WorldWideScience

Sample records for striking sequence homology

  1. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  2. A sensitive short read homology search tool for paired-end read sequencing data.

    Science.gov (United States)

    Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai

    2017-10-16

    Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .

  3. Electromyographic Study of a Sequence of Yau-Man Kung Fu Palm Strikes with and without Impact.

    Science.gov (United States)

    Neto, Osmar Pinto; Magini, Marcio; Pacheco, Marcos T T

    2007-01-01

    IN MARTIAL ARTS AND CONTACT SPORTS, STRIKES ARE OFTEN TRAINED IN TWO DIFFERENT WAYS: with and without impacts. This study aims to compare the electromyographical activity (EMG) of the triceps brachii (TB), biceps brachii (BB) and brachioradialis (BR) muscles during strikes with and without impacts. Eight Yau-Man Kung Fu practitioners participated in the experiment. Each participant performed 5 sequences of 5 consecutive KF Yau-Man palm strikes with no impact intercalated with 5 sequences of 5 repetitions targeting a KF training shield. Surface EMG signals were obtained from the TB, BB, and RB for 3.0 seconds using an eight-channel module with a total amplifier gain of 2000 and sampled at 3500 Hz. The EMG analyses were done in the time (rms) and frequency (wavelet) domains. For the frequency domain, Morlet wavelet power spectra were obtained and an original method was used to quantify statistically significant regions on the power spectra. The results both in the time and frequency domains indicate a higher TB and BR muscle activity for the strikes with impacts. No significant difference was found for the BB in the two different scenarios. In addition, the results show that the wavelet power spectra pattern for the three analysed muscles obtained from the strikes with and without impacts were similar. Key pointsEMG analysis of a sequence of Kung Fu strikes demonstrates higher Triceps Brachii and Brachioradialis muscle activity for strikes with impact than strikes without impact.An original reliable method for quantifying EMG wavelet transform results is presented.EMG wavelet power spectra describe muscle roles during a Kung Fu sequence of strikes.

  4. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles

    DEFF Research Database (Denmark)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole

    2010-01-01

    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.......0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models.......3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is...

  5. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.

    Directory of Open Access Journals (Sweden)

    Bekim Sadikovic

    2010-12-01

    Full Text Available Mitochondrial DNA (mtDNA deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM, progressive external ophthalmoplegia (PEO, and Kearns-Sayre syndrome (KSS, to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (<6 years old showed a diffused pattern of deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41. Only 15% (3/20 of the young patients (<6 years old carry the 5 kb common deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17 exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier

  6. Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes.

    Science.gov (United States)

    Sadikovic, Bekim; Wang, Jing; El-Hattab, Ayman W; Landsverk, Megan; Douglas, Ganka; Brundage, Ellen K; Craigen, William J; Schmitt, Eric S; Wong, Lee-Jun C

    2010-12-20

    Mitochondrial DNA (mtDNA) deletions are a common cause of mitochondrial disorders. Large mtDNA deletions can lead to a broad spectrum of clinical features with different age of onset, ranging from mild mitochondrial myopathies (MM), progressive external ophthalmoplegia (PEO), and Kearns-Sayre syndrome (KSS), to severe Pearson syndrome. The aim of this study is to investigate the molecular signatures surrounding the deletion breakpoints and their association with the clinical phenotype and age at onset. MtDNA deletions in 67 patients were characterized using array comparative genomic hybridization (aCGH) followed by PCR-sequencing of the deletion junctions. Sequence homology including both perfect and imperfect short repeats flanking the deletion regions were analyzed and correlated with clinical features and patients' age group. In all age groups, there was a significant increase in sequence homology flanking the deletion compared to mtDNA background. The youngest patient group (deletion distribution in size and locations, with a significantly lower sequence homology flanking the deletion, and the highest percentage of deletion mutant heteroplasmy. The older age groups showed rather discrete pattern of deletions with 44% of all patients over 6 years old carrying the most common 5 kb mtDNA deletion, which was found mostly in muscle specimens (22/41). Only 15% (3/20) of the young patients (deletion, which is usually present in blood rather than muscle. This group of patients predominantly (16 out of 17) exhibit multisystem disorder and/or Pearson syndrome, while older patients had predominantly neuromuscular manifestations including KSS, PEO, and MM. In conclusion, sequence homology at the deletion flanking regions is a consistent feature of mtDNA deletions. Decreased levels of sequence homology and increased levels of deletion mutant heteroplasmy appear to correlate with earlier onset and more severe disease with multisystem involvement.

  7. Remote homology detection using a kernel method that combines sequence and secondary-structure similarity scores.

    Science.gov (United States)

    Wieser, Daniela; Niranjan, Mahesan

    2009-01-01

    Distant evolutionary relationships between proteins with low sequence similarity are difficult to recognise by computational methods. Consequently, many sequences obtained from large-scale sequencing projects cannot be assigned to any known proteins or families despite being evolutionarily related. To boost sensitivity, various sequence-based methods have been modified to make use of the better conserved secondary structure. Most of these methods are instance-based or generative. Here, we introduce a kernel-based remote homology detection method that allows for a combination of sequence and secondary-structure similarity scores in a discriminative approach. We studied the ability of the method to predict superfamily membership as defined by the SCOP database. We show that a kernel method that combined sequence similarity scores with predicted secondary-structure similarity scores performed similar to a classifier that used scores calculated from sequences and true secondary structures, but performed better than a sequence-only based classifier and achieved a better mean than recently published results on the same data-set. It can be concluded that SVM classifiers trained to predict homology between distantly related proteins, become more accurate, if a joint sequence/secondary-structure similarity score approach is used.

  8. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    Megeed, A.A.

    2011-01-01

    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  9. The sequence homologies of cytochromes P-450 and active-site geometries

    Science.gov (United States)

    Lewis, David F. V.; Moereels, Henri

    1992-06-01

    The amino acid sequence alignment of 16 cytochrome P-450 proteins representative of the major families is reported. The sequence matching process has been carried out on the basis of maximum homology by residue type, retention of secondary structure and minimization of deletions/insertions except where additional loop regions exist. From the starting point of known reported sequence homology matching from the literature, a realignment on the basis of conserved residues involved in both structure and function gives rise to a self-consistent set of sequences which correlates with known mechanistic and structural data. Once fitted, these archetypal sequences form a straightforward template for the alignment of all P-450 subfamilies. Computer modelling of the active-site regions constructed from homology with the bacterial form of the enzyme (P-450CAM) evinces the correct substrate specificity. Furthermore, the construction of the macromolecular assembly of components of the cytochrome P-450 system on the microsomal endoplasmic reticular membrane is presented from the evidence of site-directed mutagenesis, analysis by molecular probes, X-ray crystallography and molecular modelling.

  10. HomPPI: a class of sequence homology based protein-protein interface prediction methods

    Directory of Open Access Journals (Sweden)

    Dobbs Drena

    2011-06-01

    Full Text Available Abstract Background Although homology-based methods are among the most widely used methods for predicting the structure and function of proteins, the question as to whether interface sequence conservation can be effectively exploited in predicting protein-protein interfaces has been a subject of debate. Results We studied more than 300,000 pair-wise alignments of protein sequences from structurally characterized protein complexes, including both obligate and transient complexes. We identified sequence similarity criteria required for accurate homology-based inference of interface residues in a query protein sequence. Based on these analyses, we developed HomPPI, a class of sequence homology-based methods for predicting protein-protein interface residues. We present two variants of HomPPI: (i NPS-HomPPI (Non partner-specific HomPPI, which can be used to predict interface residues of a query protein in the absence of knowledge of the interaction partner; and (ii PS-HomPPI (Partner-specific HomPPI, which can be used to predict the interface residues of a query protein with a specific target protein. Our experiments on a benchmark dataset of obligate homodimeric complexes show that NPS-HomPPI can reliably predict protein-protein interface residues in a given protein, with an average correlation coefficient (CC of 0.76, sensitivity of 0.83, and specificity of 0.78, when sequence homologs of the query protein can be reliably identified. NPS-HomPPI also reliably predicts the interface residues of intrinsically disordered proteins. Our experiments suggest that NPS-HomPPI is competitive with several state-of-the-art interface prediction servers including those that exploit the structure of the query proteins. The partner-specific classifier, PS-HomPPI can, on a large dataset of transient complexes, predict the interface residues of a query protein with a specific target, with a CC of 0.65, sensitivity of 0.69, and specificity of 0.70, when homologs of

  11. Rapid and enhanced remote homology detection by cascading hidden Markov model searches in sequence space.

    Science.gov (United States)

    Kaushik, Swati; Nair, Anu G; Mutt, Eshita; Subramanian, Hari Prasanna; Sowdhamini, Ramanathan

    2016-02-01

    In the post-genomic era, automatic annotation of protein sequences using computational homology-based methods is highly desirable. However, often protein sequences diverge to an extent where detection of homology and automatic annotation transfer is not straightforward. Sophisticated approaches to detect such distant relationships are needed. We propose a new approach to identify deep evolutionary relationships of proteins to overcome shortcomings of the available methods. We have developed a method to identify remote homologues more effectively from any protein sequence database by using several cascading events with Hidden Markov Models (C-HMM). We have implemented clustering of hits and profile generation of hit clusters to effectively reduce the computational timings of the cascaded sequence searches. Our C-HMM approach could cover 94, 83 and 40% coverage at family, superfamily and fold levels, respectively, when applied on diverse protein folds. We have compared C-HMM with various remote homology detection methods and discuss the trade-offs between coverage and false positives. A standalone package implemented in Java along with a detailed documentation can be downloaded from https://github.com/RSLabNCBS/C-HMM SUPPLEMENTARY INFORMATION: Supplementary data are available at Bioinformatics online. mini@ncbs.res.in. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Sequence basis of Barnacle Cement Nanostructure is Defined by Proteins with Silk Homology

    Science.gov (United States)

    So, Christopher R.; Fears, Kenan P.; Leary, Dagmar H.; Scancella, Jenifer M.; Wang, Zheng; Liu, Jinny L.; Orihuela, Beatriz; Rittschof, Dan; Spillmann, Christopher M.; Wahl, Kathryn J.

    2016-11-01

    Barnacles adhere by producing a mixture of cement proteins (CPs) that organize into a permanently bonded layer displayed as nanoscale fibers. These cement proteins share no homology with any other marine adhesives, and a common sequence-basis that defines how nanostructures function as adhesives remains undiscovered. Here we demonstrate that a significant unidentified portion of acorn barnacle cement is comprised of low complexity proteins; they are organized into repetitive sequence blocks and found to maintain homology to silk motifs. Proteomic analysis of aggregate bands from PAGE gels reveal an abundance of Gly/Ala/Ser/Thr repeats exemplified by a prominent, previously unidentified, 43 kDa protein in the solubilized adhesive. Low complexity regions found throughout the cement proteome, as well as multiple lysyl oxidases and peroxidases, establish homology with silk-associated materials such as fibroin, silk gum sericin, and pyriform spidroins from spider silk. Distinct primary structures defined by homologous domains shed light on how barnacles use low complexity in nanofibers to enable adhesion, and serves as a starting point for unraveling the molecular architecture of a robust and unique class of adhesive nanostructures.

  13. ELECTROMYOGRAPHIC STUDY OF A SEQUENCE OF YAU-MAN KUNG FU PALM STRIKES WITH AND WITHOUT IMPACT

    Directory of Open Access Journals (Sweden)

    Osmar Pinto Neto

    2007-10-01

    Full Text Available In martial arts and contact sports, strikes are often trained in two different ways: with and without impacts. This study aims to compare the electromyographical activity (EMG of the triceps brachii (TB, biceps brachii (BB and brachioradialis (BR muscles during strikes with and without impacts. Eight Yau-Man Kung Fu practitioners participated in the experiment. Each participant performed 5 sequences of 5 consecutive KF Yau-Man palm strikes with no impact intercalated with 5 sequences of 5 repetitions targeting a KF training shield. Surface EMG signals were obtained from the TB, BB, and RB for 3.0 seconds using an eight-channel module with a total amplifier gain of 2000 and sampled at 3500 Hz. The EMG analyses were done in the time (rms and frequency (wavelet domains. For the frequency domain, Morlet wavelet power spectra were obtained and an original method was used to quantify statistically significant regions on the power spectra. The results both in the time and frequency domains indicate a higher TB and BR muscle activity for the strikes with impacts. No significant difference was found for the BB in the two different scenarios. In addition, the results show that the wavelet power spectra pattern for the three analysed muscles obtained from the strikes with and without impacts were similar

  14. BBH-LS: an algorithm for computing positional homologs using sequence and gene context similarity.

    Science.gov (United States)

    Zhang, Melvin; Leong, Hon Wai

    2012-01-01

    Identifying corresponding genes (orthologs) in different species is an important step in genome-wide comparative analysis. In particular, one-to-one correspondences between genes in different species greatly simplify certain problems such as transfer of function annotation and genome rearrangement studies. Positional homologs are the direct descendants of a single ancestral gene in the most recent common ancestor and by definition form one-to-one correspondence. In this work, we present a simple yet effective method (BBH-LS) for the identification of positional homologs from the comparative analysis of two genomes. Our BBH-LS method integrates sequence similarity and gene context similarity in order to get more accurate ortholog assignments. Specifically, BBH-LS applies the bidirectional best hit heuristic to a combination of sequence similarity and gene context similarity scores. We applied our method to the human, mouse, and rat genomes and found that BBH-LS produced the best results when using both sequence and gene context information equally. Compared to the state-of-the-art algorithms, such as MSOAR2, BBH-LS is able to identify more positional homologs with fewer false positives.

  15. Homology and conservation of amino acids in E-protein sequences of dengue serotypes

    Directory of Open Access Journals (Sweden)

    Ramesh Venkatachalam

    2014-09-01

    Full Text Available Objective: To identify the homology and phylogenetic relationship among the four dengue virus (DENV serotypes, and conservation of amino acid in E-proteins and to find out the phylogenetic relationship among the strains of four DENV serotypes. Methods: Clustal W analysis for homology and phylogram, European molecular biology open software suite for pairwise alignment of amino acid sequences and BLAST-P analysis for various strains of four DENV serotypes were carried out. Results: Homology of E-protein sequences of four DENV serotypes indicated a close relationship of DENV-1 with DENV-3. DENV-2 showed close relationship with DENV-1 and -3 forming a single cluster whereas DENV-4 alone formed group with a single serotype. In the multiple sequence alignment, 19 amino acid conserved groups were observed. BLAST-P analysis showed more number of 100% similarity among DENV-1 and -3 strains whereas only few strains showed 100% similarity in DENV-4. However, 100% similarity was absent among the DENV-3 strains. Conclusions: From the present study, phylogenetically all the four DENV serotypes were related but DENV-1, -2 and -3 were very closely related whereas DENV-4 was somewhat distant from the other three serotypes.

  16. A homology identification method that combines protein sequence and structure information.

    Science.gov (United States)

    Yu, L.; White, J. V.; Smith, T. F.

    1998-01-01

    A new method is presented for identifying distantly related homologous proteins that are unrecognizable by conventional sequence comparison methods. The method combines information about functionally conserved sequence patterns with information about structure context. This information is encoded in stochastic discrete state-space models (DSMs) that comprise a new family of hidden Markov models. The new models are called sequence-pattern-embedded DSMs (pDSMs). This method can identify distantly related protein family members with a high sensitivity and specificity. The method is illustrated with trypsin-like serine proteases and globins. The strategy for building pDSMs is presented. The method has been validated using carefully constructed positive and negative control sets. In addition to the ability to recognize remote homologs, pDSM sequence analysis predicts secondary structures with higher sensitivity, specificity, and Q3 accuracy than DSM analysis, which omits information about conserved sequence patterns. The identification of trypsin-like serine proteases in new genomes is discussed. PMID:9865944

  17. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles.

    Science.gov (United States)

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl

    2010-07-01

    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is web server is available at http://www.cbs.dtu.dk/services/CPHmodels/.

  18. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  19. Method for predicting homology modeling accuracy from amino acid sequence alignment: the power function.

    Science.gov (United States)

    Iwadate, Mitsuo; Kanou, Kazuhiko; Terashi, Genki; Umeyama, Hideaki; Takeda-Shitaka, Mayuko

    2010-01-01

    We have devised a power function (PF) that can predict the accuracy of a three-dimensional (3D) structure model of a protein using only amino acid sequence alignments. This Power Function (PF) consists of three parts; (1) the length of a model, (2) a homology identity percent value and (3) the agreement rate between PSI-PRED secondary structure prediction and the secondary structure judgment of a reference protein. The PF value is mathematically computed from the execution process of homology search tools, such as FASTA or various BLAST programs, to obtain the amino acid sequence alignments. There is a high correlation between the global distance test-total score (GDT_TS) value of the protein model based upon the PF score and the GDT_TS(MAX) value used as an index of protein modeling accuracy in the international contest Critical Assessment of Techniques for Protein Structure Prediction (CASP). Accordingly, the PF method is valuable for constructing a highly accurate model without wasteful calculations of homology modeling that is normally performed by an iterative method to move the main chain and side chains in the modeling process. Moreover, a model with higher accuracy can be obtained by combining the models ordered by the PF score with models sorted by the size of the CIRCLE score. The CIRCLE software is a 3D-1D program, in which energetic stabilization is estimated based upon the experimental environment of each amino acid residue in the protein solution or protein crystals.

  20. Assessing GPCR homology models constructed from templates of various transmembrane sequence identities: Binding mode prediction and docking enrichment.

    Science.gov (United States)

    Loo, Jason S E; Emtage, Abigail L; Ng, Kar Weng; Yong, Alene S J; Doughty, Stephen W

    2018-03-01

    GPCR crystal structures have become more readily accessible in recent years. However, homology models of GPCRs continue to play an important role as many GPCR structures remain unsolved. The new crystal structures now available provide not only additional templates for homology modelling but also the opportunity to assess the performance of homology models against their respective crystal structures and gain insight into the performance of such models. In this study we have constructed homology models from templates of various transmembrane sequence identities for eight GPCR targets to better understand the relationship between transmembrane sequence identity and model quality. Model quality was assessed relative to the crystal structure in terms of structural accuracy as well as performance in two typical structure-based drug design applications: ligand binding pose prediction and docking enrichment in virtual screening. Crystal structures significantly outperformed homology models in both assessments. Accurate ligand binding pose prediction was possible but difficult to achieve using homology models, even with the use of induced fit docking. In virtual screening using homology models still conferred significant enrichment compared to random selection, with a clear benefit also observed in using models optimized through induced fit docking. Our results indicate that while homology models that are reasonably accurate structurally can be constructed, without significant refinement homology models will be outperformed by crystal structures in ligand binding pose prediction and docking enrichment regardless of the template used, primarily due to the extremely high level of structural accuracy needed for such applications. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. EST sequences and their annotation (amino acid sequence and results of homology search) - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available esource Project ( http://www.nbrp.jp/ ). The link to the National BioResource Pro...List Contact us Dicty_cDB EST sequences and their annotation (amino acid sequence and results of homology se...arch) Data detail Data name EST sequences and their annotation (amino acid sequence and results of homology ...search) DOI 10.18908/lsdba.nbdc00419-001 Description of data contents Sequences of cDNA clones of Dictyostelium discoideum and the...s (with target DBs: dicty EST-DB, DNA-DB and protein-DB)). Links to the Atlas database ( http://dictycdb.bio

  2. GPU-Acceleration of Sequence Homology Searches with Database Subsequence Clustering.

    Science.gov (United States)

    Suzuki, Shuji; Kakuta, Masanori; Ishida, Takashi; Akiyama, Yutaka

    2016-01-01

    Sequence homology searches are used in various fields and require large amounts of computation time, especially for metagenomic analysis, owing to the large number of queries and the database size. To accelerate computing analyses, graphics processing units (GPUs) are widely used as a low-cost, high-performance computing platform. Therefore, we mapped the time-consuming steps involved in GHOSTZ, which is a state-of-the-art homology search algorithm for protein sequences, onto a GPU and implemented it as GHOSTZ-GPU. In addition, we optimized memory access for GPU calculations and for communication between the CPU and GPU. As per results of the evaluation test involving metagenomic data, GHOSTZ-GPU with 12 CPU threads and 1 GPU was approximately 3.0- to 4.1-fold faster than GHOSTZ with 12 CPU threads. Moreover, GHOSTZ-GPU with 12 CPU threads and 3 GPUs was approximately 5.8- to 7.7-fold faster than GHOSTZ with 12 CPU threads.

  3. Update Direct-Strike Lightning Environment for Stockpile-to-Target Sequence (Second Revision)

    Energy Technology Data Exchange (ETDEWEB)

    Uman, Martin A. [Univ. of Florida, Gainesville, FL (United States); Rakov, V. A. [Univ. of Florida, Gainesville, FL (United States); Elisme, J. O. [Univ. of Florida, Gainesville, FL (United States); Jordan, D. M. [Univ. of Florida, Gainesville, FL (United States); Biaji, C. J. [Univ. of Florida, Gainesville, FL (United States); Hill, J. D. [Univ. of Florida, Gainesville, FL (United States)

    2010-10-05

    The University of Florida has surveyed all relevant publications reporting lightning characteristics and presents here an up-to-date version of the direct-strike lightning environment specifications for nuclear weapons published in 1989 by R. J. Fisher and M. A. Uman. Further, we present functional expressions for current vs. time, current derivative vs. time, second current derivative vs. time, charge transfer vs. time, and action integral (specific energy) vs. time for positive and negative first return strokes, for negative subsequent return strokes, and for positive and negative continuing currents; and we give sets of constants for these functional expressions so that the resultant waveforms exhibit approximately the median and extreme lightning parameters presented in the updated direct strike environment. Fourier transforms of the return stroke current waveforms are presented. The results of our literature survey are included in three Appendices entitled Return Stroke Current, Continuing Current, and Positive Lightning.

  4. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru

    1989-01-01

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  5. Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

    Directory of Open Access Journals (Sweden)

    Jaimie-Leigh Jonker

    Full Text Available Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes. It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa. Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes. Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa are more conserved within barnacles than others (20 kDa.

  6. Adhesive Proteins of Stalked and Acorn Barnacles Display Homology with Low Sequence Similarities

    Science.gov (United States)

    Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie

    2014-01-01

    Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins ‘sticky’ has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7–16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18–26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa). PMID:25295513

  7. Update Direct-Strike Lightning Environment for Stockpile-to-Target Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Uman, M A; Rakov, V A; Elisme, J O; Jordan, D M; Biagi, C J; Hill, J D

    2008-10-01

    The University of Florida has surveyed all relevant publications reporting lightning characteristics and presents here an up-to-date version of the direct-strike lightning environment specifications for nuclear weapons published in 1989 by R. J. Fisher and M. A. Uman. Further, we present functional expressions for current vs. time, current derivative vs. time, second current derivative vs. time, charge transfer vs. time, and action integral (specific energy) vs. time for first return strokes, for subsequent return strokes, and for continuing currents; and we give sets of constants for these expressions so that they yield approximately the median and extreme negative lightning parameters presented in this report. Expressions for the median negative lightning waveforms are plotted. Finally, we provide information on direct-strike lightning damage to metals such as stainless steel, which could be used as components of storage containers for nuclear waste materials; and we describe UF's new experimental research program to add to the sparse data base on the properties of positive lightning. Our literature survey, referred to above, is included in four Appendices. The following four sections (II, III, IV, and V) of this final report deal with related aspects of the research: Section II. Recommended Direct-Strike Median and Extreme Parameters; Section III. Time-Domain Waveforms for First Strokes, Subsequent Strokes, and Continuing Currents; Section IV. Damage to Metal Surfaces by Lightning Currents; and Section V. Measurement of the Characteristics of Positive Lightning. Results of the literature search used to derive the material in Section II and Section IV are found in the Appendices: Appendix 1. Return Stroke Current, Appendix 2. Continuing Current, Appendix 3. Positive Lightning, and Appendix 4. Lightning Damage to Metal Surfaces.

  8. Update Direct-Strike Lightning Environment for Stockpile-to-Target Sequence

    International Nuclear Information System (INIS)

    Uman, M.A.; Rakov, V.A.; Elisme, J.O.; Jordan, D.M.; Biagi, C.J.; Hill, J.D.

    2008-01-01

    The University of Florida has surveyed all relevant publications reporting lightning characteristics and presents here an up-to-date version of the direct-strike lightning environment specifications for nuclear weapons published in 1989 by R. J. Fisher and M. A. Uman. Further, we present functional expressions for current vs. time, current derivative vs. time, second current derivative vs. time, charge transfer vs. time, and action integral (specific energy) vs. time for first return strokes, for subsequent return strokes, and for continuing currents; and we give sets of constants for these expressions so that they yield approximately the median and extreme negative lightning parameters presented in this report. Expressions for the median negative lightning waveforms are plotted. Finally, we provide information on direct-strike lightning damage to metals such as stainless steel, which could be used as components of storage containers for nuclear waste materials; and we describe UF's new experimental research program to add to the sparse data base on the properties of positive lightning. Our literature survey, referred to above, is included in four Appendices. The following four sections (II, III, IV, and V) of this final report deal with related aspects of the research: Section II. Recommended Direct-Strike Median and Extreme Parameters; Section III. Time-Domain Waveforms for First Strokes, Subsequent Strokes, and Continuing Currents; Section IV. Damage to Metal Surfaces by Lightning Currents; and Section V. Measurement of the Characteristics of Positive Lightning. Results of the literature search used to derive the material in Section II and Section IV are found in the Appendices: Appendix 1. Return Stroke Current, Appendix 2. Continuing Current, Appendix 3. Positive Lightning, and Appendix 4. Lightning Damage to Metal Surfaces

  9. Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

    Science.gov (United States)

    Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

    2017-01-01

    Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

  10. Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

    Directory of Open Access Journals (Sweden)

    Mukul Sharma

    2017-01-01

    Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

  11. Contig sequences and their annotation (amino acid sequence and results of homology search), and expression profile - Dicty_cDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Dicty_cDB Contig sequences and their annotation (amino acid sequence and results of homology... search), and expression profile Data detail Data name Contig sequences and their annotation (amino acid seq...f data contents Contig sequences of cDNA sequences of Dictyostelium discoideum and the...EST-3'EST-ligated sequence and full-length cDNA sequence by the assembly program ...Phrap ( http://www.phrap.org/index.html ). Link to the list of clones constituting the contig, the information on its mapping to the

  12. External and semi-internal controls for PCR amplification of homologous sequences in mixed templates

    DEFF Research Database (Denmark)

    Kalle, Elena; Gulevich, Alexander; Rensing, Christopher Günther T

    2013-01-01

    . The complexity of the external and semi-internal amplification controls must be comparable with the assumed complexity of the samples. We also emphasize that amplification controls should be applied in multi-template PCR regardless of the post-assay method used to analyze products.......In a mixed template, the presence of homologous target DNA sequences creates environments that almost inevitably give rise to artifacts and biases during PCR. Heteroduplexes, chimeras, and skewed template-to-product ratios are the exclusive attributes of mixed template PCR and never occur...... in a single template assay. Yet, multi-template PCR has been used without appropriate attention to quality control and assay validation, in spite of the fact that such practice diminishes the reliability of results. External and internal amplification controls became obligatory elements of good laboratory...

  13. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    International Nuclear Information System (INIS)

    Chang, Soo-Ik; Hammes, G.G.

    1989-01-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chicken and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the β-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution

  14. Sequence and functional analysis of a homolog of interleukin-10 encoded by the parapoxvirus orf virus.

    Science.gov (United States)

    Fleming, S B; Haig, D M; Nettleton, P; Reid, H W; McCaughan, C A; Wise, L M; Mercer, A

    2000-01-01

    Orf virus is a large DNA virus and is the type species of the Parapoxvirus genus of the family Poxviridae. Orf virus infects the epithelium of sheep and goats and is transmissible to humans. Recently we discovered a gene in orf virus that encodes a polypeptide with remarkable homology to mammalian interleukin (IL-10) and viral encoded IL-10s of herpes viruses. The predicted polypeptide sequence shows high levels of amino acid identity to IL-10 of sheep (80%), cattle (75%), humans (67%) and mice (64%), as well as IL-10-like proteins of Epstein-Barr virus (63%) and equine herpes virus (67%). The C-terminal region, comprising two-thirds of the orf virus protein, is identical to ovine IL-10 which suggests that this gene has been captured from its host sheep during the evolution of orf virus. In contrast the N-terminal region shows little homology with cellular IL10s and in this respect resembles other viral IL-10s. IL-10 is a pleiotrophic cytokine that can exert either immunostimulatory or immunosuppressive effects on many cell types. IL-10 is a potent anti-inflammatory cytokine with inhibitory effects on non-specific immunity in particular macrophage function and Thl effector function. Our studies so far, indicate, that the functional activities of orf virus IL-10 are the same as ovine IL-10. Orf virus IL-10 stimulates mouse thymocyte proliferation and inhibits cytokine synthesis in lipopolysaccharide-activated ovine macrophages, peripheral blood monocytes and keratinocytes. Infection of sheep with an IL-10 deletion mutant of orf virus has shown that interferon-gamma levels are higher in tissue infected with the mutant virus than the parent virus. The functional activities of IL-10 and our data on orf virus IL-10 suggest a role in immune evasion.

  15. An artificial functional family filter in homolog searching in next-generation sequencing metagenomics.

    Directory of Open Access Journals (Sweden)

    Ruofei Du

    Full Text Available In functional metagenomics, BLAST homology search is a common method to classify metagenomic reads into protein/domain sequence families such as Clusters of Orthologous Groups of proteins (COGs in order to quantify the abundance of each COG in the community. The resulting functional profile of the community is then used in downstream analysis to correlate the change in abundance to environmental perturbation, clinical variation, and so on. However, the short read length coupled with next-generation sequencing technologies poses a barrier in this approach, essentially because similarity significance cannot be discerned by searching with short reads. Consequently, artificial functional families are produced, in which those with a large number of reads assigned decreases the accuracy of functional profile dramatically. There is no method available to address this problem. We intended to fill this gap in this paper. We revealed that BLAST similarity scores of homologues for short reads from COG protein members coding sequences are distributed differently from the scores of those derived elsewhere. We showed that, by choosing an appropriate score cut-off, we are able to filter out most artificial families and simultaneously to preserve sufficient information in order to build the functional profile. We also showed that, by incorporated application of BLAST and RPS-BLAST, some artificial families with large read counts can be further identified after the score cutoff filtration. Evaluated on three experimental metagenomic datasets with different coverages, we found that the proposed method is robust against read coverage and consistently outperforms the other E-value cutoff methods currently used in literatures.

  16. Amino acid sequences mediating vascular cell adhesion molecule 1 binding to integrin alpha 4: homologous DSP sequence found for JC polyoma VP1 coat protein

    Directory of Open Access Journals (Sweden)

    Michael Andrew Meyer

    2013-07-01

    Full Text Available The JC polyoma viral coat protein VP1 was analyzed for amino acid sequences homologies to the IDSP sequence which mediates binding of VLA-4 (integrin alpha 4 to vascular cell adhesion molecule 1. Although the full sequence was not found, a DSP sequence was located near the critical arginine residue linked to infectivity of the virus and binding to sialic acid containing molecules such as integrins (3. For the JC polyoma virus, a DSP sequence was found at residues 70, 71 and 72 with homology also noted for the mouse polyoma virus and SV40 virus. Three dimensional modeling of the VP1 molecule suggests that the DSP loop has an accessible site for interaction from the external side of the assembled viral capsid pentamer.

  17. Cloning, Expression, Sequence Analysis and Homology Modeling of the Prolyl Endoprotease from Eurygaster integriceps Puton

    Directory of Open Access Journals (Sweden)

    Ravi Chandra Yandamuri

    2014-10-01

    Full Text Available eurygaster integriceps Puton, commonly known as sunn pest, is a major pest of wheat in Northern Africa, the Middle East and Eastern Europe. This insect injects a prolyl endoprotease into the wheat, destroying the gluten. The purpose of this study was to clone the full length cDNA of the sunn pest prolyl endoprotease (spPEP for expression in E. coli and to compare the amino acid sequence of the enzyme to other known PEPs in both phylogeny and potential tertiary structure. Sequence analysis shows that the 5ꞌ UTR contains several putative transcription factor binding sites for transcription factors known to be expressed in Drosophila that might be useful targets for inhibition of the enzyme. The spPEP was first identified as a prolyl endoprotease by Darkoh et al., 2010. The enzyme is a unique serine protease of the S9A family by way of its substrate recognition of the gluten proteins, which are greater than 30 kD in size. At 51% maximum identity to known PEPs, homology modeling using SWISS-MODEL, the porcine brain PEP (PDB: 2XWD was selected in the database of known PEP structures, resulting in a predicted tertiary structure 99% identical to the porcine brain PEP structure. A Km for the recombinant spPEP was determined to be 210 ± 53 µM for the zGly-Pro-pNA substrate in 0.025 M ethanolamine, pH 8.5, containing 0.1 M NaCl at 37 °C with a turnover rate of 172 ± 47 µM Gly-Pro-pNA/s/µM of enzyme.

  18. Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...ta, and heuristic estimation of a similarity threshold for homologs of each protein by entropy-optimized organi...no acid sequences of predicted proteins and their annotation for 95 organism species . Data analysis method ...y threshold for homologs of each protein by entropy-optimized organism count method ( Bioinformatics 2009 Ma

  19. Recombination-Independent Recognition of DNA Homology for Repeat-Induced Point Mutation (RIP Is Modulated by the Underlying Nucleotide Sequence.

    Directory of Open Access Journals (Sweden)

    Eugene Gladyshev

    2016-05-01

    Full Text Available Haploid germline nuclei of many filamentous fungi have the capacity to detect homologous nucleotide sequences present on the same or different chromosomes. Once recognized, such sequences can undergo cytosine methylation or cytosine-to-thymine mutation specifically over the extent of shared homology. In Neurospora crassa this process is known as Repeat-Induced Point mutation (RIP. Previously, we showed that RIP did not require MEI-3, the only RecA homolog in Neurospora, and that it could detect homologous trinucleotides interspersed with a matching periodicity of 11 or 12 base-pairs along participating chromosomal segments. This pattern was consistent with a mechanism of homology recognition that involved direct interactions between co-aligned double-stranded (ds DNA molecules, where sequence-specific dsDNA/dsDNA contacts could be established using no more than one triplet per turn. In the present study we have further explored the DNA sequence requirements for RIP. In our previous work, interspersed homologies were always examined in the context of a relatively long adjoining region of perfect homology. Using a new repeat system lacking this strong interaction, we now show that interspersed homologies with overall sequence identity of only 36% can be efficiently detected by RIP in the absence of any perfect homology. Furthermore, in this new system, where the total amount of homology is near the critical threshold required for RIP, the nucleotide composition of participating DNA molecules is identified as an important factor. Our results specifically pinpoint the triplet 5'-GAC-3' as a particularly efficient unit of homology recognition. Finally, we present experimental evidence that the process of homology sensing can be uncoupled from the downstream mutation. Taken together, our results advance the notion that sequence information can be compared directly between double-stranded DNA molecules during RIP and, potentially, in other processes

  20. FeatureMap3D - a tool to map protein features and sequence conservation onto homologous structures in the PDB

    DEFF Research Database (Denmark)

    Wernersson, Rasmus; Rapacki, Krzysztof; Stærfeldt, Hans Henrik

    2006-01-01

    FeatureMap3D is a web-based tool that maps protein features onto 3D structures. The user provides sequences annotated with any feature of interest, such as post-translational modifications, protease cleavage sites or exonic structure and FeatureMap3D will then search the Protein Data Bank (PDB......) for structures of homologous proteins. The results are displayed both as an annotated sequence alignment, where the user-provided annotations as well as the sequence conservation between the query and the target sequence are displayed, and also as a publication-quality image of the 3D protein structure...... with the selected features and sequence conservation enhanced. The results are also returned in a readily parsable text format as well as a PyMol (http://pymol.sourceforge.net/) script file, which allows the user to easily modify the protein structure image to suit a specific purpose. FeatureMap3D can also be used...

  1. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. CONCLUSIONS: We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences...

  2. Identification of the porcine homologous of human disease causing trinucleotide repeat sequences

    DEFF Research Database (Denmark)

    Madsen, Lone Bruhn; Thomsen, Bo; Sølvsten, Christina Ane Elisabeth

    2007-01-01

    in this paper the identification of porcine noncoding and polyglutamine-encoding TNR regions and the comparison to the homologous TNRs from human, chimpanzee, dog, opossum, rat, and mouse. Several of the porcine TNR regions are highly polymorphic both within and between different breeds. The TNR regions...

  3. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta.

    Science.gov (United States)

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W; Kanost, Michael R; Jiang, Haobo

    2015-07-01

    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., in preparation), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sushi, Wonton, TSP, CUB, Frizzle, and SR domains. There are nineteen groups of genes evolved from relatively recent gene duplication and sequence divergence. Thirty-five SPs and seven SPHs contain 1, 2 or 5 clip domains. Multiple sequence alignment and molecular modeling of the 54 clip domains have revealed structural diversity of these regulatory modules. Sequence comparison with their homologs in Drosophila melanogaster, Anopheles gambiae and Tribolium castaneum allows us to classify them into five subfamilies: A are SPHs with 1 or 5 group-3 clip domains, B are SPs with 1 or 2 group-2 clip domains, C, D1 and D2 are SPs with a single clip domain in group-1a, 1b and 1c, respectively. We have classified into six categories the 125 expression profiles of SP-related proteins in fat body, brain, midgut, Malpighian tubule, testis, and ovary at different stages, suggesting that they participate in various physiological processes. Through RNA-Seq-based gene annotation and expression profiling, as well as intragenomic sequence comparisons, we have established a framework of information for future biochemical research of nondigestive SPs and SPHs in this model species. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Sequence Alignment and Homology Search with BLAST and ClustalW.

    Science.gov (United States)

    Hung, Jui-Hung; Weng, Zhiping

    2016-11-01

    This protocol illustrates the steps of searching a sequence database with BLAST, which in essence performs pairwise alignment between the query sequence and each target sequence in the database. Steps for performing multiple sequence alignments with ClustalW are then described. Argonaute 2 (Ago2) is an essential component for small interfering RNA (siRNA)-directed RNA interference (RNAi) in fruit flies. This protocol uses Ago2 to demonstrate how to search for all Ago2 paralogs in the fly proteome using BLAST and to obtain a multiple sequence alignment of these sequences with ClustalW. © 2016 Cold Spring Harbor Laboratory Press.

  5. Structural and Sequence Similarities of Hydra Xeroderma Pigmentosum A Protein to Human Homolog Suggest Early Evolution and Conservation

    Directory of Open Access Journals (Sweden)

    Apurva Barve

    2013-01-01

    Full Text Available Xeroderma pigmentosum group A (XPA is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1 and replication protein A 70 kDa subunit (RPA70 proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  6. Structural and sequence similarities of hydra xeroderma pigmentosum A protein to human homolog suggest early evolution and conservation.

    Science.gov (United States)

    Barve, Apurva; Ghaskadbi, Saroj; Ghaskadbi, Surendra

    2013-01-01

    Xeroderma pigmentosum group A (XPA) is a protein that binds to damaged DNA, verifies presence of a lesion, and recruits other proteins of the nucleotide excision repair (NER) pathway to the site. Though its homologs from yeast, Drosophila, humans, and so forth are well studied, XPA has not so far been reported from protozoa and lower animal phyla. Hydra is a fresh-water cnidarian with a remarkable capacity for regeneration and apparent lack of organismal ageing. Cnidarians are among the first metazoa with a defined body axis, tissue grade organisation, and nervous system. We report here for the first time presence of XPA gene in hydra. Putative protein sequence of hydra XPA contains nuclear localization signal and bears the zinc-finger motif. It contains two conserved Pfam domains and various characterized features of XPA proteins like regions for binding to excision repair cross-complementing protein-1 (ERCC1) and replication protein A 70 kDa subunit (RPA70) proteins. Hydra XPA shows a high degree of similarity with vertebrate homologs and clusters with deuterostomes in phylogenetic analysis. Homology modelling corroborates the very close similarity between hydra and human XPA. The protein thus most likely functions in hydra in the same manner as in other animals, indicating that it arose early in evolution and has been conserved across animal phyla.

  7. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction

    KAUST Repository

    Cui, Xuefeng

    2016-06-15

    Motivation: Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. Method: We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence–structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. Results: We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM–HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods.

  8. Completion of HLA protein sequences by automated homology-based nearest-neighbor extrapolation of HLA database sequences

    NARCIS (Netherlands)

    Geneugelijk, K; Niemann, M; de Hoop, T; Spierings, E

    2016-01-01

    The IMGT/HLA database contains every publicly available HLA sequence. However, most of these HLA protein sequences are restricted to the alpha-1/alpha-2 domain for HLA class-I and alpha-1/beta-1 domain for HLA class-II. Nevertheless, also polymorphism outside these domains may play a role in

  9. A human homolog of the mouse CD8 molecule, Lyt-3: genomic sequence and expression.

    Science.gov (United States)

    Johnson, P

    1987-01-01

    The CD8 antigen is a marker for those cytotoxic T cells that recognize antigen in the context of class I major histocompatibility antigens (MHC) and has now been identified in many species. In rodents the CD8 antigen is a heterodimer of two distinct chains, Lyt-2 and Lyt-3 in the mouse and OX-8 Mr 32,000 and 37,000 chains in the rat. Human CD8 has consistently been described as a homodimer/homomultimer on mature T cells made up of one chain homologous to the Lyt-2 and OX-8 Mr 32,000 chains. This paper identifies a human equivalent of the second rodent CD8 chain (Lyt-3 and OX-8 Mr 37,000 chains) at the genomic level and shows that this gene is transcribed in human thymocytes and in some acute leukemic T-cell lines. The existence of a human Lyt-3 homolog raises the possibility that human CD8, like mouse CD8, may exist as a heterodimer.

  10. Oligomerization of mouse alpha 1-syntrophin and self-association of its pleckstrin homology domain 1 containing sequences.

    Science.gov (United States)

    Oak, S A; Jarrett, H W

    2000-08-01

    Syntrophins are known to self-associate to form oligomers. Mouse alpha 1-syntrophin sequences were produced as chimeric fusion proteins in bacteria and were found to also oligomerize and in a micromolar Ca(2+)-dependent manner. The oligomerization was localized to the N-terminal pleckstrin homology domain (PH1) or adjacent sequences; the second, C-terminal PH2 domain did not show oligomerization. PH1 was found to self-associate, and calmodulin or Ca(2+)-chelating agents such as ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) could effectively prevent this oligomerization. A single calmodulin bound per syntrophin to cause inhibition of the precipitation. Since calmodulin inhibited syntrophin oligomerization in the presence or absence of Ca(2+), Ca(2+) binding to syntrophin is responsible for the inhibition by EGTA of syntrophin oligomerization.

  11. Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

    Directory of Open Access Journals (Sweden)

    David Karlin

    Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

  12. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    Science.gov (United States)

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  13. More than 1,001 problems with protein domain databases: transmembrane regions, signal peptides and the issue of sequence homology.

    Directory of Open Access Journals (Sweden)

    Wing-Cheong Wong

    Full Text Available Large-scale genome sequencing gained general importance for life science because functional annotation of otherwise experimentally uncharacterized sequences is made possible by the theory of biomolecular sequence homology. Historically, the paradigm of similarity of protein sequences implying common structure, function and ancestry was generalized based on studies of globular domains. Having the same fold imposes strict conditions over the packing in the hydrophobic core requiring similarity of hydrophobic patterns. The implications of sequence similarity among non-globular protein segments have not been studied to the same extent; nevertheless, homology considerations are silently extended for them. This appears especially detrimental in the case of transmembrane helices (TMs and signal peptides (SPs where sequence similarity is necessarily a consequence of physical requirements rather than common ancestry. Thus, matching of SPs/TMs creates the illusion of matching hydrophobic cores. Therefore, inclusion of SPs/TMs into domain models can give rise to wrong annotations. More than 1001 domains among the 10,340 models of Pfam release 23 and 18 domains of SMART version 6 (out of 809 contain SP/TM regions. As expected, fragment-mode HMM searches generate promiscuous hits limited to solely the SP/TM part among clearly unrelated proteins. More worryingly, we show explicit examples that the scores of clearly false-positive hits, even in global-mode searches, can be elevated into the significance range just by matching the hydrophobic runs. In the PIR iProClass database v3.74 using conservative criteria, we find that at least between 2.1% and 13.6% of its annotated Pfam hits appear unjustified for a set of validated domain models. Thus, false-positive domain hits enforced by SP/TM regions can lead to dramatic annotation errors where the hit has nothing in common with the problematic domain model except the SP/TM region itself. We suggest a workflow of

  14. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction.

    Science.gov (United States)

    Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin

    2016-06-15

    Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence-structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM-HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods. Our program is freely available for download from http://sfb.kaust.edu.sa/Pages/Software.aspx : xin.gao@kaust.edu.sa Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  15. Sequence homology: A poor predictive value for profilins cross-reactivity

    Directory of Open Access Journals (Sweden)

    Pazouki Nazanin

    2005-09-01

    Full Text Available Summary Background Profilins are highly cross-reactive allergens which bind IgE antibodies of almost 20% of plant-allergic patients. This study is aimed at investigating cross-reactivity of melon profilin with other plant profilins and the role of the linear and conformational epitopes in human IgE cross-reactivity. Methods Seventeen patients with melon allergy were selected based on clinical history and a positive skin prick test to melon extract. Melon profilin has been cloned and expressed in E. coli. The IgE binding and cross-reactivity of the recombinant profilin were measured by ELISA and inhibition ELISA. The amino acid sequence of melon profilin was compared with other profilin sequences. A combination of chemical cleavage and immunoblotting techniques were used to define the role of conformational and linear epitopes in IgE binding. Comparative modeling was used to construct three-dimensional models of profilins and to assess theoretical impact of amino acid differences on conformational structure. Results Profilin was identified as a major IgE-binding component of melon. Alignment of amino acid sequences of melon profilin with other profilins showed the most identity with watermelon profilin. This melon profilin showed substantial cross-reactivity with the tomato, peach, grape and Cynodon dactylon (Bermuda grass pollen profilins. Cantaloupe, watermelon, banana and Poa pratensis (Kentucky blue grass displayed no notable inhibition. Our experiments also indicated human IgE only react with complete melon profilin. Immunoblotting analysis with rabbit polyclonal antibody shows the reaction of the antibody to the fragmented and complete melon profilin. Although, the well-known linear epitope of profilins were identical in melon and watermelon, comparison of three-dimensional models of watermelon and melon profilins indicated amino acid differences influence the electric potential and accessibility of the solvent-accessible surface of

  16. Sequence characteristics of a gene in equine herpesvirus 1 homologous to glycoprotein H of herpes simplex virus.

    Science.gov (United States)

    Robertson, G R; Scott, N A; Miller, J M; Sabine, M; Zheng, M; Bell, C W; Whalley, J M

    1991-01-01

    A gene in equine herpesvirus 1 (EHV-1, equine abortion virus) homologous to the glycoprotein H gene of herpes simplex virus (HSV) was identified and characterised by its nucleotide and derived amino acid sequence. The EHV-1 gH gene is located at 0.47-0.49 map units and contains an open reading frame capable of specifying a polypeptide of 848 amino acids, including N- and C-terminal hydrophobic domains consistent with signal and membrane anchor regions respectively, and 11 potential sites for N-glycosylation. Alignment of the amino acid sequence with those published for HSV gH, varicella zoster virus gpIII, Epstein Barr virus gp85 and human cytomegalovirus p86 shows similarity of the EHV gene with the 2 other alpha-herpesviruses over most of the polypeptide, but only the C-terminal half could be aligned for all 5 viruses. The identical positioning of 6 cysteine residues and a number of highly conserved amino acid motifs supports a common evolutionary origin of this gene and is consistent with its role as an essential glycoprotein of the herpesvirus family. An origin of replication is predicted to occur at approximately 300 nucleotides downstream of the EHV-1 gH coding region, on the basis of similarity to other herpesvirus origins.

  17. PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

    Science.gov (United States)

    Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

    2016-07-08

    The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Complete Unique Genome Sequence, Expression Profile, and Salivary Gland Tissue Tropism of the Herpesvirus 7 Homolog in Pigtailed Macaques.

    Science.gov (United States)

    Staheli, Jeannette P; Dyen, Michael R; Deutsch, Gail H; Basom, Ryan S; Fitzgibbon, Matthew P; Lewis, Patrick; Barcy, Serge

    2016-08-01

    Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses and are highly prevalent in the human population. Roseolovirus reactivation in an immunocompromised host can cause severe pathologies. While the pathogenic potential of HHV-7 is unclear, it can reactivate HHV-6 from latency and thus contributes to severe pathological conditions associated with HHV-6. Because of the ubiquitous nature of roseoloviruses, their roles in such interactions and the resulting pathological consequences have been difficult to study. Furthermore, the lack of a relevant animal model for HHV-7 infection has hindered a better understanding of its contribution to roseolovirus-associated diseases. Using next-generation sequencing analysis, we characterized the unique genome of an uncultured novel pigtailed macaque roseolovirus. Detailed genomic analysis revealed the presence of gene homologs to all 84 known HHV-7 open reading frames. Phylogenetic analysis confirmed that the virus is a macaque homolog of HHV-7, which we have provisionally named Macaca nemestrina herpesvirus 7 (MneHV7). Using high-throughput RNA sequencing, we observed that the salivary gland tissue samples from nine different macaques had distinct MneHV7 gene expression patterns and that the overall number of viral transcripts correlated with viral loads in parotid gland tissue and saliva. Immunohistochemistry staining confirmed that, like HHV-7, MneHV7 exhibits a natural tropism for salivary gland ductal cells. We also observed staining for MneHV7 in peripheral nerve ganglia present in salivary gland tissues, suggesting that HHV-7 may also have a tropism for the peripheral nervous system. Our data demonstrate that MneHV7-infected macaques represent a relevant animal model that may help clarify the causality between roseolovirus reactivation and diseases. Human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 are classified as roseoloviruses. We have recently discovered that pigtailed macaques are naturally

  19. Isolation and characterization of sequences homologous to the tobacco clone axi 1 (auxin independent) from a Vicia sativa nodule cDNA library

    NARCIS (Netherlands)

    Yalçin-Mendi, Y.; Çetiner, S.; Bisseling, T.

    2001-01-01

    In this research, partial nucleotide sequences of the axi 1 gene, which is related to auxin perception and transduction, isolated from Vicia sativa using cDNA library screening were investigated. Four V. sativa cDNA clones representing homologous of the tobacco axi 1 (auxin independent) cDNA clone

  20. Molecular analysis of Agrobacterium T-DNA integration in tomato reveals a role for left border sequence homology in most integration events.

    Science.gov (United States)

    Thomas, Colwyn M; Jones, Jonathan D G

    2007-10-01

    Studies in several plants have shown that Agrobacterium tumefaciens T-DNA can integrate into plant chromosomal DNA by different mechanisms involving single-stranded (ss) or double-stranded (ds) forms. One mechanism requires sequence homology between plant target and ssT-DNA border sequences and another double-strand-break repair in which preexisting chromosomal DSBs "capture" dsT-DNAs. To learn more about T-DNA integration in Solanum lycopersicum we characterised 98 T-DNA/plant DNA junction sequences and show that T-DNA left border (LB) and right border transfer is much more variable than previously reported in Arabidopsis thaliana and Populus tremula. The analysis of seven plant target sequences showed that regions of homology between the T-DNA LB and plant chromosomal DNA plays an important role in T-DNA integration. One T-DNA insertion generated a target sequence duplication that resulted from nucleolytic processing of a LB/plant DNA heteroduplex that generated a DSB in plant chromosomal DNA. One broken end contained a captured T-DNA that served as a template for DNA repair synthesis. We propose that most T-DNA integrations in tomato require sequence homology between the ssT-DNA LB and plant target DNA which results in the generation of DSBs in plant chromosomal DNA.

  1. In silico sequence analysis and homology modeling of predicted beta-amylase 7-like protein in Brachypodium distachyon L.

    Directory of Open Access Journals (Sweden)

    ERTUĞRUL FILIZ

    2014-04-01

    Full Text Available Beta-amylase (β-amylase, EC 3.2.1.2 is an enzyme that catalyses hydrolysis of glucosidic bonds in polysaccharides. In this study, we analyzed protein sequence of predicted beta-amylase 7-like protein in Brachypodium distachyon. pI (isoelectric point value was found as 5.23 in acidic character, while the instability index (II was found as 50.28 with accepted unstable protein. The prediction of subcellular localization was revealed that the protein may reside in chloroplast by using CELLO v.2.5. The 3D structure of protein was performed using comparative homology modeling with SWISS-MODEL. The accuracy of the predicted 3D structure was checked using Ramachandran plot analysis showed that 95.4% in favored region. The results of our study contribute to understanding of β-amylase protein structure in grass species and will be scientific base for 3D modeling of beta-amylase proteins in further studies.

  2. Next generation sequencing identifies mutations in Atonal homolog 7 (ATOH7) in families with global eye developmental defects

    Science.gov (United States)

    Khan, Kamron; Logan, Clare V.; McKibbin, Martin; Sheridan, Eamonn; Elçioglu, Nursel H.; Yenice, Ozlem; Parry, David A.; Fernandez-Fuentes, Narcis; Abdelhamed, Zakia I.A.; Al-Maskari, Ahmed; Poulter, James A.; Mohamed, Moin D.; Carr, Ian M.; Morgan, Joanne E.; Jafri, Hussain; Raashid, Yasmin; Taylor, Graham R.; Johnson, Colin A.; Inglehearn, Chris F.; Toomes, Carmel; Ali, Manir

    2012-01-01

    The atonal homolog 7 (ATOH7) gene encodes a transcription factor involved in determining the fate of retinal progenitor cells and is particularly required for optic nerve and ganglion cell development. Using a combination of autozygosity mapping and next generation sequencing, we have identified homozygous mutations in this gene, p.E49V and p.P18RfsX69, in two consanguineous families diagnosed with multiple ocular developmental defects, including severe vitreoretinal dysplasia, optic nerve hypoplasia, persistent fetal vasculature, microphthalmia, congenital cataracts, microcornea, corneal opacity and nystagmus. Most of these clinical features overlap with defects in the Norrin/β-catenin signalling pathway that is characterized by dysgenesis of the retinal and hyaloid vasculature. Our findings document Mendelian mutations within ATOH7 and imply a role for this molecule in the development of structures at the front as well as the back of the eye. This work also provides further insights into the function of ATOH7, especially its importance in retinal vascular development and hyaloid regression. PMID:22068589

  3. Tracing the Evolutionary History of the CAP Superfamily of Proteins Using Amino Acid Sequence Homology and Conservation of Splice Sites.

    Science.gov (United States)

    Abraham, Anup; Chandler, Douglas E

    2017-10-01

    Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.

  4. SyntenyTracker: a tool for defining homologous synteny blocks using radiation hybrid maps and whole-genome sequence

    Directory of Open Access Journals (Sweden)

    Lewin Harris A

    2009-07-01

    Full Text Available Abstract Background The recent availability of genomic sequences and BAC libraries for a large number of mammals provides an excellent opportunity for identifying comparatively-anchored markers that are useful for creating high-resolution radiation-hybrid (RH and BAC-based comparative maps. To use these maps for multispecies genome comparison and evolutionary inference, robust bioinformatic tools are required for the identification of chromosomal regions shared between genomes and to localize the positions of evolutionary breakpoints that are the signatures of chromosomal rearrangements. Here we report an automated tool for the identification of homologous synteny blocks (HSBs between genomes that tolerates errors common in RH comparative maps and can be used for automated whole-genome analysis of chromosome rearrangements that occur during evolution. Findings We developed an algorithm and software tool (SyntenyTracker that can be used for automated definition of HSBs using pair-wise RH or gene-based comparative maps as input. To verify correct implementation of the underlying algorithm, SyntenyTracker was used to identify HSBs in the cattle and human genomes. Results demonstrated 96% agreement with HSBs defined manually using the same set of rules. A comparison of SyntenyTracker with the AutoGRAPH synteny tool was performed using identical datasets containing 14,380 genes with 1:1 orthology in human and mouse. Discrepancies between the results using the two tools and advantages of SyntenyTracker are reported. Conclusion SyntenyTracker was shown to be an efficient and accurate automated tool for defining HSBs using datasets that may contain minor errors resulting from limitations in map construction methodologies. The utility of SyntenyTracker will become more important for comparative genomics as the number of mapped and sequenced genomes increases.

  5. Domain structures and molecular evolution of class I and class II major histocompatibility gene complex (MHC) products deduced from amino acid and nucleotide sequence homologies

    Science.gov (United States)

    Ohnishi, Koji

    1984-12-01

    Domain structures of class I and class II MHC products were analyzed from a viewpoint of amino acid and nucleotide sequence homologies. Alignment statistics revealed that class I (transplantation) antigen H chains consist of four mutually homologous domains, and that class II (HLA-DR) antigen β and α chains are both composed of three mutually homologous ones. The N-terminal three and two domains of class I and class II (both β and α) gene products, respectively, all of which being ˜90 residues long, were concluded to be homologous to β2-microglobulin (β2M). The membraneembedded C-terminal shorter domains of these MHC products were also found to be homologous to one another and to the third domain of class I H chains. Class I H chains were found to be more closely related to class II α chains than to class II β chains. Based on these findings, an exon duplication history from a common ancestral gene encoding a β2M-like primodial protein of one-domain-length up to the contemporary MHC products was proposed.

  6. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta

    OpenAIRE

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W.; Kanost, Michael R.; Jiang, Haobo

    2014-01-01

    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., 2015), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sush...

  7. Sequence-Divergent Chordopoxvirus Homologs of the O3 Protein Maintain Functional Interactions with Components of the Vaccinia Virus Entry-Fusion Complex

    Science.gov (United States)

    Satheshkumar, P. S.

    2012-01-01

    Composed of 35 amino acids, O3 is the smallest characterized protein encoded by vaccinia virus (VACV) and is an integral component of the entry-fusion complex (EFC). O3 is conserved with 100% identity in all orthopoxviruses except for monkeypox viruses, whose O3 homologs have 2 to 3 amino acid substitutions. Since O3 is part of the EFC, high conservation could suggest an immutable requirement for interaction with multiple proteins. Chordopoxviruses of other genera also encode small proteins with a characteristic predicted N-terminal α-helical hydrophobic domain followed by basic amino acids and proline in the same relative genome location as that of VACV O3. However, the statistical significance of their similarity to VACV O3 is low due to the large contribution of the transmembrane domain, their small size, and their sequence diversity. Nevertheless, trans-complementation experiments demonstrated the ability of a representative O3-like protein from each chordopoxvirus genus to rescue the infectivity of a VACV mutant that was unable to express endogenous O3. Moreover, recombinant viruses expressing O3 homologs in place of O3 replicated and formed plaques as well or nearly as well as wild-type VACV. The O3 homologs expressed by the recombinant VACVs were incorporated into the membranes of mature virions and, with one exception, remained stably associated with the detergent-extracted and affinity-purified EFC. The ability of the sequence-divergent O3 homologs to coordinate function with VACV entry proteins suggests the conservation of structural motifs. Analysis of chimeras formed by swapping domains of O3 with those of other proteins indicated that the N-terminal transmembrane segment was responsible for EFC interactions and for the complementation of infectivity. PMID:22114343

  8. Identification of neurofibromatosis 1 (NF1) homologous loci by direct sequencing, fluorescence in situ hybridization, and PCR amplification of somatic cell hybrids

    Energy Technology Data Exchange (ETDEWEB)

    Purandare, S.M.; Neil, S.M.; Brothman, A. [Univ. of Utah, Salt Lake City (United States)]|[Jikei Univ., Tokyo (Japan)] [and others

    1995-12-10

    Using fluorescence in situ hybridization (FISH), we have identified seven NF1-related loci, two separate loci on chromosome 2, at bands 2q21 and 2q33-q34, and one locus each on five other chromosomes at bands 14q11.2, 15q11.2, 18p11.2, 21q11.2-q21, and 22q11.2. Application of PCR using NF1 primer pairs and genomic DNA from somatic cell hybrids confirmed the above loci, identified additional loci on chromosomes 12 and 15, and showed that the various loci do not share homology beyond NF1 exon 27b. Sequenced PCR products representing segments corresponding to NF1 exons from these loci demonstrated greater than 95% sequence identity with the NF1 locus. We used sequence differences between bona fide NF1 and NF1-homologous loci to strategically design primer sets to specifically amplify 30 of 36 exons within the 5{prime} end of the NF1 gene. These developments have facilitated mutation analysis at the NF1 locus using genomic DNA as template. 41 refs., 3 figs., 3 tabs.

  9. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    Directory of Open Access Journals (Sweden)

    Geisa P.C. Evaristo

    2015-09-01

    Full Text Available An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was achieved by complementary CID and ETD fragmentations of full-length peptides and of selected tryptic fragments. Heavy and light isotope dimethyl labeling assisted with annotation of sequence ion series. The identified primary structures are GCD[I/L]STCATHN[I/L]VNE[I/L]NKFDKSKPSSGGVGPESP-NH2 and SCNLSTCATHNLVNELNKFDKSKPSSGGVGPESF-NH2, i.e. two carboxyamidated 34 residue peptides with an aminoterminal intramolecular ring structure formed by a disulfide bridge between Cys2 and Cys7. Edman degradation analysis of the second peptide positively confirmed the exact sequence, resolving I/L discriminations. Both peptide sequences are novel and share homology with calcitonin, calcitonin gene related peptide (CGRP and adrenomedullin from other vertebrates. Detailed sequence analysis as well as the 34 residue length of both O. schmackeri peptides, suggest they do not fully qualify as either calcitonins (32 residues or CGRPs (37 amino acids and may justify their classification in a novel peptide family within the calcitonin gene related peptide superfamily. Smooth muscle contractility assays with synthetic replicas of the S–S linked peptides on rat tail artery, uterus, bladder and ileum did not reveal myotropic activity.

  10. RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins.

    Science.gov (United States)

    Walia, Rasna R; Xue, Li C; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

    2014-01-01

    Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence

  11. RNABindRPlus: A Predictor that Combines Machine Learning and Sequence Homology-Based Methods to Improve the Reliability of Predicted RNA-Binding Residues in Proteins

    Science.gov (United States)

    Walia, Rasna R.; Xue, Li C.; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

    2014-01-01

    Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence

  12. Multiplexed CRISPR/Cas9 genome editing increases the efficacy of homologous-dependent repair of donor sequences in mammalian cells

    Directory of Open Access Journals (Sweden)

    Ezio T. Fok

    2015-07-01

    Full Text Available Efficient and robust genome editing tools and strategies allow for specific and exact genetic changes to be captured in model systems, thereby accelerating both forward and reverse genetics studies. The development of CRISPR/Cas9 as a facile designer nuclease toolset has allowed for defined genetic modifications to be efficiently made through homology-directed repair of targeted DNA double-stranded breaks (DSBs using exogenous repair templates. However, traditional single DSB strategies are still relatively inefficient as the short gene conversion tracts of mammalian cell systems limit the extent of achievable gene alteration from the DSB site. In order to improve on the inefficiency, we devised a dual cut strategy, which relies on reconstituting entire deleted gene fragments to precisely modify extensive gene regions of interest. Using the CRISPR/Cas9 system, we were able to introduce targeted deletions and repair of the endogenous KRAS gene locus in cell culture. The use of two simultaneous DSBs can be employed for efficient application of homology-directed repair with a large dsDNA donor sequence, thereby improving the efficacy of deriving cells with a desired gene editing outcome. In conclusion, a multiplexed CRISPR/Cas9 editing strategy represents an efficient tool for the editing of complex, heterologous sequence tracts.

  13. Sequencing and structural homology modeling of the ecdysone receptor in two chrysopids used in biological control of pest insects.

    Science.gov (United States)

    Zotti, Moises João; Christiaens, Olivier; Rougé, Pierre; Grutzmacher, Anderson Dionei; Zimmer, Paulo Dejalma; Smagghe, Guy

    2012-04-01

    In insects, the process of molting and metamorphosis are mainly regulated by a steroidal hormone 20-hydroxyecdysone (20E) and its analogs (ecdysteroids) that specifically bind to the ecdysone receptor ligand-binding domain (EcR-LBD). Currently, several synthetic non-steroidal ecdysone agonists, including tebufenozide, are commercially available as insecticides. Tebufenozide exerts its activity by binding to the 20E-binding site and thus activating EcR permanently. It appears that subtle differences in the architecture among LBDs may underpin the differential binding affinity of tebufenozide across taxonomic orders. In brief, first we demonstrated the harmlessness of tebufenozide towards Chrysoperla externa (Ce). Then, a molecular analysis of EcR-LBD of two neuropteran insects Chrysoperla carnea and Ce was presented. Finally, we constructed a chrysopid in silico homology model docked ponasterone A (PonA) and tebufenozide into the binding pocket and analyzed the amino acids indentified as critical for binding to PonA and tebufenozide. Due to a restrict extent in the cavity at the bottom of the ecdysone-binding pocket a steric clash occurred upon docking of tebufenozide. The absence of harm biological effect and the docking results suggest that tebufenozide is prevented of any deleterious effects on chrysopids.

  14. mRNA:guanine-N7 cap methyltransferases: identification of novel members of the family, evolutionary analysis, homology modeling, and analysis of sequence-structure-function relationships

    Directory of Open Access Journals (Sweden)

    Radlinska Monika

    2001-06-01

    Full Text Available Abstract Background The 5'-terminal cap structure plays an important role in many aspects of mRNA metabolism. Capping enzymes encoded by viruses and pathogenic fungi are attractive targets for specific inhibitors. There is a large body of experimental data on viral and cellular methyltransferases (MTases that carry out guanine-N7 (cap 0 methylation, including results of extensive mutagenesis. However, a crystal structure is not available and cap 0 MTases are too diverged from other MTases of known structure to allow straightforward homology-based interpretation of these data. Results We report a 3D model of cap 0 MTase, developed using sequence-to-structure threading and comparative modeling based on coordinates of the glycine N-methyltransferase. Analysis of the predicted structural features in the phylogenetic context of the cap 0 MTase family allows us to rationalize most of the experimental data available and to propose potential binding sites. We identified a case of correlated mutations in the cofactor-binding site of viral MTases that may be important for the rational drug design. Furthermore, database searches and phylogenetic analysis revealed a novel subfamily of hypothetical MTases from plants, distinct from "orthodox" cap 0 MTases. Conclusions Computational methods were used to infer the evolutionary relationships and predict the structure of Eukaryotic cap MTase. Identification of novel cap MTase homologs suggests candidates for cloning and biochemical characterization, while the structural model will be useful in designing new experiments to better understand the molecular function of cap MTases.

  15. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  16. Directed homology

    DEFF Research Database (Denmark)

    Fahrenberg, Uli

    2004-01-01

    We introduce a new notion of directed homology for semicubical sets. We show that it respects directed homotopy and is functorial, and that it appears to enjoy some good algebraic properties. Our work has applications to higher-dimensional automata.......We introduce a new notion of directed homology for semicubical sets. We show that it respects directed homotopy and is functorial, and that it appears to enjoy some good algebraic properties. Our work has applications to higher-dimensional automata....

  17. Frequency and organization of papA homologous DNA sequences among uropathogenic digalactoside-binding Escherichia coli strains.

    OpenAIRE

    Denich, K; Craiu, A; Rugo, H; Muralidhar, G; O'Hanley, P

    1991-01-01

    The frequency of selected papA DNA sequences among 89 digalactoside-binding, uropathogenic Escherichia coli strains was evaluated with 12 different synthetic 15-base probes corresponding to papA genes from four digalactoside-binding piliated recombinant strains (HU849, 201B, and 200A). The papA probes encode amino acids which are common at the carboxy terminus of all strains, adjacent to the proximal portion of the intramolecular disulfide loop of strain 210B, or predicted to constitute the t...

  18. A protein with amino acid sequence homology to bovine insulin is present in the legume Vigna unguiculata (cowpea

    Directory of Open Access Journals (Sweden)

    Venâncio T.M.

    2003-01-01

    Full Text Available Since the discovery of bovine insulin in plants, much effort has been devoted to the characterization of these proteins and elucidation of their functions. We report here the isolation of a protein with similar molecular mass and same amino acid sequence to bovine insulin from developing fruits of cowpea (Vigna unguiculata genotype Epace 10. Insulin was measured by ELISA using an anti-human insulin antibody and was detected both in empty pods and seed coats but not in the embryo. The highest concentrations (about 0.5 ng/µg of protein of the protein were detected in seed coats at 16 and 18 days after pollination, and the values were 1.6 to 4.0 times higher than those found for isolated pods tested on any day. N-terminal amino acid sequencing of insulin was performed on the protein purified by C4-HPLC. The significance of the presence of insulin in these plant tissues is not fully understood but we speculate that it may be involved in the transport of carbohydrate to the fruit.

  19. The catalytic domain of acanthamoeba myosin I heavy chain kinase. II. Expression of active catalytic domain and sequence homology to p21-activated kinase (PAK).

    Science.gov (United States)

    Brzeska, H; Szczepanowska, J; Hoey, J; Korn, E D

    1996-10-25

    Acanthamoeba myosin I heavy chain (MIHC) kinase is a monomeric 97-kDa protein that is activated by binding to acidic phospholipids or by autophosphorylation. Activation by phospholipids is inhibited by Ca2+-calmodulin. In the accompanying paper (Brzeska, H., Martin, B., and Korn, E. D. (1996) J. Biol. Chem. 271, 27049-27055), we identified the catalytic domain as the COOH-terminal 35 kDa produced by trypsin digestion of phosphorylated MIHC kinase. In this paper, we report the cloning and sequencing of the corresponding cDNA and expression of fully active catalytic domain. The expressed catalytic domain has substrate specificity similar to that of native kinase and resistance to trypsin similar to that of fully phosphorylated MIHC kinase. MIHC kinase catalytic domain has only 25% sequence identity to the catalytic domain of protein kinase A and similarly low sequence identity to the catalytic domains of protein kinase C- and calmodulin-dependent kinases, but 50% sequence identity and 70% similarity to the p21-activated kinase (PAK) and STE20 family of kinases. This suggests that MIHC kinase is (at least) evolutionarily related to the PAK family, whose activities are regulated by small GTP-binding proteins. The homology includes the presence of a potential MIHC kinase autophosphorylation site as well as conserved Tyr and Ser/Thr residues in the region corresponding to the P+1 loop of protein kinase A. A synthetic peptide corresponding to this region of MIHC kinase is phosphorylated by both the expressed catalytic domain and native MIHC kinase.

  20. FFPred 2.0: improved homology-independent prediction of gene ontology terms for eukaryotic protein sequences.

    Directory of Open Access Journals (Sweden)

    Federico Minneci

    Full Text Available To understand fully cell behaviour, biologists are making progress towards cataloguing the functional elements in the human genome and characterising their roles across a variety of tissues and conditions. Yet, functional information - either experimentally validated or computationally inferred by similarity - remains completely missing for approximately 30% of human proteins. FFPred was initially developed to bridge this gap by targeting sequences with distant or no homologues of known function and by exploiting clear patterns of intrinsic disorder associated with particular molecular activities and biological processes. Here, we present an updated and improved version, which builds on larger datasets of protein sequences and annotations, and uses updated component feature predictors as well as revised training procedures. FFPred 2.0 includes support vector regression models for the prediction of 442 Gene Ontology (GO terms, which largely expand the coverage of the ontology and of the biological process category in particular. The GO term list mainly revolves around macromolecular interactions and their role in regulatory, signalling, developmental and metabolic processes. Benchmarking experiments on newly annotated proteins show that FFPred 2.0 provides more accurate functional assignments than its predecessor and the ProtFun server do; also, its assignments can complement information obtained using BLAST-based transfer of annotations, improving especially prediction in the biological process category. Furthermore, FFPred 2.0 can be used to annotate proteins belonging to several eukaryotic organisms with a limited decrease in prediction quality. We illustrate all these points through the use of both precision-recall plots and of the COGIC scores, which we recently proposed as an alternative numerical evaluation measure of function prediction accuracy.

  1. On S3-equivariant homology

    Directory of Open Access Journals (Sweden)

    Mohamed Elhamdadi

    2001-01-01

    Full Text Available We prove that the group S3 (norm 1 quaternions cannot be a geometric realization of a crossed simplicial group and construct an exact sequence connecting S3-equivariant homology of an S3-space with its Pin(2-equivariant homology.

  2. Comparative analysis of the human and feline c-sis proto-oncogenes : Identification of 5' human c-sis coding sequences that are not homologous to the transforming gene of simian sarcoma virus

    NARCIS (Netherlands)

    Ouweland, Ans M.W. van den; Breuer, M.L.; Steenbergh, P.H.; Schalken, Jack A.; Bloemers, H.P.J.; Ven, Wim J.M. Van de

    1985-01-01

    Feline and human genetic sequences, homologous to the v-sis gene of simian sarcoma virus, have been isolated from cosmid gene libraries and characterized by restriction endonuclease analysis. Comparison of the two loci revealed their related structural organization. In both loci, similar unique

  3. The Ectopic Overexpression of the Cotton Ve1 and Ve2-Homolog Sequences Leads to Resistance Response to Verticillium Wilt in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jieyin Chen

    2017-05-01

    Full Text Available Verticillium wilt, caused by the Verticillium dahliae phytopathogen, is a devastating disease affecting many economically important crops. A receptor-like protein (RLP gene, Ve1, has been reported to confer resistance to V. dahliae in tomato plants, but few genes have been found to be involved in cotton Verticillium wilt resistance. Here, we cloned two RLP gene homologs, Gossypium barbadense resistance gene to Verticillium dahliae 1 (GbaVd1 and GbaVd2, from the Verticillium wilt-resistant cultivar G. barbadense cv. Hai7124. GbaVd1 and GbaVd2 display sequence divergence, but both encode typical RLPs. Virus-induced gene silencing of GbaVd1 or GbaVd2 compromised the resistance of cotton to V. dahliae, and both genes conferred Verticillium wilt resistance after interfamily transfer into Arabidopsis. Microarray analysis revealed that GbaVd1 and GbaVd2 participate in Verticillium wilt resistance in Arabidopsis through activation of defense responses, including the endocytosis process, signaling factors, transcription factors and reinforcement of the cell wall, as demonstrated by lignification in Arabidopsis transgenic plants. In addition, microarray analysis showed that GbaVd1 and GbaVd2 differentially mediate resistance signaling and activation of defense responses after overexpression in Arabidopsis. Thus, GbaVd1 and GbaVd2 encode RLPs and act as disease resistance genes that mediate the defense response against V. dahliae in cotton.

  4. Lightning Often Strikes Twice

    Science.gov (United States)

    2005-01-01

    Contrary to popular misconception, lightning often strikes the same place twice. Certain conditions are just ripe for a bolt of electricity to come zapping down; and a lightning strike is powerful enough to do a lot of damage wherever it hits. NASA created the Accurate Location of Lightning Strikes technology to determine the ground strike point of lightning and prevent electrical damage in the immediate vicinity of the Space Shuttle launch pads at Kennedy Space Center. The area surrounding the launch pads is enmeshed in a network of electrical wires and components, and electronic equipment is highly susceptible to lightning strike damage. The accurate knowledge of the striking point is important so that crews can determine which equipment or system needs to be retested following a strike. Accurate to within a few yards, this technology can locate a lightning strike in the perimeter of the launch pad. As an added bonus, the engineers, then knowing where the lightning struck, can adjust the variables that may be attracting the lightning, to create a zone that will be less susceptible to future strikes.

  5. Options with Extreme Strikes

    Directory of Open Access Journals (Sweden)

    Lingjiong Zhu

    2015-07-01

    Full Text Available In this short paper, we study the asymptotics for the price of call options for very large strikes and put options for very small strikes. The stock price is assumed to follow the Black–Scholes models. We analyze European, Asian, American, Parisian and perpetual options and conclude that the tail asymptotics for these option types fall into four scenarios.

  6. Should doctors strike?

    Science.gov (United States)

    Park, John J; Murray, Scott A

    2014-05-01

    Last year in June, British doctors went on strike for the first time since 1975. Amidst a global economic downturn and with many health systems struggling with reduced finances, around the world the issue of public health workers going on strike is a very real one. Almost all doctors will agree that we should always follow the law, but often the law is unclear or does not cover a particular case. Here we must appeal to ethical discussion. The General Medical Council, in its key guidance document for practising doctors, Good Medical Practice, claims that 'Good doctors make the care of their patients their first concern'. Is this true? And if so, how is this relevant to the issue of striking? One year on since the events, we carefully reflect and argue whether it was right for doctors to pursue strike action, and call for greater discussion of ethical issues such as the recent strikes, particularly among younger members of the profession.

  7. Despite sequence homologies to gluten, salivary proline-rich proteins do not elicit immune responses central to the pathogenesis of celiac disease.

    Science.gov (United States)

    Tian, Na; Leffler, Daniel A; Kelly, Ciaran P; Hansen, Joshua; Marietta, Eric V; Murray, Joseph A; Schuppan, Detlef; Helmerhorst, Eva J

    2015-12-01

    Celiac disease (CD) is an inflammatory disorder triggered by ingested gluten, causing immune-mediated damage to the small-intestinal mucosa. Gluten proteins are strikingly similar in amino acid composition and sequence to proline-rich proteins (PRPs) in human saliva. On the basis of this feature and their shared destination in the gastrointestinal tract, we hypothesized that salivary PRPs may modulate gluten-mediated immune responses in CD. Parotid salivary secretions were collected from CD patients, refractory CD patients, non-CD patients with functional gastrointestinal complaints, and healthy controls. Structural similarities of PRPs with gluten were probed with anti-gliadin antibodies. Immune responses to PRPs were investigated toward CD patient-derived peripheral blood mononuclear cells and in a humanized transgenic HLA-DQ2/DQ8 mouse model for CD. Anti-gliadin antibodies weakly cross-reacted with the abundant salivary amylase but not with PRPs. Likewise, the R5 antibody, recognizing potential antigenic gluten epitopes, showed negligible reactivity to salivary proteins from all groups. Inflammatory responses in peripheral blood mononuclear cells were provoked by gliadins whereas responses to PRPs were similar to control levels, and PRPs did not compete with gliadins in immune stimulation. In vivo, PRP peptides were well tolerated and nonimmunogenic in the transgenic HLA-DQ2/DQ8 mouse model. Collectively, although structurally similar to dietary gluten, salivary PRPs were nonimmunogenic in CD patients and in a transgenic HLA-DQ2/DQ8 mouse model for CD. It is possible that salivary PRPs play a role in tolerance induction to gluten early in life. Deciphering the structural basis for the lack of immunogenicity of salivary PRPs may further our understanding of the toxicity of gluten. Copyright © 2015 the American Physiological Society.

  8. An antifungal peptide from Coffea canephora seeds with sequence homology to glycine-rich proteins exerts membrane permeabilization and nuclear localization in fungi.

    Science.gov (United States)

    Zottich, Umberto; Da Cunha, Maura; Carvalho, André O; Dias, Germana B; Casarin, Nádia; Vasconcelos, Ilka M; Gomes, Valdirene M

    2013-06-01

    The superfamily of glycine-rich proteins (GRPs) corresponds to a large and complex group of plant proteins that may be involved in many developmental and physiological processes such as RNA biogenesis, stress tolerance, pollen hydration and plant-pathogen interactions, showing defensive activity against fungi, bacteria and viruses. In this study, the peptides from Coffea canephora seeds were extracted according to the methods of Egorov et al. (2005). The purified peptide was submitted for amino acid sequencing and antimicrobial activity measurement. The purified peptide with a molecular weight of 7kDa, named Cc-GRP, was observed to display homology to GRPs. The Cc-GRP-fungi interaction led to morphological changes and membrane permeability, including the formation of pseudohyphae, which were visualized with the aid of SYTOX green dye. Additionally, Cc-GRP also prevented colony formation by yeasts. Antifungal assays of Fusarium oxysporum and Colletotrichum lindemuthianum, observed by light microscopy, showed that the two molds exhibited morphological changes after the growth assay. Cc-GRP coupled to FITC and its subsequent treatment with DAPI revealed the presence of the peptide in the cell wall, cell surface and nucleus of F. oxysporum. In this work we purified, characterized and evaluated the in vitro effect on fungi of a new peptide from coffee, named Cc-GRP, which is involved in the plant defense system against pathogens by acting through a membrane permeabilization mechanism and localized in the nuclei of fungal cells. We also showed, for the first time, the intracellular localization of Cc-GRP during antimicrobial assay. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. High-rate GPS results for the April 2012 Sumatra earthquake sequence, an unusual, complex, and very large intraplate strike-slip event

    Science.gov (United States)

    Hill, E. M.; Hermawan, I.; Lay, T.; Yue, H.; Banerjee, P.; Qiu, Q.; Macpherson, K. A.; Feng, L.; Tsang, L. L.; Lubis, A.; Tapponnier, P.; Sieh, K. E.

    2012-12-01

    The 11 April 2012 Mw 8.6 Sumatra earthquake was one of the largest strike-slip earthquakes ever recorded, and also one of the largest intraplate earthquakes. It was followed 2 hours later by another great earthquake, of Mw 8.2, in a similar location. The events occurred ~400 km from northern Sumatra, on the oceanic side of the Sunda megathrust. The event was recorded by high-rate GPS stations from our 50-station Sumatra GPS Array (SuGAr). We will present the coseismic displacements and constraints on slip obtained from this network. The location of the events is very interesting. Scientists have long been puzzled by the nature and location of the boundary between the Indian and Australian plates in the depths of the Indian Ocean. Because of the resistance provided by the collision of India with Tibet far to the north, the Indian plate is moving relatively northwards at about 1 cm/yr slower than the Australian plate; this difference in velocity causes strain between the Indian and Australian plates. These earthquakes provide important new evidence that this strain is reactivating a system of faults on the seafloor that were inherited from an older geological epoch, and bring up questions about why this deformation appears to be diffuse, rather than behaving as a proper plate boundary. The events also highlight a back-and-forth interaction between the intraplate faults and the Sunda megathrust; the 2004 megathrust event brought these earthquakes ahead in time, but these earthquakes will in turn have stressed the megathrust. Published seismological results have indicated great complexity in the rupture patterns for these events, with a cascading failure of multiple conjugate faults. Surprisingly, the majority of slip seems to have occurred on the WNW-trending, right-lateral faults, rather than the NNE-trending left-lateral faults that are prominent features of the seafloor. The seismological results also show that the ruptures are likely to have extended from the

  10. Relative K-homology and normal operators

    DEFF Research Database (Denmark)

    Manuilov, Vladimir; Thomsen, Klaus

    2009-01-01

    -term exact sequence which generalizes the excision six-term exact sequence in the first variable of KK-theory. Subsequently we investigate the relative K-homology which arises from the group of relative extensions by specializing to abelian $C^*$-algebras. It turns out that this relative K-homology carries...

  11. Allele-Specific Droplet Digital PCR Combined with a Next-Generation Sequencing-Based Algorithm for Diagnostic Copy Number Analysis in Genes with High Homology: Proof of Concept Using Stereocilin.

    Science.gov (United States)

    Amr, Sami S; Murphy, Elissa; Duffy, Elizabeth; Niazi, Rojeen; Balciuniene, Jorune; Luo, Minjie; Rehm, Heidi L; Abou Tayoun, Ahmad N

    2018-04-01

    Copy number variants (CNVs) can substantially contribute to the pathogenic variant spectrum in several disease genes. The detection of this type of variant is complicated in genes with high homology to other genomic sequences, yet such genomics regions are more likely to lead to CNVs, making it critical to address detection in these settings. We developed a copy number analysis approach for high homology genes/regions that consisted of next-generation sequencing (NGS)-based dosage analysis accompanied by allele-specific droplet digital PCR (ddPCR) confirmatory testing. We applied this approach to copy number analysis in STRC , a gene with 98.9% homology to a nonfunctional pseudogene, pSTRC , and characterized its accuracy in detecting different copy number states by use of known samples. Using a cohort of 517 patients with hearing loss, we prospectively demonstrated the clinical utility of the approach, which contributed 30 of the 122 total positives (6%) to the diagnostic yield, increasing the overall yield from 17.6% to 23.6%. Positive STRC genotypes included homozygous (n = 15) or compound heterozygous (n = 8) deletions, or heterozygous deletions in trans with pathogenic sequence variants (n = 7). Finally, this approach limited ddPCR testing to cases with NGS copy number findings, thus markedly reducing the number of costly and laborious, albeit specific, ddPCR tests. NGS-based CNV detection followed by allele-specific ddPCR confirmatory testing is a reliable and affordable approach for copy number analysis in medically relevant genes with homology issues. © 2017 American Association for Clinical Chemistry.

  12. A right to strike?

    Science.gov (United States)

    Jennings, K; Western, G

    1997-07-01

    During 1995, there was a major shift in the United Kingdom in the debate of whether it is right for nurses to strike. The Royal College of Nursing, the former advocate of a non-industrial action policy, moved towards the UNISON position that industrial action is ethical in some circumstances, as well as the necessary thing to do. The authors, both nurses and UNISON officials, look at the reasons for this change and why UNISON's historical position sees industrial action as an effective weapon in defending services, as well as wages and jobs. It can be right to strike.

  13. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  14. Algab õppus "Saber Strike"

    Index Scriptorium Estoniae

    2014-01-01

    Täna algab Eestis, Lätis ja Leedus Ameerika Ühendriikide Euroopa väekoondise õppus "Saber Strike", mille eesmärk on maaväeüksuste koostöö harjutamine. Õppusest võtab osa üle 2000 kaitseväelase Baltimaadest, USAst, Ühendkuningriigist, Taanist, Norrast, Soomest ja Saksamaalt. Eestist osaleb õppusel ligi 400 kaitseväelast

  15. Global strike hypersonic weapons

    Science.gov (United States)

    Lewis, Mark J.

    2017-11-01

    Beginning in the 1940's, the United States has pursued the development of hypersonic technologies, enabling atmospheric flight in excess of five times the speed of sound. Hypersonic flight has application to a range of military and civilian applications, including commercial transport, space access, and various weapons and sensing platforms. A number of flight tests of hypersonic vehicles have been conducted by countries around the world, including the United States, Russia, and China, that could lead the way to future hypersonic global strike weapon systems. These weapons would be especially effective at penetrating conventional defenses, and could pose a significant risk to national security.

  16. De novo sequencing of two novel peptides homologous to calcitonin-like peptides, from skin secretion of the Chinese Frog, Odorrana schmackeri

    NARCIS (Netherlands)

    Evaristo, Geisa P C; Pinkse, Martijn W H; Chen, Tianbao; Wang, Lei; Mohammed, Shabaz; Heck, Albert J R; Mathes, Isabella; Lottspeich, Friedrich; Shaw, Chris; Albar, Juan Pablo; Verhaert, Peter D E M

    2015-01-01

    An MS/MS based analytical strategy was followed to solve the complete sequence of two new peptides from frog (Odorrana schmackeri) skin secretion. This involved reduction and alkylation with two different alkylating agents followed by high resolution tandem mass spectrometry. De novo sequencing was

  17. Cyclic homology and group actions

    Science.gov (United States)

    Ponge, Raphaël

    2018-01-01

    In this paper we present the construction of explicit quasi-isomorphisms that compute the cyclic homology and periodic cyclic homology of crossed-product algebras associated with (discrete) group actions. In the first part we deal with algebraic crossed-products associated with group actions on unital algebras over any ring k ⊃ Q. In the second part, we extend the results to actions on locally convex algebras. We then deal with crossed-products associated with group actions on manifolds and smooth varieties. For the finite order components, the results are expressed in terms of what we call "mixed equivariant cohomology". This "mixed" theory mediates between group homology and de Rham cohomology. It is naturally related to equivariant cohomology, and so we obtain explicit constructions of cyclic cycles out of equivariant characteristic classes. For the infinite order components, we simplify and correct the misidentification of Crainic (1999). An important new homological tool is the notion of "triangular S-module". This is a natural generalization of the cylindrical complexes of Getzler-Jones. It combines the mixed complexes of Burghelea-Kassel and parachain complexes of Getzler-Jones with the S-modules of Kassel-Jones. There are spectral sequences naturally associated with triangular S-modules. In particular, this allows us to recover spectral sequences of Feigin-Tsygan and Getzler-Jones and leads us to a new spectral sequence.

  18. Impulse of a Kendo Strike

    Directory of Open Access Journals (Sweden)

    Masahiro Abe

    2012-06-01

    Full Text Available An expert swordsman struck a target with a kendo sword. The velocity and force of the strike were measured. The relationship between the strike velocity, impact force and effective mass of the sword was investigated. It was shown that the effective mass of the sword remains constant for typical strike velocities.

  19. The genome of the THE I human transposable repetitive elements is composed of a basic motif homologous to an ancestral immunoglobulin gene sequence.

    OpenAIRE

    Hakim, I; Amariglio, N; Grossman, Z; Simoni-Brok, F; Ohno, S; Rechavi, G

    1994-01-01

    Amplification of rearranged human immunoglobulin heavy-chain genes using the polymerase chain reaction resulted unexpectedly in the amplification of human transposable repetitive element genomes. These were identified as members of the THE I (transposon-like human element I) transposable element family. Analysis of the THE I sequences revealed the presence of several copies of the ancestral building block described > 10 years ago by Ohno and coworkers as the primordial immunoglobulin sequence...

  20. Human DNA contains sequences homologous to the 5'-non-coding region of hepatits C virus: characterization with restriction endonucleases reveals individual varieties.

    Science.gov (United States)

    Dennin, Reinhard H; Wo, Jianer

    2003-07-01

    To investigate a 272 base pair section of the 5'-non-coding region of genomic DNA from the peripheral blood monounuclear cells of healthy hepatitis virus C (HCV)-negative human subjects (not patients). This sequence section bears interest because (1) it harbors several potential methylation (Cp-rich) sites, and (2) it represents the largest part of its internal ribosomal entry site. A pre-PCR digestion protocol was established making consistent use of four restriction endonucleases selected for certain features: SmaI, XmaCI, MspI, and HpaII are inhibited if methylation(s) are present at certain cytosines within their cutting sequences. The suspected HCV-specific sequence was found in the DNA of each subject tested. The pre-PCR digestion assay reveals individual differences in their pattern of methylation, which may be due to possible epigenetic phenomena. The results provide formal proof that these HCV-specific sequences are contained in the genomic or extra chromosomal target DNA, and probably belong to a new class of endogenous sequences.

  1. Sequences homologous to the human x- and y-borne zinc finger protein genes (ZFX/Y) are autosomal in monotreme mannals

    Energy Technology Data Exchange (ETDEWEB)

    Watson, J.M.; Frost, C.; Graves, M.J.A. (Latrobe Univ., Bundoora (Australia)); Spencer, J.A. (Beckman Inst. of the City of Hope, Duarte, CA (United States))

    1993-02-01

    The human zinc finger protein genes (ZFX/Y) were identified as a result of a systematic search for the testis-determining factor gene on the human Y chromosome. Although they play no direct role in sex determination, they are of particular interest because they are highly conserved among mammals, birds, and amphibians and because, in eutherian mammals at least, they have active alleles on both the X and the Y chromosomes outside the pseudoautosomal region. We used in situ hybridization to localize the homologues of the zinc finger protein gene to chromosome 1 of the Australian echidna and to an equivalent position on chromosomes 1 and 2 of the playtpus. The localization to platypus chromosome 1 was confirmed by Southern analysis of a Chinese hamster [times] platypus cell hybrid retaining most of platypus chromosome 1. This localization is consistent with the cytological homology of chromosome 1 between the two species. The zinc finger protein gene homologues were localized to regions of platypus chromosomes 1 and 2 that included a number of other genes situated near ZFX on the short arm of the human X chromosome. These results support the hypothesis that many of the genes located on the short arm of the human X were originally autosomal and have been translocated to the X chromosome since the eutherian-metatherian divergence. 34 refs., 3 figs., 2 tabs.

  2. A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

    Science.gov (United States)

    Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

    2010-02-01

    A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

  3. Precision Strike Annual Programs Review

    Science.gov (United States)

    2009-03-11

    Damage Area*• GPS / INS Navigation + SAL Terminal • Precise əm CEP • Low Probability of Collateral Damage • GPS Extends Glide Range to 10+km • Agile...Page 311 Mar 09 Unclassified Unclassified Viper Strike Lineage Viper Strike SAL Seeker Proof of Principle Demos I & II Hunter-Viper Strike Quick...Information Management • CCA - Clinger Cohen Act • RIT- Rapid Improvement Team • BMMP – Business Management Modernization Program • BTA/ERAM – Business

  4. Real Topological Cyclic Homology

    DEFF Research Database (Denmark)

    Høgenhaven, Amalie

    The main topics of this thesis are real topological Hochschild homology and real topological cyclic homology. If a ring or a ring spectrum is equipped with an anti-involution, then it induces additional structure on the topological Hochschild homology spectrum. The group O(2) acts on the spectrum......, where O(2) is the semi-direct product of T, the multiplicative group of complex number of modulus 1, by the group G=Gal(C/R). We refer to this O(2)-spectrum as the real topological Hochschild homology. This generalization leads to a G-equivariant version of topological cyclic homology, which we call...... real topological cyclic homology. The first part of the thesis computes the G-equivariant homotopy type of the real topological cyclic homology of spherical group rings at a prime p with anti-involution induced by taking inverses in the group. The second part of the thesis investigates the derived G...

  5. Homology Groups of a Pipeline Petri Net

    Directory of Open Access Journals (Sweden)

    A. A. Husainov

    2013-01-01

    Full Text Available Petri net is said to be elementary if every place can contain no more than one token. In this paper, it is studied topological properties of the elementary Petri net for a pipeline consisting of n functional devices. If the work of the functional devices is considered continuous, we can come to some topological space of “intermediate” states. In the paper, it is calculated the homology groups of this topological space. By induction on n, using the Addition Sequence for homology groups of semicubical sets, it is proved that in dimension 0 and 1 the integer homology groups of these nets are equal to the group of integers, and in the remaining dimensions are zero. Directed homology groups are studied. A connection of these groups with deadlocks and newsletters is found. This helps to prove that all directed homology groups of the pipeline elementary Petri nets are zeroth.

  6. Isolation and characterization of the normal crossreacting antigen: homology of its NH2-terminal amino acid sequence with that of carcinoembryonic antigen.

    Science.gov (United States)

    Engvall, E; Shively, J E; Wrann, M

    1978-01-01

    The normal antigen, NCA, which crossreacts with the carcinoembryonic antigen, CEA, was purified from normal spleen tissue by an immunochemical purification method using insolubilized antibodies to either CEA or NCA. The highly purified NCA obtained was extensively characterized by immunological tests. The molecular weight of NCA determined by chromatography on Sephadex G-200 was approximately 100,000. The total amount of carbohydrate in NCA was 30%, compared to 60% in CEA. NCA and CEA also differed in sugar composition. The amino acid composition of NCA was nearly identical to that of CEA, except for the apparent presence of methionine in NCA but not in CEA. The sequence of the first 26 NH2-terminal amino acids in NCA was identical to that of CEA except at position 21, where alanine was found in NCA instead of valine in CEA. Images PMID:77016

  7. Lectures on functor homology

    CERN Document Server

    Touzé, Antoine

    2015-01-01

    This book features a series of lectures that explores three different fields in which functor homology (short for homological algebra in functor categories) has recently played a significant role. For each of these applications, the functor viewpoint provides both essential insights and new methods for tackling difficult mathematical problems. In the lectures by Aurélien Djament, polynomial functors appear as coefficients in the homology of infinite families of classical groups, e.g. general linear groups or symplectic groups, and their stabilization. Djament’s theorem states that this stable homology can be computed using only the homology with trivial coefficients and the manageable functor homology. The series includes an intriguing development of Scorichenko’s unpublished results. The lectures by Wilberd van der Kallen lead to the solution of the general cohomological finite generation problem, extending Hilbert’s fourteenth problem and its solution to the context of cohomology. The focus here is o...

  8. Homologous expression and T3SS-dependent secretion of TAP-tagged Xo2276 in Xanthomonas oryzae pv. oryzae induced by rice leaf extract and its direct in vitro recognition of putative target DNA sequence.

    Science.gov (United States)

    Kim, Seunghwan; Nguyen, Thi-Dieu-Hanh; Lee, Joohee; Hong, Myoung-ki; Pham, Tan-Viet; Ahn, Yeh-Jin; Lee, Byoung-Moo; Han, Ye Sun; Kim, Dong-Eun; Kim, Jeong-Gu; Kang, Lin-Woo

    2013-01-01

    Xo2276 is a putative transcription activator-like effector (TALE) in Xanthomonas oryzae pv. oryzae (Xoo). Xo2276 was expressed with a TAP-tag at the C-terminus in Xoo cells to enable quantitative analysis of protein expression and secretion. Nearly all TAP-tagged Xo2276 existed in an insoluble form; addition of rice leaf extracts from a Xoo-susceptible rice cultivar, Milyang23, significantly stimulated secretion of TAP-tagged Xo2276 into the medium. In a T3SS-defective Xoo mutant strain, secretion of TAP-tagged Xo2276 was blocked. Xo2276 is a Xoo ortholog of Xanthomonas campestris pv. vesicatoria (Xcv) AvrBs3 and contains a conserved DNA-binding domain (DBD), which includes 19.5 tandem repeats of 34 amino acids. Xo2276- DBD was expressed in E. coli and purified. Direct in vitro recognition of Xo2276-DBD on a putative target DNA sequence was confirmed using an electrophoretic mobility shift assay. This is the first study measuring the homologous expression and secretion of Xo2276 in vitro using rice leaf extract and its direct in vitro binding to the specific target DNA sequence.

  9. Dualities in Persistent (Co)Homology

    Energy Technology Data Exchange (ETDEWEB)

    de Silva, Vin; Morozov, Dmitriy; Vejdemo-Johansson, Mikael

    2011-09-16

    We consider sequences of absolute and relative homology and cohomology groups that arise naturally for a filtered cell complex. We establishalgebraic relationships between their persistence modules, and show that they contain equivalent information. We explain how one can use the existingalgorithm for persistent homology to process any of the four modules, and relate it to a recently introduced persistent cohomology algorithm. Wepresent experimental evidence for the practical efficiency of the latter algorithm.

  10. Identification and comparative sequence analysis of a gene in equine herpesvirus 1 with homology to the herpes simplex virus glycoprotein D gene.

    Science.gov (United States)

    Whalley, M; Robertson, G; Bell, C; Love, D; Elphinstone, M; Wiley, L; Craven, D

    1991-10-01

    A homologue of the herpes simplex virus (HSV) glycoprotein D gene has been identified in the genome of equine herpesvirus-1 (EHV-1, equine abortion virus). An open reading frame in the middle of the short unique (US) region is capable of encoding a polypeptide of 402 amino acids that has 26% and 20% of its residues matching pseudorabies virus (PRV) gp50 and HSV-1 gD, respectively. Despite this low level of similarity, the positional identity of six cysteine residues and certain motifs, and the location of the EHV-1 gene, clearly define the EHV-1 polypeptide as one of a family of "gD-like" proteins. Two transcripts of 3.3-3.6 kb and 5.4-5.9 kb were identified, consistent with coterminal mRNAs for the EHV-1 gD gene and the adjacent upstream gene, respectively. Partial sequencing of other regions in US also revealed EHV-1 homologues of HSV-1 gE and gI genes, and a possible equivalent gene to PRV gX. By analogy with the ability of HSV-1 gD and PRV gp50 to induce strong anti-viral immune responses, the EHV-1 gD gene product is expected to be an excellent candidate for development as a vaccine antigen.

  11. Continental United States Hurricane Strikes

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Continental U.S. Hurricane Strikes Poster is our most popular poster which is updated annually. The poster includes all hurricanes that affected the U.S. since...

  12. Syntenic homology of human unique DNA sequences within chromossome regions 5q31, 10q22, 13q32-33 and 19q13.1 in the great apes

    Directory of Open Access Journals (Sweden)

    Rhea U. Vallente-Samonte

    2000-09-01

    Full Text Available Homologies between chromosome banding patterns and DNA sequences in the great apes and humans suggest an apparent common origin for these two lineages. The availability of DNA probes for specific regions of human chromosomes (5q31, 10q22, 13q32-33 and 19q13.1 led us to cross-hybridize these to chimpanzee (Pan troglodytes, PTR, gorilla (Gorilla gorilla, GGO and orangutan (Pongo pygmaeus, PPY chromosomes in a search for equivalent regions in the great apes. Positive hybridization signals to the chromosome 5q31-specific DNA probe were observed at HSA 5q31, PTR 4q31, GGO 4q31 and PPY 4q31, while fluorescent signals using the chromosome 10q22-specific DNA probe were noted at HSA 10q22, PTR 8q22, GGO 8q22 and PPY 7q22. The chromosome arms showing hybridization signals to the Quint-EssentialTM 13-specific DNA probe were identified as HSA 13q32-33, PTR 14q32-33, GGO 14q32-33 and PPY 14q32-33, while those presenting hybridization signals to the chromosome 19q13.1-specific DNA probe were identified as HSA 19q13.1, PTR 20q13, GGO 20q13 and PPY 20q13. All four probes presumably hybridized to homologous chromosomal locations in the apes, which suggests a homology of certain unique DNA sequences among hominoid species.Homologias entre os padrões de bandamento de cromossomos e seqüências de DNA em grandes macacos e humanos sugerem uma aparente origem comum para estas duas linhagens. A disponibilidade de sondas de DNA para regiões específicas de cromossomos humanos (5q31, 10q22, 13q32-33 e 19q13.1 nos levou a realizar hibridação cruzada com cromossomos de chimpanzé (Pan troglodytes, PTR, gorila (Gorilla gorilla, GGO e orangotango (Pongo pygmaeus, PPY em um pesquisa de regiões equivalentes em grandes macacos. Sinais positivos de hibridação para a sonda de DNA específica para o cromossomo 5q31 foram observados em HSA 5q31, PTR 4q31, GGO 4q31 e PPY 4q31, enquanto que sinais fluorescentes usando a sonda de DNA específica para o cromossomo 10q22 foram

  13. [Physicians' strikes--ethical considerations].

    Science.gov (United States)

    Glick, Shimon; Schwarzfuchs, Dan

    2012-01-01

    Strikes in general represent a solution based on a form of coercion. Historically, the striker caused direct damage to his employer, who was responsible for the perceived unfair treatment of the employee. In the case of strikes in the public sector, the employer is generally not harmed, but innocent citizens suffer in order to pressure the government agencies, a questionable practice from an ethical viewpoint. Physicians' strikes have more serious ethical problems. They cause suffering and death to innocent citizens. They violate the ethical codes to which physicians have committed themselves as professionals, and they seriously impair the trust of the public in physicians. Better and more ethical ways to provide fair compensation for physicians must be employed, perhaps like those used for judges and members of the IDF.

  14. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

  15. Gorenstein homological dimensions

    DEFF Research Database (Denmark)

    Holm, Henrik Granau

    2004-01-01

    In basic homological algebra, the projective, injective and 2at dimensions of modules play an important and fundamental role. In this paper, the closely related Gorenstein projective, Gorenstein injective and Gorenstein 2at dimensions are studied. There is a variety of nice results about Gorenstein...... dimensions over special commutative noetherian rings; very often local Cohen–Macaulay rings with a dualizing module. These results are done by Avramov, Christensen, Enochs, Foxby, Jenda, Martsinkovsky and Xu among others. The aim of this paper is to generalize these results, and to give homological...... descriptions of the Gorenstein dimensions over arbitrary associative rings....

  16. Respecting the right to strike

    CERN Multimedia

    Staff Association

    2015-01-01

    Since two years the representatives of the employers in the ILO, a tripartite multilateral body responsible for guaranteeing the correct application of an international labour code, try to weaken the global work regulations. On the occasion of the Global Day of Action for the right to strike at the invitation of the Geneva community of Union action (Communauté genevoise d’action syndicale) and the Swiss Trade Union Association (Union syndicale suisse) around noon on Wednesday 18th February some fifty staff representatives of international organizations gathered on the place des Nations in Geneva to reaffirm the importance of this fundamental right, too often flouted. A delegation of the CERN Staff Association was also present. In a short speech, the Staff Association said that, while being one of the fundamental human rights, to be efficient the right to strike must be used intelligently. It must be implemented taking into account the sensitivities of the professional environment and r...

  17. Homology and phylogeny and their automated inference.

    Science.gov (United States)

    Fuellen, Georg

    2008-06-01

    The analysis of the ever-increasing amount of biological and biomedical data can be pushed forward by comparing the data within and among species. For example, an integrative analysis of data from the genome sequencing projects for various species traces the evolution of the genomes and identifies conserved and innovative parts. Here, I review the foundations and advantages of this "historical" approach and evaluate recent attempts at automating such analyses. Biological data is comparable if a common origin exists (homology), as is the case for members of a gene family originating via duplication of an ancestral gene. If the family has relatives in other species, we can assume that the ancestral gene was present in the ancestral species from which all the other species evolved. In particular, describing the relationships among the duplicated biological sequences found in the various species is often possible by a phylogeny, which is more informative than homology statements. Detecting and elaborating on common origins may answer how certain biological sequences developed, and predict what sequences are in a particular species and what their function is. Such knowledge transfer from sequences in one species to the homologous sequences of the other is based on the principle of 'my closest relative looks and behaves like I do', often referred to as 'guilt by association'. To enable knowledge transfer on a large scale, several automated 'phylogenomics pipelines' have been developed in recent years, and seven of these will be described and compared. Overall, the examples in this review demonstrate that homology and phylogeny analyses, done on a large (and automated) scale, can give insights into function in biology and biomedicine.

  18. Macular damage following lightning strikes.

    Science.gov (United States)

    Augustin, A J; Koch, F; Böker, T

    1995-07-01

    Two men with recent history of lightining strike were referred to our hospital. Both patients complained of metamorphosia in one eye and reduced visual acuity. Funduscopy revealed target-like alterations at the fovea. Fluorescein angiography showed window defects of the central retinal pigment epithelium in both patients. One patient developed an anterior subcapsular cataract. If the eye is part of the current-circuit, the melanin granules of the iris, pigment epithelium, and choroid might act as a resistor. The resulting accumulation of heat may lead to damage of the surrounding tissues.

  19. GPCR Homology Model Generation for Lead Optimization.

    Science.gov (United States)

    Tautermann, Christofer S

    2018-01-01

    The vast increase of recently solved GPCR X-ray structures forms the basis for GPCR homology modeling to atomistic accuracy. Nowadays, homology models can be employed for GPCR-ligand optimization and have been reported as invaluable tools for drug design in the last few years. Elucidation of the complex GPCR pharmacology and the associated GPCR conformations made clear that different homology models have to be constructed for different activation states of the GPCRs. Therefore, templates have to be chosen accordingly to their sequence homology as well as to their activation state. The subsequent ligand placement is nontrivial, as some recent X-ray structures show very unusual ligand binding sites and solvent involvement, expanding the space of the putative ligand binding site from the generic retinal binding pocket to the whole receptor. In the present study, a workflow is presented starting from the selection of the target sequence, guiding through the GPCR modeling process, and finishing with ligand placement and pose validation.

  20. Women, transition and strikes in Serbia

    OpenAIRE

    Novaković, Nada G.

    2014-01-01

    The author, in a sociological way, describes and analyzes the concepts of transition, privatization and strikes in Serbia, particularly the place of women in it. It examines the most important economic and social causes and consequences of these phenomena. The main hypothesis is: women's strikes in the Serbian transition are less efficient than strikes and public protests of women in the developed world and the second Yugoslavia. A strike is a class conflict, in which the workers are fighting...

  1. 14 CFR 35.38 - Lightning strike.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Lightning strike. 35.38 Section 35.38... STANDARDS: PROPELLERS Tests and Inspections § 35.38 Lightning strike. The applicant must demonstrate, by... lightning strike without causing a major or hazardous propeller effect. The limit to which the propeller has...

  2. Batter's Choice: Lessons for Teaching Tactics in a Modified Striking/Fielding Game

    Science.gov (United States)

    Sinclair, Christina

    2004-01-01

    When played in their standard form, striking/fielding games are often a favorite among elementary students; yet they allow for only limited participation, which is contradictory to quality physical education. This article presents a sequence of lessons leading to Batter's Choice, a modified striking/fielding game, designed to maximize the…

  3. Strikes in Serbia since 2000 to 2005

    Directory of Open Access Journals (Sweden)

    Novaković Nada

    2005-01-01

    Full Text Available In this article author deals with main characteristics of strikes in Serbia within the period 2000–2005. Analysis starts with thesis that strike is open class conflict within class divided society. Therefore strike is radical form of trade union struggle for workers rights. Main questions in the analysis were: on social structure as a background of strikes, on organizations and trade unions included in it, on effects of strikes in Serbia in the given period. Main thesis of the article is that every power dislike strikes and is ready to do everything to diminish them. Main reason lies in the class nature of social conflict that underlie them. Main processes that underlie strike phenomena in Serbia since 2000. are the processes of originally capital accumulation. These bring about the formation of new capitalist class and proletariat of all professions. Author gives a brief analysis of privatization process, as well as of restructuring of public sector and deregulation of economy trying to show the role of all of it in origins of strikes. Main conclusion is that there are large number of strikes in all parts of society, that are well organized, with support of one or more trade unions. For these in power they are factor of obstacle on the way of successful transition. As for the reasons and outcomes these strikes are akin to the strikes at the beginning of 19th century.

  4. Third-party support for strike action.

    Science.gov (United States)

    Kelloway, E Kevin; Francis, Lori; Catano, Victor M; Dupré, Kathryne E

    2008-07-01

    Labor strikes are often seen as battles for public support. Members of the public are asked to show respect for a strike by refusing to cross the picket line or by joining strikers on the picket line. Such public support may affect the morale of strikers and influence the strike's duration. Despite the perceived importance of the public in labor disputes, members of third parties have not been considered in previous strike research. In 2 studies, the authors show that a new measure of third-party strike support is unidimensional and highly reliable. In both cases, union attitudes and perceptions of distributive justice were significant predictors of support for strike action. Those who are more supportive of unions in general and believe that the contract offered to the strikers was unfair were more likely to support the strike by engaging in such actions as conversing with strikers, writing letters, and refusing to cross the picket line.

  5. Equivariant elliptic homology

    International Nuclear Information System (INIS)

    Devoto, J.A.

    1992-05-01

    In a previous paper we studied the modular properties of indices of elliptic operators on twisted loop spaces of manifolds with finite group actions. This motivates the introduction of the universal twisted elliptic genus. This genus can be interpreted as a ring homomorphism from the equivariant bordism ring MU * G to a ring Ell * G . It is shown that the functor X→Ell * G =MU * G (X)x MU * G Ell * G defines an equivariant homology theory, and that the associated cohomology theory satisfies a conjecture of Atiyah and Segal about generalized Lefchetz formulas. (author). 24 refs

  6. Whole genome sequencing and analysis reveal insights into the genetic structure, diversity and evolutionary relatedness of luxI and luxR homologs in bacteria belonging to the Sphingomonadaceae family.

    Science.gov (United States)

    Gan, Han Ming; Gan, Huan You; Ahmad, Nurul H; Aziz, Nazrin A; Hudson, André O; Savka, Michael A

    2014-01-01

    Here we report the draft genomes and annotation of four N-acyl homoserine lactone (AHL)-producing members from the family Sphingomonadaceae. Comparative genomic analyses of 62 Sphingomonadaceae genomes were performed to gain insights into the distribution of the canonical luxI/R-type quorum sensing (QS) network within this family. Forty genomes contained at least one luxR homolog while the genome of Sphingobium yanoikuyae B1 contained seven Open Reading Frames (ORFs) that have significant homology to that of luxR. Thirty-three genomes contained at least one luxI homolog while the genomes of Sphingobium sp. SYK6, Sphingobium japonicum, and Sphingobium lactosutens contained four luxI. Using phylogenetic analysis, the sphingomonad LuxR homologs formed five distinct clades with two minor clades located near the plant associated bacteria (PAB) LuxR solo clade. This work for the first time shows that 13 Sphingobium and one Sphingomonas genome(s) contain three convergently oriented genes composed of two tandem luxR genes proximal to one luxI (luxR-luxR-luxI). Interestingly, luxI solos were identified in two Sphingobium species and may represent species that contribute to AHL-based QS system by contributing AHL molecules but are unable to perceive AHLs as signals. This work provides the most comprehensive description of the luxI/R circuitry and genome-based taxonomical description of the available sphingomonad genomes to date indicating that the presence of luxR solos and luxI solos are not an uncommon feature in members of the Sphingomonadaceae family.

  7. Grid diagrams and Khovanov homology

    DEFF Research Database (Denmark)

    Droz, Jean-Marie; Wagner, Emmanuel

    2009-01-01

    We explain how to compute the Jones polynomial of a link from one of its grid diagrams and we observe a connection between Bigelow’s homological definition of the Jones polynomial and Kauffman’s definition of the Jones polynomial. Consequently, we prove that the Maslov grading on the Seidel–Smith...... symplectic link invariant coincides with the difference between the homological grading on Khovanov homology and the Jones grading on Khovanov homology. We give some evidence for the truth of the Seidel–Smith conjecture....

  8. Complete genome sequence analysis and identification of putative metallo-beta-lactamase and SpoIIIE homologs in Bacillus cereus group phage BCP8-2, a new member of the proposed Bastille-like group.

    Science.gov (United States)

    Asare, Paul Tetteh; Bandara, Nadeeka; Jeong, Tae-Yong; Ryu, Sangryeol; Klumpp, Jochen; Kim, Kwang-Pyo

    2015-10-01

    Bacillus cereus group-specific bacteriophage BCP8-2 exhibits a broad lysis spectrum among food and human isolates (330/364) of B. cereus while not infecting B. subtilis (50) or B. licheniformis (12) strains. Its genome is 159,071 bp long with 220 open reading frames, including genes for putative methyltransferases, metallo-beta-lactamase, and a sporulation-related SpoIIIE homolog, as wells as 18 tRNAs. Comparative genome analysis showed that BCP8-2 is related to the recently proposed Bastille-like phages, but not with either SPO1-like or Twort-like phages of the subfamily Spounavirinae.

  9. Clustering evolving proteins into homologous families.

    Science.gov (United States)

    Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A

    2013-04-08

    Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better

  10. 14 CFR 29.631 - Bird strike.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Bird strike. 29.631 Section 29.631... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Design and Construction General § 29.631 Bird strike. The... safe landing (for Category B) after impact with a 2.2-lb (1.0 kg) bird when the velocity of the...

  11. Mismatch Repair during Homologous and Homeologous Recombination

    Science.gov (United States)

    Spies, Maria; Fishel, Richard

    2015-01-01

    Homologous recombination (HR) and mismatch repair (MMR) are inextricably linked. HR pairs homologous chromosomes before meiosis I and is ultimately responsible for generating genetic diversity during sexual reproduction. HR is initiated in meiosis by numerous programmed DNA double-strand breaks (DSBs; several hundred in mammals). A characteristic feature of HR is the exchange of DNA strands, which results in the formation of heteroduplex DNA. Mismatched nucleotides arise in heteroduplex DNA because the participating parental chromosomes contain nonidentical sequences. These mismatched nucleotides may be processed by MMR, resulting in nonreciprocal exchange of genetic information (gene conversion). MMR and HR also play prominent roles in mitotic cells during genome duplication; MMR rectifies polymerase misincorporation errors, whereas HR contributes to replication fork maintenance, as well as the repair of spontaneous DSBs and genotoxic lesions that affect both DNA strands. MMR suppresses HR when the heteroduplex DNA contains excessive mismatched nucleotides, termed homeologous recombination. The regulation of homeologous recombination by MMR ensures the accuracy of DSB repair and significantly contributes to species barriers during sexual reproduction. This review discusses the history, genetics, biochemistry, biophysics, and the current state of studies on the role of MMR in homologous and homeologous recombination from bacteria to humans. PMID:25731766

  12. Strong Algerian Earthquake Strikes Near Capital City

    Science.gov (United States)

    Ayadi, A.; Maouche, S.; Harbi, A.; Meghraoui, M.; Beldjoudi, H.; Oussadou, F.; Mahsas, A.; Benouar, D.; Heddar, A.; Rouchiche, Y.; Kherroubi, A.; Frogneux, M.; Lammali, K.; Benhamouda, F.; Sebaï, A.; Bourouis, S.; Alasset, P. J.; Aoudia, A.; Cakir, Z.; Merahi, M.; Nouar, O.; Yelles, A.; Bellik, A.; Briole, P.; Charade, O.; Thouvenot, F.; Semane, F.; Ferkoul, A.; Deramchi, A.; Haned, S. A.

    On 21 May 2003, a damaging earthquake of Mw 6.8 struck the region of Boumerdes 40 km east of Algiers in northern Algeria (Figure 1). The mainshock, which lasted ~ 36-40 s, had devastating effects and claimed about 2300 victims, caused more than 11,450 injuries, and left about 200,000 people homeless. It destroyed and seriously damaged around 180,000 housing units and 6000 public buildings with losses estimated at $5 billion. The mainshock was widely felt within a radius of ~ 400 km in Algeria. To the north, the earthquake was felt in southeastern Spain, including the Balearic Islands, and also in Sardinia and in southern France. The mainshock location, which was calculated at 36.91°N, 3.58°E (15 km offshore of Zemmouri; Figure 1), and the local magnitude (Md 6.4) are from seismic records of local stations. International seismological centers obtained Mw 6.8 (NEIC) with a thrust focal mechanism solution and 1.83 × 1026 dyne.cm for the seismic moment. A sequence of aftershocks affected the epicentral area with two strong shocks reaching Mw 5.8 on 27 and 29 May 2003. Field investigations allowed us to assign a maximum intensity X (European Macroseismic Scale 98) and to report rockfalls, minor surface cracks, and liquefaction phenomena. The mainshock was not associated with inland surface faulting, but one of the most striking coseismic effects is the coastal uplift and the backwash along the littoral of the Mitidja basin.

  13. Lightning Strike in Pregnancy With Fetal Injury.

    Science.gov (United States)

    Galster, Kellen; Hodnick, Ryan; Berkeley, Ross P

    2016-06-01

    Injuries from lightning strikes are an infrequent occurrence, and are only rarely noted to involve pregnant victims. Only 13 cases of lightning strike in pregnancy have been previously described in the medical literature, along with 7 additional cases discovered within news media reports. This case report presents a novel case of lightning-associated injury in a patient in the third trimester of pregnancy, resulting in fetal ischemic brain injury and long-term morbidity, and reviews the mechanics of lightning strikes along with common injury patterns of which emergency providers should be aware. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  14. Homology theory on algebraic varieties

    CERN Document Server

    Wallace, Andrew H

    1958-01-01

    Homology Theory on Algebraic Varieties, Volume 6 deals with the principles of homology theory in algebraic geometry and includes the main theorems first formulated by Lefschetz, one of which is interpreted in terms of relative homology and another concerns the Poincaré formula. The actual details of the proofs of these theorems are introduced by geometrical descriptions, sometimes aided with diagrams. This book is comprised of eight chapters and begins with a discussion on linear sections of an algebraic variety, with emphasis on the fibring of a variety defined over the complex numbers. The n

  15. Expeditionary Strike Group: Command Structure Design Support

    National Research Council Canada - National Science Library

    Hutchins, Susan G; Kemple, William G; Kleinman, David L; Hocevar, Susan P

    2005-01-01

    An Expeditionary Strike Group (ESG) is a new capability mix that combines the combat power of three surface combatants and one submarine with an Amphibious Readiness Group/ Marine Expeditionary Unit...

  16. The Chicago Teachers Strike and Its Public

    Science.gov (United States)

    Shuffelton, Amy B.

    2014-01-01

    This article considers the 2012 Chicago Teachers Strike in light of John Dewey's "The Public and Its Problems." It engages Dewey's conceptualization of practical reason to challenge the educational reform movement's commitment to technocratic decision-making.

  17. Combining Evidence from Homologous Datasets

    National Research Council Canada - National Science Library

    Feng, Ao; Allan, James

    2006-01-01

    .... We argue that combining evidence from these "homologous" datasets can give us better representation of the original data, and our experiments show that a model combining all sources outperforms each...

  18. Fivebranes and 3-manifold homology

    Science.gov (United States)

    Gukov, Sergei; Putrov, Pavel; Vafa, Cumrun

    2017-07-01

    Motivated by physical constructions of homological knot invariants, we study their analogs for closed 3-manifolds. We show that fivebrane compactifications provide a universal description of various old and new homological invariants of 3-manifolds. In terms of 3d/3d correspondence, such invariants are given by the Q-cohomology of the Hilbert space of partially topologically twisted 3d N=2 theory T[ M 3] on a Riemann surface with defects. We demonstrate this by concrete and explicit calculations in the case of monopole/Heegaard Floer homology and a 3-manifold analog of Khovanov-Rozansky link homology. The latter gives a categorification of Chern-Simons partition function. Some of the new key elements include the explicit form of the S-transform and a novel connection between categorification and a previously mysterious role of Eichler integrals in Chern-Simons theory.

  19. Strikes in the public sector in Denmark

    DEFF Research Database (Denmark)

    Scheuer, Steen; Ibsen, Flemming; Høgedahl, Laust

    2016-01-01

    This article looks at strikes by employees in the public sector, discusses the theoretical background to these conflicts and shows – based on a case study of three strikes in the Danish public sector – how different union strategies lead to very different outcomes in terms of economic gains......, while public sector unions trying to move up the wage hierarchy cannot expect much help from fellow public sector unions, often quite the reverse....

  20. Object-oriented Persistent Homology.

    Science.gov (United States)

    Wang, Bao; Wei, Guo-Wei

    2016-01-15

    Persistent homology provides a new approach for the topological simplification of big data via measuring the life time of intrinsic topological features in a filtration process and has found its success in scientific and engineering applications. However, such a success is essentially limited to qualitative data classification and analysis. Indeed, persistent homology has rarely been employed for quantitative modeling and prediction. Additionally, the present persistent homology is a passive tool, rather than a proactive technique, for classification and analysis. In this work, we outline a general protocol to construct object-oriented persistent homology methods. By means of differential geometry theory of surfaces, we construct an objective functional, namely, a surface free energy defined on the data of interest. The minimization of the objective functional leads to a Laplace-Beltrami operator which generates a multiscale representation of the initial data and offers an objective oriented filtration process. The resulting differential geometry based object-oriented persistent homology is able to preserve desirable geometric features in the evolutionary filtration and enhances the corresponding topological persistence. The cubical complex based homology algorithm is employed in the present work to be compatible with the Cartesian representation of the Laplace-Beltrami flow. The proposed Laplace-Beltrami flow based persistent homology method is extensively validated. The consistence between Laplace-Beltrami flow based filtration and Euclidean distance based filtration is confirmed on the Vietoris-Rips complex for a large amount of numerical tests. The convergence and reliability of the present Laplace-Beltrami flow based cubical complex filtration approach are analyzed over various spatial and temporal mesh sizes. The Laplace-Beltrami flow based persistent homology approach is utilized to study the intrinsic topology of proteins and fullerene molecules. Based on a

  1. Comparative homology modeling of human rhodopsin with several ...

    African Journals Online (AJOL)

    The molecular structure of rhodopsin has been studied by cryo-electron microscopic, Nuclear Magnetic Resonance (NMR) and X-ray crystallographic techniques in bovine. A humble effort has been ... Key words: Homology modeling, human rhodopsin, bovine templates, sequence alignment, model building, energy profiles.

  2. Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

    Science.gov (United States)

    Ningxia Du; Paula M. Pijut

    2010-01-01

    An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

  3. Women, transition and strikes in Serbia

    Directory of Open Access Journals (Sweden)

    Novaković Nada G.

    2014-01-01

    Full Text Available The author, in a sociological way, describes and analyzes the concepts of transition, privatization and strikes in Serbia, particularly the place of women in it. It examines the most important economic and social causes and consequences of these phenomena. The main hypothesis is: women's strikes in the Serbian transition are less efficient than strikes and public protests of women in the developed world and the second Yugoslavia. A strike is a class conflict, in which the workers are fighting for their social and economic rights, threatened by the capitalist class. Elites in government and state authorities protect the interests of big capital at the detriment of the interests of the majority of workers. Exploring women's strikes in transition reveals the nature of the social and political system. Their strikes in enterprises, the blocking of public spaces and public protests are systemic, ie. class determined. As the transition was very fast, the resistance of the strikers was inefficient, and the protests of women became an expression of desperation against the loss of jobs and basic resources for lifehood. In short, this research is about the main causes, the organizational forms and the consequences of strikes in which the majority were women. For this purpose, the author chose to describe an array of strikes in the industries and the companies where women are most employed. The choice of strikes in the economic sector is not accidental, but a consequence of the fact that the women there were the most vulnerable. Women in public institutions and companies had much higher financial and social position. They are less likely to strike and publicly protested. After 2000, these strikes were more successful than worker's strikes in textile, food processing, manufacturing and trade. Relationship between the government and the public towards them was tainted by self-interest and selective. The main criterion for the selection of companies and

  4. Active and recent strike-slip tectonics

    Science.gov (United States)

    Nur, Amos; Boccaletti, Mario

    An international workshop cosponsored by the Department of Geology, University of Florence, Italy and the Department of Geophysics, Stanford University, Stanford, Calif., was held in Florence, Italy, April 18-20, 1989,on the topic of active and recent strike-slip tectonics in the continental crust. Workshop participants from Turkey, Ethiopia, Israel, Greece, and various universities in Italy, Spain, West Germany, France, the United Kingdom, Brazil, and the United States reported on a broad range of studies involving strike-slip faulting in continental crustal setting. As it turned out, much of the work reported on involved aspects of strike-slip faulting that are only poorly understood, especially crustal deformation, which is distributed over a multiplicity of faults, or even fault domains.One of the rewarding aspects of this workshop was the diversity of geographic areas and geological settings covered by the reporters. The north and east Anatolian faults, the Dead Sea transform zone, western Turkey, north and central Greece, Malta, Sicily, southern Italy, the bethic Cordillera in southern Spain, Tunisia, Tibet and southwest China, offshore Brazil, Alaska, Nevada, and California. A recurring observation reported for all those areas was mixed mode faulting, i.e., the coterminous or sequential occurrence of strike-slip and normal faulting, or strike-slip and thrust, and in many instances also strikeslip, normal and thrust faulting in a single tectonic setting.

  5. Cloning and Sequencing of yajC and secD Homologs of Brucella abortus and Demonstration of Immune Responses to YajC in Mice Vaccinated with B. abortus RB51

    Science.gov (United States)

    Vemulapalli, Ramesh; Duncan, A. Jane; Boyle, Stephen M.; Sriranganathan, Nammalwar; Toth, Thomas E.; Schurig, Gerhardt G.

    1998-01-01

    To identify Brucella antigens that are potentially involved in stimulating a protective cell-mediated immune response, a gene library of Brucella abortus 2308 was screened for the expression of antigens reacting with immunoglobulin G2a antibodies from BALB/c mice vaccinated with B. abortus RB51. One selected positive clone (clone MCB68) contained an insert of 2.6 kb; nucleotide sequence analysis of this insert revealed two open reading frames (ORFs). The deduced amino acid sequences of the first and second ORFs had significant similarities with the YajC and SecD proteins, respectively, of several bacterial species. Both the YajC and SecD proteins were expressed in Escherichia coli as fusion proteins with maltose binding protein (MBP). In Western blots, sera from mice vaccinated with B. abortus RB51 recognized YajC but not SecD. Further Western blot analysis with purified recombinant YajC protein indicated that mice inoculated with B. abortus 19 or 2308 or B. melitensis RM1 also produced antibodies to YajC. In response to in vitro stimulation with recombinant MBP-YajC fusion protein, splenocytes from mice vaccinated with B. abortus RB51 were able to proliferate and produce gamma interferon but not interleukin-4. This study demonstrates, for the first time, the involvement of YajC protein in an immune response to an infectious agent. PMID:9826342

  6. High speed homology search with FPGAs.

    Science.gov (United States)

    Yamaguchi, Yoshiki; Maruyama, Tsutomu; Konagaya, Akihiko

    2002-01-01

    We will introduce a way how we can achieve high speed homology search by only adding one off-the-shelf PCI board with one Field Programmable Gate Array (FPGA) to a Pentium based computer system in use. FPGA is a reconfigurable device, and any kind of circuits, such as pattern matching program, can be realized in a moment. The performance is almost proportional to the size of FPGA which is used in the system, and FPGAs are becoming larger and larger following Moore's law. We can easily obtain latest/larger FPGAs in the form off-the-shelf PCI boards with FPGAs, at low costs. The result which we obtained is as follows. The performance is most comparable with small to middle class dedicated hardware systems when we use a board with one of the latest FPGAs and the performance can be furthermore accelerated by using more number of FPGA boards. The time for comparing a query sequence of 2,048 elements with a database sequence of 64 million elements by the Smith-Waterman algorithm is about 34 sec, which is about 330 times faster than a desktop computer with a 1 GHz Pentium III. We can also accelerate the performance of a laptop computer using a PC card with one smaller FPGA. The time for comparing a query sequence (1,024) with the database sequence (64 million) is about 185 sec, which is about 30 times faster than the desktop computer.

  7. ELMs, strike point jumps and SOL currents

    International Nuclear Information System (INIS)

    Solano, Emilia R.; Jachmich, S.; Villone, F.; Hawkes, N.; Guenther, K.; Korotkov, A.; Stamp, M.; Andrew, P.; Conboy, J.; Mattews, G.F.; Corre, Y.; Loarte, A.; Pitts, R.A.; Cenedese, A.; Kempenaars, M.; Bolzonella, T.; Rachlew, E.

    2005-01-01

    Plasma equilibria before and after ELMs in JET are investigated. ELMs could be associated with fragile equilibria and separatrix instabilities: previously closed field lines would open up, releasing plasma current and leading to the formation of a new, smaller separatrix. This model could explain experimental observations of sudden jumps and shifts in strike point positions. Novel instability mechanisms are discussed to explain the large transient jumps observed in the strike point position: positive X-point instability, due to positive toroidal current density at the X-point and diamagnetic instability, due to negative inboard toroidal current density. (author)

  8. Persistent homology of complex networks

    International Nuclear Information System (INIS)

    Horak, Danijela; Maletić, Slobodan; Rajković, Milan

    2009-01-01

    Long-lived topological features are distinguished from short-lived ones (considered as topological noise) in simplicial complexes constructed from complex networks. A new topological invariant, persistent homology, is determined and presented as a parameterized version of a Betti number. Complex networks with distinct degree distributions exhibit distinct persistent topological features. Persistent topological attributes, shown to be related to the robust quality of networks, also reflect the deficiency in certain connectivity properties of networks. Random networks, networks with exponential connectivity distribution and scale-free networks were considered for homological persistency analysis

  9. Strikes, solidarity and scabs. Union members participation norms and williengness to participate in strikes.

    NARCIS (Netherlands)

    Akkerman, A.; Born, M.; Torenvlied, R.

    2013-01-01

    This article studies how participation norms affect workers' willingness to strike. A factor analysis on the responses of 468 Dutch union members about appropriate behavior during a strike produces two factors. The first factor reflects a "solidarity norm" favoring group solidarity; the second

  10. Examining the efficacy of a genotyping-by-sequencing technique for population genetic analysis of the mushroom Laccaria bicolor and evaluating whether a reference genome is necessary to assess homology

    Science.gov (United States)

    Wilson, Andrew W.; Wickett, Norman J.; Grabowski, Paul; Fant, Jeremie; Borevitz, Justin; Mueller, Gregory M.

    2016-01-01

    Given the diversity and ecological importance of Fungi, there is a lack of population genetic research on these organisms. The reason for this can partially be explained by their cryptic nature and difficulty in identifying genets. Additionally, the difficulty (relative to plants and animals) in developing molecular markers for fungal population genetics contributes to the lack of research in this area. This study examines the ability of restriction-site associated DNA (RAD) sequencing to generate SNPs in Laccaria bicolor. Eighteen samples of morphologically identified L. bicolor from the United States and Europe were selected for this project. The RAD sequencing method produced anywhere from 290 K to over three million reads. Mapping these reads to the genome of L. bicolor resulted in 84 K to 940 K unique reads from individual samples. Results indicate that incorporation of non-L. bicolor taxa into the analysis resulted in a precipitous drop in shared loci among samples., suggests the potential of these methods to identify cryptic species. F-statistics were easily calculated, although an observable “noise” was detected when using the “All Loci” treatment versus filtering loci to those present in at least 50% of the individuals. The data were analyzed using tests of Hardy-Weinburg equilibrium, population genetic statistics (FIS and FST), and population structure analysis using the program STRUCTURE. The results provide encouraging feedback regarding the potential utility of these methods and their data for population genetic analysis. We were unable to draw conclusions of life history of L. bicolor populations from this data set, given the small sample size. The results of this study indicate the potential of these methods to address population genetics and general life history questions in the Agaricales. Further research is necessary to explore the specific application of these methods in the Agaricales or other fungal groups. PMID:25361831

  11. Productive homologous and non-homologous recombination of hepatitis C virus in cell culture

    DEFF Research Database (Denmark)

    Scheel, Troels K H; Galli, Andrea; Li, Yi-Ping

    2013-01-01

    Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported......) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13-36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6...

  12. Simulating the Risk of Bird Strikes

    NARCIS (Netherlands)

    Metz, I.C.; Ellerbroek, J.; Muhlhausen, Thorsten; Kügler, D.; Hoekstra, J.M.

    2017-01-01

    This paper presents a fast-time simulation environment for assessing the risk of bird strikes in aviation. An existing air traffic simulator was enhanced in order to simulate air and bird traffic simultaneously and to recognize collisions between birds and aircraft. Furthermore, a method was

  13. The Front Line: No Strikes, Just Balls.

    Science.gov (United States)

    Unks, Gerald

    1979-01-01

    Recent actions of British teachers suggest an alternative to the teacher strike. Those teachers dramatically demonstrated their grievances by withholding the voluntary extra services they customarily perform. American teachers could accomplish the same end by collectively refusing to perform extraneous administrative services: collecting money,…

  14. When Lightning Strikes a Second Time

    Science.gov (United States)

    Allen, Kent

    2017-01-01

    The chances of lightning striking twice are infinitesimal, at best. What are the odds, in middle age, of being struck with a jarring bolt of figurative lightning, then a few months later being an eyewitness as the same sizzle in the sky jolts a group of students--those decision-makers of tomorrow? The author describes two experiences that proved…

  15. Impact of lightning strikes on hospital functions.

    Science.gov (United States)

    Mortelmans, Luc J M; Van Springel, Gert L J; Van Boxstael, Sam; Herrijgers, Jan; Hoflacks, Stefaan

    2009-01-01

    Two regional hospitals were struck by lightning during a one-month period. The first hospital, which had 236 beds, suffered a direct strike to the building. This resulted in a direct spread of the power peak and temporary failure of the standard power supply. The principle problems, after restoring standard power supply, were with the fire alarm system and peripheral network connections in the digital radiology systems. No direct impact on the hardware could be found. Restarting the servers resolved all problems. The second hospital, which had 436 beds, had a lightning strike on the premises and mainly experienced problems due to induction. All affected installations had a cable connection from outside in one way or another. The power supplies never were endangered. The main problem was the failure of different communication systems (telephone, radio, intercom, fire alarm system). Also, the electronic entrance control went out. During the days after the lightening strike, multiple software problems became apparent, as well as failures of the network connections controlling the technical support systems. There are very few ways to prepare for induction problems. The use of fiber-optic networks can limit damage. To the knowledge of the authors, these are the first cases of lightning striking hospitals in medical literature.

  16. [Management of the hunger strike in prison].

    Science.gov (United States)

    Fayeulle, Stéphanie; Renou, Frédéric; Protais, Emmanuel; Hédouin, Valéry; Wartel, Guillaume; Yvin, Jean-Luc

    2010-10-01

    Entering prison can feed pre-existent behavior of demands or generate them. Several means of expression are then used. Hunger strike is an average privileged act. It belongs to prison culture. Estimate how practitioners working in prison take care of the hunger strikers. The study, realised in 2008, was led with all the Units of Consultations and Ambulatory Care in France. It is a declarative investigation where a medical testimony by unit was asked. From 174 "maisons d'arrêt" and establishments for punishment in France, 95 answers were obtained. This situation was already seen by 98,8% of the doctors. The motives for hunger strike were mainly judicial for "maisons d'arrêt" (70,1%) and prison motives for detention centers (68,7%). Mainly, doctors opted for a neutral attitude (63% of the cases). The hunger strikes were mostly brief (less than a week in 85% of the cases). Only 5,5% of the doctors proposed written information concerning the risks incurred during a fast. A doctor in 4 approximately (23%) was already witness to complications due to fasting. The fact that a patient may refuse care makes the medical approach difficult. Faced with such a situation, 45% of the doctors privileged their duty of care, 28% respected the patient's wishes, and 27% did not pronounce. From a therapeutic point of view, the place of treatment using vitamins was rarely recognized (32,7%). Hunger strike is rarely severe, but it is rather frequent in prison so that every doctor working there will be confronted with it. The refeeding syndrome seems often ignored. The coverage of hunger strike is governed by the law, but ethical questions stay in the appreciation of every doctor. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  17. Gait Retraining From Rearfoot Strike to Forefoot Strike does not change Running Economy.

    Science.gov (United States)

    Roper, Jenevieve Lynn; Doerfler, Deborah; Kravitz, Len; Dufek, Janet S; Mermier, Christine

    2017-12-01

    Gait retraining is a method for management of patellofemoral pain, which is a common ailment among recreational runners. The present study investigated the effects of gait retraining from rearfoot strike to forefoot strike on running economy, heart rate, and respiratory exchange ratio immediately post-retraining and one-month post-retraining in recreational runners with patellofemoral pain. Knee pain was also measured. Sixteen participants (n=16) were randomly placed in the control (n=8) or experimental (n=8) group. A 10-minute treadmill RE test was performed by all subjects. The experimental group performed eight gait retraining running sessions where foot strike pattern was switched from rearfoot strike to forefoot strike, while the control group received no intervention. There were no significant differences for running economy (p=0.26), respiratory exchange ratio (p=0.258), or heart rate (p=0.248) between the groups. Knee pain reported on a visual analog scale was also significantly reduced (p<0.05) as a result of retraining. The present study demonstrates that retraining from rearfoot strike to forefoot strike did not affect running economy up to one-month post-retraining while reducing running-related patellofemoral pain. © Georg Thieme Verlag KG Stuttgart · New York.

  18. Homology groups for particles on one-connected graphs

    Science.gov (United States)

    MaciÄ Żek, Tomasz; Sawicki, Adam

    2017-06-01

    We present a mathematical framework for describing the topology of configuration spaces for particles on one-connected graphs. In particular, we compute the homology groups over integers for different classes of one-connected graphs. Our approach is based on some fundamental combinatorial properties of the configuration spaces, Mayer-Vietoris sequences for different parts of configuration spaces, and some limited use of discrete Morse theory. As one of the results, we derive the closed-form formulae for ranks of the homology groups for indistinguishable particles on tree graphs. We also give a detailed discussion of the second homology group of the configuration space of both distinguishable and indistinguishable particles. Our motivation is the search for new kinds of quantum statistics.

  19. Acetylcholine Receptor: Complex of Homologous Subunits

    Science.gov (United States)

    Raftery, Michael A.; Hunkapiller, Michael W.; Strader, Catherine D.; Hood, Leroy E.

    1980-06-01

    The acetylcholine receptor from the electric ray Torpedo californica is composed of five subunits; two are identical and the other three are structurally related to them. Microsequence analysis of the four polypeptides demonstrates amino acid homology among the subunits. Further sequence analysis of both membrane-bound and Triton-solubilized, chromatographically purified receptor gave the stoichiometry of the four subunits (40,000:50,000:60,000:65,000 daltons) as 2:1:1:1, indicating that this protein is a pentameric complex with a molecular weight of 255,000 daltons. Genealogical analysis suggests that divergence from a common ancestral gene occurred early in the evolution of the receptor. This shared ancestry argues that each of the four subunits plays a functional role in the receptor's physiological action.

  20. ["Bell-striking" Saying of Acupuncture Therapy].

    Science.gov (United States)

    Zhao, Jing-Sheng

    2017-04-25

    As an analogy, a prototype of "bell-striking" is proposed in the present paper for exploring the basic properties, major elements, and potential mechanisms of acupuncture stimulation. On the strength of analysis on the physiological basis of acupuncture effect, several fundamental aspects of acupuncture are summarized as a) the body-surface stimulating characters, b) general and local effects, and c) triggering the auto-regulative function of the organism, which mimics the "bell-striking" response. Namely, when stroke, bell will chime, otherwise, chiming will not be heard. During analyzing special contents of acupuncture theory, its formative background should not be separated, and it is improper to take, modern medical theory of the human body as the guiding thinking way for researching the ancient Chinese medical literature.

  1. Central hyperadrenergic state after lightning strike.

    Science.gov (United States)

    Parsaik, Ajay K; Ahlskog, J Eric; Singer, Wolfgang; Gelfman, Russell; Sheldon, Seth H; Seime, Richard J; Craft, Jennifer M; Staab, Jeffrey P; Kantor, Birgit; Low, Phillip A

    2013-08-01

    To describe and review autonomic complications of lightning strike. Case report and laboratory data including autonomic function tests in a subject who was struck by lightning. A 24-year-old man was struck by lightning. Following that, he developed dysautonomia, with persistent inappropriate sinus tachycardia and autonomic storms, as well as posttraumatic stress disorder (PTSD) and functional neurologic problems. The combination of persistent sinus tachycardia and episodic exacerbations associated with hypertension, diaphoresis, and agitation was highly suggestive of a central hyperadrenergic state with superimposed autonomic storms. Whether the additional PTSD and functional neurologic deficits were due to a direct effect of the lightning strike on the central nervous system or a secondary response is open to speculation.

  2. Homologous radioimmunoassay for human prolactin

    International Nuclear Information System (INIS)

    Reuter, A.M.; Kennes, F.; Gevaert, Y.; Franchimont, P.

    1976-01-01

    Although thee are descriptions of a range of radioimmunoassays for human prolactin in various biological fluids, only one of these is an homologous assay using human prolactin as the reference standard and tracer as well and an anti-human prolactin antiserum (Sinha, Y.N., Selby, F.W.; Lewis, U.; and Vanderlaan, W.P., 1973, J. Clin. Endocr., Vol. 36, 509). A homologous radioimmunoassay using human putuitary prolactin has been developed. The separation method is based on the double antibody solid phase system. Cross reactivity with human growth hormone (GH), placental lactogen (HPL), the pituitary protein hormones and prolactins of various species were studied as were values found in normal subjects in basal conditions and after a TRH injection. (author)

  3. Persistent Homology of Collaboration Networks

    Directory of Open Access Journals (Sweden)

    C. J. Carstens

    2013-01-01

    Full Text Available Over the past few decades, network science has introduced several statistical measures to determine the topological structure of large networks. Initially, the focus was on binary networks, where edges are either present or not. Thus, many of the earlier measures can only be applied to binary networks and not to weighted networks. More recently, it has been shown that weighted networks have a rich structure, and several generalized measures have been introduced. We use persistent homology, a recent technique from computational topology, to analyse four weighted collaboration networks. We include the first and second Betti numbers for the first time for this type of analysis. We show that persistent homology corresponds to tangible features of the networks. Furthermore, we use it to distinguish the collaboration networks from similar random networks.

  4. Improving work conditions through strike: Examination of nurses' attitudes through perceptions of two physician strikes in Israel.

    Science.gov (United States)

    Gafni-Lachter, Liat; Admi, Hanna; Eilon, Yael; Lachter, Jesse

    2017-01-01

    Strikes are means to influence policies related to working conditions, yet raise ethical dilemmas for healthcare workers. Nurse strikes have become more prominent around the world. To assess the change in Israeli nurses' attitudes towards strikes in light of two physician strikes that have preceded a nursing strike. An anonymous survey was administered once in 2000 (N = 106) and again in 2011 (n = 175) following 110 days of a physician strike, to assess nurses' attitudes towards the strike and resulting ethical issues. A statistically significant change (p working conditions related to professional and public health agendas.

  5. Homological algebra in -abelian categories

    Indian Academy of Sciences (India)

    Deren Luo

    2017-08-16

    Aug 16, 2017 ... Homological algebra, as a connected system of notions and results, was first developed ..... monomorphism. Thus di−1. C( fg) is a weak kernel of di. C( fg) for i = 0,..., n −1 (we consider. X. −1, Y−1, Y−1, Xn+1, Yn+1, Yn+1 as 0 objects). Indeed, let. ( ui+1 vi. ) ..... Theorem 3.5 ((n + 2) × (n + 2)-lemma). Let A be a ...

  6. Stress distribution of metatarsals during forefoot strike versus rearfoot strike: A finite element study.

    Science.gov (United States)

    Li, Shudong; Zhang, Yan; Gu, Yaodong; Ren, James

    2017-12-01

    Due to the limitations of experimental approaches, comparison of the internal deformation and stresses of the human man foot between forefoot and rearfoot landing is not fully established. The objective of this work is to develop an effective FE modelling approach to comparatively study the stresses and energy in the foot during forefoot strike (FS) and rearfoot strike (RS). The stress level and rate of stress increase in the Metatarsals are established and the injury risk between these two landing styles is evaluated and discussed. A detailed subject specific FE foot model is developed and validated. A hexahedral dominated meshing scheme was applied on the surface of the foot bones and skin. An explicit solver (Abaqus/Explicit) was used to stimulate the transient landing process. The deformation and internal energy of the foot and stresses in the metatarsals are comparatively investigated. The results for forefoot strike tests showed an overall higher average stress level in the metatarsals during the entire landing cycle than that for rearfoot strike. The increase rate of the metatarsal stress from the 0.5 body weight (BW) to 2 BW load point is 30.76% for forefoot strike and 21.39% for rearfoot strike. The maximum rate of stress increase among the five metatarsals is observed on the 1st metatarsal in both landing modes. The results indicate that high stress level during forefoot landing phase may increase potential of metatarsal injuries. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Acute transient hemiparesis induced by lightning strike.

    Science.gov (United States)

    Rahmani, Seyed Hesam; Faridaalaee, Gholamreza; Jahangard, Samira

    2015-07-01

    According to data from the National Oceanic and Atmospheric Administration,in the years from 1959 to 1994, lightning was responsible for more than 3000 deaths and nearly 10,000 casualties. The most important characteristic features of lightning injuries are multisystem involvement and widely variable severity. Lightning strikes are primarily a neurologic injury that affects all 3 components of the nervous system: central, autonomic,and peripheral. Neurologic complications of lightning strikes vary from transient benign symptoms to permanent disability. Many patients experience a temporary paralysis called keraunoparalysis. Here we reported a 22-year-old mountaineer man with complaining of left sided hemiparesis after being hit by a lightning strike in the mountain 3 hours ago. There was no loss of consciousness at hitting time. On arrival the patient was alert, awake and hemodynamically stable. In neurologic examination cranial nerves were intact, left sided upper and lower extremity muscle force was I/V with a combination of complete sensory loss, and right-sided muscle force and sensory examination were normal. There is not any evidence of significant vascular impairment in the affected extremities. Brain MRI and CT scan and cervical MRI were normal. During 2 days of admission, with intravenous hydration, heparin 5000 unit SC q12hr and physical therapy of the affected limbs, motor and sensory function improved and was normal except mild paresthesia. He was discharged 1 day later for outpatient follow up while vitamin B1 100mg orally was prescribed.Paresthesia improved after 3 days without further sequels.

  8. Catching homologies by geometric entropy

    Science.gov (United States)

    Felice, Domenico; Franzosi, Roberto; Mancini, Stefano; Pettini, Marco

    2018-02-01

    A geometric entropy is defined in terms of the Riemannian volume of the parameter space of a statistical manifold associated with a given network. As such it can be a good candidate for measuring networks complexity. Here we investigate its ability to single out topological features of networks proceeding in a bottom-up manner: first we consider small size networks by analytical methods and then large size networks by numerical techniques. Two different classes of networks, the random graphs and the scale-free networks, are investigated computing their Betti numbers and then showing the capability of geometric entropy of detecting homologies.

  9. Kuranishi homology and Kuranishi cohomology

    OpenAIRE

    Joyce, Dominic

    2007-01-01

    A Kuranishi space is a topological space with a Kuranishi structure, defined by Fukaya and Ono. Kuranishi structures occur naturally on moduli spaces of J-holomorphic curves in symplectic geometry. Let Y be an orbifold and R a commutative ring or Q-algebra. We define two kinds of Kuranishi homology KH_*(Y;R). The chain complex KC_*(Y;R) defining KH_*(Y;R) is spanned over R by [X,f,G], for X a compact oriented Kuranishi space with corners, f : X --> Y smooth, and G "gauge-fixing data" which ma...

  10. Lightning strike-induced brachial plexopathy

    Directory of Open Access Journals (Sweden)

    Amita N Bhargava

    2014-01-01

    Full Text Available We describe a patient who presented with a history of lightning strike injury. Following the injury, he sustained acute right upper limb weakness with pain. Clinically, the lesion was located to the upper and middle trunk of the right brachial plexus, and the same confirmed with electrophysiological studies. Nerve damage due to lightning injuries is considered very rare, and a plexus damage has been described infrequently, if ever. Thus, the proposed hypothesis that lightning rarely causes neuropathy, as against high-voltage electric current, due to its shorter duration of exposure not causing severe burns which lead to nerve damage, needs to be reconsidered.

  11. Analysis of Simulated Aircraft Lightning Strikes and Their Electromagnetic Effects

    National Research Council Canada - National Science Library

    Gruden, James

    2001-01-01

    To survive the intense electromagnetic fields associated with a lightning strike, proper design of aircraft electrical control systems requires knowledge of the transient current pulse associated with a lightning strike...

  12. Strike-slip tectonics during rift linkage

    Science.gov (United States)

    Pagli, C.; Yun, S. H.; Ebinger, C.; Keir, D.; Wang, H.

    2017-12-01

    The kinematics of triple junction linkage and the initiation of transforms in magmatic rifts remain debated. Strain patterns from the Afar triple junction provide tests of current models of how rifts grow to link in area of incipient oceanic spreading. Here we present a combined analysis of seismicity, InSAR and GPS derived strain rate maps to reveal that the plate boundary deformation in Afar is accommodated primarily by extensional tectonics in the Red Sea and Gulf of Aden rifts, and does not require large rotations about vertical axes (bookshelf faulting). Additionally, models of stress changes and seismicity induced by recent dykes in one sector of the Afar triple junction provide poor fit to the observed strike-slip earthquakes. Instead we explain these patterns as rift-perpendicular shearing at the tips of spreading rifts where extensional strains terminate against less stretched lithosphere. Our results demonstrate that rift-perpendicular strike-slip faulting between rift segments achieves plate boundary linkage during incipient seafloor spreading.

  13. BLANNOTATOR: enhanced homology-based function prediction of bacterial proteins

    Directory of Open Access Journals (Sweden)

    Kankainen Matti

    2012-02-01

    Full Text Available Abstract Background Automated function prediction has played a central role in determining the biological functions of bacterial proteins. Typically, protein function annotation relies on homology, and function is inferred from other proteins with similar sequences. This approach has become popular in bacterial genomics because it is one of the few methods that is practical for large datasets and because it does not require additional functional genomics experiments. However, the existing solutions produce erroneous predictions in many cases, especially when query sequences have low levels of identity with the annotated source protein. This problem has created a pressing need for improvements in homology-based annotation. Results We present an automated method for the functional annotation of bacterial protein sequences. Based on sequence similarity searches, BLANNOTATOR accurately annotates query sequences with one-line summary descriptions of protein function. It groups sequences identified by BLAST into subsets according to their annotation and bases its prediction on a set of sequences with consistent functional information. We show the results of BLANNOTATOR's performance in sets of bacterial proteins with known functions. We simulated the annotation process for 3090 SWISS-PROT proteins using a database in its state preceding the functional characterisation of the query protein. For this dataset, our method outperformed the five others that we tested, and the improved performance was maintained even in the absence of highly related sequence hits. We further demonstrate the value of our tool by analysing the putative proteome of Lactobacillus crispatus strain ST1. Conclusions BLANNOTATOR is an accurate method for bacterial protein function prediction. It is practical for genome-scale data and does not require pre-existing sequence clustering; thus, this method suits the needs of bacterial genome and metagenome researchers. The method and a

  14. Bird strike incidence at Addis Ababa Bole International Airport ...

    African Journals Online (AJOL)

    The time and rate of bird strike incidences, species composition and number of birds involved in strikes, and the behaviour of birds were recorded at Bole International Airport from December 1994 to December 1995. The gut contents of the birds struck by aircraft were analyzed. A total of 33 bird strikes were recorded during ...

  15. Evaluating the Effects of a Bird Strike Advisory System

    NARCIS (Netherlands)

    Metz, I.C.; Mühlhausen, T; Ellerbroek, J.; Hoekstra, J.M.

    2016-01-01

    Bird strikes have operational impacts and cause economic loss to the aviation industry. In the worst case, the damages resulting from bird strikes lead to crashes. The highest risk for bird strikes lies in the area below 3000 ft and thus mainly in airport environments. Despite intense efforts from

  16. effects of strike cost on economic development in nigeria

    African Journals Online (AJOL)

    USER

    productivity as in most cases strike cost (wages and salaries as well as other unavoidable payments) are paid during the .... Many times the Nigeria Labour Congress (NLC) and students have had to strike against ... the direct compensation package and other conditions of service. This is the most popular cause of strike in ...

  17. Forward to the Past: Strikes and Striking as Dialogue by other ...

    African Journals Online (AJOL)

    In Nigeria, from the colonial period to the present, the employment of strikes and protests by nationalists, Nigerian workers and civil society groups has been established as one of the potent means of conveying viewpoints, positions as well as the demand for equality, fairness, social justice and reforms. It has been used as ...

  18. Identification of a novel MLPK homologous gene MLPKn1 and its expression analysis in Brassica oleracea.

    Science.gov (United States)

    Gao, Qiguo; Shi, Songmei; Liu, Yudong; Pu, Quanming; Liu, Xiaohuan; Zhang, Ying; Zhu, Liquan

    2016-09-01

    M locus protein kinase, one of the SRK-interacting proteins, is a necessary positive regulator for the self-incompatibility response in Brassica. In B. rapa, MLPK is expressed as two different transcripts, MLPKf1 and MLPKf2, and either isoform can complement the mlpk/mlpk mutation. The AtAPK1B gene has been considered to be the ortholog of BrMLPK, and AtAPK1B has no role in self-incompatibility (SI) response in A. thaliana SRK-SCR plants. Until now, what causes the MLPK and APK1B function difference during SI response in Brassica and A. thaliana SRKb-SCRb plants has remained unknown. Here, in addition to the reported MLPKf1/2, we identified the new MLPKf1 homologous gene MLPKn1 from B. oleracea. BoMLPKn1 and BoMLPKf1 shared nucleotide sequence identity as high as 84.3 %, and the most striking difference consisted in two fragment insertions in BoMLPKn1. BoMLPKn1 and BoMLPKf1 had a similar gene structure; both their deduced amino acid sequences contained a typical plant myristoylation consensus sequence and a Ser/Thr protein kinase domain. BoMLPKn1 was widely expressed in petal, sepal, anther, stigma and leaf. Genome-wide survey revealed that the B. oleracea genome contained three MLPK homologous genes: BoMLPKf1/2, BoMLPKn1 and Bol008343n. The B. rapa genome also contained three MLPK homologous genes, BrMLPKf1/2, BraMLPKn1 and Bra040929. Phylogenetic analysis revealed that BoMLPKf1/2 and BrMLPKf1/2 were phylogenetically more distant from AtAPK1A than Bol008343n, Bra040929, BraMLPKn1 and BoMLPKn1, Synteny analysis revealed that the B. oleracea chromosomal region containing BoMLPKn1 displayed high synteny with the A. thaliana chromosomal region containing APK1B, whereas the B. rapa chromosomal region containing BraMLPKn1 showed high synteny with the A. thaliana chromosomal region containing APK1B. Together, these results revealed that BoMLPKn1/BraMLPKn1, and not the formerly reported BoMLPKf1/2 (BrMLPKf1/2), was the orthologous genes of AtAPK1B, and no ortholog of Bo

  19. Persistent homology and string vacua

    Energy Technology Data Exchange (ETDEWEB)

    Cirafici, Michele [Center for Mathematical Analysis, Geometry and Dynamical Systems,Instituto Superior Técnico, Universidade de Lisboa,Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Institut des Hautes Études Scientifiques,Le Bois-Marie, 35 route de Chartres, F-91440 Bures-sur-Yvette (France)

    2016-03-08

    We use methods from topological data analysis to study the topological features of certain distributions of string vacua. Topological data analysis is a multi-scale approach used to analyze the topological features of a dataset by identifying which homological characteristics persist over a long range of scales. We apply these techniques in several contexts. We analyze N=2 vacua by focusing on certain distributions of Calabi-Yau varieties and Landau-Ginzburg models. We then turn to flux compactifications and discuss how we can use topological data analysis to extract physical information. Finally we apply these techniques to certain phenomenologically realistic heterotic models. We discuss the possibility of characterizing string vacua using the topological properties of their distributions.

  20. Equivariant ordinary homology and cohomology

    CERN Document Server

    Costenoble, Steven R

    2016-01-01

    Filling a gap in the literature, this book takes the reader to the frontiers of equivariant topology, the study of objects with specified symmetries. The discussion is motivated by reference to a list of instructive “toy” examples and calculations in what is a relatively unexplored field. The authors also provide a reading path for the first-time reader less interested in working through sophisticated machinery but still desiring a rigorous understanding of the main concepts. The subject’s classical counterparts, ordinary homology and cohomology, dating back to the work of Henri Poincaré in topology, are calculational and theoretical tools which are important in many parts of mathematics and theoretical physics, particularly in the study of manifolds. Similarly powerful tools have been lacking, however, in the context of equivariant topology. Aimed at advanced graduate students and researchers in algebraic topology and related fields, the book assumes knowledge of basic algebraic topology and group act...

  1. Strike Point Control for the National Spherical Torus Experiment (NSTX)

    International Nuclear Information System (INIS)

    Kolemen, E.; Gates, D.A.; Rowley, C.W.; Kasdin, N.J.; Kallman, J.; Gerhardt, S.; Soukhanovskii, V.; Mueller, D.

    2010-01-01

    This paper presents the first control algorithm for the inner and outer strike point position for a Spherical Torus (ST) fusion experiment and the performance analysis of the controller. A liquid lithium divertor (LLD) will be installed on NSTX which is believed to provide better pumping than lithium coatings on carbon PFCs. The shape of the plasma dictates the pumping rate of the lithium by channeling the plasma to LLD, where strike point location is the most important shape parameter. Simulations show that the density reduction depends on the proximity of strike point to LLD. Experiments were performed to study the dynamics of the strike point, design a new controller to change the location of the strike point to desired location and stabilize it. The most effective PF coils in changing inner and outer strike points were identified using equilibrium code. The PF coil inputs were changed in a step fashion between various set points and the step response of the strike point position was obtained. From the analysis of the step responses, PID controllers for the strike points were obtained and the controller was tuned experimentally for better performance. The strike controller was extended to include the outer-strike point on the inner plate to accommodate the desired low outer-strike points for the experiment with the aim of achieving 'snowflake' divertor configuration in NSTX.

  2. Homology in Electromagnetic Boundary Value Problems

    Directory of Open Access Journals (Sweden)

    Matti Pellikka

    2010-01-01

    Full Text Available We discuss how homology computation can be exploited in computational electromagnetism. We represent various cellular mesh reduction techniques, which enable the computation of generators of homology spaces in an acceptable time. Furthermore, we show how the generators can be used for setting up and analysis of an electromagnetic boundary value problem. The aim is to provide a rationale for homology computation in electromagnetic modeling software.

  3. Allergen homologs in the Euroglyphus maynei draft genome.

    Directory of Open Access Journals (Sweden)

    S Dean Rider

    Full Text Available Euroglyphus maynei is a house dust mite commonly found in homes worldwide and is the source of allergens that sensitize and induce allergic reactions in humans. It is the source of species-specific allergens as well as allergens that are cross-reactive with the allergens from house dust mites Dermatophagoides farinae and D. pteronyssinus, and the ectoparasitic scabies mite Sarcoptes scabiei. The genomics, proteomics and molecular biology of E. maynei and its allergens have not been as extensively investigated as those of D. farinae, D. pteronyssinus, and S. scabiei where natural and recombinant allergens from these species have been characterized. Until now, little was known about the genome of E. maynei and it allergens but this information will be important for producing recombinant allergens for diagnostic and therapeutic purposes and for understanding the allergic response mechanism by immune effector cells that mediate the allergic reaction. We sequenced and assembled the 59 Mb E. maynei genome to aid the identification of homologs for known allergenic proteins. The predicted proteome shared orthologs with D. farinae and S. scabiei, and included proteins with homology to more than 30 different groups of allergens. However, the majority of allergen candidates could not be assigned as clear orthologs to known mite allergens. The genomic sequence data, predicted proteome, and allergen homologs identified from E. maynei provide insight into the relationships among astigmatid mites and their allergens, which should allow for the development of improved diagnostics and immunotherapy.

  4. Isolamento e caracterização parcial de sequências homólogas a genes ribossomais (rDNA em Blastocladiella emersonii - DOI: 10.4025/actascibiolsci.v25i2.2037 Isolation and partial characterization of homologous sequences of ribosomal genes (rDNA in Blastocladiella emersonii

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Correa

    2003-04-01

    Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will

  5. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  6. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  7. Homotopic Chain Maps Have Equal s-Homology and d-Homology

    Directory of Open Access Journals (Sweden)

    M. Z. Kazemi-Baneh

    2016-01-01

    Full Text Available The homotopy of chain maps on preabelian categories is investigated and the equality of standard homologies and d-homologies of homotopic chain maps is established. As a special case, if X and Y are the same homotopy type, then their nth d-homology R-modules are isomorphic, and if X is a contractible space, then its nth d-homology R-modules for n≠0 are trivial.

  8. The morphology of strike-slip faults - Examples from the San Andreas Fault, California

    Science.gov (United States)

    Bilham, Roger; King, Geoffrey

    1989-01-01

    The dilatational strains associated with vertical faults embedded in a horizontal plate are examined in the framework of fault kinematics and simple displacement boundary conditions. Using boundary element methods, a sequence of examples of dilatational strain fields associated with commonly occurring strike-slip fault zone features (bends, offsets, finite rupture lengths, and nonuniform slip distributions) is derived. The combinations of these strain fields are then used to examine the Parkfield region of the San Andreas fault system in central California.

  9. Geological Effects on Lightning Strike Distributions

    KAUST Repository

    Berdahl, J. Scott

    2016-05-16

    Recent advances in lightning detection networks allow for detailed mapping of lightning flash locations. Longstanding rumors of geological influence on cloud-to-ground (CG) lightning distribution and recent commercial claims based on such influence can now be tested empirically. If present, such influence could represent a new, cheap and efficient geophysical tool with applications in mineral, hydrothermal and oil exploration, regional geological mapping, and infrastructure planning. This project applies statistical analysis to lightning data collected by the United States National Lightning Detection Network from 2006 through 2015 in order to assess whether the huge range in electrical conductivities of geological materials plays a role in the spatial distribution of CG lightning. CG flash densities are mapped for twelve areas in the contiguous United States and compared to elevation and geology, as well as to the locations of faults, railroads and tall towers including wind turbines. Overall spatial randomness is assessed, along with spatial correlation of attributes. Negative and positive polarity lightning are considered separately and together. Topography and tower locations show a strong influence on CG distribution patterns. Geology, faults and railroads do not. This suggests that ground conductivity is not an important factor in determining lightning strike location on scales larger than current flash location accuracies, which are generally several hundred meters. Once a lightning channel is established, however, ground properties at the contact point may play a role in determining properties of the subsequent stroke.

  10. Collective bargaining and strikes among physicians.

    Science.gov (United States)

    Keith, S N

    1984-11-01

    UNLIKE EMPLOYEES IN OTHER SECTORS OF THE ECONOMY, HEALTH CARE WORKERS ARE DIRECTED TOWARD ONE ULTIMATE GOAL: making people well and keeping them healthy. The development of collective bargaining and union activities during this century has had a great impact on all industries in the United States and the western world. However, only in recent years have workers in the health care sector been affected by the organized labor movement. The history of collective bargaining and strikes among physicians, the key decision-makers in the health care sector, is even more recent. Because of their central position, physicians' collective activity has had and will continue to have tremendous implications for the viability of the present health care system and the quality of patient care. Even though most physicians continue to function as individual, entrepreneurial service providers and "professionals," physicians as a group are more frequently being seen as members of a utility like industry. Their importance to individuals and society as a whole, it can be argued, is second to none; if physicians refuse to work there can be no worse set of outcomes. To estimate the potential future impact of growing collective action on the part of physicians, this article explores the general historical developments.

  11. Lectures on homology with internal symmetries

    International Nuclear Information System (INIS)

    Solovyov, Yu.

    1993-09-01

    Homology with internal symmetries is a natural generalization of cyclic homology introduced, independently, by Connes and Tsygan, which has turned out to be a very useful tool in a number of problems of algebra, geometry topology, analysis and mathematical physics. It suffices to say cycling homology and cohomology are successfully applied in the index theory of elliptic operators on foliations, in the description of the homotopy type of pseudoisotopy spaces, in the theory of characteristic classes in algebraic K-theory. They are also applied in noncommutative differential geometry and in the cohomology of Lie algebras, the branches of mathematics which brought them to life in the first place. Essentially, we consider dihedral homology, which was successfully applied for the description of the homology type of groups of homeomorphisms and diffeomorphisms of simply connected manifolds. (author). 27 refs

  12. RNA interference against viruses: strike and counterstrike

    NARCIS (Netherlands)

    Haasnoot, Joost; Westerhout, Ellen M.; Berkhout, Ben

    2007-01-01

    RNA interference (RNAi) is a conserved sequence-specific, gene-silencing mechanism that is induced by double-stranded RNA. RNAi holds great promise as a novel nucleic acid-based therapeutic against a wide variety of diseases, including cancer, infectious diseases and genetic disorders. Antiviral

  13. Children on hunger strike: child abuse or legitimate protest?

    Science.gov (United States)

    Mok, A.; Nelson, E. A.; Murphy, J.; Hampson, A.; Hendriks, J. H.

    1996-01-01

    The issue of children on hunger strike (voluntary total fasting) has not been reported before. The World Medical Association Declaration of Tokyo 1975 and the Declaration of Malta 1991 (revised 1992) provide clinicians with guidelines for the management of adult patients on hunger strike but do not mention children. We report the management of 14 Vietnamese children, aged 1 to 12 years, who took part in a hunger strike at a refugee detention centre in Hong Kong. PMID:8597690

  14. Children on hunger strike: child abuse or legitimate protest?

    OpenAIRE

    Mok, A.; Nelson, E. A.; Murphy, J.; Hampson, A.; Hendriks, J. H.

    1996-01-01

    The issue of children on hunger strike (voluntary total fasting) has not been reported before. The World Medical Association Declaration of Tokyo 1975 and the Declaration of Malta 1991 (revised 1992) provide clinicians with guidelines for the management of adult patients on hunger strike but do not mention children. We report the management of 14 Vietnamese children, aged 1 to 12 years, who took part in a hunger strike at a refugee detention centre in Hong Kong.

  15. The effect of hand dominance on martial arts strikes.

    Science.gov (United States)

    Neto, Osmar Pinto; Silva, Jansen Henrique; Marzullo, Ana Carolina de Miranda; Bolander, Richard P; Bir, Cynthia A

    2012-08-01

    The main goal of this study was to compare dominant and non-dominant martial arts palm strikes under different circumstances that usually happen during martial arts and combative sports applications. Seven highly experienced (10±5 years) right hand dominant Kung Fu practitioners performed strikes with both hands, stances with left or right lead legs, and with the possibility or not of stepping towards the target (moving stance). Peak force was greater for the dominant hand strikes (1593.76±703.45 N vs. 1042.28±374.16 N; p<.001), whereas no difference was found in accuracy between the hands (p=.141). Additionally, peak force was greater for the strikes with moving stance (1448.75±686.01 N vs. 1201.80±547.98 N; p=.002) and left lead leg stance (1378.06±705.48 N vs. 1269.96±547.08 N). Furthermore, the difference in peak force between strikes with moving and stationary stances was statistically significant only for the strikes performed with a left lead leg stance (p=.007). Hand speed was higher for the dominant hand strikes (5.82±1.08 m/s vs. 5.24±0.78 m/s; p=.001) and for the strikes with moving stance (5.79±1.01 m/s vs. 5.29±0.90 m/s; p<.001). The difference in hand speed between right and left hand strikes was only significant for strikes with moving stance. In summary, our results suggest that the stronger palm strike for a right-handed practitioner is a right hand strike on a left lead leg stance moving towards the target. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Change of gene structure and function by non-homologous end-joining, homologous recombination, and transposition of DNA.

    Directory of Open Access Journals (Sweden)

    Wolfgang Goettel

    2009-06-01

    Full Text Available An important objective in genome research is to relate genome structure to gene function. Sequence comparisons among orthologous and paralogous genes and their allelic variants can reveal sequences of functional significance. Here, we describe a 379-kb region on chromosome 1 of maize that enables us to reconstruct chromosome breakage, transposition, non-homologous end-joining, and homologous recombination events. Such a high-density composition of various mechanisms in a small chromosomal interval exemplifies the evolution of gene regulation and allelic diversity in general. It also illustrates the evolutionary pace of changes in plants, where many of the above mechanisms are of somatic origin. In contrast to animals, somatic alterations can easily be transmitted through meiosis because the germline in plants is contiguous to somatic tissue, permitting the recovery of such chromosomal rearrangements. The analyzed region contains the P1-wr allele, a variant of the genetically well-defined p1 gene, which encodes a Myb-like transcriptional activator in maize. The P1-wr allele consists of eleven nearly perfect P1-wr 12-kb repeats that are arranged in a tandem head-to-tail array. Although a technical challenge to sequence such a structure by shotgun sequencing, we overcame this problem by subcloning each repeat and ordering them based on nucleotide variations. These polymorphisms were also critical for recombination and expression analysis in presence and absence of the trans-acting epigenetic factor Ufo1. Interestingly, chimeras of the p1 and p2 genes, p2/p1 and p1/p2, are framing the P1-wr cluster. Reconstruction of sequence amplification steps at the p locus showed the evolution from a single Myb-homolog to the multi-gene P1-wr cluster. It also demonstrates how non-homologous end-joining can create novel gene fusions. Comparisons to orthologous regions in sorghum and rice also indicate a greater instability of the maize genome, probably due to

  17. Debunking the viper's strike: harmless snakes kill a common assumption.

    Science.gov (United States)

    Penning, David A; Sawvel, Baxter; Moon, Brad R

    2016-03-01

    To survive, organisms must avoid predation and acquire nutrients and energy. Sensory systems must correctly differentiate between potential predators and prey, and elicit behaviours that adjust distances accordingly. For snakes, strikes can serve both purposes. Vipers are thought to have the fastest strikes among snakes. However, strike performance has been measured in very few species, especially non-vipers. We measured defensive strike performance in harmless Texas ratsnakes and two species of vipers, western cottonmouths and western diamond-backed rattlesnakes, using high-speed video recordings. We show that ratsnake strike performance matches or exceeds that of vipers. In contrast with the literature over the past century, vipers do not represent the pinnacle of strike performance in snakes. Both harmless and venomous snakes can strike with very high accelerations that have two key consequences: the accelerations exceed values that can cause loss of consciousness in other animals, such as the accelerations experienced by jet pilots during extreme manoeuvres, and they make the strikes faster than the sensory and motor responses of mammalian prey and predators. Both harmless and venomous snakes can strike faster than the blink of an eye and often reach a target before it can move. © 2016 The Author(s).

  18. Which way up? Recognition of homologous DNA segments in parallel and antiparallel alignments

    Science.gov (United States)

    O'Lee, Dominic J.; Wynveen, Aaron; Albrecht, Tim; Kornyshev, Alexei A.

    2015-01-01

    Homologous gene shuffling between DNA molecules promotes genetic diversity and is an important pathway for DNA repair. For this to occur, homologous genes need to find and recognize each other. However, despite its central role in homologous recombination, the mechanism of homology recognition has remained an unsolved puzzle of molecular biology. While specific proteins are known to play a role at later stages of recombination, an initial coarse grained recognition step has, however, been proposed. This relies on the sequence dependence of the DNA structural parameters, such as twist and rise, mediated by intermolecular interactions, in particular, electrostatic ones. In this proposed mechanism, sequences that have the same base pair text, or are homologous, have lower interaction energy than those sequences with uncorrelated base pair texts. The difference between the two energies is termed the "recognition energy." Here, we probe how the recognition energy changes when one DNA fragment slides past another, and consider, for the first time, homologous sequences in antiparallel alignment. This dependence on sliding is termed the "recognition well." We find there is a recognition well for anti-parallel, homologous DNA tracts, but only a very shallow one, so that their interaction will differ little from the interaction between two nonhomologous tracts. This fact may be utilized in single molecule experiments specially targeted to test the theory. As well as this, we test previous theoretical approximations in calculating the recognition well for parallel molecules against MC simulations and consider more rigorously the optimization of the orientations of the fragments about their long axes upon calculating these recognition energies. The more rigorous treatment affects the recognition energy a little, when the molecules are considered rigid. When torsional flexibility of the DNA molecules is introduced, we find excellent agreement between the analytical

  19. MEDELLER: homology-based coordinate generation for membrane proteins.

    Science.gov (United States)

    Kelm, Sebastian; Shi, Jiye; Deane, Charlotte M

    2010-11-15

    Membrane proteins (MPs) are important drug targets but knowledge of their exact structure is limited to relatively few examples. Existing homology-based structure prediction methods are designed for globular, water-soluble proteins. However, we are now beginning to have enough MP structures to justify the development of a homology-based approach specifically for them. We present a MP-specific homology-based coordinate generation method, MEDELLER, which is optimized to build highly reliable core models. The method outperforms the popular structure prediction programme Modeller on MPs. The comparison of the two methods was performed on 616 target-template pairs of MPs, which were classified into four test sets by their sequence identity. Across all targets, MEDELLER gave an average backbone root mean square deviation (RMSD) of 2.62 Å versus 3.16 Å for Modeller. On our 'easy' test set, MEDELLER achieves an average accuracy of 0.93 Å backbone RMSD versus 1.56 Å for Modeller. http://medeller.info; Implemented in Python, Bash and Perl CGI for use on Linux systems; Supplementary data are available at http://www.stats.ox.ac.uk/proteins/resources.

  20. Caenorhabditis elegans contains structural homologs of human prk and plk.

    Science.gov (United States)

    Ouyang, B; Wang, Y; Wei, D

    1999-01-01

    We and others have recently reported cloning and characterization of human prk and plk, members of the polo family of protein serine/threonine kinases that includes the budding yeast cdc5 and Drosophila melanoganster polo. The cdc5 gene is essential for cell cycle progression through mitosis and controls adaptation to the yeast DNA damage checkpoint. Here we report the identification of two new cdc5 homologs from Ceanorhabditis elegans, named plc1 and plc2. The deduced amino acid sequences of Plc1 and Plc2 share strong homology with both human Prk and Plk. plc1 and plc2 genes are closely linked on chromosome III and share 40% residue identity, suggesting that gene duplication followed by independent evolution gives rise to multiple polo homologous genes within a species. Similar to polo family members in other species, two distinct domains are present in Plc1 and Plc2 with the N-terminal half being the putative kinase domain. Interestingly, Plc2, unlike Plc1, contains a less conserved polo box within the C-terminal half of the protein, suggesting a functional division between these two kinases.

  1. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

    Directory of Open Access Journals (Sweden)

    Marc Lenoir

    2015-10-01

    Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  2. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.

    Science.gov (United States)

    Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

    2015-10-23

    The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.

  3. Better understanding of homologous recombination through a 12-week laboratory course for undergraduates majoring in biotechnology.

    Science.gov (United States)

    Li, Ming; Shen, Xiaodong; Zhao, Yan; Hu, Xiaomei; Hu, Fuquan; Rao, Xiancai

    2017-07-08

    Homologous recombination, a central concept in biology, is defined as the exchange of DNA strands between two similar or identical nucleotide sequences. Unfortunately, undergraduate students majoring in biotechnology often experience difficulties in understanding the molecular basis of homologous recombination. In this study, we developed and implemented a 12-week laboratory course for biotechnology undergraduates in which gene targeting in Streptococcus suis was used to facilitate their understanding of the basic concept and process of homologous recombination. Students worked in teams of two to select a gene of interest to create a knockout mutant using methods that relied on homologous recombination. By integrating abstract knowledge and practice in the process of scientific research, students gained hands-on experience in molecular biology techniques while learning about the principle and process of homologous recombination. The learning outcomes and survey-based assessment demonstrated that students substantially enhanced their understanding of how homologous recombination could be used to study gene function. Overall, the course was very effective for helping biotechnology undergraduates learn the theory and application of homologous recombination, while also yielding positive effects in developing confidence and scientific skills for future work in research. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):329-335, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  4. A decade of U.S. Air Force bat strikes

    Science.gov (United States)

    Peurach, Suzanne C.; Dove, Carla J.; Stepko, Laura

    2009-01-01

    From 1997 through 2007, 821 bat strikes were reported to the U.S. Air Force (USAF) Safety Center by aircraft personnel or ground crew and sent to the National Museum of Natural History, Smithsonian Institution, for identification. Many samples were identified by macroscopic and or microscopic comparisons with bat specimens housed in the museum and augmented during the last 2 years by DNA analysis. Bat remains from USAF strikes during this period were received at the museum from 40 states in the United States and from 20 countries. We confirmed that 46% of the strikes were caused by bats, but we did not identify them further; we identified 5% only to the family or genus level, and 49% to the species level. Fifty-five of the 101 bat-strike samples submitted for DNA analysis have been identified to the species level. Twenty-five bat species have been recorded striking USAF planes worldwide. The Brazilian free-tailed bat (Tadarida brasiliensis; n = 173) is the species most commonly identified in USAF strike impacts, followed by the red bat (Lasiurus borealis; n = 83). Bat strikes peak during the spring and fall, with >57% occurring from August through October; 82% of the reports that included time of strike were recorded between 2100 and 0900 hours. More than 12% of the bat strikes were reported at >300 m above ground level (AGL). Although $825,000 and >50% of this sum was attributable to 5 bat-strike incidents. Only 5 bats from the 10 most damaging bat strikes were identified to the species level, either because we did not receive remains with the reports or the sample was insufficient for identification.

  5. Along-strike Variations in Active Strain Accumulation in the Northwest Himalaya

    Science.gov (United States)

    Morell, K. D.; Ahmad, T.; Sandiford, M.; Codilean, A. T.; Fulop, R. H.

    2015-12-01

    The spatial distribution of channel steepness, erosion rate, and physiographic data highlight pronounced along-strike changes in active strain accumulation in the northwest Himalaya. In particular, the data suggest that the mid-crustal ramp of the Main Himalayan Thrust could merge along-strike with an active portion of the Main Boundary Thrust near longitude ~77º E. This along-strike change in active fault geometry also coincides with the lateral termination of both lesser and greater Himalayan sequences, a significant reduction in total shortening within the wedge, and pronounced variations in regional seismicity. Recent activity along extensional structures in the high Himalaya of this same region appears to have led to significant reorganization, modification and capture of the Sutlej River basin, one of the largest Himalayan river systems. Given the recent 2015 Gorkha earthquake along a comparable section ~500-km along strike, these new constraints on active fault architecture could have regional implications for how strain is partitioned along seismogenic faults in the northwest Himalaya.

  6. Rifkin strikes against gene transfer experiments.

    Science.gov (United States)

    Beardsley, T

    Jeremy Rifkin's lobbying organization, the Foundation on Economic Trends, has brought suit in U.S. District Court, together with the Humane Society of the U.S., to halt gene transfer experiments being carried out in livestock by the Department of Agriculture. The plaintiffs allege that the experiments--which entail injecting fusion genes that include the DNA structural sequence of the human growth hormone into the fertilized eggs of sheep and pigs--are morally objectionable, a potential threat to the biological stability of animal species, and likely to have undesirable economic and environmental consequences.

  7. Reporting the Great Railroad Strike: How Ideology Shaped the News.

    Science.gov (United States)

    Coward, John

    The Great Railroad Strike of 1877, a national catastrophe and the major news story of the year, was the first national labor strike in U.S. history. Because of the ideological bias of the press, specifically its implicit commitment to capitalism and to objectivity (itself a "myth" of social order), newspapers of the period could be…

  8. The public's attitude towards strike action by healthcare workers and ...

    African Journals Online (AJOL)

    The strength of the associations was determined by Cramer's V. Results. Results revealed strong opinions among the population regarding strikes, numerous misapprehensions when it comes to striking and rights, a poor awareness of other healthcare-related rights and the perception of poor treatment at public hospitals.

  9. Teaching Striking Skills in Elementary Physical Education Using Woodball

    Science.gov (United States)

    Chang, Seung Ho; Lee, Jihyun

    2017-01-01

    Object control (OC) skills are a part of fundamental motor skills and basic functional skills, which work as a prerequisite to becoming a skilled performer in many sports. Of various OC skills, striking is one of the most difficult to master due to a variety of interrelated movement components. A form of vertical or underarm striking is a more…

  10. LAW AND ETHICS OF STRIKES IN THE NIGERIAN HEALTH SYSTEM

    African Journals Online (AJOL)

    2014-10-06

    Oct 6, 2014 ... employment. Kidnapping has been affecting virtually every sector of the Nigerian economy. Thus it is not the right of any health worker to embark on strike. Rather the right to strike can be derived from the principle of collective bargaining, which according to Ahmed (2014) is an essential principle. Workers ...

  11. Ban on right to strike by police challenged

    NARCIS (Netherlands)

    Grünell, M.

    2008-01-01

    After months of negotiation between the police force and the minister of the interior on the renewal of the collective agreement, the police trade unions began threatening industrial action and strikes in December 2007. The courts were divided on the issue, with some ruling out strikes as a means of

  12. Martial arts striking hand peak acceleration, accuracy and consistency.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina De Miranda; Bolander, Richard P; Bir, Cynthia A

    2013-01-01

    The goal of this paper was to investigate the possible trade-off between peak hand acceleration and accuracy and consistency of hand strikes performed by martial artists of different training experiences. Ten male martial artists with training experience ranging from one to nine years volunteered to participate in the experiment. Each participant performed 12 maximum effort goal-directed strikes. Hand acceleration during the strikes was obtained using a tri-axial accelerometer block. A pressure sensor matrix was used to determine the accuracy and consistency of the strikes. Accuracy was estimated by the radial distance between the centroid of each subject's 12 strikes and the target, whereas consistency was estimated by the square root of the 12 strikes mean squared distance from their centroid. We found that training experience was significantly correlated to hand peak acceleration prior to impact (r(2)=0.456, p =0.032) and accuracy (r(2)=0. 621, p=0.012). These correlations suggest that more experienced participants exhibited higher hand peak accelerations and at the same time were more accurate. Training experience, however, was not correlated to consistency (r(2)=0.085, p=0.413). Overall, our results suggest that martial arts training may lead practitioners to achieve higher striking hand accelerations with better accuracy and no change in striking consistency.

  13. Optimizing the design of oligonucleotides for homology directed gene targeting.

    Science.gov (United States)

    Miné-Hattab, Judith; Fleury, Geneviève; Prevost, Chantal; Dutreix, Marie; Viovy, Jean-Louis

    2011-04-05

    Gene targeting depends on the ability of cells to use homologous recombination to integrate exogenous DNA into their own genome. A robust mechanistic model of homologous recombination is necessary to fully exploit gene targeting for therapeutic benefit. In this work, our recently developed numerical simulation model for homology search is employed to develop rules for the design of oligonucleotides used in gene targeting. A Metropolis Monte-Carlo algorithm is used to predict the pairing dynamics of an oligonucleotide with the target double-stranded DNA. The model calculates the base-alignment between a long, target double-stranded DNA and a probe nucleoprotein filament comprised of homologous recombination proteins (Rad51 or RecA) polymerized on a single strand DNA. In this study, we considered different sizes of oligonucleotides containing 1 or 3 base heterologies with the target; different positions on the probe were tested to investigate the effect of the mismatch position on the pairing dynamics and stability. We show that the optimal design is a compromise between the mean time to reach a perfect alignment between the two molecules and the stability of the complex. A single heterology can be placed anywhere without significantly affecting the stability of the triplex. In the case of three consecutive heterologies, our modeling recommends using long oligonucleotides (at least 35 bases) in which the heterologous sequences are positioned at an intermediate position. Oligonucleotides should not contain more than 10% consecutive heterologies to guarantee a stable pairing with the target dsDNA. Theoretical modeling cannot replace experiments, but we believe that our model can considerably accelerate optimization of oligonucleotides for gene therapy by predicting their pairing dynamics with the target dsDNA.

  14. Optimizing the design of oligonucleotides for homology directed gene targeting.

    Directory of Open Access Journals (Sweden)

    Judith Miné-Hattab

    Full Text Available BACKGROUND: Gene targeting depends on the ability of cells to use homologous recombination to integrate exogenous DNA into their own genome. A robust mechanistic model of homologous recombination is necessary to fully exploit gene targeting for therapeutic benefit. METHODOLOGY/PRINCIPAL FINDINGS: In this work, our recently developed numerical simulation model for homology search is employed to develop rules for the design of oligonucleotides used in gene targeting. A Metropolis Monte-Carlo algorithm is used to predict the pairing dynamics of an oligonucleotide with the target double-stranded DNA. The model calculates the base-alignment between a long, target double-stranded DNA and a probe nucleoprotein filament comprised of homologous recombination proteins (Rad51 or RecA polymerized on a single strand DNA. In this study, we considered different sizes of oligonucleotides containing 1 or 3 base heterologies with the target; different positions on the probe were tested to investigate the effect of the mismatch position on the pairing dynamics and stability. We show that the optimal design is a compromise between the mean time to reach a perfect alignment between the two molecules and the stability of the complex. CONCLUSION AND SIGNIFICANCE: A single heterology can be placed anywhere without significantly affecting the stability of the triplex. In the case of three consecutive heterologies, our modeling recommends using long oligonucleotides (at least 35 bases in which the heterologous sequences are positioned at an intermediate position. Oligonucleotides should not contain more than 10% consecutive heterologies to guarantee a stable pairing with the target dsDNA. Theoretical modeling cannot replace experiments, but we believe that our model can considerably accelerate optimization of oligonucleotides for gene therapy by predicting their pairing dynamics with the target dsDNA.

  15. Risk Considerations of Bird Strikes to Space Launch Vehicles

    Science.gov (United States)

    Hales, Christy; Ring, Robert

    2016-01-01

    Within seconds after liftoff of the Space Shuttle during mission STS-114, a turkey vulture impacted the vehicle's external tank. The contact caused no apparent damage to the Shuttle, but the incident led NASA to consider the potential consequences of bird strikes during a Shuttle launch. The environment at Kennedy Space Center provides unique bird strike challenges due to the Merritt Island National Wildlife Refuge and the Atlantic Flyway bird migration routes. NASA is currently refining risk assessment estimates for the probability of bird strike to space launch vehicles. This paper presents an approach for analyzing the risks of bird strikes to space launch vehicles and presents an example. The migration routes, types of birds present, altitudes of those birds, exposed area of the launch vehicle, and its capability to withstand impacts affect the risk due to bird strike. A summary of significant risk contributors is discussed.

  16. Power electromagnetic strike machine for engineering-geological surveys

    Science.gov (United States)

    Usanov, K. M.; Volgin, A. V.; Chetverikov, E. A.; Kargin, V. A.; Moiseev, A. P.; Ivanova, Z. I.

    2017-10-01

    When implementing the processes of dynamic sensing of soils and pulsed nonexplosive seismic exploration, the most common and effective method is the strike one, which is provided by a variety of structure and parameters of pneumatic, hydraulic, electrical machines of strike action. The creation of compact portable strike machines which do not require transportation and use of mechanized means is important. A promising direction in the development of strike machines is the use of pulsed electromagnetic actuator characterized by relatively low energy consumption, relatively high specific performance and efficiency, and providing direct conversion of electrical energy into mechanical work of strike mass with linear movement trajectory. The results of these studies allowed establishing on the basis of linear electromagnetic motors the electromagnetic pulse machines with portable performance for dynamic sensing of soils and land seismic pulse of small depths.

  17. Parameterizing sequence alignment with an explicit evolutionary model.

    Science.gov (United States)

    Rivas, Elena; Eddy, Sean R

    2015-12-10

    Inference of sequence homology is inherently an evolutionary question, dependent upon evolutionary divergence. However, the insertion and deletion penalties in the most widely used methods for inferring homology by sequence alignment, including BLAST and profile hidden Markov models (profile HMMs), are not based on any explicitly time-dependent evolutionary model. Using one fixed score system (BLOSUM62 with some gap open/extend costs, for example) corresponds to making an unrealistic assumption that all sequence relationships have diverged by the same time. Adoption of explicit time-dependent evolutionary models for scoring insertions and deletions in sequence alignments has been hindered by algorithmic complexity and technical difficulty. We identify and implement several probabilistic evolutionary models compatible with the affine-cost insertion/deletion model used in standard pairwise sequence alignment. Assuming an affine gap cost imposes important restrictions on the realism of the evolutionary models compatible with it, as single insertion events with geometrically distributed lengths do not result in geometrically distributed insert lengths at finite times. Nevertheless, we identify one evolutionary model compatible with symmetric pair HMMs that are the basis for Smith-Waterman pairwise alignment, and two evolutionary models compatible with standard profile-based alignment. We test different aspects of the performance of these "optimized branch length" models, including alignment accuracy and homology coverage (discrimination of residues in a homologous region from nonhomologous flanking residues). We test on benchmarks of both global homologies (full length sequence homologs) and local homologies (homologous subsequences embedded in nonhomologous sequence). Contrary to our expectations, we find that for global homologies a single long branch parameterization suffices both for distant and close homologous relationships. In contrast, we do see an advantage in

  18. Wavelet transform analysis of electromyography kung fu strikes data.

    Science.gov (United States)

    Neto, Osmar Pinto; Marzullo, Ana Carolina de Miranda

    2009-11-01

    In martial arts and contact sports strikes are performed at near maximum speeds. For that reason, electromyography (EMG) analysis of such movements is non-trivial. This paper has three main goals: firstly, to investigate the differences in the EMG activity of muscles during strikes performed with and without impacts; secondly, to assess the advantages of using Sum of Significant Power (SSP) values instead of root mean square (rms) values when analyzing EMG data; and lastly to introduce a new method of calculating median frequency values using wavelet transforms (WMDF). EMG data of the deltoid anterior (DA), triceps brachii (TB) and brachioradialis (BR) muscles were collected from eight Kung Fu practitioners during strikes performed with and without impacts. SSP results indicated significant higher muscle activity (p = 0.023) for the strikes with impact. WMDF results, on the other hand, indicated significant lower values (p = 0. 007) for the strikes with impact. SSP results presented higher sensitivity than rms to quantify important signal differences and, at the same time, presented lower inter-subject coefficient of variations. The result of increase in SSP values and decrease in WMDF may suggest better synchronization of motor units for the strikes with impact performed by the experienced Kung Fu practitioners. Key PointsThe results show higher muscle activity and lower electromyography median frequencies for strikes with impact compared to strikes without.SSP results presented higher sensitivity and lower inter-subject coefficient of variations than rms results.Kung Fu palm strikes with impact may present better motor units' synchronization than strikes without.

  19. Conservation of coevolving protein interfaces bridges prokaryote–eukaryote homologies in the twilight zone

    Science.gov (United States)

    Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

    2016-01-01

    Protein–protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein–protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein–protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein–protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach. PMID:27965389

  20. Flexible mapping of homology onto structure with Homolmapper

    Directory of Open Access Journals (Sweden)

    Lagarias J Clark

    2007-04-01

    Full Text Available Abstract Background Over the past decade, a number of tools have emerged for the examination of homology relationships among protein sequences in a structural context. Most recent software implementations for such analysis are tied to specific molecular viewing programs, which can be problematic for collaborations involving multiple viewing environments. Incorporation into larger packages also adds complications for users interested in adding their own scoring schemes or in analyzing proteins incorporating unusual amino acid residues such as selenocysteine. Results We describe homolmapper, a command-line application for mapping information from a multiple protein sequence alignment onto a protein structure for analysis in the viewing software of the user's choice. Homolmapper is small (under 250 K for the application itself and is written in Python to ensure portability. It is released for non-commercial use under a modified University of California BSD license. Homolmapper permits facile import of additional scoring schemes and can incorporate arbitrary additional amino acids to allow handling of residues such as selenocysteine or pyrrolysine. Homolmapper also provides tools for defining and analyzing subfamilies relative to a larger alignment, for mutual information analysis, and for rapidly visualizing the locations of mutations and multi-residue motifs. Conclusion Homolmapper is a useful tool for analysis of homology relationships among proteins in a structural context. There is also extensive, example-driven documentation available. More information about homolmapper is available at http://www.mcb.ucdavis.edu/faculty-labs/lagarias/homolmapper_home/homolmapper%20web%20page.htm.

  1. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

    2016-03-02

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  2. A Massively Parallel Sequence Similarity Search for Metagenomic Sequencing Data

    Directory of Open Access Journals (Sweden)

    Masanori Kakuta

    2017-10-01

    Full Text Available Sequence similarity searches have been widely used in the analyses of metagenomic sequencing data. Finding homologous sequences in a reference database enables the estimation of taxonomic and functional characteristics of each query sequence. Because current metagenomic sequencing data consist of a large number of nucleotide sequences, the time required for sequence similarity searches account for a large proportion of the total time. This time-consuming step makes it difficult to perform large-scale analyses. To analyze large-scale metagenomic data, such as those found in the human oral microbiome, we developed GHOST-MP (Genome-wide HOmology Search Tool on Massively Parallel system, a parallel sequence similarity search tool for massively parallel computing systems. This tool uses a fast search algorithm based on suffix arrays of query and database sequences and a hierarchical parallel search to accelerate the large-scale sequence similarity search of metagenomic sequencing data. The parallel computing efficiency and the search speed of this tool were evaluated. GHOST-MP was shown to be scalable over 10,000 CPU (Central Processing Unit cores, and achieved over 80-fold acceleration compared with mpiBLAST using the same computational resources. We applied this tool to human oral metagenomic data, and the results indicate that the oral cavity, the oral vestibule, and plaque have different characteristics based on the functional gene category.

  3. Strikes by physicians: a historical perspective toward an ethical evaluation.

    Science.gov (United States)

    Thompson, Stephen L; Salmon, J Warren

    2006-01-01

    Current conditions surrounding the house of medicine-including corporate and government cost-containment strategies, increasing market-penetration schemes in health care, along with clinical scrutiny and the administrative control imposed under privatization by managed care firms, insurance companies, and governments-have spurred an upsurge in physician unionization, which requires a revisiting of the issue of physician strikes. Strikes by physicians have been relatively rare events in medical history. When they have occurred, they have aroused intense debate over their ethical justification among professionals and the public alike, notwithstanding what caused the strikes. As physicians and other health care providers increasingly find employment within organizations as wage-contract employees and their work becomes more highly rationalized, more physicians will join labor organizations to protect both their economic and their professional interests. As a result, these physicians will have to come to terms with the use of the strike weapon. On the surface, many health care strikes may not ever seem justifiable, but in certain defined situations a strike would be not only permissible but an ethical imperative. With an exacerbation of labor strife in the health sector in many nations, it is crucial to explore the question of what constitutes an ethical physician strike.

  4. Determine the Foot Strike Pattern Using Inertial Sensors

    Directory of Open Access Journals (Sweden)

    Tzyy-Yuang Shiang

    2016-01-01

    Full Text Available From biomechanical point of view, strike pattern plays an important role in preventing potential injury risk in running. Traditionally, strike pattern determination was conducted by using 3D motion analysis system with cameras. However, the procedure is costly and not convenient. With the rapid development of technology, sensors have been applied in sport science field lately. Therefore, this study was designed to determine the algorithm that can identify landing strategies with a wearable sensor. Six healthy male participants were recruited to perform heel and forefoot strike strategies at 7, 10, and 13 km/h speeds. The kinematic data were collected by Vicon 3D motion analysis system and 2 inertial measurement units (IMU attached on the dorsal side of both shoes. The data of each foot strike were gathered for pitch angle and strike index analysis. Comparing the strike index from IMU with the pitch angle from Vicon system, our results showed that both signals exhibited highly correlated changes between different strike patterns in the sagittal plane (r=0.98. Based on the findings, the IMU sensors showed potential capabilities and could be extended beyond the context of sport science to other fields, including clinical applications.

  5. Genes homologous to glycopeptide resistance vanA are widespread in soil microbial communities

    DEFF Research Database (Denmark)

    Guardabassi, L.; Agersø, Yvonne

    2006-01-01

    The occurrence of D-Ala : D-Lac ligase genes homologous to glycopeptide resistance vanA was studied in samples of agricultural (n=9) and garden (n=3) soil by culture-independent methods. Cloning and sequencing of nested degenerate PCR products obtained from soil DNA revealed the occurrence of D......A in enterococci. Such sequences were recovered from all agricultural samples as well as from two garden samples with no history of organic fertilization. The results indicated that soil is a rich and assorted reservoir of genes closely related to those conferring glycopeptide resistance in clinical bacteria.......-Ala : D-Ala ligase genes unrelated to vanA. In order to enhance detection of vanA-homologous genes, a third PCR step was added using primers targeting vanA in soil Paenibacillus. Sequencing of 25 clones obtained by this method allowed recovery of 23 novel sequences having 86-100% identity with van...

  6. A recurrent translocation is mediated by homologous recombination between HERV-H elements

    Directory of Open Access Journals (Sweden)

    Hermetz Karen E

    2012-01-01

    Full Text Available Abstract Background Chromosome rearrangements are caused by many mutational mechanisms; of these, recurrent rearrangements can be particularly informative for teasing apart DNA sequence-specific factors. Some recurrent translocations are mediated by homologous recombination between large blocks of segmental duplications on different chromosomes. Here we describe a recurrent unbalanced translocation casued by recombination between shorter homologous regions on chromosomes 4 and 18 in two unrelated children with intellectual disability. Results Array CGH resolved the breakpoints of the 6.97-Megabase (Mb loss of 18q and the 7.30-Mb gain of 4q. Sequencing across the translocation breakpoints revealed that both translocations occurred between 92%-identical human endogenous retrovirus (HERV elements in the same orientation on chromosomes 4 and 18. In addition, we find sequence variation in the chromosome 4 HERV that makes one allele more like the chromosome 18 HERV. Conclusions Homologous recombination between HERVs on the same chromosome is known to cause chromosome deletions, but this is the first report of interchromosomal HERV-HERV recombination leading to a translocation. It is possible that normal sequence variation in substrates of non-allelic homologous recombination (NAHR affects the alignment of recombining segments and influences the propensity to chromosome rearrangement.

  7. Strike action by nurses in South Africa: A value clarification

    Directory of Open Access Journals (Sweden)

    Marie Muller

    2001-09-01

    Full Text Available The Labour Relations Act (South Africa, 1991 made provision for protected strike action by employees, subject to certain conditions, procedures and negotiated agreements. This led to the removal of the strike clause in the Nursing Act (South Africa, 1992. The labour rights of all citizens are entrenched in the Constitution of the country (South Africa, 1996. Participation in strike action by the nurse/ midwife, regardless of the legal requirements and specifications, does, however, pose an ethical question. It is therefore necessary to conduct a value clarification on strike action by nurses in South Africa. The purpose of this research is to explore and describe the perceived values of participants from an accessible population on this phenomenon. A qualitative, exploratory and descriptive research design was deployed. The perceived values of nurses on strike action were collected by means of an openended questionnaire/sketch. Over a period of three years a purposive and convenient sampling method was used, involving all the enrolled post basic nursing/midwifery students/ learners at a particular Nursing Education Institution. The justification of the sample was further enhanced by also collecting data on the participants’ age and provincial distribution location. Although a 63% sample realisation (of the accessible population was achieved, this represents only 1,5% of the registered nursing/midwifery population in the country. A descriptive analysis of the participants’ age and provincial distribution was undertaken, as well as a content analysis of their perceived values on strike action. The mean age of the participants was 48 years, which could be attributed to the fact that most of them were enrolled for a post-basic Diploma in Community Nursing Science. Most of the responses (52,7% were against strike action and 32,5% supported strike action by nurses as a constitutional and legal right. A fairly substantial number of participants (14

  8. "Thunderstruck": penetrating thoracic injury from lightning strike.

    Science.gov (United States)

    van Waes, Oscar J F; van de Woestijne, Pieter C; Halm, Jens A

    2014-04-01

    Lightning strike victims are rarely presented at an emergency department. Burns are often the primary focus. This case report describes the improvised explosive device like-injury to the thorax due to lightning strike and its treatment, which has not been described prior in (kerauno)medicine. Penetrating injury due to blast from lightning strike is extremely rare. These "shrapnel" injuries should however be ruled out in all patients struck by lightning. Copyright © 2013 American College of Emergency Physicians. Published by Mosby, Inc. All rights reserved.

  9. On the hodological criterion for homology

    Directory of Open Access Journals (Sweden)

    Macarena eFaunes

    2015-06-01

    Full Text Available Owen’s pre-evolutionary definition of a homologue as the same organ in different animals under every variety of form and function and its redefinition after Darwin as the same trait in different lineages due to common ancestry entail the same heuristic problem: how to establish sameness. Although different criteria for homology often conflict, there is currently a generalized acceptance of gene expression as the best criterion. This gene-centered view of homology results from a reductionist and preformationist concept of living beings. Here, we adopt an alternative organismic-epigenetic viewpoint, and conceive living beings as systems whose identity is given by the dynamic interactions between their components at their multiple levels of composition. We posit that there cannot be an absolute homology criterion, and instead, homology should be inferred from comparisons at the levels and developmental stages where the delimitation of the compared trait lies. In this line, we argue that neural connectivity, i.e., the hodological criterion, should prevail in the determination of homologies between brain supra-cellular structures, such as the vertebrate pallium.

  10. Continental United States Hurricane Strikes 1950-2012

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Continental U.S. Hurricane Strikes Poster is our most popular poster which is updated annually. The poster includes all hurricanes that affected the U.S. since...

  11. 2005 Significant U.S. Hurricane Strikes Poster

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The 2005 Significant U.S. Hurricane Strikes poster is one of two special edition posters for the Atlantic Hurricanes. This beautiful poster contains two sets of...

  12. Ethical and legal consideration of prisoner's hunger strike in Serbia.

    Science.gov (United States)

    Alempijevic, Djordje; Pavlekic, Snezana; Jecmenica, Dragan; Nedeljkov, Aleksandra; Jankovic, Milos

    2011-03-01

    Hunger strike of prisoners and detainees remains a major human rights and ethical issue for medical professionals. We are reporting on a case of a 48-year-old male sentenced prisoner, intravenous heroin user, who went on a hunger strike and died 15 days later. Throughout the fasting period, the prisoner, who was capable of decision making, refused any medical examination. Autopsy findings were not supporting prolonged starvation, while toxicology revealed benzodiazepines and opiates in blood and urine. Cause of death was given as "heroin intoxication" in keeping with detection of 6-MAM. Legal and ethical issues pertinent to medical examination and treatment of prisoners on hunger strike are explored in accordance with legislation and professional ethical standards in Serbia. A recommendation for the best autopsy practice in deaths following hunger strike has been made. © 2011 American Academy of Forensic Sciences.

  13. Nuclear First Strike-Have the Rules Changed?

    National Research Council Canada - National Science Library

    Carter, Rosemary M

    2008-01-01

    .... Nuclear first strike is the policy that reserves the right to use nuclear weapons against an enemy before that enemy employs a like weapon without any constraints on the decision to employ the weapon...

  14. Joint Strike Fighter fit for duty in Europe?

    NARCIS (Netherlands)

    Heerkens, Johannes M.G.

    2000-01-01

    Focuses on the potential growth of the Joint Strike Fighter (JSF) market in Europe. Competition between Lockheed Martin and Boeing for the fighter's design contract; Disadvantages of the fighter plane; Stealth performance of JSF.

  15. A homolog of the RPS2 disease resistance gene is constitutively expressed in Brassica oleracea

    Directory of Open Access Journals (Sweden)

    Malvas Celia C.

    2003-01-01

    Full Text Available In this study, we identified disease resistance gene homologs in Brassica oleracea and assessed their expression in lines resistant and susceptible to Xanthomonas campestris pv. campestris (Xcc. Two DNA fragments of approximately 2.5 kb (BI-16/RPS2 and Lc201/RPS2 were amplified by PCR from two Brassica lines using primers based on an RPS2 homologous sequence previously described in the Brassica oleracea ecotype B117. The sequences of these fragments shared high similarity (95-98% with RPS2 homologs from various Brassica species. The digestion of these fragments with restriction enzymes revealed polymorphisms at the Xba I restriction sites. The length polymorphisms were used as a co-dominant marker in an F2 population developed to segregate for resistance to Xcc, the causal agent of black rot. Linkage analysis showed no significant association between the marker and quantitative trait loci for black rot. RT-PCR with specific primers yielded an expected 453 bp fragment that corresponded to the RPS2 homologs in both resistant and susceptible lines inoculated with the pathogen, as well as in non-inoculated control plants. These results suggest that these homologs are constitutively expressed in B. oleracea.

  16. Comparison of force, power, and striking efficiency for a Kung Fu strike performed by novice and experienced practitioners: preliminary analysis.

    Science.gov (United States)

    Neto, Osmar Pinto; Magini, Marcio; Saba, Marcelo M F; Pacheco, Marcos Tadeu Tavares

    2008-02-01

    This paper presents a comparison of force, power, and efficiency values calculated from Kung Fu Yau-Man palm strikes, when performed by 7 experienced and 6 novice men. They performed 5 palm strikes to a freestanding basketball, recorded by high-speed camera at 1000 Hz. Nonparametric comparisons and correlations showed experienced practitioners presented larger values of mean muscle force, mean impact force, mean muscle power, mean impact power, and mean striking efficiency, as is noted in evidence obtained for other martial arts. Also, an interesting result was that for experienced Kung Fu practitioners, muscle power was linearly correlated with impact power (p = .98) but not for the novice practitioners (p = .46).

  17. Local avian density influences risk of mortality from window strikes

    Science.gov (United States)

    Sabo, Ann M.; Hagemeyer, Natasha D.G.; Lahey, Ally S.

    2016-01-01

    Up to a billion birds die per year in North America as a result of striking windows. Both transparent and reflective glass panes are a cause for concern, misleading birds by either acting as invisible, impenetrable barriers to desired resources, or reflecting those resources over a large surface area. A high number of window strikes occur during migration, but little is known about the factors of susceptibility, or whether particular avian taxa are more vulnerable than others. We report on a study of window strikes and mist-netting data at the Virginia Zoological Park (Norfolk, Virginia, USA), conducted in the autumn of 2013 and 2014. We focused on three factors likely to contribute to an individual’s predisposition to collide with windows: (i) taxonomic classification, (ii) age, and (iii) migrant vs. resident status. Thrushes, dominated by the partial migrant American Robin (Turdus migratorius), were significantly less likely to strike glass than be sampled in mist nets (χ2 = 9.21, p = 0.002), while wood-warblers (Parulidae) were more likely to strike than expected (χ2 = 13.55, p windows (45.4%) was not significantly different (χ2 = 0.05, p = 0.827) than the population of juvenile birds naturally occurring at the zoo (48.8%). Migrants, however, were significantly more susceptible to window strikes than residents (χ2 = 6.35, p = 0.012). Our results suggest that resident birds are able to learn to avoid and thus reduce their likelihood of striking windows; this intrinsic risk factor may help explain the apparent susceptibility of certain taxa to window strikes. PMID:27366656

  18. Homological methods, representation theory, and cluster algebras

    CERN Document Server

    Trepode, Sonia

    2018-01-01

    This text presents six mini-courses, all devoted to interactions between representation theory of algebras, homological algebra, and the new ever-expanding theory of cluster algebras. The interplay between the topics discussed in this text will continue to grow and this collection of courses stands as a partial testimony to this new development. The courses are useful for any mathematician who would like to learn more about this rapidly developing field; the primary aim is to engage graduate students and young researchers. Prerequisites include knowledge of some noncommutative algebra or homological algebra. Homological algebra has always been considered as one of the main tools in the study of finite-dimensional algebras. The strong relationship with cluster algebras is more recent and has quickly established itself as one of the important highlights of today’s mathematical landscape. This connection has been fruitful to both areas—representation theory provides a categorification of cluster algebras, wh...

  19. Parallelism, deep homology, and evo-devo.

    Science.gov (United States)

    Hall, Brian K

    2012-01-01

    Parallelism has been the subject of a number of recent studies that have resulted in reassessment of the term and the process. Parallelism has been aligned with homology leaving convergence as the only case of homoplasy, regarded as a transition between homologous and convergent characters, and defined as the independent evolution of genetic traits. Another study advocates abolishing the term parallelism and treating all cases of the independent evolution of characters as convergence. With the sophistication of modern genomics and genetic analysis, parallelism of characters of the phenotype is being discovered to reflect parallel genetic evolution. Approaching parallelism from developmental and genetic perspectives enables us to tease out the degree to which the reuse of pathways represent deep homology and is a major task for evolutionary developmental biology in the coming decades. © 2012 Wiley Periodicals, Inc.

  20. NASA storm hazards research in lightning strikes to aircraft

    Science.gov (United States)

    Fisher, B. D.; Brown, P. W.; Plumer, J. A.

    1985-01-01

    The lightning strike condition data gathered in the 1980-1984 period are presented, together with the lightning attachment point analysis for the NASA F-106B research aircraft are presented. The analysis of the experienced 637 direct lightning strikes shows that the highest strike rates (2.1 strikes/min and 13 strikes/penetration) occurred at altitudes between 38,000 and 40,000 ft. The regions of highest risk for an aircraft to experience a direct lightning strike were the areas of thunderstorms where the ambient temperature was colder than -40 C and where the relative turbulence and precipitation intensities were characterized as negligible to light. The presence and location of lightning, therefore, did not necessarily indicate the presence and location of hazardous precipitation and turbulence. The total onboard data show that the lightning attachment patterns on this aircraft fall into four general categories, although the 1984 data suggest that the entire surface of the F-106B may be susceptible to lightning attachment.

  1. WAVELET TRANSFORM ANALYSIS OF ELECTROMYOGRAPHY KUNG FU STRIKES DATA

    Directory of Open Access Journals (Sweden)

    Ana Carolina de Miranda Marzullo

    2009-11-01

    Full Text Available In martial arts and contact sports strikes are performed at near maximum speeds. For that reason, electromyography (EMG analysis of such movements is non-trivial. This paper has three main goals: firstly, to investigate the differences in the EMG activity of muscles during strikes performed with and without impacts; secondly, to assess the advantages of using Sum of Significant Power (SSP values instead of root mean square (rms values when analyzing EMG data; and lastly to introduce a new method of calculating median frequency values using wavelet transforms (WMDF. EMG data of the deltoid anterior (DA, triceps brachii (TB and brachioradialis (BR muscles were collected from eight Kung Fu practitioners during strikes performed with and without impacts. SSP results indicated significant higher muscle activity (p = 0.023 for the strikes with impact. WMDF results, on the other hand, indicated significant lower values (p = 0. 007 for the strikes with impact. SSP results presented higher sensitivity than rms to quantify important signal differences and, at the same time, presented lower inter-subject coefficient of variations. The result of increase in SSP values and decrease in WMDF may suggest better synchronization of motor units for the strikes with impact performed by the experienced Kung Fu practitioners

  2. Infernal 1.1: 100-fold faster RNA homology searches.

    Science.gov (United States)

    Nawrocki, Eric P; Eddy, Sean R

    2013-11-15

    Infernal builds probabilistic profiles of the sequence and secondary structure of an RNA family called covariance models (CMs) from structurally annotated multiple sequence alignments given as input. Infernal uses CMs to search for new family members in sequence databases and to create potentially large multiple sequence alignments. Version 1.1 of Infernal introduces a new filter pipeline for RNA homology search based on accelerated profile hidden Markov model (HMM) methods and HMM-banded CM alignment methods. This enables ∼100-fold acceleration over the previous version and ∼10 000-fold acceleration over exhaustive non-filtered CM searches. Source code, documentation and the benchmark are downloadable from http://infernal.janelia.org. Infernal is freely licensed under the GNU GPLv3 and should be portable to any POSIX-compliant operating system, including Linux and Mac OS/X. Documentation includes a user's guide with a tutorial, a discussion of file formats and user options and additional details on methods implemented in the software. nawrockie@janelia.hhmi.org

  3. Complementary DNA and derived amino acid sequence of the α subunit of human complement protein C8: evidence for the existence of a separate α subunit messenger RNA

    International Nuclear Information System (INIS)

    Rao, A.G.; Howard, O.M.Z.; Ng, S.C.; Whitehead, A.S.; Colten, H.R.; Sodetz, J.M.

    1987-01-01

    The entire amino acid sequence of the α subunit (M/sub r/ 64,000) of the eight component of complement (C8) was determined by characterizing cDNA clones isolated from a human liver cDNA library. Two clones with overlapping inserts of net length 2.44 kilobases (kb) were isolated and found to contain the entire α coding region [1659 base pairs (bp)]. The 5' end consists of an untranslated region and a leader sequence of 30 amino acids. This sequence contains an apparent initiation Met, signal peptide, and propeptide which ends with an arginine-rich sequence that is characteristic of proteolytic processing sites found in the pro form of protein precursors. The 3' untranslated region contains two polyadenylation signals and a poly(A)sequence. RNA blot analysis of total cellular RNA from the human hepatoma cell line HepG2 revealed a message size of ∼2.5 kb. Features of the 5' and 3' sequences and the message size suggest that a separate mRNA codes for α and argues against the occurrence of a single-chain precursor form of the disulfide-linked α-λ subunit found in mature C8. Analysis of the derived amino acid sequence revealed several membrane surface seeking domains and a possible transmembrane domain. Analysis of the carbohydrate composition indicates 1 or 2 asparagine-linked but no O-linked oligosaccharide chains, a result consistent with predictions from the amino acid sequence. Most significantly, it exhibits a striking overall homology to human C9, with values of 24% on the basis of identity and 46% when conserved substitutions are allowed. As described in an accompanying report this homology also extends to the β subunit of C8

  4. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

    Science.gov (United States)

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

    2017-11-17

    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  5. Complementary DNA and derived amino acid sequence of the β subunit of human complement protein C8: identification of a close structural and ancestral relationship to the α subunit and C9

    International Nuclear Information System (INIS)

    Howard, O.M.Z.; Rao, A.G.; Sodetz, J.M.

    1987-01-01

    A cDNA clone encoding the β subunit (M/sub r/ 64,000) of the eighth component of complement (C8) has been isolated from a human liver cDNA library. This clone has a cDNA insert of 1.95 kilobases (kb) and contains the entire β sequence [1608 base pairs (bp)]. Analysis of total cellular RNA isolated from the hepatoma cell line HepG2 revealed the mRNA for β to be ∼ 2.5 kb. This is similar to the message size for the α subunit of C8 and confirms the existence of different mRNAs for α and β. This finding supports genetic evidence that α and β are encoded at different loci. Analysis of the derived amino acid sequence revealed several membrane surface seeking segments that may facilitate β interaction with target membranes during complement-mediated cytolysis. Determined of the carbohydrate composition indicated 1 or 2 asparagine-linked but no O-linked oligosaccharide chains. Comparison of the β sequence to that reported earlier and to that of human C9 revealed a striking homology between all three proteins. For β and α, the overall homology is 33% on the basis of identity and 53% when conserved substitutions are allowed. For β and C9, the values are 26% and 47 5 , respectively. All three have a large internal domain that is nearly cysteine free and N- and C-termini that are cysteine-rich and homologous to the low-density lipoprotein receptor repeat and epidermal growth factor type sequences, respectively. The overall homology and similarities in size and structural organization are indicative of a close ancestral relationship. It is concluded that α, β and C9 are members of a family of structurally related proteins that are capable of interacting to produce a hydrophilic to amphiphilic transition and membrane association

  6. [The Teachers' Right to Strike Versus the Students' Right to an Education.

    Science.gov (United States)

    Powell, Edward M.

    The speaker establishes himself in opposition to teacher strikes, outlines the scope of teacher strikes, discusses arguments for and against the right of teachers to strike, presents the kinds of strikes that are possible, outlines what a board and the administration can do to head off a strike, and presents the American Association of School…

  7. Threading homology through algebra selected patterns

    CERN Document Server

    Boffi, Giandomenico

    2006-01-01

    Aimed at graduate students and researchers in mathematics, this book takes homological themes, such as Koszul complexes and their generalizations, and shows how these can be used to clarify certain problems in selected parts of algebra, as well as their success in solving a number of them.

  8. Homological stability for unordered configuration spaces

    DEFF Research Database (Denmark)

    Randal-Williams, Oscar

    2013-01-01

    This paper consists of two related parts. In the first part we give a self-contained proof of homological stability for the spaces C_n(M;X) of configurations of n unordered points in a connected open manifold M with labels in a path-connected space X, with the best possible integral stability range...

  9. Homology modeling of γ-aminobutyrateaminotransferase, a ...

    African Journals Online (AJOL)

    γ-Aminobutyrate aminotransferase (GABA-AT) is a pyridoxal phosphate dependent homodimeric enzyme of 50-kD subunits. It is a potential drug target against epilepsy. The three-dimensional structure of GABA-AT is not experimentally known, and we thus resorted to homology modelling to build a model based on x-ray ...

  10. On the homology length spectrum of surfaces

    OpenAIRE

    Massart, Daniel; Parlier, Hugo

    2014-01-01

    On a surface with a Finsler metric, we investigate the asymptotic growth of the number of closed geodesics of length less than L which minimize length among all geodesic multicurves in the same homology class. An important class of surfaces which are of interest to us are hyperbolic surfaces.

  11. Homology and cohomology of Rees semigroup algebras

    DEFF Research Database (Denmark)

    Grønbæk, Niels; Gourdeau, Frédéric; White, Michael C.

    2011-01-01

    Let S by a Rees semigroup, and let 1¹(S) be its convolution semigroup algebra. Using Morita equivalence we show that bounded Hochschild homology and cohomology of l¹(S) is isomorphic to those of the underlying discrete group algebra....

  12. Nash equilibria via duality and homological selection

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Given a multifunction from to the -fold symmetric product Symk(X), we use the Dold–Thom theorem to establish a homological selection theorem. ... The domain part of the email address of all email addresses used by the office of Indian Academy of Sciences, including those of the staff, the journals, ...

  13. Cell biology of homologous recombination in yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine Valerie; Rothstein, Rodney; Lisby, Michael

    2011-01-01

    Homologous recombination is an important pathway for error-free repair of DNA lesions, such as single- and double-strand breaks, and for rescue of collapsed replication forks. Here, we describe protocols for live cell imaging of single-lesion recombination events in the yeast Saccharomyces...

  14. Lower Miocene coeval thrusting and strike-slip faulting in the Western Betics

    Science.gov (United States)

    Frasca, Gianluca; Gueydan, Frédéric; Brun, Jean-Pierre

    2015-04-01

    In the framework of the Africa-Europe convergence, the Mediterranean system presents a complex interaction between subduction rollback and upper subduction plate deformation since 30 Ma. The western end of the system shows an arcuate geometry across the Gibraltar arc, the Betico-Rifean belt, in which the relationship between slab dynamics and onshore tectonics is poorly constrained. The present study focuses on the Western Betics, which is characterized by two major thrusts: 1/ the Alboran Front limits the metamorphic domain (Alboran Domain) from the fold-and-thrust belts involving the Mesozoic cover of the Iberian margin (Subbetics Domain); 2/ the Alboran Internal Thrust allows the juxtaposition of a strongly attenuated lithosphere section, containing the large Ronda subcontinental mantle bodies, on top of crustal rocks. New structural data show that two major E-W strike-slip corridors controlled the deformation pattern of the Alboran Domain, in which E-W dextral strike-slip faults, N60° thrusts and N140° normal faults developed simultaneously during dextral strike-slip simple shear. The Alozaina piggy-back Basin, mainly formed by olistotromic deposits of Lower Miocene age, provides an age estimate for the continuous westward translation of the Alboran Domain, with reference to Iberia, that is accommodated mainly by an E-W lateral strike-slip ramp and a N60° frontal thrust ramp. In this context, a thrust sequence led to the piling up of thrust units in the Western Betics and to the crustal emplacement of the Ronda Peridotites bodies.

  15. Parametric representation of centrifugal pump homologous curves

    International Nuclear Information System (INIS)

    Veloso, Marcelo A.; Mattos, Joao R.L. de

    2015-01-01

    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

  16. Polar representation of centrifugal pump homologous curves

    International Nuclear Information System (INIS)

    Veloso, Marcelo Antonio; Mattos, Joao Roberto Loureiro de

    2008-01-01

    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic parameters: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. Any one of these quantities can be expressed as a function of any two others. The curves showing the relationships between these four variables are called the pump characteristic curves, also referred to as four-quadrant curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, the four-quadrant configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the polar form appears as the simplest way to represent the homologous curves. In the polar method, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a

  17. Parametric representation of centrifugal pump homologous curves

    Energy Technology Data Exchange (ETDEWEB)

    Veloso, Marcelo A.; Mattos, Joao R.L. de, E-mail: velosom@cdtn.br, E-mail: jrmattos@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2015-07-01

    Essential for any mathematical model designed to simulate flow transient events caused by pump operations is the pump performance data. The performance of a centrifugal pump is characterized by four basic quantities: the rotational speed, the volumetric flow rate, the dynamic head, and the hydraulic torque. The curves showing the relationships between these four variables are called the pump characteristic curves. The characteristic curves are empirically developed by the pump manufacturer and uniquely describe head and torque as functions of volumetric flow rate and rotation speed. Because of comprising a large amount of points, this configuration is not suitable for computational purposes. However, it can be converted to a simpler form by the development of the homologous curves, in which dynamic head and hydraulic torque ratios are expressed as functions of volumetric flow and rotation speed ratios. The numerical use of the complete set of homologous curves requires specification of sixteen partial curves, being eight for the dynamic head and eight for the hydraulic torque. As a consequence, the handling of homologous curves is still somewhat complicated. In solving flow transient problems that require the pump characteristic data for all the operation zones, the parametric form appears as the simplest way to deal with the homologous curves. In this approach, the complete characteristics of a pump can be described by only two closed curves, one for the dynamic head and other for the hydraulic torque, both in function of a single angular coordinate defined adequately in terms of the quotient between volumetric flow ratio and rotation speed ratio. The usefulness and advantages of this alternative method are demonstrated through a practical example in which the homologous curves for a pump of the type used in the main coolant loops of a pressurized water reactor (PWR) are transformed to the parametric form. (author)

  18. Isolated Sensorineural Hearing Loss as a Sequela after Lightning Strike

    Directory of Open Access Journals (Sweden)

    Mahfuz Turan

    2015-01-01

    Full Text Available In most of the surviving patients after a lightning strike, audiovestibular abnormalities have been reported. The most frequently reported type of abnormalities is a tympanic membrane perforation with hearing loss and external ear canal burn. However a sensor neural hearing loss and mixed type hearing loss can also occur, but these occur rarely. A nineteen-year-old female patient had, after a lightning strike, serious burns on the left ear, behind the ear, and on the chest and neck. She also had in her left ear 108 dB hearing loss with irregular central perforation and in her right ear 52 dB sensorineural hearing loss. There was no hearing loss before the strike. A hearing aid was recommended for the right ear and good care and follow-up were recommended for the left ear. A lightning strike can cause serious audiological damage. Therefore, it is necessary to make a careful audiovestibular evaluation of the patients. Although there exist rarely healed cases from sensorineural hearing loss after lightning strike in literature, in our case hearing loss occurred bilaterally and then it healed unilaterally. This condition is quite rare in literature.

  19. Regulation of the insulin-like developmental pathway of Caenorhabditis elegans by a homolog of the PTEN tumor suppressor gene.

    Science.gov (United States)

    Gil, E B; Malone Link, E; Liu, L X; Johnson, C D; Lees, J A

    1999-03-16

    The human PTEN tumor suppressor gene is mutated in a wide variety of sporadic tumors. To determine the function of PTEN in vivo we have studied a PTEN homolog in Caenorhabditis elegans. We have generated a strong loss-of-function allele of the PTEN homolog and shown that the deficient strain is unable to enter dauer diapause. An insulin-like phosphatidylinositol 3-OH kinase (PI3'K) signaling pathway regulates dauer-stage entry. Mutations in either the daf-2 insulin receptor-like (IRL) gene or the age-1 encoded PI3'K catalytic subunit homolog cause constitutive dauer formation and also affect the life span, brood size, and metabolism of nondauer animals. Strikingly, loss-of-function mutations in the age-1 PI3'K and daf-2 IRL genes are suppressed by loss-of-function mutations in the PTEN homolog. We establish that the PTEN homolog is encoded by daf-18, a previously uncloned gene that has been shown to interact genetically with the DAF-2 IRL AGE-1 PI3'K signaling pathway. This interaction provides clear genetic evidence that PTEN acts to antagonize PI3'K function in vivo. Given the conservation of the PI3'K signaling pathway between C. elegans and mammals, the analysis of daf-18 PTEN mutant nematodes should shed light on the role of human PTEN in the etiology of metabolic disease, aging, and cancer.

  20. Predicting timing of foot strike during running, independent of striking technique, using principal component analysis of joint angles.

    Science.gov (United States)

    Osis, Sean T; Hettinga, Blayne A; Leitch, Jessica; Ferber, Reed

    2014-08-22

    As 3-dimensional (3D) motion-capture for clinical gait analysis continues to evolve, new methods must be developed to improve the detection of gait cycle events based on kinematic data. Recently, the application of principal component analysis (PCA) to gait data has shown promise in detecting important biomechanical features. Therefore, the purpose of this study was to define a new foot strike detection method for a continuum of striking techniques, by applying PCA to joint angle waveforms. In accordance with Newtonian mechanics, it was hypothesized that transient features in the sagittal-plane accelerations of the lower extremity would be linked with the impulsive application of force to the foot at foot strike. Kinematic and kinetic data from treadmill running were selected for 154 subjects, from a database of gait biomechanics. Ankle, knee and hip sagittal plane angular acceleration kinematic curves were chained together to form a row input to a PCA matrix. A linear polynomial was calculated based on PCA scores, and a 10-fold cross-validation was performed to evaluate prediction accuracy against gold-standard foot strike as determined by a 10 N rise in the vertical ground reaction force. Results show 89-94% of all predicted foot strikes were within 4 frames (20 ms) of the gold standard with the largest error being 28 ms. It is concluded that this new foot strike detection is an improvement on existing methods and can be applied regardless of whether the runner exhibits a rearfoot, midfoot, or forefoot strike pattern. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. VARIATION OF STRIKE INCENTIVES WITH DAMAGE PREFERENCES; FINAL

    International Nuclear Information System (INIS)

    G. CANAVAN

    2001-01-01

    For START III level forces, strike allocations and magnitudes vary little with L, but first strike costs vary directly with L, which means that for K reflecting a preference for the survival of high value targets over their destruction and a preference for high value over military targets, the costs of action are far greater than those of inaction for a wide range of values of damage preference L. Thus, if both sides have much greater preferences for the survival of their high value targets than for military targets or destruction, they do not see a net incentive to strike, and crises are terminated by inaction. Recent decades suggest strong preferences for the survival of high value and that this has contributed to the lack of direct conflict during that period

  2. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

    Science.gov (United States)

    Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

    2010-04-30

    Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

  3. Comparison of blade-strike modeling results with empirical data

    Energy Technology Data Exchange (ETDEWEB)

    Ploskey, Gene R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Carlson, Thomas J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2004-03-01

    This study is the initial stage of further investigation into the dynamics of injury to fish during passage through a turbine runner. As part of the study, Pacific Northwest National Laboratory (PNNL) estimated the probability of blade strike, and associated injury, as a function of fish length and turbine operating geometry at two adjacent turbines in Powerhouse 1 of Bonneville Dam. Units 5 and 6 had identical intakes, stay vanes, wicket gates, and draft tubes, but Unit 6 had a new runner and curved discharge ring to minimize gaps between the runner hub and blades and between the blade tips and discharge ring. We used a mathematical model to predict blade strike associated with two Kaplan turbines and compared results with empirical data from biological tests conducted in 1999 and 2000. Blade-strike models take into consideration the geometry of the turbine blades and discharges as well as fish length, orientation, and distribution along the runner. The first phase of this study included a sensitivity analysis to consider the effects of difference in geometry and operations between families of turbines on the strike probability response surface. The analysis revealed that the orientation of fish relative to the leading edge of a runner blade and the location that fish pass along the blade between the hub and blade tip are critical uncertainties in blade-strike models. Over a range of discharges, the average prediction of injury from blade strike was two to five times higher than average empirical estimates of visible injury from shear and mechanical devices. Empirical estimates of mortality may be better metrics for comparison to predicted injury rates than other injury measures for fish passing at mid-blade and blade-tip locations.

  4. Computational integration of homolog and pathway gene module expression reveals general stemness signatures.

    Directory of Open Access Journals (Sweden)

    Martina Koeva

    Full Text Available The stemness hypothesis states that all stem cells use common mechanisms to regulate self-renewal and multi-lineage potential. However, gene expression meta-analyses at the single gene level have failed to identify a significant number of genes selectively expressed by a broad range of stem cell types. We hypothesized that stemness may be regulated by modules of homologs. While the expression of any single gene within a module may vary from one stem cell type to the next, it is possible that the expression of the module as a whole is required so that the expression of different, yet functionally-synonymous, homologs is needed in different stem cells. Thus, we developed a computational method to test for stem cell-specific gene expression patterns from a comprehensive collection of 49 murine datasets covering 12 different stem cell types. We identified 40 individual genes and 224 stemness modules with reproducible and specific up-regulation across multiple stem cell types. The stemness modules included families regulating chromatin remodeling, DNA repair, and Wnt signaling. Strikingly, the majority of modules represent evolutionarily related homologs. Moreover, a score based on the discovered modules could accurately distinguish stem cell-like populations from other cell types in both normal and cancer tissues. This scoring system revealed that both mouse and human metastatic populations exhibit higher stemness indices than non-metastatic populations, providing further evidence for a stem cell-driven component underlying the transformation to metastatic disease.

  5. Planarian PTEN homologs regulate stem cells and regeneration through TOR signaling.

    Science.gov (United States)

    Oviedo, Néstor J; Pearson, Bret J; Levin, Michael; Sánchez Alvarado, Alejandro

    2008-01-01

    We have identified two genes, Smed-PTEN-1 and Smed-PTEN-2, capable of regulating stem cell function in the planarian Schmidtea mediterranea. Both genes encode proteins homologous to the mammalian tumor suppressor, phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Inactivation of Smed-PTEN-1 and -2 by RNA interference (RNAi) in planarians disrupts regeneration, and leads to abnormal outgrowths in both cut and uncut animals followed soon after by death (lysis). The resulting phenotype is characterized by hyperproliferation of neoblasts (planarian stem cells), tissue disorganization and a significant accumulation of postmitotic cells with impaired differentiation capacity. Further analyses revealed that rapamycin selectively prevented such accumulation without affecting the normal neoblast proliferation associated with physiological turnover and regeneration. In animals in which PTEN function is abrogated, we also detected a significant increase in the number of cells expressing the planarian Akt gene homolog (Smed-Akt). However, functional abrogation of Smed-Akt in Smed-PTEN RNAi-treated animals does not prevent cell overproliferation and lethality, indicating that functional abrogation of Smed-PTEN is sufficient to induce abnormal outgrowths. Altogether, our data reveal roles for PTEN in the regulation of planarian stem cells that are strikingly conserved to mammalian models. In addition, our results implicate this protein in the control of stem cell maintenance during the regeneration of complex structures in planarians.

  6. Germline progenitors escape the widespread phenomenon of homolog pairing during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Eric F Joyce

    Full Text Available Homolog pairing, which plays a critical role in meiosis, poses a potential risk if it occurs in inappropriate tissues or between nonallelic sites, as it can lead to changes in gene expression, chromosome entanglements, and loss-of-heterozygosity due to mitotic recombination. This is particularly true in Drosophila, which supports organismal-wide pairing throughout development. Discovered over a century ago, such extensive pairing has led to the perception that germline pairing in the adult gonad is an extension of the pairing established during embryogenesis and, therefore, differs from the mechanism utilized in most species to initiate pairing specifically in the germline. Here, we show that, contrary to long-standing assumptions, Drosophila meiotic pairing in the gonad is not an extension of pairing established during embryogenesis. Instead, we find that homologous chromosomes are unpaired in primordial germ cells from the moment the germline can be distinguished from the soma in the embryo and remain unpaired even in the germline stem cells of the adult gonad. We further establish that pairing originates immediately after the stem cell stage. This pairing occurs well before the initiation of meiosis and, strikingly, continues through the several mitotic divisions preceding meiosis. These discoveries indicate that the spatial organization of the Drosophila genome differs between the germline and the soma from the earliest moments of development and thus argue that homolog pairing in the germline is an active process as versus a passive continuation of pairing established during embryogenesis.

  7. [Force-feeding of hunger-striking prisoners].

    Science.gov (United States)

    Glick, Shimon

    2014-09-01

    In contrast to the position of the World Medical Association and the Ethics Council of the Israel Medical Association, the author argues for forced-feeding of hunger-striking prisoners when their condition reaches a stage of danger of death or permanent injury. This position is based on the priority of human life over autonomy, and of a communitarian ethic. This position is supported by a District Court decision ordering the feeding of a hunger-striking prisoner, by a Supreme Court decision imposing surgery on a non-consenting prisoner, and in line with Israel's Patient's Right Law.

  8. Sound Quality and Striking Position of a Conga Drum

    Directory of Open Access Journals (Sweden)

    Dylan Harvey

    2014-12-01

    Full Text Available The relationship between the location at which a drum membrane was struck and the quality of sound produced was investigated by striking the drum at several distances between the center and the rim. Through analyzing the harmonics of the wave produced from the impact, it was shown that as the striking location changes, the relative amplitudes of different modes of vibration also changes. It was found that sound of a higher pitch is produced at the rim of the drum than anywhere else on the drum head due to higher modes of vibration becoming dominant.

  9. MORE THAN A LABOR DISPUTE: THE PATCO STRIKE OF 1981

    Directory of Open Access Journals (Sweden)

    Paul L. Butterworth

    2005-01-01

    Full Text Available On August 3, 1981, 13,000 air traffic controllers walked off the job. Under US law, the strike was illegal. President Ronald Reagan ordered the strikers as a group to return to work; when they did not, he ordered individual strikers to return, and again they refused. Two days later the president fired the strikers. Reagan's action transformed relations between organized labor and American management, and created the worst turbulence to hit the American airways in recent history. “More Than a Labor Dispute” examines the work stoppage and aftermath through the eyes of two controllers and a pilot, all of whom worked during the strike.

  10. Remarkable rates of lightning strike mortality in Malawi.

    Science.gov (United States)

    Mulder, Monique Borgerhoff; Msalu, Lameck; Caro, Tim; Salerno, Jonathan

    2012-01-01

    Livingstone's second mission site on the shore of Lake Malawi suffers very high rates of consequential lightning strikes. Comprehensive interviewing of victims and their relatives in seven Traditional Authorities in Nkhata Bay District, Malawi revealed that the annual rate of consequential strikes was 419/million, more than six times higher than that in other developing countries; the rate of deaths from lightning was 84/million/year, 5.4 times greater than the highest ever recorded. These remarkable figures reveal that lightning constitutes a significant stochastic source of mortality with potential life history consequences, but it should not deflect attention away from the more prominent causes of mortality in this rural area.

  11. Assembly and dynamics of the bacteriophage T4 homologous recombination machinery

    Directory of Open Access Journals (Sweden)

    Morrical Scott W

    2010-12-01

    Full Text Available Abstract Homologous recombination (HR, a process involving the physical exchange of strands between homologous or nearly homologous DNA molecules, is critical for maintaining the genetic diversity and genome stability of species. Bacteriophage T4 is one of the classic systems for studies of homologous recombination. T4 uses HR for high-frequency genetic exchanges, for homology-directed DNA repair (HDR processes including DNA double-strand break repair, and for the initiation of DNA replication (RDR. T4 recombination proteins are expressed at high levels during T4 infection in E. coli, and share strong sequence, structural, and/or functional conservation with their counterparts in cellular organisms. Biochemical studies of T4 recombination have provided key insights on DNA strand exchange mechanisms, on the structure and function of recombination proteins, and on the coordination of recombination and DNA synthesis activities during RDR and HDR. Recent years have seen the development of detailed biochemical models for the assembly and dynamics of presynaptic filaments in the T4 recombination system, for the atomic structure of T4 UvsX recombinase, and for the roles of DNA helicases in T4 recombination. The goal of this chapter is to review these recent advances and their implications for HR and HDR mechanisms in all organisms.

  12. Molecular Cloning And Sequencing Of Disintegrin Like Domain ...

    African Journals Online (AJOL)

    Disintegrin-like domain was cloned and sequenced from Cerastes cerastes venom gland tissue. Nested RT-PCR was performed using initial primers designed based on the homology of disintegrins from Trimeresurus flavoviridis, Glodius halys , Agkistrodon halys and Trimeresurus macrosquamatus. The homology was ...

  13. Homological mirror symmetry and tropical geometry

    CERN Document Server

    Catanese, Fabrizio; Kontsevich, Maxim; Pantev, Tony; Soibelman, Yan; Zharkov, Ilia

    2014-01-01

    The relationship between Tropical Geometry and Mirror Symmetry goes back to the work of Kontsevich and Y. Soibelman (2000), who applied methods of non-archimedean geometry (in particular, tropical curves) to Homological Mirror Symmetry. In combination with the subsequent work of Mikhalkin on the “tropical” approach to Gromov-Witten theory, and the work of Gross and Siebert, Tropical Geometry has now become a powerful tool. Homological Mirror Symmetry is the area of mathematics concentrated around several categorical equivalences connecting symplectic and holomorphic (or algebraic) geometry. The central ideas first appeared in the work of Maxim Kontsevich (1993). Roughly speaking, the subject can be approached in two ways: either one uses Lagrangian torus fibrations of Calabi-Yau manifolds (the so-called Strominger-Yau-Zaslow picture, further developed by Kontsevich and Soibelman) or one uses Lefschetz fibrations of symplectic manifolds (suggested by Kontsevich and further developed by Seidel). Tropical Ge...

  14. Remote protein homology detection and fold recognition using two-layer support vector machine classifiers.

    Science.gov (United States)

    Muda, Hilmi M; Saad, Puteh; Othman, Razib M

    2011-08-01

    Remote protein homology detection and fold recognition refer to detection of structural homology in proteins where there are small or no similarities in the sequence. To detect protein structural classes from protein primary sequence information, homology-based methods have been developed, which can be divided to three types: discriminative classifiers, generative models for protein families and pairwise sequence comparisons. Support Vector Machines (SVM) and Neural Networks (NN) are two popular discriminative methods. Recent studies have shown that SVM has fast speed during training, more accurate and efficient compared to NN. We present a comprehensive method based on two-layer classifiers. The 1st layer is used to detect up to superfamily and family in SCOP hierarchy using optimized binary SVM classification rules. It used the kernel function known as the Bio-kernel, which incorporates the biological information in the classification process. The 2nd layer uses discriminative SVM algorithm with string kernel that will detect up to protein fold level in SCOP hierarchy. The results obtained were evaluated using mean ROC and mean MRFP and the significance of the result produced with pairwise t-test was tested. Experimental results show that our approaches significantly improve the performance of remote protein homology detection and fold recognition for all three different version SCOP datasets (1.53, 1.67 and 1.73). We achieved 4.19% improvements in term of mean ROC in SCOP 1.53, 4.75% in SCOP 1.67 and 4.03% in SCOP 1.73 datasets when compared to the result produced by well-known methods. The combination of first layer and second layer of BioSVM-2L performs well in remote homology detection and fold recognition even in three different versions of datasets. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

    Directory of Open Access Journals (Sweden)

    Ujjwal Maulik

    Full Text Available Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon request.sarkar@labri.fr.

  16. Searching remote homology with spectral clustering with symmetry in neighborhood cluster kernels.

    Science.gov (United States)

    Maulik, Ujjwal; Sarkar, Anasua

    2013-01-01

    Remote homology detection among proteins utilizing only the unlabelled sequences is a central problem in comparative genomics. The existing cluster kernel methods based on neighborhoods and profiles and the Markov clustering algorithms are currently the most popular methods for protein family recognition. The deviation from random walks with inflation or dependency on hard threshold in similarity measure in those methods requires an enhancement for homology detection among multi-domain proteins. We propose to combine spectral clustering with neighborhood kernels in Markov similarity for enhancing sensitivity in detecting homology independent of "recent" paralogs. The spectral clustering approach with new combined local alignment kernels more effectively exploits the unsupervised protein sequences globally reducing inter-cluster walks. When combined with the corrections based on modified symmetry based proximity norm deemphasizing outliers, the technique proposed in this article outperforms other state-of-the-art cluster kernels among all twelve implemented kernels. The comparison with the state-of-the-art string and mismatch kernels also show the superior performance scores provided by the proposed kernels. Similar performance improvement also is found over an existing large dataset. Therefore the proposed spectral clustering framework over combined local alignment kernels with modified symmetry based correction achieves superior performance for unsupervised remote homolog detection even in multi-domain and promiscuous domain proteins from Genolevures database families with better biological relevance. Source code available upon request. sarkar@labri.fr.

  17. Language evolution: neural homologies and neuroinformatics.

    Science.gov (United States)

    Arbib, Michael; Bota, Mihail

    2003-11-01

    This paper contributes to neurolinguistics by grounding an evolutionary account of the readiness of the human brain for language in the search for homologies between different cortical areas in macaque and human. We consider two hypotheses for this grounding, that of Aboitiz and Garci;a [Brain Res. Rev. 25 (1997) 381] and the Mirror System Hypothesis of Rizzolatti and Arbib [Trends Neurosci. 21 (1998) 188] and note the promise of computational modeling of neural circuitry of the macaque and its linkage to analysis of human brain imaging data. In addition to the functional differences between the two hypotheses, problems arise because they are grounded in different cortical maps of the macaque brain. In order to address these divergences, we have developed several neuroinformatics tools included in an on-line knowledge management system, the NeuroHomology Database, which is equipped with inference engines both to relate and translate information across equivalent cortical maps and to evaluate degrees of homology for brain regions of interest in different species.

  18. Homology among divergent Paleozoic tetrapod clades.

    Science.gov (United States)

    Carroll, R L

    1999-01-01

    A stringent definition of homology is necessary to establish phylogenetic relationships among Paleozoic amphibians. Many derived characters exhibited by divergent clades of Carboniferous lepospondyls resemble those achieved convergently among Cenozoic squamates that have elongate bodies and reduced limbs, and by lineages of modern amphibians that have undergone miniaturization. Incongruent character distribution, poorly resolved cladograms and functionally improbable character transformations determined by phylogenetic analysis suggest that convergence was also common among Paleozoic amphibians with a skull length under 3 cm, including lepospondyls, early amniotes and the putative ancestors of modern amphibians. For this reason, it is injudicious to equate apparent synapomorphy (perceived common presence of a particular derived character in two putative sister-taxa) with strict homology of phylogenetic origin. Identification of homology by the similarity of structure, anatomical position and pattern of development is insufficient to establish the synapomorphy of bone and limb loss or precocial ossification of vertebral centra, which are common among small Paleozoic amphibians. The only way in which synapomorphies can be established definitively is through the discovery and recognition of the trait in question in basal members of each of the clades under study, and in their immediate common ancestors.

  19. Several aspects of some techniques avoiding homologous blood transfusions

    NARCIS (Netherlands)

    E.C.S.M. van Woerkens (Liesbeth)

    1998-01-01

    textabstractThe use of homologous blood products during anesthesia and surgery is not without risks. Complications due to homologous blood transfusions include transfusion reactions, isosensitization, transmission of infections (including HIV, hepatitis, CMV) and immunosuppression (resuiting in

  20. EDITORIAL Plagiarism - time to strike at the epidemic

    African Journals Online (AJOL)

    admin

    Plagiarism - time to strike at the epidemic. Lukman Yusuf1, Abraham Aseffa2. We live in a globalized world where information is instantly shared across continents. The number of biomedical journals available for reference is quite enormous and there is a sudden huge surge of free open access journals in the last few years ...

  1. The Eastern Pacific Tropical Cyclone Strike Probability Program (EPSTRKP).

    Science.gov (United States)

    1980-08-01

    of nine preselected points of interest. Although subject to change the points currently listed within the program are: Acapulco, Mazatlan, Puerto ... Vallarta , La Paz, San Diego, Hilo, Honolulu, Johnston Island and Midway Island. The strike probabilities, computed upon receipt of each 6-hourly warning

  2. Effects of Union Organization on Strike Incidence in EU Companies

    NARCIS (Netherlands)

    Jansen, Giedo

    2014-01-01

    The author reinvestigates the relationship between the organizational power of trade unions and strikes based on data from the European Company Survey 2009 (ECS-2009) and the Institutional Characteristics of Trade Unions, Wage Setting, State Intervention and Social Pacts (ICTWSS) database, which

  3. Monte Carlo Simulation to Estimate Likelihood of Direct Lightning Strikes

    Science.gov (United States)

    Mata, Carlos; Medelius, Pedro

    2008-01-01

    A software tool has been designed to quantify the lightning exposure at launch sites of the stack at the pads under different configurations. In order to predict lightning strikes to generic structures, this model uses leaders whose origins (in the x-y plane) are obtained from a 2D random, normal distribution.

  4. Torts Liability for Strike Action and Third Party Rights.

    Science.gov (United States)

    Raday, Frances

    1979-01-01

    Studies the nature of the torts liability incurred in strikes and the extent of existing immunities bestowed on strikers and their organizers, and explores the principles that should govern liability and immunity. Available from Israel Law Review Association, c/o Faculty of Law, Hebrew University of Jerusalem, Mount Scopus, P.O.B. 24100, Jerusalem…

  5. Nurses need the right to strike to protect patients.

    Science.gov (United States)

    Harrison, Malcolm

    2012-04-25

    Four of your readers panellists were asked if the RCN should be affiliated to the Trades Union Congress (reflections April 4). One of them said the RCN needs to modernise and join the wider trade union movement, but 'should keep the "no strike" policy that has always served it so well'.

  6. Analysis of the effects of frequent strikes on academic performance ...

    African Journals Online (AJOL)

    The history of Academic Staff Union of Universities (ASUU)'s strike can be traced back to 1978, the period of the beginning of the decline in the oil boom, when the country faced the consequences of the failure by its rulers to use the oil wealth to generate production and a social welfare system. Military dictatorship had ...

  7. On Striking for a Bargain between Two Completely Informed Agents

    NARCIS (Netherlands)

    Houba, H.E.D.; Wen, Q.

    2007-01-01

    This paper provides a thorough equilibrium analysis of a wage contract negotiation model where the union must choose between strike and holdout between offers and counter-offers. When the union and the firm have different discount factors, delay in reaching an agreement may Pareto dominate many

  8. Assemblage of strike-slip faults and tectonic extension and ...

    Indian Academy of Sciences (India)

    12

    and its effect on the productivity of the tight reservoirs. The study will not only guide. 95 the oil-gas ..... 5 Effect of tectonic extension and compression on coal reservoir productivity. 288. 5.1 Strike-slip compression and ..... staff of all the authors that cooperated in performing the analyses. We are also. 425 grateful to the ...

  9. Assemblage of strike-slip faults and tectonic extension and ...

    Indian Academy of Sciences (India)

    12

    Assemblage of strike-slip faults and tectonic. 1 extension and compression analysis: A case. 2 study of a Lower Permian commercial coal. 3 reservoir in China. 4. 5. Shuai Yina,*, Dawei Lvb, Zhonghu Wu c .... high-quality reservoirs, and tectonic action is a leading factor for oil and gas. 70 enrichment. Therefore, it is of great ...

  10. BIRD/WILDLIFE STRIKE CONTROL FOR SAFER AIR ...

    African Journals Online (AJOL)

    Osondu

    2012-06-05

    Jun 5, 2012 ... These include staff training and retraining, developing good data bank based on .... wildlife is very important in bird control. Successful habitat ... Designated staff patrols the airside areas using chemical repellants, propane cannons, distress call. Birds/Wildlife Strikes Control for Safer Air .................Usman et ...

  11. LAW AND ETHICS OF STRIKES IN THE NIGERIAN HEALTH SYSTEM

    African Journals Online (AJOL)

    2014-10-06

    Oct 6, 2014 ... MDCN Code of ethics intends to give right for cessation of work by workers in the health sector of the economy. Thus under the Common Law, a strike, especially in the essential services is a breach of the contract of employment. The Trade. Union (amendment) Act (Federal Republic of. Nigeria, 2005) ...

  12. Growth control of kalanchoe cultivars Rako and Gold Strike by ...

    African Journals Online (AJOL)

    This study was conducted to test the potential of paclobutrazol and uniconazole used at the propagation stage as a plant growth retardant (PGR) of kalanchoe cultivars Rako and Gold Strike. Three node terminal cuttings were soaked in 500 mL of 0.05, 0.25, or 0.50 mg·L-1 paclobutrazol or uniconazole solution for 2 h.

  13. Striking Inside Angola with 32 Battalion | Scheepers | Scientia ...

    African Journals Online (AJOL)

    Scientia Militaria: South African Journal of Military Studies. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 42, No 1 (2014) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register. Striking Inside Angola with 32 ...

  14. Force, reaction time, and precision of Kung Fu strikes.

    Science.gov (United States)

    Neto, Osmar Pinto; Bolander, Richard; Pacheco, Marcos Tadeu Tavares; Bir, Cynthia

    2009-08-01

    The goal was to compare values of force, precision, and reaction time of several martial arts punches and palm strikes performed by advanced and intermediate Kung Fu practitioners, both men and women. 13 Kung Fu practitioners, 10 men and three women, participated. Only the men, three advanced and seven intermediate, were considered for comparisons between levels. Reaction time values were obtained using two high speed cameras that recorded each strike at 2500 Hz. Force of impact was measured by a load cell. For comparisons of groups, force data were normalized by participant's body mass and height. Precision of the strikes was determined by a high speed pressure sensor. The results show that palm strikes were stronger than punches. Women in the study presented, on average, lower values of reaction time and force but higher values of precision than men. Advanced participants presented higher forces than intermediate participants. Significant negative correlations between the values of force and precision and the values of force and reaction time were also found.

  15. Computing Homology Group Generators of Images Using Irregular Graph Pyramids

    OpenAIRE

    Peltier , Samuel; Ion , Adrian; Haxhimusa , Yll; Kropatsch , Walter; Damiand , Guillaume

    2007-01-01

    International audience; We introduce a method for computing homology groups and their generators of a 2D image, using a hierarchical structure i.e. irregular graph pyramid. Starting from an image, a hierarchy of the image is built, by two operations that preserve homology of each region. Instead of computing homology generators in the base where the number of entities (cells) is large, we first reduce the number of cells by a graph pyramid. Then homology generators are computed efficiently on...

  16. Case Report: Mass Casualty Lightning Strike at Ranger Training Camp.

    Science.gov (United States)

    Thompson, Shannon N; Wilson, Zachary W; Cole, Christopher B; Kennedy, Andrew R; Aycock, Ryan D

    2017-05-01

    Although lightning strikes are a rare occurrence, their significance cannot be ignored given military operations in the field during all types of weather. With proper medical management, patients with lightning injuries can return to duty. Information for this case report comes from eyewitness account at the 6th Ranger Training Battalion and from review of physician documentation from the 96th Medical Group, Eglin Air Force Base, Florida. A lightning strike injured 44 Ranger School participants during a training exercise on August 12, 2015, at Camp Rudder, Florida. These patients were triaged in the field and transported to emergency department of Eglin Air Force Base. Of the 44 casualties, 20 were admitted. All were returned to duty the following day. One patient had cardiac arrest. This patient, along with two others, was admitted to the intensive care unit. Seventeen other patients were admitted for observation for rhabdomyolysis and/or cardiac arrhythmias. One patient was admitted with suspected acute kidney injury indicated by an elevated creatinine. All patients, including those admitted to the intensive care unit, were released on the day following the lightning strike without restrictions and were allowed to return to duty with increased medical monitoring. This case report highlights the need for proper triage and recognition of lightning strike injury, coordination of care between field operations and emergency department personnel, and close follow-up for patients presenting with lightning injury. Symptoms, physical exam, and laboratory findings from rigorous training can be difficult to distinguish from those resulting from lightning injury. Secondary injuries resulting from blunt trauma from falls may have been prevented by the use of the lightning strike posture. Further analysis of procedures and standard operating protocols to mitigate risk during thunderstorms may be required to prevent lightning's effects on large groups of military personnel

  17. Management of patients during hunger strike and refeeding phase.

    Science.gov (United States)

    Eichelberger, M; Joray, M L; Perrig, M; Bodmer, M; Stanga, Z

    2014-01-01

    Hunger strikers resuming nutritional intake may develop a life-threatening refeeding syndrome (RFS). Consequently, hunger strikers represent a core challenge for the medical staff. The objective of the study was to test the effectiveness and safety of evidence-based recommendations for prevention and management of RFS during the refeeding phase. This was a retrospective, observational data analysis of 37 consecutive, unselected cases of prisoners on a hunger strike during a 5-y period. The sample consisted of 37 cases representing 33 individual patients. In seven cases (18.9%), the hunger strike was continued during the hospital stay, in 16 episodes (43.2%) cessation of the hunger strike occurred immediately after admission to the security ward, and in 14 episodes (37.9%) during hospital stay. In the refeed cases (n = 30), nutritional replenishment occurred orally, and in 25 (83.3%) micronutrients substitutions were made based on the recommendations. The gradual refeeding with fluid restriction occurred over 10 d. Uncomplicated dyselectrolytemia was documented in 12 cases (40%) within the refeeding phase. One case (3.3%) presented bilateral ankle edemas as a clinical manifestation of moderate RFS. Intensive medical treatment was not necessary and none of the patients died. Seven episodes of continued hunger strike were observed during the entire hospital stay without medical complications. Our data suggested that seriousness and rate of medical complications during the refeeding phase can be kept at a minimum in a hunger strike population. This study supported use of recommendations to optimize risk management and to improve treatment quality and patient safety in this vulnerable population. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Of Horse-Caterpillars and Homologies: Evolution of the Hippocampus and Its Name.

    Science.gov (United States)

    Butler, Ann B

    2017-01-01

    The hippocampus was first named in mammals based on the appearance of its gross morphological features, one end of it being fancied to resemble the head of a horse and the rest of it a silkworm, or caterpillar. A hippocampus, occupying the most medial part of the telencephalic pallium, has subsequently been identified in diverse nonmammalian taxa, but in which the "horse-caterpillar" morphology is lacking. While some strikingly similar functional similarities have been identified, questions of its homology ("sameness") across these taxa and about the very fundamental relationship of structure to function in central nervous system structures remain open. The hippocampal formation of amniotes participates in allocentric (external landmark) spatial navigation, memory, and attention to novel stimuli, and these functions generally are shared across amniotes despite variation in its morphological features. Substantially greater deviation in its morphology occurs in anamniotes, including amphibians and ray-finned fishes (actinopterygians), but its functions of allocentric spatial navigation and/or memory have been found to be preserved by studies in these taxa. Its shared functional roles cannot be used as evidence of structural homology, but given that other criteria indicate homology of the medial pallial derivative across these clades, the similar functions themselves may be regarded as homologous functions if they are based on the same cellular mechanisms and connections. The question arises as to whether the similar functions are performed by as yet undiscovered, shared morphological features or by different features that accomplish the same results via different mechanisms of neural function. © 2017 S. Karger AG, Basel.

  19. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  20. Implications of Incessant Strike Actions on the Implementation of Technical Education Programme in Nigeria

    Science.gov (United States)

    Adavbiele, J. A.

    2015-01-01

    This paper was designed to x-ray the implications of incessant strike actions on the implementation of Technical education programme in Nigeria. The paper took an exploratory view on the concept of strike actions in Nigeria with particular references on notable strike actions that have occurred in Nigeria. The types of strike were explained and…

  1. Conservation of the three-dimensional structure in non-homologous or unrelated proteins

    Directory of Open Access Journals (Sweden)

    Sousounis Konstantinos

    2012-08-01

    Full Text Available Abstract In this review, we examine examples of conservation of protein structural motifs in unrelated or non-homologous proteins. For this, we have selected three DNA-binding motifs: the histone fold, the helix-turn-helix motif, and the zinc finger, as well as the globin-like fold. We show that indeed similar structures exist in unrelated proteins, strengthening the concept that three-dimensional conservation might be more important than the primary amino acid sequence.

  2. Isolation, sequence identification and tissue expression profile of a ...

    African Journals Online (AJOL)

    The complete expressed sequence tag (CDS) sequence of Banna mini-pig inbred line (BMI) ribokinase gene (RBKS) was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) based on the conserved sequence information of the cattle or other mammals and known highly homologous swine ESTs.

  3. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Pongo abelii, Macaca fascicularis, Mus musculus, Bos taurus and Rattus norvegicus are 93.1, 92.5, 92.2, 91.1, 90.6 and 90.0% respectively. The amino acid sequence encoded by RPS20 ...

  4. A PHF8 homolog in C. elegans promotes DNA repair via homologous recombination.

    Directory of Open Access Journals (Sweden)

    Changrim Lee

    Full Text Available PHF8 is a JmjC domain-containing histone demethylase, defects in which are associated with X-linked mental retardation. In this study, we examined the roles of two PHF8 homologs, JMJD-1.1 and JMJD-1.2, in the model organism C. elegans in response to DNA damage. A deletion mutation in either of the genes led to hypersensitivity to interstrand DNA crosslinks (ICLs, while only mutation of jmjd-1.1 resulted in hypersensitivity to double-strand DNA breaks (DSBs. In response to ICLs, JMJD-1.1 did not affect the focus formation of FCD-2, a homolog of FANCD2, a key protein in the Fanconi anemia pathway. However, the dynamic behavior of RPA-1 and RAD-51 was affected by the mutation: the accumulations of both proteins at ICLs appeared normal, but their subsequent disappearance was retarded, suggesting that later steps of homologous recombination were defective. Similar changes in the dynamic behavior of RPA-1 and RAD-51 were seen in response to DSBs, supporting a role of JMJD-1.1 in homologous recombination. Such a role was also supported by our finding that the hypersensitivity of jmjd-1.1 worms to ICLs was rescued by knockdown of lig-4, a homolog of Ligase 4 active in nonhomologous end-joining. The hypersensitivity of jmjd-1.1 worms to ICLs was increased by rad-54 knockdown, suggesting that JMJD-1.1 acts in parallel with RAD-54 in modulating chromatin structure. Indeed, the level of histone H3 Lys9 tri-methylation, a marker of heterochromatin, was higher in jmjd-1.1 cells than in wild-type cells. We conclude that the histone demethylase JMJD-1.1 influences homologous recombination either by relaxing heterochromatin structure or by indirectly regulating the expression of multiple genes affecting DNA repair.

  5. A novel mutation in TFL1 homolog affecting determinacy in cowpea (Vigna unguiculata).

    Science.gov (United States)

    Dhanasekar, P; Reddy, K S

    2015-02-01

    Mutations in the widely conserved Arabidopsis Terminal Flower 1 (TFL1) gene and its homologs have been demonstrated to result in determinacy across genera, the knowledge of which is lacking in cowpea. Understanding the molecular events leading to determinacy of apical meristems could hasten development of cowpea varieties with suitable ideotypes. Isolation and characterization of a novel mutation in cowpea TFL1 homolog (VuTFL1) affecting determinacy is reported here for the first time. Cowpea TFL1 homolog was amplified using primers designed based on conserved sequences in related genera and sequence variation was analysed in three gamma ray-induced determinate mutants, their indeterminate parent "EC394763" and two indeterminate varieties. The analyses of sequence variation exposed a novel SNP distinguishing the determinate mutants from the indeterminate types. The non-synonymous point mutation in exon 4 at position 1,176 resulted from transversion of cytosine (C) to adenine (A) leading to an amino acid change (Pro-136 to His) in determinate mutants. The effect of the mutation on protein function and stability was predicted to be detrimental using different bioinformatics/computational tools. The functionally significant novel substitution mutation is hypothesized to affect determinacy in the cowpea mutants. Development of suitable regeneration protocols in this hitherto recalcitrant crop and subsequent complementation assay in mutants or over-expressing assay in parents could decisively conclude the role of the SNP in regulating determinacy in these cowpea mutants.

  6. Homologous Circular-ribbon Flares Driven by Twisted Flux Emergence

    Science.gov (United States)

    Xu, Z.; Yang, K.; Guo, Y.; Zhao, J.; Zhao, Z. J.; Kashapova, L.

    2017-12-01

    In this paper, we report two homologous circular-ribbon flares associated with two filament eruptions. They were well observed by the New Vacuum Solar Telescope and the Solar Dynamics Observatory on 2014 March 5. Prior to the flare, two small-scale filaments enclosed by a circular pre-flare brightening lie along the circular polarity inversion line around the parasitic polarity, which has shown a continuous rotation since its first appearance. Two filaments eventually erupt in sequence associated with two homologous circular-ribbon flares and display an apparent writhing signature. Supplemented by the nonlinear force-free field extrapolation and the magnetic field squashing factor investigation, the following are revealed. (1) This event involves the emergence of magnetic flux ropes into a pre-existing polarity area, which yields the formation of a 3D null-point topology in the corona. (2) Continuous input of the free energy in the form of a flux rope from beneath the photosphere may drive a breakout-type reconnection occurring high in the corona, supported by the pre-flare brightening. (3) This initiation reconnection could release the constraint on the flux rope and trigger the MHD instability to first make filament F1 lose equilibrium. The subsequent more violent magnetic reconnection with the overlying flux is driven during the filament rising. In return, the eruption of filament F2 is further facilitated by the reduction of the magnetic tension force above. These two processes form a positive feedback to each other to cause the energetic mass eruption and flare.

  7. Function of Rad51 paralogs in eukaryotic homologous recombinational repair

    International Nuclear Information System (INIS)

    Liu, N.; Skowronek, K.

    2003-01-01

    Full text: Homologous recombinational repair (HRR) is an important mechanism for maintaining genetic integrity and cancer prevention by accurately repair of DNA double strand breaks induced by environmental insults or occurred in DNA replication. A critical step in HRR is the polymerization of Rad51 on single stranded DNA to form nuclear protein filaments, the later conduct DNA strand paring and exchange between homologous strands. A number of proteins, including replication protein A (RPA), Rad52 and Rad51 paralogs, are suggested to modulate or facilitate the process of Rad51 filament formation. Five Rad51 paralogs, namely XRCC2, XRCC3, Rad51B, Rad51C and Rad51D have been identified in eucaryotic cells. These proteins show distant protein sequence identity to Rad51, to yeast Rad51 paralogs (Rad55 and Rad57) and to each other. Hamster or chicken mutants of Rad51 paralogs exhibit hypersensitivity to a variety of DNA damaging agents, especially cross-linking agents, and are defective in assembly of Rad51 onto HRR site after DNA damage. Recent data from our and other labs showed that Rad51 paralogs constitute two distinct complexes in cell extracts, one contains XRCC2, Rad51B, Rad51C and Rad51D, and the other contains Rad51C and XRCC3. Rad51C is involved in both complexes. Our results also showed that XRCC3-Rad51C complex interacts with Rad51 in vivo. Furthermore, overexpression of Rad52 can partially suppress the hypersensitivity of XRCC2 mutant irs1 to ionizing radiation and corrected the defects in Rad51 focus formation. These results suggest that XRCC2 and other Rad51 paralogs play a mediator function to Rad51 in the early stage of HRR

  8. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  9. Homological Perturbation Theory for Nonperturbative Integrals

    Science.gov (United States)

    Johnson-Freyd, Theo

    2015-11-01

    We use the homological perturbation lemma to produce explicit formulas computing the class in the twisted de Rham complex represented by an arbitrary polynomial. This is a non-asymptotic version of the method of Feynman diagrams. In particular, we explain that phenomena usually thought of as particular to asymptotic integrals in fact also occur exactly: integrals of the type appearing in quantum field theory can be reduced in a totally algebraic fashion to integrals over an Euler-Lagrange locus, provided this locus is understood in the scheme-theoretic sense, so that imaginary critical points and multiplicities of degenerate critical points contribute.

  10. Remarkable rates of lightning strike mortality in Malawi.

    Directory of Open Access Journals (Sweden)

    Monique Borgerhoff Mulder

    Full Text Available Livingstone's second mission site on the shore of Lake Malawi suffers very high rates of consequential lightning strikes. Comprehensive interviewing of victims and their relatives in seven Traditional Authorities in Nkhata Bay District, Malawi revealed that the annual rate of consequential strikes was 419/million, more than six times higher than that in other developing countries; the rate of deaths from lightning was 84/million/year, 5.4 times greater than the highest ever recorded. These remarkable figures reveal that lightning constitutes a significant stochastic source of mortality with potential life history consequences, but it should not deflect attention away from the more prominent causes of mortality in this rural area.

  11. Legal questions surrounding hunger strikes by detainees and prisoners.

    Science.gov (United States)

    Strauss, S A

    1991-01-01

    The 'right to die' is not of an absolute character but is subject to definite qualification. There are legal and social interests reflecting profound ethical values which militate against an absolute right on the part of a prisoner to die by means of a hunger strike. The declared policy of the South African authorities is that a prisoner who resorts to a hunger strike may not be subjected to force-feeding. This is in accordance with the 1975 Tokyo Declaration. Unfortunately the Declaration is silent on the question of whether a doctor may provide medical treatment once a hunger striker has reached the point where he is no longer capable of rational thought. In this article it is submitted that a doctor would be legally entitled to do so.

  12. Single Station System and Method of Locating Lightning Strikes

    Science.gov (United States)

    Medelius, Pedro J. (Inventor); Starr, Stanley O. (Inventor)

    2003-01-01

    An embodiment of the present invention uses a single detection system to approximate a location of lightning strikes. This system is triggered by a broadband RF detector and measures a time until the arrival of a leading edge of the thunder acoustic pulse. This time difference is used to determine a slant range R from the detector to the closest approach of the lightning. The azimuth and elevation are determined by an array of acoustic sensors. The leading edge of the thunder waveform is cross-correlated between the various acoustic sensors in the array to determine the difference in time of arrival, AT. A set of AT S is used to determine the direction of arrival, AZ and EL. The three estimated variables (R, AZ, EL) are used to locate a probable point of the lightning strike.

  13. HUNGER STRIKES AND FORCE-FEEDING IN PRISONS

    Directory of Open Access Journals (Sweden)

    Radu-Florin GEAMĂNU

    2016-05-01

    Full Text Available This study will try to give an overview and assess the international and European standards regarding the management of hunger strikes. We will analyse the international and European standards regarding the force-feeding a prisoner on a hunger strike. The paper will focus on the study of the ECtHR judgements regarding the force-feeding of hunger strikers. Also, we will address the U.S. case and the force-feeding of prisoners which is considered to be, in certain cases, an act of torture based on the international human rights standards. To close with, the study will attempt to go through the recent developments in the Romanian legislation, analysing the legislation and its conformity with the European principles and recommendations, bearing in mind the prohibition, in absolute terms, of torture or inhuman or degrading treatment or punishment.

  14. Control of striking velocity by table tennis players.

    Science.gov (United States)

    Marinovic, Welber; Iizuka, Cristina Akiko; Freudenheim, Andrea Michele

    2004-12-01

    This study investigated how 7 skilled table tennis players controlled velocity of a forehand drive stroke when the ball's trajectory, velocity, and spin were modified. They hit a target in response to balls launched under four different conditions. The relative and absolute times used in the backswing phase showed no significant differences among conditions. When subjects hit fastballs, there was a significant change in the time required for them to reach the peak of velocity in the forward swing phase. In addition, players decreased the velocity of their strokes to hit fast-approaching balls. These results indicate that highly skilled table tennis players need to adjust the striking velocity and striking time (relative and absolute) required to reach the peak of velocity in the forward swing phase for these task modifications. Since they used slower movement velocities to hit faster-approaching balls, skilled table tennis players may override this speed-coupling process.

  15. Simulating Bird Strike on Aircraft Composite Wing Leading Edge.

    OpenAIRE

    Ericsson, Max

    2012-01-01

    In this master thesis project the possibility to model the response of a wing when subjected to bird strike using finite elements is analyzed. Since this transient event lasts only a few milliseconds the used solution method is explicit time integration. The wing is manufactured using carbon fiber laminate. Carbon fiber laminates have orthotropic material properties with different stiffness in different directions. Accordingly, there are damage mechanisms not considered when using metal that ...

  16. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

    Science.gov (United States)

    Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

    2016-11-01

    Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is

  17. Striking dynamics and kinetic properties of boxing and MMA gloves

    Directory of Open Access Journals (Sweden)

    Benjamin Lee

    2014-08-01

    Full Text Available With the growing popularity of Mixed Martial Arts (MMA as a competitive sport, questions regarding the dynamic response and properties of MMA gloves arise. High-energy impacts from punches are very similar to boxing yet MMA competition requires the use of 4 oz fingerless glove, compared to the larger full enclosure boxing glove. This work assessed the kinetic properties and strike dynamics of MMA gloves and compared findings with traditional boxing gloves. Gloves mounted on a molded fist were impacted repetitively on an instrumental anvil designed for impact, over a 5 hour period resulting in 10,000 continuous and consistent strikes. Kinetic data from impacts were sampled at the beginning of the data collection and subsequently every 30 minutes (every 1,000 strikes. MMA gloves produced 4-5 times greater peak force and 5 times faster load rate compared to the boxing glove. However, MMA gloves also showed signs of material fatigue, with peak force increasing by 35% and rate of loading increasing by 60% over the duration of the test. Boxing glove characteristics did deteriorate but to a lesser extent. In summary, the kinetic properties of MMA glove differed substantially from the boxing glove resulting in impacts characterized by higher peak forces and more rapid development of force. Material properties including stiffness and thickness play a role in the kinetic characteristics upon impact, and can be inferred to alter injury mechanisms of blunt force trauma.

  18. A preliminary 3D model for cytochrome P450 2D6 constructed by homology model building

    NARCIS (Netherlands)

    Koymans, L M; Vermeulen, N P; Baarslag, A; Donné-Op den Kelder, G M

    A homology model building study of cytochrome P450 2D6 has been carried out based on the crystal structure of cytochrome P450 101. The primary sequences of P450 101 and P450 2D6 were aligned by making use of an automated alignment procedure. This alignment was adjusted manually by matching

  19. Transient disruption of non-homologous end-joining facilitates targeted genome manipulations in the filamentous fungus Aspergillus nidulans

    DEFF Research Database (Denmark)

    Nielsen, Jakob Blæsbjerg; Nielsen, Michael Lynge; Mortensen, Uffe Hasbro

    2008-01-01

    We have developed a transiently disrupted nkuA system in Aspergillus nidulans for efficient gene targeting. The nkuA disruption was made by inserting a counter-selectable marker flanked by a direct repeat (DR) composed of nkuA sequences. In the disrupted state, the non-homologous end-joining (NHE...

  20. Cloning of human and mouse genes homologous to RAD52, a yeast gene involved in DNA repair and recombination.

    NARCIS (Netherlands)

    D.F.R. Muris; O.Y. Bezzubova (Olga); J-M. Buerstedde; K. Vreeken; A.S. Balajee; C.J. Osgood; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); K. Ostermann; H. Schmidt (Henning); A.T. Natarajan; J.C.J. Eeken; P.H.M. Lohmann (Paul); A. Pastink (Albert)

    1994-01-01

    textabstractThe RAD52 gene of Saccharomyces cerevisiae is required for recombinational repair of double-strand breaks. Using degenerate oligonucleotides based on conserved amino acid sequences of RAD52 and rad22, its counterpart from Schizosaccharomyces pombe, RAD52 homologs from man and mouse were

  1. Analysis of plastid DNA-like sequences within the nuclear genomes of higher plants.

    Science.gov (United States)

    Ayliffe, M A; Scott, N S; Timmis, J N

    1998-06-01

    A wide-ranging examination of plastid (pt)DNA sequence homologies within higher plant nuclear genomes (promiscuous DNA) was undertaken. Digestion with methylation-sensitive restriction enzymes and Southern analysis was used to distinguish plastid and nuclear DNA in order to assess the extent of variability of promiscuous sequences within and between plant species. Some species, such as Gossypium hirsutum (cotton), Nicotiana tabacum (tobacco), and Chenopodium quinoa, showed homogenity of these sequences, while intraspecific sequence variation was observed among different cultivars of Pisum sativum (pea), Hordeum vulgare (barley), and Triticum aestivum (wheat). Hypervariability of plastid sequence homologies was identified in the nuclear genomes of Spinacea oleracea (spinach) and Beta vulgaris (beet), in which individual plants were shown to possess a unique spectrum of nuclear sequences with ptDNA homology. This hypervariability apparently extended to somatic variation in B. vulgaris. No sequences with ptDNA homology were identified by this method in the nuclear genome of Arabidopsis thaliana.

  2. Extracellular Disulfide Bridges Serve Different Purposes in Two Homologous Chemokine Receptors, CCR1 and CCR5

    DEFF Research Database (Denmark)

    Rummel, Pia Cwarzko; Thiele, Stefanie; Hansen, Laerke Smidt

    2013-01-01

    interact with residues in the main binding crevice, we show that the 7TM-conserved bridge is essential for all types of ligand-mediated activation, whereas the chemokine-conserved bridge is dispensable for small-molecule activation in CCR1. However, in striking contrast to previous studies in other...... chemokine receptors, high affinity CCL3 chemokine binding was maintained in the absence of either bridge. In CCR5, the closest homolog to CCR1, a completely different dependency was observed as neither chemokine activation nor binding was retained in the absence of either bridge. In contrast, both bridges...... where dispensable for small-molecule activation. This indicates that CCR5 activity is independent of extracellular regions, whereas in CCR1, preserved folding of ECL2 is necessary for activation. These results indicate that conserved structural features in a receptor subgroup, does not necessarily...

  3. Back-translation for discovering distant protein homologies in the presence of frameshift mutations

    Directory of Open Access Journals (Sweden)

    Noé Laurent

    2010-01-01

    Full Text Available Abstract Background Frameshift mutations in protein-coding DNA sequences produce a drastic change in the resulting protein sequence, which prevents classic protein alignment methods from revealing the proteins' common origin. Moreover, when a large number of substitutions are additionally involved in the divergence, the homology detection becomes difficult even at the DNA level. Results We developed a novel method to infer distant homology relations of two proteins, that accounts for frameshift and point mutations that may have affected the coding sequences. We design a dynamic programming alignment algorithm over memory-efficient graph representations of the complete set of putative DNA sequences of each protein, with the goal of determining the two putative DNA sequences which have the best scoring alignment under a powerful scoring system designed to reflect the most probable evolutionary process. Our implementation is freely available at http://bioinfo.lifl.fr/path/. Conclusions Our approach allows to uncover evolutionary information that is not captured by traditional alignment methods, which is confirmed by biologically significant examples.

  4. Identification and Partial Characterization of Potential FtsL and FtsQ Homologs of Chlamydia

    Directory of Open Access Journals (Sweden)

    Scot P Ouellette

    2015-11-01

    Full Text Available Chlamydia is amongst the rare bacteria that lack the critical cell division protein FtsZ. By annotation, Chlamydia also lacks several other essential cell division proteins including the FtsLBQ complex that links the early (e.g. FtsZ and late (e.g. FtsI/Pbp3 components of the division machinery. Here, we report chlamydial FtsL and FtsQ homologs. Ct271 aligned well with E. coli FtsL and shared sequence homology with it, including a predicted leucine-zipper like motif. Based on in silico modeling, we show that Ct764 has structural homology to FtsQ in spite of little sequence similarity. Importantly, ct271/ftsL and ct764/ftsQ are present within all sequenced chlamydial genomes and are expressed during the replicative phase of the chlamydial developmental cycle, two key characteristics for a chlamydial cell division gene. GFP-Ct764 localized to the division septum of dividing transformed chlamydiae, and, importantly, over-expression inhibited chlamydial development. Using a bacterial two-hybrid approach, we show that Ct764 interacted with other components of the chlamydial division apparatus. However, Ct764 was not capable of complementing an E. coli FtsQ depletion strain in spite of its ability to interact with many of the same division proteins as E. coli FtsQ, suggesting that chlamydial FtsQ may function differently. We previously proposed that Chlamydia uses MreB and other rod-shape determining proteins as an alternative system for organizing the division site and its apparatus. Chlamydial FtsL and FtsQ homologs expand the number of identified chlamydial cell division proteins and suggest that Chlamydia has likely kept the late components of the division machinery while substituting the Mre system for the early components.

  5. Isolation, expression and evolution of FERTILIZATION INDEPENDENT ENDOSPERM homologs in Podostemaceae.

    Science.gov (United States)

    Khanduri, Priyanka; Sharma, Roopam; Bhat, Vishnu; Tandon, Rajesh

    2016-03-01

    Podostemaceae is an interesting family of angiosperms with unusual development and morphology. Among these, double fertilization, a defining feature of angiosperms is invariably missing in the family. Consequently, embryo development in the seeds takes place without endosperm. In recent years, the role of polycomb genes has garnered much interest because of their crucial role in seed development. Some of these genes have been reported from many unrelated species, underlining their high conservation. Thus, it becomes exciting to know the role of these genes in podostemads, which are devoid of double fertilization and endosperm. Here, we report the isolation, characterization and expression patterns of homologs of Fertilization Independent Endosperm (FIE) in two species of Podostemaceae, Zeylanidium olivaceum and Polypleurum stylosum. FIE like homologs could be identified in Z. olivaceum (ZoFIE) and P. stylosum (PsFIE). The predicted amino acid sequence of FIE homologs showed similarity to other homologs, containing the conserved seven WD40 repeats. Expression studies revealed that ZoFIE and PsFIE transcripts were present in the vegetative tissue (thallus in Podostemaceae) and the seedlings, similar to the model plants. However, the ZoFIE and PsFIE expression disappeared in the flowering stages. This unique pattern of expression suggests that in the absence of double fertilization and endosperm the expression of FIS complex genes perhaps is obliterated in Podostemaceae.

  6. Impact of template choice on homology model efficiency in virtual screening.

    Science.gov (United States)

    Rataj, Krzysztof; Witek, Jagna; Mordalski, Stefan; Kosciolek, Tomasz; Bojarski, Andrzej J

    2014-06-23

    Homology modeling is a reliable method of predicting the three-dimensional structures of proteins that lack NMR or X-ray crystallographic data. It employs the assumption that a structural resemblance exists between closely related proteins. Despite the availability of many crystal structures of possible templates, only the closest ones are chosen for homology modeling purposes. To validate the aforementioned approach, we performed homology modeling of four serotonin receptors (5-HT1AR, 5-HT2AR, 5-HT6R, 5-HT7R) for virtual screening purposes, using 10 available G-Protein Coupled Receptors (GPCR) templates with diverse evolutionary distances to the targets, with various approaches to alignment construction and model building. The resulting models were further validated in two steps by means of ligand docking and enrichment calculation, using Glide software. The final quality of the models was determined in virtual screening-like experiments by the AUROC score of the resulting ROC curves. The outcome of this research showed that no correlation between sequence identity and model quality was found, leading to the conclusion that the closest phylogenetic relative is not always the best template for homology modeling.

  7. Functional organization of an Mbp enhancer exposes striking transcriptional regulatory diversity within myelinating glia

    DEFF Research Database (Denmark)

    Dionne, Nancy; Dib, Samar; Finsen, Bente

    2016-01-01

    In mammals, large caliber axons are ensheathed by myelin, a glial specialization supporting axon integrity and conferring accelerated and energy-efficient action potential conduction. Myelin basic protein (MBP) is required for normal myelin elaboration with maximal mbp transcription...... regulatory element combinations were found to drive expression in oligodendrocytes and Schwann cells with a minimal 129 bp sequence conferring expression in oligodendrocytes throughout myelin elaboration, maintenance and repair. Unexpectedly, M3 derivatives conferred markedly different spatial and temporal...... expression programs thus illuminating striking transcriptional heterogeneity within post-mitotic oligodendrocytes. Finally, one M3 derivative engaged only during primary myelination, not during adult remyelination, demonstrating that transcriptional regulation in the two states is not equivalent. GLIA 2015....

  8. Apparent homology of expressed genes from wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana.

    Science.gov (United States)

    Kirst, Matias; Johnson, Arthur F; Baucom, Christie; Ulrich, Erin; Hubbard, Kristy; Staggs, Rod; Paule, Charles; Retzel, Ernest; Whetten, Ross; Sederoff, Ronald

    2003-06-10

    Pinus taeda L. (loblolly pine) and Arabidopsis thaliana differ greatly in form, ecological niche, evolutionary history, and genome size. Arabidopsis is a small, herbaceous, annual dicotyledon, whereas pines are large, long-lived, coniferous forest trees. Such diverse plants might be expected to differ in a large number of functional genes. We have obtained and analyzed 59,797 expressed sequence tags (ESTs) from wood-forming tissues of loblolly pine and compared them to the gene sequences inferred from the complete sequence of the Arabidopsis genome. Approximately 50% of pine ESTs have no apparent homologs in Arabidopsis or any other angiosperm in public databases. When evaluated by using contigs containing long, high-quality sequences, we find a higher level of apparent homology between the inferred genes of these two species. For those contigs 1,100 bp or longer, approximately 90% have an apparent Arabidopsis homolog (E value < 10-10). Pines and Arabidopsis last shared a common ancestor approximately 300 million years ago. Few genes would be expected to retain high sequence similarity for this time if they did not have essential functions. These observations suggest substantial conservation of gene sequence in seed plants.

  9. Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2015-05-01

    Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

  10. Regulation of Homologous Recombination by SUMOylation

    DEFF Research Database (Denmark)

    Pinela da Silva, Sonia Cristina

    , deletions, and genome rearrangements that can lead to cell death or cancer in humans. The post-translational modification by SUMO (small ubiquitinlike modifier) has proven to be an important regulator of HR and genome integrity, but the molecular mechanisms responsible for these roles are still unclear......Double-strand breaks (DSBs) are one of the most deleterious types of DNA lesions challenging genome integrity. The DNA damage response (DDR) promotes fast and effective detection and repair of the damaged DNA, leading to cell cycle arrest through checkpoint activation and the recruitment of repair...... factors such as the homologous recombination (HR) machinery. HR constitutes the main DSB repair pathway in Saccharomyces cerevisiae and despite being largely considered an error-free process and essential for genome stability, uncontrolled recombination can lead to loss of heterozygosity, translocations...

  11. More on homological supersymmetric quantum mechanics

    Science.gov (United States)

    Behtash, Alireza

    2018-03-01

    In this work, we first solve complex Morse flow equations for the simplest case of a bosonic harmonic oscillator to discuss localization in the context of Picard-Lefschetz theory. We briefly touch on the exact non-BPS solutions of the bosonized supersymmetric quantum mechanics on algebraic geometric grounds and report that their complex phases can be accessed through the cohomology of WKB 1-form of the underlying singular spectral curve subject to necessary cohomological corrections for nonzero genus. Motivated by Picard-Lefschetz theory, we write down a general formula for the index of N =4 quantum mechanics with background R -symmetry gauge fields. We conjecture that certain symmetries of the refined Witten index and singularities of the moduli space may be used to determine the correct intersection coefficients. A few examples, where this conjecture holds, are shown in both linear and closed quivers with rank-one quiver gauge groups. The R -anomaly removal along the "Morsified" relative homology cycles also called "Lefschetz thimbles" is shown to lead to the appearance of Stokes lines. We show that the Fayet-Iliopoulos parameters appear in the intersection coefficients for the relative homology of the quiver quantum mechanics resulting from dimensional reduction of 2 d N =(2 ,2 ) gauge theory on a circle and explicitly calculate integrals along the Lefschetz thimbles in N =4 C Pk -1 model. The Stokes jumping of coefficients and its relation to wall crossing phenomena is briefly discussed. We also find that the notion of "on-the-wall" index is related to the invariant Lefschetz thimbles under Stokes phenomena. An implication of the Lefschetz thimbles in constructing knots from quiver quantum mechanics is indicated.

  12. Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement

    International Nuclear Information System (INIS)

    Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.

    1987-01-01

    cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells

  13. Automatic sequences

    CERN Document Server

    Haeseler, Friedrich

    2003-01-01

    Automatic sequences are sequences which are produced by a finite automaton. Although they are not random they may look as being random. They are complicated, in the sense of not being not ultimately periodic, they may look rather complicated, in the sense that it may not be easy to name the rule by which the sequence is generated, however there exists a rule which generates the sequence. The concept automatic sequences has special applications in algebra, number theory, finite automata and formal languages, combinatorics on words. The text deals with different aspects of automatic sequences, in particular:· a general introduction to automatic sequences· the basic (combinatorial) properties of automatic sequences· the algebraic approach to automatic sequences· geometric objects related to automatic sequences.

  14. Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner

    OpenAIRE

    Checchi, Paula M.; Engebrecht, JoAnne

    2011-01-01

    Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

  15. A local homology theory for linearly compact modules

    International Nuclear Information System (INIS)

    Nguyen Tu Cuong; Tran Tuan Nam

    2004-11-01

    We introduce a local homology theory for linearly modules which is in some sense dual to the local cohomology theory of A. Grothendieck. Some basic properties of local homology modules are shown such as: the vanishing and non-vanishing, the noetherianness of local homology modules. By using duality, we extend some well-known results in theory of local cohomology of A. Grothendieck. (author)

  16. Automatic Prediction of Protein 3D Structures by Probabilistic Multi-template Homology Modeling.

    Science.gov (United States)

    Meier, Armin; Söding, Johannes

    2015-10-01

    Homology modeling predicts the 3D structure of a query protein based on the sequence alignment with one or more template proteins of known structure. Its great importance for biological research is owed to its speed, simplicity, reliability and wide applicability, covering more than half of the residues in protein sequence space. Although multiple templates have been shown to generally increase model quality over single templates, the information from multiple templates has so far been combined using empirically motivated, heuristic approaches. We present here a rigorous statistical framework for multi-template homology modeling. First, we find that the query proteins' atomic distance restraints can be accurately described by two-component Gaussian mixtures. This insight allowed us to apply the standard laws of probability theory to combine restraints from multiple templates. Second, we derive theoretically optimal weights to correct for the redundancy among related templates. Third, a heuristic template selection strategy is proposed. We improve the average GDT-ha model quality score by 11% over single template modeling and by 6.5% over a conventional multi-template approach on a set of 1000 query proteins. Robustness with respect to wrong constraints is likewise improved. We have integrated our multi-template modeling approach with the popular MODELLER homology modeling software in our free HHpred server http://toolkit.tuebingen.mpg.de/hhpred and also offer open source software for running MODELLER with the new restraints at https://bitbucket.org/soedinglab/hh-suite.

  17. The C. elegans Crumbs family contains a CRB3 homolog and is not essential for viability

    Directory of Open Access Journals (Sweden)

    Selma Waaijers

    2015-02-01

    Full Text Available Crumbs proteins are important regulators of epithelial polarity. In C. elegans, no essential role for the two described Crumbs homologs has been uncovered. Here, we identify and characterize an additional Crumbs family member in C. elegans, which we termed CRB-3 based on its similarity in size and sequence to mammalian CRB3. We visualized CRB-3 subcellular localization by expressing a translational GFP fusion. CRB-3::GFP was expressed in several polarized tissues in the embryo and larval stages, and showed apical localization in the intestine and pharynx. To identify the function of the Crumbs family in C. elegans development, we generated a triple Crumbs deletion mutant by sequentially removing the entire coding sequence for each crumbs homolog using a CRISPR/Cas9-based approach. Remarkably, animals lacking all three Crumbs homologs are viable and show normal epithelial polarity. Thus, the three C. elegans Crumbs family members do not appear to play an essential role in epithelial polarity establishment.

  18. Colored Kauffman homology and super-A-polynomials

    International Nuclear Information System (INIS)

    Nawata, Satoshi; Ramadevi, P.; Zodinmawia

    2014-01-01

    We study the structural properties of colored Kauffman homologies of knots. Quadruple-gradings play an essential role in revealing the differential structure of colored Kauffman homology. Using the differential structure, the Kauffman homologies carrying the symmetric tensor products of the vector representation for the trefoil and the figure-eight are determined. In addition, making use of relations from representation theory, we also obtain the HOMFLY homologies colored by rectangular Young tableaux with two rows for these knots. Furthermore, the notion of super-A-polynomials is extended in order to encompass two-parameter deformations of PSL(2,ℂ) character varieties

  19. Homology among tet determinants in conjugative elements of streptococci

    Energy Technology Data Exchange (ETDEWEB)

    Smith, M.D.; Hazum, S.; Guild, W.R.

    1981-10-01

    A mutation to tetracycline sensitivity in a resistant strain of Streptococcus pneumoniae was shown by several criteria to be due to a point mutation in the conjugative o(cat-tet) element found in the chromosomes of strains derived from BM6001, a clinical strain resistant to tetracycline and chloramphenicol. Strains carrying the mutation were transformed back to tetracycline resistance with the high efficiency of a point marker by donor deoxyribonucleic acids from its ancestral strain and from nine other clinical isolates of pneumococcus and by deoxyribonucleic acids from Group D Streptococcus faecalis and Group B Streptococcus agalactiae strains that also carry conjugative tet elements in their chromosomes. It was not transformed to resistance by tet plasmid deoxyribonucleic acids from either gram-negative or gram-positive species, except for one that carried transposon TN916, the conjugative tet element present in the chromosomes of some S. faecalis strains. The results showed that the tet determinants in conjugative elements of several streptococcal species share a high degree of deoxyribonucleic acid sequence homology and suggested that they differ from other tet genes.

  20. Homologous plasmid recombination is elevated in immortally transformed cells.

    Science.gov (United States)

    Finn, G K; Kurz, B W; Cheng, R Z; Shmookler Reis, R J

    1989-09-01

    The levels of intramolecular plasmid recombination, following transfection of a plasmid substrate for homologous recombination into normal and immortally transformed cells, have been examined by two independent assays. In the first assay, recovered plasmid was tested for DNA rearrangements which regenerate a functional neomycin resistance gene from two overlapping fragments. Following transformation of bacteria, frequencies of recombinationlike events were determined from the ratio of neomycin-resistant (recombinant) colonies to ampicillin-resistant colonies (indicating total plasmid recovery). Such events, yielding predominantly deletions between the directly repeated sequences, were substantially more frequent in five immortal cell lines than in any of three normal diploid cell strains tested. Effects of plasmid replication or interaction with T antigen and of bacterially mediated rejoining of linear molecules generated in mammalian cells were excluded by appropriate controls. The second assay used limited coamplification of a control segment of plasmid DNA, and of the predicted recombinant DNA region, primed by two sets of flanking oligonucleotides. Each amplified band was quantitated by reference to a near-linear standard curve generated concurrently, and recombination frequencies were determined from the ratio of recombinant/control DNA regions. The results confirmed that recombinant DNA structures were generated within human cells at direct repeats in the transfected plasmid and were markedly more abundant in an immortal cell line than in the diploid normal cells from which that line was derived.

  1. Ecological genomics in Xanthomonas: the nature of genetic adaptation with homologous recombination and host shifts

    KAUST Repository

    Huang, Chao-Li

    2015-03-15

    Background: Comparative genomics provides insights into the diversification of bacterial species. Bacterial speciation usually takes place with lasting homologous recombination, which not only acts as a cohering force between diverging lineages but brings advantageous alleles favored by natural selection, and results in ecologically distinct species, e.g., frequent host shift in Xanthomonas pathogenic to various plants. Results: Using whole-genome sequences, we examined the genetic divergence in Xanthomonas campestris that infected Brassicaceae, and X. citri, pathogenic to a wider host range. Genetic differentiation between two incipient races of X. citri pv. mangiferaeindicae was attributable to a DNA fragment introduced by phages. In contrast to most portions of the genome that had nearly equivalent levels of genetic divergence between subspecies as a result of the accumulation of point mutations, 10% of the core genome involving with homologous recombination contributed to the diversification in Xanthomonas, as revealed by the correlation between homologous recombination and genomic divergence. Interestingly, 179 genes were under positive selection; 98 (54.7%) of these genes were involved in homologous recombination, indicating that foreign genetic fragments may have caused the adaptive diversification, especially in lineages with nutritional transitions. Homologous recombination may have provided genetic materials for the natural selection, and host shifts likely triggered ecological adaptation in Xanthomonas. To a certain extent, we observed positive selection nevertheless contributed to ecological divergence beyond host shifting. Conclusion: Altogether, mediated with lasting gene flow, species formation in Xanthomonas was likely governed by natural selection that played a key role in helping the deviating populations to explore novel niches (hosts) or respond to environmental cues, subsequently triggering species diversification. © Huang et al.

  2. FBH1 helicase disrupts RAD51 filaments in vitro and modulates homologous recombination in mammalian cells

    DEFF Research Database (Denmark)

    Simandlova, Jitka; Zagelbaum, Jennifer; Payne, Miranda J

    2013-01-01

    Efficient repair of DNA double strand breaks and interstrand cross-links requires the homologous recombination (HR) pathway, a potentially error-free process that utilizes a homologous sequence as a repair template. A key player in HR is RAD51, the eukaryotic ortholog of bacterial RecA protein. RAD....... Using a combination of molecular genetic, biochemical, and single-molecule biophysical techniques, we provide mechanistic insight into the mode of action of the FBH1 helicase as a regulator of RAD51-dependent HR in mammalian cells. We show that FBH1 binds directly to RAD51 and is able to disrupt RAD51...... filaments on DNA through its ssDNA translocase function. Consistent with this, a mutant mouse embryonic stem cell line with a deletion in the FBH1 helicase domain fails to limit RAD51 chromatin association and shows hyper-recombination. Our data are consistent with FBH1 restraining RAD51 DNA binding under...

  3. A superfamily of archaeal, bacterial, and eukaryotic proteins homologous to animal transglutaminases.

    Science.gov (United States)

    Makarova, K S; Aravind, L; Koonin, E V

    1999-08-01

    Computer analysis using profiles generated by the PSI-BLAST program identified a superfamily of proteins homologous to eukaryotic transglutaminases. The members of the new protein superfamily are found in all archaea, show a sporadic distribution among bacteria, and were detected also in eukaryotes, such as two yeast species and the nematode Caenorhabditis elegans. Sequence conservation in this superfamily primarily involves three motifs that center around conserved cysteine, histidine, and aspartate residues that form the catalytic triad in the structurally characterized transglutaminase, the human blood clotting factor XIIIa'. On the basis of the experimentally demonstrated activity of the Methanobacterium phage pseudomurein endoisopeptidase, it is proposed that many, if not all, microbial homologs of the transglutaminases are proteases and that the eukaryotic transglutaminases have evolved from an ancestral protease.

  4. Enzyme discovery beyond homology: a unique hydroxynitrile lyase in the Bet v1 superfamily

    Science.gov (United States)

    Lanfranchi, Elisa; Pavkov-Keller, Tea; Koehler, Eva-Maria; Diepold, Matthias; Steiner, Kerstin; Darnhofer, Barbara; Hartler, Jürgen; van den Bergh, Tom; Joosten, Henk-Jan; Gruber-Khadjawi, Mandana; Thallinger, Gerhard G.; Birner-Gruenberger, Ruth; Gruber, Karl; Winkler, Margit; Glieder, Anton

    2017-05-01

    Homology and similarity based approaches are most widely used for the identification of new enzymes for biocatalysis. However, they are not suitable to find truly novel scaffolds with a desired function and this averts options and diversity. Hydroxynitrile lyases (HNLs) are an example of non-homologous isofunctional enzymes for the synthesis of chiral cyanohydrins. Due to their convergent evolution, finding new representatives is challenging. Here we show the discovery of unique HNL enzymes from the fern Davallia tyermannii by coalescence of transcriptomics, proteomics and enzymatic screening. It is the first protein with a Bet v1-like protein fold exhibiting HNL activity, and has a new catalytic center, as shown by protein crystallography. Biochemical properties of D. tyermannii HNLs open perspectives for the development of a complementary class of biocatalysts for the stereoselective synthesis of cyanohydrins. This work shows that systematic integration of -omics data facilitates discovery of enzymes with unpredictable sequences and helps to extend our knowledge about enzyme diversity.

  5. PSpice Model of Lightning Strike to a Steel Reinforced Structure

    International Nuclear Information System (INIS)

    Koone, Neil; Condren, Brian

    2003-01-01

    Surges and arcs from lightning can pose hazards to personnel and sensitive equipment, and processes. Steel reinforcement in structures can act as a Faraday cage mitigating lightning effects. Knowing a structure's response to a lightning strike allows hazards associated with lightning to be analyzed. A model of lightning's response in a steel reinforced structure has been developed using PSpice (a commercial circuit simulation). Segments of rebar are modeled as inductors and resistors in series. A program has been written to take architectural information of a steel reinforced structure and 'build' a circuit network that is analogous to the network of reinforcement in a facility. A severe current waveform (simulating a 99th percentile lightning strike), modeled as a current source, is introduced in the circuit network, and potential differences within the structure are determined using PSpice. A visual three-dimensional model of the facility displays the voltage distribution across the structure using color to indicate the potential difference relative to the floor. Clear air arcing distances can be calculated from the voltage distribution using a conservative value for the dielectric breakdown strength of air. Potential validation tests for the model will be presented

  6. Recent geodynamics of major strike-slip zones

    Directory of Open Access Journals (Sweden)

    Vladimir G. Trifonov

    2015-09-01

    In all of the cases mentioned above, strike-slip deformation was expressed only or mainly during strong earthquakes. At other times, the rate of its accumulation was small and the dominant stress conditions led to transverse shortening, rarely resulting in local lengthening of the tectonic zone. These variations are caused by the tectonic peculiarities of these zones. The sinistral component of the deformation is related to the shift of the Arabian Plate relative to the African one, but also the transverse component is related to the continental slope and is expressed by the Coastal range shortening that exists in the El Ghab segment zone. There is not only a dextral deformation component, but also a transverse component, expressed by shortening of the Fergana and Talas ranges existing in the Talas-Fergana fault zone. In both zones, the shortening component became appreciable or dominant when the strike-slip deformation rate decreased. Similar, but more local, relationships were expressed in the epicentral area of the 2003 Altai earthquake and in the Western Palmyrides.

  7. Onset of aseismic creep on major strike-slip faults

    KAUST Repository

    Çakir, Ziyadin

    2012-10-02

    Time series analysis of spaceborne synthetic aperture radar (SAR) data, GPS measurements, and fi eld observations reveal that the central section of the Izmit (Turkey) fault that slipped with a supershear rupture velocity in the A.D. 1999, Mw7.4, Izmit earthquake began creeping aseismically following the earthquake. Rapid initial postseismic afterslip decayed logarithmically with time and appears to have reached a steady rate comparable to the preearthquake full fault-crossing rate, suggesting that it may continue for decades and possibly until late in the earthquake cycle. If confi rmed by future monitoring, these observations identify postseismic afterslip as a mechanism for initiating creep behavior along strike-slip faults. Long-term afterslip and/or creep has signifi cant implications for earthquake cycle models, recurrence intervals of large earthquakes, and accordingly, seismic hazard estimation along mature strike-slip faults, in particular for Istanbul which is believed to lie adjacent to a seismic gap along the North Anatolian fault in the Sea of Marmara. © 2012 Geological Society of America.

  8. Influence of strike object grounding on close lightning electric fields

    Science.gov (United States)

    Baba, Yoshihiro; Rakov, Vladimir A.

    2008-06-01

    Using the finite difference time domain (FDTD) method, we have calculated vertical electric field Ez, horizontal (radial) electric field Eh, and azimuthal magnetic field Hϕ produced on the ground surface by lightning strikes to 160-m- and a 553-m-high conical strike objects representing the Peissenberg tower (Germany) and the CN Tower (Canada), respectively. The fields were computed for a typical subsequent stroke at distances d' from the bottom of the object ranging from 5 to 100 m for the 160-m tower and from 10 to 300 m for the 553-m tower. Grounding of the 160-m object was assumed to be accomplished by its underground basement represented by a 10-m-radius and 8-m-long perfectly conducting cylinder with or without a reference ground plane located 2 m below. The reference ground plane simulates, to some extent, a higher-conducting ground layer that is expected to exist below the water table. The configuration without reference ground plane actually means that this plane is present, but is located at an infinitely large depth. Grounding of the 553-m object was modeled in a similar manner but in the absence of reference ground plane only. In all cases considered, waveforms of Eh and Hϕ are not much influenced by the presence of strike object, while waveforms of Ez are. Waveforms of Ez are essentially unipolar (as they are in the absence of strike object) when the ground conductivity σ is 10 mS/m (the equivalent transient grounding impedance is several ohms) or greater. Thus, for the CN Tower, for which σ ≥ 10 mS/m, the occurrence of Ez polarity change is highly unlikely. For the 160-m tower and for σ = 1 and 0.1 mS/m, waveforms of Ez become bipolar (exhibit polarity change) at d' ≤ 10 m and d' ≤ 50 m, respectively, regardless of the presence of the reference ground plane. The corresponding equivalent transient grounding impedances are about 30 and 50 Ω in the absence of the reference ground plane and smaller than 10 Ω in the presence of the reference

  9. Three Replicons of Rhizobium sp. Strain NGR234 Harbor Symbiotic Gene Sequences

    Science.gov (United States)

    Flores, Margarita; Mavingui, Patrick; Girard, Lourdes; Perret, Xavier; Broughton, William J.; Martínez-Romero, Esperanza; Dávila, Guillermo; Palacios, Rafael

    1998-01-01

    Rhizobium sp. strain NGR234 contains three replicons: the symbiotic plasmid or pNGR234a, a megaplasmid (pNGR234b), and the chromosome. Symbiotic gene sequences not present in pNGR234a were analyzed by hybridization. DNA sequences homologous to the genes fixLJKNOPQGHIS were found on the chromosome, while sequences homologous to nodPQ and exoBDFLK were found on pNGR234b. PMID:9811668

  10. The Diffusion of Strikes: A Dyadic Analysis of Economic Sectors in the Netherlands, 1995–2007

    NARCIS (Netherlands)

    Jansen, Giedo; Sluiter, Roderick; Akkerman, Agnes

    2016-01-01

    This study examines the extent to which strikes diffuse across sectors and to what extent this diffusion of strikes can be explained by similarities and interdependencies between sectors. For this purpose, the authors examine a unique temporally disaggregated and dyadic database on strikes in Dutch

  11. The Right to Strike in Public Employment. Key Issues Series--No. 15. Second Edition, Revised.

    Science.gov (United States)

    Sterret, Grace; Aboud, Antone

    Since the 1960s, the number of strikes by public employees, especially local government employees, has increased, and the number of employees belonging to unions or associations has about tripled. Recently, attention has been focused on strikes by public employees as a result of the strike in 1981 by air traffic controllers and their subsequent…

  12. Causes of falls of hangingwall over gullies adjacent to stabilizing strike pillars

    CSIR Research Space (South Africa)

    Turner, PA

    1987-08-01

    Full Text Available This report discusses the occurrence of falls of ground in strike gullies. Falls of hangingwall over strike gullies on the up-dip side of strike stabilizing pillars in longwall mining systems were investigated. Gullies were examined in both...

  13. Strikes in France and the Netherlands; A Comparison of Labour Market Institutions

    NARCIS (Netherlands)

    Butter, den F.A.G.; Koppes, S.Y.

    2003-01-01

    Strikes as a consequence of labour conflicts occur about 28 times as much in France as in the Netherlands. This paper examines the institutional differences underlying these differences in strike activity. Our empirical analysis shows that strike activity is high in France if workers were successful

  14. GPCR-SSFE: A comprehensive database of G-protein-coupled receptor template predictions and homology models

    Directory of Open Access Journals (Sweden)

    Kreuchwig Annika

    2011-05-01

    Full Text Available Abstract Background G protein-coupled receptors (GPCRs transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Description Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. Conclusions The data provided by GPCR-SSFE are useful for investigating

  15. GPCR-SSFE: a comprehensive database of G-protein-coupled receptor template predictions and homology models.

    Science.gov (United States)

    Worth, Catherine L; Kreuchwig, Annika; Kleinau, Gunnar; Krause, Gerd

    2011-05-23

    G protein-coupled receptors (GPCRs) transduce a wide variety of extracellular signals to within the cell and therefore have a key role in regulating cell activity and physiological function. GPCR malfunction is responsible for a wide range of diseases including cancer, diabetes and hyperthyroidism and a large proportion of drugs on the market target these receptors. The three dimensional structure of GPCRs is important for elucidating the molecular mechanisms underlying these diseases and for performing structure-based drug design. Although structural data are restricted to only a handful of GPCRs, homology models can be used as a proxy for those receptors not having crystal structures. However, many researchers working on GPCRs are not experienced homology modellers and are therefore unable to benefit from the information that can be gleaned from such three-dimensional models. Here, we present a comprehensive database called the GPCR-SSFE, which provides initial homology models of the transmembrane helices for a large variety of family A GPCRs. Extending on our previous theoretical work, we have developed an automated pipeline for GPCR homology modelling and applied it to a large set of family A GPCR sequences. Our pipeline is a fragment-based approach that exploits available family A crystal structures. The GPCR-SSFE database stores the template predictions, sequence alignments, identified sequence and structure motifs and homology models for 5025 family A GPCRs. Users are able to browse the GPCR dataset according to their pharmacological classification or search for results using a UniProt entry name. It is also possible for a user to submit a GPCR sequence that is not contained in the database for analysis and homology model building. The models can be viewed using a Jmol applet and are also available for download along with the alignments. The data provided by GPCR-SSFE are useful for investigating general and detailed sequence-structure-function relationships

  16. The 2016 Kumamoto earthquake sequence.

    Science.gov (United States)

    Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.

  17. The 2016 Kumamoto earthquake sequence

    Science.gov (United States)

    KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474

  18. The Causes of Quasi-homologous CMEs

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Lijuan; Wang, Yuming; Liu, Rui; Zhou, Zhenjun; Liu, Jiajia; Liu, Kai; Shen, Chenglong; Zhang, Quanhao [CAS Key Laboratory of Geospace Environment, Department of Geophysics and Planetary Sciences, University of Science and Technology of China, Hefei, Anhui, 230026 (China); Temmer, M.; Thalmann, J. K.; Veronig, A. M., E-mail: ymwang@ustc.edu.cn, E-mail: ljliu@mail.ustc.edu.cn [Institute of Physics/IGAM, University of Graz, Universitätsplatz 5/II, A-8010 Graz (Austria)

    2017-08-01

    In this paper, we identified the magnetic source locations of 142 quasi-homologous (QH) coronal mass ejections (CMEs), of which 121 are from solar cycle (SC) 23 and 21 from SC 24. Among those CMEs, 63% originated from the same source location as their predecessor (defined as S-type), while 37% originated from a different location within the same active region as their predecessor (defined as D-type). Their distinctly different waiting time distributions, peaking around 7.5 and 1.5 hr for S- and D-type CMEs, suggest that they might involve different physical mechanisms with different characteristic timescales. Through detailed analysis based on nonlinear force-free coronal magnetic field modeling of two exemplary cases, we propose that the S-type QH CMES might involve a recurring energy release process from the same source location (by magnetic free energy replenishment), whereas the D-type QH CMEs can happen when a flux tube system is disturbed by a nearby CME.

  19. Controlling PTEN (Phosphatase and Tensin Homolog) Stability

    Science.gov (United States)

    Gupta, Amit

    2016-01-01

    Phosphatase and tensin homolog (PTEN) is a phosphoinositide lipid phosphatase and one of the most frequently disrupted tumor suppressors in many forms of cancer, with even small reductions in the expression levels of PTEN promoting cancer development. Although the post-translational ubiquitination of PTEN can control its stability, activity, and localization, a detailed understanding of how PTEN ubiquitination integrates with other cellular regulatory processes and may be dysregulated in cancer has been hampered by a poor understanding of the significance of ubiquitination at individual sites. Here we show that Lys66 is not required for cellular activity, yet dominates over other PTEN ubiquitination sites in the regulation of protein stability. Notably, combined mutation of other sites (Lys13, Lys80, and Lys289) has relatively little effect on protein expression, protein stability, or PTEN polyubiquitination. The present work identifies a key role for Lys66 in the regulation of PTEN expression and provides both an opportunity to improve the stability of PTEN as a protein therapy and a mechanistic basis for efforts to stabilize endogenous PTEN. PMID:27405757

  20. Dynamic protein assemblies in homologous recombination with single DNA molecules

    NARCIS (Netherlands)

    van der Heijden, A.H.

    2007-01-01

    What happens when your DNA breaks? This thesis describes experimental work on the single-molecule level focusing on the interaction between DNA and DNA-repair proteins, in particular bacterial RecA and human Rad51, involved in homologous recombination. Homologous recombination and its central event

  1. Induction of osteogenesis by demineralized homologous and xenograft bone matrix

    Directory of Open Access Journals (Sweden)

    Dall'Agnol Rosiris

    2003-01-01

    Full Text Available The osteogenesis induction by demineralized bone matrix grafts remains as a challenge in the reconstructions of the mandible through homologous and xenografts or in implants in abdominal muscle. PURPOSE: Observed the behaviour of implants of demineralized bone matrix at the mandible (right side with homologous graft and left side with xenograft of pig. METHODS: Experimental study with homologous and heterologous implants of demineralized bone matrix at the mandible and in ectopic muscle at the Center of Experimental Surgery of Heliopolis Hospital, Hosphel, São Paulo, Brazil. In 6 white New Zeland rabbits, 46 grafts were performed being 23 with homologous (rabbit and 23 with xenograft (pig. 12 homologous implants (6 at the right side of the mandible and 6 at abdominal muscle of the rabbit and 12 heterologous implants of pigs (6 at the left side of the mandible and 6 at abdominal muscle rabbit were performed with demineralized bone matrix. RESULTS: Osteogenesis was assessed through histologic features after 30 and 60 days. After 1 rabbit dead, osteogenesis (mandible were detected in 9 of 11 (82% rabbits that received homologous matrix, in spite of heterologous implants showed osteogenesis in 6 out of 11 (54% (p=0,18. The abdominal muscle showed induced osteogenesis in 3 out of 11(27% animals with homologous and 0% with heterologous implants (p=0,10. CONCLUSIONS: Osteogenesis induction through homologous grafts in rabbit mandible and abdominal muscle were more effective than xenografts.

  2. Statistical Inference for Porous Materials using Persistent Homology.

    Energy Technology Data Exchange (ETDEWEB)

    Moon, Chul [Univ. of Georgia, Athens, GA (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Mitchell, Scott A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-12-01

    We propose a porous materials analysis pipeline using persistent homology. We rst compute persistent homology of binarized 3D images of sampled material subvolumes. For each image we compute sets of homology intervals, which are represented as summary graphics called persistence diagrams. We convert persistence diagrams into image vectors in order to analyze the similarity of the homology of the material images using the mature tools for image analysis. Each image is treated as a vector and we compute its principal components to extract features. We t a statistical model using the loadings of principal components to estimate material porosity, permeability, anisotropy, and tortuosity. We also propose an adaptive version of the structural similarity index (SSIM), a similarity metric for images, as a measure to determine the statistical representative elementary volumes (sREV) for persistence homology. Thus we provide a capability for making a statistical inference of the uid ow and transport properties of porous materials based on their geometry and connectivity.

  3. Electrical Characterizations of Lightning Strike Protection Techniques for Composite Materials

    Science.gov (United States)

    Szatkowski, George N.; Nguyen, Truong X.; Koppen, Sandra V.; Ely, Jay J.; Mielnik, John J.

    2009-01-01

    The growing application of composite materials in commercial aircraft manufacturing has significantly increased the risk of aircraft damage from lightning strikes. Composite aircraft designs require new mitigation strategies and engineering practices to maintain the same level of safety and protection as achieved by conductive aluminum skinned aircraft. Researchers working under the NASA Aviation Safety Program s Integrated Vehicle Health Management (IVHM) Project are investigating lightning damage on composite materials to support the development of new mitigation, diagnosis & prognosis techniques to overcome the increased challenges associated with lightning protection on composite aircraft. This paper provides an overview of the electrical characterizations being performed to support IVHM lightning damage diagnosis research on composite materials at the NASA Langley Research Center.

  4. A Probabilistic, Facility-Centric Approach to Lightning Strike Location

    Science.gov (United States)

    Huddleston, Lisa L.; Roeder, William p.; Merceret, Francis J.

    2012-01-01

    A new probabilistic facility-centric approach to lightning strike location has been developed. This process uses the bivariate Gaussian distribution of probability density provided by the current lightning location error ellipse for the most likely location of a lightning stroke and integrates it to determine the probability that the stroke is inside any specified radius of any location, even if that location is not centered on or even with the location error ellipse. This technique is adapted from a method of calculating the probability of debris collisionith spacecraft. Such a technique is important in spaceport processing activities because it allows engineers to quantify the risk of induced current damage to critical electronics due to nearby lightning strokes. This technique was tested extensively and is now in use by space launch organizations at Kennedy Space Center and Cape Canaveral Air Force Station. Future applications could include forensic meteorology.

  5. Migraine strikes as neuronal excitability reaches a tipping point.

    Directory of Open Access Journals (Sweden)

    Marten Scheffer

    Full Text Available Self-propagating waves of cerebral neuronal firing, known as spreading depolarisations, are believed to be at the roots of migraine attacks. We propose that the start of spreading depolarisations corresponds to a critical transition that occurs when dynamic brain networks approach a tipping point. We show that this hypothesis is consistent with current pathogenetic insights and observed dynamics. Our view implies that migraine strikes when modulating factors further raise the neuronal excitability in genetically predisposed subjects to a level where even minor perturbations can trigger spreading depolarisations. A corollary is that recently discovered generic early warning indicators for critical transitions may be used to predict the onset of migraine attacks even before patients are clinically aware. This opens up new avenues for dissecting the mechanisms for the onset of migraine attacks and for identifying novel prophylactic treatment targets for the prevention of attacks.

  6. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    Directory of Open Access Journals (Sweden)

    Yushen Du

    2016-11-01

    Full Text Available Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp, we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available.

  7. Precision Strike Training in Lean Manufacturing: A Workplace Literacy Guidebook [and] Final Report on Precision Strike Workplace Literacy Training at CertainTeed Corporation.

    Science.gov (United States)

    National Alliance of Business, Inc., Washington, DC.

    CertainTeed's Precision Strike training program was designed to close the gaps between the current status of its workplace and where that work force needed to be to compete successfully in global markets. Precision Strike included Skills and Knowledge in Lifelong Learning (SKILL) customized, computerized lessons in basic skills, one-on-one…

  8. The Implications of Strike-Slip Earthquake Source Properties on the Transform Boundary Development Process

    Science.gov (United States)

    Neely, J. S.; Huang, Y.; Furlong, K.

    2017-12-01

    Subduction-Transform Edge Propagator (STEP) faults, produced by the tearing of a subducting plate, allow us to study the development of a transform plate boundary and improve our understanding of both long-term geologic processes and short-term seismic hazards. The 280 km long San Cristobal Trough (SCT), formed by the tearing of the Australia plate as it subducts under the Pacific plate near the Solomon and Vanuatu subduction zones, shows along-strike variations in earthquake behaviors. The segment of the SCT closest to the tear rarely hosts earthquakes > Mw 6, whereas the SCT sections more than 80 - 100 km from the tear experience Mw7 earthquakes with repeated rupture along the same segments. To understand the effect of cumulative displacement on SCT seismicity, we analyze b-values, centroid-time delays and corner frequencies of the SCT earthquakes. We use the spectral ratio method based on Empirical Green's Functions (eGfs) to isolate source effects from propagation and site effects. We find high b-values along the SCT closest to the tear with values decreasing with distance before finally increasing again towards the far end of the SCT. Centroid time-delays for the Mw 7 strike-slip earthquakes increase with distance from the tear, but corner frequency estimates for a recent sequence of Mw 7 earthquakes are approximately equal, indicating a growing complexity in earthquake behavior with distance from the tear due to a displacement-driven transform boundary development process (see figure). The increasing complexity possibly stems from the earthquakes along the eastern SCT rupturing through multiple asperities resulting in multiple moment pulses. If not for the bounding Vanuatu subduction zone at the far end of the SCT, the eastern SCT section, which has experienced the most displacement, might be capable of hosting larger earthquakes. When assessing the seismic hazard of other STEP faults, cumulative fault displacement should be considered a key input in

  9. THE EFFECTS OF HEIGHT AND DISTANCE ON THE FORCE PRODUCTION AND ACCELERATION IN MARTIAL ARTS STRIKES

    Directory of Open Access Journals (Sweden)

    Cynthia A. Bir

    2009-11-01

    Full Text Available Almost all cultures have roots in some sort of self defence system and yet there is relatively little research in this area, outside of a sports related environment. This project investigated different applications of strikes from Kung Fu practitioners that have not been addressed before in the literature. Punch and palm strikes were directly compared from different heights and distances, with the use of a load cell, accelerometers, and high speed video. The data indicated that the arm accelerations of both strikes were similar, although the force and resulting acceleration of the target were significantly greater for the palm strikes. Additionally, the relative height at which the strike was delivered was also investigated. The overall conclusion is that the palm strike is a more effective strike for transferring force to an object. It can also be concluded that an attack to the chest would be ideal for maximizing impact force and moving an opponent off balance

  10. Role of N-S strike-slip faulting in structuring of north-eastern Tunisia; geodynamic implications

    Science.gov (United States)

    Arfaoui, Aymen; Soumaya, Abdelkader; Ben Ayed, Noureddine; Delvaux, Damien; Ghanmi, Mohamed; Kadri, Ali; Zargouni, Fouad

    2017-05-01

    Three major compressional events characterized by folding, thrusting and strike-slip faulting occurred in the Eocene, Late Miocene and Quaternary along the NE Tunisian domain between Bou Kornine-Ressas-Msella and Cap Bon Peninsula. During the Plio-Quaternary, the Grombalia and Mornag grabens show a maximum of collapse in parallelism with the NNW-SSE SHmax direction and developed as 3rd order distensives zones within a global compressional regime. Using existing tectonic and geophysical data supplemented by new fault-kinematic observations, we show that Cenozoic deformation of the Mesozoic sedimentary sequences is dominated by first order N-S faults reactivation, this sinistral wrench system is responsible for the formation of strike-slip duplexes, thrusts, folds and grabens. Following our new structural interpretation, the major faults of N-S Axis, Bou Kornine-Ressas-Messella (MRB) and Hammamet-Korbous (HK) form an N-S first order compressive relay within a left lateral strike-slip duplex. The N-S master MRB fault is dominated by contractional imbricate fans, while the parallel HK fault is characterized by a trailing of extensional imbricate fans. The Eocene and Miocene compression phases in the study area caused sinistral strike-slip reactivation of pre-existing N-S faults, reverse reactivation of NE-SW trending faults and normal-oblique reactivation of NW-SE faults, creating a NE-SW to N-S trending system of east-verging folds and overlaps. Existing seismic tomography images suggest a key role for the lithospheric subvertical tear or STEP fault (Slab Transfer Edge Propagator) evidenced below this region on the development of the MRB and the HK relay zone. The presence of extensive syntectonic Pliocene on top of this crustal scale fault may be the result of a recent lithospheric vertical kinematic of this STEP fault, due to the rollback and lateral migration of the Calabrian slab eastward.

  11. Phenotypic changes in Cyprinus carpiovar var. Jian introduced by sperm-mediated transgenesis of rearranged homologous DNA fragments.

    Science.gov (United States)

    Cao, Zheming; Ding, Weidong; Ren, Hongtao

    2013-09-01

    Common carp, specifically the Jian variety (Cyprinus carpiovar var. Jian), is an important Chinese and global aquatic stock for commercial foodstuff. Homologous recombination of carp gene sequences has been widely used in population genetics to broadly screen for beneficial phenotypical variations, thus optimizing artificially engineered carp stocks with Jian variety and native stock varieties. Random rearrangement of homologous DNA fragments from parent specimens of C. carpiovar var. Jian were attained by digestion of genomic DNA with MspI followed by religation and redigestion with EcoR I to specifically rearrange homologous DNA fragments of myostatin and microsatellite genes. Based on known characteristics of myostatin gene function, growth pattern changes in resultant carp mutant varieties was expected. DNA fragments were introduced into metaphase-II oocytes, resulting in one to several dozen insertions of homologous fragments into the host genome by sperm-mediated transgenesis. Introduction of rearranged homologous DNA fragments often resulted in phenotypic changes in C. carpiovar var. Jian, including significant phenotypic changes linked to growth rate at 4 months.

  12. Peridinialean dinoflagellate plate patterns, labels and homologies

    Science.gov (United States)

    Edwards, L.E.

    1990-01-01

    Tabulation patterns for peridinialean dinoflagellate thecae and cysts have been traditionally expressed using a plate labelling system described by C.A. Kofoid in the early 1900's. This system can obscure dinoflagellate plate homologies and has not always been strictly applied. The plate-labelling system presented here introduces new series labels but incorporates key features and ideas from the more recently proposed systems of G.L. Eaton and F.J.R. Taylor, as modified by W.R. Evitt. Plate-series recognition begins with the cingulum (C-series) and proceeds from the cingulum toward the apex for the three series of the epitheca/epicyst and proceeds from the cingulum toward the antapex for the two series of the hypotheca/hypocyst. The epithecal/epicystal model consists of eight plates that touch the anterior margin of the cingulum (E-series: plates E1-E7, ES), seven plates toward the apex that touch the E-series plates (M-series: R, M1-M6), and up to seven plates near the apex that do not touch E-series plates (D-series: Dp-Dv). The hypothecal/hypocystal model consists of eight plates that touch the posterior margin of the cingulum (H-series: H1-H6,HR,HS) and three plates toward the antapex (T1-T3). Epithecal/epicystal tabulation patterns come in both 8- and 7- models, corresponding to eight and seven plates, respectively, in the E-series. Hypothecal/hypocystal tabulation patterns also come in both 8- and 7-models, corresponding to eight and seven plates, respectively, in the H-series. By convention, the 7-model epitheca/epicyst has no plates E1 and M1; the 7-model hypotheca/hypocyst has no plate H6. Within an 8-model or 7-model, the system emphasizes plates that are presumed to be homologous by giving them identical labels. I introduce the adjectives "monothigmate", "dithigmate," and "trithigmate" to designate plates touching one, two, and three plates, respectively, of the adjacent series. The term "thigmation" applies to the analysis of plate contacts between

  13. Similarities between human eosinophil-derived neurotoxin and eosinophil cationic protein: homology with ribonuclease

    International Nuclear Information System (INIS)

    Gleich, G.J.; Loegering, D.A.; Bell, M.P.; Checkel, J.L.; Ackerman, S.J.; McKean, D.J.

    1986-01-01

    The eosinophil granule contains a series of basic proteins, including eosinophil-derived neurotoxin (EDN) and eosinophil cationic protein (ECP). EDN and ECP were isolated from eosinophil granules by heparin-Sepharose chromatography. Radioimmunoassay of fractions from heparin-Sepharose showed one peak of EDN activity and two peaks of ECP activity (termed ECP-1 and ECP-2). EDN, ECP-1, and ECP-2 each exhibited heterogeneity in charge and molecular weight when analyzed by two-dimensional electrophoresis. Digestion of EDN and both ECP's with endoglycosidase-F decreased their molecular weights indicating that their heterogeneity is due in part to n-linked oligosaccharides. Amino acid sequence analyses showed that ECP-1 and ECP-2 were identical from residues 1 through 59 and that EDN and ECP sequences were highly homologous (37 of 55 residues identical). Both EDN and ECP NH 2 -terminal sequences showed significant homology to RNase, especially in regions of the RNase molecule involved in ligand binding. EDN, ECP-1 and ECP-2 had neurotoxic activity, causing the Gordon phenomenon at doses down 0.15 microgram; the proteins were comparable in their activities. These results indicate that EDN and ECP are related proteins and suggest that they derived from genes associated with the RNase family

  14. Competitive repair by naturally dispersed repetitive DNA during non-allelic homologous recombination

    Energy Technology Data Exchange (ETDEWEB)

    Hoang, Margaret L.; Tan, Frederick J.; Lai, David C.; Celniker, Sue E.; Hoskins, Roger A.; Dunham, Maitreya J.; Zheng, Yixian; Koshland, Douglas

    2010-08-27

    Genome rearrangements often result from non-allelic homologous recombination (NAHR) between repetitive DNA elements dispersed throughout the genome. Here we systematically analyze NAHR between Ty retrotransposons using a genome-wide approach that exploits unique features of Saccharomyces cerevisiae purebred and Saccharomyces cerevisiae/Saccharomyces bayanus hybrid diploids. We find that DNA double-strand breaks (DSBs) induce NAHR-dependent rearrangements using Ty elements located 12 to 48 kilobases distal to the break site. This break-distal recombination (BDR) occurs frequently, even when allelic recombination can repair the break using the homolog. Robust BDR-dependent NAHR demonstrates that sequences very distal to DSBs can effectively compete with proximal sequences for repair of the break. In addition, our analysis of NAHR partner choice between Ty repeats shows that intrachromosomal Ty partners are preferred despite the abundance of potential interchromosomal Ty partners that share higher sequence identity. This competitive advantage of intrachromosomal Tys results from the relative efficiencies of different NAHR repair pathways. Finally, NAHR generates deleterious rearrangements more frequently when DSBs occur outside rather than within a Ty repeat. These findings yield insights into mechanisms of repeat-mediated genome rearrangements associated with evolution and cancer.

  15. Improving model construction of profile HMMs for remote homology detection through structural alignment

    Directory of Open Access Journals (Sweden)

    Zaverucha Gerson

    2007-11-01

    Full Text Available Abstract Background Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. Results We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. Conclusion We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  16. Improving model construction of profile HMMs for remote homology detection through structural alignment.

    Science.gov (United States)

    Bernardes, Juliana S; Dávila, Alberto M R; Costa, Vítor S; Zaverucha, Gerson

    2007-11-09

    Remote homology detection is a challenging problem in Bioinformatics. Arguably, profile Hidden Markov Models (pHMMs) are one of the most successful approaches in addressing this important problem. pHMM packages present a relatively small computational cost, and perform particularly well at recognizing remote homologies. This raises the question of whether structural alignments could impact the performance of pHMMs trained from proteins in the Twilight Zone, as structural alignments are often more accurate than sequence alignments at identifying motifs and functional residues. Next, we assess the impact of using structural alignments in pHMM performance. We used the SCOP database to perform our experiments. Structural alignments were obtained using the 3DCOFFEE and MAMMOTH-mult tools; sequence alignments were obtained using CLUSTALW, TCOFFEE, MAFFT and PROBCONS. We performed leave-one-family-out cross-validation over super-families. Performance was evaluated through ROC curves and paired two tailed t-test. We observed that pHMMs derived from structural alignments performed significantly better than pHMMs derived from sequence alignment in low-identity regions, mainly below 20%. We believe this is because structural alignment tools are better at focusing on the important patterns that are more often conserved through evolution, resulting in higher quality pHMMs. On the other hand, sensitivity of these tools is still quite low for these low-identity regions. Our results suggest a number of possible directions for improvements in this area.

  17. MetaGO: Predicting Gene Ontology of non-homologous proteins through low-resolution protein structure prediction and protein-protein network mapping.

    Science.gov (United States)

    Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang

    2018-03-10

    Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's-homology based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's-homology based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence-homology based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.

  18. Homology modelling and docking analysis of L-lactate dehydrogenase from Streptococcus thermopilus

    Directory of Open Access Journals (Sweden)

    Vukić Vladimir R.

    2016-01-01

    Full Text Available The aim of this research was to create a three-dimensional model of L-lactate dehydrogenase from the main yoghurt starter culture - Streptococcus thermopilus, to analyse its structural features and investigate substrate binding in the active site. NCBI BlastP was used against the Protein Data Bank database in order to identify the template for construction of homology models. Multiple sequence alignment was performed using the program MUSCULE within the UGENE 1.11.3 program. Homology models were constructed using the program Modeller v. 9.17. The obtained 3D model was verified by Ramachandran plots. Molecular docking simulations were performed using the program Surflex-Dock. The highest sequence similarity was observed with L-lactate dehydrogenase from Lactobacillus casei subsp. casei, with 69% identity. Therefore, its structure (PDB ID: 2ZQY:A was selected as a modelling template for homology modelling. Active residues are by sequence similarity predicted: S. thermophilus - HIS181 and S. aureus - HIS179. Binding energy of pyruvate to L-lactate dehydrogenase of S. thermopilus was - 7.874 kcal/mol. Pyruvate in L-lactate dehydrogenase of S. thermopilus makes H bonds with catalytic HIS181 (1.9 Å, as well as with THR235 (3.6 Å. Although our results indicate similar position of substrates between L-lactate dehydrogenase of S. thermopilus and S. aureus, differences in substrate distances and binding energy values could influence the reaction rate. Based on these results, the L-lactate dehydrogenase model proposed here could be used as a guide for further research, such as transition states of the reaction through molecular dynamics. [Projekat Ministarstva nauke Republike Srbije, br. III 46009

  19. A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models.

    Science.gov (United States)

    Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson

    2011-03-23

    Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

  20. Mutations in the Ty3 major homology region affect multiple steps in Ty3 retrotransposition.

    OpenAIRE

    Orlinsky, K J; Gu, J; Hoyt, M; Sandmeyer, S; Menees, T M

    1996-01-01

    The Saccharomyces cerevisiae retroviruslike element Ty3 encodes the major structural proteins capsid (CA) and nucleocapsid in the GAG3 open reading frame. The Ty3 CA protein contains a sequence (QGX2EX5FX3LX3H, where H is a hydrophobic residue) which has not been observed in other retrotransposons but which is similar to the major homology region (MHR) described for retrovirus CA. In this study the effects of mutations in the Ty3 MHR on particle formation, processing, DNA synthesis, and trans...

  1. Conservation and co-option in developmental programmes: the importance of homology relationships

    Directory of Open Access Journals (Sweden)

    Becker May-Britt

    2005-10-01

    Full Text Available Abstract One of the surprising insights gained from research in evolutionary developmental biology (evo-devo is that increasing diversity in body plans and morphology in organisms across animal phyla are not reflected in similarly dramatic changes at the level of gene composition of their genomes. For instance, simplicity at the tissue level of organization often contrasts with a high degree of genetic complexity. Also intriguing is the observation that the coding regions of several genes of invertebrates show high sequence similarity to those in humans. This lack of change (conservation indicates that evolutionary novelties may arise more frequently through combinatorial processes, such as changes in gene regulation and the recruitment of novel genes into existing regulatory gene networks (co-option, and less often through adaptive evolutionary processes in the coding portions of a gene. As a consequence, it is of great interest to examine whether the widespread conservation of the genetic machinery implies the same developmental function in a last common ancestor, or whether homologous genes acquired new developmental roles in structures of independent phylogenetic origin. To distinguish between these two possibilities one must refer to current concepts of phylogeny reconstruction and carefully investigate homology relationships. Particularly problematic in terms of homology decisions is the use of gene expression patterns of a given structure. In the future, research on more organisms other than the typical model systems will be required since these can provide insights that are not easily obtained from comparisons among only a few distantly related model species.

  2. San Andreas-sized Strike-slip Fault on Europa

    Science.gov (United States)

    1998-01-01

    This mosaic of the south polar region of Jupiter's moon Europa shows the northern 290 kilometers (180 miles) of a strike-slip fault named Astypalaea Linea. The entire fault is about 810 kilometers (500 miles) long, about the size of the California portion of the San Andreas fault, which runs from the California-Mexico border north to the San Francisco Bay. In a strike-slip fault, two crustal blocks move horizontally past one another, similar to two opposing lanes of traffic. Overall motion along the fault seems to have followed a continuous narrow crack along the feature's entire length, with a path resembling steps on a staircase crossing zones that have been pulled apart. The images show that about 50 kilometers (30 miles) of displacement have taken place along the fault. The fault's opposite sides can be reconstructed like a puzzle, matching the shape of the sides and older, individual cracks and ridges broken by its movements. [figure removed for brevity, see original site] The red line marks the once active central crack of the fault. The black line outlines the fault zone, including material accumulated in the regions which have been pulled apart. Bends in the fault have allowed the surface to be pulled apart. This process created openings through which warmer, softer ice from below Europa's brittle ice shell surface, or frozen water from a possible subsurface ocean, could reach the surface. This upwelling of material formed large areas of new ice within the boundaries of the original fault. A similar pulling-apart phenomenon can be observed in the geological trough surrounding California's Salton Sea, in Death Valley and the Dead Sea. In those cases, the pulled-apart regions can include upwelled materials, but may be filled mostly by sedimentary and eroded material from above. One theory is that fault motion on Europa is induced by the pull of variable daily tides generated by Jupiter's gravitational tug on Europa. Tidal tension opens the fault and

  3. The K-homology of nets of C∗-algebras

    Science.gov (United States)

    Ruzzi, Giuseppe; Vasselli, Ezio

    2014-12-01

    Let X be a space, intended as a possibly curved space-time, and A a precosheaf of C∗-algebras on X. Motivated by algebraic quantum field theory, we study the Kasparov and Θ-summable K-homology of A interpreting them in terms of the holonomy equivariant K-homology of the associated C∗-dynamical system. This yields a characteristic class for K-homology cycles of A with values in the odd cohomology of X, that we interpret as a generalized statistical dimension.

  4. Isolation of human oncogene sequences (v-fes homologue) from a cosmid library.

    NARCIS (Netherlands)

    J. Groffen; N. Heisterkamp; F.G. Grosveld (Frank); W. van de Ven (Wim); J.R. Stephenson

    1982-01-01

    textabstractTo define the human homolog (or homologs) of transforming sequences (v-fes gene) common to Gardner (GA) and Snyder Theilen (ST) isolates of feline sarcoma virus (FeSV), a representative library of human lung carcinoma DNA in a cosmid vector system was constructed. Three cosmid clones

  5. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...... on transcriptional evidence. Analysis of repetitive sequences suggests that they are underrepresented in the reference assembly, reflecting an enrichment of gene-rich regions in the current assembly. Characterization of Lotus natural variation by resequencing of L. japonicus accessions and diploid Lotus species...... is currently ongoing, facilitated by the MG20 reference sequence...

  6. Effect of public transport strikes on air pollution levels in Barcelona (Spain).

    Science.gov (United States)

    Basagaña, Xavier; Triguero-Mas, Margarita; Agis, David; Pérez, Noemí; Reche, Cristina; Alastuey, Andrés; Querol, Xavier

    2018-01-01

    Public transport strikes can lead to an increase of the number of private vehicle trips, which in turn can increase air pollution levels. We aimed to estimate the change in air pollution concentrations during public transport strikes in the city of Barcelona (Spain). Data on strikes of the metro, train or bus systems were collected from government records (2005-2016). We collected daily concentrations of NOx; particulate matter with an aerodynamic diameter smaller than 10μm (PM10), 2.5μm (PM2.5), and 1μm (PM1); particle number concentration (N); black carbon (BC) and CO from research and official monitoring stations. We fitted linear regression models for each pollutant with the strike indicator as an independent variable, and models were adjusted for day of the week, month, year, and holiday periods. During the study period, there were 208days affected by a strike of the metro (28), train (106) or bus (91) systems. Half of the strikes were partial, most of them were single-day strikes, there was little overlap between strikes of the different transport systems, and all strikes had to comply with mandatory minimal services. When pooling all types of strikes, NOx and BC showed higher levels during strike days in comparison with non-strike days (increase between 4.1% and 7.7%, with higher increases for NO). The increases in these concentrations were more evident during full day and multiday metro strikes. In conclusion, alterations in public transport have consequences on air quality. This highlights the importance of public transport in reducing air pollution concentrations in cities. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Fold-and-thrust belt evolution influenced by along and across strike thickness variations: new insights from brittle-ductile centrifuge analogue models

    Science.gov (United States)

    Santolaria Otin, Pablo; Harris, Lyal; Casas, Antonio; Soto, Ruth

    2014-05-01

    Using a new centrifuge analogue modelling approach, 38 models were performed to study the influence of along and across strike thickness variations of a ductile-brittle layered sequence on the kinematics and deformation style of fold-and-thrust belts. Four different series, changing the brittle-ductile thickness ratio in models with i) constant thickness, ii) across strike varying thickness, iii) along strike varying thickness and iv) along and across-strike varying thickness, were performed. The brittle sedimentary cover was simulated by "Moon Sand™", regular fine-grained quartz sand coated by polymer and synthetic rubber binders, allowing layers to be placed vertically in the centrifuge (impossible with normal sand). The ductile décollement (evaporites) was simulated by silicone putty (Crazy Aaron Enterprise's Thinking Putty™). Models were run step by step in a high-acceleration centrifuge attaining 900 g, what allows to drastically reduce the experimental time. In addition to surface observation and serial cross-sections at the end of the models, CT scans portray the progressive 3- and 4-dimensional evolution of several models. With constant thickness, the increase of the brittle-ductile ratio results in the decrease of the number of structures where shortening is accommodated and the development of structures does not follow a linear sequence. Across-strike thickness variations trigger the location of deformation towards the wedge front, precluding the emplacement of structures in the hinterland. Along-strike thickness changes result in the lateral variation of the number of structure and a differential displacement of the deformation front. The occurrence of oblique structures is enhanced in wedges with across and along strike thickness variations where, in addition, rotational domains are observed. Comparison with the South Pyrenean Central Unit, in the Southern Pyrenees, characterized by a west- and southward thinning of the pretectonic Mesozoic series

  8. A preliminary study on surface ground deformation near shallow foundation induced by strike-slip faulting

    Science.gov (United States)

    Wong, Pei-Syuan; Lin, Ming-Lang

    2016-04-01

    According to investigation of recent earthquakes, ground deformation and surface rupture are used to map the influenced range of the active fault. The zones of horizontal and vertical surface displacements and different features of surface rupture are investigated in the field, for example, the Greendale Fault 2010, MW 7.1 Canterbury earthquake. The buildings near the fault rotated and displaced vertically and horizontally due to the ground deformation. Besides, the propagation of fault trace detoured them because of the higher rigidity. Consequently, it's necessary to explore the ground deformation and mechanism of the foundation induced by strike-slip faulting for the safety issue. Based on previous study from scaled analogue model of strike-slip faulting, the ground deformation is controlled by material properties, depth of soil, and boundary condition. On the condition controlled, the model shows the features of ground deformation in the field. This study presents results from shear box experiment on small-scale soft clay models subjected to strike-slip faulting and placed shallow foundations on it in a 1-g environment. The quantifiable data including sequence of surface rupture, topography and the position of foundation are recorded with increasing faulting. From the result of the experiment, first en echelon R shears appeared. The R shears rotated to a more parallel angle to the trace and cracks pulled apart along them with increasing displacements. Then the P shears crossed the basement fault in the opposite direction appears and linked R shears. Lastly the central shear was Y shears. On the other hand, the development of wider zones of rupture, higher rising surface and larger the crack area on surface developed, with deeper depth of soil. With the depth of 1 cm and half-box displacement 1.2 cm, en echelon R shears appeared and the surface above the fault trace elevated to 1.15 mm (Dv), causing a 1.16 cm-wide zone of ground-surface rupture and deformation

  9. The assessment of lethal propeller strike injuries in sea mammals.

    Science.gov (United States)

    Byard, Roger W; Winskog, Calle; Machado, Aaron; Boardman, Wayne

    2012-04-01

    Assessment of injuries in marine mammals may be required to help authorities determine whether human activity was involved. Three cases of marine animal deaths involving propeller blade strikes are reported to demonstrate characteristic features of such cases and diagnostic difficulties that may occur. Case 1: A juvenile New Zealand fur seal (Arctocephalus forsteri) suffered two parallel linear incised wounds of the flank and died following small intestinal herniation. Case 2: An Indo-Pacific bottlenose dolphin neonate (Tursiops aduncus) died from a deeply incised wound of the left side of the head with shattering of the skull and laceration of the underlying brain.Case 3: An adult female Indo-Pacific bottlenose dolphin (T. aduncus) died from two parallel chop wounds to the torso with opening of the thoracic and abdominal cavities with fractures of the ribs and vertebrae. Given that some animals may recover, and that the carcasses of those that are killed may simply not be found or reported, it is impossible to provide an estimate of the incidence of this type of injury amongst wild sea mammals. In cases that do come to forensic attention accurate evaluation of the type of injury may potentially have great medicolegal significance. Post-mortem putrefaction and post-mortem feeding by other sea animals may complicate assessments. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  10. Cellular nonlinear networks for strike-point localization at JET

    Science.gov (United States)

    Arena, P.; Fortuna, L.; Bruno, M.; Vagliasindi, G.; Murari, A.; Andrew, P.; Mazzitelli, G.

    2005-11-01

    At JET, the potential of fast image processing for real-time purposes is thoroughly investigated. Particular attention is devoted to smart sensors based on system on chip technology. The data of the infrared cameras were processed with a chip implementing a cellular nonlinear network (CNN) structure so as to support and complement the magnetic diagnostics in the real-time localization of the strike-point position in the divertor. The circuit consists of two layers of complementary metal-oxide semiconductor components, the first being the sensor and the second implementing the actual CNN. This innovative hardware has made it possible to determine the position of the maximum thermal load with a time resolution of the order of 30 ms. Good congruency has been found with the measurement from the thermocouples in the divertor, proving the potential of the infrared data in locating the region of the maximum thermal load. The results are also confirmed by JET magnetic codes, both those used for the equilibrium reconstructions and those devoted to the identification of the plasma boundary.

  11. Cellular nonlinear networks for strike-point localization at JET

    International Nuclear Information System (INIS)

    Arena, P.; Fortuna, L.; Bruno, M.; Vagliasindi, G.; Murari, A.; Andrew, P.; Mazzitelli, G.

    2005-01-01

    At JET, the potential of fast image processing for real-time purposes is thoroughly investigated. Particular attention is devoted to smart sensors based on system on chip technology. The data of the infrared cameras were processed with a chip implementing a cellular nonlinear network (CNN) structure so as to support and complement the magnetic diagnostics in the real-time localization of the strike-point position in the divertor. The circuit consists of two layers of complementary metal-oxide semiconductor components, the first being the sensor and the second implementing the actual CNN. This innovative hardware has made it possible to determine the position of the maximum thermal load with a time resolution of the order of 30 ms. Good congruency has been found with the measurement from the thermocouples in the divertor, proving the potential of the infrared data in locating the region of the maximum thermal load. The results are also confirmed by JET magnetic codes, both those used for the equilibrium reconstructions and those devoted to the identification of the plasma boundary

  12. On the homology and the cohomology of certain polycyclic groups

    International Nuclear Information System (INIS)

    Majumdar, S.

    1987-10-01

    The homology and the cohomology of infinite non-abelian split extensions of cyclic groups by cyclic groups have been computed through construction of nice free resolutions for these groups. (author). 16 refs

  13. Substrate and Cation Binding Mechanism of Glutamate Transporter Homologs

    NARCIS (Netherlands)

    Jensen, Sonja

    2017-01-01

    Glutamate transporters and their homologs are membrane proteins that transport glutamate and aspartate together with sodium ions and/or protons. Human glutamate transporters remove the neurotransmitter glutamate after signal transmission. Therefore, glutamate transporters play a great role in

  14. Homology of normal chains and cohomology of charges

    CERN Document Server

    Pauw, Th De; Pfeffer, W F

    2017-01-01

    The authors consider a category of pairs of compact metric spaces and Lipschitz maps where the pairs satisfy a linearly isoperimetric condition related to the solvability of the Plateau problem with partially free boundary. It includes properly all pairs of compact Lipschitz neighborhood retracts of a large class of Banach spaces. On this category the authors define homology and cohomology functors with real coefficients which satisfy the Eilenberg-Steenrod axioms, but reflect the metric properties of the underlying spaces. As an example they show that the zero-dimensional homology of a space in our category is trivial if and only if the space is path connected by arcs of finite length. The homology and cohomology of a pair are, respectively, locally convex and Banach spaces that are in duality. Ignoring the topological structures, the homology and cohomology extend to all pairs of compact metric spaces. For locally acyclic spaces, the authors establish a natural isomorphism between their cohomology and the �...

  15. Seismic evidence of conjugate normal faulting: The 1994 Devil Canyon earthquake sequence near Challis, Idaho

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Suzette M. [Boise State Univ., ID (United States)

    1994-08-01

    Aftershock hypocenters of the 1984 Devil Canyon, Idaho earthquake indicate the sequence was associated with conjugate normal faulting on two northwest-striking normal faults that bound the Warm Spring Creek graben.

  16. Zeroth Poisson Homology, Foliated Cohomology and Perfect Poisson Manifolds

    Science.gov (United States)

    Martínez-Torres, David; Miranda, Eva

    2018-01-01

    We prove that, for compact regular Poisson manifolds, the zeroth homology group is isomorphic to the top foliated cohomology group, and we give some applications. In particular, we show that, for regular unimodular Poisson manifolds, top Poisson and foliated cohomology groups are isomorphic. Inspired by the symplectic setting, we define what a perfect Poisson manifold is. We use these Poisson homology computations to provide families of perfect Poisson manifolds.

  17. Phylogenetic position of the acariform mites: sensitivity to homology assessment under total evidence

    Directory of Open Access Journals (Sweden)

    Pepato Almir R

    2010-08-01

    Full Text Available Abstract Background Mites (Acari have traditionally been treated as monophyletic, albeit composed of two major lineages: Acariformes and Parasitiformes. Yet recent studies based on morphology, molecular data, or combinations thereof, have increasingly drawn their monophyly into question. Furthermore, the usually basal (molecular position of one or both mite lineages among the chelicerates is in conflict to their morphology, and to the widely accepted view that mites are close relatives of Ricinulei. Results The phylogenetic position of the acariform mites is examined through employing SSU, partial LSU sequences, and morphology from 91 chelicerate extant terminals (forty Acariformes. In a static homology framework, molecular sequences were aligned using their secondary structure as guide, whereby regions of ambiguous alignment were discarded, and pre-aligned sequences analyzed under parsimony and different mixed models in a Bayesian inference. Parsimony and Bayesian analyses led to trees largely congruent concerning infra-ordinal, well-supported branches, but with low support for inter-ordinal relationships. An exception is Solifugae + Acariformes (P. P = 100%, J. = 0.91. In a dynamic homology framework, two analyses were run: a standard POY analysis and an analysis constrained by secondary structure. Both analyses led to largely congruent trees; supporting a (Palpigradi (Solifugae Acariformes clade and Ricinulei as sister group of Tetrapulmonata with the topology (Ricinulei (Amblypygi (Uropygi Araneae. Combined analysis with two different morphological data matrices were run in order to evaluate the impact of constraining the analysis on the recovered topology when employing secondary structure as a guide for homology establishment. The constrained combined analysis yielded two topologies similar to the exclusively molecular analysis for both morphological matrices, except for the recovery of Pedipalpi instead of the (Uropygi Araneae clade. The

  18. Phylogenetic position of the acariform mites: sensitivity to homology assessment under total evidence.

    Science.gov (United States)

    Pepato, Almir R; da Rocha, Carlos E F; Dunlop, Jason A

    2010-08-02

    Mites (Acari) have traditionally been treated as monophyletic, albeit composed of two major lineages: Acariformes and Parasitiformes. Yet recent studies based on morphology, molecular data, or combinations thereof, have increasingly drawn their monophyly into question. Furthermore, the usually basal (molecular) position of one or both mite lineages among the chelicerates is in conflict to their morphology, and to the widely accepted view that mites are close relatives of Ricinulei. The phylogenetic position of the acariform mites is examined through employing SSU, partial LSU sequences, and morphology from 91 chelicerate extant terminals (forty Acariformes). In a static homology framework, molecular sequences were aligned using their secondary structure as guide, whereby regions of ambiguous alignment were discarded, and pre-aligned sequences analyzed under parsimony and different mixed models in a Bayesian inference. Parsimony and Bayesian analyses led to trees largely congruent concerning infra-ordinal, well-supported branches, but with low support for inter-ordinal relationships. An exception is Solifugae + Acariformes (P. P = 100%, J. = 0.91). In a dynamic homology framework, two analyses were run: a standard POY analysis and an analysis constrained by secondary structure. Both analyses led to largely congruent trees; supporting a (Palpigradi (Solifugae Acariformes)) clade and Ricinulei as sister group of Tetrapulmonata with the topology (Ricinulei (Amblypygi (Uropygi Araneae))). Combined analysis with two different morphological data matrices were run in order to evaluate the impact of constraining the analysis on the recovered topology when employing secondary structure as a guide for homology establishment. The constrained combined analysis yielded two topologies similar to the exclusively molecular analysis for both morphological matrices, except for the recovery of Pedipalpi instead of the (Uropygi Araneae) clade. The standard (direct optimization) POY

  19. Conventional Prompt Global Strike and Long-Range Ballistic Missiles: Background and Issues

    Science.gov (United States)

    2016-02-24

    Silver Bullet? Asking the Right Questions About Conventional Prompt Global Strike (Washington, DC: Carneige Endowment for International Peace, 2013), pp...124 James M. Acton, Silver Bullet? Asking the Right Questions About Prompt Global Strike (Washington, DC: Carnegie Endowment for International Peace, 2013), pp. 120-129. ...Conventional Prompt Global Strike and Long-Range Ballistic Missiles: Background and Issues Amy F. Woolf Specialist in Nuclear Weapons Policy

  20. Vessel Strike of Whales in Australia: The Challenges of Analysis of Historical Incident Data

    Directory of Open Access Journals (Sweden)

    David Peel

    2018-03-01

    Full Text Available Death or injury to whales from vessel strike is one of the primary threats to whale populations worldwide. However, quantifying the rate of occurrence of these collisions is difficult because many incidents are not detected (particularly from large vessels and therefore go unreported. Furthermore, varying reporting biases occur related to species identification, spatial coverage of reports and type of vessels involved. The International Whaling Commission (IWC has compiled a database of the worldwide occurrence of vessel strikes to cetaceans, within which Australia constitutes ~7% (35 reports of the reported worldwide (~471 reports vessel strike records involving large whales. Worldwide records consist largely of modern reports within the last two decades and historical evaluation of ship strike reports has mainly focused on the Northern Hemisphere. To address this we conducted a search of historical national and international print media archive databases to discover reports of vessel strikes globally, although with a focus on Australian waters. A significant number of previously unrecorded reports of vessel strikes were found for both Australia (76 and worldwide (140, resulting in a revised estimate of ~15% of global vessel strikes occurring in Australian waters. This detailed collation and analysis of vessel strike data in an Australian context has contributed to our knowledge of the worldwide occurrence of vessel strikes and challenges the notion that vessel strikes were historically rare in Australia relative to the rest of the world. The work highlights the need to examine historical records to provide context around current anthropogenic threats to marine fauna and demonstrates the importance of formalized reporting structures for effective collation of vessel strike reports. This paper examines the issues and biases in analysis of vessel strike data in general that would apply to any jurisdiction. Using the Australian data as an example

  1. Sequence Variations in the Non-Coding Sequence of CTX Phages in Vibrio cholerae.

    Science.gov (United States)

    Kim, Eun Jin; Yu, Hyun Jin; Kim, Dong Wook

    2016-08-28

    This study focused on the variations in the non-coding sequences between ctxB and rstR of various CTX phages. The non-coding sequences of CTX-1 and CTX-cla are phage type-specific. The length of the non-coding region of CTX-1 and CTX-cla is 601 and 730 nucleotides, respectively. The non-coding sequence of CTX phage could be divided into three regions. There is a phage type-specific Variable region between two homologous Common regions (Common regions 1 and 2). The non-coding sequence of RS1 element is similar to CTX-1 except that Common region 1 is replaced by a short RS1-specific sequence. The non-coding sequences of CTX-2 and CTX-cla are homologous, indicating the non-coding sequence of CTX-2 is derived from CTX-cla. The non-coding region of CTX-O139 is similar to CTX-cla and CTX-2; however, it contains an extra phage type-specific sequence between Common region 2 and rstR. The variations in the non-coding sequences of CTX phages might be associated with the difference in the replication efficiency and the directionality in the integration into the V. cholerae chromosome.

  2. Restriction and sequence alterations affect DNA uptake sequence-dependent transformation in Neisseria meningitidis.

    Directory of Open Access Journals (Sweden)

    Ole Herman Ambur

    Full Text Available Transformation is a complex process that involves several interactions from the binding and uptake of naked DNA to homologous recombination. Some actions affect transformation favourably whereas others act to limit it. Here, meticulous manipulation of a single type of transforming DNA allowed for quantifying the impact of three different mediators of meningococcal transformation: NlaIV restriction, homologous recombination and the DNA Uptake Sequence (DUS. In the wildtype, an inverse relationship between the transformation frequency and the number of NlaIV restriction sites in DNA was observed when the transforming DNA harboured a heterologous region for selection (ermC but not when the transforming DNA was homologous with only a single nucleotide heterology. The influence of homologous sequence in transforming DNA was further studied using plasmids with a small interruption or larger deletions in the recombinogenic region and these alterations were found to impair transformation frequency. In contrast, a particularly potent positive driver of DNA uptake in Neisseria sp. are short DUS in the transforming DNA. However, the molecular mechanism(s responsible for DUS specificity remains unknown. Increasing the number of DUS in the transforming DNA was here shown to exert a positive effect on transformation. Furthermore, an influence of variable placement of DUS relative to the homologous region in the donor DNA was documented for the first time. No effect of altering the orientation of DUS was observed. These observations suggest that DUS is important at an early stage in the recognition of DNA, but does not exclude the existence of more than one level of DUS specificity in the sequence of events that constitute transformation. New knowledge on the positive and negative drivers of transformation may in a larger perspective illuminate both the mechanisms and the evolutionary role(s of one of the most conserved mechanisms in nature: homologous

  3. Metazoan Scc4 homologs link sister chromatid cohesion to cell and axon migration guidance.

    Directory of Open Access Journals (Sweden)

    Vlad C Seitan

    2006-07-01

    Full Text Available Saccharomyces cerevisiae Scc2 binds Scc4 to form an essential complex that loads cohesin onto chromosomes. The prevalence of Scc2 orthologs in eukaryotes emphasizes a conserved role in regulating sister chromatid cohesion, but homologs of Scc4 have not hitherto been identified outside certain fungi. Some metazoan orthologs of Scc2 were initially identified as developmental gene regulators, such as Drosophila Nipped-B, a regulator of cut and Ultrabithorax, and delangin, a protein mutant in Cornelia de Lange syndrome. We show that delangin and Nipped-B bind previously unstudied human and fly orthologs of Caenorhabditis elegans MAU-2, a non-axis-specific guidance factor for migrating cells and axons. PSI-BLAST shows that Scc4 is evolutionarily related to metazoan MAU-2 sequences, with the greatest homology evident in a short N-terminal domain, and protein-protein interaction studies map the site of interaction between delangin and human MAU-2 to the N-terminal regions of both proteins. Short interfering RNA knockdown of human MAU-2 in HeLa cells resulted in precocious sister chromatid separation and in impaired loading of cohesin onto chromatin, indicating that it is functionally related to Scc4, and RNAi analyses show that MAU-2 regulates chromosome segregation in C. elegans embryos. Using antisense morpholino oligonucleotides to knock down Xenopus tropicalis delangin or MAU-2 in early embryos produced similar patterns of retarded growth and developmental defects. Our data show that sister chromatid cohesion in metazoans involves the formation of a complex similar to the Scc2-Scc4 interaction in the budding yeast. The very high degree of sequence conservation between Scc4 homologs in complex metazoans is consistent with increased selection pressure to conserve additional essential functions, such as regulation of cell and axon migration during development.

  4. Functional Coverage of the Human Genome by Existing Structures, Structural Genomics Targets, and Homology Models.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available The bias in protein structure and function space resulting from experimental limitations and targeting of particular functional classes of proteins by structural biologists has long been recognized, but never continuously quantified. Using the Enzyme Commission and the Gene Ontology classifications as a reference frame, and integrating structure data from the Protein Data Bank (PDB, target sequences from the structural genomics projects, structure homology derived from the SUPERFAMILY database, and genome annotations from Ensembl and NCBI, we provide a quantified view, both at the domain and whole-protein levels, of the current and projected coverage of protein structure and function space relative to the human genome. Protein structures currently provide at least one domain that covers 37% of the functional classes identified in the genome; whole structure coverage exists for 25% of the genome. If all the structural genomics targets were solved (twice the current number of structures in the PDB, it is estimated that structures of one domain would cover 69% of the functional classes identified and complete structure coverage would be 44%. Homology models from existing experimental structures extend the 37% coverage to 56% of the genome as single domains and 25% to 31% for complete structures. Coverage from homology models is not evenly distributed by protein family, reflecting differing degrees of sequence and structure divergence within families. While these data provide coverage, conversely, they also systematically highlight functional classes of proteins for which structures should be determined. Current key functional families without structure representation are highlighted here; updated information on the "most wanted list" that should be solved is available on a weekly basis from http://function.rcsb.org:8080/pdb/function_distribution/index.html.

  5. Prokaryotic caspase homologs: phylogenetic patterns and functional characteristics reveal considerable diversity.

    Directory of Open Access Journals (Sweden)

    Johannes Asplund-Samuelsson

    Full Text Available Caspases accomplish initiation and execution of apoptosis, a programmed cell death process specific to metazoans. The existence of prokaryotic caspase homologs, termed metacaspases, has been known for slightly more than a decade. Despite their potential connection to the evolution of programmed cell death in eukaryotes, the phylogenetic distribution and functions of these prokaryotic metacaspase sequences are largely uncharted, while a few experiments imply involvement in programmed cell death. Aiming at providing a more detailed picture of prokaryotic caspase homologs, we applied a computational approach based on Hidden Markov Model search profiles to identify and functionally characterize putative metacaspases in bacterial and archaeal genomes. Out of the total of 1463 analyzed genomes, merely 267 (18% were identified to contain putative metacaspases, but their taxonomic distribution included most prokaryotic phyla and a few archaea (Euryarchaeota. Metacaspases were particularly abundant in Alphaproteobacteria, Deltaproteobacteria and Cyanobacteria, which harbor many morphologically and developmentally complex organisms, and a distinct correlation was found between abundance and phenotypic complexity in Cyanobacteria. Notably, Bacillus subtilis and Escherichia coli, known to undergo genetically regulated autolysis, lacked metacaspases. Pfam domain architecture analysis combined with operon identification revealed rich and varied configurations among the metacaspase sequences. These imply roles in programmed cell death, but also e.g. in signaling, various enzymatic activities and protein modification. Together our data show a wide and scattered distribution of caspase homologs in prokaryotes with structurally and functionally diverse sub-groups, and with a potentially intriguing evolutionary role. These features will help delineate future characterizations of death pathways in prokaryotes.

  6. Multiple evolutionary events involved in maintaining homologs of Resistance to Powdery Mildew 8 in Brassica napus

    Directory of Open Access Journals (Sweden)

    Qin Li

    2016-07-01

    Full Text Available The Resistance to Powdery Mildew 8 (RPW8 locus confers broad-spectrum resistance to powdery mildew in Arabidopsis thaliana. There are four Homologous to RPW8s (BrHRs in Brassica rapa and three in B. oleracea (BoHRs. B. napus (Bn is derived from diploidization of a hybrid between B. rapa and B. oleracea, thus should have seven homologs of RPW8 (BnHRs. It is unclear whether these genes are still maintained or lost in B. napus after diploidization and how they might have been evolved. Here we reported the identification and sequence polymorphisms of BnHRs from a set of B. napus accessions. Our data indicated that while the BoHR copy from B. oleracea is highly conserved, the BrHR copy from B. rapa is relatively variable in the B. napus genome owing to multiple evolutionary events, such as gene loss, point mutation, insertion, deletion and intragenic recombination. Given the overall high sequence homology of BnHR genes, it is not surprising that both intragenic recombination between two orthologs and two paralogs were detected in B. napus, which may explain the loss of BoHR genes in some B. napus accessions. When ectopically expressed in Arabidopsis, a C-terminally truncated version of BnHRa and BnHRb, as well as the full length BnHRd fused with YFP at their C-termini could trigger cell death in the absence of pathogens and enhanced resistance to powdery mildew disease. Moreover, subcellular localization analysis showed that both BnHRa-YFP and BnHRb-YFP were mainly localized to the extra-haustorial membrane (EHM encasing the haustorium of powdery mildew. Taken together, our data suggest that the duplicated BnHR genes might have been subjected to differential selection and at least some may play a role in defense and could serve as resistance resource in engineering disease-resistant plants.

  7. Homologous Recombination and Xylella fastidiosa Host-Pathogen Associations in South America.

    Science.gov (United States)

    Coletta-Filho, Helvécio D; Francisco, Carolina S; Lopes, João R S; Muller, Christiane; Almeida, Rodrigo P P

    2017-03-01

    Homologous recombination affects the evolution of bacteria such as Xylella fastidiosa, a naturally competent plant pathogen that requires insect vectors for dispersal. This bacterial species is taxonomically divided into subspecies, with phylogenetic clusters within subspecies that are host specific. One subspecies, pauca, is primarily limited to South America, with the exception of recently reported strains in Europe and Costa Rica. Despite the economic importance of X. fastidiosa subsp. pauca in South America, little is known about its genetic diversity. Multilocus sequence typing (MLST) has previously identified six sequence types (ST) among plant samples collected in Brazil (both subsp. pauca and multiplex). Here, we report on a survey of X. fastidiosa genetic diversity (MLST based) performed in six regions in Brazil and two in Argentina, by sampling five different plant species. In addition to the six previously reported ST, seven new subsp. pauca and two new subsp. multiplex ST were identified. The presence of subsp. multiplex in South America is considered to be the consequence of a single introduction from its native range in North America more than 80 years ago. Different phylogenetic approaches clustered the South American ST into four groups, with strains infecting citrus (subsp. pauca); coffee and olive (subsp. pauca); coffee, hibiscus, and plum (subsp. pauca); and plum (subsp. multiplex). In areas where these different genetic clusters occurred sympatrically, we found evidence of homologous recombination in the form of bidirectional allelic exchange between subspp. pauca and multiplex. In fact, the only strain of subsp. pauca isolated from a plum host had an allele that originated from subsp. multiplex. These signatures of bidirectional homologous recombination between endemic and introduced ST indicate that gene flow occurs in short evolutionary time frames in X. fastidiosa, despite the ecological isolation (i.e., host plant species) of genotypes.

  8. ‘The Nairobi General Strike [1950]: from protest to insurgency’

    OpenAIRE

    Hyde, David

    2002-01-01

    The Nairobi General Strike [1950] was the culmination of Kenya’s post war strike wave and urban upheaval. An unprecedented upsurge occurred with the general strikes in Mombasa [1947] led by the African Workers Federation [A.W.F.] and in Nairobi by the East African Trades Union Congress [E.A.T.U.C.]. While this has been termed and treated as a city wide strike, there is enough evidence to suggest a movement that went some way beyond Nairobi. The extent of the cohesion and reciprocal impacts am...

  9. Operational Functions to Achieve Synergy between Special Operations and Precision Strike

    National Research Council Canada - National Science Library

    Huff, William M

    2005-01-01

    ...). The paper describes the operational functions required from the appointed operational commander and his staff to achieve synergism through the combination of special operations and precision strike...

  10. The Chinese nuclear arsenal and its second-strike capability

    International Nuclear Information System (INIS)

    Cabestan, Jean-Pierre

    2013-03-01

    It is well known that China possesses a second- strike capability, but a great deal of uncertainty persists on the subject. Over the last few years, without officially adjusting its doctrine, China has nonetheless defined its objectives. In April 2010, the People's Liberation Army Daily indicated that China needed such a capability and contended that ballistic missile submarines (SSBNs) would constitute the safest means of delivery. In the same year, the IISS estimated that the People's Liberation Army was in possession of 90 ICBMs (66 ground-based missiles and 24 SLBMs) and 400 IRBM mainly aimed at Taiwan and Japan. The Pentagon's 2012 report proposed 50-75 ICBMs and 80 -120 IRBM and MRBM. While it is established that the People's Liberation Army is developing Jin class submarines (type-094, of which there are currently two in service, which will soon rise to five) and is developing solid-propellant missiles, which could be activated more quickly, not a great deal is known about the progress of these two projects. The JL-2 (7400 km), which is mounted on SSBNs, is still being tested. In parallel, the traditional principle to which China adheres - no first use of nuclear weapons - seems to have been slightly dented. Thus, in January 2011, the Japanese press agency Kyodo (relayed by Stratfor) reported that the People's Liberation Army had lowered the threshold for use of its strategic weapons: it could henceforth envisage a preventive nuclear strike against a nuclear power that had by conventional means destroyed key strategic targets on its territory, such as a nuclear power station, a dam, or a large city, having provided prior warning to the aggressor. But what most worries the U.S. and its Asian allies, particularly the Japanese, is the quasi-total opacity of the Chinese military nuclear programme. While in April 2010, the United States and Russia signed a treaty limiting their number of strategic weapons to 1550 by 2018, China considers

  11. Transformation of Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine biosynthesis

    International Nuclear Information System (INIS)

    Skory, C.D.; Horng, J.S.; Pestka, J.J.; Linz, J.E.

    1990-01-01

    The lack of efficient transformation methods for aflatoxigenic Aspergillus parasiticus has been a major constraint for the study of aflatoxin biosynthesis at the genetic level. A transformation system with efficiencies of 30 to 50 stable transformants per μg of DNA was developed for A. parasiticus by using homologous pyrG gene. The pyrG gene from A. parasiticus was isolated by in situ plaque hybridization of a lambda genomic DNA library. Uridine auxotrophs of A. parasiticus ATCC 36537, a mutant blocked in aflatoxin biosynthesis, were isolated by selection on 5-fluoroorotic acid following nitrosoguanidine mutagenesis. Isolates with mutations in the pyrG gene resulting in elimination of orotidine monophosphate (OMP) decarboxylase activity were detected by assaying cell extracts for their ability to convert [ 14 C]OMP to [ 14 C]UMP. Transformation of A. parasiticus pyrG protoplasts with the homologous pyrG gene restored the fungal cells to prototrophy. Enzymatic analysis of cell extracts of transformant clones demonstrated that these extracts had the ability to convert [ 14 C]OMP to [ 14 C]UMP. Southern analysis of DNA purified from transformant clones indicated that both pUC19 vector sequences and pyrG sequences were integrated into the genome. The development of this pyrG transformation system should allow cloning of the aflatoxin-biosynthetic genes, which will be useful in studying the regulation of aflatoxin biosynthesis and may ultimately provide a means for controlling aflatoxin production in the field

  12. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation.

    Science.gov (United States)

    Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K

    2017-07-01

    To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

  13. The Sac10b homolog in Methanococcus maripaludis binds DNA at specific sites.

    Science.gov (United States)

    Liu, Yuchen; Guo, Li; Guo, Rong; Wong, Richard L; Hernandez, Hilda; Hu, Jinchuan; Chu, Yindi; Amster, I Jonathan; Whitman, William B; Huang, Li

    2009-04-01

    The Sac10b protein family, also known as Alba, is widely distributed in Archaea. Sac10b homologs in thermophilic Sulfolobus species are very abundant. They bind both DNA and RNA with high affinity and without sequence specificity, and their physiological functions are still not fully understood. Mma10b from the euryarchaeote Methanococcus maripaludis is a mesophilic member of the Sac10b family. Mma10b is not abundant and constitutes only approximately 0.01% of the total cellular protein. Disruption of mma10b resulted in poor growth of the mutant in minimal medium at near the optimal growth temperature but had no detectable effect on growth in rich medium. Quantitative proteomics, real time reverse transcription-PCR, and enzyme assays revealed that the expression levels of some genes involved in CO(2) assimilation and other activities were changed in the Deltamma10b mutant. Chromatin immunoprecipitation suggested a direct association of Mma10b with an 18-bp DNA binding motif in vivo. Electrophoretic mobility shift assays and DNase I footprinting confirmed that Mma10b preferentially binds specific sequences of DNA with an apparent Kd in the 100 nM range. These results suggested that the physiological role of Mma10b in the mesophilic methanococci is greatly diverged from that of homologs in thermophiles.

  14. Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

    Science.gov (United States)

    Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

    2012-09-01

    FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. [Homology of Staphylococcus aureus isolated from skin lesions and nose of patients with impetigo].

    Science.gov (United States)

    Li, Yun-Zhu; Ma, Lin; Kong, Fan-Rong

    2009-02-01

    To investigate the homology of Staphylococcus aureus (SA) strains isolated from nose and skin lesions of impetigo children. Totally 263 outpatients aged 3 months to 14 years who were seen by the Department of Dermatology of Beijing Children's Hospital between August 2005 and March 2006 were enrolled in this study. The isolations from nose and skin lesions of 58 impetigo children who were randomly selected from these 263 children with spa sequence were typed. The sequence results of SA were analyzed using special websites. There were 106 impetigo patients in these 263 children. The isolation rate of SA was 78.3% in the nose of 106 impetigo patients and was 21.0% in that of the rest 157 patients (P impetigo patients, 30 patients had their primary lesions on the face (including 28 cases of SA nose isolates) and 76 patients had their primary lesions on the other parts of body (including 56 cases of SA nose isolates) (P impetigo patients had the same type pairs of nose and skin. SA isolated from the skin lesions and nose of impetigo patients has remarkably homology. Nasal carriage of SA may be closely relevant with the occurrence of impetigo.

  16. Bacteriophage Nf DNA region controlling late transcription: structural and functional homology with bacteriophage phi 29.

    Science.gov (United States)

    Nuez, B; Salas, M

    1993-06-25

    The putative region for the control of late transcription of the Bacillus subtilis phage Nf has been identified by DNA sequence homology with the equivalent region of the evolutionary related phage phi 29. A similar arrangement of early and late promoters has been detected in the two phages, suggesting that viral transcription could be regulated in a similar way at late times of the infection. Transcription of late genes requires the presence of a viral early protein, gpF in phage Nf and p4 in phage phi 29, being the latter known to bind to a DNA region located upstream from the phage phi 29 late promoter. We have identified a DNA region located upstream from the putative late promoter of phage Nf that is probably involved in binding protein gpF. Furthermore, we show that the phage phi 29 protein p4 is able to bind to this region and activate transcription from the phage Nf putative late promoter. Sequence alignment has also revealed the existence of significant internal homology between the two early promoters contained in this region of each phage.

  17. Assessment of performing an MST strike in Tank 21H

    Energy Technology Data Exchange (ETDEWEB)

    Poirier, Michael R.

    2014-09-29

    Previous Savannah River National Laboratory (SRNL) tank mixing studies performed for the Small Column Ion Exchange (SCIX) project have shown that 3 Submersible Mixer Pumps (SMPs) installed in Tank 41 are sufficient to support actinide removal by MST sorption as well as subsequent resuspension and removal of settled solids. Savannah River Remediation (SRR) is pursuing MST addition into Tank 21 as part of the Large Tank Strike (LTS) project. The preliminary scope for LTS involves the use of three standard slurry pumps (installed in N, SE, and SW risers) in a Type IV tank. Due to the differences in tank size, internal interferences, and pump design, a separate mixing evaluation is required to determine if the proposed configuration will allow for MST suspension and strontium and actinide sorption. The author performed the analysis by reviewing drawings for Tank 21 [W231023] and determining the required cleaning radius or zone of influence for the pumps. This requirement was compared with previous pilot-scale MST suspension data collected for SCIX that determined the cleaning radius, or zone of influence, as a function of pump operating parameters. The author also reviewed a previous Tank 50 mixing analysis that examined the ability of standard slurry pumps to suspend sludge particles. Based on a review of the pilot-scale SCIX mixing tests and Tank 50 pump operating experience, three standard slurry pumps should be able to suspend sludge and MST to effectively sorb strontium and actinides onto the MST. Using the SCIX data requires an assumption about the impact of cooling coils on slurry pump mixing. The basis for this assumption is described in this report. Using the Tank 50 operating experience shows three standard slurry pumps should be able to suspend solids if the shear strength of the settled solids is less than 160 Pa. Because Tank 21 does not contain cooling coils, the shear strength could be larger.

  18. Positive Emotions Associated with "Counter-Strike" Game Playing.

    Science.gov (United States)

    Shin, Mirim; Heard, Rob; Suo, Chao; Chow, Chin Moi

    2012-10-01

    Digital game playing engages people for long periods of time. The pleasure offered by digital games may explain the players' consumption of this activity. Games may elicit both positive and negative emotions, which can be measured by encephalography (EEG). The EEG alpha asymmetry index (AI) is different in positive and negative emotions and so may be used to distinguish positive from negative emotions that occur during gaming. We hypothesized that the "Counter-Strike" (CS) game (Valve Software, Bellevue, WA) is pleasurable and demonstrable with a positive EEG AI. Twelve male participants ages 18-30 years underwent EEG recordings continuously during and postgame. EEG was also recorded pregame for control conditions of baseline (sitting on a chair staring at a blank wall), movement (moving fingers on the computer keyboard with a blank screen), sound (listening to the sound of the CS game with a blank screen), and screen (watching the CS game without playing). Self-ratings of emotional responses were completed at pre-, during, and postgame. A significant decrease in the EEG AI was observed under the screen condition compared with baseline, whereas an increase was observed postgame compared with the screen condition. The participants demonstrated a positive EEG AI following the "shoot" events (shoot opponents) and negative emotions after the "being shot" events. Subjective ratings of emotional response indicated happiness during and postgame, but anger and arousal were reported only during the game. The overall results are consistent with the hypothesis that predominantly positive emotional reactions are elicited from playing the CS game and concur with positive subjective ratings of happiness. Future studies may explore the relationship of game pleasure and obsessive game play.

  19. A homology model of restriction endonuclease SfiI in complex with DNA

    Directory of Open Access Journals (Sweden)

    Skowronek Krzysztof J

    2005-01-01

    Full Text Available Abstract Background Restriction enzymes (REases are commercial reagents commonly used in recombinant DNA technologies. They are attractive models for studying protein-DNA interactions and valuable targets for protein engineering. They are, however, extremely divergent: the amino acid sequence of a typical REase usually shows no detectable similarities to any other proteins, with rare exceptions of other REases that recognize identical or very similar sequences. From structural analyses and bioinformatics studies it has been learned that some REases belong to at least four unrelated and structurally distinct superfamilies of nucleases, PD-DxK, PLD, HNH, and GIY-YIG. Hence, they are extremely hard targets for structure prediction and homology-based inference of sequence-function relationships and the great majority of REases remain structurally and evolutionarily unclassified. Results SfiI is a REase which recognizes the interrupted palindromic sequence 5'GGCCNNNN^NGGCC3' and generates 3 nt long 3' overhangs upon cleavage. SfiI is an archetypal Type IIF enzyme, which functions as a tetramer and cleaves two copies of the recognition site in a concerted manner. Its sequence shows no similarity to other proteins and nothing is known about the localization of its active site or residues important for oligomerization. Using the threading approach for protein fold-recognition, we identified a remote relationship between SfiI and BglI, a dimeric Type IIP restriction enzyme from the PD-DxK superfamily of nucleases, which recognizes the 5'GCCNNNN^NGGC3' sequence and whose structure in complex with the substrate DNA is available. We constructed a homology model of SfiI in complex with its target sequence and used it to predict residues important for dimerization, tetramerization, DNA binding and catalysis. Conclusions The bioinformatics analysis suggest that SfiI, a Type IIF enzyme, is more closely related to BglI, an "orthodox" Type IIP restriction enzyme

  20. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  1. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  2. Feature Selection and the Class Imbalance Problem in Predicting Protein Function from Sequence

    NARCIS (Netherlands)

    Al-Shahib, A.; Breitling, R.; Gilbert, D.

    2005-01-01

    Abstract: When the standard approach to predict protein function by sequence homology fails, other alternative methods can be used that require only the amino acid sequence for predicting function. One such approach uses machine learning to predict protein function directly from amino acid sequence

  3. SEQUENCING AND SEQUENCE ANALYSIS OF MYOSTATIN GENE IN THE EXON 1 OF THE CAMEL (CAMELUS DROMEDARIUS

    Directory of Open Access Journals (Sweden)

    M. G. SHAH, A. S. QURESHI1, M. REISSMANN2 AND H. J. SCHWARTZ3

    2006-10-01

    Full Text Available Myostatin, also called growth differentiation factor-8 (GDF-8, is a member of the mammalian growth transforming family (TGF-beta superfamily, which is expressed specifically in developing an adult skeletal muscle. Muscular hypertrophy allele (mh allele in the double muscle breeds involved mutation within the myostatin gene. Genomic DNA was isolated from the camel hair using NucleoSpin Tissue kit. Two animals of each of the six breeds namely, Marecha, Dhatti, Larri, Kohi, Sakrai and Cambelpuri were used for sequencing. For PCR amplification of the gene, a primer pair was designed from homolog regions of already published sequences of farm animals from GenBank. Results showed that camel myostatin possessed more than 90% homology with that of cattle, sheep and pig. Camel formed separate cluster from the pig in spite of having high homology (98% and showed 94% homology with cattle and sheep as reported in literature. Sequence analysis of the PCR amplified part of exon 1 (256 bp of the camel myostatin was identical among six camel breeds.

  4. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  5. Increased T cell breadth and antibody response elicited in prime-boost regimen by viral vector encoded homologous SIV Gag/Env in outbred CD1 mice

    DEFF Research Database (Denmark)

    Andersson, Anne Marie Carola; Holst, Peter Johannes

    2016-01-01

    ) or homologous (SIVmac239) gag sequences using adenovirus (Ad5) and MVA vectors. Env (SIVmac239) was co-encoded in the vectors to study the induction of antibodies, which is a primary target of current HIV vaccine designs. All three vaccines were designed as virus-encoded virus-like particle vaccines. Antibody...

  6. Meta-analysis of small RNA-sequencing errors reveals ubiquitous post-transcriptional RNA modifications

    OpenAIRE

    Ebhardt, H. Alexander; Tsang, Herbert H.; Dai, Denny C.; Liu, Yifeng; Bostan, Babak; Fahlman, Richard P.

    2009-01-01

    Recent advances in DNA-sequencing technology have made it possible to obtain large datasets of small RNA sequences. Here we demonstrate that not all non-perfectly matched small RNA sequences are simple technological sequencing errors, but many hold valuable biological information. Analysis of three small RNA datasets originating from Oryza sativa and Arabidopsis thaliana small RNA-sequencing projects demonstrates that many single nucleotide substitution errors overlap when aligning homologous...

  7. Along strike variation of active fault arrays and their effect on landscape morphology of the northwestern Himalaya

    Science.gov (United States)

    Nennewitz, Markus; Thiede, Rasmus; Bookhagen, Bodo

    2017-04-01

    location of along strike changes which are interpreted as their segment boundaries. In addition to the steepness indices we use the accumulation of elevation data as a proxy for the strain that has been accumulated over a specific distance. Thus, despite the changes in topography, structural setting, and kinematics along the NW Himalaya we observe that the topography of the orogen is in good agreement with recently measured convergence rates obtained from GPS campaigns. These data suggest reduced crustal shortening towards the northwest. Deformation in the Central Himalaya has been explained either by in-sequence thrusting along the MFT that localize the entire Holocene shortening or a combination of this with out-of-sequence thrusting in the vicinity of the PT2. In contrast to these conceptual models, we propose that the segmented NW Himalaya is a product of the synchronous activity of different fault segments, accommodating the crustal shortening along three independently deforming organic segments. The lateral discontinuity of these segments is responsible for the accommodation of the variation in the deformation and the maintenance of the topography of the Himalaya in NW India.

  8. Application of nonnegative matrix factorization to improve profile-profile alignment features for fold recognition and remote homolog detection

    Directory of Open Access Journals (Sweden)

    Lee Soo-Young

    2008-07-01

    Full Text Available Abstract Background Nonnegative matrix factorization (NMF is a feature extraction method that has the property of intuitive part-based representation of the original features. This unique ability makes NMF a potentially promising method for biological sequence analysis. Here, we apply NMF to fold recognition and remote homolog detection problems. Recent studies have shown that combining support vector machines (SVM with profile-profile alignments improves performance of fold recognition and remote homolog detection remarkably. However, it is not clear which parts of sequences are essential for the performance improvement. Results The performance of fold recognition and remote homolog detection using NMF features is compared to that of the unmodified profile-profile alignment (PPA features by estimating Receiver Operating Characteristic (ROC scores. The overall performance is noticeably improved. For fold recognition at the fold level, SVM with NMF features recognize 30% of homolog proteins at > 0.99 ROC scores, while original PPA feature, HHsearch, and PSI-BLAST recognize almost none. For detecting remote homologs that are related at the superfamily level, NMF features also achieve higher performance than the original PPA features. At > 0.90 ROC50 scores, 25% of proteins with NMF features correctly detects remotely related proteins, whereas using original PPA features only 1% of proteins detect remote homologs. In addition, we investigate the effect of number of positive training examples and the number of basis vectors on performance improvement. We also analyze the ability of NMF to extract essential features by comparing NMF basis vectors with functionally important sites and structurally conserved regions of proteins. The results show that NMF basis vectors have significant overlap with functional sites from PROSITE and with structurally conserved regions from the multiple structural alignments generated by MUSTANG. The correlation between

  9. Chromhome: A rich internet application for accessing comparative chromosome homology maps

    Directory of Open Access Journals (Sweden)

    Cox Tony

    2008-03-01

    Full Text Available Abstract Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome http://www.chromhome.org is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to

  10. Chromhome: A rich internet application for accessing comparative chromosome homology maps

    Science.gov (United States)

    Nagarajan, Sridevi; Rens, Willem; Stalker, James; Cox, Tony; Ferguson-Smith, Malcolm A

    2008-01-01

    Background Comparative genomics has become a significant research area in recent years, following the availability of a number of sequenced genomes. The comparison of genomes is of great importance in the analysis of functionally important genome regions. It can also be used to understand the phylogenetic relationships of species and the mechanisms leading to rearrangement of karyotypes during evolution. Many species have been studied at the cytogenetic level by cross species chromosome painting. With the large amount of such information, it has become vital to computerize the data and make them accessible worldwide. Chromhome is a comprehensive web application that is designed to provide cytogenetic comparisons among species and to fulfil this need. Results The Chromhome application architecture is multi-tiered with an interactive client layer, business logic and database layers. Enterprise java platform with open source framework OpenLaszlo is used to implement the Rich Internet Chromhome Application. Cross species comparative mapping raw data are collected and the processed information is stored into MySQL Chromhome database. Chromhome Release 1.0 contains 109 homology maps from 51 species. The data cover species from 14 orders and 30 families. The homology map displays all the chromosomes of the compared species as one image, making comparisons among species easier. Inferred data also provides maps of homologous regions that could serve as a guideline for researchers involved in phylogenetic or evolution based studies. Conclusion Chromhome provides a useful resource for comparative genomics, holding graphical homology maps of a wide range of species. It brings together cytogenetic data of many genomes under one roof. Inferred painting can often determine the chromosomal homologous regions between two species, if each has been compared with a common third species. Inferred painting greatly reduces the need to map entire genomes and helps focus only on relevant

  11. Pre/post-strike atmospheric assessment system (PAAS)

    International Nuclear Information System (INIS)

    Peglow, S. G.; Molitoris, J. D.

    1997-01-01

    The Pre/Post-Strike Atmospheric Assessment System was proposed to show the importance of local meteorological conditions in the vicinity of a site suspected of storing or producing toxic agents and demonstrate a technology to measure these conditions, specifically wind fields. The ability to predict the collateral effects resulting from an attack on a facility containing hazardous materials is crucial to conducting effective military operations. Our study approach utilized a combination of field measurements with dispersion modeling to better understand which variables in terrain and weather were most important to collateral damage predictions. To develop the PAAS wind-sensing technology, we utilized a combination of emergent and available technology from micro-Doppler and highly coherent laser systems. The method used for wind sensing is to probe the atmosphere with a highly coherent laser beam. As the beam probes, light is back-scattered from particles entrained in the air to the lidar transceiver and detected by the instrument. Any motion of the aerosols with a component along the beam axis leads to a Doppler shift of the received light. Scanning in a conical fashion about the zenith results in a more accurate and two-dimensional measurement of the wind velocity. The major milestones in the benchtop system development were to verify the design by demonstrating the technique in the laboratory, then scale the design down to a size consistent with a demonstrator unit which could be built to take data in the field. The micro-Doppler heterodyne system we developed determines absolute motion by optically mixing a reference beam with the return signal and has shown motion sensitivity to better than 1 cm/s. This report describes the rationale, technical approach and laboratory testing undertaken to demonstrate the feasibility and utility of a system to provide local meteorological data and predict atmospheric particulate motion. The work described herein was funded by

  12. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow, Rutgers University/Georgia Institute of Technology, Michael Schatz, Georgia Institute of Technology, William Kalies, Florida Atlantic University, Thomas Wanner,George Mason University

    2010-05-19

    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  13. Multiscale analysis of nonlinear systems using computational homology

    Energy Technology Data Exchange (ETDEWEB)

    Konstantin Mischaikow; Michael Schatz; William Kalies; Thomas Wanner

    2010-05-24

    This is a collaborative project between the principal investigators. However, as is to be expected, different PIs have greater focus on different aspects of the project. This report lists these major directions of research which were pursued during the funding period: (1) Computational Homology in Fluids - For the computational homology effort in thermal convection, the focus of the work during the first two years of the funding period included: (1) A clear demonstration that homology can sensitively detect the presence or absence of an important flow symmetry, (2) An investigation of homology as a probe for flow dynamics, and (3) The construction of a new convection apparatus for probing the effects of large-aspect-ratio. (2) Computational Homology in Cardiac Dynamics - We have initiated an effort to test the use of homology in characterizing data from both laboratory experiments and numerical simulations of arrhythmia in the heart. Recently, the use of high speed, high sensitivity digital imaging in conjunction with voltage sensitive fluorescent dyes has enabled researchers to visualize electrical activity on the surface of cardiac tissue, both in vitro and in vivo. (3) Magnetohydrodynamics - A new research direction is to use computational homology to analyze results of large scale simulations of 2D turbulence in the presence of magnetic fields. Such simulations are relevant to the dynamics of black hole accretion disks. The complex flow patterns from simulations exhibit strong qualitative changes as a function of magnetic field strength. Efforts to characterize the pattern changes using Fourier methods and wavelet analysis have been unsuccessful. (4) Granular Flow - two experts in the area of granular media are studying 2D model experiments of earthquake dynamics where the stress fields can be measured; these stress fields from complex patterns of 'force chains' that may be amenable to analysis using computational homology. (5) Microstructure

  14. Charting novel allergens from date palm pollen (Phoenix sylvestris) using homology driven proteomics.

    Science.gov (United States)

    Saha, Bodhisattwa; Bhattacharya, Swati Gupta

    2017-08-08

    Pollen grains from Phoenix sylvestris (date palm), a commonly cultivated tree in India has been found to cause severe allergic diseases in an increasing percentage of hypersensitive individuals. To unearth its allergenic components, pollen protein were profiled by two-dimensional gel electrophoresis followed by immunoblotting with date palm pollen sensitive patient sera. Allergens were identified by MALDI-TOF/TOF employing a layered proteomic approach combining conventional database dependent search and manual de novo sequencing followed by homology-based search as Phoenix sylvestris is unsequenced. Derivatization of tryptic peptides by acetylation has been demonstrated to differentiate the 'b' from the 'y' ions facilitating efficient de novo sequencing. Ten allergenic proteins were identified, out of which six showed homology with known allergens while others were reported for the first time. Amongst these, isoflavone reductase, beta-conglycinin, S-adenosyl methionine synthase, 1, 4 glucan synthase and beta-galactosidase were commonly reported as allergens from coconut pollen and presumably responsible for cross-reactivity. One of the allergens had IgE binding epitope recognized by its glycan moiety. The allergenic potency of date palm pollen has been demonstrated using in vitro tests. The identified allergens can be used to develop vaccines for immunotherapy against date palm pollen allergy. Identification of allergenic proteins from sources harboring them is essential in developing therapeutic interventions. This is the first comprehensive study on the identification of allergens from Phoenix sylvestris (date palm) pollen, one of the major aeroallergens in India using a proteomic approach. Proteomic methods are being increasingly used to identify allergens. However, since many of these proteins arise from species which are un-sequenced, it becomes difficult to interpret those using conventional proteomics. Date palm being an unsequenced species, the Ig

  15. Evolution of pH buffers and water homeostasis in eukaryotes: homology between humans and Acanthamoeba proteins.

    Science.gov (United States)

    Baig, Abdul M; Zohaib, R; Tariq, S; Ahmad, H R

    2018-02-01

    This study intended to trace the evolution of acid-base buffers and water homeostasis in eukaryotes. Acanthamoeba castellanii  was selected as a model unicellular eukaryote for this purpose. Homologies of proteins involved in pH and water regulatory mechanisms at cellular levels were compared between humans and A. castellanii. Amino acid sequence homology, structural homology, 3D modeling and docking prediction were done to show the extent of similarities between carbonic anhydrase 1 (CA1), aquaporin (AQP), band-3 protein and H + pump. Experimental assays were done with acetazolamide (AZM), brinzolamide and mannitol to observe their effects on the trophozoites of  A. castellanii.  The human CA1, AQP, band-3 protein and H + -transport proteins revealed similar proteins in Acanthamoeba. Docking showed the binding of AZM on amoebal AQP-like proteins.  Acanthamoeba showed transient shape changes and encystation at differential doses of brinzolamide, mannitol and AZM.  Conclusion: Water and pH regulating adapter proteins in Acanthamoeba and humans show significant homology, these mechanisms evolved early in the primitive unicellular eukaryotes and have remained conserved in multicellular eukaryotes.

  16. The concept of homology as a basis for evaluating developmental mechanisms: exploring selective attention across the life-span.

    Science.gov (United States)

    Lickliter, Robert; Bahrick, Lorraine E

    2013-01-01

    Research with human infants as well as non-human animal embryos and infants has consistently demonstrated the benefits of intersensory redundancy for perceptual learning and memory for redundantly specified information during early development. Studies of infant affect discrimination, face discrimination, numerical discrimination, sequence detection, abstract rule learning, and word comprehension and segmentation have all shown that intersensory redundancy promotes earlier detection of these properties when compared to unimodal exposure to the same properties. Here we explore the idea that such intersensory facilitation is evident across the life-span and that this continuity is an example of a developmental behavioral homology. We present evidence that intersensory facilitation is most apparent during early phases of learning for a variety of tasks, regardless of developmental level, including domains that are novel or tasks that require discrimination of fine detail or speeded responses. Under these conditions, infants, children, and adults all show intersensory facilitation, suggesting a developmental homology. We discuss the challenge and propose strategies for establishing appropriate guidelines for identifying developmental behavioral homologies. We conclude that evaluating the extent to which continuities observed across development are homologous can contribute to a better understanding of the processes of development. Copyright © 2012 Wiley Periodicals, Inc.

  17. The balancing act between the constitutional right to strike and the ...

    African Journals Online (AJOL)

    While the South African Constitution enshrines both children's right to a basic education and teachers' right to strike, conflict between these two often occurs when the way in which teachers' unions conduct strike actions detracts from learners' education. This article identifies the parties affected by industrial action in the ...

  18. Expert Anticipatory Skill in Striking Sports: A Review and a Model

    Science.gov (United States)

    Muller, Sean; Abernethy, Bruce

    2012-01-01

    Expert performers in striking sports can hit objects moving at high speed with incredible precision. Exceptionally well developed anticipation skills are necessary to cope with the severe constraints on interception. In this paper, we provide a review of the empirical evidence regarding expert interception in striking sports and propose a…

  19. Factors affecting defensive strike behavior in Brown Treesnakes (Boiga irregularis) provoked by humans

    Science.gov (United States)

    Spencer, McKayka M.; Lardner, Bjorn; Mazurek, M.J.; Reed, Robert N.

    2015-01-01

    Striking is a typical antipredator defense exhibited by many species of snakes. While trapping Brown Treesnakes (Boiga irregularis) on Guam, we observed that snakes most frequently struck at an approaching person at a site where snakes had been trapped, marked, and handled in the past. Using a combination of between-sites and within-site comparisons, we assessed if the propensity to strike was correlated with capture histories (both recent and long-term), snake size, body condition (a proxy to nutritional stress), sex, or tail condition (broken or intact), while controlling for confounding variables. We confirmed that propensity to strike was higher at the site where we had been conducting capture-mark-recapture for several years. However, we were unable to demonstrate a correlation between striking tendencies and individual recent or long-term capture histories. The only morphological covariate that had an effect on strike propensity was sex, with females striking more often than males. After removing the site effect from our model, we found that snakes missing parts of their tails were more likely to strike than snakes with intact tails. We have yet to identify the factor(s) that cause the pronounced difference across sites in snake propensity to strike, and data from additional sites might help elucidate any geographical patterns.

  20. The dark side of solidarity: social norms and social relations in the aftermath of strikes

    NARCIS (Netherlands)

    Thommes, Kirsten; Akkerman, Agnes; Torenvlied, René; Born, Marieke

    2014-01-01

    This paper studies how employees anticipate change in social relations after a strike in their organisation. We hypothesise that two group norms affect employees' fear that a strike deteriorates the social relations with their colleagues. We distinguish between two different norms associated with a

  1. The dark side of solidarity. The impact of norms on the aftermath of strikes

    NARCIS (Netherlands)

    Thommes, K; Akkerman, A.; Torenvlied, R.

    2014-01-01

    This paper studies how employees anticipate change in social relations after a strike in their organisation. We hypothesise that two group norms affect employees' fear that a strike deteriorates the social relations with their colleagues. We distinguish between two different norms associated with a

  2. Variation in Foot Strike Patterns among Habitually Barefoot and Shod Runners in Kenya.

    Science.gov (United States)

    Lieberman, Daniel E; Castillo, Eric R; Otarola-Castillo, Erik; Sang, Meshack K; Sigei, Timothy K; Ojiambo, Robert; Okutoyi, Paul; Pitsiladis, Yannis

    2015-01-01

    Runners are often categorized as forefoot, midfoot or rearfoot strikers, but how much and why do individuals vary in foot strike patterns when running on level terrain? This study used general linear mixed-effects models to explore both intra- and inter-individual variations in foot strike pattern among 48 Kalenjin-speaking participants from Kenya who varied in age, sex, body mass, height, running history, and habitual use of footwear. High speed video was used to measure lower extremity kinematics at ground contact in the sagittal plane while participants ran down 13 meter-long tracks with three variables independently controlled: speed, track stiffness, and step frequency. 72% of the habitually barefoot and 32% of the habitually shod participants used multiple strike types, with significantly higher levels of foot strike variation among individuals who ran less frequently and who used lower step frequencies. There was no effect of sex, age, height or weight on foot strike angle, but individuals were more likely to midfoot or forefoot strike when they ran on a stiff surface, had a high preferred stride frequency, were habitually barefoot, and had more experience running. It is hypothesized that strike type variation during running, including a more frequent use of forefoot and midfoot strikes, used to be greater before the introduction of cushioned shoes and paved surfaces.

  3. The Balancing Act between the Constitutional Right to Strike and the Constitutional Right to Education

    Science.gov (United States)

    Deacon, H. J.

    2014-01-01

    While the South African Constitution enshrines both children's right to a basic education and teachers' right to strike, conflict between these two often occurs when the way in which teachers' unions conduct strike actions detracts from learners' education. This article identifies the parties affected by industrial action in the school context,…

  4. The Implications of Granting New Jersey Teachers the Right to Strike: A Public Policy Statement.

    Science.gov (United States)

    Lisella, Carmine; Schwartz, Patricia

    Strikes are generally accepted as legitimate prerogatives of employees bargaining with employers in the private sector. Two broad questions must be answered when considering whether the right to strike should be granted public employees, including teachers. First, what are the distinctions between the public and private sectors that can reasonably…

  5. Are physicians' strikes ever morally justifiable? A call for a return to ...

    African Journals Online (AJOL)

    Though physicians strike provides an opportunity to generate more knowledge about the process in which legitimacy of an organization can be restored, it meets with a great deal of resistance not only by the public but from within the medical profession. This paper critically examines the legitimacy of strike by medical ...

  6. Major Burn Injury From Lightning Strike: A Case Report and Review ...

    African Journals Online (AJOL)

    BACKGROUND: Lightning has been viewed as a sign of the anger of the “gods” from Greek mythology. Among Yorubas, thunderstorm is regarded as anger from the god of thunder, “Sango” who could strike anybody anywhere to vent his anger at someone who has committed some form of atrocity. When lightning strikes, it ...

  7. Strike type variation among Tarahumara Indians in minimal sandals versus conventional running shoes

    Directory of Open Access Journals (Sweden)

    Daniel E. Lieberman

    2014-06-01

    Conclusion: These data reinforce earlier studies that there is variation among foot strike patterns among minimally shod runners, but also support the hypothesis that foot stiffness and important aspects of running form, including foot strike, differ between runners who grow up using minimal versus modern, conventional footwear.

  8. A rapid assessment of species-specific bird strike risk at the Kotoka ...

    African Journals Online (AJOL)

    A rapid assessment of species-specific bird strike risk at the Kotoka International Airport in Accra, Ghana. ... We conclude that wildlife management to avert the risk of bird strikes could be successfully achieved by adopting both proactive and reactive measures to reduce the presence of problem species at the aerodrome.

  9. Lightning Strikes and Thunder Claps: The Strategic Bomber and Air Superiority

    Science.gov (United States)

    2012-12-01

    Views November–December 2012 Air & Space Power Journal | 137 Lightning Strikes and Thunder Claps The Strategic Bomber and Air Superiority Maj Wade S...2012 to 00-00-2012 4. TITLE AND SUBTITLE Lightning Strikes and Thunder Claps: The Strategic Bomber and Air Superiority 5a. CONTRACT NUMBER 5b

  10. Variation in Foot Strike Patterns among Habitually Barefoot and Shod Runners in Kenya.

    Directory of Open Access Journals (Sweden)

    Daniel E Lieberman

    Full Text Available Runners are often categorized as forefoot, midfoot or rearfoot strikers, but how much and why do individuals vary in foot strike patterns when running on level terrain? This study used general linear mixed-effects models to explore both intra- and inter-individual variations in foot strike pattern among 48 Kalenjin-speaking participants from Kenya who varied in age, sex, body mass, height, running history, and habitual use of footwear. High speed video was used to measure lower extremity kinematics at ground contact in the sagittal plane while participants ran down 13 meter-long tracks with three variables independently controlled: speed, track stiffness, and step frequency. 72% of the habitually barefoot and 32% of the habitually shod participants used multiple strike types, with significantly higher levels of foot strike variation among individuals who ran less frequently and who used lower step frequencies. There was no effect of sex, age, height or weight on foot strike angle, but individuals were more likely to midfoot or forefoot strike when they ran on a stiff surface, had a high preferred stride frequency, were habitually barefoot, and had more experience running. It is hypothesized that strike type variation during running, including a more frequent use of forefoot and midfoot strikes, used to be greater before the introduction of cushioned shoes and paved surfaces.

  11. Labor Conflict on the National Stage: Metaphoric Lenses in Israel's Teachers' Strike

    Science.gov (United States)

    Shenkar, Miriam; Shenkar, Oded

    2011-01-01

    Teachers often embed their labor demands within a broader context to claim high moral ground and build community support. We analyze a recent teachers' strike in Israel, looking at how the strike played out in a country where the challenges of globalization collided with a socialist legacy in the face of an existential threat. The analysis reveals…

  12. Photonic reagent control of dynamically homologous quantum systems

    International Nuclear Information System (INIS)

    Beltrani, Vincent; Dominy, Jason; Ho, Tak-San; Rabitz, Herschel

    2007-01-01

    The general objective of quantum control is the manipulation of atomic scale physical and chemical phenomena through the application of external control fields. These tailored fields, or photonic reagents, exhibit systematic properties analogous to those of ordinary laboratory reagents. This analogous behavior is explored further here by considering the controlled response of a family of homologous quantum systems to a single common photonic reagent. A level set of dynamically homologous quantum systems is defined as the family that produces the same value(s) for a target physical observable(s) when controlled by a common photonic reagent. This paper investigates the scope of homologous quantum system control using the level set exploration technique (L-SET). L-SET enables the identification of continuous families of dynamically homologous quantum systems. Each quantum system is specified by a point in a hypercube whose edges are labeled by Hamiltonian matrix elements. Numerical examples are presented with simple finite level systems to illustrate the L-SET concepts. Both connected and disconnected families of dynamically homologous systems are shown to exist

  13. Primary homologies of the circumorbital bones of snakes.

    Science.gov (United States)

    Palci, Alessandro; Caldwell, Michael W

    2013-09-01

    Some snakes have two circumorbital ossifications that in the current literature are usually referred to as the postorbital and supraorbital. We review the arguments that have been proposed to justify this interpretation and provide counter-arguments that reject those conjectures of primary homology based on the observation of 32 species of lizards and 81 species of snakes (both extant and fossil). We present similarity arguments, both topological and structural, for reinterpretation of the primary homologies of the dorsal and posterior orbital ossifications of snakes. Applying the test of similarity, we conclude that the posterior orbital ossification of snakes is topologically consistent as the homolog of the lacertilian jugal, and that the dorsal orbital ossification present in some snakes (e.g., pythons, Loxocemus, and Calabaria) is the homolog of the lacertilian postfrontal. We therefore propose that the terms postorbital and supraorbital should be abandoned as reference language for the circumorbital bones of snakes, and be replaced with the terms jugal and postfrontal, respectively. The primary homology claim for the snake "postorbital" fails the test of similarity, while the term "supraorbital" is an unnecessary and inaccurate application of the concept of a neomorphic ossification, for an element that passes the test of similarity as a postfrontal. This reinterpretation of the circumorbital bones of snakes is bound to have important repercussions for future phylogenetic analyses and consequently for our understanding of the origin and evolution of snakes. Copyright © 2013 Wiley Periodicals, Inc.

  14. Three homologous genes encoding sn-glycerol-3-phosphate acyltransferase 4 exhibit different expression patterns and functional divergence in Brassica napus.

    Science.gov (United States)

    Chen, Xue; Truksa, Martin; Snyder, Crystal L; El-Mezawy, Aliaa; Shah, Saleh; Weselake, Randall J

    2011-02-01

    Brassica napus is an allotetraploid (AACC) formed from the fusion of two diploid progenitors, Brassica rapa (AA) and Brassica oleracea (CC). Polyploidy and genome-wide rearrangement during the evolution process have resulted in genes that are present as multiple homologs in the B. napus genome. In this study, three B. napus homologous genes encoding endoplasmic reticulum-bound sn-glycerol-3-phosphate acyltransferase 4 (GPAT4) were identified and characterized. Although the three GPAT4 homologs share a high sequence similarity, they exhibit different expression patterns and altered epigenetic features. Heterologous expression in yeast further revealed that the three BnGPAT4 homologs encoded functional GPAT enzymes but with different levels of polypeptide accumulation. Complementation of the Arabidopsis (Arabidopsis thaliana) gpat4 gpat8 double mutant line with individual BnGPAT4 homologs suggested their physiological roles in cuticle formation. Analysis of gpat4 RNA interference lines of B. napus revealed that the BnGPAT4 deficiency resulted in reduced cutin content and altered stomatal structures in leaves. Our results revealed that the BnGPAT4 homologs have evolved into functionally divergent forms and play important roles in cutin synthesis and stomatal development.

  15. HOMOLOGY BETWEEN SEGMENTS OF HUMAN HEMOSTATIC PROTEINS AND PROTEINS OF VIRUSES WHICH CAUSE ACUTE RESPIRATORY INFECTIONS OR DISEASES WITH SIMILAR SYMPTOMS

    Directory of Open Access Journals (Sweden)

    I. N. Zhilinskaya

    2017-01-01

    Full Text Available Objectives: To identify homologous segments of human hemostatic and viral proteins and to assess the role of human hemostatic proteins in viral replication. Materials and Methods: The following viruses were chosen for comparison: influenza B (B/Astrakhan/2/2017, coronaviruses (Hcov229E and SARS-Co, type 1 adenovirus (adenoid 71, measles (ICHINOSE-BA and rubella (Therien. The primary structures of viral proteins and 41 human hemostatic proteins were obtained from open–access www.ncbi.nlm.nih. gov and www.nextprot.org databases, respectively. Sequence homology was determined by comparing 12-amino-acid segments. Those sequences identical in ≥ 8 positions were considered homologous. Results: The analysis shows that viral proteins contain segments which mimic a number of human hemostatic proteins. Most of these segments, except those of adenovirus proteins, are homologous with coagulation factors. The increase in viral virulence, as in case of SARS-Co, correlates with an increased number of segments homologous with hemostatic proteins. Conclusion: Hemostasis plays an important role in viral replication and pathogenesis. The conclusion is consistent with the literature data about the relationship of hemostasis and inflammatory response to viral infections.

  16. Eps 15 Homology Domain (EHD-1 Remodels Transverse Tubules in Skeletal Muscle.

    Directory of Open Access Journals (Sweden)

    Alexis R Demonbreun

    Full Text Available We previously showed that Eps15 homology domain-containing 1 (EHD1 interacts with ferlin proteins to regulate endocytic recycling. Myoblasts from Ehd1-null mice were found to have defective recycling, myoblast fusion, and consequently smaller muscles. When expressed in C2C12 cells, an ATPase dead-EHD1 was found to interfere with BIN1/amphiphysin 2. We now extended those findings by examining Ehd1-heterozygous mice since these mice survive to maturity in normal Mendelian numbers and provide a ready source of mature muscle. We found that heterozygosity of EHD1 was sufficient to produce ectopic and excessive T-tubules, including large intracellular aggregates that contained BIN1. The disorganized T-tubule structures in Ehd1-heterozygous muscle were accompanied by marked elevation of the T-tubule-associated protein DHPR and reduction of the triad linker protein junctophilin 2, reflecting defective triads. Consistent with this, Ehd1-heterozygous muscle had reduced force production. Introduction of ATPase dead-EHD1 into mature muscle fibers was sufficient to induce ectopic T-tubule formation, seen as large BIN1 positive structures throughout the muscle. Ehd1-heterozygous mice were found to have strikingly elevated serum creatine kinase and smaller myofibers, but did not display findings of muscular dystrophy. These data indicate that EHD1 regulates the maintenance of T-tubules through its interaction with BIN1 and links T-tubules defects with elevated creatine kinase and myopathy.

  17. The chloroplast triggers developmental reprogramming when mutS HOMOLOG1 is suppressed in plants.

    Science.gov (United States)

    Xu, Ying-Zhi; Santamaria, Roberto de la Rosa; Virdi, Kamaldeep S; Arrieta-Montiel, Maria P; Razvi, Fareha; Li, Shaoqing; Ren, Guodong; Yu, Bin; Alexander, Danny; Guo, Lining; Feng, Xuehui; Dweikat, Ismail M; Clemente, Tom E; Mackenzie, Sally A

    2012-06-01

    Multicellular eukaryotes demonstrate nongenetic, heritable phenotypic versatility in their adaptation to environmental changes. This inclusive inheritance is composed of interacting epigenetic, maternal, and environmental factors. Yet-unidentified maternal effects can have a pronounced influence on plant phenotypic adaptation to changing environmental conditions. To explore the control of phenotypy in higher plants, we examined the effect of a single plant nuclear gene on the expression and transmission of phenotypic variability in Arabidopsis (Arabidopsis thaliana). MutS HOMOLOG1 (MSH1) is a plant-specific nuclear gene product that functions in both mitochondria and plastids to maintain genome stability. RNA interference suppression of the gene elicits strikingly similar programmed changes in plant growth pattern in six different plant species, changes subsequently heritable independent of the RNA interference transgene. The altered phenotypes reflect multiple pathways that are known to participate in adaptation, including altered phytohormone effects for dwarfed growth and reduced internode elongation, enhanced branching, reduced stomatal density, altered leaf morphology, delayed flowering, and extended juvenility, with conversion to perennial growth pattern in short days. Some of these effects are partially reversed with the application of gibberellic acid. Genetic hemicomplementation experiments show that this phenotypic plasticity derives from changes in chloroplast state. Our results suggest that suppression of MSH1, which occurs under several forms of abiotic stress, triggers a plastidial response process that involves nongenetic inheritance.

  18. Developing personal values: trainees' attitudes toward strikes by health care providers.

    Science.gov (United States)

    Li, Su-Ting T; Srinivasan, Malathi; Der-Martirosian, Claudia; Kravitz, Richard L; Wilkes, Michael S

    2011-05-01

    Worldwide, health care providers use strikes and job actions to influence policy. For health care providers, especially physicians, strikes create an ethical tension between an obligation to care for current patients (e.g., to provide care and avoid abandonment) and an obligation to better care for future patients by seeking system improvements (e.g., improvements in safety, to access, and in the composition and strength of the health care workforce). This tension is further intensified when the potential benefit of a strike involves professional self-interest and the potential risk involves patient harm or death. By definition, trainees are still forming their professional identities and values, including their opinions on fair wages, health policy, employee benefits, professionalism, and strikes. In this article, the authors explore these ethical tensions, beginning with a discussion of reactions to a potential 2005 nursing strike at the University of California, Davis, Medical Center. The authors then propose a conceptual model describing factors that may influence health care providers' decisions to strike (including personal ethics, personal agency, and strike-related context). In particular, the authors explore the relationship between training level and attitudes toward taking a job action, such as going on strike. Because trainees' attitudes toward strikes continue to evolve during training, the authors maintain that open discussion around the ethics of health care professionals' strikes and other methods of conflict resolution should be included in medical education to enhance professionalism and systems-based practice training. The authors include sample case vignettes to help initiate these important discussions. Copyright © by the Association of American medical Colleges.

  19. A discriminative method for protein remote homology detection and fold recognition combining Top-n-grams and latent semantic analysis.

    Science.gov (United States)

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2008-12-01

    Protein remote homology detection and fold recognition are central problems in bioinformatics. Currently, discriminative methods based on support vector machine (SVM) are the most effective and accurate methods for solving these problems. A key step to improve the performance of the SVM-based methods is to find a suitable representation of protein sequences. In this paper, a novel building block of proteins called Top-n-grams is presented, which contains the evolutionary information extracted from the protein sequence frequency profiles. The protein sequence frequency profiles are calculated from the multiple sequence alignments outputted by PSI-BLAST and converted into Top-n-grams. The protein sequences are transformed into fixed-dimension feature vectors by the occurrence times of each Top-n-gram. The training vectors are evaluated by SVM to train classifiers which are then used to classify the test protein sequences. We demonstrate that the prediction performance of remote homology detection and fold recognition can be improved by combining Top-n-grams and latent semantic analysis (LSA), which is an efficient feature extraction technique from natural language processing. When tested on superfamily and fold benchmarks, the method combining Top-n-grams and LSA gives significantly better results compared to related methods. The method based on Top-n-grams significantly outperforms the methods based on many other building blocks including N-grams, patterns, motifs and binary profiles. Therefore, Top-n-gram is a good building block of the protein sequences and can be widely used in many tasks of the computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the prediction of protein binding sites.

  20. Lower bounds for homological dimensions of Banach algebras

    International Nuclear Information System (INIS)

    Selivanov, Yurii V

    2007-01-01

    Let A be a commutative unital Banach algebra with infinite spectrum. Then by Helemskii's global dimension theorem the global homological dimension of A is strictly greater than one. This estimate has no analogue for abstract algebras or non-normable topological algebras. It is proved in the present paper that for every unital Banach algebra B the global homological dimensions and the homological bidimensions of the Banach algebras A widehat-otimes B and B (assuming certain restrictions on A) are related by A widehat-otimes B≥2 + dg B and A widehat-otimes B≥2 + db B. Thus, a partial extension of Helemskii's theorem to tensor products is obtained. Bibliography: 28 titles.

  1. Using Persistent Homology to Describe Rayleigh-Bénard Convection

    Science.gov (United States)

    Tithof, Jeffrey; Suri, Balachandra; Xu, Mu; Kramar, Miroslav; Levanger, Rachel; Mischaikow, Konstantin; Paul, Mark; Schatz, Michael

    2015-11-01

    Complex spatial patterns that exhibit aperiodic dynamics commonly arise in a wide variety of systems in nature and technology. Describing, understanding, and predicting the behavior of such patterns is an open problem. We explore the use of persistent homology (a branch of algebraic topology) to characterize spatiotemporal dynamics in a canonical fluid mechanics problem, Rayleigh Bénard convection. Persistent homology provides a powerful mathematical formalism in which the topological characteristics of a pattern (e.g. the midplane temperature field) are encoded in a so-called persistence diagram. By applying a metric to measure the pairwise distances across multiple persistence diagrams, we can quantify the similarities between different states in a time series. Our results show that persistent homology yields new physical insights into the complex dynamics of large spatially extended systems that are driven far-from-equilibrium. This work is supported under NSF grant DMS-1125302.

  2. The cohesion protein SOLO associates with SMC1 and is required for synapsis, recombination, homolog bias and cohesion and pairing of centromeres in Drosophila Meiosis.

    Directory of Open Access Journals (Sweden)

    Rihui Yan

    Full Text Available Cohesion between sister chromatids is mediated by cohesin and is essential for proper meiotic segregation of both sister chromatids and homologs. solo encodes a Drosophila meiosis-specific cohesion protein with no apparent sequence homology to cohesins that is required in male meiosis for centromere cohesion, proper orientation of sister centromeres and centromere enrichment of the cohesin subunit SMC1. In this study, we show that solo is involved in multiple aspects of meiosis in female Drosophila. Null mutations in solo caused the following phenotypes: 1 high frequencies of homolog and sister chromatid nondisjunction (NDJ and sharply reduced frequencies of homolog exchange; 2 reduced transmission of a ring-X chromosome, an indicator of elevated frequencies of sister chromatid exchange (SCE; 3 premature loss of centromere pairing and cohesion during prophase I, as indicated by elevated foci counts of the centromere protein CID; 4 instability of the lateral elements (LEs and central regions of synaptonemal complexes (SCs, as indicated by fragmented and spotty staining of the chromosome core/LE component SMC1 and the transverse filament protein C(3G, respectively, at all stages of pachytene. SOLO and SMC1 are both enriched on centromeres throughout prophase I, co-align along the lateral elements of SCs and reciprocally co-immunoprecipitate from ovarian protein extracts. Our studies demonstrate that SOLO is closely associated with meiotic cohesin and required both for enrichment of cohesin on centromeres and stable assembly of cohesin into chromosome cores. These events underlie and are required for stable cohesion of centromeres, synapsis of homologous chromosomes, and a recombination mechanism that suppresses SCE to preferentially generate homolog crossovers (homolog bias. We propose that SOLO is a subunit of a specialized meiotic cohesin complex that mediates both centromeric and axial arm cohesion and promotes homolog bias as a component of

  3. Khovanov-Rozansky Graph Homology and Composition Product

    DEFF Research Database (Denmark)

    Wagner, Emmanuel

    2008-01-01

    In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology.......In analogy with a recursive formula for the HOMFLY-PT polynomial of links given by Jaeger, we give a recursive formula for the graph polynomial introduced by Kauffman and Vogel. We show how this formula extends to the Khovanov–Rozansky graph homology....

  4. Even with nonnative interactions, the updated folding transition states of the homologs Proteins G & L are extensive and similar.

    Science.gov (United States)

    Baxa, Michael C; Yu, Wookyung; Adhikari, Aashish N; Ge, Liang; Xia, Zhen; Zhou, Ruhong; Freed, Karl F; Sosnick, Tobin R

    2015-07-07

    Experimental and computational folding studies of Proteins L & G and NuG2 typically find that sequence differences determine which of the two hairpins is formed in the transition state ensemble (TSE). However, our recent work on Protein L finds that its TSE contains both hairpins, compelling a reassessment of the influence of sequence on the folding behavior of the other two homologs. We characterize the TSEs for Protein G and NuG2b, a triple mutant of NuG2, using ψ analysis, a method for identifying contacts in the TSE. All three homologs are found to share a common and near-native TSE topology with interactions between all four strands. However, the helical content varies in the TSE, being largely absent in Proteins G & L but partially present in NuG2b. The variability likely arises from competing propensities for the formation of nonnative β turns in the naturally occurring proteins, as observed in our TerItFix folding algorithm. All-atom folding simulations of NuG2b recapitulate the observed TSEs with four strands for 5 of 27 transition paths [Lindorff-Larsen K, Piana S, Dror RO, Shaw DE (2011) Science 334(6055):517-520]. Our data support the view that homologous proteins have similar folding mechanisms, even when nonnative interactions are present in the transition state. These findings emphasize the ongoing challenge of accurately characterizing and predicting TSEs, even for relatively simple proteins.

  5. Induction of human immunodeficiency virus (HIV-1 envelope specific cell-mediated immunity by a non-homologous synthetic peptide.

    Directory of Open Access Journals (Sweden)

    Ammar Achour

    2007-11-01

    Full Text Available Cell mediated immunity, including efficient CTL response, is required to prevent HIV-1 from cell-to-cell transmission. In previous investigations, we have shown that B1 peptide derived by Fourier transformation of HIV-1 primary structures and sharing no sequence homology with the parent proteins was able to generate antiserum which recognizes envelope and Tat proteins. Here we have investigated cellular immune response towards a novel non-homologous peptide, referred to as cA1 peptide.The 20 amino acid sequence of cA1 peptide was predicted using the notion of peptide hydropathic properties; the peptide is encoded by the complementary anti-sense DNA strand to the sense strand of previously described non-homologous A1 peptide. In this report we demonstrate that the cA1 peptide can be a target for major histocompatibility complex (MHC class I-restricted cytotoxic T lymphocytes in HIV-1-infected or envelope-immunized individuals. The cA1 peptide is recognized in association with different MHC class I allotypes and could prime in vitro CTLs, derived from gp160-immunized individuals capable to recognize virus variants.For the first time a theoretically designed immunogen involved in broad-based cell-immune memory activation is described. Our findings may thus contribute to the advance in vaccine research by describing a novel strategy to develop a synthetic AIDS vaccine.

  6. Regulation of highly homologous major urinary proteins in house mice quantified with label-free proteomic methods? ?Electronic supplementary information (ESI) available. See DOI: 10.1039/c6mb00278a Click here for additional data file.

    OpenAIRE

    Enk, Viktoria M.; Baumann, Christian; Tho?, Michaela; Luzynski, Kenneth C.; Razzazi-Fazeli, Ebrahim; Penn, Dustin J.

    2016-01-01

    Major urinary proteins (MUPs) are highly homologous proteoforms that function in binding, transporting and releasing pheromones in house mice. The main analytical challenge for studying variation in MUPs, even for state-of-the-art proteomics techniques, is their high degree of amino acid sequence homology. In this study we used unique peptides for proteoform-specific identification. We applied different search engines (ProteinPilot? vs. PEAKS?) and protein databases (MUP database vs. SwissPro...

  7. [Prevalence and homology analysis on human and animals severe fever with thrombocytopenia syndrome virus infection in Yantai of Shandong province].

    Science.gov (United States)

    Gong, Lianfeng; Jiang, Mei; Liu, Juan; Han, Wenqing; Liu, Jingyu; Sun, Zhenlu; Wang, Zhiyu; Gao, Qiao; Xing, Yufang; Ding, Shujun; Wang, Xianjun

    2014-05-01

    To learn the prevalence of infection of human and animals severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) in Yantai, Shandong province, and to analyze the pathogenic features of SFTSV as well as its relationship between human and animal hosts. From April to November in 2011, 3 576 serum samples were collected from domesticated animals, including sheep, cattle, pigs, dogs, chickens, in Laizhou and Penglai areas where fever with thrombocytopenia syndrome frequently occurred among local residents. Total SFTSV antibodies and virus-specific nucleic acids of the serum were tested by ELISA and Real time RT-PCR, respectively. SFTSV infection on each animal was observed in different months. 2 590 human serum samples were also collected in Laizhou and Penglai areas, with IgG antibodies tested by ELISA. Virus was isolated with Vero cells from the serum which SFTSV viral nucleic acids were positive. S fragments were amplified by RT-PCR and sequenced, with homology analysis conducted on these sequences. The overall positive rate of serum samples from animals on the total SFTSV antibodies was 40.24% (1 439/3 576) while the positive rate for specific nucleic acids was 4.56% (163/3 576). The positive rates for SFTSV antibodies were 62.78%, 52.97%, 45.56%, 28.73%, 1.45% and the positive rates for specific nucleic acids were 5.72%, 4.63%, 3.02%, 5.25% and 3.73%, in sheep, cattle, chickens, dogs, pigs, respectively. The antigens/antibodies for SFTSV in animals changed seasonally. The overall positive rate for SFTSV IgG antibody from 2 590 human samples was 5.41%. Thirteen virus strains were isolated from these serum samples (10 strains from human and 3 strains from animals). The nucleotide homology of 13S fragments' sequences ranged from 95.23% to 100.00% and the nucleotide homology with the isolates from other provinces were between 94.72% and 99.13%. The homology was considered to be high. High prevalence of SFTSV infections occurred both in human and domestic

  8. PXA1, a putative S. cerevisiae homolog of the human adrenoleukyodystrophy gene

    Energy Technology Data Exchange (ETDEWEB)

    Shani, N.; Watkins, P.A.; Valle, D. [Johns Hopkins Univ. School of Medicine, Baltimore, MD (United States)

    1994-09-01

    The adrenoleukodystrophy protein (ALDP) and the 70 kD peroxisomal membrane protein (PMP70) are ATP-binding cassette transporters in the peroxisome membrane. The former is defective in X-linked adrenoleukodystrophy (ALD), a neurodegenerative disorder with defective peroxisome oxidation of very long chain fatty acids; the latter is implicated in Zellweger syndrome, a defect in peroxisome biogenesis. The functions and interactions of ALDP and PMP70 in the peroxisomal membrane are not known. To develop a system in which these questions could be addressed, we sought to clone their yeast homologs. Using RT/PCR with degenerate primers and oleic acid (C18:1) induced yeast RNA as template, we amplified a cDNA segment corresponding to a conserved region of ALDP and PMP70. By sequencing amplified products, we found one with homology to both proteins and used it to clone the corresponding full length yeast gene (PXA1). PXA1 encodes a 758 amino acid protein with 28% and 21% overall identity to ALDP and PMP70, respectively which increases to 47% and 39% in a C terminal region of 178 amino acids. The PXA1 protein precipitates with peroxisomes as shown by immunoblot analysis of cell fractionation gradients. Disruption of PXA1 by homologous recombination results in impaired growth on oleic acid and reduced ability to oxidize oleate. The growth phenotype can be corrected by expression of the wild type PXA1 in the mutant strain. Peroxisomes in the PXA1 mutant yeast strain are intact as judged by catalase distribution and electron microscopy. Given the amino acid similarity, fatty acid oxidation defect and lack of an effect on peroxisomal integrity, we hypothesize that PXA1 may be the yeast ortholog of ALDP. Complementation studies to examine this hypothesis are in progress.

  9. Propagation of strike-slip faults across Holocene volcano-sedimentary deposits, Pasto, Colombia

    Science.gov (United States)

    Rovida, Andrea; Tibaldi, Alessandro

    2005-10-01

    This study contributes to the understanding of shear failure development on the basis of macroscopic field data collected in latest Pleistocene-Holocene pyroclastic and fluvio-lacustrine deposits in the Pasto Valley, SW Colombia. Here there is a pervasive system of microfaults and joints. Right-lateral strike-slip microfaults strike N065°, whereas left-lateral strike-slip microfaults strike N120°. Three main joint sets strike N, N065° and N020° in decreasing order of frequency. Stress computation gives a horizontal σ1 trending ˜N060° and a horizontal σ3 trending ˜N150°, consistent with earthquake focal mechanisms and stress inversion of main faults. Synthetic shears dominate resulting from nucleation of older cracks. In the basement cropping out northeast of Pasto, the NE- to ENE-striking Buesaco, Aranda and Pasto Faults show evidence of latest Pleistocene-Holocene right-lateral strike-slip motions. The structures in the Pasto Valley can be interpreted as a Mode III damage zone representing the up-dip propagation of the main faults across the young volcano-sedimentary deposits.

  10. Collective Labor Disputes and Strikes in Russia: The Impact of Judicial Precedents and Enforcement

    Directory of Open Access Journals (Sweden)

    Elena Gerasimova

    2017-01-01

    Full Text Available The right to strike is recognized in the Constitution and the Labor Code of the Russian Federation as a means to resolve collective labor disputes. However, in Russia labor protests come up for discussion much more frequently than strikes. In recent years the number of labor protests in Russia, including various forms of work stoppage, has increased significantly compared to previous years, but the number of legally constituted collective labor disputes and strikes has remained very low. The legislation on resolution of collective labor disputes and mounting strikes is quite restrictive in Russia, and its enforcement also encourages employees to seek alternative ways to settle collective labor conflicts. There is little empirical research on the judicial implementation of these norms and its influence on the enforcement of legislation. Therefore, this paper analyses the reasoning of courts in cases on the legality of strikes, their interpretations of the law, and the impact these decisions have on the enforcement of the legislation on resolution of collective labor disputes and strikes. Our conclusion is that the courts act as another restrictive influence on the resolution of collective labor disputes and the exercise of the right to strike in Russia.

  11. A simple field method to identify foot strike pattern during running.

    Science.gov (United States)

    Giandolini, Marlène; Poupard, Thibaut; Gimenez, Philippe; Horvais, Nicolas; Millet, Guillaume Y; Morin, Jean-Benoît; Samozino, Pierre

    2014-05-07

    Identifying foot strike patterns in running is an important issue for sport clinicians, coaches and footwear industrials. Current methods allow the monitoring of either many steps in laboratory conditions or only a few steps in the field. Because measuring running biomechanics during actual practice is critical, our purpose is to validate a method aiming at identifying foot strike patterns during continuous field measurements. Based on heel and metatarsal accelerations, this method requires two uniaxial accelerometers. The time between heel and metatarsal acceleration peaks (THM) was compared to the foot strike angle in the sagittal plane (αfoot) obtained by 2D video analysis for various conditions of speed, slope, footwear, foot strike and state of fatigue. Acceleration and kinematic measurements were performed at 1000Hz and 120Hz, respectively, during 2-min treadmill running bouts. Significant correlations were observed between THM and αfoot for 14 out of 15 conditions. The overall correlation coefficient was r=0.916 (Pfoot strike except for extreme forefoot strike during which the heel rarely or never strikes the ground, and for different footwears and states of fatigue. We proposed a classification based on THM: FFS<-5.49ms

  12. A computational approach to discovering the functions of bacterial phytochromes by analysis of homolog distributions

    Directory of Open Access Journals (Sweden)

    Lamparter Tilman

    2006-03-01

    Full Text Available Abstract Background Phytochromes are photoreceptors, discovered in plants, that control a wide variety of developmental processes. They have also been found in bacteria and fungi, but for many species their biological role remains obscure. This work concentrates on the phytochrome system of Agrobacterium tumefaciens, a non-photosynthetic soil bacterium with two phytochromes. To identify proteins that might share common functions with phytochromes, a co-distribution analysis was performed on the basis of protein sequences from 138 bacteria. Results A database of protein sequences from 138 bacteria was generated. Each sequence was BLASTed against the entire database. The homolog distribution of each query protein was then compared with the homolog distribution of every other protein (target protein of the same species, and the target proteins were sorted according to their probability of co-distribution under random conditions. As query proteins, phytochromes from Agrobacterium tumefaciens, Pseudomonas aeruginosa, Deinococcus radiodurans and Synechocystis PCC 6803 were chosen along with several phytochrome-related proteins from A. tumefaciens. The Synechocystis photosynthesis protein D1 was selected as a control. In the D1 analyses, the ratio between photosynthesis-related proteins and those not related to photosynthesis among the top 150 in the co-distribution tables was > 3:1, showing that the method is appropriate for finding partner proteins with common functions. The co-distribution of phytochromes with other histidine kinases was remarkably high, although most co-distributed histidine kinases were not direct BLAST homologs of the query protein. This finding implies that phytochromes and other histidine kinases share common functions as parts of signalling networks. All phytochromes tested, with one exception, also revealed a remarkably high co-distribution with glutamate synthase and methionine synthase. This result implies a general role of

  13. Silencing the lettuce homologs of small rubber particle protein does not influence natural rubber biosynthesis in lettuce (Lactuca sativa).

    Science.gov (United States)

    Chakrabarty, Romit; Qu, Yang; Ro, Dae-Kyun

    2015-05-01

    Natural rubber, cis-1,4-polyisoprene, is an important raw material in chemical industries, but its biosynthetic mechanism remains elusive. Natural rubber is known to be synthesized in rubber particles suspended in laticifer cells in the Brazilian rubber tree (Hevea brasiliensis). In the rubber tree, rubber elongation factor (REF) and its homolog, small rubber particle protein (SRPP), were found to be the most abundant proteins in rubber particles, and they have been implicated in natural rubber biosynthesis. As lettuce (Lactuca sativa) can synthesize natural rubber, we utilized this annual, transformable plant to examine in planta roles of the lettuce REF/SRPP homologs by RNA interference. Among eight lettuce REF/SRPP homologs identified, transcripts of two genes (LsSRPP4 and LsSRPP8) accounted for more than 90% of total transcripts of REF/SRPP homologs in lettuce latex. LsSRPP4 displays a typical primary protein sequence as other REF/SRPP, while LsSRPP8 is twice as long as LsSRPP4. These two major LsSRPP transcripts were individually and simultaneously silenced by RNA interference, and relative abundance, polymer molecular weight, and polydispersity of natural rubber were analyzed from the LsSRPP4- and LsSRPP8-silenced transgenic lettuce. Despite previous data suggesting the implications of REF/SRPP in natural rubber biosynthesis, qualitative and quantitative alterations of natural rubber could not be observed in transgenic lettuce lines. It is concluded that lettuce REF/SRPP homologs are not critically important proteins in natural rubber biosynthesis in lettuce. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. A rapid method for recombination and site-specific mutagenesis by placing homologous ends on DNA using polymerase chain reaction.

    Science.gov (United States)

    Jones, D H; Howard, B H

    1991-01-01

    We have developed a novel polymerase chain reaction (PCR) method that permits the rapid generation of site-specific mutants and recombinant DNA constructs with a minimum number of steps and primers. DNA segments are modified by using amplifying primers that add homologous ends to the polymerase chain reaction product(s). These homologous ends undergo recombination in vivo following transformation of recA-E. coli strains used routinely in cloning. In vivo circularization of PCR products containing plasmid sequences with a selective marker permits the rapid cloning of the desired mutant or recombinant. In the mutagenesis protocol, 7 of the 12 clones contained the product of interest, and 6 of these clones had no detected error (50% of the clones without detected errors). In each of several recombination protocols, at least 50% of the clones tested contained the insert of interest without detected errors.

  15. Crystallographic and bioinformatic studies on restriction endonucleases: inference of evolutionary relationships in the "midnight zone" of homology.

    Science.gov (United States)

    Bujnicki, Janusz M

    2003-10-01

    Type II restriction endonucleases (ENases) cleave DNA with remarkable sequence specificity. Their discovery in 1970 and studies on molecular genetics and biochemistry carried out over the past four decades laid foundations for recombinant DNA techniques. Today, restriction enzymes are indispensable tools in molecular biology and molecular medicine and a paradigm for proteins that specifically interact with DNA as well as a challenging target for protein engineering. The sequence-structure-function relationships for these proteins are therefore of central interest in biotechnology. However, among numerous ENase sequences, only a few exhibit statistically significant similarity in pairwise comparisons, which was initially interpreted as evidence for the lack of common origin. Nevertheless, X-ray crystallographic studies of seemingly dissimilar type II ENases demonstrated that they share a common structural core and metal-binding/catalytic site, arguing for extreme divergence rather than independent evolution. A similar nuclease domain has been also identified in various enzymes implicated in DNA repair and recombination. Ironically, following the series of crystallographic studies suggesting homology of all type II ENases, bioinformatic studies provided evidence that some restriction enzymes are in fact diverged members of unrelated nuclease superfamilies: Nuc, HNH and GIY-YIG. Hence, the restriction enzymes as a whole, represent a group of functionally similar proteins, which evolved on multiple occasions and subsequently diverged into the "midnight zone" of homology, where common origins within particular groups can be inferred only from structure-guided comparisons. The structure-guided approaches used for this purpose include: identification of functionally important residues using superposition of atomic coordinates, alignment of sequence profiles enhanced by secondary structures, fold recognition, and homology modeling. This review covers recent results of

  16. Gender frames and collective action: Configurations of masculinity in the Pittston Coal strike

    Energy Technology Data Exchange (ETDEWEB)

    Beckwith, K. [College Wooster, Wooster, OH (United States)

    2001-06-01

    This article develops the concept of gender frame for understanding major transformations in the collective action repertoires of social movements. Focusing on the United Mine Workers of America (UMWA) strike against the Pittston Coal Group (1989-90), the article discusses the UMWA's traditional collective action repertoire and its innovation of nonviolent protest, widely employed during the strike. Interviews with major activists and UMWA staff and officers illustrate how the UMWA employed a gender frame of mining masculinities to initiate the new nonviolent strike action. The article concludes by suggesting how collective action repertoires and framing are linked and encouraging future research on gender frames in social movements.

  17. Homology of the open moduli space of curves

    DEFF Research Database (Denmark)

    Madsen, Ib Henning

    2012-01-01

    This is a survey on the proof of a generalized version of the Mumford conjecture obtained in joint work with M. Weiss stating that a certain map between some classifying spaces which a priori have different natures induces an isomorphism at the level of integral homology. We also discuss our proo...

  18. On rationality of logarithmic Q-homology planes - I

    International Nuclear Information System (INIS)

    Pradeep, C.R.

    1995-09-01

    Normal surfaces over the complex plane are considered that are logarithmic (i.e., all its singularities are of the quotient type) and of which all reduced homology groups with rational coefficients vanish. It is proved that all such planes are rational. 16 refs

  19. Monitoring homologous recombination in rice (Oryza sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Yang Zhuanying; Tang Li [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China); Li Meiru [South China Botanic Garden, Chinese Academy of Sciences, Guangzhou 510650 (China); Chen Lei; Xu Jie [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China); Wu Goujiang [South China Botanic Garden, Chinese Academy of Sciences, Guangzhou 510650 (China); Li Hongqing, E-mail: hqli@scnu.edu.cn [Guangdong Provincial Key Lab of Biotechnology for Plant Development, College of Life Sciences, South China Normal University, Guangzhou 510631 (China)

    2010-09-10

    Here we describe a system to assay homologous recombination during the complete life cycle of rice (Oryza sativa L.). Rice plants were transformed with two copies of non-functional GUS reporter overlap fragments as recombination substrate. Recombination was observed in all plant organs examined, from the seed stage until the flowering stage of somatic plant development. Embryogenic cells exhibited the highest recombination ability with an average of 3 x 10{sup -5} recombination events per genome, which is about 10-fold of that observed in root cells, and two orders of that observed in leaf cells. Histological analysis revealed that recombination events occurred in diverse cell types, but preferentially in cells with small size. Examples of this included embryogenic cells in callus, phloem cells in the leaf vein, and cells located in the root apical meristem. Steady state RNA analysis revealed that the expression levels of rice Rad51 homologs are positively correlated with increased recombination rates in embryogenic calli, roots and anthers. Finally, radiation treatment of plantlets from distinct recombination lines increased the recombination frequency to different extents. These results showed that homologous recombination frequency can be effectively measured in rice using a transgene reporter assay. This system will facilitate the study of DNA damage signaling and homologous recombination in rice, a model monocot.

  20. Response of Sahel goats tp homologous PPR vaccine (Capripestovax

    African Journals Online (AJOL)

    The response of Sahel goats to homologous PPR vaccine (CapripestovaxR) under field conditions was investigated in Maiduguri, using virus neutralization test and haematology. The study showed that the Sahel goats seroconverted with geometric mean titres (GMT) of 18.5 and 130 on day zero and 28 days post ...

  1. Multiresolution persistent homology for excessively large biomolecular datasets

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Kelin; Zhao, Zhixiong [Department of Mathematics, Michigan State University, East Lansing, Michigan 48824 (United States); Wei, Guo-Wei, E-mail: wei@math.msu.edu [Department of Mathematics, Michigan State University, East Lansing, Michigan 48824 (United States); Department of Electrical and Computer Engineering, Michigan State University, East Lansing, Michigan 48824 (United States); Department of Biochemistry and Molecular Biology, Michigan State University, East Lansing, Michigan 48824 (United States)

    2015-10-07

    Although persistent homology has emerged as a promising tool for the topological simplification of complex data, it is computationally intractable for large datasets. We introduce multiresolution persistent homology to handle excessively large datasets. We match the resolution with the scale of interest so as to represent large scale datasets with appropriate resolution. We utilize flexibility-rigidity index to access the topological connectivity of the data set and define a rigidity density for the filtration analysis. By appropriately tuning the resolution of the rigidity density, we are able to focus the topological lens on the scale of interest. The proposed multiresolution topological analysis is validated by a hexagonal fractal image which has three distinct scales. We further demonstrate the proposed method for extracting topological fingerprints from DNA molecules. In particular, the topological persistence of a virus capsid with 273 780 atoms is successfully analyzed which would otherwise be inaccessible to the normal point cloud method and unreliable by using coarse-grained multiscale persistent homology. The proposed method has also been successfully applied to the protein domain classification, which is the first time that persistent homology is used for practical protein domain analysis, to our knowledge. The proposed multiresolution topological method has potential applications in arbitrary data sets, such as social networks, biological networks, and graphs.

  2. Homology modeling of ɣ-aminobutyrate- aminotransferase, a ...

    African Journals Online (AJOL)

    Jane

    2011-06-29

    Jun 29, 2011 ... of GABA-AT is not experimentally known, and we thus resorted to homology modelling to build a model based on x-ray crystal ... MUSCLE programs. The model was further checked for its correctness by predicting the .... is an important step for the prediction of protein's tertiary structure. Secondary structure ...

  3. Efficacy of homologous peste des petits ruminants vaccine on sheep ...

    African Journals Online (AJOL)

    The effect of homologous peste des petits ruminants vaccine (HPPRV) on flock size, morbidity and mortality in sheep and goats was determined in five locations, Unguwan Goje, Bayan Fada, Lowcost, Kyamsangi, and Bagyar, in Dengi, Kanam Local Government Area of Plateau State. Enzyme-linked Immunosorbent Assay ...

  4. Homology modelling and bivalent single-chain Fv construction of ...

    Indian Academy of Sciences (India)

    Homology modelling and bivalent single-chain Fv construction of anti-HepG2 single-chain immunoglobulin Fv fragments from a phage display library ... Department of Infectious Diseases, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China; Department of ...

  5. Synthesis and characterization of new homologous series of ...

    Indian Academy of Sciences (India)

    Two homologous series of unsymmetrical alkylated chalcones and 3,5-diaryl isoxazoles, consisting of 20 members, with various n-alkyl bromides (n=2−7, 10, 12, 14, 16) have been synthesized and studied for their liquid crystalline property. Simple strategy was employed to achieve the target materials. Flexibilityin the ...

  6. Phenylbutyrate inhibits homologous recombination induced by camptothecin and methyl methanesulfonate

    DEFF Research Database (Denmark)

    Kaiser, Gitte Schalck; Germann, Susanne Manuela; Westergaard, Tine

    2011-01-01

    . Treatment with PBA is accompanied by a dramatic reduction in histone H4 lysine 8 acetylation. Live cell imaging of homologous recombination proteins indicates that repair of CPT-induced DNA damage is redirected to a non-recombinogenic pathway in the presence of PBA without loss in cell viability...

  7. Identification of rodent homologs of hepatitis C virus and pegiviruses

    DEFF Research Database (Denmark)

    Kapoor, Amit; Simmonds, Peter; Scheel, Troels K H

    2013-01-01

    Flaviviridae. The genetic diversity of the rodent hepaciviruses exceeded that observed for hepaciviruses infecting either humans or non-primates, leading to new insights into the origin, evolution, and host range of hepaciviruses. The presence of genes, encoded proteins, and translation elements homologous...

  8. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) for directed enzyme evolution.

    Science.gov (United States)

    Gonzalez-Perez, David; Molina-Espeja, Patricia; Garcia-Ruiz, Eva; Alcalde, Miguel

    2014-01-01

    Approaches that depend on directed evolution require reliable methods to generate DNA diversity so that mutant libraries can focus on specific target regions. We took advantage of the high frequency of homologous DNA recombination in Saccharomyces cerevisiae to develop a strategy for domain mutagenesis aimed at introducing and in vivo recombining random mutations in defined segments of DNA. Mutagenic Organized Recombination Process by Homologous IN vivo Grouping (MORPHING) is a one-pot random mutagenic method for short protein regions that harnesses the in vivo recombination apparatus of yeast. Using this approach, libraries can be prepared with different mutational loads in DNA segments of less than 30 amino acids so that they can be assembled into the remaining unaltered DNA regions in vivo with high fidelity. As a proof of concept, we present two eukaryotic-ligninolytic enzyme case studies: i) the enhancement of the oxidative stability of a H2O2-sensitive versatile peroxidase by independent evolution of three distinct protein segments (Leu28-Gly57, Leu149-Ala174 and Ile199-Leu268); and ii) the heterologous functional expression of an unspecific peroxygenase by exclusive evolution of its native 43-residue signal sequence.

  9. CTCF facilitates DNA double-strand break repair by enhancing homologous recombination repair.

    Science.gov (United States)

    Hilmi, Khalid; Jangal, Maïka; Marques, Maud; Zhao, Tiejun; Saad, Amine; Zhang, Chenxi; Luo, Vincent M; Syme, Alasdair; Rejon, Carlis; Yu, Zhenbao; Krum, Asiev; Fabian, Marc R; Richard, Stéphane; Alaoui-Jamali, Moulay; Orthwein, Alexander; McCaffrey, Luke; Witcher, Michael

    2017-05-01

    The repair of DNA double-strand breaks (DSBs) is mediated via two major pathways, nonhomologous end joining (NHEJ) and homologous recombination (HR) repair. DSB repair is vital for cell survival, genome stability, and tumor suppression. In contrast to NHEJ, HR relies on extensive homology and templated DNA synthesis to restore the sequence surrounding the break site. We report a new role for the multifunctional protein CCCTC-binding factor (CTCF) in facilitating HR-mediated DSB repair. CTCF is recruited to DSB through its zinc finger domain independently of poly(ADP-ribose) polymers, known as PARylation, catalyzed by poly(ADP-ribose) polymerase 1 (PARP-1). CTCF ensures proper DSB repair kinetics in response to γ-irradiation, and the loss of CTCF compromises HR-mediated repair. Consistent with its role in HR, loss of CTCF results in hypersensitivity to DNA damage, inducing agents and inhibitors of PARP. Mechanistically, CTCF acts downstream of BRCA1 in the HR pathway and associates with BRCA2 in a PARylation-dependent manner, enhancing BRCA2 recruitment to DSB. In contrast, CTCF does not influence the recruitment of the NHEJ protein 53BP1 or LIGIV to DSB. Together, our findings establish for the first time that CTCF is an important regulator of the HR pathway.

  10. [Gene fusion of egfp & kan and recombinant plasmid construction by red mediated in vivo homologous recombination].

    Science.gov (United States)

    Wu, Yang; Li, Shan-Hu; Shi, Qing-Guo; Liu, Dang-Sheng; Zhou, Jian-Guang

    2007-07-01

    Recombineering, a new genetic engineering technology based on high efficiency in vivo homologous recombination, can be used in target DNA knock-in, knock-out and gene cloning. In the process of gene subcloning mediated by Recombineering technique, high-quality target DNA fragments were difficult to obtain using in vitro overlapping PCR,therefore the efficiency of in vivo homologous recombination was severely interrupted. To solve this problem, some technology improvements have been established based on the principle of Red recombinases. The PCR DNA fragments of egfp and kan genes with complementary sequences on the end of each fragment were co-introduced into a pcDNA3.1 vector and Red recombinases containing E. coli DY331 host cells by electroporation. A recombinant plasmid pcDNA3.1-egfp-kan was screened directly by antibiotic marker. The positive rates can reach to 45%. The EGFP gene expression of pcDNA3.1-egfp-kan can be observed by transient transfection of 293 eukaryotic cells.

  11. Integrative taxonomy of ciliates: Assessment of molecular phylogenetic content and morphological homology testing.

    Science.gov (United States)

    Vďačný, Peter

    2017-10-01

    The very diverse and comparatively complex morphology of ciliates has given rise to numerous taxonomic concepts. However, the information content of the utilized molecular markers has seldom been explored prior to phylogenetic analyses and taxonomic decisions. Likewise, robust testing of morphological homology statements and the apomorphic nature of diagnostic characters of ciliate taxa is rarely carried out. Four phylogenetic techniques that may help address these issues are reviewed. (1) Split spectrum analysis serves to determine the exact number and quality of nucleotide positions supporting individual nodes in phylogenetic trees and to discern long-branch artifacts that cause spurious phylogenies. (2) Network analysis can depict all possible evolutionary trajectories inferable from the dataset and locate and measure the conflict between them. (3) A priori likelihood mapping tests the suitability of data for reconstruction of a well resolved tree, visualizes the tree-likeness of quartets, and assesses the support of an internal branch of a given tree topology. (4) Reconstruction of ancestral morphologies can be applied for analyzing homology and apomorphy statements without circular reasoning. Since these phylogenetic tools are rarely used, their principles and interpretation are introduced and exemplified using various groups of ciliates. Finally, environmental sequencing data are discussed in this light. Copyright © 2017 The Author. Published by Elsevier GmbH.. All rights reserved.

  12. Isolation of Specific Clones from Nonarrayed BAC Libraries through Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Mikhail Nefedov

    2011-01-01

    Full Text Available We have developed a new approach to screen bacterial artificial chromosome (BAC libraries by recombination selection. To test this method, we constructed an orangutan BAC library using an E. coli strain (DY380 with temperature inducible homologous recombination (HR capability. We amplified one library segment, induced HR at 42∘C to make it recombination proficient, and prepared electrocompetent cells for transformation with a kanamycin cassette to target sequences in the orangutan genome through terminal recombineering homologies. Kanamycin-resistant colonies were tested for the presence of BACs containing the targeted genes by the use of a PCR-assay to confirm the presence of the kanamycin insertion. The results indicate that this is an effective approach for screening clones. The advantage of recombination screening is that it avoids the high costs associated with the preparation, screening, and archival storage of arrayed BAC libraries. In addition, the screening can be conceivably combined with genetic engineering to create knockout and reporter constructs for functional studies.

  13. The PLAC1-homology region of the ZP domain is sufficient for protein polymerisation

    Directory of Open Access Journals (Sweden)

    Litscher Eveline S

    2006-04-01

    Full Text Available Abstract Background Hundreds of extracellular proteins polymerise into filaments and matrices by using zona pellucida (ZP domains. ZP domain proteins perform highly diverse functions, ranging from structural to receptorial, and mutations in their genes are responsible for a number of severe human diseases. Recently, PLAC1, Oosp1-3, Papillote and CG16798 proteins were identified that share sequence homology with the N-terminal half of the ZP domain (ZP-N, but not with its C-terminal half (ZP-C. The functional significance of this partial conservation is unknown. Results By exploiting a highly engineered bacterial strain, we expressed in soluble form the PLAC1-homology region of mammalian sperm receptor ZP3 as a fusion to maltose binding protein. Mass spectrometry showed that the 4 conserved Cys residues within the ZP-N moiety of the fusion protein adopt the same disulfide bond connectivity as in full-length native ZP3, indicating that it is correctly folded, and electron microscopy and biochemical analyses revealed that it assembles into filaments. Conclusion These findings provide a function for PLAC1-like proteins and, by showing that ZP-N is a biologically active folding unit, prompt a re-evaluation of the architecture of the ZP domain and its polymers. Furthermore, they suggest that ZP-C might play a regulatory role in the assembly of ZP domain protein complexes.

  14. Proliferative lymphocyte responses to virus antigens homologous to GAD65 in IDDM.

    Science.gov (United States)

    Jones, D B; Crosby, I

    1996-11-01

    Virus infection has been proposed as an initiating factor in the aetiology of insulin-dependent diabetes mellitus (IDDM). We have examined lymphocyte proliferation to virus proteins which demonstrate sequence similarity to the beta-cell autoantigen glutamic acid decarboxylase (GAD)65. The magnitude and frequency of response to coxsackie B viruses and adenovirus in a T-cell proliferation assay was significantly higher in a group of recently diagnosed IDDM subjects than in non-diabetic control subjects. The frequency of positive response to the coxsackie B viruses was also significantly higher in IDDM subjects expressing the DRB 1*04 major histocompatibility complex (MHC) haplotype than the DRB 1*03 haplotype. There was no evidence that non-aspartate residue at position 57 of DQB 1 genes influenced virus responses in the IDDM group. The coxsackie homology was in amino acids 258-266 and the adenovirus homology was in amino acids 509-524 of GAD65. Both these regions are suspected to be T-cell epitopes in IDDM. These results indicate a disease and MHC class II association between coxsackie B virus infection and IDDM and an association between adenovirus infection and IDDM.

  15. A macrophage inflammatory protein homolog encoded by guinea pig cytomegalovirus signals via CC chemokine receptor 1

    International Nuclear Information System (INIS)

    Penfold, Mark; Miao Zhenhua; Wang Yu; Haggerty, Shannon; Schleiss, Mark R.

    2003-01-01

    Cytomegaloviruses encode homologs of cellular immune effector proteins, including chemokines (CKs) and CK receptor-like G protein-coupled receptors (GPCRs). Sequence of the guinea pig cytomegalovirus (GPCMV) genome identified an open reading frame (ORF) which predicted a 101 amino acid (aa) protein with homology to the macrophage inflammatory protein (MIP) subfamily of CC (β) CKs, designated GPCMV-MIP. To assess functionality of this CK, recombinant GPCMV-MIP was expressed in HEK293 cells and assayed for its ability to bind to and functionally interact with a variety of GPCRs. Specific signaling was observed with the hCCR1 receptor, which could be blocked with hMIP -1α in competition experiments. Migration assays revealed that GPCMV-MIP was able to induce chemotaxis in hCCR1-L1.2 cells. Antisera raised against a GST-MIP fusion protein immunoprecipitated species of ∼12 and 10 kDa from GPCMV-inoculated tissue culture lysates, and convalescent antiserum from GPCMV-infected animals was immunoreactive with GST-MIP by ELISA assay. These results represent the first substantive in vitro characterization of a functional CC CK encoded by a cytomegalovirus

  16. Antibodies against homologous microbial caseinolytic proteases P characterise primary biliary cirrhosis.

    Science.gov (United States)

    Bogdanos, Dimitrios-Petrou; Baum, Harold; Sharma, Umesh C; Grasso, Alessandro; Ma, Yun; Burroughs, Andrew K; Vergani, Diego

    2002-01-01

    Antibodies to caseinolytic protease P(177-194) (ClpP(177-194)) of the proteolytic subunit of the Clp complex of Escherichia coli (E. coli) are uniquely present in primary biliary cirrhosis (PBC). Molecular mimicry between the regulatory subunit ClpX and the principal T-cell epitope of pyruvate dehydrogenase complex (PDC-E2) in PBC, has been proposed to account for this. Since ClpP is highly conserved among bacteria we investigated whether the micro-organisms triggering these antibodies may be other than E. coli. E. coli ClpP(177-194) is homologous with ClpP peptides of Yersinia enterocolitica (YEREN) and Haemophilus influenzae (HAEIN). Enzyme linked immunosorbent assay (ELISA) reactivity to these peptides was tested in 45 patients with PBC, 44 pathological and 32 healthy controls. Reactivity to at least one of the ClpP peptides was observed in 21 (47%) PBC patients, 5.8% pathological and 3.1% healthy controls (PECOLI ClpP(177-194), alone or in association with YEREN and/or HAEIN peptides, compared to three (14.2%) reactive with YEREN, two (9.5%) with YEREN/HAEIN and one (4.7%) with HAEIN peptide. Simultaneous reactivity to homologous sequences was due to cross-reactivity as confirmed by competition ELISAs. The PBC-specificity of anti-microbial ClpP reactivity is confirmed: the questions as to primary trigger(s) and relevance to PBC pathogenesis remain open.

  17. Sequence similarity network reveals common ancestry of multidomain proteins.

    Directory of Open Access Journals (Sweden)

    Nan Song

    2008-05-01

    Full Text Available We address the problem of homology identification in complex multidomain families with varied domain architectures. The challenge is to distinguish sequence pairs that share common ancestry from pairs that share an inserted domain but are otherwise unrelated. This distinction is essential for accuracy in gene annotation, function prediction, and comparative genomics. There are two major obstacles to multidomain homology identification: lack of a formal definition and lack of curated benchmarks for evaluating the performance of new methods. We offer preliminary solutions to both problems: 1 an extension of the traditional model of homology to include domain insertions; and 2 a manually curated benchmark of well-studied families in mouse and human. We further present Neighborhood Correlation, a novel method that exploits the local structure of the sequence similarity network to identify homologs with great accuracy based on the observation that gene duplication and domain shuffling leave distinct patterns in the sequence similarity network. In a rigorous, empirical comparison using our curated data, Neighborhood Correlation outperforms sequence similarity, alignment length, and domain architecture comparison. Neighborhood Correlation is well suited for automated, genome-scale analyses. It is easy to compute, does not require explicit knowledge of domain architecture, and classifies both single and multidomain homologs with high accuracy. Homolog predictions obtained with our method, as well as our manually curated benchmark and a web-based visualization tool for exploratory analysis of the network neighborhood structure, are available at http://www.neighborhoodcorrelation.org. Our work represents a departure from the prevailing view that the concept of homology cannot be applied to genes that have undergone domain shuffling. In contrast to current approaches that either focus on the homology of individual domains or consider only families with

  18. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  19. Molecular cloning, expression analysis and sequence prediction of ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-28

    Nov 28, 2011 ... Besides, one basic leucine zipper domain (bZIP) in amino acid area from 274 to 337 was found, concurring with the main characteristic of C/EBPs. Homologous comparison of the amino acid sequences from C/EBPβ cloned in this study and those from different species indicated C/EBPβ gene of Qinchuan ...

  20. Cloning and sequencing of the bovine gastrin gene

    DEFF Research Database (Denmark)

    Lund, T; Rehfeld, J F; Olsen, Jørgen

    1989-01-01

    In order to deduce the primary structure of bovine preprogastrin we therefore sequenced a gastrin DNA clone isolated from a bovine liver cosmid library. Bovine preprogastrin comprises 104 amino acids and consists of a signal peptide, a 37 amino acid spacer-sequence, the gastrin-34 sequence followed...... by an amidation-site (Gly-Arg-Arg), and a C-terminal nonapeptide. Comparison with human, porcine, and rat cDNA sequences revealed extensive homology in the coding region as well as in short noncoding structures....