...... the celiac T-cell epitope homology, and mutation in these genes, leading to the expression of glutamic acid at particular positions, could hypothetically be involved in the initiation of CD in HLA-DQ2-positive children. Six gene regions with high celiac T-cell epitope homology were investigated for single......-nucleotide polymorphisms using direct sequencing of DNA from 20 CD patients, 27 type 1 diabetes mellitus (T1DM) patients with associated CD, 24 patients with T1DM without CD and 110 healthy controls, all of Caucasian origin. No variants in any of these genes in any of the investigated groups were found. We conclude...

  8. Strike Point Control on EAST Using an Isoflux Control Method

    International Nuclear Information System (INIS)

    Xing Zhe; Xiao Bingjia; Luo Zhengping; Walker, M. L.; Humphreys, D. A.

    2015-01-01

    For the advanced tokamak, the particle deposition and thermal load on the divertor is a big challenge. By moving the strike points on divertor target plates, the position of particle deposition and thermal load can be shifted. We could adjust the Poloidal Field (PF) coil current to achieve the strike point position feedback control. Using isoflux control method, the strike point position can be controlled by controlling the X point position. On the basis of experimental data, we establish relational expressions between X point position and strike point position. Benchmark experiments are carried out to validate the correctness and robustness of the control methods. The strike point position is successfully controlled following our command in the EAST operation. (paper)

  9. Statistical distributions of optimal global alignment scores of random protein sequences

    Directory of Open Access Journals (Sweden)

    Tang Jiaowei

    2005-10-01

    Full Text Available Abstract Background The inference of homology from statistically significant sequence similarity is a central issue in sequence alignments. So far the statistical distribution function underlying the optimal global alignments has not been completely determined. Results In this study, random and real but unrelated sequences prepared in six different ways were selected as reference datasets to obtain their respective statistical distributions of global alignment scores. All alignments were carried out with the Needleman-Wunsch algorithm and optimal scores were fitted to the Gumbel, normal and gamma distributions respectively. The three-parameter gamma distribution performs the best as the theoretical distribution function of global alignment scores, as it agrees perfectly well with the distribution of alignment scores. The normal distribution also agrees well with the score distribution frequencies when the shape parameter of the gamma distribution is sufficiently large, for this is the scenario when the normal distribution can be viewed as an approximation of the gamma distribution. Conclusion We have shown that the optimal global alignment scores of random protein sequences fit the three-parameter gamma distribution function. This would be useful for the inference of homology between sequences whose relationship is unknown, through the evaluation of gamma distribution significance between sequences.

  10. A computational approach to discovering the functions of bacterial phytochromes by analysis of homolog distributions

    Directory of Open Access Journals (Sweden)

    Lamparter Tilman

    2006-03-01

    Full Text Available Abstract Background Phytochromes are photoreceptors, discovered in plants, that control a wide variety of developmental processes. They have also been found in bacteria and fungi, but for many species their biological role remains obscure. This work concentrates on the phytochrome system of Agrobacterium tumefaciens, a non-photosynthetic soil bacterium with two phytochromes. To identify proteins that might share common functions with phytochromes, a co-distribution analysis was performed on the basis of protein sequences from 138 bacteria. Results A database of protein sequences from 138 bacteria was generated. Each sequence was BLASTed against the entire database. The homolog distribution of each query protein was then compared with the homolog distribution of every other protein (target protein of the same species, and the target proteins were sorted according to their probability of co-distribution under random conditions. As query proteins, phytochromes from Agrobacterium tumefaciens, Pseudomonas aeruginosa, Deinococcus radiodurans and Synechocystis PCC 6803 were chosen along with several phytochrome-related proteins from A. tumefaciens. The Synechocystis photosynthesis protein D1 was selected as a control. In the D1 analyses, the ratio between photosynthesis-related proteins and those not related to photosynthesis among the top 150 in the co-distribution tables was > 3:1, showing that the method is appropriate for finding partner proteins with common functions. The co-distribution of phytochromes with other histidine kinases was remarkably high, although most co-distributed histidine kinases were not direct BLAST homologs of the query protein. This finding implies that phytochromes and other histidine kinases share common functions as parts of signalling networks. All phytochromes tested, with one exception, also revealed a remarkably high co-distribution with glutamate synthase and methionine synthase. This result implies a general role of

  11. Comparison of force, power, and striking efficiency for a Kung Fu strike performed by novice and experienced practitioners: preliminary analysis.

    Science.gov (United States)

    Neto, Osmar Pinto; Magini, Marcio; Saba, Marcelo M F; Pacheco, Marcos Tadeu Tavares

    2008-02-01

    This paper presents a comparison of force, power, and efficiency values calculated from Kung Fu Yau-Man palm strikes, when performed by 7 experienced and 6 novice men. They performed 5 palm strikes to a freestanding basketball, recorded by high-speed camera at 1000 Hz. Nonparametric comparisons and correlations showed experienced practitioners presented larger values of mean muscle force, mean impact force, mean muscle power, mean impact power, and mean striking efficiency, as is noted in evidence obtained for other martial arts. Also, an interesting result was that for experienced Kung Fu practitioners, muscle power was linearly correlated with impact power (p = .98) but not for the novice practitioners (p = .46).

  12. How to Choose the Suitable Template for Homology Modelling of GPCRs: 5-HT7 Receptor as a Test Case.

    Science.gov (United States)

    Shahaf, Nir; Pappalardo, Matteo; Basile, Livia; Guccione, Salvatore; Rayan, Anwar

    2016-09-01

    G protein-coupled receptors (GPCRs) are a super-family of membrane proteins that attract great pharmaceutical interest due to their involvement in almost every physiological activity, including extracellular stimuli, neurotransmission, and hormone regulation. Currently, structural information on many GPCRs is mainly obtained by the techniques of computer modelling in general and by homology modelling in particular. Based on a quantitative analysis of eighteen antagonist-bound, resolved structures of rhodopsin family "A" receptors - also used as templates to build 153 homology models - it was concluded that a higher sequence identity between two receptors does not guarantee a lower RMSD between their structures, especially when their pair-wise sequence identity (within trans-membrane domain and/or in binding pocket) lies between 25 % and 40 %. This study suggests that we should consider all template receptors having a sequence identity ≤50 % with the query receptor. In fact, most of the GPCRs, compared to the currently available resolved structures of GPCRs, fall within this range and lack a correlation between structure and sequence. When testing suitability for structure-based drug design, it was found that choosing as a template the most similar resolved protein, based on sequence resemblance only, led to unsound results in many cases. Molecular docking analyses were carried out, and enrichment factors as well as attrition rates were utilized as criteria for assessing suitability for structure-based drug design. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Preventive strike vs. false targets and protection in defense strategy

    International Nuclear Information System (INIS)

    Levitin, Gregory; Hausken, Kjell

    2011-01-01

    A defender allocates its resource between defending an object passively and striking preventively against an attacker seeking to destroy the object. With no preventive strike the defender distributes its entire resource between deploying false targets, which the attacker cannot distinguish from the genuine object, and protecting the object. If the defender strikes preventively, the attacker's vulnerability depends on its protection and on the defender's resource allocated to the strike. If the attacker survives, the object's vulnerability depends on the attacker's revenge attack resource allocated to the attacked object. The optimal defense resource distribution between striking preventively, deploying the false targets and protecting the object is analyzed. Two cases of the attacker strategy are considered: when the attacker attacks all of the targets and when it chooses a number of targets to attack. An optimization model is presented for making a decision about the efficiency of the preventive strike based on the estimated attack probability, dependent on a variety of model parameters.

  14. [Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

    Science.gov (United States)

    Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

    2017-03-01

    Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

  15. WAVELET TRANSFORM ANALYSIS OF ELECTROMYOGRAPHY KUNG FU STRIKES DATA

    Directory of Open Access Journals (Sweden)

    Ana Carolina de Miranda Marzullo

    2009-11-01

    Full Text Available In martial arts and contact sports strikes are performed at near maximum speeds. For that reason, electromyography (EMG analysis of such movements is non-trivial. This paper has three main goals: firstly, to investigate the differences in the EMG activity of muscles during strikes performed with and without impacts; secondly, to assess the advantages of using Sum of Significant Power (SSP values instead of root mean square (rms values when analyzing EMG data; and lastly to introduce a new method of calculating median frequency values using wavelet transforms (WMDF. EMG data of the deltoid anterior (DA, triceps brachii (TB and brachioradialis (BR muscles were collected from eight Kung Fu practitioners during strikes performed with and without impacts. SSP results indicated significant higher muscle activity (p = 0.023 for the strikes with impact. WMDF results, on the other hand, indicated significant lower values (p = 0. 007 for the strikes with impact. SSP results presented higher sensitivity than rms to quantify important signal differences and, at the same time, presented lower inter-subject coefficient of variations. The result of increase in SSP values and decrease in WMDF may suggest better synchronization of motor units for the strikes with impact performed by the experienced Kung Fu practitioners

  16. Review of the Lightning Strike Incident at Launch Complex 37 on July 27, 1967, and Comparison to a Gemini Lightning Strike

    Science.gov (United States)

    Llewellyn, J. A.

    1967-01-01

    The Launch Complex 37 lightning strike of July 27, 1967, was reviewed and compared to a similar incident on the Gemini Program. Available data indicate little likelihood of damaging currents having been present in SA-204 Launch Vehicle or the ground equipment during the July 27th incident. Based on the results of subsystem and system testing after the strike, anticipated results of future testing, the six months elapsed time between the strike-and launch, and the fact that much of the critical airborne electrical/electronic equipment has been removed since the strike for other reasons, no new actions are considered necessary at this time in the Gemini case, significant failures occurred in both airborne and ground circuits. Due to the resultant semi, condlictor uncertainty, and the relatively' short time prior to planned launch, all critical airborne components containing semiconduetors were replaced, and a sophisticated data comparison task was implemented.

  17. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  18. Strike action by nurses in South Africa: A value clarification

    Directory of Open Access Journals (Sweden)

    Marie Muller

    2001-09-01

    Full Text Available The Labour Relations Act (South Africa, 1991 made provision for protected strike action by employees, subject to certain conditions, procedures and negotiated agreements. This led to the removal of the strike clause in the Nursing Act (South Africa, 1992. The labour rights of all citizens are entrenched in the Constitution of the country (South Africa, 1996. Participation in strike action by the nurse/ midwife, regardless of the legal requirements and specifications, does, however, pose an ethical question. It is therefore necessary to conduct a value clarification on strike action by nurses in South Africa. The purpose of this research is to explore and describe the perceived values of participants from an accessible population on this phenomenon. A qualitative, exploratory and descriptive research design was deployed. The perceived values of nurses on strike action were collected by means of an openended questionnaire/sketch. Over a period of three years a purposive and convenient sampling method was used, involving all the enrolled post basic nursing/midwifery students/ learners at a particular Nursing Education Institution. The justification of the sample was further enhanced by also collecting data on the participants’ age and provincial distribution location. Although a 63% sample realisation (of the accessible population was achieved, this represents only 1,5% of the registered nursing/midwifery population in the country. A descriptive analysis of the participants’ age and provincial distribution was undertaken, as well as a content analysis of their perceived values on strike action. The mean age of the participants was 48 years, which could be attributed to the fact that most of them were enrolled for a post-basic Diploma in Community Nursing Science. Most of the responses (52,7% were against strike action and 32,5% supported strike action by nurses as a constitutional and legal right. A fairly substantial number of participants (14

  19. The Highly Conserved Proline at Position 438 in Pseudorabies Virus gH Is Important for Regulation of Membrane Fusion

    OpenAIRE

    Schröter, Christina; Klupp, Barbara G.; Fuchs, Walter; Gerhard, Marika; Backovic, Marija; Rey, Felix A.; Mettenleiter, Thomas C.

    2014-01-01

    Membrane fusion in herpesviruses requires viral glycoproteins (g) gB and gH/gL. While gB is considered the actual fusion protein but is nonfusogenic per se, the function of gH/gL remains enigmatic. Crystal structures for different gH homologs are strikingly similar despite only moderate amino acid sequence conservation. A highly conserved sequence motif comprises the residues serine-proline-cysteine corresponding to positions 437 to 439 in pseudorabies virus (PrV) gH. The PrV-gH structure sho...

  20. The Teacher Strike: School District Protection Procedures. A Manual for School District Officials on How to Handle a Teachers' Strike.

    Science.gov (United States)

    Igoe, Joseph A.; DiRocco, Anthony P.

    This booklet is designed to give practical and realistic advice to school district officials faced with the possibility of a teachers' strike. It is intended for use both by school district administrators and school board members. The booklet is organized into four sections that focus in turn on signs of a pending teachers' strike, union…

  1. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  2. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    OpenAIRE

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-01

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to ...

  3. ‘The Nairobi General Strike [1950]: from protest to insurgency’

    OpenAIRE

    Hyde, David

    2002-01-01

    The Nairobi General Strike [1950] was the culmination of Kenya’s post war strike wave and urban upheaval. An unprecedented upsurge occurred with the general strikes in Mombasa [1947] led by the African Workers Federation [A.W.F.] and in Nairobi by the East African Trades Union Congress [E.A.T.U.C.]. While this has been termed and treated as a city wide strike, there is enough evidence to suggest a movement that went some way beyond Nairobi. The extent of the cohesion and reciprocal impacts am...

  4. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  5. PEST sequences in the malaria parasite Plasmodium falciparum: a genomic study

    Directory of Open Access Journals (Sweden)

    Bell Angus

    2003-06-01

    Full Text Available Abstract Background Inhibitors of the protease calpain are known to have selectively toxic effects on Plasmodium falciparum. The enzyme has a natural inhibitor calpastatin and in eukaryotes is responsible for turnover of proteins containing short sequences enriched in certain amino acids (PEST sequences. The genome of P. falciparum was searched for this protease, its natural inhibitor and putative substrates. Methods The publicly available P. falciparum genome was found to have too many errors to permit reliable analysis. An earlier annotation of chromosome 2 was instead examined. PEST scores were determined for all annotated proteins. The published genome was searched for calpain and calpastatin homologs. Results Typical PEST sequences were found in 13% of the proteins on chromosome 2, including a surprising number of cell-surface proteins. The annotated calpain gene has a non-biological "intron" that appears to have been created to avoid an unrecognized frameshift. Only the catalytic domain has significant similarity with the vertebrate calpains. No calpastatin homologs were found in the published annotation. Conclusion A calpain gene is present in the genome and many putative substrates of this enzyme have been found. Calpastatin homologs may be found once the re-annotation is completed. Given the selective toxicity of calpain inhibitors, this enzyme may be worth exploring further as a potential drug target.

  6. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  7. Children on hunger strike: child abuse or legitimate protest?

    OpenAIRE

    Mok, A.; Nelson, E. A.; Murphy, J.; Hampson, A.; Hendriks, J. H.

    1996-01-01

    The issue of children on hunger strike (voluntary total fasting) has not been reported before. The World Medical Association Declaration of Tokyo 1975 and the Declaration of Malta 1991 (revised 1992) provide clinicians with guidelines for the management of adult patients on hunger strike but do not mention children. We report the management of 14 Vietnamese children, aged 1 to 12 years, who took part in a hunger strike at a refugee detention centre in Hong Kong.

  8. Chromhome: a rich internet application for accessing comparative chromosome homology maps.

    Science.gov (United States)

    Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

    2008-03-26

    Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant

  9. Chromhome: A rich internet application for accessing comparative chromosome homology maps

    Directory of Open Access Journals (Sweden)

    Cox Tony

    2008-03-01

    Full Text Available Abstract Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to

  10. Expertise of using striking techniques for power stroke in badminton.

    Science.gov (United States)

    Zhu, Qin

    2013-10-01

    Two striking techniques (fast swing and angled striking) were examined to see if they allowed effective use of string tension for the power stroke in badminton. 12 participants (4 novices, 4 recreational, and 4 expert badminton players) were recorded by a fast-speed camera while striking a shuttlecock with racquets of 8 different string tensions. The peak speed of the shuttlecock, the racquet angle and the shuttlecock angle were analyzed. The results showed that expert players succeeded in using both striking techniques to overcome the constraint of string tension and produce a consistently superior stroke. Failure to use either striking technique resulted in inferior performance that was constrained by string tension. Expertise in badminton allows the necessary motor adjustments based on the affordance perception of the string tension.

  11. Fast and accurate taxonomic assignments of metagenomic sequences using MetaBin.

    Directory of Open Access Journals (Sweden)

    Vineet K Sharma

    Full Text Available Taxonomic assignment of sequence reads is a challenging task in metagenomic data analysis, for which the present methods mainly use either composition- or homology-based approaches. Though the homology-based methods are more sensitive and accurate, they suffer primarily due to the time needed to generate the Blast alignments. We developed the MetaBin program and web server for better homology-based taxonomic assignments using an ORF-based approach. By implementing Blat as the faster alignment method in place of Blastx, the analysis time has been reduced by severalfold. It is benchmarked using both simulated and real metagenomic datasets, and can be used for both single and paired-end sequence reads of varying lengths (≥45 bp. To our knowledge, MetaBin is the only available program that can be used for the taxonomic binning of short reads (<100 bp with high accuracy and high sensitivity using a homology-based approach. The MetaBin web server can be used to carry out the taxonomic analysis, by either submitting reads or Blastx output. It provides several options including construction of taxonomic trees, creation of a composition chart, functional analysis using COGs, and comparative analysis of multiple metagenomic datasets. MetaBin web server and a standalone version for high-throughput analysis are available freely at http://metabin.riken.jp/.

  12. Developing personal values: trainees' attitudes toward strikes by health care providers.

    Science.gov (United States)

    Li, Su-Ting T; Srinivasan, Malathi; Der-Martirosian, Claudia; Kravitz, Richard L; Wilkes, Michael S

    2011-05-01

    Worldwide, health care providers use strikes and job actions to influence policy. For health care providers, especially physicians, strikes create an ethical tension between an obligation to care for current patients (e.g., to provide care and avoid abandonment) and an obligation to better care for future patients by seeking system improvements (e.g., improvements in safety, to access, and in the composition and strength of the health care workforce). This tension is further intensified when the potential benefit of a strike involves professional self-interest and the potential risk involves patient harm or death. By definition, trainees are still forming their professional identities and values, including their opinions on fair wages, health policy, employee benefits, professionalism, and strikes. In this article, the authors explore these ethical tensions, beginning with a discussion of reactions to a potential 2005 nursing strike at the University of California, Davis, Medical Center. The authors then propose a conceptual model describing factors that may influence health care providers' decisions to strike (including personal ethics, personal agency, and strike-related context). In particular, the authors explore the relationship between training level and attitudes toward taking a job action, such as going on strike. Because trainees' attitudes toward strikes continue to evolve during training, the authors maintain that open discussion around the ethics of health care professionals' strikes and other methods of conflict resolution should be included in medical education to enhance professionalism and systems-based practice training. The authors include sample case vignettes to help initiate these important discussions. Copyright © by the Association of American medical Colleges.

  13. Effect of public transport strikes on air pollution levels in Barcelona (Spain).

    Science.gov (United States)

    Basagaña, Xavier; Triguero-Mas, Margarita; Agis, David; Pérez, Noemí; Reche, Cristina; Alastuey, Andrés; Querol, Xavier

    2018-01-01

    Public transport strikes can lead to an increase of the number of private vehicle trips, which in turn can increase air pollution levels. We aimed to estimate the change in air pollution concentrations during public transport strikes in the city of Barcelona (Spain). Data on strikes of the metro, train or bus systems were collected from government records (2005-2016). We collected daily concentrations of NOx; particulate matter with an aerodynamic diameter smaller than 10μm (PM10), 2.5μm (PM2.5), and 1μm (PM1); particle number concentration (N); black carbon (BC) and CO from research and official monitoring stations. We fitted linear regression models for each pollutant with the strike indicator as an independent variable, and models were adjusted for day of the week, month, year, and holiday periods. During the study period, there were 208days affected by a strike of the metro (28), train (106) or bus (91) systems. Half of the strikes were partial, most of them were single-day strikes, there was little overlap between strikes of the different transport systems, and all strikes had to comply with mandatory minimal services. When pooling all types of strikes, NOx and BC showed higher levels during strike days in comparison with non-strike days (increase between 4.1% and 7.7%, with higher increases for NO). The increases in these concentrations were more evident during full day and multiday metro strikes. In conclusion, alterations in public transport have consequences on air quality. This highlights the importance of public transport in reducing air pollution concentrations in cities. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. On (co)homology of Frobenius Poisson algebras

    OpenAIRE

    Zhu, Can; Van Oystaeyen, Fred; ZHANG, Yinhuo

    2014-01-01

    In this paper, we study Poisson (co)homology of a Frobenius Poisson algebra. More precisely, we show that there exists a duality between Poisson homology and Poisson cohomology of Frobenius Poisson algebras, similar to that between Hochschild homology and Hochschild cohomology of Frobenius algebras. Then we use the non-degenerate bilinear form on a unimodular Frobenius Poisson algebra to construct a Batalin-Vilkovisky structure on the Poisson cohomology ring making it into a Batalin-Vilkovisk...

  15. N-terminal sequence of human leukocyte glycoprotein Mo1: conservation across species and homology to platelet IIb/IIIa.

    Science.gov (United States)

    Pierce, M W; Remold-O'Donnell, E; Todd, R F; Arnaout, M A

    1986-12-12

    Mo1 and gp160-gp93 are two surface membrane glycoprotein heterodimers present on granulocytes and monocytes derived from humans and guinea pigs, respectively. We purified both antigens and found that their alpha subunits had identical N-termini which were significantly homologous to the alpha subunit of the human adhesion platelet glycoprotein IIb/IIIa.

  16. Impact of lightning strikes on hospital functions.

    Science.gov (United States)

    Mortelmans, Luc J M; Van Springel, Gert L J; Van Boxstael, Sam; Herrijgers, Jan; Hoflacks, Stefaan

    2009-01-01

    Two regional hospitals were struck by lightning during a one-month period. The first hospital, which had 236 beds, suffered a direct strike to the building. This resulted in a direct spread of the power peak and temporary failure of the standard power supply. The principle problems, after restoring standard power supply, were with the fire alarm system and peripheral network connections in the digital radiology systems. No direct impact on the hardware could be found. Restarting the servers resolved all problems. The second hospital, which had 436 beds, had a lightning strike on the premises and mainly experienced problems due to induction. All affected installations had a cable connection from outside in one way or another. The power supplies never were endangered. The main problem was the failure of different communication systems (telephone, radio, intercom, fire alarm system). Also, the electronic entrance control went out. During the days after the lightening strike, multiple software problems became apparent, as well as failures of the network connections controlling the technical support systems. There are very few ways to prepare for induction problems. The use of fiber-optic networks can limit damage. To the knowledge of the authors, these are the first cases of lightning striking hospitals in medical literature.

  17. MRI findings of Wernicke encephalopathy revisited due to hunger strike

    Energy Technology Data Exchange (ETDEWEB)

    Unlu, Ercument [Department of Radiology, Trakya University School of Medicine, Mimar Sinan m, Muammer Aksoy c, Yorulmaz apt, No 50, D-1 22030 Edirne (Turkey)]. E-mail: drercument@yahoo.com; Cakir, Bilge [Department of Radiology, Trakya University School of Medicine, Mimar Sinan m, Muammer Aksoy c, Yorulmaz apt, No 50, D-1 22030 Edirne (Turkey); Asil, Talip [Department of Neurology, Trakya University School of Medicine, Edirne (Turkey)

    2006-01-15

    Background and Purpose: The purpose of this study was to determine the characteristic magnetic resonance imaging (MRI) findings among a group of patients who presented with Wernicke encephalopathy (WE) due to the neurological complications of a long-term hunger strike (HS). Methods: MRI studies also including the fluid-attenuated inversion recovery (FLAIR) sequence and diffusion-weighted imaging (DWI) of six male patients with WE aged from 25 to 38 years (mean age 31 years) were evaluated. Results: In all subjects, T2-weighted sequences, FLAIR and DWI revealed a signal hyperintensity within the posteromedial thalami and surrounding the third ventricle. In particular, on coronal images, the hyperintense areas around the third ventricle showed a suggestive 'double wing' configuration. We observed an increased signal on proton-density and T2-weighted images in the mamillary bodies of three patients. Four patients demonstrated additional hyperintensities within the periaqueductal region and/or the tectal plate. At least one lesion area in five of six patients demonstrated contrast enhancement. Conclusion: The consistent imaging findings of our study suggest that MRI is a reliable means of diagnosing WE. Acute WE is sometimes underdiagnosed, yet early diagnosis and treatment of WE is crucial in order to avoid persistent brain damage. MRI, including postcontrast T1-weighted imaging, DWI beneath standardized T2-weighted imaging, and FLAIR sequences may prove to be a valuable adjunct to clinical diagnosis and to provide additional information in acute and/or subacute WE.

  18. MRI findings of Wernicke encephalopathy revisited due to hunger strike

    International Nuclear Information System (INIS)

    Unlu, Ercument; Cakir, Bilge; Asil, Talip

    2006-01-01

    Background and Purpose: The purpose of this study was to determine the characteristic magnetic resonance imaging (MRI) findings among a group of patients who presented with Wernicke encephalopathy (WE) due to the neurological complications of a long-term hunger strike (HS). Methods: MRI studies also including the fluid-attenuated inversion recovery (FLAIR) sequence and diffusion-weighted imaging (DWI) of six male patients with WE aged from 25 to 38 years (mean age 31 years) were evaluated. Results: In all subjects, T2-weighted sequences, FLAIR and DWI revealed a signal hyperintensity within the posteromedial thalami and surrounding the third ventricle. In particular, on coronal images, the hyperintense areas around the third ventricle showed a suggestive 'double wing' configuration. We observed an increased signal on proton-density and T2-weighted images in the mamillary bodies of three patients. Four patients demonstrated additional hyperintensities within the periaqueductal region and/or the tectal plate. At least one lesion area in five of six patients demonstrated contrast enhancement. Conclusion: The consistent imaging findings of our study suggest that MRI is a reliable means of diagnosing WE. Acute WE is sometimes underdiagnosed, yet early diagnosis and treatment of WE is crucial in order to avoid persistent brain damage. MRI, including postcontrast T1-weighted imaging, DWI beneath standardized T2-weighted imaging, and FLAIR sequences may prove to be a valuable adjunct to clinical diagnosis and to provide additional information in acute and/or subacute WE

  19. Compilation and analysis of Escherichia coli promoter DNA sequences.

    OpenAIRE

    Hawley, D K; McClure, W R

    1983-01-01

    The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. The complete listing was divided into two groups depending upon whether or not the promoter had been defined by genetic (promoter mutations) or biochemical (5' end determination) criteria. A consensus promoter sequence based on homologies among 112 well-defined promoters was determined that was in substantial agreement with previous compilations. In addition, we have tabulated 98 promoter ...

  20. The Coding and Effector Transfer of Movement Sequences

    Science.gov (United States)

    Kovacs, Attila J.; Muhlbauer, Thomas; Shea, Charles H.

    2009-01-01

    Three experiments utilizing a 14-element arm movement sequence were designed to determine if reinstating the visual-spatial coordinates, which require movements to the same spatial locations utilized during acquisition, results in better effector transfer than reinstating the motor coordinates, which require the same pattern of homologous muscle…

  1. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

    KAUST Repository

    Huang, Chao-Li; Pu, Pei-Hua; Huang, Hao-Jen; Sung, Huang-Mo; Liaw, Hung-Jiun; Chen, Yi-Min; Chen, Chien-Ming; Huang, Ming-Ban; Osada, Naoki; Gojobori, Takashi; Pai, Tun-Wen; Chen, Yu-Tin; Hwang, Chi-Chuan; Chiang, Tzen-Yuh

    2015-01-01

    Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

  2. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

    KAUST Repository

    Huang, Chao-Li

    2015-03-15

    Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

  3. [Force-feeding of hunger-striking prisoners].

    Science.gov (United States)

    Glick, Shimon

    2014-09-01

    In contrast to the position of the World Medical Association and the Ethics Council of the Israel Medical Association, the author argues for forced-feeding of hunger-striking prisoners when their condition reaches a stage of danger of death or permanent injury. This position is based on the priority of human life over autonomy, and of a communitarian ethic. This position is supported by a District Court decision ordering the feeding of a hunger-striking prisoner, by a Supreme Court decision imposing surgery on a non-consenting prisoner, and in line with Israel's Patient's Right Law.

  4. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    Energy Technology Data Exchange (ETDEWEB)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

  5. Human papilloma viruses and cervical tumours: mapping of integration sites and analysis of adjacent cellular sequences

    International Nuclear Information System (INIS)

    Klimov, Eugene; Vinokourova, Svetlana; Moisjak, Elena; Rakhmanaliev, Elian; Kobseva, Vera; Laimins, Laimonis; Kisseljov, Fjodor; Sulimova, Galina

    2002-01-01

    In cervical tumours the integration of human papilloma viruses (HPV) transcripts often results in the generation of transcripts that consist of hybrids of viral and cellular sequences. Mapping data using a variety of techniques has demonstrated that HPV integration occurred without obvious specificity into human genome. However, these techniques could not demonstrate whether integration resulted in the generation of transcripts encoding viral or viral-cellular sequences. The aim of this work was to map the integration sites of HPV DNA and to analyse the adjacent cellular sequences. Amplification of the INTs was done by the APOT technique. The APOT products were sequenced according to standard protocols. The analysis of the sequences was performed using BLASTN program and public databases. To localise the INTs PCR-based screening of GeneBridge4-RH-panel was used. Twelve cellular sequences adjacent to integrated HPV16 (INT markers) expressed in squamous cell cervical carcinomas were isolated. For 11 INT markers homologous human genomic sequences were readily identified and 9 of these showed significant homologies to known genes/ESTs. Using the known locations of homologous cDNAs and the RH-mapping techniques, mapping studies showed that the INTs are distributed among different human chromosomes for each tumour sample and are located in regions with the high levels of expression. Integration of HPV genomes occurs into the different human chromosomes but into regions that contain highly transcribed genes. One interpretation of these studies is that integration of HPV occurs into decondensed regions, which are more accessible for integration of foreign DNA

  6. FASTERp: A Feature Array Search Tool for Estimating Resemblance of Protein Sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macklin, Derek; Egan, Rob; Wang, Zhong

    2014-03-14

    Metagenome sequencing efforts have provided a large pool of billions of genes for identifying enzymes with desirable biochemical traits. However, homology search with billions of genes in a rapidly growing database has become increasingly computationally impractical. Here we present our pilot efforts to develop a novel alignment-free algorithm for homology search. Specifically, we represent individual proteins as feature vectors that denote the presence or absence of short kmers in the protein sequence. Similarity between feature vectors is then computed using the Tanimoto score, a distance metric that can be rapidly computed on bit string representations of feature vectors. Preliminary results indicate good correlation with optimal alignment algorithms (Spearman r of 0.87, ~;;1,000,000 proteins from Pfam), as well as with heuristic algorithms such as BLAST (Spearman r of 0.86, ~;;1,000,000 proteins). Furthermore, a prototype of FASTERp implemented in Python runs approximately four times faster than BLAST on a small scale dataset (~;;1000 proteins). We are optimizing and scaling to improve FASTERp to enable rapid homology searches against billion-protein databases, thereby enabling more comprehensive gene annotation efforts.

  7. Strike kinematics and performance in juvenile ball pythons (Python regius).

    Science.gov (United States)

    Ryerson, William G; Tan, Weimin

    2017-08-01

    The rapid strike of snakes has interested researchers for decades. Although most work has focused on the strike performance of vipers, recent work has shown that other snakes outside of the Viperidae can strike with the same velocities and accelerations. However, to date all of these examples focus on performance in adult snakes. Here, we use high-speed video to measure the strike kinematics and performance of 10 juvenile (pythons, Python regius. We find that juvenile P. regius strike at levels comparable to larger snakes, but with shorter durations and over shorter distances. We conclude that the juvenile P. regius maintain performance likely through manipulation of the axial musculature and accompanying elastic tissues, and that this is a first step to understanding ontogenetic changes in behavior and a potential avenue for understanding how captivity may also impact behavior. © 2017 Wiley Periodicals, Inc.

  8. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    OpenAIRE

    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier

    2005-01-01

    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  9. effect of strikes on management and planning of educational ...

    African Journals Online (AJOL)

    Global Journal

    Strike is an event that consumes and waste a lot of time which implies that ... from this paper. KEYWORDS: Strikes, Management, Planning, Educational, Activities, Universities ..... employers; and Introduction of new technology which affect the ...

  10. Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

    Science.gov (United States)

    Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

    2012-09-01

    FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. When strike comes to town... anticipated and actual behavioural reactions to a one-day, pre-announced, complete rail strike in the Netherlands

    NARCIS (Netherlands)

    Rietveld, P.; Exel, N.J.A.

    2009-01-01

    We conducted secondary analysis on data collected among rail users, days before and after a national rail strike in the Netherlands. Our aim was to compare anticipated and actual behavioural reactions to the rail strike, investigate associations with traveller and trip characteristics, and perceived

  12. Continental United States Hurricane Strikes

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Continental U.S. Hurricane Strikes Poster is our most popular poster which is updated annually. The poster includes all hurricanes that affected the U.S. since...

  13. Rapid Acquisition of Linezolid Resistance in Methicillin-Resistant Staphylococcus aureus: Role of Hypermutation and Homologous Recombination.

    Science.gov (United States)

    Iguchi, Shigekazu; Mizutani, Tomonori; Hiramatsu, Keiichi; Kikuchi, Ken

    2016-01-01

    We previously reported the case of a 64-year-old man with mediastinitis caused by Staphylococcus aureus in which the infecting bacterium acquired linezolid resistance after only 14 days treatment with linezolid. We therefore investigated relevant clinical isolates for possible mechanisms of this rapid acquisition of linezolid resistance. Using clinical S. aureus isolates, we assessed the in vitro mutation rate and performed stepwise selection for linezolid resistance. To investigate homologous recombination, sequences were determined for each of the 23S ribosomal RNA (23S rRNA) loci; analyzed sequences spanned the entirety of each 23S rRNA gene, including domain V, as well as the 16S-23S intergenic spacer regions. We additionally performed next-generation sequencing on clinical strains to identify single-nucleotide polymorphisms compared to the N315 genome. Strains isolated from the patient prior to linezolid exposure (M5-M7) showed higher-level linezolid resistance than N315, and the pre-exposure strain (M2) exhibited more rapid acquisition of linezolid resistance than did N315. However, the mutation rates of these and contemporaneous clinical isolates were similar to those of N315, and the isolates did not exhibit any mutations in hypermutation-related genes. Sequences of the 23S rRNA genes and 16S-23S intergenic spacer regions were identical among the pre- and post-exposure clinical strains. Notably, all of the pre-exposure isolates harbored a recQ missense mutation (Glu69Asp) with respect to N315; such a lesion may have affected short sequence recombination (facilitating, for example, recombination among rrn loci). We hypothesize that this mechanism contributed to rapid acquisition of linezolid resistance. Hypermutation and homologous recombination of the ribosomal RNA genes, including 23S rRNA genes, appear not to have been sources of the accelerated acquisition of linezolid resistance observed in our clinical case. Increased frequency of short sequence

  14. Accurate protein structure modeling using sparse NMR data and homologous structure information.

    Science.gov (United States)

    Thompson, James M; Sgourakis, Nikolaos G; Liu, Gaohua; Rossi, Paolo; Tang, Yuefeng; Mills, Jeffrey L; Szyperski, Thomas; Montelione, Gaetano T; Baker, David

    2012-06-19

    While information from homologous structures plays a central role in X-ray structure determination by molecular replacement, such information is rarely used in NMR structure determination because it can be incorrect, both locally and globally, when evolutionary relationships are inferred incorrectly or there has been considerable evolutionary structural divergence. Here we describe a method that allows robust modeling of protein structures of up to 225 residues by combining (1)H(N), (13)C, and (15)N backbone and (13)Cβ chemical shift data, distance restraints derived from homologous structures, and a physically realistic all-atom energy function. Accurate models are distinguished from inaccurate models generated using incorrect sequence alignments by requiring that (i) the all-atom energies of models generated using the restraints are lower than models generated in unrestrained calculations and (ii) the low-energy structures converge to within 2.0 Å backbone rmsd over 75% of the protein. Benchmark calculations on known structures and blind targets show that the method can accurately model protein structures, even with very remote homology information, to a backbone rmsd of 1.2-1.9 Å relative to the conventional determined NMR ensembles and of 0.9-1.6 Å relative to X-ray structures for well-defined regions of the protein structures. This approach facilitates the accurate modeling of protein structures using backbone chemical shift data without need for side-chain resonance assignments and extensive analysis of NOESY cross-peak assignments.

  15. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  16. Role of N-S strike-slip faulting in structuring of north-eastern Tunisia; geodynamic implications

    Science.gov (United States)

    Arfaoui, Aymen; Soumaya, Abdelkader; Ben Ayed, Noureddine; Delvaux, Damien; Ghanmi, Mohamed; Kadri, Ali; Zargouni, Fouad

    2017-05-01

    Three major compressional events characterized by folding, thrusting and strike-slip faulting occurred in the Eocene, Late Miocene and Quaternary along the NE Tunisian domain between Bou Kornine-Ressas-Msella and Cap Bon Peninsula. During the Plio-Quaternary, the Grombalia and Mornag grabens show a maximum of collapse in parallelism with the NNW-SSE SHmax direction and developed as 3rd order distensives zones within a global compressional regime. Using existing tectonic and geophysical data supplemented by new fault-kinematic observations, we show that Cenozoic deformation of the Mesozoic sedimentary sequences is dominated by first order N-S faults reactivation, this sinistral wrench system is responsible for the formation of strike-slip duplexes, thrusts, folds and grabens. Following our new structural interpretation, the major faults of N-S Axis, Bou Kornine-Ressas-Messella (MRB) and Hammamet-Korbous (HK) form an N-S first order compressive relay within a left lateral strike-slip duplex. The N-S master MRB fault is dominated by contractional imbricate fans, while the parallel HK fault is characterized by a trailing of extensional imbricate fans. The Eocene and Miocene compression phases in the study area caused sinistral strike-slip reactivation of pre-existing N-S faults, reverse reactivation of NE-SW trending faults and normal-oblique reactivation of NW-SE faults, creating a NE-SW to N-S trending system of east-verging folds and overlaps. Existing seismic tomography images suggest a key role for the lithospheric subvertical tear or STEP fault (Slab Transfer Edge Propagator) evidenced below this region on the development of the MRB and the HK relay zone. The presence of extensive syntectonic Pliocene on top of this crustal scale fault may be the result of a recent lithospheric vertical kinematic of this STEP fault, due to the rollback and lateral migration of the Calabrian slab eastward.

  17. Salmon louse (Lepeophtheirus salmonis transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis

    Directory of Open Access Journals (Sweden)

    Jonassen Inge

    2008-03-01

    Full Text Available Abstract Background Lepeophtheirus salmonis is an ectoparasitic copepod feeding on skin, mucus and blood from salmonid hosts. Initial analysis of EST sequences from pre adult and adult stages of L. salmonis revealed a large proportion of novel transcripts. In order to link unknown transcripts to biological functions we have combined EST sequencing and microarray analysis to characterize female salmon louse transcriptomes during post molting maturation and egg production. Results EST sequence analysis shows that 43% of the ESTs have no significant hits in GenBank. Sequenced ESTs assembled into 556 contigs and 1614 singletons and whenever homologous genes were identified no clear correlation with homologous genes from any specific animal group was evident. Sequence comparison of 27 L. salmonis proteins with homologous proteins in humans, zebrafish, insects and crustaceans revealed an almost identical sequence identity with all species. Microarray analysis of maturing female adult salmon lice revealed two major transcription patterns; up-regulation during the final molting followed by down regulation and female specific up regulation during post molting growth and egg production. For a third minor group of ESTs transcription decreased during molting from pre-adult II to immature adults. Genes regulated during molting typically gave hits with cuticula proteins whilst transcripts up regulated during post molting growth were female specific, including two vitellogenins. Conclusion The copepod L.salmonis contains high a level of novel genes. Among analyzed L.salmonis proteins, sequence identities with homologous proteins in crustaceans are no higher than to homologous proteins in humans. Three distinct processes, molting, post molting growth and egg production correlate with transcriptional regulation of three groups of transcripts; two including genes related to growth, one including genes related to egg production. The function of the regulated

  18. Extracellular Disulfide Bridges Serve Different Purposes in Two Homologous Chemokine Receptors, CCR1 and CCR5

    DEFF Research Database (Denmark)

    Rummel, Pia Cwarzko; Thiele, Stefanie; Hansen, Laerke Smidt

    2013-01-01

    interact with residues in the main binding crevice, we show that the 7TM-conserved bridge is essential for all types of ligand-mediated activation, whereas the chemokine-conserved bridge is dispensable for small-molecule activation in CCR1. However, in striking contrast to previous studies in other...... chemokine receptors, high affinity CCL3 chemokine binding was maintained in the absence of either bridge. In CCR5, the closest homolog to CCR1, a completely different dependency was observed as neither chemokine activation nor binding was retained in the absence of either bridge. In contrast, both bridges...... where dispensable for small-molecule activation. This indicates that CCR5 activity is independent of extracellular regions, whereas in CCR1, preserved folding of ECL2 is necessary for activation. These results indicate that conserved structural features in a receptor subgroup, does not necessarily...

  19. Miners' strike 1984-85

    Energy Technology Data Exchange (ETDEWEB)

    Brown, L; Salter, S [comps.

    1985-01-01

    References relating to the 1984-85 UK miners strike are listed under the following subject headings: events and analysis - a chronological record; short term effects - coal stocks and supplies, electricity supplies, financial, industrial and economic; the miners and their leadership; social aspects - civil liberties, media coverage, mining communities, picketing, policing, the future; pit closures. 240 references.

  20. A local homology theory for linearly compact modules

    International Nuclear Information System (INIS)

    Nguyen Tu Cuong; Tran Tuan Nam

    2004-11-01

    We introduce a local homology theory for linearly modules which is in some sense dual to the local cohomology theory of A. Grothendieck. Some basic properties of local homology modules are shown such as: the vanishing and non-vanishing, the noetherianness of local homology modules. By using duality, we extend some well-known results in theory of local cohomology of A. Grothendieck. (author)

  1. Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions.

    Science.gov (United States)

    Zhou, Hufeng; Gao, Shangzhi; Nguyen, Nam Ninh; Fan, Mengyuan; Jin, Jingjing; Liu, Bing; Zhao, Liang; Xiong, Geng; Tan, Min; Li, Shijun; Wong, Limsoon

    2014-04-08

    H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both

  2. Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

    Directory of Open Access Journals (Sweden)

    Holly J Atkinson

    Full Text Available The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

  3. Using sequence similarity networks for visualization of relationships across diverse protein superfamilies.

    Science.gov (United States)

    Atkinson, Holly J; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C

    2009-01-01

    The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.

  4. Accident scenarios triggered by lightning strike on atmospheric storage tanks

    International Nuclear Information System (INIS)

    Necci, Amos; Argenti, Francesca; Landucci, Gabriele; Cozzani, Valerio

    2014-01-01

    Severe Natech accidents may be triggered by lightning strike affecting storage tanks containing relevant inventories of hazardous materials. The present study focused on the identification of event sequences and accident scenarios following lightning impact on atmospheric tanks. Reference event trees, validated using past accident analysis, are provided to describe the specific accident chains identified, accounting for reference protection and mitigation safety barriers usually adopted in current industrial practice. An overall methodology was outlined to allow the calculation of the expected frequencies of final scenarios following lightning impact on atmospheric storage tanks, taking into account the expected performance of available safety barriers. The methodology was applied to a case study in order to better understand the data that may be obtained and their importance in the framework of quantitative risk assessment (QRA) and of the risk management of industrial facilities with respect to external hazards due to natural events. - Highlights: • Event sequences following lightning impact on atmospheric tanks were identified. • Reference event trees including standard safety barriers were obtained. • Safety barriers applied in industrial practice were assessed to quantify event trees. • Frequencies of final scenarios following lightning impact on tanks were calculated. • Natech scenarios caused by lightning have an important influence on risk profiles

  5. Origin and structure of major orogen-scale exhumed strike-slip

    Science.gov (United States)

    Cao, Shuyun; Neubauer, Franz

    2016-04-01

    The formation of major exhumed strike-slip faults represents one of the most important dynamic processes affecting the evolution of the Earth's lithosphere and surface. Detailed models of the potential initiation and properties and architecture of orogen-scale exhumed strike-slip faults and how these relate to exhumation are rare. In this study, we deal with key properties controlling the development of major exhumed strike-slip fault systems, which are equivalent to the deep crustal sections of active across fault zones. We also propose two dominant processes for the initiation of orogen-scale exhumed strike-slip faults: (1) pluton-controlled and (2) metamorphic core complex-controlled strike-slip faults. In these tectonic settings, the initiation of faults occurs by rheological weakening along hot-to-cool contacts and guides the overall displacement and ultimate exhumation. These processes result in a specific thermal and structural architecture of such faults. These types of strike-slip dominated fault zones are often subparallel to mountain ranges and expose a wide variety of mylonitic, cataclastic and non-cohesive fault rocks, which were formed at different structural levels of the crust during various stages of faulting. The high variety of distinctive fault rocks is a potential evidence for recognition of these types of strike-slip faults. Exhumation of mylonitic rocks is, therefore, a common feature of such reverse oblique-slip strike-slip faults, implying major transtensive and/or transpressive processes accompanying pure strike-slip motion during exhumation. Some orogen-scale strike-slip faults nucleate and initiate along rheologically weak zones, e.g. at granite intrusions, zones of low-strength minerals, thermally weakened crust due to ascending fluids, and lateral borders of hot metamorphic core complexes. A further mechanism is the juxtaposition of mechanically strong mantle lithosphere to hot asthenosphere in continental transform faults (e.g., San

  6. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    Science.gov (United States)

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  7. The concept of homology as a basis for evaluating developmental mechanisms: exploring selective attention across the life-span.

    Science.gov (United States)

    Lickliter, Robert; Bahrick, Lorraine E

    2013-01-01

    Research with human infants as well as non-human animal embryos and infants has consistently demonstrated the benefits of intersensory redundancy for perceptual learning and memory for redundantly specified information during early development. Studies of infant affect discrimination, face discrimination, numerical discrimination, sequence detection, abstract rule learning, and word comprehension and segmentation have all shown that intersensory redundancy promotes earlier detection of these properties when compared to unimodal exposure to the same properties. Here we explore the idea that such intersensory facilitation is evident across the life-span and that this continuity is an example of a developmental behavioral homology. We present evidence that intersensory facilitation is most apparent during early phases of learning for a variety of tasks, regardless of developmental level, including domains that are novel or tasks that require discrimination of fine detail or speeded responses. Under these conditions, infants, children, and adults all show intersensory facilitation, suggesting a developmental homology. We discuss the challenge and propose strategies for establishing appropriate guidelines for identifying developmental behavioral homologies. We conclude that evaluating the extent to which continuities observed across development are homologous can contribute to a better understanding of the processes of development. Copyright © 2012 Wiley Periodicals, Inc.

  8. Functional Coverage of the Human Genome by Existing Structures, Structural Genomics Targets, and Homology Models.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available The bias in protein structure and function space resulting from experimental limitations and targeting of particular functional classes of proteins by structural biologists has long been recognized, but never continuously quantified. Using the Enzyme Commission and the Gene Ontology classifications as a reference frame, and integrating structure data from the Protein Data Bank (PDB, target sequences from the structural genomics projects, structure homology derived from the SUPERFAMILY database, and genome annotations from Ensembl and NCBI, we provide a quantified view, both at the domain and whole-protein levels, of the current and projected coverage of protein structure and function space relative to the human genome. Protein structures currently provide at least one domain that covers 37% of the functional classes identified in the genome; whole structure coverage exists for 25% of the genome. If all the structural genomics targets were solved (twice the current number of structures in the PDB, it is estimated that structures of one domain would cover 69% of the functional classes identified and complete structure coverage would be 44%. Homology models from existing experimental structures extend the 37% coverage to 56% of the genome as single domains and 25% to 31% for complete structures. Coverage from homology models is not evenly distributed by protein family, reflecting differing degrees of sequence and structure divergence within families. While these data provide coverage, conversely, they also systematically highlight functional classes of proteins for which structures should be determined. Current key functional families without structure representation are highlighted here; updated information on the "most wanted list" that should be solved is available on a weekly basis from http://function.rcsb.org:8080/pdb/function_distribution/index.html.

  9. Protein sequence comparison and protein evolution

    Energy Technology Data Exchange (ETDEWEB)

    Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry

    1995-12-31

    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  10. Variation in foot strike patterns during running among habitually barefoot populations.

    Science.gov (United States)

    Hatala, Kevin G; Dingwall, Heather L; Wunderlich, Roshna E; Richmond, Brian G

    2013-01-01

    Endurance running may have a long evolutionary history in the hominin clade but it was not until very recently that humans ran wearing shoes. Research on modern habitually unshod runners has suggested that they utilize a different biomechanical strategy than runners who wear shoes, namely that barefoot runners typically use a forefoot strike in order to avoid generating the high impact forces that would be experienced if they were to strike the ground with their heels first. This finding suggests that our habitually unshod ancestors may have run in a similar way. However, this research was conducted on a single population and we know little about variation in running form among habitually barefoot people, including the effects of running speed, which has been shown to affect strike patterns in shod runners. Here, we present the results of our investigation into the selection of running foot strike patterns among another modern habitually unshod group, the Daasanach of northern Kenya. Data were collected from 38 consenting adults as they ran along a trackway with a plantar pressure pad placed midway along its length. Subjects ran at self-selected endurance running and sprinting speeds. Our data support the hypothesis that a forefoot strike reduces the magnitude of impact loading, but the majority of subjects instead used a rearfoot strike at endurance running speeds. Their percentages of midfoot and forefoot strikes increased significantly with speed. These results indicate that not all habitually barefoot people prefer running with a forefoot strike, and suggest that other factors such as running speed, training level, substrate mechanical properties, running distance, and running frequency, influence the selection of foot strike patterns.

  11. Variation in foot strike patterns during running among habitually barefoot populations.

    Directory of Open Access Journals (Sweden)

    Kevin G Hatala

    Full Text Available Endurance running may have a long evolutionary history in the hominin clade but it was not until very recently that humans ran wearing shoes. Research on modern habitually unshod runners has suggested that they utilize a different biomechanical strategy than runners who wear shoes, namely that barefoot runners typically use a forefoot strike in order to avoid generating the high impact forces that would be experienced if they were to strike the ground with their heels first. This finding suggests that our habitually unshod ancestors may have run in a similar way. However, this research was conducted on a single population and we know little about variation in running form among habitually barefoot people, including the effects of running speed, which has been shown to affect strike patterns in shod runners. Here, we present the results of our investigation into the selection of running foot strike patterns among another modern habitually unshod group, the Daasanach of northern Kenya. Data were collected from 38 consenting adults as they ran along a trackway with a plantar pressure pad placed midway along its length. Subjects ran at self-selected endurance running and sprinting speeds. Our data support the hypothesis that a forefoot strike reduces the magnitude of impact loading, but the majority of subjects instead used a rearfoot strike at endurance running speeds. Their percentages of midfoot and forefoot strikes increased significantly with speed. These results indicate that not all habitually barefoot people prefer running with a forefoot strike, and suggest that other factors such as running speed, training level, substrate mechanical properties, running distance, and running frequency, influence the selection of foot strike patterns.

  12. Along strike variation of active fault arrays and their effect on landscape morphology of the northwestern Himalaya

    Science.gov (United States)

    Nennewitz, Markus; Thiede, Rasmus; Bookhagen, Bodo

    2017-04-01

    location of along strike changes which are interpreted as their segment boundaries. In addition to the steepness indices we use the accumulation of elevation data as a proxy for the strain that has been accumulated over a specific distance. Thus, despite the changes in topography, structural setting, and kinematics along the NW Himalaya we observe that the topography of the orogen is in good agreement with recently measured convergence rates obtained from GPS campaigns. These data suggest reduced crustal shortening towards the northwest. Deformation in the Central Himalaya has been explained either by in-sequence thrusting along the MFT that localize the entire Holocene shortening or a combination of this with out-of-sequence thrusting in the vicinity of the PT2. In contrast to these conceptual models, we propose that the segmented NW Himalaya is a product of the synchronous activity of different fault segments, accommodating the crustal shortening along three independently deforming organic segments. The lateral discontinuity of these segments is responsible for the accommodation of the variation in the deformation and the maintenance of the topography of the Himalaya in NW India.

  13. Algab õppus "Saber Strike"

    Index Scriptorium Estoniae

    2014-01-01

    Täna algab Eestis, Lätis ja Leedus Ameerika Ühendriikide Euroopa väekoondise õppus "Saber Strike", mille eesmärk on maaväeüksuste koostöö harjutamine. Õppusest võtab osa üle 2000 kaitseväelase Baltimaadest, USAst, Ühendkuningriigist, Taanist, Norrast, Soomest ja Saksamaalt. Eestist osaleb õppusel ligi 400 kaitseväelast

  14. Central hyperadrenergic state after lightning strike.

    Science.gov (United States)

    Parsaik, Ajay K; Ahlskog, J Eric; Singer, Wolfgang; Gelfman, Russell; Sheldon, Seth H; Seime, Richard J; Craft, Jennifer M; Staab, Jeffrey P; Kantor, Birgit; Low, Phillip A

    2013-08-01

    To describe and review autonomic complications of lightning strike. Case report and laboratory data including autonomic function tests in a subject who was struck by lightning. A 24-year-old man was struck by lightning. Following that, he developed dysautonomia, with persistent inappropriate sinus tachycardia and autonomic storms, as well as posttraumatic stress disorder (PTSD) and functional neurologic problems. The combination of persistent sinus tachycardia and episodic exacerbations associated with hypertension, diaphoresis, and agitation was highly suggestive of a central hyperadrenergic state with superimposed autonomic storms. Whether the additional PTSD and functional neurologic deficits were due to a direct effect of the lightning strike on the central nervous system or a secondary response is open to speculation.

  15. Statistical Inference for Porous Materials using Persistent Homology.

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Chul [Univ. of Georgia, Athens, GA (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mitchell, Scott A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-12-01

    We propose a porous materials analysis pipeline using persistent homology. We rst compute persistent homology of binarized 3D images of sampled material subvolumes. For each image we compute sets of homology intervals, which are represented as summary graphics called persistence diagrams. We convert persistence diagrams into image vectors in order to analyze the similarity of the homology of the material images using the mature tools for image analysis. Each image is treated as a vector and we compute its principal components to extract features. We t a statistical model using the loadings of principal components to estimate material porosity, permeability, anisotropy, and tortuosity. We also propose an adaptive version of the structural similarity index (SSIM), a similarity metric for images, as a measure to determine the statistical representative elementary volumes (sREV) for persistence homology. Thus we provide a capability for making a statistical inference of the uid ow and transport properties of porous materials based on their geometry and connectivity.

  16. K-homology and K-cohomology constructions of relations

    International Nuclear Information System (INIS)

    Abd El-Sattar, A. Dabbour; Bayoumy, F.M.

    1990-08-01

    One of the important homology (cohomology) theories, based on systems of covering of the space, is the homology (cohomology) theory of relations. In the present work, by using the idea of K-homology and K-cohomology groups different varieties of the Dowker's theory are introduced and studied. These constructions are defined on the category of pairs of topological spaces and over a pair of coefficient groups. (author). 14 refs

  17. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

    2001-01-01

    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  18. VARIATION OF STRIKE INCENTIVES WITH DAMAGE PREFERENCES; FINAL

    International Nuclear Information System (INIS)

    G. CANAVAN

    2001-01-01

    For START III level forces, strike allocations and magnitudes vary little with L, but first strike costs vary directly with L, which means that for K reflecting a preference for the survival of high value targets over their destruction and a preference for high value over military targets, the costs of action are far greater than those of inaction for a wide range of values of damage preference L. Thus, if both sides have much greater preferences for the survival of their high value targets than for military targets or destruction, they do not see a net incentive to strike, and crises are terminated by inaction. Recent decades suggest strong preferences for the survival of high value and that this has contributed to the lack of direct conflict during that period

  19. Isolation and characterization of rhamnose-binding lectins from eggs of steelhead trout (Oncorhynchus mykiss) homologous to low density lipoprotein receptor superfamily.

    Science.gov (United States)

    Tateno, H; Saneyoshi, A; Ogawa, T; Muramoto, K; Kamiya, H; Saneyoshi, M

    1998-07-24

    Two L-rhamnose-binding lectins named STL1 and STL2 were isolated from eggs of steelhead trout (Oncorhynchus mykiss) by affinity chromatography and ion exchange chromatography. The apparent molecular masses of purified STL1 and STL2 were estimated to be 84 and 68 kDa, respectively, by gel filtration chromatography. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and matrix-assisted laser desorption ionization time of flight mass spectrometry of these lectins revealed that STL1 was composed of noncovalently linked trimer of 31.4-kDa subunits, and STL2 was noncovalently linked trimer of 21.5-kDa subunits. The minimum concentrations of STL1, a major component, and STL2, a minor component, needed to agglutinate rabbit erythrocytes were 9 and 0.2 microg/ml, respectively. The most effective saccharide in the hemagglutination inhibition assay for both STL1 and STL2 was L-rhamnose. Saccharides possessing the same configuration of hydroxyl groups at C2 and C4 as that in L-rhamnose, such as L-arabinose and D-galactose, also inhibited. The amino acid sequence of STL2 was determined by analysis of peptides generated by digestion of the S-carboxamidomethylated protein with Achromobacter protease I or Staphylococcus aureus V8 protease. The STL2 subunit of 195 amino acid residues proved to have a unique polypeptide architecture; that is, it was composed of two tandemly repeated homologous domains (STL2-N and STL2-C) with 52% internal homology. These two domains showed a sequence homology to the subunit (105 amino acid residues) of D-galactoside-specific sea urchin (Anthocidaris crassispina) egg lectin (37% for STL2-N and 46% for STL2-C, respectively). The N terminus of the STL1 subunit was blocked with an acetyl group. However, a partial amino acid sequence of the subunit showed a sequence similarity to STL2. Moreover, STL2 also showed a sequence homology to the ligand binding domain of the vitellogenin receptor. We have also employed surface plasmon resonance biosensor

  20. Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae.

    Science.gov (United States)

    Bao, Zehua; Xiao, Han; Liang, Jing; Zhang, Lu; Xiong, Xiong; Sun, Ning; Si, Tong; Zhao, Huimin

    2015-05-15

    One-step multiple gene disruption in the model organism Saccharomyces cerevisiae is a highly useful tool for both basic and applied research, but it remains a challenge. Here, we report a rapid, efficient, and potentially scalable strategy based on the type II Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated proteins (Cas) system to generate multiple gene disruptions simultaneously in S. cerevisiae. A 100 bp dsDNA mutagenizing homologous recombination donor is inserted between two direct repeats for each target gene in a CRISPR array consisting of multiple donor and guide sequence pairs. An ultrahigh copy number plasmid carrying iCas9, a variant of wild-type Cas9, trans-encoded RNA (tracrRNA), and a homology-integrated crRNA cassette is designed to greatly increase the gene disruption efficiency. As proof of concept, three genes, CAN1, ADE2, and LYP1, were simultaneously disrupted in 4 days with an efficiency ranging from 27 to 87%. Another three genes involved in an artificial hydrocortisone biosynthetic pathway, ATF2, GCY1, and YPR1, were simultaneously disrupted in 6 days with 100% efficiency. This homology-integrated CRISPR (HI-CRISPR) strategy represents a powerful tool for creating yeast strains with multiple gene knockouts.

  1. The 2016 Kumamoto earthquake sequence.

    Science.gov (United States)

    Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.

  2. The 2016 Kumamoto earthquake sequence

    Science.gov (United States)

    KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474

  3. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow; Michael Schatz; William Kalies; Thomas Wanner

    2010-05-24

    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  4. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow, Rutgers University/Georgia Institute of Technology, Michael Schatz, Georgia Institute of Technology, William Kalies, Florida Atlantic University, Thomas Wanner,George Mason University

    2010-05-19

    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  5. Persistent homology of complex networks

    International Nuclear Information System (INIS)

    Horak, Danijela; Maletić, Slobodan; Rajković, Milan

    2009-01-01

    Long-lived topological features are distinguished from short-lived ones (considered as topological noise) in simplicial complexes constructed from complex networks. A new topological invariant, persistent homology, is determined and presented as a parameterized version of a Betti number. Complex networks with distinct degree distributions exhibit distinct persistent topological features. Persistent topological attributes, shown to be related to the robust quality of networks, also reflect the deficiency in certain connectivity properties of networks. Random networks, networks with exponential connectivity distribution and scale-free networks were considered for homological persistency analysis

  6. TurboFold: Iterative probabilistic estimation of secondary structures for multiple RNA sequences

    Directory of Open Access Journals (Sweden)

    Sharma Gaurav

    2011-04-01

    Full Text Available Abstract Background The prediction of secondary structure, i.e. the set of canonical base pairs between nucleotides, is a first step in developing an understanding of the function of an RNA sequence. The most accurate computational methods predict conserved structures for a set of homologous RNA sequences. These methods usually suffer from high computational complexity. In this paper, TurboFold, a novel and efficient method for secondary structure prediction for multiple RNA sequences, is presented. Results TurboFold takes, as input, a set of homologous RNA sequences and outputs estimates of the base pairing probabilities for each sequence. The base pairing probabilities for a sequence are estimated by combining intrinsic information, derived from the sequence itself via the nearest neighbor thermodynamic model, with extrinsic information, derived from the other sequences in the input set. For a given sequence, the extrinsic information is computed by using pairwise-sequence-alignment-based probabilities for co-incidence with each of the other sequences, along with estimated base pairing probabilities, from the previous iteration, for the other sequences. The extrinsic information is introduced as free energy modifications for base pairing in a partition function computation based on the nearest neighbor thermodynamic model. This process yields updated estimates of base pairing probability. The updated base pairing probabilities in turn are used to recompute extrinsic information, resulting in the overall iterative estimation procedure that defines TurboFold. TurboFold is benchmarked on a number of ncRNA datasets and compared against alternative secondary structure prediction methods. The iterative procedure in TurboFold is shown to improve estimates of base pairing probability with each iteration, though only small gains are obtained beyond three iterations. Secondary structures composed of base pairs with estimated probabilities higher than a

  7. Is the foot striking pattern more important than barefoot or shod conditions in running?

    Science.gov (United States)

    Shih, Yo; Lin, Kuan-Lun; Shiang, Tzyy-Yuang

    2013-07-01

    People have advocated barefoot running, claiming that it is better suited to human nature. Humans usually run barefoot using a forefoot strike and run shod using a heel strike. The striking pattern was thought to be a key factor that contributes to the benefit of barefoot running. The purpose of this study is to use scientific data to prove that the striking pattern is more important than barefoot or shod conditions for runners on running injuries prevention. Twelve habitually male shod runners were recruited to run under four varying conditions: barefoot running with a forefoot strike, barefoot running with a heel strike, shod running with a forefoot strike, and shod running with a heel strike. Kinetic and kinematic data and electromyography signals were recorded during the experiments. The results showed that the lower extremity can gain more compliance when running with a forefoot strike. Habitually shod runners can gain more shock absorption by changing the striking pattern to a forefoot strike when running with shoes and barefoot conditions. Habitually shod runners may be subject to injuries more easily when they run barefoot while maintaining their heel strike pattern. Higher muscle activity in the gastrocnemius was observed when running with a forefoot strike, which may imply a greater training load on the muscle and a tendency for injury. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Micropathogen Community Analysis in Hyalomma rufipes via High-Throughput Sequencing of Small RNAs

    Science.gov (United States)

    Luo, Jin; Liu, Min-Xuan; Ren, Qiao-Yun; Chen, Ze; Tian, Zhan-Cheng; Hao, Jia-Wei; Wu, Feng; Liu, Xiao-Cui; Luo, Jian-Xun; Yin, Hong; Wang, Hui; Liu, Guang-Yuan

    2017-01-01

    Ticks are important vectors in the transmission of a broad range of micropathogens to vertebrates, including humans. Because of the role of ticks in disease transmission, identifying and characterizing the micropathogen profiles of tick populations have become increasingly important. The objective of this study was to survey the micropathogens of Hyalomma rufipes ticks. Illumina HiSeq2000 technology was utilized to perform deep sequencing of small RNAs (sRNAs) extracted from field-collected H. rufipes ticks in Gansu Province, China. The resultant sRNA library data revealed that the surveyed tick populations produced reads that were homologous to St. Croix River Virus (SCRV) sequences. We also observed many reads that were homologous to microbial and/or pathogenic isolates, including bacteria, protozoa, and fungi. As part of this analysis, a phylogenetic tree was constructed to display the relationships among the homologous sequences that were identified. The study offered a unique opportunity to gain insight into the micropathogens of H. rufipes ticks. The effective control of arthropod vectors in the future will require knowledge of the micropathogen composition of vectors harboring infectious agents. Understanding the ecological factors that regulate vector propagation in association with the prevalence and persistence of micropathogen lineages is also imperative. These interactions may affect the evolution of micropathogen lineages, especially if the micropathogens rely on the vector or host for dispersal. The sRNA deep-sequencing approach used in this analysis provides an intuitive method to survey micropathogen prevalence in ticks and other vector species. PMID:28861401

  9. Survey of transposable elements in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    Rossi Magdalena

    2001-01-01

    Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

  10. Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

    Directory of Open Access Journals (Sweden)

    Yang Jie

    2017-01-01

    Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

  11. Exploring sequence characteristics related to high-level production of secreted proteins in Aspergillus niger.

    Directory of Open Access Journals (Sweden)

    Bastiaan A van den Berg

    Full Text Available Protein sequence features are explored in relation to the production of over-expressed extracellular proteins by fungi. Knowledge on features influencing protein production and secretion could be employed to improve enzyme production levels in industrial bioprocesses via protein engineering. A large set, over 600 homologous and nearly 2,000 heterologous fungal genes, were overexpressed in Aspergillus niger using a standardized expression cassette and scored for high versus no production. Subsequently, sequence-based machine learning techniques were applied for identifying relevant DNA and protein sequence features. The amino-acid composition of the protein sequence was found to be most predictive and interpretation revealed that, for both homologous and heterologous gene expression, the same features are important: tyrosine and asparagine composition was found to have a positive correlation with high-level production, whereas for unsuccessful production, contributions were found for methionine and lysine composition. The predictor is available online at http://bioinformatics.tudelft.nl/hipsec. Subsequent work aims at validating these findings by protein engineering as a method for increasing expression levels per gene copy.

  12. Identification of a Flavivirus Sequence in a Marine Arthropod.

    Directory of Open Access Journals (Sweden)

    Michael J Conway

    Full Text Available Phylogenetic analysis has yet to uncover the early origins of flaviviruses. In this study, I mined a database of expressed sequence tags in order to discover novel flavivirus sequences. Flavivirus sequences were identified in a pool of mRNA extracted from the sea spider Endeis spinosa (Pycnogonida, Pantopoda. Reconstruction of the translated sequences and BLAST analysis matched the sequence to the flavivirus NS5 gene. Additional sequences corresponding to envelope and the NS5 MTase domain were also identified. Phylogenetic analysis of homologous NS5 sequences revealed that Endeis spinosa NS5 (ESNS5 is likely related to classical insect-specific flaviviruses. It is unclear if ESNS5 represents genetic material from an active viral infection or an integrated viral genome. These data raise the possibility that classical insect-specific flaviviruses and perhaps medically relevant flaviviruses, evolved from progenitors that infected marine arthropods.

  13. Causes of falls of hangingwall over gullies adjacent to stabilizing strike pillars

    CSIR Research Space (South Africa)

    Turner, PA

    1987-08-01

    Full Text Available This report discusses the occurrence of falls of ground in strike gullies. Falls of hangingwall over strike gullies on the up-dip side of strike stabilizing pillars in longwall mining systems were investigated. Gullies were examined in both...

  14. Conservation and co-option in developmental programmes: the importance of homology relationships

    Directory of Open Access Journals (Sweden)

    Becker May-Britt

    2005-10-01

    Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

  15. ["Bell-striking" Saying of Acupuncture Therapy].

    Science.gov (United States)

    Zhao, Jing-Sheng

    2017-04-25

    As an analogy, a prototype of "bell-striking" is proposed in the present paper for exploring the basic properties, major elements, and potential mechanisms of acupuncture stimulation. On the strength of analysis on the physiological basis of acupuncture effect, several fundamental aspects of acupuncture are summarized as a) the body-surface stimulating characters, b) general and local effects, and c) triggering the auto-regulative function of the organism, which mimics the "bell-striking" response. Namely, when stroke, bell will chime, otherwise, chiming will not be heard. During analyzing special contents of acupuncture theory, its formative background should not be separated, and it is improper to take, modern medical theory of the human body as the guiding thinking way for researching the ancient Chinese medical literature.

  16. Respecting the right to strike

    CERN Multimedia

    Staff Association

    2015-01-01

    Since two years the representatives of the employers in the ILO, a tripartite multilateral body responsible for guaranteeing the correct application of an international labour code, try to weaken the global work regulations. On the occasion of the Global Day of Action for the right to strike at the invitation of the Geneva community of Union action (Communauté genevoise d’action syndicale) and the Swiss Trade Union Association (Union syndicale suisse) around noon on Wednesday 18th February some fifty staff representatives of international organizations gathered on the place des Nations in Geneva to reaffirm the importance of this fundamental right, too often flouted. A delegation of the CERN Staff Association was also present. In a short speech, the Staff Association said that, while being one of the fundamental human rights, to be efficient the right to strike must be used intelligently. It must be implemented taking into account the sensitivities of the professional environment and r...

  17. The effects of preferred and non-preferred running strike patterns on tissue vibration properties.

    Science.gov (United States)

    Enders, Hendrik; von Tscharner, Vinzenz; Nigg, Benno M

    2014-03-01

    To characterize soft tissue vibrations during running with a preferred and a non-preferred strike pattern in shoes and barefoot. Cross-sectional study. Participants ran at 3.5 m s(-1) on a treadmill in shoes and barefoot using a rearfoot and a forefoot strike for each footwear condition. The preferred strike patterns for the subjects were a rearfoot strike and a forefoot strike for shod and barefoot running, respectively. Vibrations were recorded with an accelerometer overlying the belly of the medial gastrocnemius. Thirteen non-linearly scaled wavelets were used for the analysis. Damping was calculated as the overall decay of power in the acceleration signal post ground contact. A higher damping coefficient indicates higher damping capacities of the soft tissue. The shod rearfoot strike showed a 93% lower damping coefficient than the shod forefoot strike (pforefoot strike showed a trend toward a lower damping coefficient compared to a barefoot rearfoot strike. Running barefoot with a forefoot strike resulted in a significantly lower damping coefficient than a forefoot strike when wearing shoes (pstrike showed lower damping compared to a barefoot rearfoot strike (p<0.001). While rearfoot striking showed lower vibration frequencies in shod and barefoot running, it did not consistently result in lower damping coefficients. This study showed that the use of a preferred movement resulted in lower damping coefficients of running related soft tissue vibrations. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  18. THE EFFECT OF STEP RATE MANIPULATION ON FOOT STRIKE PATTERN OF LONG DISTANCE RUNNERS.

    Science.gov (United States)

    Allen, Darrell J; Heisler, Hollie; Mooney, Jennifer; Kring, Richard

    2016-02-01

    Running gait retraining to change foot strike pattern in runners from a heel strike pattern to a non heel- strike pattern has been shown to reduce impact forces and may help to reduce running related injuries. Step rate manipulation above preferred is known to help decrease step length, foot inclination angle, and vertical mass excursion, but has not yet been evaluated as a method to change foot strike pattern. The purpose of this study was to investigate the effect of step rate manipulation on foot strike pattern in shod recreational runners who run with a heel strike pattern. A secondary purpose was to describe the effect of step rate manipulation at specific percentages above preferred on foot inclination angle at initial contact. Forty volunteer runners, who were self-reported heel strikers and had a weekly running mileage of at least 10 miles, were recruited. Runners were confirmed to be heel strikers during the warm up period on the treadmill. The subject's step rate was determined at their preferred running pace. A metronome was used to increase step rate above the preferred step rate by 5%, 10% and 15%. 2D video motion analysis was utilized to determine foot strike pattern and to measure foot inclination angle at initial contact for each step rate condition. There was a statistically significant change in foot strike pattern from a heel strike pattern to a mid-foot or forefoot strike pattern at both 10% and 15% step rates above preferred. Seven of the 40 subjects (17.5%) changed from a heel- strike pattern to a non- heel strike pattern at +10% and 12 of the 40 subjects (30%) changed to a non-heel strike pattern at +15%. Mean foot inclination angle at initial contact showed a statistically significant change (reduction) as step rate increased. Step rate manipulation of 10% or greater may be enough to change foot strike pattern from a heel strike to a mid-foot or forefoot strike pattern in a small percentage of recreational runners who run in traditional

  19. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  20. Multiple Evolutionary Events Involved in Maintaining Homologs of Resistance to Powdery Mildew 8 in Brassica napus.

    Science.gov (United States)

    Li, Qin; Li, Jing; Sun, Jin-Long; Ma, Xian-Feng; Wang, Ting-Ting; Berkey, Robert; Yang, Hui; Niu, Ying-Ze; Fan, Jing; Li, Yan; Xiao, Shunyuan; Wang, Wen-Ming

    2016-01-01

    The Resistance to Powdery Mildew 8 (RPW8) locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs) in Brassica rapa and three in Brassica oleracea (BoHRs). Brassica napus (Bn) is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs). It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here, we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion, and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  1. Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis

    International Nuclear Information System (INIS)

    Skory, C.D.; Horng, J.S.; Pestka, J.J.; Linz, J.E.

    1990-01-01

    The lack of efficient transformation methods for aflatoxigenic Aspergillus parasiticus has been a major constraint for the study of aflatoxin biosynthesis at the genetic level. A transformation system with efficiencies of 30 to 50 stable transformants per μg of DNA was developed for A. parasiticus by using homologous pyrG gene. The pyrG gene from A. parasiticus was isolated by in situ plaque hybridization of a lambda genomic DNA library. Uridine auxotrophs of A. parasiticus ATCC 36537, a mutant blocked in aflatoxin biosynthesis, were isolated by selection on 5-fluoroorotic acid following nitrosoguanidine mutagenesis. Isolates with mutations in the pyrG gene resulting in elimination of orotidine monophosphate (OMP) decarboxylase activity were detected by assaying cell extracts for their ability to convert [ 14 C]OMP to [ 14 C]UMP. Transformation of A. parasiticus pyrG protoplasts with the homologous pyrG gene restored the fungal cells to prototrophy. Enzymatic analysis of cell extracts of transformant clones demonstrated that these extracts had the ability to convert [ 14 C]OMP to [ 14 C]UMP. Southern analysis of DNA purified from transformant clones indicated that both pUC19 vector sequences and pyrG sequences were integrated into the genome. The development of this pyrG transformation system should allow cloning of the aflatoxin-biosynthetic genes, which will be useful in studying the regulation of aflatoxin biosynthesis and may ultimately provide a means for controlling aflatoxin production in the field

  2. Manipulation of Foot Strike and Footwear Increases Achilles Tendon Loading During Running.

    Science.gov (United States)

    Rice, Hannah; Patel, Mubarak

    2017-08-01

    The Achilles tendon is the most common site of tendon overuse injury in humans. Running with a forefoot strike pattern and in minimal shoes is a topic of recent interest, yet evidence is currently limited regarding the combined influence of foot strike and footwear on Achilles tendon loading. To investigate the influence of both foot strike and footwear on Achilles tendon loading in habitual rearfoot strike runners. Controlled laboratory study. Synchronized kinematic and force data were collected from 22 habitual rearfoot strikers (11 male), who habitually ran in nonminimal running shoes, during overground running at 3.6 m·s -1 . Participants ran in 3 different footwear conditions (standard running shoe, minimal running shoe, and barefoot) with both a rearfoot strike (RFS) and an imposed forefoot strike (FFS) in each footwear condition. Achilles tendon loading was estimated by use of inverse dynamics, where the Achilles tendon moment arm was determined with a regression equation. A 2-way, repeated-measures analysis of variance was used to compare conditions. Achilles tendon impulse was greater when subjects ran with an FFS rather than an RFS in minimal shoes. Achilles tendon loading rates were higher when subjects ran either in minimal shoes or barefoot than in standard shoes, regardless of foot strike. In runners who habitually rearfoot strike in standard running shoes, running in minimal shoes or barefoot increased the rate of tendon loading, and running with a forefoot strike in minimal shoes increased the magnitude of tendon loading. Transitioning to these running conditions may increase the risk of tendinopathy.

  3. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities.

    Science.gov (United States)

    Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric

    2005-03-10

    Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  4. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities

    Directory of Open Access Journals (Sweden)

    Maréchal Eric

    2005-03-01

    Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.

  5. Precision Strike Training in Lean Manufacturing: A Workplace Literacy Guidebook [and] Final Report on Precision Strike Workplace Literacy Training at CertainTeed Corporation.

    Science.gov (United States)

    National Alliance of Business, Inc., Washington, DC.

    CertainTeed's Precision Strike training program was designed to close the gaps between the current status of its workplace and where that work force needed to be to compete successfully in global markets. Precision Strike included Skills and Knowledge in Lifelong Learning (SKILL) customized, computerized lessons in basic skills, one-on-one…

  6. Effects of Foot Strike and Step Frequency on Achilles Tendon Stress During Running.

    Science.gov (United States)

    Lyght, Michael; Nockerts, Matthew; Kernozek, Thomas W; Ragan, Robert

    2016-08-01

    Achilles tendon (AT) injuries are common in runners. The AT withstands high magnitudes of stress during running which may contribute to injury. Our purpose was to examine the effects of foot strike pattern and step frequency on AT stress and strain during running utilizing muscle forces based on a musculoskeletal model and subject-specific ultrasound-derived AT cross-sectional area. Nineteen female runners performed running trials under 6 conditions, including rearfoot strike and forefoot strike patterns at their preferred cadence, +5%, and -5% preferred cadence. Rearfoot strike patterns had less peak AT stress (P forefoot strike pattern. A reduction in peak AT stress and strain were exhibited with a +5% preferred step frequency relative to the preferred condition using a rearfoot (P forefoot (P=.005) strike pattern. Strain rate was not different (P > .05) between step frequencies within each foot strike condition. Our results suggest that a rearfoot pattern may reduce AT stress, strain, and strain rate. Increases in step frequency of 5% above preferred frequency, regardless of foot strike pattern, may also lower peak AT stress and strain.

  7. Force, reaction time, and precision of Kung Fu strikes.

    Science.gov (United States)

    Neto, Osmar Pinto; Bolander, Richard; Pacheco, Marcos Tadeu Tavares; Bir, Cynthia

    2009-08-01

    The goal was to compare values of force, precision, and reaction time of several martial arts punches and palm strikes performed by advanced and intermediate Kung Fu practitioners, both men and women. 13 Kung Fu practitioners, 10 men and three women, participated. Only the men, three advanced and seven intermediate, were considered for comparisons between levels. Reaction time values were obtained using two high speed cameras that recorded each strike at 2500 Hz. Force of impact was measured by a load cell. For comparisons of groups, force data were normalized by participant's body mass and height. Precision of the strikes was determined by a high speed pressure sensor. The results show that palm strikes were stronger than punches. Women in the study presented, on average, lower values of reaction time and force but higher values of precision than men. Advanced participants presented higher forces than intermediate participants. Significant negative correlations between the values of force and precision and the values of force and reaction time were also found.

  8. Generation and analysis of expressed sequence tags from Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    EVELYN SILVA

    2006-01-01

    Full Text Available Botrytis cinerea is a filamentous plant pathogen of a wide range of plant species, and its infection may cause enormous damage both during plant growth and in the post-harvest phase. We have constructed a cDNA library from an isolate of B. cinerea and have sequenced 11,482 expressed sequence tags that were assembled into 1,003 contigs sequences and 3,032 singletons. Approximately 81% of the unigenes showed significant similarity to genes coding for proteins with known functions: more than 50% of the sequences code for genes involved in cellular metabolism, 12% for transport of metabolites, and approximately 10% for cellular organization. Other functional categories include responses to biotic and abiotic stimuli, cell communication, cell homeostasis, and cell development. We carried out pair-wise comparisons with fungal databases to determine the B. cinerea unisequence set with relevant similarity to genes in other fungal pathogenic counterparts. Among the 4,035 non-redundant B. cinerea unigenes, 1,338 (23% have significant homology with Fusarium verticillioides unigenes. Similar values were obtained for Saccharomyces cerevisiae and Aspergillus nidulans (22% and 24%, respectively. The lower percentages of homology were with Magnaporthe grisae and Neurospora crassa (13% and 19%, respectively. Several genes involved in putative and known fungal virulence and general pathogenicity were identified. The results provide important information for future research on this fungal pathogen

  9. A 1,681-locus consensus genetic map of cultivated cucumber including 67 NB-LRR resistance gene homolog and ten gene loci.

    Science.gov (United States)

    Yang, Luming; Li, Dawei; Li, Yuhong; Gu, Xingfang; Huang, Sanwen; Garcia-Mas, Jordi; Weng, Yiqun

    2013-03-25

    Cucumber is an important vegetable crop that is susceptible to many pathogens, but no disease resistance (R) genes have been cloned. The availability of whole genome sequences provides an excellent opportunity for systematic identification and characterization of the nucleotide binding and leucine-rich repeat (NB-LRR) type R gene homolog (RGH) sequences in the genome. Cucumber has a very narrow genetic base making it difficult to construct high-density genetic maps. Development of a consensus map by synthesizing information from multiple segregating populations is a method of choice to increase marker density. As such, the objectives of the present study were to identify and characterize NB-LRR type RGHs, and to develop a high-density, integrated cucumber genetic-physical map anchored with RGH loci. From the Gy14 draft genome, 70 NB-containing RGHs were identified and characterized. Most RGHs were in clusters with uneven distribution across seven chromosomes. In silico analysis indicated that all 70 RGHs had EST support for gene expression. Phylogenetic analysis classified 58 RGHs into two clades: CNL and TNL. Comparative analysis revealed high-degree sequence homology and synteny in chromosomal locations of these RGH members between the cucumber and melon genomes. Fifty-four molecular markers were developed to delimit 67 of the 70 RGHs, which were integrated into a genetic map through linkage analysis. A 1,681-locus cucumber consensus map including 10 gene loci and spanning 730.0 cM in seven linkage groups was developed by integrating three component maps with a bin-mapping strategy. Physically, 308 scaffolds with 193.2 Mbp total DNA sequences were anchored onto this consensus map that covered 52.6% of the 367 Mbp cucumber genome. Cucumber contains relatively few NB-LRR RGHs that are clustered and unevenly distributed in the genome. All RGHs seem to be transcribed and shared significant sequence homology and synteny with the melon genome suggesting conservation of

  10. The K-homology of nets of C∗-algebras

    Science.gov (United States)

    Ruzzi, Giuseppe; Vasselli, Ezio

    2014-12-01

    Let X be a space, intended as a possibly curved space-time, and A a precosheaf of C∗-algebras on X. Motivated by algebraic quantum field theory, we study the Kasparov and Θ-summable K-homology of A interpreting them in terms of the holonomy equivariant K-homology of the associated C∗-dynamical system. This yields a characteristic class for K-homology cycles of A with values in the odd cohomology of X, that we interpret as a generalized statistical dimension.

  11. The genome sequence of Caenorhabditis briggsae: a platform for comparative genomics.

    Directory of Open Access Journals (Sweden)

    Lincoln D Stein

    2003-11-01

    Full Text Available The soil nematodes Caenorhabditis briggsae and Caenorhabditis elegans diverged from a common ancestor roughly 100 million years ago and yet are almost indistinguishable by eye. They have the same chromosome number and genome sizes, and they occupy the same ecological niche. To explore the basis for this striking conservation of structure and function, we have sequenced the C. briggsae genome to a high-quality draft stage and compared it to the finished C. elegans sequence. We predict approximately 19,500 protein-coding genes in the C. briggsae genome, roughly the same as in C. elegans. Of these, 12,200 have clear C. elegans orthologs, a further 6,500 have one or more clearly detectable C. elegans homologs, and approximately 800 C. briggsae genes have no detectable matches in C. elegans. Almost all of the noncoding RNAs (ncRNAs known are shared between the two species. The two genomes exhibit extensive colinearity, and the rate of divergence appears to be higher in the chromosomal arms than in the centers. Operons, a distinctive feature of C. elegans, are highly conserved in C. briggsae, with the arrangement of genes being preserved in 96% of cases. The difference in size between the C. briggsae (estimated at approximately 104 Mbp and C. elegans (100.3 Mbp genomes is almost entirely due to repetitive sequence, which accounts for 22.4% of the C. briggsae genome in contrast to 16.5% of the C. elegans genome. Few, if any, repeat families are shared, suggesting that most were acquired after the two species diverged or are undergoing rapid evolution. Coclustering the C. elegans and C. briggsae proteins reveals 2,169 protein families of two or more members. Most of these are shared between the two species, but some appear to be expanding or contracting, and there seem to be as many as several hundred novel C. briggsae gene families. The C. briggsae draft sequence will greatly improve the annotation of the C. elegans genome. Based on similarity to C

  12. Molecular cloning and sequencing analysis of the interferon receptor (IFNAR-1) from Columba livia.

    Science.gov (United States)

    Li, Chao; Chang, Wei Shan

    2014-01-01

    Partial sequence cloning of interferon receptor (IFNAR-1) of Columba livia. In order to obtain a certain length (630 bp) of gene, a pair of primers was designed according to the conserved nucleotide sequence of Gallus (EU477527.1) and Taeniopygia guttata (XM_002189232.1) IFNAR-1 gene fragment that was published by GenBank. Special primers were designed by the Race method to amplify the 3'terminal cDNA. The Columba livia IFNAR-1 displayed 88.5%, 80.5% and 73.8% nucleotide identity to Falco peregrinus, Gallus and Taeniopygia guttata, respectively. Phylogenetic analysis of the IFNAR1 gene showed that the relationship of Columba livia, Falco peregrinus and chicken had high homology. We successfully obtained a Columba livia IFNAR-1 gene partial sequence. Analysis of the genetic tree showed that the relationship of Columba livia and Falco peregrinus IFNAR-1 had high homology. This result can be used as reference for further research and practical application.

  13. Ethical and legal consideration of prisoner's hunger strike in Serbia.

    Science.gov (United States)

    Alempijevic, Djordje; Pavlekic, Snezana; Jecmenica, Dragan; Nedeljkov, Aleksandra; Jankovic, Milos

    2011-03-01

    Hunger strike of prisoners and detainees remains a major human rights and ethical issue for medical professionals. We are reporting on a case of a 48-year-old male sentenced prisoner, intravenous heroin user, who went on a hunger strike and died 15 days later. Throughout the fasting period, the prisoner, who was capable of decision making, refused any medical examination. Autopsy findings were not supporting prolonged starvation, while toxicology revealed benzodiazepines and opiates in blood and urine. Cause of death was given as "heroin intoxication" in keeping with detection of 6-MAM. Legal and ethical issues pertinent to medical examination and treatment of prisoners on hunger strike are explored in accordance with legislation and professional ethical standards in Serbia. A recommendation for the best autopsy practice in deaths following hunger strike has been made. © 2011 American Academy of Forensic Sciences.

  14. New Insight Into the Diversity of SemiSWEET Sugar Transporters and the Homologs in Prokaryotes

    Directory of Open Access Journals (Sweden)

    Baolei Jia

    2018-05-01

    Full Text Available Sugars will eventually be exported transporters (SWEETs and SemiSWEETs represent a family of sugar transporters in eukaryotes and prokaryotes, respectively. SWEETs contain seven transmembrane helices (TMHs, while SemiSWEETs contain three. The functions of SemiSWEETs are less studied. In this perspective article, we analyzed the diversity and conservation of SemiSWEETs and further proposed the possible functions. 1,922 SemiSWEET homologs were retrieved from the UniProt database, which is not proportional to the sequenced prokaryotic genomes. However, these proteins are very diverse in sequences and can be classified into 19 clusters when >50% sequence identity is required. Moreover, a gene context analysis indicated that several SemiSWEETs are located in the operons that are related to diverse carbohydrate metabolism. Several proteins with seven TMHs can be found in bacteria, and sequence alignment suggested that these proteins in bacteria may be formed by the duplication and fusion. Multiple sequence alignments showed that the amino acids for sugar translocation are still conserved and coevolved, although the sequences show diversity. Among them, the functions of a few amino acids are still not clear. These findings highlight the challenges that exist in SemiSWEETs and provide future researchers the foundation to explore these uncharted areas.

  15. Teaching Striking Skills in Elementary Physical Education Using Woodball

    Science.gov (United States)

    Chang, Seung Ho; Lee, Jihyun

    2017-01-01

    Object control (OC) skills are a part of fundamental motor skills and basic functional skills, which work as a prerequisite to becoming a skilled performer in many sports. Of various OC skills, striking is one of the most difficult to master due to a variety of interrelated movement components. A form of vertical or underarm striking is a more…

  16. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  17. QUASAR--scoring and ranking of sequence-structure alignments.

    Science.gov (United States)

    Birzele, Fabian; Gewehr, Jan E; Zimmer, Ralf

    2005-12-15

    Sequence-structure alignments are a common means for protein structure prediction in the fields of fold recognition and homology modeling, and there is a broad variety of programs that provide such alignments based on sequence similarity, secondary structure or contact potentials. Nevertheless, finding the best sequence-structure alignment in a pool of alignments remains a difficult problem. QUASAR (quality of sequence-structure alignments ranking) provides a unifying framework for scoring sequence-structure alignments that aids finding well-performing combinations of well-known and custom-made scoring schemes. Those scoring functions can be benchmarked against widely accepted quality scores like MaxSub, TMScore, Touch and APDB, thus enabling users to test their own alignment scores against 'standard-of-truth' structure-based scores. Furthermore, individual score combinations can be optimized with respect to benchmark sets based on known structural relationships using QUASAR's in-built optimization routines.

  18. Natural Homologous Triploidization and DNA Methylation in SARII-628, a Twin-seedling Line of Rice (Oryza sativa

    Directory of Open Access Journals (Sweden)

    Hai PENG

    2007-12-01

    Full Text Available A total of five pairs of diploid-triploid twin-seedlings (a diploid seedling and a triploid seedling emerged from a grain were selected out from 4500 pairs of seedlings from SARII-628, a twin-seedling rice line. SSR analysis indicated that no difference between the diploid seedling and corresponding triploid seedling in a twin-seedling was found at the 310 loci, indicating that there was no obvious change in DNA primary structure. A modified AFLP technique ‘MSAP (methylation-sensitive AFLP’ was used to analyze methylation mutation. Although no methylation mutation was noted among the five diploids, 29 methylation mutation loci were found from the corresponding triploids. This suggested that methylation mutation happened rapidly on M0 generation after natural homologous triploidization. The mutations were classified into 10 types, including 3 increased types, 3 decreased types and 4 undecided types of methylation-degrees. The bands of 22 loci were sequenced and then those sequences were searched through website. The result showed that the methylation mutation involved into the whole rice genome and the 12 pairs of chromosomes. The mutation trend was site-related and there were different mutation loci for different triploids, which foretold that SARII-628 would have different evolution fates after natural homologous triploidization.

  19. Draft genome sequence of the Coccolithovirus Emiliania huxleyi virus 203.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2011-12-01

    The Coccolithoviridae are a recently discovered group of viruses that infect the marine coccolithophorid Emiliania huxleyi. Emiliania huxleyi virus 203 (EhV-203) has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 400 kbp, consisting of 464 coding sequences (CDSs). Here we describe the genomic features of EhV-203 together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  20. Along-strike Variations in the Himalayas Illuminated by the Aftershock Sequence of the 2015 Mw 7.8 Gorkha Earthquake Using the NAMASTE Local Seismic Network

    Science.gov (United States)

    Mendoza, M.; Ghosh, A.; Karplus, M. S.; Nabelek, J.; Sapkota, S. N.; Adhikari, L. B.; Klemperer, S. L.; Velasco, A. A.

    2016-12-01

    As a result of the 2015 Mw 7.8 Gorkha earthquake, more than 8,000 people were killed from a combination of infrastructure failure and triggered landslides. This earthquake produced 4 m of peak co-seismic slip as the fault ruptured 130 km east under densely populated cities, such as Kathmandu. To understand earthquake dynamics in this part of the Himalayas and help mitigate similar future calamities by the next destructive event, it is imperative to study earthquake activities in detail and improve our understanding of the source and structural complexities. In response to the Gorkha event, multiple institutions developed and deployed a 10-month long dense seismic network called NAMASTE. It blanketed a 27,650 km2 area, mainly covering the rupture area of the Gorkha earthquake, in order to capture the dynamic sequence of aftershock behavior. The network consisted of a mix of 45 broadband, short-period, and strong motion sensors, with an average spacing of 20 km. From the first 6 months of data, starting approximately 1.5 after the mainshock, we develop a robust catalog containing over 3,000 precise earthquake locations, and local magnitudes that range between 0.3 and 4.9. The catalog has a magnitude of completeness of 1.5, and an overall low b-value of 0.78. Using the HypoDD algorithm, we relocate earthquake hypocenters with high precision, and thus illustrate the fault geometry down to depths of 25 km where we infer the location of the gently-dipping Main Frontal Thrust (MFT). Above the MFT, the aftershocks illuminate complex structure produced by relatively steeply dipping faults. Interestingly, we observe sharp along-strike change in the seismicity pattern. The eastern part of the aftershock area is significantly more active than the western part. The change in seismicity may reflect structural and/or frictional lateral heterogeneity in this part of the Himalayan fault system. Such along-strike variations play an important role in rupture complexities and

  1. Feature Hepatitis: Hepatitis Can Strike Anyone

    Science.gov (United States)

    ... Navigation Bar Home Current Issue Past Issues Feature Hepatitis Hepatitis Can Strike Anyone Past Issues / Spring 2009 Table ... from all walks of life are affected by hepatitis, especially hepatitis C, the most common form of ...

  2. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    Science.gov (United States)

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  3. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus

    OpenAIRE

    Spence, Robert J.; Noune, Christopher; Hauxwell, Caroline

    2016-01-01

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length.

  4. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  5. Physicians' strikes and the competing bases of physicians' moral obligations.

    Science.gov (United States)

    MacDougall, D Robert

    2013-09-01

    Many authors have addressed the morality of physicians' strikes on the assumption that medical practice is morally different from other kinds of occupations. This article analyzes three prominent theoretical accounts that attempt to ground such special moral obligations for physicians--practice-based accounts, utilitarian accounts, and social contract accounts--and assesses their applicability to the problem of the morality of strikes. After critiquing these views, it offers a fourth view grounding special moral obligations in voluntary commitments, and explains why this is a preferable basis for understanding physicians' moral obligations in general and especially as pertaining to strikes.

  6. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  7. Computing Homology Group Generators of Images Using Irregular Graph Pyramids

    OpenAIRE

    Peltier , Samuel; Ion , Adrian; Haxhimusa , Yll; Kropatsch , Walter; Damiand , Guillaume

    2007-01-01

    International audience; We introduce a method for computing homology groups and their generators of a 2D image, using a hierarchical structure i.e. irregular graph pyramid. Starting from an image, a hierarchy of the image is built, by two operations that preserve homology of each region. Instead of computing homology generators in the base where the number of entities (cells) is large, we first reduce the number of cells by a graph pyramid. Then homology generators are computed efficiently on...

  8. Homologs of the Acinetobacter baumannii AceI transporter represent a new family of bacterial multidrug efflux systems.

    Science.gov (United States)

    Hassan, Karl A; Liu, Qi; Henderson, Peter J F; Paulsen, Ian T

    2015-02-10

    Multidrug efflux systems are a major cause of resistance to antimicrobials in bacteria, including those pathogenic to humans, animals, and plants. These proteins are ubiquitous in these pathogens, and five families of bacterial multidrug efflux systems have been identified to date. By using transcriptomic and biochemical analyses, we recently identified the novel AceI (Acinetobacter chlorhexidine efflux) protein from Acinetobacter baumannii that conferred resistance to the biocide chlorhexidine, via an active efflux mechanism. Proteins homologous to AceI are encoded in the genomes of many other bacterial species and are particularly prominent within proteobacterial lineages. In this study, we expressed 23 homologs of AceI and examined their resistance and/or transport profiles. MIC analyses demonstrated that, like AceI, many of the homologs conferred resistance to chlorhexidine. Many of the AceI homologs conferred resistance to additional biocides, including benzalkonium, dequalinium, proflavine, and acriflavine. We conducted fluorimetric transport assays using the AceI homolog from Vibrio parahaemolyticus and confirmed that resistance to both proflavine and acriflavine was mediated by an active efflux mechanism. These results show that this group of AceI homologs represent a new family of bacterial multidrug efflux pumps, which we have designated the proteobacterial antimicrobial compound efflux (PACE) family of transport proteins. Bacterial multidrug efflux pumps are an important class of resistance determinants that can be found in every bacterial genome sequenced to date. These transport proteins have important protective functions for the bacterial cell but are a significant problem in the clinical setting, since a single efflux system can mediate resistance to many structurally and mechanistically diverse antibiotics and biocides. In this study, we demonstrate that proteins related to the Acinetobacter baumannii AceI transporter are a new class of multidrug

  9. New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

    International Nuclear Information System (INIS)

    Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

    1986-01-01

    The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' Δgag-fms-Δpol-Δenv 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV

  10. New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

    Energy Technology Data Exchange (ETDEWEB)

    Besmer, P.; Lader, E.; George, P.C.; Bergold, P.J.; Qui, F.; Zuckerman, E.E.; Hardy, W.D.

    1986-10-01

    The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' ..delta..gag-fms-..delta..pol-..delta..env 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV.

  11. Inverse statistical physics of protein sequences: a key issues review.

    Science.gov (United States)

    Cocco, Simona; Feinauer, Christoph; Figliuzzi, Matteo; Monasson, Rémi; Weigt, Martin

    2018-03-01

    In the course of evolution, proteins undergo important changes in their amino acid sequences, while their three-dimensional folded structure and their biological function remain remarkably conserved. Thanks to modern sequencing techniques, sequence data accumulate at unprecedented pace. This provides large sets of so-called homologous, i.e. evolutionarily related protein sequences, to which methods of inverse statistical physics can be applied. Using sequence data as the basis for the inference of Boltzmann distributions from samples of microscopic configurations or observables, it is possible to extract information about evolutionary constraints and thus protein function and structure. Here we give an overview over some biologically important questions, and how statistical-mechanics inspired modeling approaches can help to answer them. Finally, we discuss some open questions, which we expect to be addressed over the next years.

  12. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

    Science.gov (United States)

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

    2015-05-01

    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Down-regulation of the strawberry Bet v 1-homologous allergen in concert with the flavonoid biosynthesis pathway in colorless strawberry mutant

    DEFF Research Database (Denmark)

    Hjernø, Karin; Alm, Rikard; Canbäck, Björn

    2006-01-01

    Proteomic screening of strawberry (Fragaria ananassa) yielded a 58% success rate in protein identification in spite of the fact that no genomic sequence is available for this species. This was achieved by a combination of MALDI-MS/MS de novo sequencing of double-derivatized peptides and indel......-tolerant searching against local protein databases built on both EST and full-length nucleotide sequences. The amino acid sequence of a strawberry allergen, homologous to the well-known major birch pollen allergen Bet v 1, was partially determined. This strawberry allergen, named Fra a 1 according...... to the nomenclature for allergen proteins, showed sequence identity of 54 and 77%, respectively, with corresponding allergens from birch and apple. Differential expression, as evaluated by 2-D DIGE, occurred in 10% of protein spots when red strawberries were compared to a colorless (white) strawberry mutant. White...

  14. A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinated genes accompanies its sedentary parasitic phase

    Directory of Open Access Journals (Sweden)

    Overall Christopher C

    2007-04-01

    Full Text Available Abstract Background Heterodera glycines (soybean cyst nematode [SCN], the major pathogen of Glycine max (soybean, undergoes muscle degradation (sarcopenia as it becomes sedentary inside the root. Many genes encoding muscular and neuromuscular components belong to the uncoordinated (unc family of genes originally identified in Caenorhabditis elegans. Previously, we reported a substantial decrease in transcript abundance for Hg-unc-87, the H. glycines homolog of unc-87 (calponin during the adult sedentary phase of SCN. These observations implied that changes in the expression of specific muscle genes occurred during sarcopenia. Results We developed a bioinformatics database that compares expressed sequence tag (est and genomic data of C. elegans and H. glycines (CeHg database. We identify H. glycines homologs of C. elegans unc genes whose protein products are involved in muscle composition and regulation. RT-PCR reveals the transcript abundance of H. glycines unc homologs at mobile and sedentary stages of its lifecycle. A prominent reduction in transcript abundance occurs in samples from sedentary nematodes for homologs of actin, unc-60B (cofilin, unc-89, unc-15 (paromyosin, unc-27 (troponin I, unc-54 (myosin, and the potassium channel unc-110 (twk-18. Less reduction is observed for the focal adhesion complex gene Hg-unc-97. Conclusion The CeHg bioinformatics database is shown to be useful in identifying homologs of genes whose protein products perform roles in specific aspects of H. glycines muscle biology. Our bioinformatics comparison of C. elegans and H. glycines genomic data and our Hg-unc-87 expression experiments demonstrate that the transcript abundance of specific H. glycines homologs of muscle gene decreases as the nematode becomes sedentary inside the root during its parasitic feeding stages.

  15. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  16. I-SceI-mediated double-strand break does not increase the frequency of homologous recombination at the Dct locus in mouse embryonic stem cells.

    Science.gov (United States)

    Fenina, Myriam; Simon-Chazottes, Dominique; Vandormael-Pournin, Sandrine; Soueid, Jihane; Langa, Francina; Cohen-Tannoudji, Michel; Bernard, Bruno A; Panthier, Jean-Jacques

    2012-01-01

    Targeted induction of double-strand breaks (DSBs) at natural endogenous loci was shown to increase the rate of gene replacement by homologous recombination in mouse embryonic stem cells. The gene encoding dopachrome tautomerase (Dct) is specifically expressed in melanocytes and their precursors. To construct a genetic tool allowing the replacement of Dct gene by any gene of interest, we generated an embryonic stem cell line carrying the recognition site for the yeast I-SceI meganuclease embedded in the Dct genomic segment. The embryonic stem cell line was electroporated with an I-SceI expression plasmid, and a template for the DSB-repair process that carried sequence homologies to the Dct target. The I-SceI meganuclease was indeed able to introduce a DSB at the Dct locus in live embryonic stem cells. However, the level of gene targeting was not improved by the DSB induction, indicating a limited capacity of I-SceI to mediate homologous recombination at the Dct locus. These data suggest that homologous recombination by meganuclease-induced DSB may be locus dependent in mammalian cells.

  17. Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner

    OpenAIRE

    Checchi, Paula M.; Engebrecht, JoAnne

    2011-01-01

    Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

  18. Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

    International Nuclear Information System (INIS)

    Mladenov, Emil; Iliakis, George

    2011-01-01

    A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

  19. Human apolipoprotein CIII gene expression is regulated by positive and negative cis-acting elements and tissue-specific protein factors

    International Nuclear Information System (INIS)

    Reue, K.; Leff, T.; Breslow, J.L.

    1988-01-01

    Apolipoprotein CIII (apoCIII) is a major protein constituent of triglyceride-rich lipoproteins and is synthesized primarily in the liver. Cis-acting DNA elements required for liver-specific apoCIII gene transcription were identified with transient expression assays in the human hepatoma (HepG2) and epithelial carcinoma (HeLa) cell lines. In liver cells, 821 nucleotides of the human apoCIII gene 5'-flanking sequence were required for maximum levels of gene expression, while the proximal 110 nucleotides alone were sufficient. No expression was observed in similar studies with HeLa cells. The level of expression was modulated by a combination of positive and negative cis-acting sequences, which interact with distinct sets of proteins from liver and HeLa cell nuclear extracts. The proximal positive regulatory region shares homology with similarly located sequences of other genes strongly expressed in the liver, including α 1 -antitrypsin and other apolipoprotein genes. The negative regulatory region is striking homologous to the human β-interferon gene regulatory element. The distal positive region shares homology with some viral enhancers and has properties of a tissue-specific enhancer. The regulation of the apoCIII gene is complex but shares features with other genes, suggesting shuffling of regulatory elements as a common mechanism for cell type-specific gene expression

  20. The Left Labourites and the General Strike of 1926 in the UK

    Directory of Open Access Journals (Sweden)

    Evgeniya G. Blosfeld

    2017-12-01

    Full Text Available The author analyses the left labourites’ attitude to the interaction of the Labour Party and trade unions and use of general strike as a means of the social struggle. Besides the article analyses the left labourites’ estimation of 1926 general strike and the causes of the defeat, and the strike of the miners who decided to continue it. The left labourites defended the branch principle of the trade unions’ organization based on the shopstewards’ model which was better adopted for the strike struggle. The left labourites took into account that the general structure of the labour movement would remain the same, but the Labour Party would take over the leadership from trade unions. The left labourites supported the peaceful way of transition to socialism and they considered the general strike to be analogy of social revolution or a means of pressure of the government for nationalization of the main economic branches and the improvement of the workers’ life conditions. Under extreme circumstances, the general strike was considered to be a means to prevent antidemocratic revolution. Evaluating the general strike of 1926, the author marks the absence of unity in the leadership, hesitations and inconsistency of the left labourites themselves. They didn’t give a single proposal about the improvement of the working-class movement organization except of state British Trade Unions Congress. As a result, the criticism of the General Council’s renegade position was bestowed upon the leadership of the Miners Federation who didn’t submit to the General Council order to stop the strike.

  1. Homologous Recombination between Genetically Divergent Campylobacter fetus Lineages Supports Host-Associated Speciation

    Science.gov (United States)

    Duim, Birgitta; van der Graaf-van Bloois, Linda; Wagenaar, Jaap A; Zomer, Aldert L

    2018-01-01

    Abstract Homologous recombination is a major driver of bacterial speciation. Genetic divergence and host association are important factors influencing homologous recombination. Here, we study these factors for Campylobacter fetus, which shows a distinct intraspecific host dichotomy. Campylobacter fetus subspecies fetus (Cff) and venerealis are associated with mammals, whereas C. fetus subsp. testudinum (Cft) is associated with reptiles. Recombination between these genetically divergent C. fetus lineages is extremely rare. Previously it was impossible to show whether this barrier to recombination was determined by the differential host preferences, by the genetic divergence between both lineages or by other factors influencing recombination, such as restriction-modification, CRISPR/Cas, and transformation systems. Fortuitously, a distinct C. fetus lineage (ST69) was found, which was highly related to mammal-associated C. fetus, yet isolated from a chelonian. The whole genome sequences of two C. fetus ST69 isolates were compared with those of mammal- and reptile-associated C. fetus strains for phylogenetic and recombination analysis. In total, 5.1–5.5% of the core genome of both ST69 isolates showed signs of recombination. Of the predicted recombination regions, 80.4% were most closely related to Cft, 14.3% to Cff, and 5.6% to C. iguaniorum. Recombination from C. fetus ST69 to Cft was also detected, but to a lesser extent and only in chelonian-associated Cft strains. This study shows that despite substantial genetic divergence no absolute barrier to homologous recombination exists between two distinct C. fetus lineages when occurring in the same host type, which provides valuable insights in bacterial speciation and evolution. PMID:29608720

  2. Factors affecting defensive strike behavior in Brown Treesnakes (Boiga irregularis) provoked by humans

    Science.gov (United States)

    Spencer, McKayka M.; Lardner, Bjorn; Mazurek, M.J.; Reed, Robert N.

    2015-01-01

    Striking is a typical antipredator defense exhibited by many species of snakes. While trapping Brown Treesnakes (Boiga irregularis) on Guam, we observed that snakes most frequently struck at an approaching person at a site where snakes had been trapped, marked, and handled in the past. Using a combination of between-sites and within-site comparisons, we assessed if the propensity to strike was correlated with capture histories (both recent and long-term), snake size, body condition (a proxy to nutritional stress), sex, or tail condition (broken or intact), while controlling for confounding variables. We confirmed that propensity to strike was higher at the site where we had been conducting capture-mark-recapture for several years. However, we were unable to demonstrate a correlation between striking tendencies and individual recent or long-term capture histories. The only morphological covariate that had an effect on strike propensity was sex, with females striking more often than males. After removing the site effect from our model, we found that snakes missing parts of their tails were more likely to strike than snakes with intact tails. We have yet to identify the factor(s) that cause the pronounced difference across sites in snake propensity to strike, and data from additional sites might help elucidate any geographical patterns.

  3. Footwear Matters: Influence of Footwear and Foot Strike on Load Rates during Running.

    Science.gov (United States)

    Rice, Hannah M; Jamison, Steve T; Davis, Irene S

    2016-12-01

    Running with a forefoot strike (FFS) pattern has been suggested to reduce the risk of overuse running injuries, due to a reduced vertical load rate compared with rearfoot strike (RFS) running. However, resultant load rate has been reported to be similar between foot strikes when running in traditional shoes, leading to questions regarding the value of running with a FFS. The influence of minimal footwear on the resultant load rate has not been considered. This study aimed to compare component and resultant instantaneous loading rate (ILR) between runners with different foot strike patterns in their habitual footwear conditions. Twenty-nine injury-free participants (22 men, seven women) ran at 3.13 m·s along a 30-m runway, with their habitual foot strike and footwear condition. Ground reaction force data were collected. Peak ILR values were compared between three conditions; those who habitually run with an RFS in standard shoes, with an FFS in standard shoes, and with an FFS in minimal shoes. Peak resultant, vertical, lateral, and medial ILR were lower (P strike. When running with an FFS, peak posterior ILR were lower (P strike. Therefore, it appears that footwear alters the load rates during running, even with similar foot strike patterns.

  4. ChickVD: a sequence variation database for the chicken genome

    DEFF Research Database (Denmark)

    Wang, Jing; He, Ximiao; Ruan, Jue

    2005-01-01

    Working in parallel with the efforts to sequence the chicken (Gallus gallus) genome, the Beijing Genomics Institute led an international team of scientists from China, USA, UK, Sweden, The Netherlands and Germany to map extensive DNA sequence variation throughout the chicken genome by sampling DN...... on quantitative trait loci using data from collaborating institutions and public resources. Our data can be queried by search engine and homology-based BLAST searches. ChickVD is publicly accessible at http://chicken.genomics.org.cn. Udgivelsesdato: 2005-Jan-1...

  5. Draft genome sequence of the coccolithovirus Emiliania huxleyi virus 202.

    Science.gov (United States)

    Nissimov, Jozef I; Worthy, Charlotte A; Rooks, Paul; Napier, Johnathan A; Kimmance, Susan A; Henn, Matthew R; Ogata, Hiroyuki; Allen, Michael J

    2012-02-01

    Emiliania huxleyi virus 202 (EhV-202) is a member of the Coccolithoviridae, a group of viruses that infect the marine coccolithophorid Emiliania huxleyi. EhV-202 has a 160- to 180-nm-diameter icosahedral structure and a genome of approximately 407 kbp, consisting of 485 coding sequences (CDSs). Here we describe the genomic features of EhV-202, together with a draft genome sequence and its annotation, highlighting the homology and heterogeneity of this genome in comparison with the EhV-86 reference genome.

  6. Relationship between foot strike pattern, running speed, and footwear condition in recreational distance runners.

    Science.gov (United States)

    Cheung, Roy T H; Wong, Rodney Y L; Chung, Tim K W; Choi, R T; Leung, Wendy W Y; Shek, Diana H Y

    2017-06-01

    Compared to competitive runners, recreational runners appear to be more prone to injuries, which have been associated with foot strike patterns. Surprisingly, only few studies had examined the foot strike patterns outside laboratories. Therefore, this study compared the foot strike patterns in recreational runners at outdoor tracks with previously reported data. We also investigated the relationship between foot strike pattern, speed, and footwear in this cohort. Among 434 recreational runners analysed, 89.6% of them landed with rearfoot strike (RFS). Only 6.9 and 3.5% landed with midfoot and forefoot, respectively. A significant shift towards non-RFS was observed in our cohort, when compared with previously reported data. When speed increased by 1 m/s, the odds of having forefoot strike and midfoot strike relative to RFS increased by 2.3 times and 2.6 times, respectively. Runners were 9.2 times more likely to run with a forefoot strike in minimalists compared to regular running shoes, although 70% of runners in minimalists continued to use a RFS. These findings suggest that foot strike pattern may differ across running conditions and runners should consider these factors in order to mitigate potential injury.

  7. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  8. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  9. Homologous Recombination as a Replication Fork Escort: Fork-Protection and Recovery

    Directory of Open Access Journals (Sweden)

    Audrey Costes

    2012-12-01

    Full Text Available Homologous recombination is a universal mechanism that allows DNA repair and ensures the efficiency of DNA replication. The substrate initiating the process of homologous recombination is a single-stranded DNA that promotes a strand exchange reaction resulting in a genetic exchange that promotes genetic diversity and DNA repair. The molecular mechanisms by which homologous recombination repairs a double-strand break have been extensively studied and are now well characterized. However, the mechanisms by which homologous recombination contribute to DNA replication in eukaryotes remains poorly understood. Studies in bacteria have identified multiple roles for the machinery of homologous recombination at replication forks. Here, we review our understanding of the molecular pathways involving the homologous recombination machinery to support the robustness of DNA replication. In addition to its role in fork-recovery and in rebuilding a functional replication fork apparatus, homologous recombination may also act as a fork-protection mechanism. We discuss that some of the fork-escort functions of homologous recombination might be achieved by loading of the recombination machinery at inactivated forks without a need for a strand exchange step; as well as the consequence of such a model for the stability of eukaryotic genomes.

  10. A geometric model for Hochschild homology of Soergel bimodules

    DEFF Research Database (Denmark)

    Webster, Ben; Williamson, Geordie

    2008-01-01

    An important step in the calculation of the triply graded link homology of Khovanov and Rozansky is the determination of the Hochschild homology of Soergel bimodules for SL(n). We present a geometric model for this Hochschild homology for any simple group G, as B–equivariant intersection cohomology...... on generators whose degree is explicitly determined by the geometry of the orbit closure, and to describe its Hilbert series, proving a conjecture of Jacob Rasmussen....

  11. Implications of Incessant Strike Actions on the Implementation of Technical Education Programme in Nigeria

    Science.gov (United States)

    Adavbiele, J. A.

    2015-01-01

    This paper was designed to x-ray the implications of incessant strike actions on the implementation of Technical education programme in Nigeria. The paper took an exploratory view on the concept of strike actions in Nigeria with particular references on notable strike actions that have occurred in Nigeria. The types of strike were explained and…

  12. Nicotiana small RNA sequences support a host genome origin of cucumber mosaic virus satellite RNA.

    Directory of Open Access Journals (Sweden)

    Kiran Zahid

    2015-01-01

    Full Text Available Satellite RNAs (satRNAs are small noncoding subviral RNA pathogens in plants that depend on helper viruses for replication and spread. Despite many decades of research, the origin of satRNAs remains unknown. In this study we show that a β-glucuronidase (GUS transgene fused with a Cucumber mosaic virus (CMV Y satellite RNA (Y-Sat sequence (35S-GUS:Sat was transcriptionally repressed in N. tabacum in comparison to a 35S-GUS transgene that did not contain the Y-Sat sequence. This repression was not due to DNA methylation at the 35S promoter, but was associated with specific DNA methylation at the Y-Sat sequence. Both northern blot hybridization and small RNA deep sequencing detected 24-nt siRNAs in wild-type Nicotiana plants with sequence homology to Y-Sat, suggesting that the N. tabacum genome contains Y-Sat-like sequences that give rise to 24-nt sRNAs capable of guiding RNA-directed DNA methylation (RdDM to the Y-Sat sequence in the 35S-GUS:Sat transgene. Consistent with this, Southern blot hybridization detected multiple DNA bands in Nicotiana plants that had sequence homology to Y-Sat, suggesting that Y-Sat-like sequences exist in the Nicotiana genome as repetitive DNA, a DNA feature associated with 24-nt sRNAs. Our results point to a host genome origin for CMV satRNAs, and suggest novel approach of using small RNA sequences for finding the origin of other satRNAs.

  13. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  14. VITAL NMR: using chemical shift derived secondary structure information for a limited set of amino acids to assess homology model accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Brothers, Michael C.; Nesbitt, Anna E.; Hallock, Michael J. [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Rupasinghe, Sanjeewa G. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Tang Ming [University of Illinois at Urbana-Champaign, Department of Chemistry (United States); Harris, Jason; Baudry, Jerome [University of Tennessee, Department of Biochemistry, Cellular and Molecular Biology (United States); Schuler, Mary A. [University of Illinois at Urbana-Champaign, Department of Cell and Developmental Biology (United States); Rienstra, Chad M., E-mail: rienstra@illinois.edu [University of Illinois at Urbana-Champaign, Department of Chemistry (United States)

    2012-01-15

    Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., {sup 13}C-{sup 13}C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

  15. VITAL NMR: Using Chemical Shift Derived Secondary Structure Information for a Limited Set of Amino Acids to Assess Homology Model Accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Brothers, Michael C [University of Illinois, Urbana-Champaign; Nesbitt, Anna E [University of Illinois, Urbana-Champaign; Hallock, Michael J [University of Illinois, Urbana-Champaign; Rupasinghe, Sanjeewa [University of Illinois, Urbana-Champaign; Tang, Ming [University of Illinois, Urbana-Champaign; Harris, Jason B [ORNL; Baudry, Jerome Y [ORNL; Schuler, Mary A [University of Illinois, Urbana-Champaign; Rienstra, Chad M [University of Illinois, Urbana-Champaign

    2011-01-01

    Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., (13)C-(13)C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library of 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.

  16. Homology of normal chains and cohomology of charges

    CERN Document Server

    Pauw, Th De; Pfeffer, W F

    2017-01-01

    The authors consider a category of pairs of compact metric spaces and Lipschitz maps where the pairs satisfy a linearly isoperimetric condition related to the solvability of the Plateau problem with partially free boundary. It includes properly all pairs of compact Lipschitz neighborhood retracts of a large class of Banach spaces. On this category the authors define homology and cohomology functors with real coefficients which satisfy the Eilenberg-Steenrod axioms, but reflect the metric properties of the underlying spaces. As an example they show that the zero-dimensional homology of a space in our category is trivial if and only if the space is path connected by arcs of finite length. The homology and cohomology of a pair are, respectively, locally convex and Banach spaces that are in duality. Ignoring the topological structures, the homology and cohomology extend to all pairs of compact metric spaces. For locally acyclic spaces, the authors establish a natural isomorphism between their cohomology and the �...

  17. Variation in Foot Strike Patterns among Habitually Barefoot and Shod Runners in Kenya.

    Science.gov (United States)

    Lieberman, Daniel E; Castillo, Eric R; Otarola-Castillo, Erik; Sang, Meshack K; Sigei, Timothy K; Ojiambo, Robert; Okutoyi, Paul; Pitsiladis, Yannis

    2015-01-01

    Runners are often categorized as forefoot, midfoot or rearfoot strikers, but how much and why do individuals vary in foot strike patterns when running on level terrain? This study used general linear mixed-effects models to explore both intra- and inter-individual variations in foot strike pattern among 48 Kalenjin-speaking participants from Kenya who varied in age, sex, body mass, height, running history, and habitual use of footwear. High speed video was used to measure lower extremity kinematics at ground contact in the sagittal plane while participants ran down 13 meter-long tracks with three variables independently controlled: speed, track stiffness, and step frequency. 72% of the habitually barefoot and 32% of the habitually shod participants used multiple strike types, with significantly higher levels of foot strike variation among individuals who ran less frequently and who used lower step frequencies. There was no effect of sex, age, height or weight on foot strike angle, but individuals were more likely to midfoot or forefoot strike when they ran on a stiff surface, had a high preferred stride frequency, were habitually barefoot, and had more experience running. It is hypothesized that strike type variation during running, including a more frequent use of forefoot and midfoot strikes, used to be greater before the introduction of cushioned shoes and paved surfaces.

  18. Variation in Foot Strike Patterns among Habitually Barefoot and Shod Runners in Kenya.

    Directory of Open Access Journals (Sweden)

    Daniel E Lieberman

    Full Text Available Runners are often categorized as forefoot, midfoot or rearfoot strikers, but how much and why do individuals vary in foot strike patterns when running on level terrain? This study used general linear mixed-effects models to explore both intra- and inter-individual variations in foot strike pattern among 48 Kalenjin-speaking participants from Kenya who varied in age, sex, body mass, height, running history, and habitual use of footwear. High speed video was used to measure lower extremity kinematics at ground contact in the sagittal plane while participants ran down 13 meter-long tracks with three variables independently controlled: speed, track stiffness, and step frequency. 72% of the habitually barefoot and 32% of the habitually shod participants used multiple strike types, with significantly higher levels of foot strike variation among individuals who ran less frequently and who used lower step frequencies. There was no effect of sex, age, height or weight on foot strike angle, but individuals were more likely to midfoot or forefoot strike when they ran on a stiff surface, had a high preferred stride frequency, were habitually barefoot, and had more experience running. It is hypothesized that strike type variation during running, including a more frequent use of forefoot and midfoot strikes, used to be greater before the introduction of cushioned shoes and paved surfaces.

  19. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    Science.gov (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  20. Development and Testing of New Gene-Homologous EST-SSRs for Eucalyptus gomphocephala (Myrtaceae

    Directory of Open Access Journals (Sweden)

    Donna Bradbury

    2013-07-01

    Full Text Available Premise of the study: New microsatellite (simple sequence repeat [SSR] primers were developed from Eucalyptus expressed sequence tags (ESTs and optimized for genetic studies of the southwestern Australian tree E. gomphocephala, which is severely impacted by tree health decline and habitat fragmentation. Methods and Results: A total of 133 gene-homologous EST-SSR primer pairs were designed for Eucalyptus, and 44 were screened in E. gomphocephala. Of these, 17 produced reliable amplification products and 11 were polymorphic. Between two and 13 alleles were observed per locus, and observed heterozygosities ranged from 0.172 to 0.867. All 17 EST-SSRs that amplified E. gomphocephala cross-amplified to at least one of E. marginata, E. camaldulensis, and E. victrix. Conclusions: This set of EST-SSR primer pairs will be valuable tools for future population genetic studies of E. gomphocephala and other eucalypts, particularly for studying gene-linked variation and informing seed-sourcing strategies for ecological restoration.

  1. Management of patients during hunger strike and refeeding phase.

    Science.gov (United States)

    Eichelberger, M; Joray, M L; Perrig, M; Bodmer, M; Stanga, Z

    2014-01-01

    Hunger strikers resuming nutritional intake may develop a life-threatening refeeding syndrome (RFS). Consequently, hunger strikers represent a core challenge for the medical staff. The objective of the study was to test the effectiveness and safety of evidence-based recommendations for prevention and management of RFS during the refeeding phase. This was a retrospective, observational data analysis of 37 consecutive, unselected cases of prisoners on a hunger strike during a 5-y period. The sample consisted of 37 cases representing 33 individual patients. In seven cases (18.9%), the hunger strike was continued during the hospital stay, in 16 episodes (43.2%) cessation of the hunger strike occurred immediately after admission to the security ward, and in 14 episodes (37.9%) during hospital stay. In the refeed cases (n = 30), nutritional replenishment occurred orally, and in 25 (83.3%) micronutrients substitutions were made based on the recommendations. The gradual refeeding with fluid restriction occurred over 10 d. Uncomplicated dyselectrolytemia was documented in 12 cases (40%) within the refeeding phase. One case (3.3%) presented bilateral ankle edemas as a clinical manifestation of moderate RFS. Intensive medical treatment was not necessary and none of the patients died. Seven episodes of continued hunger strike were observed during the entire hospital stay without medical complications. Our data suggested that seriousness and rate of medical complications during the refeeding phase can be kept at a minimum in a hunger strike population. This study supported use of recommendations to optimize risk management and to improve treatment quality and patient safety in this vulnerable population. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Hybridization Capture Using Short PCR Products Enriches Small Genomes by Capturing Flanking Sequences (CapFlank)

    DEFF Research Database (Denmark)

    Tsangaras, Kyriakos; Wales, Nathan; Sicheritz-Pontén, Thomas

    2014-01-01

    , a non-negligible fraction of the resulting sequence reads are not homologous to the bait. We demonstrate that during capture, the bait-hybridized library molecules add additional flanking library sequences iteratively, such that baits limited to targeting relatively short regions (e.g. few hundred...... nucleotides) can result in enrichment across entire mitochondrial and bacterial genomes. Our findings suggest that some of the off-target sequences derived in capture experiments are non-randomly enriched, and that CapFlank will facilitate targeted enrichment of large contiguous sequences with minimal prior...

  3. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  4. Lion (Panthera leo) and cheetah (Acinonyx jubatus) IFN-gamma sequences.

    Science.gov (United States)

    Maas, Miriam; Van Rhijn, Ildiko; Allsopp, Maria T E P; Rutten, Victor P M G

    2010-04-15

    Cloning and sequencing of the full length lion and cheetah interferon-gamma (IFN-gamma) transcript will enable the expression of the recombinant cytokine, to be used for production of monoclonal antibodies and to set up lion and cheetah-specific IFN-gamma ELISAs. These are relevant in blood-based diagnosis of bovine tuberculosis, an important threat to lions in the Kruger National Park. Alignment of nucleotide and amino acid sequences of lion and cheetah and that of domestic cats showed homologies of 97-100%. Copyright 2009 Elsevier B.V. All rights reserved.

  5. Identification of three homologous latex-clearing protein (lcp) genes from the genome of Streptomyces sp. strain CFMR 7.

    Science.gov (United States)

    Nanthini, Jayaram; Ong, Su Yean; Sudesh, Kumar

    2017-09-10

    Rubber materials have greatly contributed to human civilization. However, being a polymeric material does not decompose easily, it has caused huge environmental problems. On the other hand, only few bacteria are known to degrade rubber, with studies pertaining them being intensively focusing on the mechanism involved in microbial rubber degradation. The Streptomyces sp. strain CFMR 7, which was previously confirmed to possess rubber-degrading ability, was subjected to whole genome sequencing using the single molecule sequencing technology of the PacBio® RS II system. The genome was further analyzed and compared with previously reported rubber-degrading bacteria in order to identify the potential genes involved in rubber degradation. This led to the interesting discovery of three homologues of latex-clearing protein (Lcp) on the chromosome of this strain, which are probably responsible for rubber degrading activities. Genes encoding oxidoreductase α-subunit (oxiA) and oxidoreductase β-subunit (oxiB) were also found downstream of two lcp genes which are located adjacent to each other. In silico analysis reveals genes that have been identified to be involved in the microbial degradation of rubber in the Streptomyces sp. strain CFMR 7. This is the first whole genome sequence of a clear-zone-forming natural rubber- degrading Streptomyces sp., which harbours three Lcp homologous genes with the presence of oxiA and oxiB genes compared to the previously reported Gordonia polyisoprenivorans strain VH2 (with two Lcp homologous genes) and Nocardia nova SH22a (with only one Lcp gene). Copyright © 2017 Elsevier B.V. All rights reserved.

  6. A simple field method to identify foot strike pattern during running.

    Science.gov (United States)

    Giandolini, Marlène; Poupard, Thibaut; Gimenez, Philippe; Horvais, Nicolas; Millet, Guillaume Y; Morin, Jean-Benoît; Samozino, Pierre

    2014-05-07

    Identifying foot strike patterns in running is an important issue for sport clinicians, coaches and footwear industrials. Current methods allow the monitoring of either many steps in laboratory conditions or only a few steps in the field. Because measuring running biomechanics during actual practice is critical, our purpose is to validate a method aiming at identifying foot strike patterns during continuous field measurements. Based on heel and metatarsal accelerations, this method requires two uniaxial accelerometers. The time between heel and metatarsal acceleration peaks (THM) was compared to the foot strike angle in the sagittal plane (αfoot) obtained by 2D video analysis for various conditions of speed, slope, footwear, foot strike and state of fatigue. Acceleration and kinematic measurements were performed at 1000Hz and 120Hz, respectively, during 2-min treadmill running bouts. Significant correlations were observed between THM and αfoot for 14 out of 15 conditions. The overall correlation coefficient was r=0.916 (Pstrike except for extreme forefoot strike during which the heel rarely or never strikes the ground, and for different footwears and states of fatigue. We proposed a classification based on THM: FFS<-5.49ms

  7. Antibodies against homologous microbial caseinolytic proteases P characterise primary biliary cirrhosis.

    Science.gov (United States)

    Bogdanos, Dimitrios-Petrou; Baum, Harold; Sharma, Umesh C; Grasso, Alessandro; Ma, Yun; Burroughs, Andrew K; Vergani, Diego

    2002-01-01

    Antibodies to caseinolytic protease P(177-194) (ClpP(177-194)) of the proteolytic subunit of the Clp complex of Escherichia coli (E. coli) are uniquely present in primary biliary cirrhosis (PBC). Molecular mimicry between the regulatory subunit ClpX and the principal T-cell epitope of pyruvate dehydrogenase complex (PDC-E2) in PBC, has been proposed to account for this. Since ClpP is highly conserved among bacteria we investigated whether the micro-organisms triggering these antibodies may be other than E. coli. E. coli ClpP(177-194) is homologous with ClpP peptides of Yersinia enterocolitica (YEREN) and Haemophilus influenzae (HAEIN). Enzyme linked immunosorbent assay (ELISA) reactivity to these peptides was tested in 45 patients with PBC, 44 pathological and 32 healthy controls. Reactivity to at least one of the ClpP peptides was observed in 21 (47%) PBC patients, 5.8% pathological and 3.1% healthy controls (PECOLI ClpP(177-194), alone or in association with YEREN and/or HAEIN peptides, compared to three (14.2%) reactive with YEREN, two (9.5%) with YEREN/HAEIN and one (4.7%) with HAEIN peptide. Simultaneous reactivity to homologous sequences was due to cross-reactivity as confirmed by competition ELISAs. The PBC-specificity of anti-microbial ClpP reactivity is confirmed: the questions as to primary trigger(s) and relevance to PBC pathogenesis remain open.

  8. (D,A)∞-modules over (D,A)∞-algebras and spectral sequences

    International Nuclear Information System (INIS)

    Lapin, S V

    2002-01-01

    We introduce the construction of a (D,A) ∞ -(co)module over a (D,A) ∞ -(co) algebra and study its main homotopy properties. We establish a connection between (D,A) ∞ -(co)modules over (D,A) ∞ -(co)algebras and spectral sequences, and thus obtain the structure of an A ∞ -comodule over the Milnor A ∞ -coalgebra on the homology of any spectrum directly from the differentials of the Adams spectral sequence of this spectrum

  9. The Complete Genome Sequence of Herpesvirus Papio 2 (Cercopithecine Herpesvirus 16) Shows Evidence of Recombination Events among Various Progenitor Herpesviruses†

    Science.gov (United States)

    Tyler, Shaun D.; Severini, Alberto

    2006-01-01

    We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an “a” sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (γ134.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses. PMID:16414998

  10. The complete genome sequence of herpesvirus papio 2 (Cercopithecine herpesvirus 16) shows evidence of recombination events among various progenitor herpesviruses.

    Science.gov (United States)

    Tyler, Shaun D; Severini, Alberto

    2006-02-01

    We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an "a" sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (gamma(1)34.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses.

  11. Foot strike patterns of recreational and sub-elite runners in a long-distance road race.

    Science.gov (United States)

    Larson, Peter; Higgins, Erin; Kaminski, Justin; Decker, Tamara; Preble, Janine; Lyons, Daniela; McIntyre, Kevin; Normile, Adam

    2011-12-01

    Although the biomechanical properties of the various types of running foot strike (rearfoot, midfoot, and forefoot) have been studied extensively in the laboratory, only a few studies have attempted to quantify the frequency of running foot strike variants among runners in competitive road races. We classified the left and right foot strike patterns of 936 distance runners, most of whom would be considered of recreational or sub-elite ability, at the 10 km point of a half-marathon/marathon road race. We classified 88.9% of runners at the 10 km point as rearfoot strikers, 3.4% as midfoot strikers, 1.8% as forefoot strikers, and 5.9% of runners exhibited discrete foot strike asymmetry. Rearfoot striking was more common among our sample of mostly recreational distance runners than has been previously reported for samples of faster runners. We also compared foot strike patterns of 286 individual marathon runners between the 10 km and 32 km race locations and observed increased frequency of rearfoot striking at 32 km. A large percentage of runners switched from midfoot and forefoot foot strikes at 10 km to rearfoot strikes at 32 km. The frequency of discrete foot strike asymmetry declined from the 10 km to the 32 km location. Among marathon runners, we found no significant relationship between foot strike patterns and race times.

  12. Expeditionary Strike Group: Command Structure Design Support

    National Research Council Canada - National Science Library

    Hutchins, Susan G; Kemple, William G; Kleinman, David L; Hocevar, Susan P

    2005-01-01

    An Expeditionary Strike Group (ESG) is a new capability mix that combines the combat power of three surface combatants and one submarine with an Amphibious Readiness Group/ Marine Expeditionary Unit...

  13. Complete Genome Sequences of Four Isolates of Plutella xylostella Granulovirus.

    Science.gov (United States)

    Spence, Robert J; Noune, Christopher; Hauxwell, Caroline

    2016-06-30

    Granuloviruses are widespread pathogens of Plutella xylostella L. (diamondback moth) and potential biopesticides for control of this global insect pest. We report the complete genomes of four Plutella xylostella granulovirus isolates from China, Malaysia, and Taiwan exhibiting pairs of noncoding, homologous repeat regions with significant sequence variation but equivalent length. Copyright © 2016 Spence et al.

  14. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  15. Several aspects of some techniques avoiding homologous blood transfusions

    NARCIS (Netherlands)

    E.C.S.M. van Woerkens (Liesbeth)

    1998-01-01

    textabstractThe use of homologous blood products during anesthesia and surgery is not without risks. Complications due to homologous blood transfusions include transfusion reactions, isosensitization, transmission of infections (including HIV, hepatitis, CMV) and immunosuppression (resuiting in

  16. Electric converters of electromagnetic strike machine with battery power

    Science.gov (United States)

    Usanov, K. M.; Volgin, A. V.; Kargin, V. A.; Moiseev, A. P.; Chetverikov, E. A.

    2018-03-01

    At present, the application of pulse linear electromagnetic engines to drive strike machines for immersion of rod elements into the soil, strike drilling of shallow wells, dynamic probing of soils is recognized as quite effective. The pulse linear electromagnetic engine performs discrete consumption and conversion of electrical energy into mechanical work. Pulse dosing of a stream transmitted by the battery source to the pulse linear electromagnetic engine of the energy is provided by the electrical converter. The electric converters with the control of an electromagnetic strike machine as functions of time and armature movement, which form the unipolar supply pulses of voltage and current necessary for the normal operation of a pulse linear electromagnetic engine, are proposed. Electric converters are stable in operation, implement the necessary range of output parameters control determined by the technological process conditions, have noise immunity and automatic disconnection of power supply in emergency modes.

  17. Strike-slip tectonics during rift linkage

    Science.gov (United States)

    Pagli, C.; Yun, S. H.; Ebinger, C.; Keir, D.; Wang, H.

    2017-12-01

    The kinematics of triple junction linkage and the initiation of transforms in magmatic rifts remain debated. Strain patterns from the Afar triple junction provide tests of current models of how rifts grow to link in area of incipient oceanic spreading. Here we present a combined analysis of seismicity, InSAR and GPS derived strain rate maps to reveal that the plate boundary deformation in Afar is accommodated primarily by extensional tectonics in the Red Sea and Gulf of Aden rifts, and does not require large rotations about vertical axes (bookshelf faulting). Additionally, models of stress changes and seismicity induced by recent dykes in one sector of the Afar triple junction provide poor fit to the observed strike-slip earthquakes. Instead we explain these patterns as rift-perpendicular shearing at the tips of spreading rifts where extensional strains terminate against less stretched lithosphere. Our results demonstrate that rift-perpendicular strike-slip faulting between rift segments achieves plate boundary linkage during incipient seafloor spreading.

  18. Sequence-based Screening for Rare Enzymes: New Insights into the World of AMDases Reveal a Conserved Motif and 58 Novel Enzymes Clustering in Eight Distinct Families.

    Directory of Open Access Journals (Sweden)

    Janine Maimanakos

    2016-08-01

    Full Text Available Arylmalonate-Decarboxylases (AMDases, EC 4.1.1.76 are very rare and mostly underexplored enzymes. Currently only four known and biochemically characterized representatives exist. However, their ability to decarboxylate α-disubstituted malonic acid derivatives to optically pure products without cofactors makes them attractive and promising candidates for the use as biocatalysts in industrial processes. Until now, AMDases could not be separated from other members of the aspartate/glutamate racemase superfamily based on their gene sequences. Within this work, a search algorithm was developed that enables a reliable prediction of AMDase activity for potential candidates. Based on specific sequence patterns and screening methods 58 novel AMDase candidate genes could be identified in this work. Thereby, AMDases with the conserved sequence pattern of Bordetella bronchiseptica’s prototype appeared to be limited to the classes of Alpha-, Beta- and Gammaproteobacteria. Amino acid homologies and comparison of gene surrounding sequences enabled the classification of eight enzyme clusters. Particularly striking is the accumulation of genes coding for different transporters of the TTT family, TRAP transporters and ABC transporters as well as genes coding for mandelate racemases/muconate lactonizing enzymes that might be involved in substrate uptake or degradation of AMDase products. Further, three novel AMDases were characterized which showed a high enantiomeric excess (>99% of the (R-enantiomer of flurbiprofen. These are the recombinant AmdA and AmdV from Variovorax sp. strains HH01 and HH02, originated from soil, and AmdP from Polymorphum gilvum found by a data base search. Altogether our findings give new insights into the class of AMDases and reveal many previously unknown enzyme candidates with high potential for bioindustrial processes.

  19. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  20. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  1. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  2. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  3. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  4. Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qin Li

    2016-07-01

    Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  5. SPOT-ligand 2: improving structure-based virtual screening by binding-homology search on an expanded structural template library.

    Science.gov (United States)

    Litfin, Thomas; Zhou, Yaoqi; Yang, Yuedong

    2017-04-15

    The high cost of drug discovery motivates the development of accurate virtual screening tools. Binding-homology, which takes advantage of known protein-ligand binding pairs, has emerged as a powerful discrimination technique. In order to exploit all available binding data, modelled structures of ligand-binding sequences may be used to create an expanded structural binding template library. SPOT-Ligand 2 has demonstrated significantly improved screening performance over its previous version by expanding the template library 15 times over the previous one. It also performed better than or similar to other binding-homology approaches on the DUD and DUD-E benchmarks. The server is available online at http://sparks-lab.org . yaoqi.zhou@griffith.edu.au or yuedong.yang@griffith.edu.au. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  6. Khovanov homology for virtual knots with arbitrary coefficients

    International Nuclear Information System (INIS)

    Manturov, Vassily O

    2007-01-01

    The Khovanov homology theory over an arbitrary coefficient ring is extended to the case of virtual knots. We introduce a complex which is well-defined in the virtual case and is homotopy equivalent to the original Khovanov complex in the classical case. Unlike Khovanov's original construction, our definition of the complex does not use any additional prescription of signs to the edges of a cube. Moreover, our method enables us to construct a Khovanov homology theory for 'twisted virtual knots' in the sense of Bourgoin and Viro (including knots in three-dimensional projective space). We generalize a number of results of Khovanov homology theory (the Wehrli complex, minimality problems, Frobenius extensions) to virtual knots with non-orientable atoms

  7. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  8. Lightning Strike Induced Damage Mechanisms of Carbon Fiber Composites

    Science.gov (United States)

    Kawakami, Hirohide

    Composite materials have a wide application in aerospace, automotive, and other transportation industries, because of the superior structural and weight performances. Since carbon fiber reinforced polymer composites possess a much lower electrical conductivity as compared to traditional metallic materials utilized for aircraft structures, serious concern about damage resistance/tolerance against lightning has been rising. Main task of this study is to clarify the lightning damage mechanism of carbon fiber reinforced epoxy polymer composites to help further development of lightning strike protection. The research on lightning damage to carbon fiber reinforced polymer composites is quite challenging, and there has been little study available until now. In order to tackle this issue, building block approach was employed. The research was started with the development of supporting technologies such as a current impulse generator to simulate a lightning strike in a laboratory. Then, fundamental electrical properties and fracture behavior of CFRPs exposed to high and low level current impulse were investigated using simple coupon specimens, followed by extensive parametric investigations in terms of different prepreg materials frequently used in aerospace industry, various stacking sequences, different lightning intensity, and lightning current waveforms. It revealed that the thermal resistance capability of polymer matrix was one of the most influential parameters on lightning damage resistance of CFRPs. Based on the experimental findings, the semi-empirical analysis model for predicting the extent of lightning damage was established. The model was fitted through experimental data to determine empirical parameters and, then, showed a good capability to provide reliable predictions for other test conditions and materials. Finally, structural element level lightning tests were performed to explore more practical situations. Specifically, filled-hole CFRP plates and patch

  9. Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.

    OpenAIRE

    Martin, M E; Piette, J; Yaniv, M; Tang, W J; Folk, W R

    1988-01-01

    The polyomavirus enhancer is composed of multiple DNA sequence elements serving as binding sites for proteins present in mouse nuclear extracts that activate transcription and DNA replication. We have identified three such proteins and their binding sites and correlate them with enhancer function. Mutation of nucleotide (nt) 5140 in the enhancer alters the binding site (TGACTAA, nt 5139-5145) for polyomavirus enhancer A binding protein 1 (PEA1), a murine homolog of the human transcription fac...

  10. BIRD/WILDLIFE STRIKE CONTROL FOR SAFER AIR ...

    African Journals Online (AJOL)

    Osondu

    2012-06-05

    Jun 5, 2012 ... Several factors including lack of adequate data, shortage of funds, inadequate training of staff and lack of ... Keywords: bird/wildlife, strike, aviation, hazard, control. Introduction ..... implications of some human activities within.

  11. Electric converters of electromagnetic strike machine with capacitor supply

    Science.gov (United States)

    Usanov, K. M.; Volgin, A. V.; Kargin, V. A.; Moiseev, A. P.; Chetverikov, E. A.

    2018-03-01

    The application of pulse linear electromagnetic engines in small power strike machines (energy impact is 0.01...1.0 kJ), where the characteristic mode of rare beats (pulse seismic vibrator, the arch crash device bins bulk materials), is quite effective. At the same time, the technical and economic performance of such machines is largely determined by the ability of the power source to provide a large instantaneous power of the supply pulses in the winding of the linear electromagnetic motor. The use of intermediate energy storage devices in power systems of rare-shock LEME makes it possible to obtain easily large instantaneous powers, forced energy conversion, and increase the performance of the machine. A capacitor power supply of a pulsed source of seismic waves is proposed for the exploration of shallow depths. The sections of the capacitor storage (CS) are connected to the winding of the linear electromagnetic motor by thyristor dischargers, the sequence of activation of which is determined by the control device. The charge of the capacitors to the required voltage is made directly from the battery source, or through the converter from a battery source with a smaller number of batteries.

  12. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) for directed enzyme evolution.

    Science.gov (United States)

    Gonzalez-Perez, David; Molina-Espeja, Patricia; Garcia-Ruiz, Eva; Alcalde, Miguel

    2014-01-01

    Approaches that depend on directed evolution require reliable methods to generate DNA diversity so that mutant libraries can focus on specific target regions. We took advantage of the high frequency of homologous DNA recombination in Saccharomyces cerevisiae to develop a strategy for domain mutagenesis aimed at introducing and in vivo recombining random mutations in defined segments of DNA. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) is a one-pot random mutagenic method for short protein regions that harnesses the in vivo recombination apparatus of yeast. Using this approach, libraries can be prepared with different mutational loads in DNA segments of less than 30 amino acids so that they can be assembled into the remaining unaltered DNA regions in vivo with high fidelity. As a proof of concept, we present two eukaryotic-ligninolytic enzyme case studies: i) the enhancement of the oxidative stability of a H2O2-sensitive versatile peroxidase by independent evolution of three distinct protein segments (Leu28-Gly57, Leu149-Ala174 and Ile199-Leu268); and ii) the heterologous functional expression of an unspecific peroxygenase by exclusive evolution of its native 43-residue signal sequence.

  13. Homology analysis and cross-immunogenicity of OmpA from pathogenic Yersinia enterocolitica, Yersinia pseudotuberculosis and Yersinia pestis.

    Science.gov (United States)

    Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin

    2015-12-01

    The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Parametric representation of centrifugal pump homologous curves

    International Nuclear Information System (INIS)

    Veloso, Marcelo A.; Mattos, Joao R.L. de

    2015-01-01

    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

  15. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

    Science.gov (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

    2012-06-26

    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  16. Primary homologies of the circumorbital bones of snakes.

    Science.gov (United States)

    Palci, Alessandro; Caldwell, Michael W

    2013-09-01

    Some snakes have two circumorbital ossifications that in the current literature are usually referred to as the postorbital and supraorbital. We review the arguments that have been proposed to justify this interpretation and provide counter-arguments that reject those conjectures of primary homology based on the observation of 32 species of lizards and 81 species of snakes (both extant and fossil). We present similarity arguments, both topological and structural, for reinterpretation of the primary homologies of the dorsal and posterior orbital ossifications of snakes. Applying the test of similarity, we conclude that the posterior orbital ossification of snakes is topologically consistent as the homolog of the lacertilian jugal, and that the dorsal orbital ossification present in some snakes (e.g., pythons, Loxocemus, and Calabaria) is the homolog of the lacertilian postfrontal. We therefore propose that the terms postorbital and supraorbital should be abandoned as reference language for the circumorbital bones of snakes, and be replaced with the terms jugal and postfrontal, respectively. The primary homology claim for the snake "postorbital" fails the test of similarity, while the term "supraorbital" is an unnecessary and inaccurate application of the concept of a neomorphic ossification, for an element that passes the test of similarity as a postfrontal. This reinterpretation of the circumorbital bones of snakes is bound to have important repercussions for future phylogenetic analyses and consequently for our understanding of the origin and evolution of snakes. Copyright © 2013 Wiley Periodicals, Inc.

  17. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  18. Electrically conductive carbon fibre-reinforced composite for aircraft lightning strike protection

    Science.gov (United States)

    Katunin, Andrzej; Krukiewicz, Katarzyna; Turczyn, Roman; Sul, Przemysław; Bilewicz, Marcin

    2017-05-01

    Aircraft elements, especially elements of exterior fuselage, are subjected to damage caused by lightning strikes. Due to the fact that these elements are manufactured from polymeric composites in modern aircraft, and thus, they cannot conduct electrical charges, the lightning strikes cause burnouts in composite structures. Therefore, the effective lightning strike protection for such structures is highly desired. The solution presented in this paper is based on application of organic conductive fillers in the form of intrinsically conducting polymers and carbon fabric in order to ensure electrical conductivity of whole composite and simultaneously retain superior mechanical properties. The presented studies cover synthesis and manufacturing of the electrically conductive composite as well as its characterization with respect to mechanical and electrical properties. The performed studies indicate that the proposed material can be potentially considered as a constructional material for aircraft industry, which characterizes by good operational properties and low cost of manufacturing with respect to current lightning strike protection materials solutions.

  19. 2005 Significant U.S. Hurricane Strikes Poster

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The 2005 Significant U.S. Hurricane Strikes poster is one of two special edition posters for the Atlantic Hurricanes. This beautiful poster contains two sets of...

  20. Are physicians strikes ever morally justifiable? A call for a return to tradition

    Directory of Open Access Journals (Sweden)

    Munyaradzi Mawere

    2010-08-01

    Full Text Available Though physicians strike provides an opportunity to generate more knowledge about the process in which legitimacy of an organization can be restored, it meets with a great deal of resistance not only by the public but from within the medical profession. This paper critically examines the legitimacy of strike by medical doctors heretofore referred to as physicians. Though critically reflecting on strikes of physicians in general, the paper makes more emphasis on Africa where physician strikes are rampant. More importantly, the paper argues that strike implies a failure for everyone in the organization (including the strikers themselves, not only the responsible government or authority. This is because when a strike occurs, an organization/fraternity is subjected to questions, scrutiny and slander. It becomes difficult to decouple what is said, decided and done. Traditionally, all medical fraternities the world-over are committed to acting comfortably to external demands- guaranteeing the patients lives and public health. By paying attention to external reactions, the medical fraternity adapts and learns what ought and should be done so that it is never again caught in the same messy. At the same time, the fraternity prepares itself for the future strikes. When the fraternity and those outside consider it is doing up to the external expectations, its lost legitimacy is restored. When legitimacy is restored, external pressure like once disturbed water returns to normal

  1. Remarkable rates of lightning strike mortality in Malawi.

    Science.gov (United States)

    Mulder, Monique Borgerhoff; Msalu, Lameck; Caro, Tim; Salerno, Jonathan

    2012-01-01

    Livingstone's second mission site on the shore of Lake Malawi suffers very high rates of consequential lightning strikes. Comprehensive interviewing of victims and their relatives in seven Traditional Authorities in Nkhata Bay District, Malawi revealed that the annual rate of consequential strikes was 419/million, more than six times higher than that in other developing countries; the rate of deaths from lightning was 84/million/year, 5.4 times greater than the highest ever recorded. These remarkable figures reveal that lightning constitutes a significant stochastic source of mortality with potential life history consequences, but it should not deflect attention away from the more prominent causes of mortality in this rural area.

  2. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  3. Recovery of arrested replication forks by homologous recombination is error-prone.

    Directory of Open Access Journals (Sweden)

    Ismail Iraqui

    Full Text Available Homologous recombination is a universal mechanism that allows repair of DNA and provides support for DNA replication. Homologous recombination is therefore a major pathway that suppresses non-homology-mediated genome instability. Here, we report that recovery of impeded replication forks by homologous recombination is error-prone. Using a fork-arrest-based assay in fission yeast, we demonstrate that a single collapsed fork can cause mutations and large-scale genomic changes, including deletions and translocations. Fork-arrest-induced gross chromosomal rearrangements are mediated by inappropriate ectopic recombination events at the site of collapsed forks. Inverted repeats near the site of fork collapse stimulate large-scale genomic changes up to 1,500 times over spontaneous events. We also show that the high accuracy of DNA replication during S-phase is impaired by impediments to fork progression, since fork-arrest-induced mutation is due to erroneous DNA synthesis during recovery of replication forks. The mutations caused are small insertions/duplications between short tandem repeats (micro-homology indicative of replication slippage. Our data establish that collapsed forks, but not stalled forks, recovered by homologous recombination are prone to replication slippage. The inaccuracy of DNA synthesis does not rely on PCNA ubiquitination or trans-lesion-synthesis DNA polymerases, and it is not counteracted by mismatch repair. We propose that deletions/insertions, mediated by micro-homology, leading to copy number variations during replication stress may arise by progression of error-prone replication forks restarted by homologous recombination.

  4. The cohesion protein SOLO associates with SMC1 and is required for synapsis, recombination, homolog bias and cohesion and pairing of centromeres in Drosophila Meiosis.

    Science.gov (United States)

    Yan, Rihui; McKee, Bruce D

    2013-01-01

    Cohesion between sister chromatids is mediated by cohesin and is essential for proper meiotic segregation of both sister chromatids and homologs. solo encodes a Drosophila meiosis-specific cohesion protein with no apparent sequence homology to cohesins that is required in male meiosis for centromere cohesion, proper orientation of sister centromeres and centromere enrichment of the cohesin subunit SMC1. In this study, we show that solo is involved in multiple aspects of meiosis in female Drosophila. Null mutations in solo caused the following phenotypes: 1) high frequencies of homolog and sister chromatid nondisjunction (NDJ) and sharply reduced frequencies of homolog exchange; 2) reduced transmission of a ring-X chromosome, an indicator of elevated frequencies of sister chromatid exchange (SCE); 3) premature loss of centromere pairing and cohesion during prophase I, as indicated by elevated foci counts of the centromere protein CID; 4) instability of the lateral elements (LE)s and central regions of synaptonemal complexes (SCs), as indicated by fragmented and spotty staining of the chromosome core/LE component SMC1 and the transverse filament protein C(3)G, respectively, at all stages of pachytene. SOLO and SMC1 are both enriched on centromeres throughout prophase I, co-align along the lateral elements of SCs and reciprocally co-immunoprecipitate from ovarian protein extracts. Our studies demonstrate that SOLO is closely associated with meiotic cohesin and required both for enrichment of cohesin on centromeres and stable assembly of cohesin into chromosome cores. These events underlie and are required for stable cohesion of centromeres, synapsis of homologous chromosomes, and a recombination mechanism that suppresses SCE to preferentially generate homolog crossovers (homolog bias). We propose that SOLO is a subunit of a specialized meiotic cohesin complex that mediates both centromeric and axial arm cohesion and promotes homolog bias as a component of chromosome

  5. Continental United States Hurricane Strikes 1950-2012

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Continental U.S. Hurricane Strikes Poster is our most popular poster which is updated annually. The poster includes all hurricanes that affected the U.S. since...

  6. Sequence analysis of RNase MRP RNA reveals its origination from eukaryotic RNase P RNA

    Science.gov (United States)

    Zhu, Yanglong; Stribinskis, Vilius; Ramos, Kenneth S.; Li, Yong

    2006-01-01

    RNase MRP is a eukaryote-specific endoribonuclease that generates RNA primers for mitochondrial DNA replication and processes precursor rRNA. RNase P is a ubiquitous endoribonuclease that cleaves precursor tRNA transcripts to produce their mature 5′ termini. We found extensive sequence homology of catalytic domains and specificity domains between their RNA subunits in many organisms. In Candida glabrata, the internal loop of helix P3 is 100% conserved between MRP and P RNAs. The helix P8 of MRP RNA from microsporidia Encephalitozoon cuniculi is identical to that of P RNA. Sequence homology can be widely spread over the whole molecule of MRP RNA and P RNA, such as those from Dictyostelium discoideum. These conserved nucleotides between the MRP and P RNAs strongly support the hypothesis that the MRP RNA is derived from the P RNA molecule in early eukaryote evolution. PMID:16540690

  7. Tomato Cf resistance proteins mediate recognition of cognate homologous effectors from fungi pathogenic on dicots and monocots.

    Science.gov (United States)

    Stergiopoulos, Ioannis; van den Burg, Harrold A; Okmen, Bilal; Beenen, Henriek G; van Liere, Sabine; Kema, Gert H J; de Wit, Pierre J G M

    2010-04-20

    Most fungal effectors characterized so far are species-specific and facilitate virulence on a particular host plant. During infection of its host tomato, Cladosporium fulvum secretes effectors that function as virulence factors in the absence of cognate Cf resistance proteins and induce effector-triggered immunity in their presence. Here we show that homologs of the C. fulvum Avr4 and Ecp2 effectors are present in other pathogenic fungi of the Dothideomycete class, including Mycosphaerella fijiensis, the causal agent of black Sigatoka disease of banana. We demonstrate that the Avr4 homolog of M. fijiensis is a functional ortholog of C. fulvum Avr4 that protects fungal cell walls against hydrolysis by plant chitinases through binding to chitin and, despite the low overall sequence homology, triggers a Cf-4-mediated hypersensitive response (HR) in tomato. Furthermore, three homologs of C. fulvum Ecp2 are found in M. fijiensis, one of which induces different levels of necrosis or HR in tomato lines that lack or contain a putative cognate Cf-Ecp2 protein, respectively. In contrast to Avr4, which acts as a defensive virulence factor, M. fijiensis Ecp2 likely promotes virulence by interacting with a putative host target causing host cell necrosis, whereas Cf-Ecp2 could possibly guard the virulence target of Ecp2 and trigger a Cf-Ecp2-mediated HR. Overall our data suggest that Avr4 and Ecp2 represent core effectors that are collectively recognized by single cognate Cf-proteins. Transfer of these Cf genes to plant species that are attacked by fungi containing these cognate core effectors provides unique ways for breeding disease-resistant crops.

  8. Preserved irradiated homologous cartilage for orbital reconstruction

    International Nuclear Information System (INIS)

    Linberg, J.V.; Anderson, R.L.; Edwards, J.J.; Panje, W.R.; Bardach, J.

    1980-01-01

    Human costal cartilage is an excellent implant material for orbital and periorbital reconstruction because of its light weight, strength, homogeneous consistency and the ease with which it can be carved. Its use has been limited by the necessity of a separate surgical procedure to obtain the material. Preserved irradiated homologous cartilage has been shown to have almost all the autogenous cartilage and is convenient to use. Preserved irradiated homologous cartilage transplants do not elicit rejection reactions, resist infection and rarely undergo absorption

  9. Cloning and sequencing of Indian Water buffalo (Bubalus bubalis) interleukin-3 cDNA

    KAUST Repository

    Sugumar, Thennarasu

    2011-12-12

    Full-length cDNA (435 bp) of the interleukin-3(IL-3) gene of the Indian water buffalo was amplified by reverse transcriptase-polymerase chain reaction and sequenced. This sequence had 96% nucleotide identity and 92% amino acid identity with bovine IL-3. There are 10 amino acid substitutions in buffalo compared with that of bovine. The amino acid sequence of buffalo IL-3 also showed very high identity with that of other ruminants, indicating functional cross-reactivity. Structural homology modelling of buffalo IL-3 protein with human IL-3 showed the presence of five helical structures.

  10. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  11. Determining and comparing protein function in Bacterial genome sequences

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla

    of this class have very little homology to other known genomes making functional annotation based on sequence similarity very difficult. Inspired in part by this analysis, an approach for comparative functional annotation was created based public sequenced genomes, CMGfunc. Functionally related groups......In November 2013, there was around 21.000 different prokaryotic genomes sequenced and publicly available, and the number is growing daily with another 20.000 or more genomes expected to be sequenced and deposited by the end of 2014. An important part of the analysis of this data is the functional...... annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...

  12. Survival and Diversity of Human Homologous Dietary MicroRNAs in Conventionally Cooked Top Sirloin and Dried Bovine Tissue Extracts.

    Directory of Open Access Journals (Sweden)

    Joseph T Dever

    Full Text Available Dietary microRNAs (miRNAs, notably those found in milk, are currently being investigated for their potential to elicit biological effects via canonical binding to human messenger RNA targets once ingested. Besides milk, beef and other bovine tissue-derived ingredients could also be a relevant source of potentially bioactive dietary miRNAs. In this study, we characterized the human homologous miRNA profiles in food-grade, bovine-sourced sirloin, heart and adrenal tissue (raw, cooked, and pasteurized, freeze-dried extracts via deep-sequencing and quantitative reverse transcription PCR (RT-qPCR. A total of 198 human homologous miRNAs were detected at 10 or more normalized reads in all replicates (n = 3 of at least one preparation method. Tissue origin rather than preparation method was the major differentiating factor of miRNA profiles, and adrenal-based miRNA profiles were the most distinct. The ten most prevalent miRNAs in each tissue represented 71-93% of the total normalized counts for all annotated miRNAs. In cooked sirloin, the most abundant miRNAs were miR-10b-5p, (48.8% of total annotated miRNA reads along with the muscle-specific miR-1 (24.1% and miR-206 (4.8%. In dried heart extracts, miR-1 (17.0%, miR-100-5p (16.1% and miR-99a-5p (11.0% gave the highest normalized read counts. In dried adrenal extracts, miR-10b-5p (71.2% was the most prominent followed by miR-143-3p (7.1% and 146b-5p (3.7%. Sequencing results for five detected and two undetected miRNAs were successfully validated by RT-qPCR. We conclude that edible, bovine tissues contain unique profiles of human homologous dietary miRNAs that survive heat-based preparation methods.

  13. Collective Labor Disputes and Strikes in Russia: The Impact of Judicial Precedents and Enforcement

    Directory of Open Access Journals (Sweden)

    Elena Gerasimova

    2017-01-01

    Full Text Available The right to strike is recognized in the Constitution and the Labor Code of the Russian Federation as a means to resolve collective labor disputes. However, in Russia labor protests come up for discussion much more frequently than strikes. In recent years the number of labor protests in Russia, including various forms of work stoppage, has increased significantly compared to previous years, but the number of legally constituted collective labor disputes and strikes has remained very low. The legislation on resolution of collective labor disputes and mounting strikes is quite restrictive in Russia, and its enforcement also encourages employees to seek alternative ways to settle collective labor conflicts. There is little empirical research on the judicial implementation of these norms and its influence on the enforcement of legislation. Therefore, this paper analyses the reasoning of courts in cases on the legality of strikes, their interpretations of the law, and the impact these decisions have on the enforcement of the legislation on resolution of collective labor disputes and strikes. Our conclusion is that the courts act as another restrictive influence on the resolution of collective labor disputes and the exercise of the right to strike in Russia.

  14. Expert Anticipatory Skill in Striking Sports: A Review and a Model

    Science.gov (United States)

    Muller, Sean; Abernethy, Bruce

    2012-01-01

    Expert performers in striking sports can hit objects moving at high speed with incredible precision. Exceptionally well developed anticipation skills are necessary to cope with the severe constraints on interception. In this paper, we provide a review of the empirical evidence regarding expert interception in striking sports and propose a…

  15. The balancing act between the constitutional right to strike and the ...

    African Journals Online (AJOL)

    While the South African Constitution enshrines both children's right to a basic education and teachers' right to strike, conflict between these two often occurs when the way in which teachers' unions conduct strike actions detracts from learners' education. This article identifies the parties affected by industrial action in the ...

  16. Homological methods, representation theory, and cluster algebras

    CERN Document Server

    Trepode, Sonia

    2018-01-01

    This text presents six mini-courses, all devoted to interactions between representation theory of algebras, homological algebra, and the new ever-expanding theory of cluster algebras. The interplay between the topics discussed in this text will continue to grow and this collection of courses stands as a partial testimony to this new development. The courses are useful for any mathematician who would like to learn more about this rapidly developing field; the primary aim is to engage graduate students and young researchers. Prerequisites include knowledge of some noncommutative algebra or homological algebra. Homological algebra has always been considered as one of the main tools in the study of finite-dimensional algebras. The strong relationship with cluster algebras is more recent and has quickly established itself as one of the important highlights of today’s mathematical landscape. This connection has been fruitful to both areas—representation theory provides a categorification of cluster algebras, wh...

  17. Joint contact loading in forefoot and rearfoot strike patterns during running.

    Science.gov (United States)

    Rooney, Brandon D; Derrick, Timothy R

    2013-09-03

    Research concerning forefoot strike pattern (FFS) versus rearfoot strike pattern (RFS) running has focused on the ground reaction force even though internal joint contact forces are a more direct measure of the loads responsible for injury. The main purpose of this study was to determine the internal loading of the joints for each strike pattern. A secondary purpose was to determine if converted FFS and RFS runners can adequately represent habitual runners with regards to the internal joint loading. Using inverse dynamics to calculate the net joint moments and reaction forces and optimization techniques to estimate muscle forces, we determined the axial compressive loading at the ankle, knee, and hip. Subjects consisted of 15 habitual FFS and 15 habitual RFS competitive runners. Each subject ran at a preferred running velocity with their habitual strike pattern and then converted to the opposite strike pattern. Plantar flexor muscle forces and net ankle joint moments were greater in the FFS running compared to the RFS running during the first half of the stance phase. The average contact forces during this period increased by 41.7% at the ankle and 14.4% at the knee joint during FFS running. Peak ankle joint contact force was 1.5 body weights greater during FFS running (pstrike pattern. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.

    Science.gov (United States)

    Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S

    1985-07-01

    The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.

  19. Phylogenomics of Phrynosomatid Lizards: Conflicting Signals from Sequence Capture versus Restriction Site Associated DNA Sequencing

    Science.gov (United States)

    Leaché, Adam D.; Chavez, Andreas S.; Jones, Leonard N.; Grummer, Jared A.; Gottscho, Andrew D.; Linkem, Charles W.

    2015-01-01

    Sequence capture and restriction site associated DNA sequencing (RADseq) are popular methods for obtaining large numbers of loci for phylogenetic analysis. These methods are typically used to collect data at different evolutionary timescales; sequence capture is primarily used for obtaining conserved loci, whereas RADseq is designed for discovering single nucleotide polymorphisms (SNPs) suitable for population genetic or phylogeographic analyses. Phylogenetic questions that span both “recent” and “deep” timescales could benefit from either type of data, but studies that directly compare the two approaches are lacking. We compared phylogenies estimated from sequence capture and double digest RADseq (ddRADseq) data for North American phrynosomatid lizards, a species-rich and diverse group containing nine genera that began diversifying approximately 55 Ma. Sequence capture resulted in 584 loci that provided a consistent and strong phylogeny using concatenation and species tree inference. However, the phylogeny estimated from the ddRADseq data was sensitive to the bioinformatics steps used for determining homology, detecting paralogs, and filtering missing data. The topological conflicts among the SNP trees were not restricted to any particular timescale, but instead were associated with short internal branches. Species tree analysis of the largest SNP assembly, which also included the most missing data, supported a topology that matched the sequence capture tree. This preferred phylogeny provides strong support for the paraphyly of the earless lizard genera Holbrookia and Cophosaurus, suggesting that the earless morphology either evolved twice or evolved once and was subsequently lost in Callisaurus. PMID:25663487

  20. Properties of Lightning Strike Protection Coatings

    Science.gov (United States)

    Gagne, Martin

    Composite materials are being increasingly used by many industries. In the case of aerospace companies, those materials are installed on their aircraft to save weight, and thus, fuel costs. These aircraft are lighter, but the loss of electrical conductivity makes aircraft vulnerable to lightning strikes, which hit commercial aircrafts on average once per year. This makes lightning strike protection very important, and while current metallic expanded copper foils offer good protection, they increase the weight of composites. Therefore, under the CRIAQ COMP-502 project, a team of industrial partners and academic researchers are investigating new conductive coatings with the following characteristics: High electromagnetic protection, high mechanical resistance, good environmental protection, manufacturability and moderate cost. The main objectives of this thesis, as part of this project, was to determine the main characteristics, such as electrical and tribomechanical properties, of conductive coatings on composite panels. Their properties were also to be tested after destructive tests such as current injection and environmental testing. Bombardier Aerospace provided the substrate, a composite of carbon fiber reinforced epoxy matrix, and the current commercial product, a surfacing film that includes an expanded copper foil used to compare with the other coatings. The conductive coatings fabricated by the students are: silver nanoparticles inside a binding matrix (PEDOT:PSS or a mix of Epoxy and PEDOT:PSS), silvered carbon nanofibers embedded in the surfacing film, cold sprayed tin, graphene oxide functionalized with silver nanowires, and electroless plated silver. Additionally as part of the project and thesis, magnetron sputtered aluminum coated samples were fabricated. There are three main types of tests to characterize the conductive coatings: electrical, mechanical and environmental. Electrical tests consist of finding the sheet resistance and specific resistivity

  1. Law and ethics of strikes in the Nigerian health system | Mcfubara ...

    African Journals Online (AJOL)

    Despite that health services are essential, health sector strikes have continued. The purpose here was to examine the legal and ethical justification of strikes in the Nigerian health sector. Documentary analysis and literature reviews were carried out. It was found that the Trade Disputes Act and the National Health Act do not ...

  2. Khovanov-Rozansky Graph Homology and Composition Product

    DEFF Research Database (Denmark)

    Wagner, Emmanuel

    2008-01-01

    In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology.......In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology....

  3. Foot strike patterns and collision forces in habitually barefoot versus shod runners.

    Science.gov (United States)

    Lieberman, Daniel E; Venkadesan, Madhusudhan; Werbel, William A; Daoud, Adam I; D'Andrea, Susan; Davis, Irene S; Mang'eni, Robert Ojiambo; Pitsiladis, Yannis

    2010-01-28

    Humans have engaged in endurance running for millions of years, but the modern running shoe was not invented until the 1970s. For most of human evolutionary history, runners were either barefoot or wore minimal footwear such as sandals or moccasins with smaller heels and little cushioning relative to modern running shoes. We wondered how runners coped with the impact caused by the foot colliding with the ground before the invention of the modern shoe. Here we show that habitually barefoot endurance runners often land on the fore-foot (fore-foot strike) before bringing down the heel, but they sometimes land with a flat foot (mid-foot strike) or, less often, on the heel (rear-foot strike). In contrast, habitually shod runners mostly rear-foot strike, facilitated by the elevated and cushioned heel of the modern running shoe. Kinematic and kinetic analyses show that even on hard surfaces, barefoot runners who fore-foot strike generate smaller collision forces than shod rear-foot strikers. This difference results primarily from a more plantarflexed foot at landing and more ankle compliance during impact, decreasing the effective mass of the body that collides with the ground. Fore-foot- and mid-foot-strike gaits were probably more common when humans ran barefoot or in minimal shoes, and may protect the feet and lower limbs from some of the impact-related injuries now experienced by a high percentage of runners.

  4. The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition

    Energy Technology Data Exchange (ETDEWEB)

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema; Hall, Traci M. Tanaka; Gavis, Elizabeth R. (Princeton); (NIH)

    2017-04-01

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subset of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.

  5. The Poster Strikes Back

    DEFF Research Database (Denmark)

    Christensen, Line Hjorth

    2005-01-01

    The paper discusses fundamental issues in relation to placing graphic design in locations such as museums of decorative arts and living history museums. Based on my Ph.D. project on British commercial posters of the interwar years and approached from a combined perspective of museology, semiotics...... and design history, I argue that the poster during the interwar years inhabits a new active position. By exploiting and challenging the commercial and aesthetic paradox out of which it arose, the poster ‘strikes back' as a museologized, exhibited object. Rather than being absorbed into the city swirl...

  6. Cloning of an E. coli RecA and yeast RAD51 homolog, radA, an allele of the uvsC in Aspergillus nidulans and its mutator effects.

    Science.gov (United States)

    Seong, K Y; Chae, S K; Kang, H S

    1997-04-30

    An E. coli RecA and yeast RAD51 homolog from Aspergillus nidulans, radA, has been cloned by screening genomic and cDNA libraries with a PCR-amplified probe. This probe was generated using primers carrying the conserved sequences of eukaryotic RecA homologs. The deduced amino acid sequence revealed two conserved Walker-A and -B type nucleotide-binding domains and exhibited 88%, 60%, and 53% identity with Mei-3 of Neurospora crassa, rhp51+ of Schizosaccharomyces pombe, and Rad51 of Saccharomyces cerevisiae, respectively. radA null mutants constructed by replacing the whole coding region with a selection marker showed high methyl methanesulfonate (MMS) sensitivity. Heterozygous diploids of radA disruptant with the uvsC114 mutant failed to complement with respect to MMS-sensitivity, indicating that radA is an allele of uvsC. In selecting spontaneous forward selenate resistant mutations, mutator effects were observed in radA null mutants similarly to those shown in uvsC114 mutant strains.

  7. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. Calcium-Enhanced Twitching Motility in Xylella fastidiosa Is Linked to a Single PilY1 Homolog.

    Science.gov (United States)

    Cruz, Luisa F; Parker, Jennifer K; Cobine, Paul A; De La Fuente, Leonardo

    2014-12-01

    The plant-pathogenic bacterium Xylella fastidiosa is restricted to the xylem vessel environment, where mineral nutrients are transported through the plant host; therefore, changes in the concentrations of these elements likely impact the growth and virulence of this bacterium. Twitching motility, dependent on type IV pili (TFP), is required for movement against the transpiration stream that results in basipetal colonization. We previously demonstrated that calcium (Ca) increases the motility of X. fastidiosa, although the mechanism was unknown. PilY1 is a TFP structural protein recently shown to bind Ca and to regulate twitching and adhesion in bacterial pathogens of humans. Sequence analysis identified three pilY1 homologs in X. fastidiosa (PD0023, PD0502, and PD1611), one of which (PD1611) contains a Ca-binding motif. Separate deletions of PD0023 and PD1611 resulted in mutants that still showed twitching motility and were not impaired in attachment or biofilm formation. However, the response of increased twitching at higher Ca concentrations was lost in the pilY1-1611 mutant. Ca does not modulate the expression of any of the X. fastidiosa PilY1 homologs, although it increases the expression of the retraction ATPase pilT during active movement. The evidence presented here suggests functional differences between the PilY1 homologs, which may provide X. fastidiosa with an adaptive advantage in environments with high Ca concentrations, such as xylem sap. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  10. [Hunger striking in prisons: ethics and the ethical and legal aspects].

    Science.gov (United States)

    García-Guerrero, J

    2013-01-01

    Hunger strike is a common form of protest in prisons and is a potential cause of many types of problems, both for the prison administration and the doctors who care for prisoners who participate in one. Issues of conflict of rights and obligations involved, and how to treat people who are subject to the Administration, which in this case takes the position of guarantor, have created major controversies over doctrine. Conscientious objection and the conflict of dual loyalty of doctors working in prisons are also issues closely linked to a prison hunger strike. In this paper we review the solution given to the problem of treatment of a prison hunger strike from three perspectives: ethics, ethical and legal.

  11. Parkinsonian abnormality of foot strike: a phenomenon of ageing and/or one responsive to levodopa therapy?

    Science.gov (United States)

    Hughes, J R; Bowes, S G; Leeman, A L; O'Neill, C J; Deshmukh, A A; Nicholson, P W; Dobbs, S M; Dobbs, R J

    1990-01-01

    1. Normally during walking, the heel strikes the ground before the forefoot. Abnormalities of foot strike in idiopathic Parkinson's disease may be amenable to therapy: objective measurements may reveal response which is not clinically apparent. Occult changes in foot strike leading to instability may parallel the normal, age-related loss of striatal dopamine. 2. The nature of foot strike was studied using pedobarography in 160 healthy volunteers, aged 15 to 91 years. Although 16% of strikes were made simultaneously by heel and forefoot, there were no instances of the forefoot preceding the heel. No significant effect of age on an index of normality of foot strikes was detected (P greater than 0.3). 3. The effect on foot strike of substituting placebo for a morning dose of a levodopa/carbidopa combination was studied in a double-blind, cross-over trial in 14 patients, aged 64 to 88 years, with no overt fluctuations in control of their idiopathic Parkinson's disease in relation to dosing. On placebo treatment there was a highly significant (P = 0.004) reduction in the number of more normal strikes, i.e. heel strikes plus simultaneous heel and forefoot strikes. The effect appeared unrelated to the corresponding difference between active and placebo treatments in plasma concentration of levodopa or a metabolite of long half-time, 3-O-methyldopa (3OMD). However, it correlated negatively (P less than 0.05) with the mean of the 3OMD concentrations. 4. It appears that some abnormalities of foot strike due to Parkinson's disease are reversible. Employing test conditions, designed to provoke abnormalities of foot strike, might be useful in screening for pre-clinical Parkinson's disease. PMID:2306409

  12. The Resistome of Low-Impacted Marine Environments Is Composed by Distant Metallo-β-Lactamases Homologs

    Directory of Open Access Journals (Sweden)

    Erica L. Fonseca

    2018-04-01

    Full Text Available The worldwide dispersion and sudden emergence of new antibiotic resistance genes (ARGs determined the need in uncovering which environment participate most as their source and reservoir. ARGs closely related to those currently found in human pathogens occur in the resistome of anthropogenic impacted environments. However, the role of pristine environment as the origin and source of ARGs remains underexplored and controversy, particularly, the marine environments represented by the oceans. Here, due to the ocean nature, we hypothesized that the resistome of this pristine/low-impacted marine environment is represented by distant ARG homologs. To test this hypothesis we performed an in silico analysis on the Global Ocean Sampling (GOS metagenomic project dataset focusing on the metallo-β-lactamases (MβLs as the ARG model. MβLs have been a challenge to public health, since they hydrolyze the carbapenems, one of the last therapeutic choice in clinics. Using Hidden Markov Model (HMM profiles, we were successful in identifying a high diversity of distant MβL homologs, related to the B1, B2, and B3 subclasses. The majority of them were distributed across the Atlantic, Indian, and Pacific Oceans being related to the chromosomally encoded MβL GOB present in Elizabethkingia genus. It was observed only a reduced number of metagenomic sequence homologs related to the acquired MβL enzymes (VIM, SPM-1, and AIM-1 that currently have impact in clinics. Therefore, low antibiotic impacted marine environment, as the ocean, are unlikely the source of ARGs that have been causing enormous threat to the public health.

  13. The Resistome of Low-Impacted Marine Environments Is Composed by Distant Metallo-β-Lactamases Homologs.

    Science.gov (United States)

    Fonseca, Erica L; Andrade, Bruno G N; Vicente, Ana C P

    2018-01-01

    The worldwide dispersion and sudden emergence of new antibiotic resistance genes (ARGs) determined the need in uncovering which environment participate most as their source and reservoir. ARGs closely related to those currently found in human pathogens occur in the resistome of anthropogenic impacted environments. However, the role of pristine environment as the origin and source of ARGs remains underexplored and controversy, particularly, the marine environments represented by the oceans. Here, due to the ocean nature, we hypothesized that the resistome of this pristine/low-impacted marine environment is represented by distant ARG homologs. To test this hypothesis we performed an in silico analysis on the Global Ocean Sampling (GOS) metagenomic project dataset focusing on the metallo-β-lactamases (MβLs) as the ARG model. MβLs have been a challenge to public health, since they hydrolyze the carbapenems, one of the last therapeutic choice in clinics. Using Hidden Markov Model (HMM) profiles, we were successful in identifying a high diversity of distant MβL homologs, related to the B1, B2, and B3 subclasses. The majority of them were distributed across the Atlantic, Indian, and Pacific Oceans being related to the chromosomally encoded MβL GOB present in Elizabethkingia genus. It was observed only a reduced number of metagenomic sequence homologs related to the acquired MβL enzymes (VIM, SPM-1, and AIM-1) that currently have impact in clinics. Therefore, low antibiotic impacted marine environment, as the ocean, are unlikely the source of ARGs that have been causing enormous threat to the public health.

  14. Physicians and strikes: can a walkout over the malpractice crisis be ethically justified?

    Science.gov (United States)

    Fiester, Autumn

    2004-01-01

    Malpractice insurance rates have created a crisis in American medicine. Rates are rising and reimbursements are not keeping pace. In response, physicians in the states hardest hit by this crisis are feeling compelled to take political action, and the current action of choice seems to be physician strikes. While the malpractice insurance crisis is acknowledged to be severe, does it justify the extreme action of a physician walkout? Should physicians engage in this type of collective action, and what are the costs to patients and the profession when such action is taken? I will offer three related arguments against physician strikes that constitute a prima facie prohibition against such action: first, strikes are intended to cause harm to patients; second, strikes are an affront to the physician-patient relationship; and, third, strikes risk decreasing the public's respect for the medical profession. As with any prima facie obligation, there are justifying conditions that may override the moral prohibition, but I will argue that the current malpractice crisis does not rise to the level of such a justifying condition. While the malpractice crisis demands and justifies a political response on the part of the nation's physicians, strikes and slow-downs are not an ethically justified means to the legitimate end of controlling insurance costs.

  15. Parkinsonian abnormality of foot strike: a phenomenon of ageing and/or one responsive to levodopa therapy?

    OpenAIRE

    Hughes, J R; Bowes, S G; Leeman, A L; O'Neill, C J; Deshmukh, A A; Nicholson, P W; Dobbs, S M; Dobbs, R J

    1990-01-01

    1. Normally during walking, the heel strikes the ground before the forefoot. Abnormalities of foot strike in idiopathic Parkinson's disease may be amenable to therapy: objective measurements may reveal response which is not clinically apparent. Occult changes in foot strike leading to instability may parallel the normal, age-related loss of striatal dopamine. 2. The nature of foot strike was studied using pedobarography in 160 healthy volunteers, aged 15 to 91 years. Although 16% of strikes w...

  16. Heel–toe running: A new look at the influence of foot strike pattern on impact force

    OpenAIRE

    John A. Mercer; Sarah Horsch

    2015-01-01

    Background/Objective: It is important to understand the factors that influence the impact force observed during running, since the impact force is likely to be related to overuse injuries. The purpose of this study was to compare the impact force during running when participants were instructed to use different foot strike patterns: obvious heel strike (Obvious-HS), subtle heel strike (Subtle-HS), midfoot strike (Mid-FS), and fore foot strike (Fore-FS) patterns. Methods: Participants (n = ...

  17. The initiation and linkage of surface fractures above a buried strike ...

    Indian Academy of Sciences (India)

    a buried strike-slip fault: An experimental approach. N Ghosh and A ... conditions viz., (i) heterogeneous simple shear of the cover rocks above a buried strike slip fault. (wrench .... (iii) study of fracture types in the damage zones from Gozo .... was dominant, the results may vary from a true ... For example, as shown in figure 5 ...

  18. AlignMe—a membrane protein sequence alignment web server

    Science.gov (United States)

    Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

    2014-01-01

    We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

  19. A homology theory for smale spaces

    CERN Document Server

    Putnam, Ian F

    2014-01-01

    The author develops a homology theory for Smale spaces, which include the basics sets for an Axiom A diffeomorphism. It is based on two ingredients. The first is an improved version of Bowen's result that every such system is the image of a shift of finite type under a finite-to-one factor map. The second is Krieger's dimension group invariant for shifts of finite type. He proves a Lefschetz formula which relates the number of periodic points of the system for a given period to trace data from the action of the dynamics on the homology groups. The existence of such a theory was proposed by Bowen in the 1970s.

  20. Homological stability for unordered configuration spaces

    DEFF Research Database (Denmark)

    Randal-Williams, Oscar

    2013-01-01

    This paper consists of two related parts. In the first part we give a self-contained proof of homological stability for the spaces C_n(M;X) of configurations of n unordered points in a connected open manifold M with labels in a path-connected space X, with the best possible integral stability range...... of the spaces C_n(M) can be considered stable when M is a closed manifold. In this case there are no stabilisation maps, but one may still ask if the dimensions of the homology groups over some field stabilise with n. We prove that this is true when M is odd-dimensional, or when the field is F_2 or Q...