Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis
Directory of Open Access Journals (Sweden)
Chong Jie Hao
2016-03-01
Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.
Streptococcus suis, an emerging drug-resistant animal and human pathogen
Directory of Open Access Journals (Sweden)
Claudio ePalmieri
2011-11-01
Full Text Available Streptococcus suis, a major porcine pathogen, has been receiving growing attention not only for its role in severe and increasingly reported infections in humans, but also for its involvement in drug resistance. Recent studies and the analysis of sequenced genomes have been providing important insights into the S. suis resistome, and have resulted in the identification of resistance determinants for tetracyclines, macrolides, aminoglycosides, chloramphenicol, antifolate drugs, streptothricin, and cadmium salts. Resistance gene-carrying genetic elements described so far include integrative and conjugative elements, transposons, genomic islands, phages, and chimeric elements. Some of these elements are similar to those reported in major streptococcal pathogens such as Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae and share the same chromosomal insertion sites. The available information strongly suggests that S. suis is an important antibiotic resistance reservoir that can contribute to the spread of resistance genes to the above-mentioned streptococci. S. suis is thus a paradigmatic example of possible intersections between animal and human resistomes.
Perez, Antonia C; Pang, Bing; King, Lauren B; Tan, Li; Murrah, Kyle A; Reimche, Jennifer L; Wren, John T; Richardson, Stephen H; Ghandi, Uma; Swords, W Edward
2014-04-01
Otitis media (OM) is an extremely common pediatric ailment caused by opportunists that reside within the nasopharynx. Inflammation within the upper airway can promote ascension of these opportunists into the middle ear chamber. OM can be chronic/recurrent in nature, and a wealth of data indicates that in these cases, the bacteria persist within biofilms. Epidemiological data demonstrate that most cases of OM are polymicrobial, which may have significant impact on antibiotic resistance. In this study, we used in vitro biofilm assays and rodent infection models to examine the impact of polymicrobial infection with Moraxella catarrhalis and Streptococcus pneumoniae (pneumococcus) on biofilm resistance to antibiotic treatment and persistence in vivo. Consistent with prior work, M. catarrhalis conferred beta-lactamase-dependent passive protection from beta-lactam killing to pneumococci within polymicrobial biofilms. Moreover, pneumococci increased resistance of M. catarrhalis to macrolide killing in polymicrobial biofilms. However, pneumococci increased colonization in vivo by M. catarrhalis in a quorum signal-dependent manner. We also found that co-infection with M. catarrhalis affects middle ear ascension of pneumococci in both mice and chinchillas. Therefore, we conclude that residence of M. catarrhalis and pneumococci within the same biofilm community significantly impacts resistance to antibiotic treatment and bacterial persistence in vivo. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Eduardo Walker Zettler
2004-12-01
Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes
Xu, Yifan; Itzek, Andreas
2014-01-01
Hydrogen peroxide (H2O2) is produced by several members of the genus Streptococcus mainly through the pyruvate oxidase SpxB under aerobic growth conditions. The acute toxic nature of H2O2 raises the interesting question of how streptococci cope with intrinsically produced H2O2, which subsequently accumulates in the microenvironment and threatens the closely surrounding population. Here, we investigate the H2O2 susceptibility of oral Streptococcus gordonii and Streptococcus sanguinis and elucidate potential mechanisms of how they protect themselves from the deleterious effect of H2O2. Both organisms are considered primary colonizers and occupy the same intraoral niche making them potential targets for H2O2 produced by other species. We demonstrate that S. gordonii produces relatively more H2O2 and has a greater ability for resistance to H2O2 stress. Functional studies show that, unlike in Streptococcus pneumoniae, H2O2 resistance is not dependent on a functional SpxB and confirms the important role of the ferritin-like DNA-binding protein Dps. However, the observed increased H2O2 resistance of S. gordonii over S. sanguinis is likely to be caused by an oxidative stress protection machinery present even under anaerobic conditions, while S. sanguinis requires a longer period of time for adaptation. The ability to produce more H2O2 and be more resistant to H2O2 might aid S. gordonii in the competitive oral biofilm environment, since it is lower in abundance yet manages to survive quite efficiently in the oral biofilm. PMID:25280752
Factors That Cause Trimethoprim Resistance in Streptococcus pyogenes
Bergmann, René; van der Linden, Mark; Chhatwal, Gursharan S.
2014-01-01
The use of trimethoprim in treatment of Streptococcus pyogenes infections has long been discouraged because it has been widely believed that this pathogen is resistant to this antibiotic. To gain more insight into the extent and molecular basis of trimethoprim resistance in S. pyogenes, we tested isolates from India and Germany and sought the factors that conferred the resistance. Resistant isolates were identified in tests for trimethoprim or trimethoprim-sulfamethoxazole (SXT) susceptibility. Resistant isolates were screened for the known horizontally transferable trimethoprim-insensitive dihydrofolate reductase (dfr) genes dfrG, dfrF, dfrA, dfrD, and dfrK. The nucleotide sequence of the intrinsic dfr gene was determined for resistant isolates lacking the horizontally transferable genes. Based on tentative criteria, 69 out of 268 isolates (25.7%) from India were resistant to trimethoprim. Occurring in 42 of the 69 resistant isolates (60.9%), dfrF appeared more frequently than dfrG (23 isolates; 33.3%) in India. The dfrF gene was also present in a collection of SXT-resistant isolates from Germany, in which it was the only detected trimethoprim resistance factor. The dfrF gene caused resistance in 4 out of 5 trimethoprim-resistant isolates from the German collection. An amino acid substitution in the intrinsic dihydrofolate reductase known from trimethoprim-resistant Streptococcus pneumoniae conferred resistance to S. pyogenes isolates of emm type 102.2, which lacked other aforementioned dfr genes. Trimethoprim may be more useful in treatment of S. pyogenes infections than previously thought. However, the factors described herein may lead to the rapid development and spread of resistance of S. pyogenes to this antibiotic agent. PMID:24492367
Sozzi, Tommaso; Smiley, Martin B.
1980-01-01
Twenty-nine strains of Lactobacillus bulgaricus and 15 strains of Streptococcus thermophilus were tested for resistance to 35 antimicrobial agents by using commercially available sensitivity disks. Approximately 35% of the isolates had uncharacteristic resistance patterns.
DEFF Research Database (Denmark)
Gustafsson, Caj Ulrik Mattias; Lannergård, Jonas; Nilsson, Olof Rickard
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against...... represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited...... to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed...
DEFF Research Database (Denmark)
Rasmussen, S. R.; Aarestrup, Frank Møller; Jensen, N. E.
1999-01-01
A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting in the identificat......A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting...
Zielnik-Jurkiewicz, Beata; Bielicka, Anna
2015-12-01
The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Isolation and characterization of promoter regions from Streptococcus gordonii CH1
Vriesema, A.J.M.; Dankert, J.; Zaat, S.A.J.
1999-01-01
We aimed to identify transcription signal sequences from Streptococcus gordonii strain CH1 by random chromosomal cloning. Five genomic fragments from a Sau3A digest, which constitutively activated transcription of a promoterless spectinomycin resistance gene in this strain, were isolated and
DEFF Research Database (Denmark)
Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M
2010-01-01
Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...
Directory of Open Access Journals (Sweden)
Raul Velez-Montoya
2010-01-01
Full Text Available Purpose. To describe the clinical characteristics, diagnosis, and treatment with intravitreal ampicillin sodium of a postoperative endophthalmitis case due to Streptococcus uberis; an environmental pathogen commonly seen in mastitis cases of lactating cows. Methods. Case Report. A 52-year-old, Hispanic diabetic patient who suddenly developed severe pain and severe loss of vision, following vitrectomy. Results. The patient was diagnosed with postoperative endophthalmitis secondary to a highly resistant strain of Streptococcus uberis that did not respond to intravitreal antibiotics. He was treated with an air-fluid interchange, anterior chamber washout, intravitreal ampicillin sodium (5 mg/0.1 mL, and silicon oil tamponade (5000 ck. The eye was anatomically stabilized, though there was no functional recovery. Conclusion. Streptococcus uberis is an uncommon pathogen to the human eye, which has unique features that help the strain in developing resistance to antibiotics. While treatment with intravitreal ampicillin is feasible, there are still concerns about its possible toxicity.
Directory of Open Access Journals (Sweden)
Raga-Luria Xavier
2009-03-01
Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.
Directory of Open Access Journals (Sweden)
Bowers Jolene R
2012-01-01
Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.
Rams, Thomas E; Feik, Diane; Mortensen, Joel E; Degener, John E; van Winkelhoff, Arie J
2014-01-01
Background: Streptococcus constellatus and Streptococcus intermedius in subgingival dental plaque biofilms may contribute to forms of periodontitis that resist treatment with conventional mechanical root debridement/surgical procedures and may additionally participate in some extraoral infections.
Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates
Directory of Open Access Journals (Sweden)
Pan F
2018-05-01
Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated
Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G
1990-01-01
Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...
Chalker, Victoria J; Waller, Andrew; Webb, Katy; Spearing, Emma; Crosse, Patricia; Brownlie, Joe; Erles, Kerstin
2012-06-01
The genetic diversity and antibiotic resistance profiles of 38 Streptococcus equi subsp. zooepidemicus isolates were determined from a kennelled canine population during two outbreaks of hemorrhagic pneumonia (1999 to 2002 and 2007 to 2010). Analysis of the szp gene hypervariable region and the 16S-23S rRNA intergenic spacer region and multilocus sequence typing (MLST) indicated a predominant tetO-positive, doxycycline-resistant ST-10 strain during 1999 to 2002 and a predominant tetM-positive doxycycline-resistant ST-62 strain during 2007 to 2010.
Genetic Transformation of Streptococcus mutans
Perry, Dennis; Kuramitsu, Howard K.
1981-01-01
Three strains of Streptococcus mutans belonging to serotypes a, c, and f were transformed to streptomycin resistance by deoxyribonucleic acids derived from homologous and heterologous streptomycin-resistant strains of S. mutans and Streptococcus sanguis strain Challis. Homologous transformation of S. mutans was less efficient than heterologous transformation by deoxyribonucleic acids from other strains of S. mutans.
Through selection of resistance to sparfloxacin, an attenuated Streptococcus agalactiae strain 138spar was obtained from its virulent parent strain S. agalactiae 138P. The full genome of S. agalactiae 138spar is 1,838,126 bp. The availability of this genome will allow comparative genomics to identi...
Dinani, Amreen; Ktaich, Nessrine; Urban, Carl; Rubin, David
2009-10-01
Endogenous endophthalmitis is a rare complication of infective endocarditis and has been decreasing due to the availability of effective antibiotics. We highlight a case of endogenous endophthalmitis due to levofloxacin-resistant Streptococcus mitis presenting as infective endocarditis. Endogenous endophthalmitis should be considered as a manifestation of an underlying systemic disease, especially in patients who present with non-specific signs and symptoms with no obvious source of precipitating infection.
The complete genome of a sparfloxacin-resistant Streptococcus agalactiae vaccine strain 138spar is 1,838,126 bp in size. The genome has 1892 coding sequences and 82 RNAs. The annotation of the genome is added by the NCBI Prokaryotic Genome Annotation Pipeline. The publishing of this genome will allo...
Streptococcus lutetiensis Bacteremia. First Clindamycin Resistant Isolate Carrying lnuB Gene
Almuzara, Marisa; Bonofiglio, Laura; Cittadini, Roberto Arnaldo; Vera Ocampo, C.; Montilla, A.; del Castillo, M.; Ramirez, Maria Soledad; Mollerach, Marta Eugenia; Vay, C.
2015-01-01
First Case of Streptococcus lutetiensis Bacteremia Involving a Clindamycin-Resistant Isolate Carrying the lnuB Gene Fil: Almuzara, Marisa. Universidad de Buenos Aires. Facultad de Farmacia y Bioquímica. Departamento de Bioquímica Clínica; Argentina; Fil: Bonofiglio, Laura. Universidad de Buenos Aires. Facultad de Farmacia y Bioquímica. Departamento de Microbiología, Inmunología y Biotecnología; Argentina; Fil: Cittadini, Roberto Arnaldo. Instituto Nacional de Tecnologia Agropecuaria;...
To develop attenuated bacteria as potential live vaccines, sparfloxacin was used in this study to modify 40 isolates of Streptococcus agalactiae. Majority of S. agalactiae used in this study were able to develop at least 80-fold resistance to sparfloxacin. When the virulence of the sparfloxacin-resi...
Directory of Open Access Journals (Sweden)
Légaré Danielle
2011-10-01
Full Text Available Abstract Background Several mutations were present in the genome of Streptococcus pneumoniae linezolid-resistant strains but the role of several of these mutations had not been experimentally tested. To analyze the role of these mutations, we reconstituted resistance by serial whole genome transformation of a novel resistant isolate into two strains with sensitive background. We sequenced the parent mutant and two independent transformants exhibiting similar minimum inhibitory concentration to linezolid. Results Comparative genomic analyses revealed that transformants acquired G2576T transversions in every gene copy of 23S rRNA and that the number of altered copies correlated with the level of linezolid resistance and cross-resistance to florfenicol and chloramphenicol. One of the transformants also acquired a mutation present in the parent mutant leading to the overexpression of an ABC transporter (spr1021. The acquisition of these mutations conferred a fitness cost however, which was further enhanced by the acquisition of a mutation in a RNA methyltransferase implicated in resistance. Interestingly, the fitness of the transformants could be restored in part by the acquisition of altered copies of the L3 and L16 ribosomal proteins and by mutations leading to the overexpression of the spr1887 ABC transporter that were present in the original linezolid-resistant mutant. Conclusions Our results demonstrate the usefulness of whole genome approaches at detecting major determinants of resistance as well as compensatory mutations that alleviate the fitness cost associated with resistance.
Combination Therapy Strategies Against Multiple-Resistant Streptococcus Suis
Directory of Open Access Journals (Sweden)
Yang Yu
2018-05-01
Full Text Available Streptococcus suis is a major swine pathogen, an emerging zoonotic agent responsible for meningitis, endocarditis and septicaemia followed by deafness in humans. The development of antimicrobial resistance in S. suis increases the risk for therapeutic failure in both animals and humans. In this study, we report the synergism of combination therapy against multi-resistant S. suis isolates from swine. Twelve antibiotic profiles were determined against 11 S. suis strains. To investigate their synergistic/antagonistic activity, checkerboard assay was performed for all the possible combinations. In-vitro killing curves and in-vivo treatment trials were used to confirm the synergistic activity of special combinations against S. suis dominant clones. In this study, 11 S. suis isolates were highly resistant to erythromycin, clindamycin, trimethoprim/sulfamethoxazole, and tetracycline with ratios of 80–100%, and the resistance percentages to enrofloxacin, florfenicol, and spectinomycin were ~50%. The checkerboard data identified two combination regimens, ampicillin plus apramycin and tiamulin plus spectinomycin which gave the greatest level of synergism against the S. suis strains. In-vitro kill-curves showed a bacterial reduction of over 3-logCFU with the use of combination treatments, whilst the application of mono-therapies achieve less than a 2-logCFU cell killing. In-vivo models confirm that administration of these two combinations significantly reduced the number of bacterial cells after 24 h of treatment. In conclusions, the combinations of ampicillin plus apramycin and tiamulin plus spectinomycin showed the greatest synergism and may be potential strategies for treatment of multi-resistant S. suis in animal.
A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae
Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar
2004-01-01
INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...
Colijn, Caroline; Cohen, Ted; Fraser, Christophe; Hanage, William; Goldstein, Edward; Givon-Lavi, Noga; Dagan, Ron; Lipsitch, Marc
2010-01-01
The rise of antimicrobial resistance in many pathogens presents a major challenge to the treatment and control of infectious diseases. Furthermore, the observation that drug-resistant strains have risen to substantial prevalence but have not replaced drug-susceptible strains despite continuing (and even growing) selective pressure by antimicrobial use presents an important problem for those who study the dynamics of infectious diseases. While simple competition models predict the exclusion of one strain in favour of whichever is ‘fitter’, or has a higher reproduction number, we argue that in the case of Streptococcus pneumoniae there has been persistent coexistence of drug-sensitive and drug-resistant strains, with neither approaching 100 per cent prevalence. We have previously proposed that models seeking to understand the origins of coexistence should not incorporate implicit mechanisms that build in stable coexistence ‘for free’. Here, we construct a series of such ‘structurally neutral’ models that incorporate various features of bacterial spread and host heterogeneity that have been proposed as mechanisms that may promote coexistence. We ask to what extent coexistence is a typical outcome in each. We find that while coexistence is possible in each of the models we consider, it is relatively rare, with two exceptions: (i) allowing simultaneous dual transmission of sensitive and resistant strains lets coexistence become a typical outcome, as does (ii) modelling each strain as competing more strongly with itself than with the other strain, i.e. self-immunity greater than cross-immunity. We conclude that while treatment and contact heterogeneity can promote coexistence to some extent, the in-host interactions between strains, particularly the interplay between coinfection, multiple infection and immunity, play a crucial role in the long-term population dynamics of pathogens with drug resistance. PMID:19940002
DEFF Research Database (Denmark)
Shepherd, Jennifer; Ibba, Michael
2013-01-01
Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...
DEFF Research Database (Denmark)
Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.
2013-01-01
Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....
Mendes, Rodrigo E; Deshpande, Lalitagauri M; Kim, Jihye; Myers, Debra S; Ross, James E; Jones, Ronald N
2013-08-01
This study describes a clinical case of a 71-year-old male with a history of ischemic cardiomyopathy after left ventricular assist device (LVAD) endocarditis caused by methicillin-resistant Staphylococcus epidermidis (MRSE) and a rare linezolid-resistant Streptococcus sanguinis strain (MIC, 32 μg/ml). The patient received courses of several antimicrobial agents, including linezolid for 79 days. The S. sanguinis strain had mutations in the 23S rRNA (T2211C, T2406C, G2576T, C2610T) and an amino acid substitution (N56D) in L22 and exhibited cross-resistance to ribosome-targeting agents.
Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae
Directory of Open Access Journals (Sweden)
Deniz Akgun Karapinar
2016-01-01
Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.
Huang, Jinhu; Ma, Jiale; Shang, Kexin; Hu, Xiao; Liang, Yuan; Li, Daiwei; Wu, Zuowei; Dai, Lei; Chen, Li; Wang, Liping
2016-01-01
Streptococcus suis is a previously neglected, newly emerging multidrug-resistant zoonotic pathogen. Mobile genetic elements (MGEs) play a key role in intra- and interspecies horizontal transfer of antimicrobial resistance (AMR) determinants. Although, previous studies showed the presence of several MGEs, a comprehensive analysis of AMR-associated mobilome as well as their interaction and evolution has not been performed. In this study, we presented the AMR-associated mobilome and their insertion hotspots in S. suis . Integrative conjugative elements (ICEs), prophages and tandem MGEs were located at different insertion sites, while 86% of the AMR-associated MGEs were inserted at rplL and rum loci. Comprehensive analysis of insertions at rplL and rum loci among four pathogenic Streptococcus species ( Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes , and S. suis ) revealed the existence of different groups of MGEs, including Tn5252, ICE Sp 1108, and TnGBS2 groups ICEs, Φm46.1 group prophage, ICE_ICE and ICE_prophage tandem MGEs. Comparative ICE genomics of ICE Sa 2603 family revealed that module exchange and acquisition/deletion were the main mechanisms in MGEs' expansion and evolution. Furthermore, the observation of tandem MGEs reflected a novel mechanism for MGE diversity. Moreover, an in vitro competition assay showed no visible fitness cost was observed between different MGE-carrying isolates and a conjugation assay revealed the transferability of ICE Sa 2603 family of ICEs. Our statistics further indicated that the prevalence and diversity of MGEs in S. suis is much greater than in other three species which prompted our hypothesis that S. suis is probably a MGEs reservoir for other streptococci. In conclusion, our results showed that acquisition of MGEs confers S. suis not only its capability as a multidrug resistance pathogen, but also represents a paradigm to study the modular evolution and matryoshkas of MGEs.
Directory of Open Access Journals (Sweden)
Jinhu Huang
2016-10-01
Full Text Available Streptococcus suis is a previously neglected, newly emerging multidrug-resistant zoonotic pathogen. Mobile genetic elements (MGEs play a key role in intra- and interspecies horizontal transfer of antimicrobial resistance (AMR determinants. Although previous studies showed the presence of several MGEs, a comprehensive analysis of AMR-associated mobilome as well as their interaction and evolution has not been performed. In this study, we presented the AMR-associated mobilome and their insertion hotspots in S. suis. Integrative conjugative elements (ICEs, prophages and tandem MGEs were located at different insertion sites, while 86% of the AMR-associated MGEs were inserted at rplL and rum loci. Comprehensive analysis of insertions at rplL and rum loci among four pathogenic Streptococcus species (Streptococcus agalactiae, Streptococcus pneumoniae, Streptococcus pyogenes, and S. suis revealed the existence of different groups of MGEs, including Tn5252, ICESp1108, and TnGBS2 groups ICEs, Φm46.1 group prophage, ICE_ICE and ICE_prophage tandem MGEs. Comparative ICE genomics of ICESa2603 family revealed that module exchange and acquisition/deletion were the main mechanisms in MGEs’ expansion and evolution. Furthermore, the observation of tandem MGEs reflected a novel mechanism for MGE diversity. Moreover, an in vitro competition assay showed no visible fitness cost was observed between different MGE-carrying isolates and a conjugation assay revealed the transferability of ICESa2603 family of ICEs. Our statistics further indicated that the prevalence and diversity of MGEs in S. suis is much greater than in other three species which prompted our hypothesis that S. suis is probably a MGEs reservoir for other streptococci. In conclusion, our results showed that acquisition of MGEs confers S. suis not only its capability as a multidrug resistance pathogen, but also represents a paradigm to study the modular evolution and matryoshkas of MGEs.
Cloning in Streptococcus lactis of plasmid-mediated UV resistance and effect on prophage stability
International Nuclear Information System (INIS)
Chopin, M.C.; Chopin, A.; Rouault, A.; Simon, D.
1986-01-01
Plasmid pIL7 (33 kilobases) from Streptococcus lactis enhances UV resistance and prophage stability. A 5.4-kilobase pIL7 fragment carrying genes coding for both characters was cloned into S. lactis, using plasmid pHV1301 as the cloning vector. The recombinant plasmid was subsequently transferred to three other S. lactis strains by transformation or protoplast fusion. Cloned genes were expressed in all tested strains
Erythromycine resistance in streptococcus pyogenes group a throat isolates in sukkur city
International Nuclear Information System (INIS)
Memon, B.
2007-01-01
To examine and evaluate the predominant and common etiologic agent(s) of pharyngitis in Sukkur city and to determine their current antibiotic susceptibility/resistance trends. Out of 257 throat samples, 149 positive for Streptococcus pyogenes Group A between November 2001 and May 2003 from adult population of Sukkur city were tested for their susceptibility to erythromycin, clindamycin, azithromycin and clairithromycin. The throat samples (swabs) were examined by Gram-stain, API system, and for presence of a hemolysis. Samples were further cultured on Muller Hinton agar for determination of antibiotic sensitivity patterns. The sensitivity was performed on only those samples which were positive for S. pyogenes. Of all throat isolates, 95% were predominantly resistant to erythromycin. Their sensitivity towards clindamycin was 30%, azithromycin 44% and clairithromycin 76% respectively. The current pharyngeal isolates of S. pyogenes exhibited frequent and alarmingly high erythromycin resistance which may be due to both intrinsic and acquired mechanisms. (author)
Gurung, Mamata; Tamang, Migma Dorji; Moon, Dong Chan; Kim, Su-Ran; Jeong, Jin-Ha; Jang, Geum-Chan; Jung, Suk-Chan; Park, Yong-Ho; Lim, Suk-Kyung
2015-07-01
Characterization of 227 Streptococcus suis strains isolated from pigs during 2010 to 2013 showed high levels of resistance to clindamycin (95.6%), tilmicosin (94.7%), tylosin (93.8%), oxytetracycline (89.4%), chlortetracycline (86.8%), tiamulin (72.7%), neomycin (70.0%), enrofloxacin (56.4%), penicillin (56.4%), ceftiofur (55.9%), and gentamicin (55.1%). Resistance to tetracyclines, macrolides, aminoglycosides, and fluoroquinolone was attributed to the tet gene, erm(B), erm(C), mph(C), and mef(A) and/or mef(E) genes, aph(3')-IIIa and aac(6')-Ie-aph(2″)-Ia genes, and single point mutations in the quinolone resistance-determining region of ParC and GyrA, respectively. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Julián Reyes Vélez
2017-05-01
Full Text Available The objectives of this study are to determine the occurrence of antimicrobial resistance (AMR genes using whole-genome sequence (WGS of Streptococcus uberis (S. uberis and Streptococcus dysgalactiae (S. dysgalactiae isolates, recovered from dairy cows in the Canadian Maritime Provinces. A secondary objective included the exploration of the association between phenotypic AMR and the genomic characteristics (genome size, guanine–cytosine content, and occurrence of unique gene sequences. Initially, 91 isolates were sequenced, and of these isolates, 89 were assembled. Furthermore, 16 isolates were excluded due to larger than expected genomic sizes (>2.3 bp × 1,000 bp. In the final analysis, 73 were used with complete WGS and minimum inhibitory concentration records, which were part of the previous phenotypic AMR study, representing 18 dairy herds from the Maritime region of Canada (1. A total of 23 unique AMR gene sequences were found in the bacterial genomes, with a mean number of 8.1 (minimum: 5; maximum: 13 per genome. Overall, there were 10 AMR genes [ANT(6, TEM-127, TEM-163, TEM-89, TEM-95, Linb, Lnub, Ermb, Ermc, and TetS] present only in S. uberis genomes and 2 genes unique (EF-TU and TEM-71 to the S. dysgalactiae genomes; 11 AMR genes [APH(3′, TEM-1, TEM-136, TEM-157, TEM-47, TetM, bl2b, gyrA, parE, phoP, and rpoB] were found in both bacterial species. Two-way tabulations showed association between the phenotypic susceptibility to lincosamides and the presence of linB (P = 0.002 and lnuB (P < 0.001 genes and the between the presence of tetM (P = 0.015 and tetS (P = 0.064 genes and phenotypic resistance to tetracyclines only for the S. uberis isolates. The logistic model showed that the odds of resistance (to any of the phenotypically tested antimicrobials was 4.35 times higher when there were >11 AMR genes present in the genome, compared with <7 AMR genes (P < 0.001. The odds of resistance was lower for S
Kristensen, Bodil M.; Olsen, John E.; Harris, Claire L.; Ufret-Vincenty, Rafael L.; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar
2013-01-01
Many pathogens express a surface protein that binds the human complement regulator factor H (FH), as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR) of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems. PMID:23637608
Directory of Open Access Journals (Sweden)
Mattias C U Gustafsson
Full Text Available Many pathogens express a surface protein that binds the human complement regulator factor H (FH, as first described for Streptococcus pyogenes and the antiphagocytic M6 protein. It is commonly assumed that FH recruited to an M protein enhances virulence by protecting the bacteria against complement deposition and phagocytosis, but the role of FH-binding in S. pyogenes pathogenesis has remained unclear and controversial. Here, we studied seven purified M proteins for ability to bind FH and found that FH binds to the M5, M6 and M18 proteins but not the M1, M3, M4 and M22 proteins. Extensive immunochemical analysis indicated that FH binds solely to the hypervariable region (HVR of an M protein, suggesting that selection has favored the ability of certain HVRs to bind FH. These FH-binding HVRs could be studied as isolated polypeptides that retain ability to bind FH, implying that an FH-binding HVR represents a distinct ligand-binding domain. The isolated HVRs specifically interacted with FH among all human serum proteins, interacted with the same region in FH and showed species specificity, but exhibited little or no antigenic cross-reactivity. Although these findings suggested that FH recruited to an M protein promotes virulence, studies in transgenic mice did not demonstrate a role for bound FH during acute infection. Moreover, phagocytosis tests indicated that ability to bind FH is neither sufficient nor necessary for S. pyogenes to resist killing in whole human blood. While these data shed new light on the HVR of M proteins, they suggest that FH-binding may affect S. pyogenes virulence by mechanisms not assessed in currently used model systems.
Kosowska-Shick, Klaudia; Clark, Catherine; Credito, Kim; McGhee, Pamela; Dewasse, Bonifacio; Bogdanovich, Tatiana; Appelbaum, Peter C
2006-02-01
Retapamulin had the lowest rate of spontaneous mutations by single-step passaging and the lowest parent and selected mutant MICs by multistep passaging among all drugs tested for all Staphylococcus aureus strains and three Streptococcus pyogenes strains which yielded resistant clones. Retapamulin has a low potential for resistance selection in S. pyogenes, with a slow and gradual propensity for resistance development in S. aureus.
Directory of Open Access Journals (Sweden)
Abedelmajeed Nasereddin
Full Text Available Infections of Streptococcus pneumoniae in children can be prevented by vaccination; left untreated, they cause high morbidity and fatalities. This study aimed at determining the nasopharyngeal carrier rates, serotype distribution and antimicrobial resistance patterns of S. pneumoniae in healthy Palestinian children under age two prior to the full introduction of the pneumococcal 7-valent conjugate vaccine (PCV7, which was originally introduced into Palestine in a pilot trial in September, 2010. In a cross sectional study, nasopharyngeal specimens were collected from 397 healthy children from different Palestinian districts between the beginning of November 2012 to the end of January 2013. Samples were inoculated into blood agar and suspected colonies were examined by amplifying the pneumococcal-specific autolysin gene using a real-time PCR. Serotypes were identified by a PCR that incorporated different sets of specific primers. Antimicrobial susceptibility was measured by disk diffusion and MIC methods. The resulting carrier rate of Streptococcus pneumoniae was 55.7% (221/397. The main serotypes were PCV7 serotypes 19F (12.2%, 23F (9.0%, 6B (8.6% and 14 (4% and PCV13 serotypes 6A (13.6% and 19A (4.1%. Notably, serotype 6A, not included in the pilot trial (PCV7 vaccine, was the most prevalent. Resistance to more than two drugs was observed for bacteria from 34.1% of the children (72/211 while 22.3% (47/211 carried bacteria were susceptible to all tested antibiotics. All the isolates were sensitive to cefotaxime and vancomycin. Any or all of these might impinge on the type and efficacy of the pneumococcal conjugate vaccines and antibiotics to be used for prevention and treatment of pneumococcal disease in the country.
Moreno, Luisa Z; Matajira, Carlos E C; Gomes, Vasco T M; Silva, Ana Paula S; Mesquita, Renan E; Christ, Ana Paula G; Sato, Maria Inês Z; Moreno, Andrea M
2016-10-01
The Streptococcus species present broad phenotypic variation, making identification difficult using only traditional microbiological methods. Even though Streptococcus suis is the most important species for the worldwide swine industry, other Streptococcus species appear to be able to cause disease in swine and could represent a higher underestimated risk for porcine health. The aim of this study was to identify Streptococcus-like isolates by MALDI-TOF MS and 16S rRNA sequencing and further molecular and antibiotic susceptibility characterization of the atypical Streptococcus species capable of causing disease in swine. Fifty presumptive Streptococcus isolates from diseased pigs isolated from different Brazilian States between 2002 and 2014 were evaluated. Among the studied isolates, 26% were identified as Streptococcus hyovaginalis, 24% as Streptococcus plurianimalium, 12% as Streptococcus alactolyticus, 10% as Streptococcus hyointestinalis, and the remaining isolates belonged to Streptococcus henryi (6%), Streptococcus thoraltensis (6%), Streptococcus gallolyticus (6%), Streptococcus gallinaceus (4%), Streptococcus sanguinis (4%), and Streptococcus mitis (2%). The Streptococcus isolates were successfully identified by spectral cluster analysis and 16S rRNA sequencing with 96% of concordance between the techniques. The SE-AFLP analysis also supported Streptococcus species distinction and enabled further observation of higher genetic heterogeneity intra-species. The identified Streptococcus species presented variable MIC values to β-lactams, enrofloxacin and florfenicol, and high resistance rates to tetracyclines and macrolides, which appear to be directly related to the industry's antimicrobial usage and resistance selection. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Tal Marom
2017-10-01
Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.
Matsui, Natsuko; Ito, Makoto; Kuramae, Hitoshi; Inukai, Tomomi; Sakai, Akiyoshi; Okugawa, Masaru
2013-04-01
An autopsy case of infective endocarditis caused by multidrug-resistant Streptococcus mitis was described in a patient with a combination of factors that compromised immune status, including autoimmune hemolytic anemia, post-splenectomy state, prolonged steroid treatment, and IgA deficiency. The isolated S. mitis strain from blood culture was broadly resistant to penicillin, cephalosporins, carbapenem, macrolides, and fluoroquinolone. Recurrent episodes of bacterial infections and therapeutic use of several antibiotics may underlie the development of multidrug resistance for S. mitis. Because clinically isolated S. mitis strains from chronically immunocompromised patients have become resistant to a wide spectrum of antibiotics, appropriate antibiotic regimens should be selected when treating invasive S. mitis infections in these compromised patients.
Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.
Murata, Takatoshi; Hanada, Nobuhiro
2016-06-01
Genes encoding fluoride transporters have been identified in bacterial and archaeal species. The genome sequence of the cariogenic Streptococcus mutans bacteria suggests the presence of a putative fluoride transporter, which is referred to as a chloride channel permease. Two homologues of this gene (GenBank locus tags SMU_1290c and SMU_1289c) reside in tandem in the genome of S. mutans The aim of this study was to determine whether the chloride channel permeases contribute to fluoride resistance. We constructed SMU_1290c- and SMU_1289c-knockout S. mutans UA159 strains. We also constructed a double-knockout strain lacking both genes. SMU_1290c or SMU_1289c was transformed into a fluoride transporter- disrupted Escherichia coli strain. All bacterial strains were cultured under appropriate conditions with or without sodium fluoride, and fluoride resistance was evaluated. All three gene-knockout S. mutans strains showed lower resistance to sodium fluoride than did the wild-type strain. No significant changes in resistance to other sodium halides were recognized between the wild-type and double-knockout strains. Both SMU_1290c and SMU_1289c transformation rescued fluoride transporter-disrupted E. coli cell from fluoride toxicity. We conclude that the chloride channel permeases contribute to fluoride resistance in S. mutans. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.
Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak
2014-08-01
The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.
A Highly Arginolytic Streptococcus Species That Potently Antagonizes Streptococcus mutans.
Huang, Xuelian; Palmer, Sara R; Ahn, Sang-Joon; Richards, Vincent P; Williams, Matthew L; Nascimento, Marcelle M; Burne, Robert A
2016-01-29
The ability of certain oral biofilm bacteria to moderate pH through arginine metabolism by the arginine deiminase system (ADS) is a deterrent to the development of dental caries. Here, we characterize a novel Streptococcus strain, designated strain A12, isolated from supragingival dental plaque of a caries-free individual. A12 not only expressed the ADS pathway at high levels under a variety of conditions but also effectively inhibited growth and two intercellular signaling pathways of the dental caries pathogen Streptococcus mutans. A12 produced copious amounts of H2O2 via the pyruvate oxidase enzyme that were sufficient to arrest the growth of S. mutans. A12 also produced a protease similar to challisin (Sgc) of Streptococcus gordonii that was able to block the competence-stimulating peptide (CSP)-ComDE signaling system, which is essential for bacteriocin production by S. mutans. Wild-type A12, but not an sgc mutant derivative, could protect the sensitive indicator strain Streptococcus sanguinis SK150 from killing by the bacteriocins of S. mutans. A12, but not S. gordonii, could also block the XIP (comX-inducing peptide) signaling pathway, which is the proximal regulator of genetic competence in S. mutans, but Sgc was not required for this activity. The complete genome sequence of A12 was determined, and phylogenomic analyses compared A12 to streptococcal reference genomes. A12 was most similar to Streptococcus australis and Streptococcus parasanguinis but sufficiently different that it may represent a new species. A12-like organisms may play crucial roles in the promotion of stable, health-associated oral biofilm communities by moderating plaque pH and interfering with the growth and virulence of caries pathogens. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Yang, Feng; Li, Hongsheng; Zhang, Shidong; Wang, Xurong
2016-01-01
Streptococcus agalactiae is a major contagious pathogen causing bovine mastitis worldwide. We report here the draft sequence of S.?agalactiae Ia strain M19, a multidrug-resistant isolate from a bovine mastitis case in Ningxia Hui autonomous region, China.
DEFF Research Database (Denmark)
Magnussen, Marita D; Gaini, Shahin; Gislason, Hannes
2016-01-01
The aim of this study was to investigate the antibacterial resistance of Streptococcus pyogenes (GAS), and correlate the findings with the sales of erythromycin and tetracycline. General practitioners in the Faroe Islands were recruited to send oropharyngeal swabs. From an ongoing pneumococcal...
Papadimitriou, Konstantinos; Anastasiou, Rania; Mavrogonatou, Eleni; Blom, Jochen; Papandreou, Nikos C; Hamodrakas, Stavros J; Ferreira, Stéphanie; Renault, Pierre; Supply, Philip; Pot, Bruno; Tsakalidou, Effie
2014-04-08
Within the genus Streptococcus, only Streptococcus thermophilus is used as a starter culture in food fermentations. Streptococcus macedonicus though, which belongs to the Streptococcus bovis/Streptococcus equinus complex (SBSEC), is also frequently isolated from fermented foods mainly of dairy origin. Members of the SBSEC have been implicated in human endocarditis and colon cancer. Here we compare the genome sequence of the dairy isolate S. macedonicus ACA-DC 198 to the other SBSEC genomes in order to assess in silico its potential adaptation to milk and its pathogenicity status. Despite the fact that the SBSEC species were found tightly related based on whole genome phylogeny of streptococci, two distinct patterns of evolution were identified among them. Streptococcus macedonicus, Streptococcus infantarius CJ18 and Streptococcus pasteurianus ATCC 43144 seem to have undergone reductive evolution resulting in significantly diminished genome sizes and increased percentages of potential pseudogenes when compared to Streptococcus gallolyticus subsp. gallolyticus. In addition, the three species seem to have lost genes for catabolizing complex plant carbohydrates and for detoxifying toxic substances previously linked to the ability of S. gallolyticus to survive in the rumen. Analysis of the S. macedonicus genome revealed features that could support adaptation to milk, including an extra gene cluster for lactose and galactose metabolism, a proteolytic system for casein hydrolysis, auxotrophy for several vitamins, an increased ability to resist bacteriophages and horizontal gene transfer events with the dairy Lactococcus lactis and S. thermophilus as potential donors. In addition, S. macedonicus lacks several pathogenicity-related genes found in S. gallolyticus. For example, S. macedonicus has retained only one (i.e. the pil3) of the three pilus gene clusters which may mediate the binding of S. gallolyticus to the extracellular matrix. Unexpectedly, similar findings were
Directory of Open Access Journals (Sweden)
Lêda Lúcia M. Ferreira
2001-06-01
ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those
Septicemia with Streptococcus pseudopneumoniae
DEFF Research Database (Denmark)
Fuursted, Kurt; Littauer, Pia Jeanette; Greve, Thomas
2016-01-01
Streptococcus pseudopneumoniae was described in 2004 as a new human pathogen, acknowledged in a range of clinical infections typically associated to the respiratory tract. This report demonstrates that S. pseudopneumoniae has the potential to cause invasive infection. In blood cultures from three...... and the antibiogram and resistome revealed no antibiotic resistance....
International Nuclear Information System (INIS)
Sharma, V.K.
1987-01-01
An erythromycin-sensitive clinical isolate of Streptococcus faecalis (CS-4B) generated intermediate-level erythromycin-resistant isolates ([CS-4B(S)] at a frequency of 4 x 10 -8 per cell. CS-4B(S) produces high-level erythromycin-resistant isolates [CS-4B(L)] at a very high frequency. The erythromycin-resistance is non-transferable, chromosomally located, and distinct from the well described erythromycin-resistance of the MLS type. The erythromycin-resistance of CS-4B(S) and CS-4B(L) is not due to an in vitro or in vivo alteration or inactivation of erythromycin. 14 C-erythromycin binds in vitro, as evaluated with sucrose gradients, to 70S ribosomes and 50S ribosomal subunits in CS-4B. Binding to CS-4B(L) ribosomes was barely detectable whereas CS-4B(S) ribosomes retained binding capacity. The binding studies on filter membranes revealed a substantial reduction of 14 C-erythromycin binding to CS-4B(S) ribosomes when compared to CS-4B ribosomes. The in vivo accumulation of 14 C-erythromycin in CS-4B and CS-4B(S) parallel the in vitro binding capacity of ribosomes indicating the apparent absence of a permeability barrier to erythromycin in CS-4B
Wang, Liping; Zhang, Yuanshu
2009-10-01
The postantibiotic effects (PAEs) and postantibiotic sub-MIC effects (PA SMEs) of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype) were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05) regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.
Energy Technology Data Exchange (ETDEWEB)
Lopez, P.; Espinosa, M.; Lacks, S.A.
1984-01-01
The 10-kb chromosomal fragment of Streptococcus pneumoniae cloned in pLS80 contains the sul-d allele of the pneumococcal gene for dihydropteroate synthase. As a single copy in the chromosome this allele confers resistance to sulfanilamide at 0.2 mg/ml; in the multicopy plasmid it confers resistance to 2.0 mg/ml. The sul-d mutation was mapped by restriction analysis to a 0.4-kb region. A spontaneous deletion beginning approx. 1.5 kb to the right of the sul-d mutation prevented gene function, possibly by removing a promoter. This region could be restored by chromosomal facilitation and be demonstrated in the plasmid by selection for sulfonamide resistance. Under selection for a vector marker, tetracycline resistance, only the deleted plasmid was detectable, apparently as a result of plasmid segregation and the advantageous growth rates of cells with smaller plasmids. When such cells were selected for sulfonamide resistance, the deleted region returned to the plasmid, presumably by equilibration between the chromosome and the plasmid pool, to give a low frequency (approx. 10/sup -3/) of cells resistant to sulfanilamide at 2.0 mg/ml. Models for the mechanisms of chromosomal facilitation and equilibration are proposed. Several derivatives of pLS80 could be transferred to Bacillus subtilis, where they conferred resistance to sulfanilamide at 2 mg/ml, thereby demonstrating cross-species expression of the pneumococcal gene. Transfer of the plasmids to B. subtilis gave rise to large deletions to the left of the sul-d marker, but these deletions did not interfere with the sul-d gene function. Restriction maps of pLS80 and its variously deleted derivatives are presented.
Eichenbaum, Zehava; Federle, Michael J.; Marra, Diana; Vos, Willem M. de; Kuipers, Oscar P.; Kleerebezem, Michiel; Scott, June R.
1998-01-01
We characterized the regulated activity of the lactococcal nisA promoter in strains of the gram-positive species Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus pneumoniae, Enterococcus faecalis, and Bacillus subtilis. nisA promoter activity was dependent on the proteins NisR and
Directory of Open Access Journals (Sweden)
S F Swedan
2016-01-01
Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C. Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.
Directory of Open Access Journals (Sweden)
Magdalena Musiorska
2016-12-01
Full Text Available Introduction. Streptococcus agalactiae infections are among the most significant causes of neonatal invasive diseases. Proper screening and detection of pregnant women carrying GBS allows intrapartum administration of antibiotic prophylaxis and is an effective measure in preventing transmission of bacteria from mother to newborns. Material and methods. Sixty three bacterial strains were isolated from vaginal swabs from pregnant and nonpregnant women of reproductive age. Species were identified by colony morphology, haemolysis type, Gram staining and SLIDEX® Strepto Plus latex test. Antimicrobial resistance of 56 strains was determined using disk-diffusion method. The presence of molecular resistance determinants was assessed using PCR with specific primers, and capsular types were identified using multiplex PCR. Results. None of the strains were resistant to the first drug of choice, penicillin. A large percentage of isolates (78.6% were resistant to doxycycline. The prevalence of resistance to macrolides and lincosamides, antibiotics used in women allergic to penicillin, was high. Those results corresponded with PCR tests, as tetM and ermA1 were most frequently detected genes (98.4 and 87.3%, respectively. 7.94% of strains possessed 7 different out of 13 tested genes determining resistance to different groups of antimicrobials. Among the capsular types, Ia, which proved to be associated with the most severe and invasive infections in mothers and neonates, was the most prevalent (65.08%. Conclusions. Even though they are susceptible to penicillin, multidrug resistance is common among S. agalactiae strains isolated from women of reproductive age and this resistance can be caused by more than one gene per single isolate
Directory of Open Access Journals (Sweden)
Dharm Raj Bhatta
2014-02-01
Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.
Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok
2011-01-01
Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.
Directory of Open Access Journals (Sweden)
Liping Wang
2009-12-01
Full Text Available The postantibiotic effects (PAEs and postantibiotic sub-MIC effects (PA SMEs of tilmicosin, erythromycin and tiamulin on erythromycin-susceptible and erythromycin-resistant strains of Streptococcus suis (M phenotype were investigated in vitro. Tilmicosin and tiamulin induced significantly longer PAE and PA SME against both erythromycin-susceptible and erythromycin-resistant strains than did erythromycin. The durations of PAE and PA SMEs were proportional to the concentrations of drugs used for exposure. The PA SMEs were substantially longer than PAEs on S. suis (P<0.05 regardless of the antimicrobial used for exposure. The results indicated that the PAE and PA SME could help in the design of efficient control strategies for infection especially caused by erythromycin-resistant S. suis and that they may provide additional valuable information for the rational drug use in clinical practice.
Chancey, Scott T; Bai, Xianhe; Kumar, Nikhil; Drabek, Elliott F; Daugherty, Sean C; Colon, Thomas; Ott, Sandra; Sengamalay, Naomi; Sadzewicz, Lisa; Tallon, Luke J; Fraser, Claire M; Tettelin, Hervé; Stephens, David S
2015-01-01
Macrolide resistance, emerging in Streptococcus pneumoniae and other Gram-positive bacteria, is increasingly due to efflux pumps encoded by mef/mel(msr) operons found on discrete mobile genetic elements. The regulation of mef/mel(msr) in these elements is not well understood. We identified the mef(E)/mel transcriptional start, localized the mef(E)/mel promoter, and demonstrated attenuation of transcription as a mechanism of regulation of macrolide-inducible mef-mediated macrolide resistance in S. pneumoniae. The mef(E)/mel transcriptional start site was a guanine 327 bp upstream of mef(E). Consensus pneumococcal promoter -10 (5'-TATACT-3') and -35 (5'-TTGAAC-3') boxes separated by 17 bp were identified 7 bp upstream of the start site. Analysis of the predicted secondary structure of the 327 5' region identified four pairs of inverted repeats R1-R8 predicted to fold into stem-loops, a small leader peptide [MTASMRLR, (Mef(E)L)] required for macrolide induction and a Rho-independent transcription terminator. RNA-seq analyses provided confirmation of transcriptional attenuation. In addition, expression of mef(E)L was also influenced by mef(E)L-dependent mRNA stability. The regulatory region 5' of mef(E) was highly conserved in other mef/mel(msr)-containing elements including Tn1207.1 and the 5612IQ complex in pneumococci and Tn1207.3 in Group A streptococci, indicating a regulatory mechanism common to a wide variety of Gram-positive bacteria containing mef/mel(msr) elements.
GC-MS-Based Metabolome and Metabolite Regulation in Serum-Resistant Streptococcus agalactiae.
Wang, Zhe; Li, Min-Yi; Peng, Bo; Cheng, Zhi-Xue; Li, Hui; Peng, Xuan-Xian
2016-07-01
Streptococcus agalactiae causes severe systemic infections in human and fish. In the present study, we established a pathogen-plasma interaction model by which we explored how S. agalactiae evaded serum-mediated killing. We found that S. agalactiae grew faster in the presence of yellow grouper plasma than in the absence of the plasma, indicating S. agalactiae evolved a way of evading the fish immune system. To determine the events underlying this phenotype, we applied GC-MS-based metabolomics approaches to identify differential metabolomes between S. agalactiae cultured with and without yellow grouper plasma. Through bioinformatics analysis, decreased malic acid and increased adenosine were identified as the most crucial metabolites that distinguish the two groups. Meanwhile, they presented with decreased TCA cycle and elevated purine metabolism, respectively. Finally, exogenous malic acid and adenosine were used to reprogram the plasma-resistant metabolome, leading to elevated and decreased susceptibility to the plasma, respectively. Therefore, our findings reveal for the first time that S. agalactiae utilizes a metabolic trick to respond to plasma killing as a result of serum resistance, which may be reverted or enhanced by exogenous malic acid and adenosine, respectively, suggesting that the metabolic trick can be regulated by metabolites.
Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection
McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz
1984-12-01
A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.
Kaczorek, E; Małaczewska, J; Wójcik, R; Rękawek, W; Siwicki, A K
2017-08-01
Mastitis of dairy cattle is one of the most frequently diagnosed diseases worldwide. The main etiological agents of mastitis are bacteria of the genus Streptococcus spp., in which several antibiotic resistance mechanisms have been identified. However, detailed studies addressing this problem have not been conducted in northeastern Poland. Therefore, the aim of our study was to analyze, on phenotypic and genotypic levels, the antibiotic resistance pattern of Streptococcus spp. isolated from clinical cases of mastitis from dairy cattle in this region of Poland. The research was conducted using 135 strains of Streptococcus (Streptococcus uberis, n = 53; Streptococcus dysgalactiae, n = 41; Streptococcus agalactiae, n = 27; other streptococci, n = 14). The investigation of the antimicrobial susceptibility to 8 active substances applied in therapy in the analyzed region, as well as a selected bacteriocin (nisin), was performed using the minimum inhibitory concentration method. The presence of selected resistance genes (n = 14) was determined via PCR. We also investigated the correlation between the presence of resistance genes and the antimicrobial susceptibility of the examined strains in vitro. The highest observed resistance of Streptococcus spp. was toward gentamicin, kanamycin, and tetracycline, whereas the highest susceptibility occurred toward penicillin, enrofloxacin, and marbofloxacin. Additionally, the tested bacteriocin showed high efficacy. The presence of 13 analyzed resistance genes was observed in the examined strains [gene mef(A) was not detected]. In most strains, at least one resistance gene, mainly responsible for resistance to tetracyclines [tet(M), tet(K), tet(L)], was observed. However, a relationship between the presence of a given resistance gene and antimicrobial susceptibility on the phenotypic level was not always observed. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Resistance of Streptococcus sanguis biofilms to antimicrobial agents
DEFF Research Database (Denmark)
Larsen, T; Fiehn, N E
1996-01-01
of Streptococcus sanguis 804 and ATCC 10556 to amoxicillin, doxycycline and chlorhexidine was determined by a broth dilution method. Subsequently, S. sanguis biofilms established in an in vitro flow model were perfused with the antimicrobial agents for 48 h at concentrations equal to and up to 500 times the MIC...
This study was conducted to evaluate the effect of supplemental levels of vitamin A (0, 2,500, 5,000, 10,000, and 20,000 IU/kg diet) on the growth performance, hematology, immune response and resistance of Nile tilapia, Oreochromis niloticus to Streptococcus iniae challenge. Each diet was fed to Nil...
Directory of Open Access Journals (Sweden)
Yayan J
2014-10-01
Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was
Directory of Open Access Journals (Sweden)
Luiz Antônio Franco da Silva
2007-09-01
Full Text Available
It was verified the spectrum of susceptibilities/resistance of 76 samples of Staphylococcus coagulase positive and 51 samples of Streptococcus sp., isolated from milk of 231 cows presenting clinical mastitis. The diffusion method was used in plate of Kirby-Bauer, being tested ten active principles used in cases of clinical mastitis. Natural penicillin, chloranphenicol, tetraciclyne, kanamicyn, gentamicyn, nitrofurantoin, trimetopryn + sulfametoxazol, enrofloxacyn, perlimicyn and ceftiofur were tested. The samples of Staphylococcus coagulase positive presented a spectrum of larger resistance for the penicillin (78.9%, followed by trimetoprim + sulfametoxazol (59.2% and nitrofurantoin (57.8%. The largest susceptibility frequency was found in enrofloxacyn (96%, in perlimicyn (94% and in ceftiofur (94%. For the samples of Streptococcus sp. there was a profile resistance for penicillin (92%, chloranphenicol (74.5% and trimetoprim + sulfametoxazol (52%. A sensibility profile was also verified for enrofloxacyn (96%, ceftiofur (92% and perlimicyn (92%.
KEY-WORDS: Bovine mastitis; resistance; susceptibilities.
Verificou-se o espectro de sensibilidade/resistência de 76 cepas de Staphylococcus coagulase positiva e 51 cepas de Streptococcus sp., isolados do leite proveniente de 231 vacas que apresentaram mastite clínica. Utilizou-se o método de difusão em placa, segundo Kirby-Bauer, testando-se 10 princípios ativos: penicilina natural, cloranfenicol, tetraciclina, kanamicina, gentamicina, nitrofurantoína, trimetoprim + sulfametoxazol, enrofloxacina, perlimicina e ceftiofur. As cepas de Staphylococcus coagulase positiva apresentaram um espectro de resistência maior para a penicilina (78,9%, vindo a seguir trimetoprim + sulfametoxazol (59,2% e
Lung abscess caused by Streptococcus pneumoniae serotype 6B
Directory of Open Access Journals (Sweden)
Yuhei Ito
Full Text Available Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess. Keywords: Streptococcus pneumoniae, Lung abscess, Serotype 6B, Penicillin-resistant Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Gladys Antonia Cueto Montoya
2007-03-01
Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.
Sheen, Tamsin R.; Jimenez, Alyssa; Wang, Nai-Yu; Banerjee, Anirban; van Sorge, Nina M.; Doran, Kelly S.
2011-01-01
Streptococcus agalactiae (group B streptococcus [GBS]) is a Gram-positive bacterium found in the female rectovaginal tract and is capable of producing severe disease in susceptible hosts, including newborns and pregnant women. The vaginal tract is considered a major reservoir for GBS, and maternal
Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.
2003-01-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance se...
Directory of Open Access Journals (Sweden)
Ana Paula Gomes de Oliveira Magalhães
2003-07-01
Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.
Tilapia aquaculture worldwide is valued around US $ 7 billion. Tilapia are an important source of protein for domestic (top 5 most consumed seafoods) and global food security. Two gram postitive bacteria, Streptococcus iniae and S. agalactiae, are responsible for billion dollar losses annually. Gen...
Streptococcus iniae and Streptococcus agalactiae
Streptococcus iniae and S. agalactiae are economically important Gram positive bacterial pathogens of cultured and wild fish with a worldwide distribution. Both bacteria are potential zoonotic pathogens and have been associated most often with infections in immunocompromised people. Streptococcus in...
Clindamycin Affects Group A Streptococcus Virulence Factors and Improves Clinical Outcome.
Andreoni, Federica; Zürcher, Claudia; Tarnutzer, Andrea; Schilcher, Katrin; Neff, Andrina; Keller, Nadia; Marques Maggio, Ewerton; Poyart, Claire; Schuepbach, Reto A; Zinkernagel, Annelies S
2017-01-15
Group A Streptococcus (GAS) has acquired an arsenal of virulence factors, promoting life-threatening invasive infections such as necrotizing fasciitis. Current therapeutic regimens for necrotizing fasciitis include surgical debridement and treatment with cell wall-active antibiotics. Addition of clindamycin (CLI) is recommended, although clinical evidence is lacking. Reflecting the current clinical dilemma, an observational study showed that only 63% of the patients with severe invasive GAS infection received CLI. This work thus aimed to address whether CLI improves necrotizing fasciitis outcome by modulating virulence factors of CLI-susceptible and CLI-resistant GAS in vitro and in vivo. Treatment with CLI reduced extracellular DNase Sda1 and streptolysin O (SLO) activity in vivo, whereas subinhibitory CLI concentrations induced expression and activity of SLO, DNase, and Streptococcus pyogenes cell envelope protease in vitro. Our in vivo results suggest that CLI should be administered as soon as possible to patients with necrotizing fasciitis, while our in vitro studies emphasize that a high dosage of CLI is essential. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Novel metabolic activity indicator in Streptococcus mutans biofilms
Deng, D.M.; Hoogenkamp, M.A.; ten Cate, J.M.; Crielaard, W.
2009-01-01
Antimicrobial resistance of micro-organisms in biofilms requires novel strategies to evaluate the efficacy of caries preventive agents in actual biofilms. Hence we investigated fluorescence intensity (FI) in Streptococcus mutans biofilms constitutively expressing green fluorescent protein (GFP).
Sheng, Wang-Huei; Chuang, Yu-Chung; Teng, Lee-Jene; Hsueh, Po-Ren
2014-08-01
This study was intended to delineate the association between digestive tract malignancies and bacteraemia due to Streptococcus gallolyticus subspecies pasteurianus. We reviewed the medical records and microbiological results of patients with bacteraemia due to Streptococcus bovis during the period 2000-2012. Species and subspecies identification of isolates originally classified as S. bovis was confirmed by 16S rRNA sequencing and PCR restriction fragment length polymorphism (PCR-RFLP) assays. Minimum inhibitory concentrations of antimicrobial agents were determined by the broth microdilution method. Of the 172 S. bovis complex isolates obtained from 172 patients (age range, Streptococcus infantarius. The majority (n = 104, 60%) of patients were male and had underlying malignancies (n = 87, 51%). Bacteraemia due to S. gallolyticus subspecies gallolyticus was significantly associated with endocarditis while S. gallolyticus subspecies pasteurianus was more likely to be associated with malignancies of the digestive tract, including gastric, pancreatic, hepatobiliary and colorectal cancers. Septic shock at presentation was the only factor associated with mortality among patients with bacteraemia due to either subspecies of S. bovis. Isolates of S. gallolyticus subspecies pasteurianus had higher rates of resistance to macrolides and clindamycin than isolates of S. gallolyticus subspecies gallolyticus. Extensive diagnostic work-up for digestive tract malignancies and trans-esophageal echocardiogram should be investigated in patients with bacteraemia caused by S. gallolyticus. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Prevalence of multiple drug resistant Streptococcus suis in and around Guwahati, India
Directory of Open Access Journals (Sweden)
Mrinalee Devi
2017-05-01
Full Text Available Aim: This study was conducted to determine the prevalence and antimicrobial susceptibility of Streptococcus suis and their resistance patterns isolated from both clinically healthy carriers and diseased pigs in and around Guwahati, Assam, India. Materials and Methods: A total of 497 samples were collected during October, 2012, to April, 2014, from clinically healthy (n=67 and diseased (n=230 pigs of varying age and either sex maintained under organized and unorganized farming systems. Samples were processed for isolation and identification of S. suis by biochemical characterization and polymerase chain reaction targeting the housekeeping gene glutamate dehydrogenase. In vitro antimicrobial susceptibility of the recovered isolates against nine antibiotic groups comprising 17 antimicrobial agents was studied by standard method. Results: Of the 497 samples examined, 7 (1.41% isolates were confirmed to be S. suis of which 5 (1.87% and 2 (0.87% were derived from clinically healthy and diseased pigs, respectively. All the isolates were susceptible to gentamicin, amikacin, and erythromycin (100% followed by the penicillin group and enrofloxacin (85.71%, ceftriaxone, doxycycline HCL, ofloxacin and chloramphenicol (71.43%, to kanamycin, clindamycin and co-trimoxazole (42.85%. The isolates showed least susceptibility to cefalexin, tetracycline and streptomycin (28.57%. All the five S. suis isolates from clinically healthy pigs were susceptible to penicillin G, amoxyclav, doxycycline HCl, gentamicin, amikacin and erythromycin, 80.00% isolates susceptible to ampicillin, enrofloxacin and ofloxacin, 60.00% to ceftriaxone, kanamycin and chloramphenicol, 40% to cefalexin, tetracycline, clindamycin and co-trimoxazole, respectively. Only 20.00% isolates were susceptible to streptomycin. Both the isolates recovered from diseased pigs were susceptible to ampicillin, ceftriaxone, gentamicin, amikacin, enrofloxacin, erythromycin, and clindamycin. On the other hand
Directory of Open Access Journals (Sweden)
Yinfang Shen
2018-03-01
Full Text Available Streptococcus pyogenes, also known as group A Streptococcus (GAS, is one of the top 10 infectious causes of death worldwide. Macrolide and tetracycline resistant GAS has emerged as a major health concern in China coinciding with an ongoing scarlet fever epidemic. Furthermore, increasing rates of fluoroquinolone (FQ non-susceptibility within GAS from geographical regions outside of China has also been reported. Fluoroquinolones are the third most commonly prescribed antibiotic in China and is an therapeutic alternative for multi-drug resistant GAS. The purpose of this study was to investigate the epidemiological and molecular features of GAS fluoroquinolone (FQ non-susceptibility in Shanghai, China. GAS (n = 2,258 recovered between 2011 and 2016 from children and adults were tested for FQ-non-susceptibility. Efflux phenotype and mutations in parC, parE, gyrA, and gyrB were investigated and genetic relationships were determined by emm typing, pulsed-field gel electrophoresis and phylogenetic analysis. The frequency of GAS FQ-non-susceptibility was 1.3% (30/2,258, with the phenotype more prevalent in GAS isolated from adults (14.3% than from children (1.2%. Eighty percent (24/30 of FQ-non-susceptible isolates were also resistant to both macrolides (ermB and tetracycline (tetM including the GAS sequence types emm12, emm6, emm11, and emm1. Genomic fingerprinting analysis of the 30 isolates revealed that non-susceptibility may arise in various genetic backgrounds even within a single emm type. No efflux phenotype was observed in FQ non-susceptible isolates, and molecular analysis of the quinolone resistance-determining regions (QRDRs identified several sequence polymorphisms in ParC and ParE, and none in GyrA and GyrB. Expansion of this analysis to 152 publically available GAS whole genome sequences from Hong Kong predicted 7.9% (12/152 of Hong Kong isolates harbored a S79F ParC mutation, of which 66.7% (8/12 were macrolide and tetracycline resistant
Sheen, Tamsin R; Jimenez, Alyssa; Wang, Nai-Yu; Banerjee, Anirban; van Sorge, Nina M; Doran, Kelly S
2011-12-01
Streptococcus agalactiae (group B streptococcus [GBS]) is a Gram-positive bacterium found in the female rectovaginal tract and is capable of producing severe disease in susceptible hosts, including newborns and pregnant women. The vaginal tract is considered a major reservoir for GBS, and maternal vaginal colonization poses a significant risk to the newborn; however, little is known about the specific bacterial factors that promote GBS colonization and persistence in the female reproductive tract. We have developed in vitro models of GBS interaction with the human female cervicovaginal tract using human vaginal and cervical epithelial cell lines. Analysis of isogenic mutant GBS strains deficient in cell surface organelles such as pili and serine-rich repeat (Srr) proteins shows that these factors contribute to host cell attachment. As Srr proteins are heavily glycosylated, we confirmed that carbohydrate moieties contribute to the effective interaction of Srr-1 with vaginal epithelial cells. Antibody inhibition assays identified keratin 4 as a possible host receptor for Srr-1. Our findings were further substantiated in an in vivo mouse model of GBS vaginal colonization, where mice inoculated with an Srr-1-deficient mutant exhibited decreased GBS vaginal persistence compared to those inoculated with the wild-type (WT) parental strain. Furthermore, competition experiments in mice showed that WT GBS exhibited a significant survival advantage over the ΔpilA or Δsrr-1 mutant in the vaginal tract. Our results suggest that these GBS surface proteins contribute to vaginal colonization and may offer new insights into the mechanisms of vaginal niche establishment.
Directory of Open Access Journals (Sweden)
Rubio-López Virginia
2012-09-01
Full Text Available Abstract Background Group A Streptococcus (GAS causes human diseases ranging in severity from uncomplicated pharyngitis to life-threatening necrotizing fasciitis and shows high rates of macrolide resistance in several countries. Our goal is to identify antimicrobial resistance in Spanish GAS isolates collected between 1994 and 2006 and to determine the molecular epidemiology (emm/T typing and PFGE and resistance mechanisms of those resistant to erythromycin and tetracycline. Results Two hundred ninety-five out of 898 isolates (32.8% were erythromycin resistant, with the predominance of emm4T4, emm75T25, and emm28T28, accounting the 67.1% of the 21 emm/T types. Spread of emm4T4, emm75T25 and emm28T28 resistant clones caused high rates of macrolide resistance. The distribution of the phenotypes was M (76.9%, cMLSB (20.3%, iMLSB (2.7% with the involvement of the erythromycin resistance genes mef(A (89.5%, msr(D (81.7%, erm(B (37.3% and erm(A (35.9%. Sixty-one isolates were tetracycline resistant, with the main representation of the emm77T28 among 20 emm/T types. To note, the combination of tet(M and tet(O tetracycline resistance genes were similar to tet(M alone reaching values close to 40%. Resistance to both antibiotics was detected in 19 isolates of 7 emm/T types, being emm11T11 and the cMLSB phenotype the most frequent ones. erm(B and tet(M were present in almost all the strains, while erm(A, mef(A, msr(D and tet(O appeared in less than half of them. Conclusions Spanish GAS were highly resistant to macrolides meanwhile showed minor resistance rate to tetracycline. A remarkable correlation between antimicrobial resistance and emm/T type was noticed. Clonal spread of emm4T4, emm75T25 and emm28T28 was the main responsable for macrolide resistance where as that emm77T28 clones were it to tetraclycline resistance. A wide variety of macrolide resistance genes were responsible for three macrolide resistance phenotypes.
Rams, Thomas E; Feik, Diane; Mortensen, Joel E; Degener, John E; van Winkelhoff, Arie J
2014-12-01
Streptococcus constellatus and Streptococcus intermedius in subgingival dental plaque biofilms may contribute to forms of periodontitis that resist treatment with conventional mechanical root debridement/surgical procedures and may additionally participate in some extraoral infections. Because systemic antibiotics are often used in these clinical situations, and little is known of the antibiotic susceptibility of subgingival isolates of these two bacterial species, this study determined the in vitro susceptibility to six antibiotics of fresh S. constellatus and S. intermedius clinical isolates from human periodontitis lesions. A total of 33 S. constellatus and 17 S. intermedius subgingival strains, each recovered from separate patients with severe chronic periodontitis (n = 50) before treatment, were subjected to antibiotic gradient strip susceptibility testing with amoxicillin, azithromycin, clindamycin, ciprofloxacin, and doxycycline on blood-supplemented Mueller-Hinton agar and to the inhibitory effects of metronidazole at 16 mg/L in an enriched Brucella blood agar dilution assay. Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing interpretative standards were used to assess the results. Clindamycin was the most active antibiotic against S. constellatus (minimum inhibitory concentration at 90% [MIC90] 0.25 mg/L), and amoxicillin was most active against S. intermedius (MIC90 0.125 mg/L). A total of 30% of the S. constellatus and S. intermedius clinical isolates were resistant in vitro to doxycycline, 98% were only intermediate in susceptibility to ciprofloxacin, and 90% were resistant to metronidazole at 16 mg/L. Subgingival S. constellatus and S. intermedius exhibited variable antibiotic susceptibility profiles, potentially complicating empirical selection of periodontitis antibiotic therapy in patients who are species positive.
Seitz, Maren; Valentin-Weigand, Peter; Willenborg, Jörg
2016-01-01
Use of antimicrobial agents in veterinary medicine is essential to control infectious diseases, thereby keeping animals healthy and animal products safe for the consumer. On the other hand, development and spread of antimicrobial resistance is of major concern for public health. Streptococcus (S.) suis reflects a typical bacterial pathogen in modern swine production due to its facultative pathogenic nature and wide spread in the pig population. Thus, in the present review we focus on certain current aspects and problems related to antimicrobial use and resistance in S. suis as a paradigm for a bacterial pathogen affecting swine husbandry worldwide. The review includes (i) general aspects of antimicrobial use and resistance in veterinary medicine with emphasis on swine, (ii) genetic resistance mechanisms of S. suis known to contribute to bacterial survival under antibiotic selection pressure, and (iii) possible other factors which may contribute to problems in antimicrobial therapy of S. suis infections, such as bacterial persister cell formation, biofilm production, and co-infections. The latter shows that we hardly understand the complexity of factors affecting the success of antimicrobial treatment of (porcine) infectious diseases and underlines the need for further research in this field.
Morici, Eleonora; Simoni, Serena; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E; Mingoia, Marina
2017-01-01
To investigate the genetic basis of catQ-mediated chloramphenicol resistance in Streptococcus agalactiae. Two clinical strains of catQ-positive chloramphenicol-resistant S. agalactiae (Sag236 and Sag403) were recently isolated, typed (MLST, PFGE pulsotypes, capsular types) and their antibiotic resistances investigated by phenotypic and genotypic approaches. Several molecular methods (PCR mapping, restriction assays, Southern blotting, sequencing and sequence analysis, conjugal transfer assays) were used to determine the genetic context of catQ and characterize a genetic element detected in the isolates. Sag236 and Sag403 shared the same ST (ST19), but exhibited a different capsular type (III and V, respectively) and pulsotype. Both harboured the macrolide resistance genes mef(I) and erm(TR) and the tetracycline resistance gene tet(M). Accordingly, they were resistant to chloramphenicol, erythromycin and tetracycline. catQ and mef(I) were associated in an IQ module that was indistinguishable in Sag236 and Sag403. In mating assays, chloramphenicol and erythromycin resistance proved transferable, at low frequency, only from Sag236. Transconjugants carried not only catQ and mef(I), but also erm(TR), suggesting a linkage of the three resistance genes in a mobile element, which, though seemingly non-mobile, was also detected in Sag403. The new element (designated ICESag236, ∼110 kb) results from recombination of two integrative and conjugative elements (ICEs) originally described in different streptococcal species: S. agalactiae ICESagTR7, carrying erm(TR); and Streptococcus pneumoniae ICESpn529IQ, carrying the prototype IQ module. These findings strengthen the notion that widespread streptococcal ICEs may form mosaics that enhance their diversity and spread, broaden their host range and carry new cargo genes. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions
The Fitness Cost of Fluoride Resistance for Different Streptococcus mutans Strains in Biofilms
Directory of Open Access Journals (Sweden)
Yanling Cai
2017-08-01
Full Text Available The cariogenic bacterium Streptococcus mutans can develop stable resistance to fluoride through chromosomal mutations in vitro. Fluoride-resistant S. mutans has seldom been isolated in clinical settings, despite the wide application of fluoride in oral-care products. One explanation is that the fluoride-resistant S. mutans strains have decreased fitness. However, so far, there has been no conclusive evidence to support this idea. The aim of this study was to investigate the fitness cost of 48-h biofilms of two fluoride-resistant S. mutans strains, UF35 and UA159-FR (UAFR, using the wild-type fluoride-sensitive strain UA159 as a reference. The engineered UF35 strain contains one point mutation, whereas UAFR, selected from NaF-containing agar plates, has multiple chromosomal mutations. All biofilms were formed for 48 h under a constantly neutral pH or a pH-cycling (8 h of neutral pH and 16 h of pH 5.5 condition in the absence of fluoride. The biomass of the biofilms was quantified with a crystal violet assay. The biofilms were also treated with chlorhexidine or solutions at pH 3.0, after which their lactic acid production was quantified. Compared to the UF35 and UA159 biofilms, the biomass of UAFR biofilms was two–four fold higher, and the UAFR biofilms were more resistant to chlorhexidine and low pH in terms of lactic acid production. No difference in biomass and lactic acid production was detected between UF35 and UA159 biofilms. The fluoride resistance of UAFR and UF35 strains in biofilms was further confirmed by treating the biofilms with NaF solutions. The level of NaF resistance of the three biofilms is generally ranked as follows: UAFR > UF35 > UA159. In conclusion, there is indeed a fitness consequence in UAFR, but surprisingly, this fluoride-resistant strain performs better than UF35 and UA159 under the described conditions. In addition, UF35 did not display a reduced fitness; it performed as well as the wild-type fluoride
Directory of Open Access Journals (Sweden)
Elena López
Full Text Available Antibiotic resistance in Streptococcus pneumoniae has increased worldwide by the spread of a few clones. Fluoroquinolone resistance occurs mainly by alteration of their intracellular targets, the type II DNA topoisomerases, which is acquired either by point mutation or by recombination. Increase in fluoroquinolone-resistance may depend on the balance between antibiotic consumption and the cost that resistance imposes to bacterial fitness. In addition, pneumococcal prophages could play an important role. Prophage induction by fluoroquinolones was confirmed in 4 clinical isolates by using Southern blot hybridization. Clinical isolates (105 fluoroquinolone-resistant and 160 fluoroquinolone-susceptible were tested for lysogeny by using a PCR assay and functional prophage carriage was studied by mitomycin C induction. Fluoroquinolone-resistant strains harbored fewer inducible prophages (17/43 than fluoroquinolone-susceptible strains (49/70 (P = 0.0018. In addition, isolates of clones associated with fluoroquinolone resistance [CC156 (3/25; CC63 (2/20, and CC81 (1/19], had lower frequency of functional prophages than isolates of clones with low incidence of fluoroquinolone resistance [CC30 (4/21, CC230 (5/20, CC62 (9/21, and CC180 (21/30]. Likewise, persistent strains from patients with chronic respiratory diseases subjected to fluoroquinolone treatment had a low frequency of inducible prophages (1/11. Development of ciprofloxacin resistance was tested with two isogenic strains, one lysogenic and the other non-lysogenic: emergence of resistance was only observed in the non-lysogenic strain. These results are compatible with the lysis of lysogenic isolates receiving fluoroquinolones before the development of resistance and explain the inverse relation between presence of inducible prophages and fluoroquinolone-resistance.
Palmieri, Claudio; Magi, Gloria; Mingoia, Marina; Bagnarelli, Patrizia; Ripa, Sandro; Varaldo, Pietro E; Facinelli, Bruna
2012-09-01
Mosaic tetracycline resistance determinants are a recently discovered class of hybrids of ribosomal protection tet genes. They may show different patterns of mosaicism, but their final size has remained unaltered. Initially thought to be confined to a small group of anaerobic bacteria, mosaic tet genes were then found to be widespread. In the genus Streptococcus, a mosaic tet gene [tet(O/W/32/O)] was first discovered in Streptococcus suis, an emerging drug-resistant pig and human pathogen. In this study, we report the molecular characterization of a tet(O/W/32/O) gene-carrying mobile element from an S. suis isolate. tet(O/W/32/O) was detected, in tandem with tet(40), in a circular 14,741-bp genetic element (39.1% G+C; 17 open reading frames [ORFs] identified). The novel element, which we designated 15K, also carried the macrolide resistance determinant erm(B) and an aminoglycoside resistance four-gene cluster including aadE (streptomycin) and aphA (kanamycin). 15K appeared to be an unstable genetic element that, in the absence of recombinases, is capable of undergoing spontaneous excision under standard growth conditions. In the integrated form, 15K was found inside a 54,879-bp integrative and conjugative element (ICE) (50.5% G+C; 55 ORFs), which we designated ICESsu32457. An ∼1.3-kb segment that apparently served as the att site for excision of the unstable 15K element was identified. The novel ICE was transferable at high frequency to recipients from pathogenic Streptococcus species (S. suis, Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae), suggesting that the multiresistance 15K element can successfully spread within streptococcal populations.
Plasmid mediated enhancement of uv resistance in Streptococcus faecalis
International Nuclear Information System (INIS)
Miehl, R.; Miller, M.; Yasbin, R.E.
1980-01-01
A 38.5-Mdal plasmid of Streptococcus faecalis subdp. zymogenes has been shown to enhance survival following uv irradiation. In addition, the presence of this plasmid increases the mutation frequencies following uv irradiation and enhanced W-reactivation. The data presented indicate that S. faecalis has an inducible error-prone repair system and that the plasmid enhances these repair functions
Fibrinogen-Induced Streptococcus mutans Biofilm Formation and Adherence to Endothelial Cells
Directory of Open Access Journals (Sweden)
Telma Blanca Lombardo Bedran
2013-01-01
Full Text Available Streptococcus mutans, the predominant bacterial species associated with dental caries, can enter the bloodstream and cause infective endocarditis. The aim of this study was to investigate S. mutans biofilm formation and adherence to endothelial cells induced by human fibrinogen. The putative mechanism by which biofilm formation is induced as well as the impact of fibrinogen on S. mutans resistance to penicillin was also evaluated. Bovine plasma dose dependently induced biofilm formation by S. mutans. Of the various plasma proteins tested, only fibrinogen promoted the formation of biofilm in a dose-dependent manner. Scanning electron microscopy observations revealed the presence of complex aggregates of bacterial cells firmly attached to the polystyrene support. S. mutans in biofilms induced by the presence of fibrinogen was markedly resistant to the bactericidal effect of penicillin. Fibrinogen also significantly increased the adherence of S. mutans to endothelial cells. Neither S. mutans cells nor culture supernatants converted fibrinogen into fibrin. However, fibrinogen is specifically bound to the cell surface of S. mutans and may act as a bridging molecule to mediate biofilm formation. In conclusion, our study identified a new mechanism promoting S. mutans biofilm formation and adherence to endothelial cells which may contribute to infective endocarditis.
Pridgeon, Julia W; Klesius, Phillip H
2013-05-31
To develop attenuated bacteria as potential live vaccines, sparfloxacin was used in this study to modify 40 isolates of Streptococcus agalactiae. Majority of S. agalactiae used in this study were able to develop at least 80-fold resistance to sparfloxacin. When the virulence of the sparfloxacin-resistant S. agalactiae isolates were tested in 10-12g Nile tilapia by intraperitoneal injection at dose of 2×10(7)CFU/fish, 31 were found to be avirulent to fish. Of the 31 avirulent sparfloxacin-resistant S. agalactiae isolates, 30 provided 75-100% protection to 10-12g Nile tilapia against challenges with a virulent S. agalactiae isolate Sag 50. When the virulence of the 30 sparfloxacin-resistant S. agalactiae isolates was tested in 3-5g Nile tilapia by intraperitoneal injection at dose of 2×10(7)CFU/fish, six were found to be avirulent to 3-5g Nile tilapia. Of the six avirulent sparfloxacin-resistant S. agalactiae isolates, four provided 3-5g Nile tilapia 100% protection against challenges with homologous isolates, including Sag 97-spar isolate that was non-hemolytic. However, Sag 97-spar failed to provide broad cross-protection against challenges with heterologous isolates. When Nile tilapia was vaccinated with a polyvalent vaccine consisting of 30 sparfloxacin-resistant S. agalactiae isolates at dose of 2×10(6)CFU/fish, the polyvalent vaccine provided significant (PS. agalactiae. Taken together, our results suggest that a polyvalent vaccine consisting of various strains of S. agalactiae might be essential to provide broader protection to Nile tilapia against infections caused by S. agalactiae. Published by Elsevier Ltd.
Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Mantese Orlando C.
2003-01-01
Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência
Sheen, Tamsin R.; Jimenez, Alyssa; Wang, Nai-Yu; Banerjee, Anirban; van Sorge, Nina M.; Doran, Kelly S.
2011-01-01
Streptococcus agalactiae (group B streptococcus [GBS]) is a Gram-positive bacterium found in the female rectovaginal tract and is capable of producing severe disease in susceptible hosts, including newborns and pregnant women. The vaginal tract is considered a major reservoir for GBS, and maternal vaginal colonization poses a significant risk to the newborn; however, little is known about the specific bacterial factors that promote GBS colonization and persistence in the female reproductive tract. We have developed in vitro models of GBS interaction with the human female cervicovaginal tract using human vaginal and cervical epithelial cell lines. Analysis of isogenic mutant GBS strains deficient in cell surface organelles such as pili and serine-rich repeat (Srr) proteins shows that these factors contribute to host cell attachment. As Srr proteins are heavily glycosylated, we confirmed that carbohydrate moieties contribute to the effective interaction of Srr-1 with vaginal epithelial cells. Antibody inhibition assays identified keratin 4 as a possible host receptor for Srr-1. Our findings were further substantiated in an in vivo mouse model of GBS vaginal colonization, where mice inoculated with an Srr-1-deficient mutant exhibited decreased GBS vaginal persistence compared to those inoculated with the wild-type (WT) parental strain. Furthermore, competition experiments in mice showed that WT GBS exhibited a significant survival advantage over the ΔpilA or Δsrr-1 mutant in the vaginal tract. Our results suggest that these GBS surface proteins contribute to vaginal colonization and may offer new insights into the mechanisms of vaginal niche establishment. PMID:21984789
Vossen, Jos M.B.M. van der; Kok, Jan; Lelie, Daniel van der; Venema, Gerhardus
An efficient protoplast transformation system and a procedure of plasmid transfer by means of protoplast fusion is described for Streptococcus lactis. Protoplasts of S. lactis IL1403 and S. lactis MG1363 were transformed by pGK12 [2.9 MDa erythromycin resistance (Emr)] with an efficiency of 3 × 10^5
Artiles, Fernando; Horcajada-Herrera, Iballa; Noguera-Catalán, Javier; Alamo-Antúnez, Isabel; Bordes-Benítez, Ana; Lafarga-Capuz, Bernardo
2007-11-01
Macrolide resistance in Streptococcus pneumoniae is coded by the ermB and mefA/E genes. The aim of this study was to determine the status of macrolide-resistance, the molecular mechanisms involved, the serogroup relationships, and the level of co-resistance in S. pneumoniae isolates from Gran Canaria and Lanzarote, in the Canary Islands, Spain. Macrolide resistance phenotypes were investigated in 261 S. pneumoniae clinical isolates over a two-year period (2004 and 2005). Genotypes were determined by PCR (detection of ermB and mefA/E genes). Overall macrolide resistance was 40.6% (106 isolates); 79.2% (84) of resistant isolates presented the MLSB phenotype (98.8% harbored the ermB gene), with a predominance of serogroup 19, and 20.8% (22) presented the M phenotype (77.3% displayed the mefA/E gene), all associated with serogroup 14. Worthy of note, the M phenotype was found in 8 invasive isolates from Lanzarote (80%) all from serogroup 14. The ermB and mefA/E genes were detected in 7 isolates belonging to serogroup 19. Absence of co-resistance was observed most frequently in serogroup 14 (66.7%). Co-resistance with penicillin G, tetracycline, and trimethoprim-sulfamethoxazole was associated with serogroup 19 (36.8%). Two isolates (0.8%) were resistant to telithromycin. The frequency of macrolide resistance mechanisms in the Canary Islands is different from that observed in the rest of Spain, particularly in Lanzarote, where 80% of isolates harbored the mefA/E gene and belonged to serogroup 14.
Kadri, Zaina; Vandamme, Peter; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; Elfahime, El Mostafa; Farricha, Omar El; Swings, Jean; Amar, Mohamed
2015-02-01
Biochemical and molecular genetic studies were performed on two unidentified Gram-stain positive, catalase and oxidase negative, non-hemolytic Streptococcus-like organisms recovered from raw camel milk in Morocco. Phenotypic characterization and comparative 16S rRNA gene sequencing demonstrated that the two strains were highly different from each other and that they did not correspond to any recognized species of the genus Streptococcus. Phylogenetic analysis based on 16S rRNA gene sequences showed the unidentified organisms each formed a hitherto unknown sub-line within the genus Streptococcus, displaying a close affinity with Streptococcus moroccensis, Streptococcus minor and Streptococcus ovis. DNA G+C content determination, MALDI-TOF mass spectrometry and biochemical tests demonstrated the bacterial isolates represent two novel species. Based on the phenotypic distinctiveness of the new bacteria and molecular genetic evidence, it is proposed to classify the two strains as Streptococcus tangierensis sp. nov., with CCMM B832(T) (=LMG 27683(T)) as the type strain, and Streptococcus cameli sp. nov., with CCMM B834(T) (=LMG 27685(T)) as the type strain.
DEFF Research Database (Denmark)
Wolter, Nicole; Smith, Anthony M; Farrell, David J
2008-01-01
A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...
Streptococcus iniae is an etiologic agent of streptococcal disease in tilapia and is one of several Streptococcus spp. that negatively impact worldwide tilapia production. Methods for the prevention and control of S. iniae include vaccines, management strategies, and antibiotics. An alternative and ...
Mechanisms of group A Streptococcus resistance to reactive oxygen species.
Henningham, Anna; Döhrmann, Simon; Nizet, Victor; Cole, Jason N
2015-07-01
Streptococcus pyogenes, also known as group A Streptococcus (GAS), is an exclusively human Gram-positive bacterial pathogen ranked among the 'top 10' causes of infection-related deaths worldwide. GAS commonly causes benign and self-limiting epithelial infections (pharyngitis and impetigo), and less frequent severe invasive diseases (bacteremia, toxic shock syndrome and necrotizing fasciitis). Annually, GAS causes 700 million infections, including 1.8 million invasive infections with a mortality rate of 25%. In order to establish an infection, GAS must counteract the oxidative stress conditions generated by the release of reactive oxygen species (ROS) at the infection site by host immune cells such as neutrophils and monocytes. ROS are the highly reactive and toxic byproducts of oxygen metabolism, including hydrogen peroxide (H2O2), superoxide anion (O2•(-)), hydroxyl radicals (OH•) and singlet oxygen (O2*), which can damage bacterial nucleic acids, proteins and cell membranes. This review summarizes the enzymatic and regulatory mechanisms utilized by GAS to thwart ROS and survive under conditions of oxidative stress. © FEMS 2015.
Directory of Open Access Journals (Sweden)
Telma Blanca Lombardo Bedran
Full Text Available Triclosan is a general membrane-active agent with a broad-spectrum antimicrobial activity that is commonly used in oral care products. In this study, we investigated the effect of sub-minimum inhibitory concentrations (MICs of triclosan on the capacity of the cariogenic bacterium Streptococcus mutans to form biofilm and adhere to oral epithelial cells. As quantified by crystal violet staining, biofilm formation by two reference strains of S. mutans was dose-dependently promoted, in the range of 2.2- to 6.2-fold, by 1/2 and 1/4 MIC of triclosan. Observations by scanning electron microscopy revealed the presence of a dense biofilm attached to the polystyrene surface. Growth of S. mutans in the presence of triclosan at sub-MICs also increased its capacity to adhere to a monolayer of gingival epithelial cells. The expression of several genes involved in adherence and biofilm formation in S. mutans was investigated by quantitative RT-PCR. It was found that sub-MICs of triclosan significantly increased the expression of comD, gtfC, and luxS, and to a lesser extent of gtfB and atlA genes. These findings stress the importance of maintaining effective bactericidal concentrations of therapeutic triclosan since sub-MICs may promote colonization of the oral cavity by S. mutans.
Shimotoyodome, A; Kobayashi, H; Nakamura, J; Tokimitsu, I; Hase, T; Inoue, T; Matsukubo, T; Takaesu, Y
2006-01-01
The aim of this study was to investigate materials which reduce saliva-promoted adhesion of Streptococcus mutans onto enamel surfaces, and their potential in preventing dental biofilm development. The effects of hydroxyapatite (HA) surface pretreatment with hydrophilic polysaccharides on saliva-promoted S. mutans adhesion in vitro and de novo dental biofilm deposition in vivo were examined. Saliva-promoted adhesion of S. mutans MT8148 was significantly reduced by pretreatment of the HA surface with tragacanth gum (TG) and yeast-derived phosphoglycans. Extracellular phosphomannan (PM) from Pichia capsulata NRRL Y-1842 and TG reduced biofilm development on lower incisors in plaque-susceptible rats when administered via drinking water at concentrations of 0.5% and 0.01%, respectively. The inhibitory effect of TG on de novo dental biofilm formation was also demonstrated when administered via mouthwash in humans. It is concluded that TG and yeast-derived PM have the potential for use as anti-adherent agents and are effective in reducing de novo dental biofilm formation.
Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M
2016-01-01
The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.
Directory of Open Access Journals (Sweden)
Catrin E Moore
Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.
NAD+-Glycohydrolase Promotes Intracellular Survival of Group A Streptococcus.
Directory of Open Access Journals (Sweden)
Onkar Sharma
2016-03-01
Full Text Available A global increase in invasive infections due to group A Streptococcus (S. pyogenes or GAS has been observed since the 1980s, associated with emergence of a clonal group of strains of the M1T1 serotype. Among other virulence attributes, the M1T1 clone secretes NAD+-glycohydrolase (NADase. When GAS binds to epithelial cells in vitro, NADase is translocated into the cytosol in a process mediated by streptolysin O (SLO, and expression of these two toxins is associated with enhanced GAS intracellular survival. Because SLO is required for NADase translocation, it has been difficult to distinguish pathogenic effects of NADase from those of SLO. To resolve the effects of the two proteins, we made use of anthrax toxin as an alternative means to deliver NADase to host cells, independently of SLO. We developed a novel method for purification of enzymatically active NADase fused to an amino-terminal fragment of anthrax toxin lethal factor (LFn-NADase that exploits the avid, reversible binding of NADase to its endogenous inhibitor. LFn-NADase was translocated across a synthetic lipid bilayer in vitro in the presence of anthrax toxin protective antigen in a pH-dependent manner. Exposure of human oropharyngeal keratinocytes to LFn-NADase in the presence of protective antigen resulted in cytosolic delivery of NADase activity, inhibition of protein synthesis, and cell death, whereas a similar construct of an enzymatically inactive point mutant had no effect. Anthrax toxin-mediated delivery of NADase in an amount comparable to that observed during in vitro infection with live GAS rescued the defective intracellular survival of NADase-deficient GAS and increased the survival of SLO-deficient GAS. Confocal microscopy demonstrated that delivery of LFn-NADase prevented intracellular trafficking of NADase-deficient GAS to lysosomes. We conclude that NADase mediates cytotoxicity and promotes intracellular survival of GAS in host cells.
Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.
2015-01-01
Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686
Directory of Open Access Journals (Sweden)
Jie Nan
2009-10-01
Full Text Available As an oral bacterial pathogen, Streptococcus mutans has been known as the aetiologic agent of human dental caries. Among a total of 1960 identified proteins within the genome of this organism, there are about 500 without any known functions. One of these proteins, SMU.440, has very few homologs in the current protein databases and it does not fall into any protein functional families. Phylogenetic studies showed that SMU.440 is related to a particular ecological niche and conserved specifically in some oral pathogens, due to lateral gene transfer. The co-occurrence of a MarR protein within the same operon among these oral pathogens suggests that SMU.440 may be associated with antibiotic resistance. The structure determination of SMU.440 revealed that it shares the same fold and a similar pocket as polyketide cyclases, which indicated that it is very likely to bind some polyketide-like molecules. From the interlinking structural and bioinformatics studies, we have concluded that SMU.440 could be involved in polyketide-like antibiotic resistance, providing a better understanding of this hypothetical protein. Besides, the combination of multiple methods in this study can be used as a general approach for functional studies of a protein with unknown function.
Sakata, Hiroshi
2015-05-01
This study targeted patients in the Department of Pediatrics, Asahikawa Kosei Hospital, between January 2002 and December 2013. In patients suspected of having hemolytic streptococcal infection, Group A Streptococcus (GAS) strains isolated from a throat swab were examined for antimicrobial susceptibility testing. The MICs were measured by the broth microdilution method. The annual number of GAS strains examined for antimicrobial susceptibility testing ranged from 28 to 65 strains, for a total of 574 strains. Some of the isolates obtained from 2006 to 2009 and from 2011 to 2013 were analyzed to determine their emm types. An erythromycin (EM) resistant strain was not detected until 2004, but one EM-resistant strain appeared in 2005. Subsequently, EM-resistant strains rapidly increased, and 48 of 65 strains (73.8%) examined in 2009 were resistant. In 2010, the number of EM-resistant strains decreased to 12 of 36 strains (33.3%). However, it gradually increased afterwards, and 37 of 60 strains (61.7%) were resistant in 2013. Out of 574 strains examined, 184 exhibited EM-resistance, and the overall resistance rate was 31.9%. Partitioning the 124 strains examined between 2006 and 2008 according to emm types, only emm28 strains, which exhibited a high resistance rate, and emm12 strains demonstrated resistance. For the 142 strains examined between 2011 and 2013, the resistance rate of emm28 strains was similarly high; the resistance of emm12 strains significantly increased, and emm1 strains exhibited a high resistance rate. The number of emm types associated with the resistant strains increased. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Juliana Rosa da Silva
2017-08-01
Full Text Available Streptococcus agalactiae is one of the main causative agents of bovine mastitis and is associated with several economic losses for producers. Few studies have evaluated antimicrobial susceptibility and the prevalence of genetic resistance determinants among isolates of this bacterium from Brazilian dairy cattle. This work aimed to evaluate the frequency of the antimicrobial resistance genes ermA, ermB, mefA, tetO, tetM, aphA3, and aad-6, and in vitro susceptibility to the antimicrobials amikacin, erythromycin, clindamycin, tetracycline, gentamicin, penicillin, ceftiofur, and cefalotin, and the associations between resistance genotypes and phenotypes among 118 S. agalactiae isolates obtained from mastitic cows in Brazilian dairy herds. Of the resistance genes examined, ermB was found in 19 isolates (16.1%, tetO in 23 (19.5%, and tetM in 24 (20.3%. The genes ermA, mefA, aphA3, and aad-6 were not identified. There was an association between the presence of genes ermB, tetM, and tetO and phenotypic resistance to erythromycin, clindamycin, and tetracycline. Rates of resistance to the tested antibiotics varied, as follows: erythromycin (19.5%, tetracycline (35.6%, gentamicin (9.3%, clindamycin (20.3%, penicillin (3.4%, and amikacin (38.1%; conversely, all isolates were susceptible to ceftiofur and cefalotin. Antimicrobial resistance testing facilitates the treatment decision process, allowing the most judicious choice of antibiotics. Moreover, it enables regional and temporal monitoring of the resistance dynamics of this pathogen of high importance to human and animal health.
The clinical consequences of antimicrobial resistance.
Rice, Louis B
2009-10-01
The continued evolution of antimicrobial resistance in the hospital and more recently in the community threatens to seriously compromise our ability to treat serious infections. The major success of the seven-valent Streptococcus pneumoniae vaccine at reducing both infection and resistance has been followed by the emergence of previously minor serotypes that express multiresistance. The almost universal activity of cephalosporins and fluoroquinolones against community Escherichia coli strains has been compromised by the spread of CTX-M beta-lactamase-producing, fluoroquinolone-resistant strains, and the emergence of community-onset methicillin-resistant Staphylococcus aureus, particularly in the United States, has forced us to re-think our empirical treatment guidelines for skin and soft-tissue infections. Finally, our most potent and reliable class of antibiotics, the carbapenems, is compromised by the growth, primarily in intensive care units, of multiresistant Klebsiella pneumoniae, Acinetobacter baumanni, and Pseudomonas aeruginosa. The lack of a robust pipeline of new agents, particularly against resistant Gram-negative bacteria, emphasizes the importance of optimizing our use of current antimicrobials and promoting strict adherence to established infection control practices.
DEFF Research Database (Denmark)
Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S
2005-01-01
A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...
Antimicrobial Susceptibility/Resistance of Streptococcus Pneumoniae
Karcic, Emina; Aljicevic, Mufida; Bektas, Sabaheta; Karcic, Bekir
2015-01-01
Introduction: Pneumococcal infections are a major cause of morbidity and mortality worldwide, whose treatment is threatened with an increase in the number of strains resistant to antibiotic therapy. Goal: The main goal of this research was to investigate the presence of antimicrobial susceptibility/resistance of S. pneumoniae. Material and methods: Taken are swabs of the nose and nasopharynx, eye and ear. In vitro tests that were made in order to study the antimicrobial resistance of pneumococci are: disk diffusion method and E-test. Results: The resistance to inhibitors of cell wall synthesis was recorded at 39.17%, protein synthesis inhibitors 19.67%, folate antagonists 47.78% and quinolone in 1.11%. S. pneumoniae has shown drug resistance to erythromycin in 45%, clindamycin in 45%, chloramphenicol–0.56%, rifampicin–6.11%, tetracycline–4.67%, penicillin-G in 4.44%, oxacillin in 73.89%, ciprofloxacin in 1.11% and trimethoprim-sulfamethoxazole in 5.34% of cases. Conclusion: The highest resistance pneumococcus showed to erythromycin, clindamycin and trimethoprim-sulfamethoxazole and these should be avoided in the treatment. The least resistance pneumococcus showed to tetracycline, rifampicin, chloramphenicol, penicillin-G and ciprofloxacin. PMID:26236165
Morioka, Ayako; Asai, Tetsuo; Ishihara, Kanako; Kojima, Akemi; Tamura, Yutaka; Takahashi, Toshio
2005-02-01
A total of 88 Staphylococcus and 61 Streptococcus isolates from diseased animals throughout Japan were examined in 2000 for the minimum inhibitory concentrations of 24 different antimicrobials by the agar dilution method standardized by the Japanese Society of Chemotherapy. The resistance rates to aminobenzylpenicillin (36.4%) and benzylpenicillin (35.2%) were high in Staphylococcus isolates, and those to oxytetracycline (45.9%) and kanamycin (21.3%) were high in Streptococcus isolates. Two isolates resistant to oxacillin harbored the mecA gene. One was Staphylococcus epidermidis derived from a pig with arthritis, and the other Staphylococcus cohnii from a head of cattle with mastitis.
Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H
2009-03-01
Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.
Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu
2016-10-20
There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.
Mechanisms of genome evolution of Streptococcus.
Andam, Cheryl P; Hanage, William P
2015-07-01
The genus Streptococcus contains 104 recognized species, many of which are associated with human or animal hosts. A globally prevalent human pathogen in this group is Streptococcus pneumoniae (the pneumococcus). While being a common resident of the upper respiratory tract, it is also a major cause of otitis media, pneumonia, bacteremia and meningitis, accounting for a high burden of morbidity and mortality worldwide. Recent findings demonstrate the importance of recombination and selection in driving the population dynamics and evolution of different pneumococcal lineages, allowing them to successfully evade the impacts of selective pressures such as vaccination and antibiotic treatment. We highlight the ability of pneumococci to respond to these pressures through processes including serotype replacement, capsular switching and horizontal gene transfer (HGT) of antibiotic resistance genes. The challenge in controlling this pathogen also lies in the exceptional genetic and phenotypic variation among different pneumococcal lineages, particularly in terms of their pathogenicity and resistance to current therapeutic strategies. The widespread use of pneumococcal conjugate vaccines, which target only a small subset of the more than 90 pneumococcal serotypes, provides us with a unique opportunity to elucidate how the processes of selection and recombination interact to generate a remarkable level of plasticity and heterogeneity in the pneumococcal genome. These processes also play an important role in the emergence and spread of multi-resistant strains, which continues to pose a challenge in disease control and/or eradication. The application of population of genomic approaches at different spatial and temporal scales will help improve strategies to control this global pathogen, and potentially other pathogenic streptococci. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014.
Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi
2017-03-01
Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.
Glass-Kaastra, Shiona K.; Pearl, David L.; Reid-Smith, Richard J.; McEwen, Beverly; Slavic, Durda; Fairles, Jim; McEwen, Scott A.
2014-01-01
Susceptibility results for Pasteurella multocida and Streptococcus suis isolated from swine clinical samples were obtained from January 1998 to October 2010 from the Animal Health Laboratory at the University of Guelph, Guelph, Ontario, and used to describe variation in antimicrobial resistance (AMR) to 4 drugs of importance in the Ontario swine industry: ampicillin, tetracycline, tiamulin, and trimethoprim–sulfamethoxazole. Four temporal data-analysis options were used: visualization of trends in 12-month rolling averages, logistic-regression modeling, temporal-scan statistics, and a scan with the “What’s strange about recent events?” (WSARE) algorithm. The AMR trends varied among the antimicrobial drugs for a single pathogen and between pathogens for a single antimicrobial, suggesting that pathogen-specific AMR surveillance may be preferable to indicator data. The 4 methods provided complementary and, at times, redundant results. The most appropriate combination of analysis methods for surveillance using these data included temporal-scan statistics with a visualization method (rolling-average or predicted-probability plots following logistic-regression models). The WSARE algorithm provided interesting results for quality control and has the potential to detect new resistance patterns; however, missing data created problems for displaying the results in a way that would be meaningful to all surveillance stakeholders. PMID:25355992
Kambarev, Stanimir; Pecorari, Frédéric; Corvec, Stéphane
2018-02-09
Streptococcus gallolyticus ssp. gallolyticus (Sgg) is a commensal bacterium and an opportunistic pathogen. In humans it has been clinically associated with the incidence of colorectal cancer (CRC) and epidemiologically recognized as an emerging cause of infective endocarditis (IE). The standard therapy of Sgg includes the administration of a penicillin in combination with an aminoglycoside. Even though penicillin-resistant isolates have still not been reported, epidemiological studies have shown that this microbe is a reservoir of multiple acquired genes, conferring resistance to tetracyclines, aminoglycosides, macrolides and glycopeptides. However, the underlying antibiotic resistance mobilome of Sgg remains poorly understood. To investigate the mobile genetic basis of antibiotic resistance in multiresistant clinical Sgg. Isolate NTS31106099 was recovered from a patient with IE and CRC at Nantes University Hospital, France and studied by Illumina WGS and comparative genomics. Molecular epidemiology of the identified mobile element(s) was performed using antibiotic susceptibility testing (AST), PCR, PFGE and WGS. Mobility was investigated by PCR and filter mating. Two novel conjugative transposons, Tn6263 and Tn6331, confer aminoglycoside/macrolide co-resistance in clinical Sgg. They display classical family Tn916/Tn1545 modular architecture and harbour an aph(3')-III→sat4→ant(6)-Ia→erm(B) multiresistance gene cluster, related to pRE25 of Enterococcus faecium. These and/or closely related elements are highly prevalent among genetically heterogeneous clinical isolates of Sgg. Previously unknown Tn916-like mobile genetic elements conferring aminoglycoside/macrolide co-resistance make Sgg, collectively with other gut Firmicutes such as enterococci and eubacteria, a potential laterally active reservoir of these antibiotic resistance determinants among the mammalian gastrointestinal microbiota. © The Author(s) 2018. Published by Oxford University Press on behalf
Streptococcus iniae is an etiologic agent of streptococcal disease in tilapia and is one of several Streptococcus spp. that negatively impact worldwide tilapia production. Methods for the prevention and control of S. iniae include vaccines, management strategies, and antibiotics. A complimentary pre...
The Antiphagocytic Activity of SeM of Streptococcus equi Requires Capsule.
Timoney, John F; Suther, Pranav; Velineni, Sridhar; Artiushin, Sergey C
2014-01-01
Resistance to phagocytosis is a crucial virulence property of Streptococcus equi (Streptococcus equi subsp. equi; Se), the cause of equine strangles. The contribution and interdependence of capsule and SeM to killing in equine blood and neutrophils were investigated in naturally occurring strains of Se. Strains CF32, SF463 were capsule and SeM positive, strains Lex90, Lex93 were capsule negative and SeM positive and strains Se19, Se1-8 were capsule positive and SeM deficient. Phagocytosis and killing of Se19, Se1-8, Lex90 and Lex93 in equine blood and by neutrophils suspended in serum were significantly (P ≤ 0.02) greater compared to CF32 and SF463. The results indicate capsule and SeM are both required for resistance to phagocytosis and killing and that the anti-phagocytic property of SeM is greatly reduced in the absence of capsule.
Alves, Livia A; Harth-Chu, Erika N; Palma, Thais H; Stipp, Rafael N; Mariano, Flávia S; Höfling, José F; Abranches, Jacqueline; Mattos-Graner, Renata O
2017-10-01
Streptococcus mutans, a dental caries pathogen, can promote systemic infections upon reaching the bloodstream. The two-component system (TCS) VicRK Sm of S. mutans regulates the synthesis of and interaction with sucrose-derived exopolysaccharides (EPS), processes associated with oral and systemic virulence. In this study, we investigated the mechanisms by which VicRK Sm affects S. mutans susceptibility to blood-mediated immunity. Compared with parent strain UA159, the vicK Sm isogenic mutant (UAvic) showed reduced susceptibility to deposition of C3b of complement, low binding to serum immunoglobulin G (IgG), and low frequency of C3b/IgG-mediated opsonophagocytosis by polymorphonuclear cells in a sucrose-independent way (Pmutans employs mechanisms of complement evasion through peptidases, which are controlled by VicRK Sm. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Wang, Xiao-Nan; Qin, Mei; Feng, Yu-Ying; Chen, Jian-Kang; Song, Yi-Shan
2017-09-01
The promotion effect on proliferation of Streptococcus thermophilus by enzymatic hydrolysates of aquatic products was firstly studied. The effect of influencing factors of the hydrolysis on the growth of S. thermophilus was investigated. Grass Carp fish skin was hydrolysed to peptides by enzymatic hydrolysis using protease ProteAX, and for the S. thermophilus growth, the optimal enzymatic hydrolysis conditions were temperature of 60 °C, initial pH of 9.0, enzyme concentration of 10 g kg -1 , hydrolysis time of 80 min, and ratio of material to liquid of 1:2. The Grass Carp fish skin hydrolysate (GCFSH) prepared under the optimum conditions was fractionated to five fragments (GCFSH 1, GCFSH 2, GCFSH 3, GCFSH 4, GCFSH 5) according to molecular weight sizes, in which the fragments GCFSH 4 and GCFSH 5, with molecular weights of less than 1000 Da, significantly promoted the growth of S. thermophilus. The hydrolysis process of Grass Carp fish skin can be simplified, and the peptides with molecular weights below 1000 Da in the hydrolysates are the best nitrogen source for proliferation of S. thermophilus. This work can provide a fundamental theoretical basis for the production of multi-component functional foods, especially in milk drinks or yogurt. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
DEFF Research Database (Denmark)
Jensen, Anders; Kilian, Mogens
2011-01-01
The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...
Group B Streptococcus and Pregnancy
... B Strep and Pregnancy • What is group B streptococcus (GBS)? • What does it mean to be colonized ... planned cesarean birth? •Glossary What is group B streptococcus (GBS)? Group B streptococcus is one of the ...
Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong
2017-01-01
ICE Sag37 , a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae . Two clinical strains of S. agalactiae , Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. Sma I-PFGE revealed a new Sma I fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICE Sag37 , which was characterized using several molecular methods and in silico analyses. ICE Sag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae . Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA , which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICE Sag37 carried genes for resistance to multiple antibiotics, including erythromycin [ erm(B) ], tetracycline [ tet(O) ], and aminoglycosides [ aadE, aphA , and ant(6) ]. Potential virulence factors, including a two-component signal transduction system ( nisK/nisR ), were also observed in ICE Sag37 . S1-PFGE analysis ruled out the existence of plasmids. ICE Sag37 is the first ICE Sa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae .
Boutry, Céline; Delplace, Brigitte; Clippe, André; Fontaine, Laetitia; Hols, Pascal
2013-02-01
Streptococcus includes species that either contain or lack the LexA-like repressor (HdiR) of the classical SOS response. In Streptococcus pneumoniae, a species which belongs to the latter group, SOS response inducers (e.g., mitomycin C [Mc] and fluoroquinolones) were shown to induce natural transformation, leading to the hypothesis that DNA damage-induced competence could contribute to genomic plasticity and stress resistance. Using reporter strains and microarray experiments, we investigated the impact of the SOS response inducers mitomycin C and norfloxacin and the role of HdiR on competence development in Streptococcus thermophilus. We show that both the addition of SOS response inducers and HdiR inactivation have a dual effect, i.e., induction of the expression of SOS genes and reduction of transformability. Reduction of transformability results from two different mechanisms, since HdiR inactivation has no major effect on the expression of competence (com) genes, while mitomycin C downregulates the expression of early and late com genes in a dose-dependent manner. The downregulation of com genes by mitomycin C was shown to take place at the level of the activation of the ComRS signaling system by an unknown mechanism. Conversely, we show that a ComX-deficient strain is more resistant to mitomycin C and norfloxacin in a viability plate assay, which indicates that competence development negatively affects the resistance of S. thermophilus to DNA-damaging agents. Altogether, our results strongly suggest that SOS response activation and competence development are antagonistic processes in S. thermophilus.
[Construction of a low-pH-sensing system in Streptococcus mutans].
Di, Kang; Yuqing, Li; Xuedong, Zhou
2017-06-01
To construct a low-pH-sensing system in Streptococcus mutans (S. mutans) and to visually detect the pH in situ. Promoter of ureaseⅠ(PureⅠ) and green fluorescence protein (gfp) DNA fragments were amplified by polymerase chain reaction (PCR) from the genome of Streptococcus salivarius 57.I and S. mutans containing the gfp fragment. The two amplified DNA fragments were ligated together and further integrated into pDL278 to construct the recombinant plasmid pDL278-pureⅠ-gfp. This recombinant plasmid was then transformed into S. mutans UA159 cells. Subsequently, the intensity of the optical density per unit area of the low-pH-sensing system was measured and compared under different pH conditions and different processing times. PureⅠ and gfp DNA fragments were amplified successfully with the correct molecule sizes (450 and 717 bp, respectively). The recombinant plasmid pDL278-pureⅠ-gfp was constructed and further verified by PCR and sequencing. The intensity of the optical density per unit area of the low-pH-sensing system increased with decreasing pH and increasing processing time. A low-pH-sensing system was constructed successfully in S. mutans. Our research verified that pureⅠ of Streptococcus salivarius can function well in S. mutans as an acid induced promoter, and provided a new method of detecting the pH of plaque biofilms in situ.
Directory of Open Access Journals (Sweden)
Romeo S. Rodríguez
2000-06-01
Full Text Available OBJETIVO: Determinar la susceptibilidad antimicrobiana de Streptococcus pyogenes con el fin de estimar la prevalencia de los fenotipos de resistencia a los macrólidos. MATERIAL Y MÉTODOS: Se realizó un estudio de tipo transversal, en 1999, en el que se evaluaron 100 cepas de S. pyogenes, aislados en el Hospital Infantil de México Federico Gómez, en el lapso comprendido entre 1992 y 1998, procedentes de niños con faringoamigdalitis, conservadas en congelación en el laboratorio de bacteriología hasta su procesamiento. Se determinó la susceptibilidad antimicrobiana a algunos beta-lactámicos, macrólidos y clindamicina. La resistencia a eritromicina se probó por medio de la prueba de difusión de doble disco. Se calcularon medidas de tendencia central. RESULTADOS: Todas las cepas fueron sensibles a los beta-lactámicos y clindamicina; 16% fueron resistentes a los macrólidos, y todas correspondieron al fenotipo M. CONCLUSIONES: Es conveniente realizar periódicamente pruebas de escrutinio para conocer los posibles cambios en los patrones de sensibilidad estreptocócica.OBJECTIVE: To determine the antibiotic susceptibility of recent isolates of Streptococcus pyogenes and to evaluate the prevalence of macrolide-resistant phenotypes. MATERIAL AND METHODS: In 1999, we conducted a cross-sectional study at Mexico Children's Hospital "Federico Gomez", to analyze one hundred strains of S. pyogenes isolated from 1992 to 1998, in children with uncomplicated pharyngotonsillitis. Strains were frozen at the bacteriology lab until they were analyzed. Strains were tested for susceptibility against some beta-lactams, macrolides and clindamycin. Double-disk testing was carried out to evaluate erythromycin-resistant phenotypes. Data are presented using central tendency measures. RESULTS: All tested strains were not resistant to beta-lactams and clindamycin; 16% of the strains were resistant to macrolides and all of them belonged to phenotype M. CONCLUSIONS
Directory of Open Access Journals (Sweden)
Patrícia A. G. Velasquez
2009-12-01
Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled
Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.
2016-01-01
Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel
Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H
2017-02-02
Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0
Streptococcus agalactiae infection in domestic rabbits, Oryctolagus cuniculus.
Ren, S Y; Geng, Y; Wang, K Y; Zhou, Z Y; Liu, X X; He, M; Peng, X; Wu, C Y; Lai, W M
2014-12-01
Streptococcus agalactiae (Group B streptococcus, GBS) has emerged as an important pathogen that affects humans and animals, including aquatic species. In August 2011, a severe infectious disease affecting rabbits, which caused 42% mortality, occurred in Mianyang, Sichuan Province, China. The main clinical signs included acute respiratory distress syndrome, fever, paddling and convulsions. A Gram-positive, chain-forming coccus was isolated from the primary organs and tissues of diseased rabbits and then identified as S. agalactiae by morphology, biochemical and physiological characteristics, 16S rDNA and gyrB gene sequences analysis. All isolates of S. agalactiae showed a similar antibiotic susceptibility, which were sensitive to florfenicol, ampicillin,gentamicin and norfloxacin, as well as being resistant to penicillin, amoxicillin and tetracycline. To our knowledge, this is the first report on S. agalactiae natural infection in domestic rabbits. © 2013 Blackwell Verlag GmbH.
Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S
2014-08-01
Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Development of genetic tools for in vivo virulence analysis of Streptococcus sanguinis.
Turner, Lauren Senty; Das, Sankar; Kanamoto, Taisei; Munro, Cindy L; Kitten, Todd
2009-08-01
Completion of the genome sequence of Streptococcus sanguinis SK36 necessitates tools for further characterization of this species. It is often desirable to insert antibiotic resistance markers and other exogenous genes into the chromosome; therefore, we sought to identify a chromosomal site for ectopic expression of foreign genes, and to verify that insertion into this site did not affect important cellular phenotypes. We designed three plasmid constructs for insertion of erm, aad9 or tetM resistance determinants into a genomic region encoding only a small (65 aa) hypothetical protein. To determine whether this insertion affected important cellular properties, SK36 and its erythromycin-resistant derivative, JFP36, were compared for: (i) growth in vitro, (ii) genetic competence, (iii) biofilm formation and (iv) virulence for endocarditis in the rabbit model of infective endocarditis (IE). The spectinomycin-resistant strain, JFP56, and tetracycline-resistant strain, JFP76, were also tested for virulence in vivo. Insertion of erm did not affect growth, competence or biofilm development of JFP36. Recovery of bacteria from heart valves of co-inoculated rabbits was similar to wild-type for JFP36, JFP56 and JFP76, indicating that IE virulence was not significantly affected. The capacity for mutant complementation in vivo was explored in an avirulent ssaB mutant background. Expression of ssaB from its predicted promoter in the target region restored IE virulence. Thus, the chromosomal site utilized is a good candidate for further manipulations of S. sanguinis. In addition, the resistant strains developed may be further applied as controls to facilitate screening for virulence factors in vivo.
Hernandez-Garcia, Juan; Wang, Jinhong; Restif, Olivier; Holmes, Mark A; Mather, Alison E; Weinert, Lucy A; Wileman, Thomas M; Thomson, Jill R; Langford, Paul R; Wren, Brendan W; Rycroft, Andrew; Maskell, Duncan J; Tucker, Alexander W
2017-08-01
Antimicrobial resistance in Streptococcus suis, a global zoonotic pathogen of pigs, has been mostly studied only in diseased animals using surveys that have not evaluated changes over time. We compared patterns of resistance between S. suis isolates from clinical cases of disease (CC) and non-clinical case (NCC) pigs in England, collected over two discrete periods, 2009-2011 and 2013-2014. Minimum inhibitory concentrations (MIC) of 17 antimicrobials (nine classes) were determined on 405 S. suis isolates categorised by sampling period and disease association to assess changes in resistance over time and association with disease. First, isolates were characterized as resistant or susceptible using published clinical breakpoints. Second, epidemiological cut-offs (ECOFF) were derived from MIC values, and isolates classified as wild type (WT) below the ECOFF and non-wild type (NWT) above the ECOFF. Finally, isolate subsets were analysed for shifts in MIC distribution. NCC isolates were more resistant than CC isolates to cephalosporins, penams, pleuromutilins, potentiated sulphonamides and tetracyclines in both study periods. Resistance levels among CC isolates increased in 2013-2014 relative to 2009-2011 for antimicrobials including aminoglycosides, cephalosporins, fluoroquinolones, pleuromutilins, potentiated sulphonamides and tetracyclines. The prevalence of isolates categorised as NWT for five or more classes of antimicrobials was greater among NCC than CC isolates for both time periods, and increased with time. This study used standardised methods to identify significant shifts in antimicrobial resistance phenotypes of S. suis isolated from pigs in England, not only over time but also between isolates from known clinical cases or disease-free pigs. Copyright © 2017. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Brook, I.; Tom, S.P.; Ledney, G.D.
1993-01-01
The use of ofloxacin and glycopeptides was evaluated for the treatment of infections arising in C3H/HeN female mice irradiated with 8.3 Gy from a 60 Co source. The 21 day regimen began 72 h after irradiation when each of five sets of experimental animals received three antimicrobial therapy regimens and a saline-treated control group. With 40 mice in each group, 20 were used to monitor survival, 20 for the recovery of bacteria from the liver culture. Treatment groups were oral ofloxacin; oral or intramuscular vancomycin oral teicoplanin, ofloxacin and vancomycin; ofloxacin and teicoplanin; or saline. Bacteria recovered from saline treated mice were Enterobacteriaceae and Streptococcus spp. By comparison, fewer Enterobacteriaceae were isolated from ofloxacin treated mice and fewer Streptococcus spp. in both vancomycin and teicoplanin treated mice. However, glycopeptide-treated mice developed infection with Aspergillis fumigatus and glycopeptide resistant Streptococcus bovis. Mortality rates within 60 days of irradiation were 100% in all treatment and control groups with the exception of ofloxacin which was 25%-35%. These data suggest that glycopeptide therapy increases rates of systemic infection with fungi and antibiotic resistant bacteria in irradiated mice. (Author)
Energy Technology Data Exchange (ETDEWEB)
Brook, I.; Tom, S.P.; Ledney, G.D. (Armed Forces Radiobiology Research Inst., Bethesda, MD (United States))
1993-11-01
The use of ofloxacin and glycopeptides was evaluated for the treatment of infections arising in C3H/HeN female mice irradiated with 8.3 Gy from a [sup 60]Co source. The 21 day regimen began 72 h after irradiation when each of five sets of experimental animals received three antimicrobial therapy regimens and a saline-treated control group. With 40 mice in each group, 20 were used to monitor survival, 20 for the recovery of bacteria from the liver culture. Treatment groups were oral ofloxacin; oral or intramuscular vancomycin oral teicoplanin, ofloxacin and vancomycin; ofloxacin and teicoplanin; or saline. Bacteria recovered from saline treated mice were Enterobacteriaceae and Streptococcus spp. By comparison, fewer Enterobacteriaceae were isolated from ofloxacin treated mice and fewer Streptococcus spp. in both vancomycin and teicoplanin treated mice. However, glycopeptide-treated mice developed infection with Aspergillis fumigatus and glycopeptide resistant Streptococcus bovis. Mortality rates within 60 days of irradiation were 100% in all treatment and control groups with the exception of ofloxacin which was 25%-35%. These data suggest that glycopeptide therapy increases rates of systemic infection with fungi and antibiotic resistant bacteria in irradiated mice. (Author).
Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter
2014-07-01
Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T) = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T) = CCMM B833(T)) are proposed. © 2014 IUMS.
Group B streptococcus - pregnancy
... medlineplus.gov/ency/patientinstructions/000511.htm Group B streptococcus - pregnancy To use the sharing features on this page, please enable JavaScript. Group B streptococcus (GBS) is a type of bacteria that some ...
Banks, David J; Porcella, Stephen F; Barbian, Kent D; Beres, Stephen B; Philips, Lauren E; Voyich, Jovanka M; DeLeo, Frank R; Martin, Judith M; Somerville, Greg A; Musser, James M
2004-08-15
We describe the genome sequence of a macrolide-resistant strain (MGAS10394) of serotype M6 group A Streptococcus (GAS). The genome is 1,900,156 bp in length, and 8 prophage-like elements or remnants compose 12.4% of the chromosome. A 8.3-kb prophage remnant encodes the SpeA4 variant of streptococcal pyrogenic exotoxin A. The genome of strain MGAS10394 contains a chimeric genetic element composed of prophage genes and a transposon encoding the mefA gene conferring macrolide resistance. This chimeric element also has a gene encoding a novel surface-exposed protein (designated "R6 protein"), with an LPKTG cell-anchor motif located at the carboxyterminus. Surface expression of this protein was confirmed by flow cytometry. Humans with GAS pharyngitis caused by serotype M6 strains had antibody against the R6 protein present in convalescent, but not acute, serum samples. Our studies add to the theme that GAS prophage-encoded extracellular proteins contribute to host-pathogen interactions in a strain-specific fashion.
Antimicrobial effects of herbal extracts on Streptococcus mutans and normal oral streptococci.
Lee, Sung-Hoon
2013-08-01
Streptococcus mutans is associated with dental caries. A cariogenic biofilm, in particular, has been studied extensively for its role in the formation of dental caries. Herbal extracts such as Cudrania tricuspidata, Sophora flavescens, Ginkgo biloba, and Betula Schmidtii have been used as a folk remedy for treating diseases. The purpose of this study was to evaluate and compare the antibacterial activity of herbal extracts against normal oral streptococci, planktonic and biofilm of S. mutans. Streptococcus gordonii, Streptococcus oralis, Streptococcus salivarius, Streptococcus sanguinis, and S. mutans were cultivated with brain heart infusion broth and susceptibility assay for the herbal extracts was performed according to the protocol of Clinical and Laboratory Standard Institute. Also, S. mutans biofilm was formed on a polystyrene 12-well plate and 8-well chamber glass slip using BHI broth containing 2% sucrose and 1% mannose after conditioning the plate and the glass slip with unstimulated saliva. The biofilm was treated with the herbal extracts in various concentrations and inoculated on Mitis-Salivarius bacitracin agar plate for enumeration of viable S. mutans by counting colony forming units. Planktonic S. mutans showed susceptibility to all of the extracts and S. mutans biofilm exhibited the highest level of sensitivity for the extracts of S. flavescens. The normal oral streptococci exhibited a weak susceptibility in comparison to S. mutans. S. oralis, however, was resistant to all of the extracts. In conclusion, the extract of S. flavescens may be a potential candidate for prevention and management of dental caries.
Merrild, Camilla Hoffmann; Andersen, Rikke Sand; Risør, Mette Bech; Vedsted, Peter
2017-06-01
Social differences in health and illness are well documented in Denmark. However, little is known about how health practices are manifested in the everyday lives of different social classes. We propose acts of resistance and formation of health subjectivities as helpful concepts to develop our understanding of how dominant health discourses are appropriated by different social classes and transformed into different practices promoting health and preventing illness. Based on fieldwork in two different social classes, we discuss how these practices both overtly and subtly challenge the normative power of the health promotion discourse. These diverse and ambiguous forms of everyday resistance illustrate how and when situated concerns move social actors to subjectively appropriate health promotion messages. Overall, the different forms of resistance elucidate how the standardized awareness and education campaigns may perpetuate the very inequalities they try to diminish. © 2016 by the American Anthropological Association.
DEFF Research Database (Denmark)
Boerlin, P.; Wissing, A.; Aarestrup, Frank Møller
2001-01-01
Ninety-six enterococcus isolates from fecal samples of pigs receiving tylosin as an antimicrobial growth promoter and 59 isolates obtained in the same farms 5 to 6 months after the ban of antimicrobial growth promoters in Switzerland were tested for susceptibility to nine antimicrobial agents....... A clear decrease in resistance to macrolides, lincosamides, and tetracycline was visible after the ban. Vancomycin-resistant Enterococcus faecium belonged to the same clonal lineage as vancomycin-resistant isolates previously isolated from Danish pigs....
Vaccination against group B streptococcus.
Heath, Paul T; Feldman, Robert G
2005-04-01
Streptococcus agalactiae (Group B streptococcus) is an important cause of disease in infants, pregnant women, the elderly and in immunosuppressed adults. An effective vaccine is likely to prevent the majority of infant disease (both early and late onset), as well as Group B streptococcus-related stillbirths and prematurity, to avoid the current real and theoretical limitations of intrapartum antibiotic prophylaxis, and to be cost effective. The optimal time to administer such a vaccine would be in the third trimester of pregnancy. The main limitations on the production of a Group B streptococcus vaccine are not technical or scientific, but regulatory and legal. A number of candidates including capsular conjugate vaccines using traditional carrier proteins such as tetanus toxoid and mutant diphtheria toxin CRM197, as well as Group B streptococcus-specific proteins such as C5a peptidase, protein vaccines using one or more Group B streptococcus surface proteins and mucosal vaccines, have the potential to be successful vaccines. The capsular conjugate vaccines using tetanus and CRM197 carrier proteins are the most advanced candidates, having already completed Phase II human studies including use in the target population of pregnant women (tetanus toxoid conjugate), however, no definitive protein conjugates have yet been trialed. However, unless the regulatory environment is changed specifically to allow the development of a Group B streptococcus vaccine, it is unlikely that one will ever reach the market.
Directory of Open Access Journals (Sweden)
Tristan Lefébure
Full Text Available Streptococcus pyogenes, is an important human pathogen classified within the pyogenic group of streptococci, exclusively adapted to the human host. Our goal was to employ a comparative evolutionary approach to better understand the genomic events concomitant with S. pyogenes human adaptation. As part of ascertaining these events, we sequenced the genome of one of the potential sister species, the agricultural pathogen S. canis, and combined it in a comparative genomics reconciliation analysis with two other closely related species, Streptococcus dysgalactiae and Streptococcus equi, to determine the genes that were gained and lost during S. pyogenes evolution. Genome wide phylogenetic analyses involving 15 Streptococcus species provided convincing support for a clade of S. equi, S. pyogenes, S. dysgalactiae, and S. canis and suggested that the most likely S. pyogenes sister species was S. dysgalactiae. The reconciliation analysis identified 113 genes that were gained on the lineage leading to S. pyogenes. Almost half (46% of these gained genes were phage associated and 14 showed significant matches to experimentally verified bacteria virulence factors. Subsequent to the origin of S. pyogenes, over half of the phage associated genes were involved in 90 different LGT events, mostly involving different strains of S. pyogenes, but with a high proportion involving the horse specific pathogen S. equi subsp. equi, with the directionality almost exclusively (86% in the S. pyogenes to S. equi direction. Streptococcus agalactiae appears to have played an important role in the evolution of S. pyogenes with a high proportion of LGTs originating from this species. Overall the analysis suggests that S. pyogenes adaptation to the human host was achieved in part by (i the integration of new virulence factors (e.g. speB, and the sal locus and (ii the construction of new regulation networks (e.g. rgg, and to some extent speB.
Disease Manifestations and Pathogenic Mechanisms of Group A Streptococcus
Barnett, Timothy C.; McArthur, Jason D.; Cole, Jason N.; Gillen, Christine M.; Henningham, Anna; Sriprakash, K. S.; Sanderson-Smith, Martina L.; Nizet, Victor
2014-01-01
SUMMARY Streptococcus pyogenes, also known as group A Streptococcus (GAS), causes mild human infections such as pharyngitis and impetigo and serious infections such as necrotizing fasciitis and streptococcal toxic shock syndrome. Furthermore, repeated GAS infections may trigger autoimmune diseases, including acute poststreptococcal glomerulonephritis, acute rheumatic fever, and rheumatic heart disease. Combined, these diseases account for over half a million deaths per year globally. Genomic and molecular analyses have now characterized a large number of GAS virulence determinants, many of which exhibit overlap and redundancy in the processes of adhesion and colonization, innate immune resistance, and the capacity to facilitate tissue barrier degradation and spread within the human host. This improved understanding of the contribution of individual virulence determinants to the disease process has led to the formulation of models of GAS disease progression, which may lead to better treatment and intervention strategies. While GAS remains sensitive to all penicillins and cephalosporins, rising resistance to other antibiotics used in disease treatment is an increasing worldwide concern. Several GAS vaccine formulations that elicit protective immunity in animal models have shown promise in nonhuman primate and early-stage human trials. The development of a safe and efficacious commercial human vaccine for the prophylaxis of GAS disease remains a high priority. PMID:24696436
TET1 promotes cisplatin-resistance via demethylating the vimentin promoter in ovarian cancer.
Han, Xi; Zhou, Yuanyuan; You, Yuanyi; Lu, Jiaojiao; Wang, Lijie; Hou, Huilian; Li, Jing; Chen, Wei; Zhao, Le; Li, Xu
2017-04-01
The development of chemo-resistance impairs the outcome of the first line platinum-based chemotherapies for ovarian cancer. Deregulation of DNA methylation/demethylation provides a critical mechanism for the occurrence of chemo-resistance. The ten-eleven translocation (TET) family of dioxygenases including TET1/2/3 plays an important part in DNA demethylation, but their roles in cisplatin resistance have not been elucidated. Using cisplatin-sensitive and cisplatin-resistant ovarian cancer cell models, we found that TET1 was significantly upregulated in cisplatin-resistant CP70 cells compared with that in cisplatin-sensitive A2780 cells. Ectopic expression of TET1 in A2780 cells promoted cisplatin resistance and decreased cytotoxicity induced by cisplatin, while inhibition of TET1 by siRNA transfection in CP70 cells attenuated cisplatin resistance and enhanced cytotoxicity of cisplatin. Increased TET1 induced re-expression of vimentin through active DNA demethylation, and cause partial epithelial-to-mesenchymal (EMT) in A2780 cells. Contrarily, knocking down of TET1 in CP70 cells reduced vimentin expression and reversed EMT process. Immunohistochemical analysis of TET1 in human ovarian cancer tissues revealed that TET1 existed in nucleus and cytoplasm in ovarian cancer tissues. And the expression of nuclear TET1 was positively correlated with residual tumor and chemotherapeutic response. Thus, TET1 expression causes resistance to cisplatin and one of the targets of TET1 action is vimentin in ovarian cancer. © 2017 International Federation for Cell Biology.
DEFF Research Database (Denmark)
Molzen, T E; Burghout, P; Bootsma, H J
2010-01-01
Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...
Controlled Human Infection for Vaccination Against Streptococcus Pyogenes
2018-04-26
Streptococcus Pyogenes Pharyngitis; Streptococcus Pharyngitis; Strep Throat; Streptococcus Pyogenes Infection; Group A Streptococcus: B Hemolytic Pharyngitis; Group A Streptococcal Infection; Gram-Positive Bacterial Infections; Bacterial Infections
Mingoia, Marina; Morici, Eleonora; Marini, Emanuela; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E
2016-03-01
The objective of this study was to investigate macrolide-resistant Streptococcus agalactiae isolates harbouring erm(TR), an erm(A) gene subclass, with emphasis on their erm(TR)-carrying genetic elements. Four erm(TR)-carrying elements have been described to date: three closely related (ICE10750-RD.2, Tn1806 and ICESp1108) in Streptococcus pyogenes, Streptococcus pneumoniae and S. pyogenes, respectively; and one completely different (IMESp2907, embedded in ICESp2906 to form ICESp2905) in S. pyogenes. Seventeen macrolide-resistant erm(TR)-positive S. agalactiae isolates were phenotypically and genotypically characterized. Their erm(TR)-carrying elements were explored by analysing the distinctive recombination genes of known erm(TR)-carrying integrative and conjugative elements (ICEs) and by PCR mapping. The new genetic context and organization of IMESp2907 in S. agalactiae were explored using several experimental procedures and in silico analyses. Five isolates harboured ICE10750-RD.2/Tn1806, five isolates harboured ICESp1108 and five isolates bore unknown erm(TR)-carrying elements. The remaining two isolates, exhibiting identical serotypes and pulsotypes, harboured IMESp2907 in a new genetic environment, which was further investigated in one of the two isolates, SagTR7. IMESp2907 was circularizable in S. agalactiae, as described in S. pyogenes. The new IMESp2907 junctions were identified based on its site-specific integration; the att sites were almost identical to those in S. pyogenes. In strain SagTR7, erm(TR)-carrying IMESp2907 was embedded in an erm(TR)-less internal element related to ICE10750-RD.2/Tn1806, which, in turn, was embedded in an ICESde3396-like element. The resulting whole ICE, ICESagTR7 (∼129 kb), was integrated into the chromosome downstream of the rplL gene, and was excisable in circular form and transferable by conjugation. This is the first study exploring erm(TR)-carrying genetic elements in S. agalactiae. © The Author 2015. Published by
Multi-drug resistance and molecular pattern of erythromycin and ...
African Journals Online (AJOL)
The appearance and dissemination of penicillin resistant and macrolide resistant Streptococcus pneumoniae strains has caused increasing concern worldwide. The aim of this study was to survey drug resistance and genetic characteristics of macrolide and penicillin resistance in S. pneumoniae. This is a cross-sectional ...
Norimatsu, Yuka; Kawashima, Junko; Takano-Yamamoto, Teruko; Takahashi, Nobuhiro
2015-09-01
Both Streptococcus and Actinomyces can produce acids from dietary sugars and are frequently found in caries lesions. In the oral cavity, nitrogenous compounds, such as peptides and amino acids, are provided continuously by saliva and crevicular gingival fluid. Given that these bacteria can also utilize nitrogen compounds for their growth, it was hypothesized that nitrogenous compounds may influence their acid production; however, no previous studies have examined this topic. Therefore, the present study aimed to assess the effects of nitrogenous compounds (tryptone and glutamate) on glucose-derived acid production by Streptococcus and Actinomyces. Acid production was evaluated using a pH-stat method under anaerobic conditions, whereas the amounts of metabolic end-products were quantified using high performance liquid chromatography. Tryptone enhanced glucose-derived acid production by up to 2.68-fold, whereas glutamate enhanced Streptococcus species only. However, neither tryptone nor glutamate altered the end-product profiles, indicating that the nitrogenous compounds stimulate the whole metabolic pathways involving in acid production from glucose, but are not actively metabolized, nor do they alter metabolic pathways. These results suggest that nitrogenous compounds in the oral cavity promote acid production by Streptococcus and Actinomyces in vivo. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.
A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.
Directory of Open Access Journals (Sweden)
Raphaël Laurenceau
Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.
Lee, Kichan; Kim, Ji-Yeon; Jung, Suk Chan; Lee, Hee-Soo; Her, Moon; Chae, Chanhee
2016-01-01
Streptococcus species are emerging potential pathogens in marine mammals. We report the isolation and identification of Streptococcus halichoeri and Streptococcus phocae in a Steller sea lion (Eumetopias jubatus) in South Korea.
van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els
2016-05-01
We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
A. Corso
2009-03-01
Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.
Interaction of Streptococcus agalactiae and cellular innate immunity in colonization and disease
Directory of Open Access Journals (Sweden)
Sybille eLandwehr-Kenzel
2014-10-01
Full Text Available Streptococcus agalactiae (Group B streptococcus, GBS is highly adapted to humans, where it is a normal constituent of the intestinal and vaginal flora. Yet, GBS has highly invasive potential and causes excessive inflammation, sepsis and death at the beginning of life, in the elderly and in diabetic patients. Thus GBS is a model pathobiont that thrives in the healthy host, but has not lost its potential virulence during coevolution with mankind. It remains incompletely understood how the innate immune system contains GBS in the natural niches, the intestinal and genital tracts, and which molecular events underlie breakdown of mucocutaneous resistance. Newborn infants between days seven and 90 of life are at risk of a particularly striking sepsis manifestation (late onset disease, LOD, where the transition from colonization to invasion and dissemination, and thus from health to severe sepsis is typically fulminant and not predictable. The great majority of late-onset sepsis cases is caused by one clone, GBS ST-17, which expresses HvgA as a signature virulence factor and adhesin. In mice, HvgA promotes the crossing of both the mucosal and the blood brain barrier. Expression levels of HvgA and other GBS virulence factors, such as pili and toxins, are regulated by the upstream two-component control system CovR/S. This in turn is modulated by acidic epithelial pH, high glucose levels and during the passage through the mouse intestine. After invasion, GBS has the ability to subvert innate immunity by mechanisms like GAPDH-dependent induction of IL-10 and β-protein binding to the inhibitory phagocyte receptors sialic acid binding immunoglobulin-like lectin 5 and 14. On the host side, sensing of GBS nucleic acids and lipopeptides by both Toll-like receptors (TLRs and the inflammasome appears to be critical for host resistance against GBS. Yet, comprehensive models on the interplay between GBS and human immune cells at the colonizing site are just
Virulence Factors of Streptococcus mutans.
1986-08-01
763512/715242 Final Report U VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS U Samuel Rosen Department of Oral Biology For the Period April 1, 1983 - June 30...00 FINAL REPORT VIRULENCE FACTORS OF STREPTOCOCCUS MUTANS Sam Rosen, Irving Shklair, E. X. Beck and F. M. Beck Ohio State University Columbus,Oh and...206-212. Johnson CP, Gorss S, Hillman JD (1978). Cariogenic properties of LDH deficient mutants of streptococcus mutans . J Dent Res 57, Special Issue
Subacute bacterial endocarditis (SBE due to Streptococcus gordonii
Directory of Open Access Journals (Sweden)
Raffaella Battista
2009-12-01
Full Text Available Endocarditis is an inflammatory state of the endothelium that promotes thrombus formation and tissue damage on the surface of heart valves. Recent studies have reported endocarditis mortality rates ranging from 12% to 46% (2008. The Streptococcus gordonii is a normal inhabitant of the human oral cavity. It is a component of the microbial communities responsible of plaque formation, associated with dental caries and also regarded as the main causative agent in the development of subacute bacterial endocarditis (SBE.
Bacterial infections in Lilongwe, Malawi: aetiology and antibiotic resistance
Directory of Open Access Journals (Sweden)
Makoka Mwai H
2012-03-01
Full Text Available Abstract Background Life-threatening infections present major challenges for health systems in Malawi and the developing world because routine microbiologic culture and sensitivity testing are not performed due to lack of capacity. Use of empirical antimicrobial therapy without regular microbiologic surveillance is unable to provide adequate treatment in the face of emerging antimicrobial resistance. This study was conducted to determine antimicrobial susceptibility patterns in order to inform treatment choices and generate hospital-wide baseline data. Methods Culture and susceptibility testing was performed on various specimens from patients presenting with possible infectious diseases at Kamuzu Central Hospital, Lilongwe, Malawi. Results Between July 2006 and December 2007 3104 specimens from 2458 patients were evaluated, with 60.1% from the adult medical service. Common presentations were sepsis, meningitis, pneumonia and abscess. An etiologic agent was detected in 13% of patients. The most common organisms detected from blood cultures were Staphylococcus aureus, Escherichia coli, Salmonella species and Streptococcus pneumoniae, whereas Streptococcus pneumoniae and Cryptococcus neoformans were most frequently detected from cerebrospinal fluid. Haemophilus influenzae was rarely isolated. Resistance to commonly used antibiotics was observed in up to 80% of the isolates while antibiotics that were not commonly in use maintained susceptibility. Conclusions There is widespread resistance to almost all of the antibiotics that are empirically used in Malawi. Antibiotics that have not been widely introduced in Malawi show better laboratory performance. Choices for empirical therapy in Malawi should be revised accordingly. A microbiologic surveillance system should be established and prudent use of antimicrobials promoted to improve patient care.
Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.
1999-01-01
One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179
Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence
W.T. Hendriksen (Wouter)
2010-01-01
textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus
Relation of Growth of Streptococcus lactis and Streptococcus cremoris to Amino Acid Transport
Poolman, Bert; Konings, Wil N.
The maximum specific growth rate of Streptococcus lactis and Streptococcus cremoris on synthetic medium containing glutamate but no glutamine decreases rapidly above pH 7. Growth of these organisms is extended to pH values in excess of 8 in the presence of glutamine. These results can be explained
Fluoride resistance in Streptococcus mutans
Liao, Ying
2017-01-01
Fluoride has been used as the most effective anti-caries agent for over five decades. It functions not only on the dental hard tissues, but also as an antimicrobial agent. It is known that oral bacteria are able to develop resistance to fluoride, which may affect the effectiveness of fluoride in
Directory of Open Access Journals (Sweden)
Kanzul Kamal Putra
2017-03-01
Full Text Available The purpose of this research was to find the resistibility of Manalagi apple peel extract, using etanol, to the growth of was to determine the antibacterial activity of Manalagi apple peel (Malus sylvestris Mill extract in various solvent using ethanol concentration against the growth of Streptococcus agalactiae and Escherichia coli bacteria that causing mastitis.The research methodwas experimental using Completely Randomized Design with 4 treatments and 6 replication. The treatments consisted of P1 (10%, P2 (20%, P3 (50% concentrations and P0 (10% iodips as the control. The variable measured was diameter of inhibition zone. The data were analyzed using ANOVA and continued by Duncan’s New Multiple Range Test (DMRT test if there was significantly difference result. The result of the inhibition zone of Manalagi apple peel extract using etanol in preventing the growth of Streptococcus agalactiae and Escherichia coli bacteria was different (P<0,01. In P2 (30% concentration, the extract resistibility to the growth of Streptococcus agalactiae bacteria was equivalent to P0 (iodips and in P3 (50% concentration, the extract resistibility to Escherichia coli bacteria was greater than P0 (iodips. Manalagi apple peel extract using etanol can be used as a natural antiseptic solution for teat dipping on dairy cows. The recommendation from the research was using extract Manalagi apple peel with etanol solvent concentration of 30% as a solution of teat dipping. Keywords : Manalagi apple peel, Teat dipping, Mastitis, Streptococcus agalactiaeand Escherichia coli
Liu, Esther Yip-Mei; Chang, Jen-Chang; Lin, Jung-Chung; Chang, Feng-Yee; Fung, Chang-Phone
2016-12-01
Penicillin-resistant Streptococcus pneumoniae is a serious concern worldwide. In this study, we analyzed the cause of β-lactam resistance in pandemic multidrug-resistant clones. A total of 41 penicillin-nonsusceptible clinical isolates were collected from 1996 to 2012. Sero- and molecular typing confirmed that these isolates were clonal types of Taiwan 19F -14, Taiwan 23F -15, and Spain 23F -1. Sero-switching was found in four isolates. All isolates were multidrug resistant. Sequencing analysis of the penicillin binding proteins (PBPs) was performed on PBP1a, 2b, and 2x, and a large number of mutations were identified in comparing to clinical penicillin-susceptible isolates and the recipient strain R6 used for homologous recombination. The T 451 A substitution was the key amino acid in PBP2b that contributed to penicillin resistance. T 338 A in PBP2x played a role in resistance and reached the highest level of resistance when combined with other mutations in PBP2x. High-level penicillin resistance could not be obtained without the combination of mutations in PBP1a with PBP2b and 2x. The amino acid substitutions in PBP1a, 2b, and 2x were the crucial factors for β-lactam resistance.
DEFF Research Database (Denmark)
Kilian, Mogens
2001-01-01
With reference to the first Principle of the International Code of Nomenclature of Bacteria, which emphasizes stability of names, it is proposed that the original names Streptococcus sanguis, Streptococcus rattus, Streptococcus cricetus, Erwinia ananas, Eubacterium tarantellus, Lactobacillus sake......, Nitrosococcus oceanus, Pseudomonas betle, Rickettsia canada and Streptomyces rangoon, all included in the Approved Lists of Bacterial Names, be conserved. Request for an Opinion...
Azizi, Arash; Aghayan, Shabnam; Zaker, Saeed; Shakeri, Mahdieh; Entezari, Navid; Lawaf, Shirin
2015-01-01
Background and Objectives. Tooth decay is an infectious disease of microbial origin. Considering the increasing prevalence of antibiotic resistance due to their overuse and also their side effects, medicinal plants are now considered for use against bacterial infections. This study aimed to assess the effects of different concentrations of Zingiber officinale extract on proliferation of Streptococcus mutans and Streptococcus sanguinis in vitro. Materials and Methods. In this experimental study, serial dilutions of the extract were prepared in two sets of 10 test tubes for each bacterium (total of 20). Standard amounts of bacterial suspension were added; 100ƛ of each tube was cultured on prepared solid agar plates and incubated at 37°C for 24 hours. Serial dilutions of the extract were prepared in another 20 tubes and 100ƛ of each tube was added to blood agar culture medium while being prepared. The mixture was transferred to the plates. The bacteria were inoculated on plates and incubated as described. Results. The minimum inhibitory concentration (MIC) was 0.02 mg/mL for S. mutans and 0.3 mg/mL for S. sanguinis. The minimum bactericidal concentration (MBC) was 0.04 mg for S. mutans and 0.6 mg for S. sanguinis. Conclusion. Zingiber officinale extract has significant antibacterial activity against S. mutans and S. sanguinis cariogenic microorganisms.
Directory of Open Access Journals (Sweden)
Arash Azizi
2015-01-01
Full Text Available Background and Objectives. Tooth decay is an infectious disease of microbial origin. Considering the increasing prevalence of antibiotic resistance due to their overuse and also their side effects, medicinal plants are now considered for use against bacterial infections. This study aimed to assess the effects of different concentrations of Zingiber officinale extract on proliferation of Streptococcus mutans and Streptococcus sanguinis in vitro. Materials and Methods. In this experimental study, serial dilutions of the extract were prepared in two sets of 10 test tubes for each bacterium (total of 20. Standard amounts of bacterial suspension were added; 100ƛ of each tube was cultured on prepared solid agar plates and incubated at 37°C for 24 hours. Serial dilutions of the extract were prepared in another 20 tubes and 100ƛ of each tube was added to blood agar culture medium while being prepared. The mixture was transferred to the plates. The bacteria were inoculated on plates and incubated as described. Results. The minimum inhibitory concentration (MIC was 0.02 mg/mL for S. mutans and 0.3 mg/mL for S. sanguinis. The minimum bactericidal concentration (MBC was 0.04 mg for S. mutans and 0.6 mg for S. sanguinis. Conclusion. Zingiber officinale extract has significant antibacterial activity against S. mutans and S. sanguinis cariogenic microorganisms.
Saito, Masanori; Shinozaki-Kuwahara, Noriko; Hirasawa, Masatomo; Takada, Kazuko
2014-09-01
Four Gram-stain-positive, catalase-negative, coccoid-shaped organisms were isolated from elephant oral cavities. The isolates were tentatively identified as streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequencing studies confirmed the organisms to be members of the genus Streptococcus. Two isolates (NUM 6304(T) and NUM 6312) were related most closely to Streptococcus salivarius with 96.8 % and 93.1 % similarity based on the 16S rRNA gene and the RNA polymerase β subunit encoding gene (rpoB), respectively, and to Streptococcus vestibularis with 83.7 % similarity based on the 60 kDa heat-shock protein gene (groEL). The other two isolates (NUM 6306(T) and NUM 6318) were related most closely to S. vestibularis with 97.0 % and 82.9 % similarity based on the 16S rRNA and groEL genes, respectively, and to S. salivarius with 93.5 % similarity based on the rpoB gene. Based on phylogenetic and phenotypic evidence, these isolates are suggested to represent novel species of the genus Streptococcus, for which the names Streptococcus loxodontisalivarius sp. nov. (type strain NUM 6304(T) = JCM 19287(T) = DSM 27382(T)) and Streptococcus saliviloxodontae sp. nov. (type strain NUM 6306(T) = JCM 19288(T) = DSM 27513(T)) are proposed. © 2014 IUMS.
Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W
2003-10-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.
Directory of Open Access Journals (Sweden)
Natasha L. Maia
2018-06-01
Full Text Available Mastitis is an inflammation of the mammary gland that causes major losses in the dairy industry. Streptococcus spp. are among the main agents of this disease. Increased resistance to antibiotics is one of the causes of therapeutic failure. Plants, due to their broad chemodiversity, are an interesting source of new molecules with antibacterial activity. Using these compounds along with traditional antibiotics is a possible method for reversing resistance. The objective of this work was to determine the interactions between the activities of guttiferone-A and 7-epiclusianone, two active substances isolated from the fruits of Garcinia brasiliensis, and traditional antibiotics against Streptococcus spp. isolated from bovine mastitis and known to be resistant to them. First, the MIC for the antibiotics and bioactive compounds was determined, followed by their activities, alone and in combination. Then, their cytotoxicity was measured in bovine mammary epithelial cells. Finally, molecular docking simulations were performed to elucidate molecular details of the interactions between β-lactamase and the compounds binding to it (clavulanic acid, ampicillin, 7-epiclusianone, and guttiferone-A. The bacterial isolates were resistant to ampicillin and gentamicin. Both antibiotics showed predominantly synergistic antibacterial activities in combination with guttiferone-A or 7-epiclusianone. These two active substances were not cytotoxic at synergistic concentrations and both showed strong binding to β-lactamase, which may explain the reversal of ampicillin resistance. These substances are promising for the treatment of bovine mastitis.
Directory of Open Access Journals (Sweden)
Chunping Zhang
2015-01-01
Full Text Available Streptococcus suis serotype 2 is an important zoonotic pathogen. Antimicrobial resistance phenotypes and genotypic characterizations of S. suis 2 from carrier sows and diseased pigs remain largely unknown. In this study, 96 swine S. suis type 2, 62 from healthy sows and 34 from diseased pigs, were analyzed. High frequency of tetracycline resistance was observed, followed by sulfonamides. The lowest resistance of S. suis 2 for β-lactams supports their use as the primary antibiotics to treat the infection of serotype 2. In contrast, 35 of 37 S. suis 2 with MLSB phenotypes were isolated from healthy sows, mostly encoded by the ermB and/or the mefA genes. Significantly lower frequency of mrp+/epf+/sly+ was observed among serotype 2 from healthy sows compared to those from diseased pigs. Furthermore, isolates from diseased pigs showed more homogeneously genetic patterns, with most of them clustered in pulsotypes A and E. The data indicate the genetic complexity of S. suis 2 between herds and a close linkage among isolates from healthy sows and diseased pigs. Moreover, many factors, such as extensive use of tetracycline or diffusion of Tn916 with tetM, might have favored for the pathogenicity and widespread dissemination of S. suis serotype 2.
Consideraciones sobre elaislamiento en exudados vaginales de Streptococcus morbillorum
Directory of Open Access Journals (Sweden)
J.M. F. Egido
1995-06-01
Full Text Available De el estúdio de 195 exudados vaginales enviados por el Servicio de Ginecologia de este hospital, durante el período 1988-1990, hemos seleccionado aquellos en los que el cultivo fue positivo para estreptococos, 58 (30% de los cuales 26 (44.8% correspondia a Streptococcus morbillorum, 9 (15.5% a Gardnerella vaginalis, 5 (8.6% a Enterococcus faecalis-durans, y a Streptococcus agalactiae, 3 (5.1% a Streptococcus mitis y Streptococcus mitis, 2 (3-4% a Streptococcus bovis y Streptococcus cremoris y 1 (1.7% a Streptococcus salivarius, Streptococcus equinus y Strptococcus sanguis II respectivamente. En todos los casos se observo antecedentes de actuacción medico- quirurjica en el tracto genital, y en el 52.8% de los casos fuô concomitante con el diagnostico clinico-micologico de candidiasis vaginal. La ideittificaccion bacteriologica se realizo mediante el sistema API 20 STREP (sistema api bioMêríeux GmbH, Nütingen, Alemania dando un patron tipico ("excelente identificacción" para el Streptococcus morbillorum.We have tested 195 vaginal secretions sent by Gynecology Service of this hospital between the years 1988 - 1990. We achieved positive culture for streptococci in 58 (30% of these cultures, 26 (44.8% corresponding to Streptococcus morbillorum 9 (15.5%, to Gardnerella vaginalis 5 (8.6%, to Enterococcus faecalis-durans and to Streptococcus agalactiae, 3 (5.1 % to Streptococcus mitis and milleri 2 (3-4%, to Streptococcus bovis and cremoris, and 1 (1.7% to Streptococcus salivarius, equinus and sanguis II respectively. We previously found that 52.8% of these patients were positive for vaginal candidiasis. The bacteriological identification done by the API 20 STREP System (bioMerieux GmbH, Nútingen, Germanyprovides a typical pattern ("good identification" for the Streptococcus morbillorum.
Regulation of Streptococcus gordonii sspB by the sspA Gene Product
El-Sabaeny, Azza; Demuth, Donald R.; Lamont, Richard J.
2001-01-01
Streptococcus gordonii expresses two related adhesins, SspA and SspB, the genes for which are adjacent on the chromosome and are regulated independently. Although the adhesins are functionally similar, the sspA promoter is more active than that of sspB. In this study we show an additional role for SspA in the control of sspB activity. Gel shift and DNA footprinting assays demonstrate that the SspA protein binds to the sspB promoter and protects a region 233 to 264 bp upstream of the predicted...
Energy Technology Data Exchange (ETDEWEB)
Choy, B.B.K.
1991-01-01
Mammalian ribonucleotide reductase is a highly regulated, rate-limiting activity responsible for converting ribonucleoside diphosphates to the deoxyribonucleotide precursors of DNA. The enzyme consists of two nonidentical proteins called M1 and M2, both of which are required for activity. Hydroxyurea is an antitumor agent which inhibits ribonucleotide reductase by interacting with the M2 component specifically at a unique tyrosyl free radical. Studies were conducted on a series of drug resistant mouse cell lines, selected by a step-wise procedure for increasing levels of resistance to the cytotoxic effects of hydroxyurea. Each successive drug selection step leading to the isolation of highly resistant cells was accompanied by stable elevations in cellular resistance and ribonucleotide reductase activity. The drug resistant cell lines exhibited gene amplification of the M2 gene, elevated M2 mRNA, and M2 protein. In addition to M2 gene amplification, posttranscriptional modulation also occurred during the drug selection. Studies of the biosynthesis rates with exogenously added iron suggest a role for iron in regulating the level of M2 protein when cells are cultured in the presence of hydroxyurea. The hydroxyurea-inactivated ribonucleotide reductase protein M2 has a destabilized iron centre, which readily releases iron. Altered expression of ferritin appears to be required for the development of hydroxyurea resistance in nammalian cells. The results show an interesting relationship between the expressions of ribonucleotide reductase and ferritin. The phorbol ester tumor promoter, TPA, is also able to alter the expression of M2. TPA was able to induce M2 mRNA levels transiently up to 18-fold within 1/2 hour. This rapid and large elevation of ribonucleotide reductase suggests that the enzyme may play a role in tumor promotion. Studies of the M2 promoter region were undertaken to better understand the mechanism of TPA induction of M2.
Bao, X.; de Soet, J.J.; Tong, H.; Gao, X.; He, L.; van Loveren, C.; Deng, D.M.
2015-01-01
Homeostasis of oral microbiota can be maintained through microbial interactions. Previous studies showed that Streptococcus oligofermentans, a non-mutans streptococci frequently isolated from caries-free subjects, inhibited the cariogenic Streptococcus mutans by the production of hydrogen peroxide
Antibiotic resistant profile of Streptococcus pneumoniae from the ...
African Journals Online (AJOL)
The isolates were subjected to antimicrobial susceptibility testing using the disc diffusion method. Results: S. pneumoniae was isolated from 37(42.04%) of the 88 samples. Isolates showed the highest resistance of 12 (32.43%) to erythromycin and lowest resistance of 4(10.81%) to ciprofloxacin. The resistance profiles for ...
Schweizer, Inga; Blättner, Sebastian; Maurer, Patrick; Peters, Katharina; Vollmer, Daniela; Vollmer, Waldemar; Hakenbeck, Regine; Denapaite, Dalia
2017-07-01
The Streptococcus pneumoniae clone Hungary 19A -6 expresses unusually high levels of β-lactam resistance, which is in part due to mutations in the MurM gene, encoding a transferase involved in the synthesis of branched peptidoglycan. Moreover, it contains the allele ciaH232 , encoding the histidine kinase CiaH (M. Müller, P. Marx, R. Hakenbeck, and R. Brückner, Microbiology 157:3104-3112, 2011, https://doi.org/10.1099/mic.0.053157-0). High-level penicillin resistance primarily requires the presence of low-affinity (mosaic) penicillin binding protein (PBP) genes, as, for example, in strain Hu17, a closely related member of the Hungary 19A -6 lineage. Interestingly, strain Hu15 is β-lactam sensitive due to the absence of mosaic PBPs. This unique situation prompted us to investigate the development of cefotaxime resistance in transformation experiments with genes known to play a role in this phenotype, pbp2x , pbp1a , murM , and ciaH , and penicillin-sensitive recipient strains R6 and Hu15. Characterization of phenotypes, peptidoglycan composition, and CiaR-mediated gene expression revealed several novel aspects of penicillin resistance. The murM gene of strain Hu17 ( murM Hu17 ), which is highly similar to murM of Streptococcus mitis , induced morphological changes which were partly reversed by ciaH232. murM Hu17 conferred cefotaxime resistance only in the presence of the pbp2x o f strain Hu17 ( pbp2x Hu17 ). The ciaH232 allele contributed to a remarkable increase in cefotaxime resistance in combination with pbp2x Hu17 and pbp1a of strain Hu17 ( pbp1a Hu17 ), accompanied by higher levels of expression of CiaR-regulated genes, documenting that ciaH232 responds to PBP1a Hu17 -mediated changes in cell wall synthesis. Most importantly, the proportion of branched peptides relative to the proportion of linear muropeptides increased in cells containing mosaic PBPs, suggesting an altered enzymatic activity of these proteins. Copyright © 2017 Schweizer et al.
Petersen, FC; Assev, S; van der Mei, HC; Busscher, HJ; Scheie, AA
Although Streptococcus intermedius and Streptococcus mutans are regarded as members of the commensal microflora of the body, S. intermedius is often associated with deep-seated purulent infections, whereas S. mutans is frequently associated with dental caries. In this study, we investigated the
Involvement of T6 pili in biofilm formation by serotype M6 Streptococcus pyogenes.
Kimura, Keiji Richard; Nakata, Masanobu; Sumitomo, Tomoko; Kreikemeyer, Bernd; Podbielski, Andreas; Terao, Yutaka; Kawabata, Shigetada
2012-02-01
The group A streptococcus (GAS) Streptococcus pyogenes is known to cause self-limiting purulent infections in humans. The role of GAS pili in host cell adhesion and biofilm formation is likely fundamental in early colonization. Pilus genes are found in the FCT (fibronectin-binding protein, collagen-binding protein, and trypsin-resistant antigen) genomic region, which has been classified into nine subtypes based on the diversity of gene content and nucleotide sequence. Several epidemiological studies have indicated that FCT type 1 strains, including serotype M6, produce large amounts of monospecies biofilm in vitro. We examined the direct involvement of pili in biofilm formation by serotype M6 clinical isolates. In the majority of tested strains, deletion of the tee6 gene encoding pilus shaft protein T6 compromised the ability to form biofilm on an abiotic surface. Deletion of the fctX and srtB genes, which encode pilus ancillary protein and class C pilus-associated sortase, respectively, also decreased biofilm formation by a representative strain. Unexpectedly, these mutant strains showed increased bacterial aggregation compared with that of the wild-type strain. When the entire FCT type 1 pilus region was ectopically expressed in serotype M1 strain SF370, biofilm formation was promoted and autoaggregation was inhibited. These findings indicate that assembled FCT type 1 pili contribute to biofilm formation and also function as attenuators of bacterial aggregation. Taken together, our results show the potential role of FCT type 1 pili in the pathogenesis of GAS infections.
Streptococcus salivarius meningitis after dental care: case report
Directory of Open Access Journals (Sweden)
Maira Zoppelletto
2012-12-01
Full Text Available Introduction. Streptococcus salivarius is a common commensal of the oral mucosa, associated with infections in different sites. Meningitis due to this species are described in a few occasions . In this study refer to a case recently diagnosed in our hospital for treatment of a subsequent dental caries. Case report. A man of 35 years, presents to the emergency room with fever, headache, confusion, marked nuchal rigor.Anamnesis is the treatment of dental caries on the previous day.The blood count showed 24.7x109 / L with WBC 22.9x109 / L (92.9% neutrophils. The lumbar puncture CSF noted cloudy with 15.0 x 109 / L WBC, glicorrachia 5 g / L, protidorrachia 6.5 g / L. Microscopic examination showed numerous granulocytes and prevalence of Gram-positive cocci.The pneumococcal antigen was negative.The blood cultures before starting antibiotic therapy, were negative. CSF was isolated from the culture of a Streptococcus salivarius. To antibiotic therapy started in the ED, after lumbar puncture is associated with the Ampicillin Ceftriaxone and continued for 15 days to improve the patient’s general condition, then resigned in the 17 th day. Materials and methods. From CSF inoculated in blood agar plates and chocolate agar alpha hemolytic colonies were isolated, catalysis negative, optochin resistant. The biochemical identification performed with Phoenix (BD and confirmed by PCR Pan bacterial (16S rDNA bacterial strain identified as Streptococcus salivarius.The antibiogram performed with Phoenix (BD according to the CLSI guidelines indicated sensitivity to penicillin, vancomycin, cefotaxime, cefepime, and chloramphenicol. Conclusions. Meningitis by Streptococcus salivarius was found in a few cases, mainly related to the transmission of health personnel from the oral cavity during lumbar punctures performed without the use of surgical masks. The following bacterial meningitis in dental treatment having a low incidence and often fatal course be suspected by
Consideraciones sobre elaislamiento en exudados vaginales de Streptococcus morbillorum
Directory of Open Access Journals (Sweden)
J.M. F. Egido
1995-06-01
Full Text Available De el estúdio de 195 exudados vaginales enviados por el Servicio de Ginecologia de este hospital, durante el período 1988-1990, hemos seleccionado aquellos en los que el cultivo fue positivo para estreptococos, 58 (30% de los cuales 26 (44.8% correspondia a Streptococcus morbillorum, 9 (15.5% a Gardnerella vaginalis, 5 (8.6% a Enterococcus faecalis-durans, y a Streptococcus agalactiae, 3 (5.1% a Streptococcus mitis y Streptococcus mitis, 2 (3-4% a Streptococcus bovis y Streptococcus cremoris y 1 (1.7% a Streptococcus salivarius, Streptococcus equinus y Strptococcus sanguis II respectivamente. En todos los casos se observo antecedentes de actuacción medico- quirurjica en el tracto genital, y en el 52.8% de los casos fuô concomitante con el diagnostico clinico-micologico de candidiasis vaginal. La ideittificaccion bacteriologica se realizo mediante el sistema API 20 STREP (sistema api bioMêríeux GmbH, Nütingen, Alemania dando un patron tipico ("excelente identificacción" para el Streptococcus morbillorum.
Plasmid-mediated UV-protection in Streptococcus lactis
Energy Technology Data Exchange (ETDEWEB)
Chopin, M.C.; Rouault, A. (Institut National de la Recherche Agronomique, Rennes (France). Lab. de Recherches de Technologie Laitiere); Moillo-Batt, A. (Institut National de la Sante et de la Recherche Medicale (INSERM), Hopital de Pontchaillon, 35 - Rennes (France))
1985-02-01
Streptococcus lactis strain IL594 contains 9 plasmids, designated pIL1 to pIL9. On the basis of protoplast-induced curing experiments the authors showed that derivatives containing pIL7 were resistant to UV-irradiation while derivatives lacking pIL7 were sensitive. The pIL7-determined UV-protection was confirmed by co-transfer of the plasmid and of the character into a plasmid-free derivative of S. lactis IL594. Moreover, prophage induction required higher UV-fluence in this derivative carrying pIL7 than in the plasmid-free strain. This is the first report of a plasmid-mediated UV-protection in group N streptococci.
Plasmid-mediated UV-protection in Streptococcus lactis
International Nuclear Information System (INIS)
Chopin, M.-C.; Rouault, A.
1985-01-01
Streptococcus lactis strain IL594 contains 9 plasmids, designated pIL1 to pIL9. On the basis of protoplast-induced curing experiments the authors showed that derivatives containing pIL7 were resistant to UV-irradiation while derivatives lacking pIL7 were sensitive. The pIL7-determined UV-protection was confirmed by cotransfer of the plasmid and of the character into a plasmid-free derivative of S. lactis IL594. Moreover, prophage induction required higher UV-fluence in this derivative carrying pIL7 than in the plasmid-free strain. This is the first report of a plasmid-mediated UV-protection in group N streptococci. (orig.)
Directory of Open Access Journals (Sweden)
Vladimir Pyatov
2017-01-01
Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.
Directory of Open Access Journals (Sweden)
Helena Parente Solari
2004-10-01
Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial
A Research of nasal methicillin resistant/sensitive Staphylococcus ...
African Journals Online (AJOL)
A Research of nasal methicillin resistant/sensitive Staphylococcus aureus and pharyngeal beta-haemolytic Streptococcus carriage in midwifery students in Kahramanmaras, Eastern Mediterranean Region of Turkey.
Jans, Christoph; Meile, Leo; Lacroix, Christophe; Stevens, Marc J A
2015-07-01
The Streptococcus bovis/Streptococcus equinus complex (SBSEC) is a group of human and animal derived streptococci that are commensals (rumen and gastrointestinal tract), opportunistic pathogens or food fermentation associates. The classification of SBSEC has undergone massive changes and currently comprises 7 (sub)species grouped into four branches based on sequences identities: the Streptococcus gallolyticus, the Streptococcus equinus, the Streptococcus infantarius and the Streptococcus alactolyticus branch. In animals, SBSEC are causative agents for ruminal acidosis, potentially laminitis and infective endocarditis (IE). In humans, a strong association was established between bacteraemia, IE and colorectal cancer. Especially the SBSEC-species S. gallolyticus subsp. gallolyticus is an emerging pathogen for IE and prosthetic joint infections. S. gallolyticus subsp. pasteurianus and the S. infantarius branch are further associated with biliary and urinary tract infections. Knowledge on pathogenic mechanisms is so far limited to colonization factors such as pili and biofilm formation. Certain strain variants of S. gallolyticus subsp. macedonicus and S. infantarius subsp. infantarius are associated with traditional dairy and plant-based food fermentations and display traits suggesting safety. However, due to their close relationship to virulent strains, their use in food fermentation has to be critically assessed. Additionally, implementing accurate and up-to-date taxonomy is critical to enable appropriate treatment of patients and risk assessment of species and strains via recently developed multilocus sequence typing schemes to enable comparative global epidemiology. Comparative genomics revealed that SBSEC strains harbour genomics islands (GI) that seem acquired from other streptococci by horizontal gene transfer. In case of virulent strains these GI frequently encode putative virulence factors, in strains from food fermentation the GI encode functions that are
Villaseñor-Sierra, Alberto; Katahira, Eva; Jaramillo-Valdivia, Abril N.; de los Angeles Barajas-García, María; Bryant, Amy; Morfín-Otero, Rayo; Márquez-Díaz, Francisco; Tinoco, Juan Carlos; Sánchez-Corona, José; Stevens, Dennis L.
2012-01-01
Summary Objective To compare the prevalence, phenotypes, and genes responsible for erythromycin resistance among Streptococcus pyogenes isolates from Mexico and the USA. Methods Eighty-nine invasive and 378 non-invasive isolates from Mexico, plus 148 invasive, 21 non-invasive, and five unclassified isolates from the USA were studied. Susceptibilities to penicillin, erythromycin, clindamycin, ceftriaxone, and vancomycin were evaluated according to Clinical and Laboratory Standards Institute (CLSI) standards. Phenotypes of erythromycin resistance were identified by triple disk test, and screening for mefA, ermTR, and ermB genes was carried out by PCR. Results All isolates were susceptible to penicillin, ceftriaxone, and vancomycin. Erythromycin resistance was found in 4.9% of Mexican strains and 5.2% of USA strains. Phenotypes in Mexican strains were 95% M and 5% cMLS; in strains from the USA, phenotypes were 33.3% iMLS, 33.3% iMLS-D, and 33.3% M. Erythromycin resistance genes in strains from Mexico were mefA (95%) and ermB (5%); USA strains harbored ermTR (56%), mefA (33%), and none (11%). In Mexico, all erythromycin-resistant strains were non-invasive, whereas 89% of strains from the USA were invasive. Conclusions Erythromycin resistance continues to exist at low levels in both Mexico and the USA, although the genetic mechanisms responsible differ between the two nations. These genetic differences may be related to the invasive character of the S. pyogenes isolated. PMID:22217469
Can Clays in Livestock Feed Promote Antibiotic Resistance and Virulence in Pathogenic Bacteria?
Rodr?guez-Rojas, Alexandro; Rodr?guez-Beltr?n, Jer?nimo; Valverde, Jos? Ram?n; Bl?zquez, Jes?s
2015-01-01
The use of antibiotics in animal husbandry has long been associated with the appearance of antibiotic resistance and virulence factor determinants. Nonetheless, the number of cases of human infection involving resistant or virulent microorganisms that originate in farms is increasing. While many antibiotics have been banned as dietary supplements in some countries, other additives thought to be innocuous in terms of the development and spread of antibiotic resistance are used as growth promot...
Streptococcus (S.) iniae and S. agalactiae are both economically important Gram positive bacterial pathogens affecting the globally farmed tilapia (Oreochromis spp.). Historically control of these bacteria in tilapia culture has included biosecurity, therapeutants and vaccination strategies. Genet...
Role of Streptococcus Anginosus on the formation of dental caries
Directory of Open Access Journals (Sweden)
Yetty Herdiyati Nonong
2011-11-01
Full Text Available Generally, the etiology of dental caries is the cariogenic properties of bacteria, these are always associated with Streptococcus mutans. Glucosyltransferase fragment (Gtf are also in other strains of Streptococcus such as Streptococcus anginosus, Streptococcus milleri which includes beta hemolysis. Genotypically B Streptococcus anginosus has genetic characteristics that are similar to Streptococcus mutans. The research objective was to determine the existence of Gtf B/C gene as a cause of caries in Streptococcus anginosus. The study was conducted in experimental laboratories with PCR technique by taking a sample of 20 children who had caries. The results showed there was the amplification of Streptococcus anginosus with a level of homology 96%, 97%, and 99%. The results of the Gtf genes amplification fragment B/C provided 600 pb ribbon. The conclusion was Streptococcus anginosus classified as cariogenic bacteria because they had Gtf B/C genes.
Influence of pH on inhibition of Streptococcus mutans by Streptococcus oligofermentans.
Liu, Ying; Chu, Lei; Wu, Fei; Guo, Lili; Li, Mengci; Wang, Yinghui; Wu, Ligeng
2014-02-01
Streptococcus oligofermentans is a novel strain of oral streptococcus that can specifically inhibit the growth of Streptococcus mutans. The aims of this study were to assess the growth of S. oligofermentans and the ability of S. oligofermentans to inhibit growth of Streptococcus mutans at different pH values. Growth inhibition was investigated in vitro using an interspecies competition assay. The 4-aminoantipyine method was used to measure the initial production rate and the total yield of hydrogen peroxide in S. oligofermentans. S. oligofermentans grew best at pH 7.0 and showed the most pronounced inhibitory effect when it was inoculated earlier than S. mutans. In terms of the total yield and the initial production rate of hydrogen peroxide by S. oligofermentans, the effects of the different culture pH values were as follows: pH 7.0 > 6.5 > 6.0 > 7.5 > 5.5 = 8.0 (i.e. there was no significant difference between pH 5.5 and pH 8.0). Environmental pH and the sequence of inoculation significantly affected the ability of S. oligofermentans to inhibit the growth of S. mutans. The degree of inhibition may be attributed to the amount of hydrogen peroxide produced. © 2013 Eur J Oral Sci.
Boretti, Vanessa Stolf; Corrêa, Renata Nunes; dos Santos, Silvana Soléo Ferreira; Leão, Mariella Vieira Pereira; Silva, Célia Regina Gonçalves e
2014-01-01
Objective: To evaluate the presence of microorganisms of the genus Staphylococcus and Streptococcus on toys in the playroom of a teaching hospital, as well to as analyze the antimicrobial resistance from isolated strains. Methods: Samples were collected from 60 toys, using wet swabs, soon after being used by the children. The samples were inoculated in enriched and selective agar for isolation and later identification of the microorganisms. Antibiogram testing was performed by agar diffusion technique. Results: The genus Staphylococcus was present in 87.0% (52/60) of the toys. Seventy-three strains were isolated, with 29.0% (21/73) coagulase-positive and 71.0% (52/73) coagulasenegative. Among the coagulase-negative strains, 90.4% were resistant to penicillin, 65.4% to oxacillin, 28.8% to clarithromycin, 61.5% to clindamycin, and none to vancomycin. Among the coagulase-positive strains, 76.2% were resistant to penicillin, 23.8% to oxacillin, 23.8% to clarithromycin, 47.6% to clindamycin, and none to vancomycin. The genus Streptococcus was not detected in any of the evaluated toys. Conclusions: Toys can be contaminated with potentially pathogenic bacteria with antimicrobial resistance, representing a possible source of nosocomial infection for patients who are already debilitated. PMID:25479842
Streptococcus pyogenes as the cause of vulvovaginitis and balanitis in children.
Randjelovic, Gordana; Otasevic, Suzana; Mladenovic-Antic, Snezana; Mladenovic, Vesna; Radovanovic-Velickovic, Radmila; Randjelovic, Marina; Bogdanovic, Dragan
2017-04-01
Streptococcus pyogenes (group A Streptococcus) is the etiological agent of perineal infection in children, consisting of perianal infection, vulvovaginitis and balanitis. If it is not properly diagnosed and treated, it can persist for many months and can cause severe complications. Furthermore, treatment with penicillin can be followed by failures and recurrences. We report here the prevalence of S. pyogenes isolates in genital tract specimens from girls (n = 1692) with symptoms of vulvovaginitis and from boys (n = 52) with balanitis in the municipality of Nis, Southeast-Serbia (the Western Balkans) in a 10 year period, and the seasonal distribution, patient age and sensitivity to bacitracin and antimicrobial drugs used in the treatment of streptococcal infection. Streptococcal vulvovaginitis was diagnosed in 2.30% of examinees. Of those cases, 64.10% were detected from April to September, and it was most common (71.79%) in girls aged 3-7 years. Streptococcal balanitis was diagnosed in two instances: in a 4-year-old boy and in a 7-year-old boy. S. pyogenes strains resistant to bacitracin were identified in five girls. Two isolates with M phenotype and five isolates with cMLS B phenotype were identified. Streptococcal vulvovaginitis was diagnosed less often in the present study, but it was still far more common than streptococcal balanitis in childhood. Bacitracin resistance of S. pyogenes strains should be taken into account in routine microbiological identification, and the detection of S. pyogenes isolates resistant to erythromycin requires surveillance in the present geographical territory. © 2016 Japan Pediatric Society.
Multidrug Resistance in Infants and Children
Directory of Open Access Journals (Sweden)
Gian Maria Pacifici
2018-02-01
Full Text Available Bacterial infections may cause disease and death. Infants and children are often subject to bacterial infections. Antimicrobials kill bacteria protecting the infected patients andreducing the risk of morbidity and mortality caused by bacteria. The antibiotics may lose their antibacterial activity when they become resistant to a bacteria. The resistance to different antibiotics in a bacteria is named multidrug-resistance. Gram-negative bacilli, especially Escherichia coli, Klebsiella, Enterobacter, Salmonella, Shigella, Pseudomonas, Streptococcus, and Haemophilus influenzae type b, may become resistant. Amikacin ampicillin, amoxicillin, amoxiclav, cefuroxime, cefotaxime, ceftazidime, cefoperazone tetracycline, chloramphenicol, ciprofloxacin, and gentamicin may cause bacterial-resistance. Resistance to bacteria for several pathogens makes complications in the treatment of infections caused by them. Salmonella strains may become resistant to ampicillin, cephalotin, ceftriaxone, gentamicin, amikacin, trimethoprim-sulfamethoxazole, chloramphenicol, and tetracycline. Shigella strains may become resistant to ampicillin, cotrimoxazole, chloramphenicol, and streptomycin. Multidrug-resistance of Streptococcus pneumoniae may be due to β-lactams, macrolides, tetracycline, chloramphenicol, and trimethoprim-sulfamethoxazole. Multidrug-resistance of Pseudomonas aeruginosa may become resistant to β-lactams, chloramphenicol, trimethoprim-sulfamethoxazole, and tetracycline. The antibacterial activity against Haemophilus strains may occur with ampicillin, sulbactam-ampicillin, trimethoprim-sulfamethoxazole, gentamicin, chloramphenicol, and ciprofloxacin. Multidrug-resistance of the Klebsiella species may be due with ampicillin, cefotaxime, cefuroxime, co-amxilav, mezlocillin, chloramphenicol, gentamicin, and ceftazidime. Multidrug-resistance of Escherichia coli may be caused by ampicillin, cotrimoxazole, chloramphenicol, ceftriaxone, and ceftazidime. Vibrio
Lovgren, M.; Dell’Acqua, L.; Palacio, R.; Echániz-Aviles, G.; Soto-Noguerón, A.; Castañeda, E.; Agudelo, C. I.; Heitmann, I.; Brandileone, M. C.; Zanella, R. C.; Rossi, A.; Pace, J.; Talbot, J. A.
1999-01-01
An international, multicenter study compared trimethoprim-sulfamethoxazole MICs for 743 Streptococcus pneumoniae isolates (107 to 244 isolates per country) by E test, using Mueller-Hinton agar supplemented with 5% defibrinated horse blood or 5% defibrinated sheep blood, with MICs determined by the National Committee for Clinical Laboratory Standards broth microdilution reference method. Agreement within 1 log2 dilution and minor error rates were 69.3 and 15.5%, respectively, on sheep blood-supplemented agar and 76.9 and 13.6%, respectively, with horse blood as the supplement. Significant interlaboratory variability was observed. E test may not be a reliable method for determining the resistance of pneumococci to trimethoprim-sulfamethoxazole. PMID:9854095
Garcia-de-la-Maria, C.; Xiong, Y. Q.; Pericas, J. M.; Armero, Y.; Moreno, A.; Mishra, N. N.; Rybak, M. J.; Tran, T. T.; Arias, C. A.; Sullam, P. M.; Bayer, A. S.
2017-01-01
ABSTRACT Among the viridans group streptococci, the Streptococcus mitis group is the most common cause of infective endocarditis. These bacteria have a propensity to be β-lactam resistant, as well as to rapidly develop high-level and durable resistance to daptomycin (DAP). We compared a parental, daptomycin-susceptible (DAPs) S. mitis/S. oralis strain and its daptomycin-resistant (DAPr) variant in a model of experimental endocarditis in terms of (i) their relative fitness in multiple target organs in this model (vegetations, kidneys, spleen) when animals were challenged individually and in a coinfection strategy and (ii) their survivability during therapy with daptomycin-gentamicin (an in vitro combination synergistic against the parental strain). The DAPr variant was initially isolated from the cardiac vegetations of animals with experimental endocarditis caused by the parental DAPs strain following treatment with daptomycin. The parental strain and the DAPr variant were comparably virulent when animals were individually challenged. In contrast, in the coinfection model without daptomycin therapy, at both the 106- and 107-CFU/ml challenge inocula, the parental strain outcompeted the DAPr variant in all target organs, especially the kidneys and spleen. When the animals in the coinfection model of endocarditis were treated with DAP-gentamicin, the DAPs strain was completely eliminated, while the DAPr variant persisted in all target tissues. These data underscore that the acquisition of DAPr in S. mitis/S. oralis does come at an intrinsic fitness cost, although this resistance phenotype is completely protective against therapy with a potentially synergistic DAP regimen. PMID:28264848
Directory of Open Access Journals (Sweden)
Deguo Wang
2015-05-01
Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
Wang, Deguo; Liu, Yanhong
2015-05-26
Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.
DEFF Research Database (Denmark)
Bek-Thomsen, Malene; Tettelin, H; Hance, I
2008-01-01
. A culture-independent method was used, based on cloning and sequencing of PCR amplicons of the housekeeping gene gdh, which shows remarkable, yet species-specific, genetic polymorphism. Samples were collected from all potential ecological niches in the oral cavity and pharynx of two adults on two occasions......We reinvestigated the clonal diversity and dynamics of Streptococcus mitis and two other abundant members of the commensal microbiota of the upper respiratory tract, Streptococcus oralis and Streptococcus infantis, to obtain information about the origin of frequently emerging clones in this habitat...... with loss and acquisition from contacts. These findings provide a platform for understanding the mechanisms that govern the balance within the complex microbiota at mucosal sites and between the microbiota and the mucosal immune system of the host....
Obesity Resistance Promotes Mild Contractile Dysfunction Associated with Intracellular Ca2+ Handling
International Nuclear Information System (INIS)
Sá, Felipe Gonçalves dos Santos de; Lima-Leopoldo, Ana Paula; Jacobsen, Bruno Barcellos; Ferron, Artur Junio Togneri; Estevam, Wagner Muller; Campos, Dijon Henrique Salomé; Castardeli, Edson; Cunha, Márcia Regina Holanda da; Cicogna, Antonio Carlos; Leopoldo, André Soares
2015-01-01
Diet-induced obesity is frequently used to demonstrate cardiac dysfunction. However, some rats, like humans, are susceptible to developing an obesity phenotype, whereas others are resistant to that. To evaluate the association between obesity resistance and cardiac function, and the impact of obesity resistance on calcium handling. Thirty-day-old male Wistar rats were distributed into two groups, each with 54 animals: control (C; standard diet) and obese (four palatable high-fat diets) for 15 weeks. After the experimental protocol, rats consuming the high-fat diets were classified according to the adiposity index and subdivided into obesity-prone (OP) and obesity-resistant (OR). Nutritional profile, comorbidities, and cardiac remodeling were evaluated. Cardiac function was assessed by papillary muscle evaluation at baseline and after inotropic maneuvers. The high-fat diets promoted increase in body fat and adiposity index in OP rats compared with C and OR rats. Glucose, lipid, and blood pressure profiles remained unchanged in OR rats. In addition, the total heart weight and the weight of the left and right ventricles in OR rats were lower than those in OP rats, but similar to those in C rats. Baseline cardiac muscle data were similar in all rats, but myocardial responsiveness to a post-rest contraction stimulus was compromised in OP and OR rats compared with C rats. Obesity resistance promoted specific changes in the contraction phase without changes in the relaxation phase. This mild abnormality may be related to intracellular Ca2+ handling
Streptococcus suis meningitis, a poacher's risk
Halaby, T.; Hoitsma, E.; Hupperts, R.; Spanjaard, L.; Luirink, M.; Jacobs, J.
2000-01-01
Streptococcus suis infection is a zoonosis that has been mainly reported in pig-rearing and pork-consuming countries. The most common disease manifestation is meningitis, often associated with cochleovestibular signs. The causative agent is Streptococcus suis serotype 2, found as a commensal in the
A European study on the relationship between antimicrobial use and antimicrobial resistance
Bronzwaer, SLAM; Cars, O; Buchholz, U; Molstad, S; Goettsch, W; Veldhuijzen, IK; Kool, JL; Sprenger, MJW; Degener, JE
In Europe, antimicrobial resistance has been monitored since 1998 by the European Antimicrobial Resistance Surveillance System (EARSS). We examined the relationship between penicillin nonsusceptibility of invasive isolates of Streptococcus pneumoniae and antibiotic sales. Information was collected
Zheng, Wenning; Tan, Mui Fern; Old, Lesley A.; Paterson, Ian C.; Jakubovics, Nicholas S.; Choo, Siew Woh
2017-01-01
Streptococcus gordonii and Streptococcus sanguinis are pioneer colonizers of dental plaque and important agents of bacterial infective endocarditis (IE). To gain a greater understanding of these two closely related species, we performed comparative analyses on 14 new S. gordonii and 5 S. sanguinis strains using various bioinformatics approaches. We revealed S. gordonii and S. sanguinis harbor open pan-genomes and share generally high sequence homology and number of core genes including virule...
Directory of Open Access Journals (Sweden)
J. M. Mutua
2017-01-01
Full Text Available This study was designed to determine antimicrobial resistance profiles of bacteria isolated from the nasal cavity of healthy camels. A total of 255 nasal samples (swabs were collected in Isiolo, Samburu, and Nakuru counties, Kenya, from which 404 bacterial isolates belonging to various genera and species were recovered. The bacterial isolates included Bacillus (39.60%, coagulase-negative Staphylococcus (29.95%, Streptococcus species other than Streptococcus agalactiae (25.74%, coagulase-positive Staphylococcus (3.96%, and Streptococcus agalactiae (0.74%. Isolates were most susceptible to Gentamicin (95.8%, followed by Tetracycline (90.5%, Kanamycin and Chloramphenicol (each at 85.3%, Sulphamethoxazole (84.2%, Co-trimoxazole (82.1%, Ampicillin (78.9%, and finally Streptomycin (76.8%. This translated to low resistance levels. Multidrug resistance was also reported in 30.5% of the isolates tested. Even though the antibiotic resistance demonstrated in this study is low, the observation is significant, since the few resistant normal flora could be harboring resistance genes which can be transferred to pathogenic bacteria within the animal, to other animals’ bacteria and, most seriously, to human pathogens.
Erginkaya, Z; Turhan, E U; Tatlı, D
2018-01-01
In this study, the antibiotic resistance (AR) of lactic acid bacteria (LAB) isolated from traditional Turkish fermented dairy products was investigated. Yogurt, white cheese, tulum cheese, cokelek, camız cream and kefir as dairy products were collected from various supermarkets. Lactic acid bacteria such as Lactobacillus spp., Streptococcus spp., Bifidobacterium spp., and Enterecoccus spp. were isolated from these dairy products. Lactobacillus spp. were resistant to vancomycin (58%), erythromycin (10.8%), tetracycline (4.3%), gentamicin (28%), and ciprofloxacin (26%). Streptococcus spp. were resistant to vancomycin (40%), erythromycin (10%), chloramphenicol (10%), gentamicin (20%), and ciprofloxacin (30%). Bifidobacterium spp. were resistant to vancomycin (60%), E 15 (6.6%), gentamicin (20%), and ciprofloxacin (33%). Enterococcus spp. were resistant to vancomycin (100%), erythromycin (100%), rifampin (100%), and ciprofloxacin (100%). As a result, LAB islated from dairy products in this study showed mostly resistance to vancomycin.
Directory of Open Access Journals (Sweden)
Nihar Nalini Mohanty,
2013-08-01
Full Text Available Aim: The present study was aimed to isolate and evaluate the continuous change in the pattern of drug resistance showed by different mastitogenic organisms, isolated from clinical and subclinical cases of mastitis.Materials and Methods: The study was carried out using 150 milk samples received from various clinical and subclinical cases, from which the causative organisms were isolated and subjected to in vitro antibiotic sensitivity test.Results: The bacteriological analysis of the samples indicated the presence of both Gram positive and Gram negative organisms followed by isolation of isolates like Staphylococcus, E. coli, Streptococcus, Bacillus, Corynebacterium, Listeria, Klebsiella. The in vitro sensitivity of Staphylococcus, E. coli and Streptococcus isolates revealed that they were more sensitive towards newer antimicrobials like Levofloxacin and Enrofloxacin.Conclusion: The prevalence of Staphylococcus was found to be maximum followed by Streptococcus and E. coli among the isolated organisms. Levofloxacin and Enrofloxacin were found to be most effective against the targeted isolates.
Streptococcus pneumoniae urinary tract infection in pedeatrics.
Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence
2017-06-01
Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.
21 CFR 866.3720 - Streptococcus spp. exo-enzyme reagents.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Streptococcus spp. exo-enzyme reagents. 866.3720... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3720 Streptococcus spp. exo-enzyme reagents. (a) Identification. Streptococcus spp. exoenzyme reagents are devices used...
Diversity of human small intestinal Streptococcus and Veillonella populations.
van den Bogert, Bartholomeus; Erkus, Oylum; Boekhorst, Jos; de Goffau, Marcus; Smid, Eddy J; Zoetendal, Erwin G; Kleerebezem, Michiel
2013-08-01
Molecular and cultivation approaches were employed to study the phylogenetic richness and temporal dynamics of Streptococcus and Veillonella populations in the small intestine. Microbial profiling of human small intestinal samples collected from four ileostomy subjects at four time points displayed abundant populations of Streptococcus spp. most affiliated with S. salivarius, S. thermophilus, and S. parasanguinis, as well as Veillonella spp. affiliated with V. atypica, V. parvula, V. dispar, and V. rogosae. Relative abundances varied per subject and time of sampling. Streptococcus and Veillonella isolates were cultured using selective media from ileostoma effluent samples collected at two time points from a single subject. The richness of the Streptococcus and Veillonella isolates was assessed at species and strain level by 16S rRNA gene sequencing and genetic fingerprinting, respectively. A total of 160 Streptococcus and 37 Veillonella isolates were obtained. Genetic fingerprinting differentiated seven Streptococcus lineages from ileostoma effluent, illustrating the strain richness within this ecosystem. The Veillonella isolates were represented by a single phylotype. Our study demonstrated that the small intestinal Streptococcus populations displayed considerable changes over time at the genetic lineage level because only representative strains of a single Streptococcus lineage could be cultivated from ileostoma effluent at both time points. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
THE MODE OF ACTION OF SULFANILAMIDE ON STREPTOCOCCUS. II.
Gay, F P; Clark, A R; Street, J A; Miles, D W
1939-04-30
The precise mode of therapeutic action of sulfanilamide on streptococcus can be arrived at only by considering the sum total of factors that inhibit or favor the natural growth of the microorganism under the experimental conditions that obtain, whether in vivo or in vitro. Too sweeping conclusions have hitherto been drawn from the study of a single variable factor, such as an unfavorable temperature or the absence or presence of peptone. We have attempted here to analyze the factors that have hitherto been recognized and some new ones, but particularly the relationship of these factors to one another. The result obtained on adding sulfanilamide to the streptococcus in the test tube is usually bacteriostasis and not complete destruction of even small numbers of bacteria. This is on the condition that the suspending medium is a favorable one for the growth of the microorganism; the more growth-promoting the medium is the less the bacteriostasis. If, on the other hand, the medium is too poor, or one that in itself inhibits growth, the addition of sulfanilamide may lead to sterilization of the culture. The conditions for growth of the streptococcus in the body of the rabbit or mouse, depend on the strain of bacteria used, but are on the whole favorable. Defence, however, in the form of phagocytosis by both polymorphonuclear and by mononuclear cells is attempted even in the susceptible animal. When sulfanilamide is used to treat such an animal, or when sulfanilamide-grown (inhibited) streptococci are employed, phagocytosis is pronounced, whether studied in the test tube or in the animal body. In the rabbit the delay by sulfanilamide and resultant increased phagocytosis by polymorphonuclears allows mononuclear cells to accumulate and recovery may result. Sulfanilamide not only does not completely destroy the streptococcus but does not even impair its innate virulence. It acts upon the streptococcus not only by inhibiting growth but by a temporary inhibition of hemotoxin
Different Erythromycin Resistance Mechanisms in Group C and Group G Streptococci
Kataja, Janne; Seppälä, Helena; Skurnik, Mikael; Sarkkinen, Hannu; Huovinen, Pentti
1998-01-01
Different mechanisms of erythromycin resistance predominate in group C and G streptococcus (GCS and GGS, respectively) isolates collected from 1992 to 1995 in Finland. Of the 21 erythromycin-resistant GCS and 32 erythromycin-resistant GGS isolates, 95% had the mefA or mefE drug efflux gene and 94% had the ermTR methylase gene, respectively.
Boretti, Vanessa Stolf; Corrêa, Renata Nunes; dos Santos, Silvana Soléo Ferreira; Leão, Mariella Vieira Pereira; Gonçalves e Silva, Célia Regina
2014-09-01
To evaluate the presence of microorganisms of the genus Staphylococcus and Streptococcus on toys in the playroom of a teaching hospital, as well to as analyze the antimicrobial from the isolated strains. Samples were collected from 60 toys, using wet swabs, soon after being used by the children. The samples were inoculated in enriched and selective agar for isolation and later identification of the microorganisms. Antibiogram testing was performed by agar diffusion technique. The genus Staphylococcus was present in 87.0% (52/60) of the toys. Seventythree strains were isolated, with 29.0% (21/73) coagulase-positive and 71.0% (52/73) coagulase-negative. Among the coagulase-negative strains, 90.4% were resistant to penicillin, 65.4% to oxacillin, 28.8% to clarithromycin, 61.5% to clindamycin, and none to vancomycin. Among the coagulase-positive strains, 76.2% were resistant to penicillin, 23.8% to oxacillin, 23.8% to clarithromycin, 47.6% to clindamycin, and none to vancomycin. The genus Streptococcus was not detected in any of the evaluated toys. Toys can be contaminated with potentially pathogenic bacteria with antimicrobial resistance, representing a possible source of nosocomial infection for patients who are already debilitated. Copyright © 2014 Sociedade de Pediatria de São Paulo. Publicado por Elsevier Editora Ltda. All rights reserved.
Directory of Open Access Journals (Sweden)
Dreier Jens
2011-08-01
Full Text Available Abstract Background Streptococcus gallolyticus subsp. gallolyticus is an important causative agent of infectious endocarditis, while the pathogenicity of this species is widely unclear. To gain insight into the pathomechanisms and the underlying genetic elements for lateral gene transfer, we sequenced the entire genome of this pathogen. Results We sequenced the whole genome of S. gallolyticus subsp. gallolyticus strain ATCC BAA-2069, consisting of a 2,356,444 bp circular DNA molecule with a G+C-content of 37.65% and a novel 20,765 bp plasmid designated as pSGG1. Bioinformatic analysis predicted 2,309 ORFs and the presence of 80 tRNAs and 21 rRNAs in the chromosome. Furthermore, 21 ORFs were detected on the plasmid pSGG1, including tetracycline resistance genes telL and tet(O/W/32/O. Screening of 41 S. gallolyticus subsp. gallolyticus isolates revealed one plasmid (pSGG2 homologous to pSGG1. We further predicted 21 surface proteins containing the cell wall-sorting motif LPxTG, which were shown to play a functional role in the adhesion of bacteria to host cells. In addition, we performed a whole genome comparison to the recently sequenced S. gallolyticus subsp. gallolyticus strain UCN34, revealing significant differences. Conclusions The analysis of the whole genome sequence of S. gallolyticus subsp. gallolyticus promotes understanding of genetic factors concerning the pathogenesis and adhesion to ECM of this pathogen. For the first time we detected the presence of the mobilizable pSGG1 plasmid, which may play a functional role in lateral gene transfer and promote a selective advantage due to a tetracycline resistance.
Directory of Open Access Journals (Sweden)
Amauri Lázaro Noda Albelo
2011-12-01
Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.
Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment.
Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T
2017-02-21
Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.
The novel species Streptococcus tigurinus and its association with oral infection.
Zbinden, Andrea; Bostanci, Nagihan; Belibasakis, Georgios N
2015-01-01
Streptococcus tigurinus is a novel species of viridans streptococci, shown to cause severe invasive infections such as infective endocarditis, spondylodiscitis and meningitis. S. tigurinus belongs to the Streptococcus mitis group and is most closely related to Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae and Streptococcus infantis. The presence of S. tigurinus in the human oral cavity has been documented, including in patients with periodontal disease. This review addresses the available scientific knowledge on S. tigurinus and its association with closely related streptococci, and discusses its putative involvement in common oral infections. While there is as yet no strong evidence on the involvement of S. tigurinus with oral infections, its presence in the oral cavity and its association with endocarditis warrants special attention for a link between oral and systemic infection.
DEFF Research Database (Denmark)
Poggenborg, René; Gaïni, Shahin; Kjaeldgaard, Poul
2008-01-01
Meningitis and spondylodiscitis caused by Streptococcus suis is a rare disease which is contracted by occupational exposure to pigs. We report a 54-y-old pig-farm worker with S. suis meningitis and septicaemia complicated with thoracal and lumbar spine spondylodiscitis. The S. suis strain involved...
2008-03-26
Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L
Kawada-Matsuo, Miki; Komatsuzawa, Hitoshi
2017-01-01
Summary Approximately 100 trillion microorganisms exist in the oral cavity. For the commensal bacteria of the oral cavity, it is important to adapt to environmental stimuli, including human- or bacteria-derived antimicrobial agents. Recently, bacterial-specific signal transduction regulatory systems, called two-component systems (TCSs), which appear to be focused on sensing and adapting to the environment, were discovered. Streptococcus mutans is an oral commensal bacteria and is also known a...
Energy Technology Data Exchange (ETDEWEB)
Sá, Felipe Gonçalves dos Santos de; Lima-Leopoldo, Ana Paula; Jacobsen, Bruno Barcellos; Ferron, Artur Junio Togneri; Estevam, Wagner Muller [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil); Campos, Dijon Henrique Salomé [Departamento de Clínica Médica - Faculdade de Medicina - Universidade Estadual Paulista, Botucatu, São Paulo (Brazil); Castardeli, Edson; Cunha, Márcia Regina Holanda da [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil); Cicogna, Antonio Carlos [Departamento de Clínica Médica - Faculdade de Medicina - Universidade Estadual Paulista, Botucatu, São Paulo (Brazil); Leopoldo, André Soares, E-mail: andresoaresleopoldo@gmail.com [Centro de Educação Física e Desportos - Departamento de Desportos - Universidade Federal do Espírito Santo, Vitória, ES (Brazil)
2015-12-15
Diet-induced obesity is frequently used to demonstrate cardiac dysfunction. However, some rats, like humans, are susceptible to developing an obesity phenotype, whereas others are resistant to that. To evaluate the association between obesity resistance and cardiac function, and the impact of obesity resistance on calcium handling. Thirty-day-old male Wistar rats were distributed into two groups, each with 54 animals: control (C; standard diet) and obese (four palatable high-fat diets) for 15 weeks. After the experimental protocol, rats consuming the high-fat diets were classified according to the adiposity index and subdivided into obesity-prone (OP) and obesity-resistant (OR). Nutritional profile, comorbidities, and cardiac remodeling were evaluated. Cardiac function was assessed by papillary muscle evaluation at baseline and after inotropic maneuvers. The high-fat diets promoted increase in body fat and adiposity index in OP rats compared with C and OR rats. Glucose, lipid, and blood pressure profiles remained unchanged in OR rats. In addition, the total heart weight and the weight of the left and right ventricles in OR rats were lower than those in OP rats, but similar to those in C rats. Baseline cardiac muscle data were similar in all rats, but myocardial responsiveness to a post-rest contraction stimulus was compromised in OP and OR rats compared with C rats. Obesity resistance promoted specific changes in the contraction phase without changes in the relaxation phase. This mild abnormality may be related to intracellular Ca2+ handling.
Laith, A A; Mazlan, A G; Effendy, A W; Ambak, M A; Nurhafizah, W W I; Alia, A S; Jabar, A; Najiah, M
2017-06-01
The current study was designed to evaluate the effects of Excoecaria agallocha leaf extracts on immune mechanisms and resistance of tilapia, Oreochromis niloticus, after challenge with Streptococcus agalactiae. Fish were divided into 6 groups; groups 1-5 fed with E. agallocha leaf extracts at 10, 20, 30, 40 and 50mgkg -1 level, respectively. Group 6 were fed without extract addition and acted as control. E. agallocha extracts were administered as feed supplement in fish diet for 28days and the hematological, immunological, and growth performance studies were conducted. Fish were infected with S. agalactiae at a dose of 15×105CFUmL -1 and the total white blood cell (WBC), phagocytosis and respiratory burst activities of leukocytes, serum bactericidal activity, lysozyme, total protein, albumin, and globulin levels were monitored and mortalities recorded for 15days post infection. Results revealed that feeding O. niloticus with 50mgkg -1 of E. agallocha enhanced WBC, phagocytic, respiratory burst, serum bactericidal and lysozyme activities on day 28 pre-challenge and on 3rd, 6th, 9th, 12th and 15th day post-challenge as compared to control. Total protein and albumin were not enhanced by E. agallocha diet. E. agallocha increased the survival of fish after challenge with S. agalactiae. The highest mortality rate (97%) was observed in control fish and the lowest mortality (27%) was observed with group fed with 50mgkg -1 extract. The results indicate that dietary intake of E. agallocha methanolic leaf extract in O. niloticus enhances the non-specific immunity and disease resistance against S. agalactiae pathogen. Copyright © 2017. Published by Elsevier Ltd.
Traverso, Fernando; Blanco, Alejandra; Villalón, Pilar; Beratz, Noelia; Sáez Nieto, Juan Antonio; Lopardo, Horacio
Streptococcus dysgalactiae subsp. equisimilis (SDSE) has virulence factors similar to those of Streptococcus pyogenes. Therefore, it causes pharyngitis and severe infections indistinguishable from those caused by the classic pathogen. The objectives of this study were: to know the prevalence of SDSE invasive infections in Argentina, to study the genetic diversity, to determine the presence of virulence genes, to study antibiotic susceptibility and to detect antibiotic resistance genes. Conventional methods of identification were used. Antibiotic susceptibility was determined by the disk diffusion and the agar dilution methods and the E-test. Twenty eight centers from 16 Argentinean cities participated in the study. Twenty three isolates (16 group G and 7 group C) were obtained between July 1 2011 and June 30 2012. Two adult patients died (8.7%). Most of the isolates were recovered from blood (60.9%). All isolates carried speJ and ssa genes. stG62647, stG653 and stG840 were the most frequent emm types. Nineteen different PFGE patterns were detected. All isolates were susceptible to penicillin and levofloxacin, 6 (26.1%) showed resistance or reduced susceptibility to erythromycin [1 mef(A), 3 erm(TR), 1 mef(A)+erm(TR) and 1 erm(TR)+erm(B)] and 7 (30.4%) were resistant or exhibited reduced susceptibility to tetracycline [2 tet(M), 5 tet(M)+tet(O)]. The prevalence in Argentina was of at least 23 invasive infections by SDSE. A wide genetic diversity was observed. All isolates carried speJ and ssa genes. Similarly to other studies, macrolide resistance (26.1%) was mainly associated to the MLS B phenotype. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
Stanniocalcin 2 promotes cell proliferation and cisplatin resistance in cervical cancer
International Nuclear Information System (INIS)
Wang, Yuxia; Gao, Ying; Cheng, Hairong; Yang, Guichun; Tan, Wenhua
2015-01-01
Cervical cancer is one of the most common carcinomas in the female reproductive system. Treatment of cervical cancer involves surgical removal and chemotherapy. Resistance to platinum-based chemotherapy drugs including cisplatin has increasingly become an important problem in the treatment of cervical cancer patients. We found in this study that stanniocalcin 2 (STC2) expression was upregulated in both cervical cancer tissues and cell lines. The levels of STC2 expression in cervical cancer cell lines were positively correlated with the rate of cell proliferation. Furthermore, in cisplatin resistant cervical cancer cells, the levels of STC2 expression were significantly elevated. Modulation of STC2 expression by siRNA or overexpression in cisplatin resistant cells resulted in altered cell survival, apoptosis, and cisplatin resistance. Finally, we found that there was significant difference in the activity of the MAPK signaling pathway between cisplatin sensitive and resistant cervical cancer cells, and that STC2 could regulate the activity of the MAPK signaling pathway. - Highlights: • STC2 was upregulated in cervical cancer and promoted cervical cancer cell proliferation. • Cisplatin resistant cells had elevated STC2 levels and enhanced proliferation. • STC2 regulated cisplatin chemosensitivity in cervical cancer cells. • STC2 regulated the activity of the MAPK signaling pathway.
Antimicrobial susceptibility of Streptococcus suis isolated from clinically healthy swine in Brazil.
Soares, Taíssa Cook Siqueira; Paes, Antonio Carlos; Megid, Jane; Ribolla, Paulo Eduardo Martins; Paduan, Karina dos Santos; Gottschalk, Marcelo
2014-04-01
Streptococcus suis is an important pathogen in the swine industry. This study is the first to report on the antimicrobial susceptibility of S. suis isolated from clinically healthy pigs in Brazil; the fourth major pork producer in the world. The antimicrobial susceptibility of 260 strains was determined by disc diffusion method. Strains were commonly susceptible to ceftiofur, cephalexin, chloramphenicol, and florfenicol, with more than 80% of the strains being susceptible to these antimicrobials. A high frequency of resistance to some of the antimicrobial agents was demonstrated, with resistance being most common to sulfa-trimethoprim (100%), tetracycline (97.69%), clindamycin (84.61%), norfloxacin (76.92%), and ciprofloxacin (61.15%). A high percentage of multidrug resistant strains (99.61%) were also found. The results of this study indicate that ceftiofur, cephalexin, and florfenicol are the antimicrobials of choice for empirical control of the infections caused by S. suis.
Kamiya, Regianne Umeko; Höfling, José Francisco; Gonçalves, Reginaldo Bruno
2008-05-01
The aim of this study was to analyse the frequency and expression of biosynthesis genes in 47 Streptococcus mutans isolates with different mutacin-producing phenotypes. Detection of the frequency and expression of genes encoding mutacin types I, II, III and IV were carried out by PCR and semi-quantitative RT-PCR, respectively, using primers specific for each type of biosynthesis gene. In addition, a further eight genes encoding putative bacteriocins, designated bsm 283, bsm 299, bsm 423, bsm 1889c, bsm 1892c, bsm 1896, bsm 1906c and bsm 1914, were also screened. There was a high phenotypic diversity; some Streptococcus mutans isolates presented broad antimicrobial spectra against other Streptococcus mutans clinical isolates, including bacteria resistant to common antibiotics, as well as Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis and Streptococcus pyogenes. The expression frequency of the bsm gene was higher than that of the previously characterized mutacins (I-IV). There was no positive correlation between the number of indicator strains inhibited (antimicrobial spectra) and the number of biosynthesis genes expressed (Spearman correlation test, r=-0.03, P>0.05). In conclusion, the high diversity of mutacin-producing phenotypes, associated with high frequency of expression of the biosynthesis genes screened, reveals a broad repertoire of genetic determinants encoding antimicrobial peptides that can act in different combinations.
Marttinen, Aino M; Ruas-Madiedo, Patricia; Hidalgo-Cantabrana, Claudio; Saari, Markku A; Ihalin, Riikka A; Söderling, Eva M
2012-09-01
We studied the effects of xylitol on biofilms containing xylitol-resistant (Xr) and xylitol-sensitive (Xs) Streptococcus mutans, Actinomyces naeslundii and S. sanguinis. The biofilms were grown for 8 and 24 h on hydroxyapatite discs. The viable microorganisms were determined by plate culturing techniques and fluorescence in situ hybridization (FISH) was performed using a S. mutans-specific probe. Extracellular cell-bound polysaccharides (EPS) were determined by spectrofluorometry from single-species S. mutans biofilms. In the presence of 5 % xylitol, the counts of the Xs S. mutans decreased tenfold in the young (8 h) biofilm (p Xr strains, and FISH confirmed these results. No differences were detected in the EPS production of the Xs S. mutans grown with or without xylitol, nor between Xr and Xs S. mutans strains. Thus, it seems that xylitol did not affect the EPS synthesis of the S. mutans strains. Since the Xr S. mutans strains, not inhibited by xylitol, showed no xylitol-induced decrease in the biofilms, we conclude that growth inhibition could be responsible for the decrease of the counts of the Xs S. mutans strains in the clinically relevant young biofilms.
Directory of Open Access Journals (Sweden)
Christoph Jans
2018-04-01
Full Text Available The Streptococcus bovis/Streptococcus equinus complex (SBSEC comprises several species inhabiting the animal and human gastrointestinal tract (GIT. They match the pathobiont description, are potential zoonotic agents and technological organisms in fermented foods. SBSEC members are associated with multiple diseases in humans and animals including ruminal acidosis, infective endocarditis (IE and colorectal cancer (CRC. Therefore, this review aims to re-evaluate adhesion and colonization abilities of SBSEC members of animal, human and food origin paired with genomic and functional host-microbe interaction data on their road from colonization to infection. SBSEC seem to be a marginal population during GIT symbiosis that can proliferate as opportunistic pathogens. Risk factors for human colonization are considered living in rural areas and animal-feces contact. Niche adaptation plays a pivotal role where Streptococcus gallolyticus subsp. gallolyticus (SGG retained the ability to proliferate in various environments. Other SBSEC members have undergone genome reduction and niche-specific gene gain to yield important commensal, pathobiont and technological species. Selective colonization of CRC tissue is suggested for SGG, possibly related to increased adhesion to cancerous cell types featuring enhanced collagen IV accessibility. SGG can colonize, proliferate and may shape the tumor microenvironment to their benefit by tumor promotion upon initial neoplasia development. Bacteria cell surface structures including lipotheichoic acids, capsular polysaccharides and pilus loci (pil1, pil2, and pil3 govern adhesion. Only human blood-derived SGG contain complete pilus loci and other disease-associated surface proteins. Rumen or feces-derived SGG and other SBSEC members lack or harbor mutated pili. Pili also contribute to binding to fibrinogen upon invasion and translocation of cells from the GIT into the blood system, subsequent immune evasion, human contact
Jans, Christoph; Boleij, Annemarie
2018-01-01
The Streptococcus bovis/Streptococcus equinus complex (SBSEC) comprises several species inhabiting the animal and human gastrointestinal tract (GIT). They match the pathobiont description, are potential zoonotic agents and technological organisms in fermented foods. SBSEC members are associated with multiple diseases in humans and animals including ruminal acidosis, infective endocarditis (IE) and colorectal cancer (CRC). Therefore, this review aims to re-evaluate adhesion and colonization abilities of SBSEC members of animal, human and food origin paired with genomic and functional host-microbe interaction data on their road from colonization to infection. SBSEC seem to be a marginal population during GIT symbiosis that can proliferate as opportunistic pathogens. Risk factors for human colonization are considered living in rural areas and animal-feces contact. Niche adaptation plays a pivotal role where Streptococcus gallolyticus subsp. gallolyticus (SGG) retained the ability to proliferate in various environments. Other SBSEC members have undergone genome reduction and niche-specific gene gain to yield important commensal, pathobiont and technological species. Selective colonization of CRC tissue is suggested for SGG, possibly related to increased adhesion to cancerous cell types featuring enhanced collagen IV accessibility. SGG can colonize, proliferate and may shape the tumor microenvironment to their benefit by tumor promotion upon initial neoplasia development. Bacteria cell surface structures including lipotheichoic acids, capsular polysaccharides and pilus loci (pil1, pil2, and pil3) govern adhesion. Only human blood-derived SGG contain complete pilus loci and other disease-associated surface proteins. Rumen or feces-derived SGG and other SBSEC members lack or harbor mutated pili. Pili also contribute to binding to fibrinogen upon invasion and translocation of cells from the GIT into the blood system, subsequent immune evasion, human contact system
Chronic mastitis in cows caused by Streptococcus dysgalactiae: Case report
Directory of Open Access Journals (Sweden)
Cojkić Aleksandar
2015-01-01
Full Text Available Mastitis in dairy cows is an economically important disease because it makes up 38% of all diseases that occur in intensive cattle breeding. Mastitis affects milk production, either temporarily or permanently, depending on the course of infection and type of pathogen agent. Regular and timely therapy of mastitis based on the application antimicrobials, apart from prophylaxis, is very important for good health of breeding stock. This paper presents the case of repeated mastitis in a cow, Holstein-Friesian breed, 5 years old, which did not respond to antibiotic therapy. Milk samples from each separate quarter of the udder were collected under aseptic conditions and sent to the laboratory for further bacteriological tests, for isolation and identification of pathogens, as well as to test pathogen resistance to some antibiotics. On the basis of bacteriological examinations, there was confirmed the presence of Streptococcus dysgalactiae, which showed sensitivity to ampicillin, cloxacillin and augmentin, intermediate resistance to tetracycline and resistance to kotrimeksazol.(cotrimoxazole-proveriti [Projekat Ministarstva nauke Republike Srbije, br. TR 31085
Group B Streptococcus and the Vaginal Microbiota.
Rosen, Geoffrey H; Randis, Tara M; Desai, Purnahamsi V; Sapra, Katherine J; Ma, Bing; Gajer, Pawel; Humphrys, Michael S; Ravel, Jacques; Gelber, Shari E; Ratner, Adam J
2017-09-15
Streptococcus agalactiae (group B Streptococcus [GBS]) is an important neonatal pathogen and emerging cause of disease in adults. The major risk factor for neonatal disease is maternal vaginal colonization. However, little is known about the relationship between GBS and vaginal microbiota. Vaginal lavage samples from nonpregnant women were tested for GBS, and amplicon-based sequencing targeting the 16S ribosomal RNA V3-V4 region was performed. Four hundred twenty-eight of 432 samples met the high-quality read threshold. There was no relationship between GBS carriage and demographic characteristics, α-diversity, or overall vaginal microbiota community state type (CST). Within the non-Lactobacillus-dominant CST IV, GBS positive status was significantly more prevalent in CST IV-A than CST IV-B. Significant clustering by GBS status was noted on principal coordinates analysis, and 18 individual taxa were found to be significantly associated with GBS carriage by linear discriminant analysis. After adjusting for race/ethnicity, 4 taxa were positively associated with GBS, and 6 were negatively associated. Vaginal microbiota CST and α-diversity are not related to GBS status. However, specific microbial taxa are associated with colonization of this important human pathogen, highlighting a potential role for the microbiota in promotion or inhibition of GBS colonization. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.
Directory of Open Access Journals (Sweden)
Rini Pratiwi
2005-06-01
Full Text Available Prevention of dental caries and periodontal disease with health promotion has been the main goal of Dentistry, since the dental plaque is a common and predominating factor leading to loss of teeth both caused by both dental caries and periodontal disease. Most devices used for plaque removal and periodontal care are based on mechanical action, including toothbrushes, interdentally brushes and oral irrigators. Today, plaque control is facilitated by an increasing variety of active agents based on either natural ingredients or synthetic product. Alternative materials based on essential oil and plant extracts are therefore of particular interest. The aim of the present study was to investigate the different of zone inhibition of Streptococcus mutans of herbal toothpastes. Samples of the subjects were 4 types of herbal toothpastes and 1 herbal toothpaste as control. For inhibition zone trial toward Streptococcus mutans, agar diffusion method was used and the interpretation was done by measuring the widest inhibition zone. The result of the study indicated a statistical significance different on inhibition zone among the 5th toothpastes, but toothpaste containing siwak was the widest inhibition zone.
Streptococcus sinensis may react with Lancefield group F antiserum.
Woo, Patrick C Y; Teng, Jade L L; Leung, Kit-wah; Lau, Susanna K P; Tse, Herman; Wong, Beatrice H L; Yuen, Kwok-yung
2004-11-01
Lancefield group F streptococci have been found almost exclusively as members of the 'Streptococcus milleri' group, although they have been reported very occasionally in some other streptococcal species. Among 302 patients with bacteraemia caused by viridans streptococci over a 6-year period, three cases were caused by Streptococcus sinensis (type strain HKU4T, HKU5 and HKU6). All three patients had infective endocarditis complicating their underlying chronic rheumatic heart diseases. Gene sequencing showed no base differences between the 16S rRNA gene sequences of HKU5 and HKU6 and that of HKU4T. All three strains were Gram-positive, non-spore-forming cocci arranged in chains. All grew on sheep blood agar as alpha-haemolytic, grey colonies of 0.5-1 mm in diameter after 24 h incubation at 37 degrees C in ambient air. Lancefield grouping revealed that HKU5 and HKU6 were Lancefield group F, but HKU4T was non-groupable with Lancefield groups A, B, C, D, F or G antisera. HKU4T was identified by the Vitek system (GPI), API system (20 STREP) and ATB system (ID32 STREP) as 99 % Streptococcus intermedius, 51.3 % S. intermedius and 99.9 % Streptococcus anginosus, respectively. Using the same tests, HKU5 was identified as 87 % Streptococcus sanguinis/Streptococcus gordonii, 59 % Streptococcus salivarius and 99.6 % S. anginosus, respectively, and HKU6 as 87 % S. sanguinis/S. gordonii, 77 % Streptococcus pneumoniae and 98.3 % S. anginosus, respectively. The present data revealed that a proportion of Lancefield group F streptococci could be S. sinensis. Lancefield group F streptococci should not be automatically reported as 'S. milleri'.
Molecular screening for erythromycin resistance genes in ...
African Journals Online (AJOL)
Aghomotsegin
2015-07-15
Jul 15, 2015 ... in Streptococcus pyogenes isolated from Iraqi patients with tonsilo-pharyngites. Hassan .... is an automated colorimetric method used for identification of bacteria and for .... counter medicines in private pharmacies against the regulations. ... Effect of telithromycin on erythromycin resistant S. pyogenes. In this ...
Tilapia (Oreochromis sp.) are an important source of protein with an economic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...
Tilapia (Oreochromis sp.) are an important source of protein with an ecomonic value approaching US $8 billion yearly. Streptococcal disease, caused by Streptococcus iniae and S. agalactiae (both Gram positive bacteria), is an emerging or re-emerging disease negatively affecting tilapia aquaculture w...
Xu, Jia-Yi; Han, Yong-He; Chen, Yanshan; Zhu, Ling-Jia; Ma, Lena Q
2016-02-01
The ability of As-resistant endophytic bacteria in As transformation and plant growth promotion was determined. The endophytes were isolated from As-hyperaccumulator Pteris vittata (PV) after growing for 60 d in a soil containing 200 mg kg(-1) arsenate (AsV). They were isolated in presence of 10 mM AsV from PV roots, stems, and leaflets, representing 4 phyla and 17 genera. All endophytes showed at least one plant growth promoting characteristics including IAA synthesis, siderophore production and P solubilization. The root endophytes had higher P solubilization ability than the leaflet (60.0 vs. 18.3 mg L(-1)). In presence of 10 mM AsV, 6 endophytes had greater growth than the control, suggesting As-stimulated growth. Furthermore, root endophytes were more resistant to AsV while the leaflet endophytes were more tolerant to arsenite (AsIII), which corresponded to the dominant As species in PV tissues. Bacterial As resistance was positively correlated to their ability in AsV reduction but not AsIII oxidation. The roles of those endophytes in promoting plant growth and As resistance in P. vittata warrant further investigation. Published by Elsevier Ltd.
Anastasiou, Rania; Driessche, Gonzalez Van; Boutou, Effrossyni; Kazou, Maria; Alexandraki, Voula; Vorgias, Constantinos E; Devreese, Bart; Tsakalidou, Effie; Papadimitriou, Konstantinos
2015-10-20
Streptococcus macedonicus ACA-DC 198 produces the bacteriocin macedocin in milk only under low NaCl concentrations (<1.0%w/v). The thermosensitive plasmid pGh9:ISS1 was employed to generate osmotic stress resistant (osmr) mutants of S. macedonicus. Three osmr mutants showing integration of the vector in unique chromosomal sites were identified and the disrupted loci were characterized. Interestingly, the mutants were able to grow and to produce macedocin at considerably higher concentrations of NaCl compared to the wild-type (up to 4.0%w/v). The production of macedocin under hyperosmotic conditions solely by the osmr mutants was validated by the well diffusion assay and by mass spectrometry analysis. RT-PCR experiments demonstrated that the macedocin biosynthetic regulon was transcribed at high salt concentrations only in the mutants. Mutant osmr3, the most robust mutant, was converted in its markerless derivative (osmr3f). Co-culture of S. macedonicus with spores of Clostridium tyrobutyricum in milk demonstrated that only the osmr3f mutant and not the wild-type inhibited the growth of the spores under hyperosmotic conditions (i.e., 2.5%w/v NaCl) due to the production of macedocin. Our study shows how genetic manipulation of a strain towards a stress resistant phenotype could improve bacteriocin production under conditions of the same stress. Copyright © 2015 Elsevier B.V. All rights reserved.
Shoji, Tatsuma; Takaya, Akiko; Sato, Yoshiharu; Kimura, Satoshi; Suzuki, Tsutomu; Yamamoto, Tomoko
2015-10-15
Adenine at position 752 in a loop of helix 35 from positions 745 to 752 in domain II of 23S rRNA is involved in binding to the ribosome of telithromycin (TEL), a member of ketolides. Methylation of guanine at position 748 by the intrinsic methyltransferase RlmA(II) enhances binding of telithromycin (TEL) to A752 in Streptococcus pneumoniae. We have found that another intrinsic methylation of the adjacent uridine at position 747 enhances G748 methylation by RlmA(II), rendering TEL susceptibility. U747 and another nucleotide, U1939, were methylated by the dual-specific methyltransferase RlmCD encoded by SP_1029 in S. pneumoniae. Inactivation of RlmCD reduced N1-methylated level of G748 by RlmA(II) in vivo, leading to TEL resistance when the nucleotide A2058, located in domain V of 23S rRNA, was dimethylated by the dimethyltransferase Erm(B). In vitro methylation of rRNA showed that RlmA(II) activity was significantly enhanced by RlmCD-mediated pre-methylation of 23S rRNA. These results suggest that RlmCD-mediated U747 methylation promotes efficient G748 methylation by RlmA(II), thereby facilitating TEL binding to the ribosome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Multiple lung abscesses caused by Streptococcus constellatus
Directory of Open Access Journals (Sweden)
Vanina Rognoni
2018-02-01
Full Text Available Despite numerous descriptions of body abscesses produced by Streptococcus milleri group bacteria, lung abscesses caused by this group remain under-reported and the clinical and laboratory features have yet to be fully characterised. We present the case of a patient admitted with lung multiple abscesses produced by Streptococcus constellatus.
Group A Streptococcus vulvovaginitis in breastfeeding women.
Rahangdale, Lisa; Lacy, Judith; Hillard, Paula A
2008-08-01
Group A beta-hemolytic streptococcus-associated vulvovaginitis is uncommon in adult women. Clinicians should include group A beta-hemolytic streptococcus as a possible cause of vulvovaginal symptoms in breastfeeding women. Along with appropriate antibiotic therapy, vaginal estrogen therapy may be considered to diminish susceptibility to recurrent infection in women with vaginal atrophy.
Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis
2017-04-01
A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.
DEFF Research Database (Denmark)
Rasmussen, Louise H.; Iversen, Katrine Højholt; Dargis, Rimtas
2017-01-01
Streptococcus oralis and Streptococcus mitis belong to the Mitis group, which are mostly commensals in the human oral cavity. Even though S. oralis and S. mitis are oral commensals, they can be opportunistic pathogens causing infective endocarditis. A recent taxonomic re-evaluation of the Mitis...
Adhesion of streptococcus rattus and streptococcus mutans to metal surfaces
International Nuclear Information System (INIS)
Branting, C.; Linder, L.E.; Sund, M.-L.; Oden, A.; Wiatr-Adamczak, E.
1988-01-01
The adhesion of Streptococcus rattus BHT and Streptococcus mutans IB to metal specimens of amalgam, silver, tin and copper was studied using (6- 3 H) thymidine labeled cells. In the standard assay the metal specimens were suspended by a nylon thread in an adhesion solution containing a chemically defined bacterial growth medium (FMC), sucrose, and radiolabeled bacteria. Maximum amounts of adhering bacteria were obtained after about 100 min of incubation. Saturation of the metal specimens with bacteria was not observed. Both strains also adhered in the absence of sucrose, indicating that glucan formation was not necessary for adhesion. However, in the presence of glucose, adhesion was only 26-45% of that observed in the presence of equimolar sucrose. Sucrose-dependent stimulation of adhesion seemed to be due to increased cell-to-cell adhesion capacity. Isolated radiolabeled water-insoluble and water-soluble polysaccharides produced from sucrose by S. rattus BHT were not adsorbed to the metal surfaces. (author)
Adhesion of streptococcus rattus and streptococcus mutans to metal surfaces
Energy Technology Data Exchange (ETDEWEB)
Branting, C.; Linder, L.E.; Sund, M.-L.; Oden, A.; Wiatr-Adamczak, E.
1988-01-01
The adhesion of Streptococcus rattus BHT and Streptococcus mutans IB to metal specimens of amalgam, silver, tin and copper was studied using (6-/sup 3/H) thymidine labeled cells. In the standard assay the metal specimens were suspended by a nylon thread in an adhesion solution containing a chemically defined bacterial growth medium (FMC), sucrose, and radiolabeled bacteria. Maximum amounts of adhering bacteria were obtained after about 100 min of incubation. Saturation of the metal specimens with bacteria was not observed. Both strains also adhered in the absence of sucrose, indicating that glucan formation was not necessary for adhesion. However, in the presence of glucose, adhesion was only 26-45% of that observed in the presence of equimolar sucrose. Sucrose-dependent stimulation of adhesion seemed to be due to increased cell-to-cell adhesion capacity. Isolated radiolabeled water-insoluble and water-soluble polysaccharides produced from sucrose by S. rattus BHT were not adsorbed to the metal surfaces.
Can Clays in Livestock Feed Promote Antibiotic Resistance and Virulence in Pathogenic Bacteria?
Directory of Open Access Journals (Sweden)
Alexandro Rodríguez-Rojas
2015-07-01
Full Text Available The use of antibiotics in animal husbandry has long been associated with the appearance of antibiotic resistance and virulence factor determinants. Nonetheless, the number of cases of human infection involving resistant or virulent microorganisms that originate in farms is increasing. While many antibiotics have been banned as dietary supplements in some countries, other additives thought to be innocuous in terms of the development and spread of antibiotic resistance are used as growth promoters. In fact, several clay materials are routinely added to animal feed with the aim of improving growth and animal product quality. However, recent findings suggest that sepiolite, a clay additive, mediates the direct transfer of plasmids between different bacterial species. We therefore hypothesize that clays present in animal feed facilitate the horizontal transfer of resistance determinants in the digestive tract of farm animals.
Hwang, In Yeong; Ku, Hyun Ok; Lim, Suk Kyung; Park, Choi Kyu; Jung, Gab Su; Jung, Suk Chan; Nam, Hyang Mi
2009-11-01
A total of 147 Enterococcus faecium and 165 Enterococcus faecalis isolates from fecal samples of chickens and pigs at slaughterhouses in Korea were tested for their resistance to 8 growth-promoting antimicrobials commonly used in animals and quinupristin and dalfopristin. Resistance to most antimicrobials was very common among both E. faecalis and E. faecium. In particular, E. faecalis showed almost no susceptibility to all the antimicrobials tested except penicillin and flavomycin, to which 1.4% and less than 24% showed resistance, respectively. Although the prevalence of resistance was lower than in E. faecalis, E. faecium showed relatively uniform resistance to all the agents tested. Among the antimicrobials tested, virginiamycin and penicillin were the most effective against E. faecium isolates: less than 31% and 41% showed resistance to those 2 antimicrobials, respectively. Penicillin was the only agent that showed relatively strong activity against both E. faecalis and E. faecium. Resistance observed in E. faecalis and E. faecium against most antimicrobials used for growth promotion was more prevalent in Korea than in European countries. The current study is the first report of resistance against feed additive antimicrobials in enterococcal isolates from livestock in Korea.
Ge, Rui; Liu, Lin; Dai, Wei; Zhang, Weigang; Yang, Yuqi; Wang, Huina; Shi, Qiong; Guo, Sen; Yi, Xiuli; Wang, Gang; Gao, Tianwen; Luan, Qi; Li, Chunying
2016-06-01
Xeroderma pigmentosum group A (XPA), a key protein in the nucleotide excision repair pathway, has been shown to promote the resistance of tumor cells to chemotherapeutic drugs by facilitating the DNA repair process. However, the role of XPA in the resistance of melanoma to platinum-based drugs like cisplatin is largely unknown. In this study, we initially found that XPA was expressed at higher levels in cisplatin-resistant melanoma cells than in cisplatin-sensitive ones. Furthermore, the knockdown of XPA not only increased cellular apoptosis but also inhibited cisplatin-induced autophagy, which rendered the melanoma cells more sensitive to cisplatin. Moreover, we discovered that the increased XPA in resistant melanoma cells promoted poly(adenosine diphosphate-ribose) polymerase 1 (PARP1) activation and that the inhibition of PARP1 could attenuate the cisplatin-induced autophagy. Finally, we proved that the inhibition of PARP1 and the autophagy process made resistant melanoma cells more susceptible to cisplatin treatment. Our study shows that XPA can promote cell-protective autophagy in a DNA repair-independent manner by enhancing the activation of PARP1 in melanoma cells resistant to cisplatin and that the XPA-PARP1-mediated autophagy process can be targeted to overcome cisplatin resistance in melanoma chemotherapy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Junjua, M.; Galia, W.; Gaci, N.; Uriot, O.; Genay, M.; Bachmann, H.; Kleerebezem, M.; Dary, A.; Roussel, Y.
2014-01-01
Aims
To construct and validate the recombinase-based in vivo expression technology (R-IVET) tool in Streptococcus thermophilus (ST).
Methods and Results
The R-IVET system we constructed in the LMD-9 strain includes the plasmid pULNcreB allowing transcriptional fusion
International Nuclear Information System (INIS)
Xu, Hanwen; Pirisi, Lucia; Creek, Kim E.
2015-01-01
Previous studies in our laboratory discovered that SIX1 mRNA expression increased during in vitro progression of HPV16-immortalized human keratinocytes (HKc/HPV16) toward a differentiation-resistant (HKc/DR) phenotype. In this study, we explored the role of Six1 at early stages of HPV16-mediated transformation by overexpressing Six1 in HKc/HPV16. We found that Six1 overexpression in HKc/HPV16 increased cell proliferation and promoted cell migration and invasion by inducing epithelial–mesenchymal transition (EMT). Moreover, the overexpression of Six1 in HKc/HPV16 resulted in resistance to serum and calcium-induced differentiation, which is the hallmark of the HKc/DR phenotype. Activation of MAPK in HKc/HPV16 overexpressing Six1 is linked to resistance to calcium-induced differentiation. In conclusion, this study determined that Six1 overexpression resulted in differentiation resistance and promoted EMT at early stages of HPV16-mediated transformation of human keratinocytes. - Highlights: • Six1 expression increases during HPV16-mediated transformation. • Six1 overexpression causes differentiation resistance in HPV16-immortalized cells. • Six1 overexpression in HPV16-immortalized keratinocytes activates MAPK. • Activation of MAPK promotes EMT and differentiation resistance. • Six1 overexpression reduces Smad-dependent TGF-β signaling
Directory of Open Access Journals (Sweden)
Clara Inés Agudelo
2009-04-01
Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic
Sox2 Is an Androgen Receptor-Repressed Gene That Promotes Castration-Resistant Prostate Cancer
Kregel, Steven; Kiriluk, Kyle J.; Rosen, Alex M.; Cai, Yi; Reyes, Edwin E.; Otto, Kristen B.; Tom, Westin; Paner, Gladell P.; Szmulewitz, Russell Z.; Vander Griend, Donald J.
2013-01-01
Despite advances in detection and therapy, castration-resistant prostate cancer continues to be a major clinical problem. The aberrant activity of stem cell pathways, and their regulation by the Androgen Receptor (AR), has the potential to provide insight into novel mechanisms and pathways to prevent and treat advanced, castrate-resistant prostate cancers. To this end, we investigated the role of the embryonic stem cell regulator Sox2 [SRY (sex determining region Y)-box 2] in normal and malignant prostate epithelial cells. In the normal prostate, Sox2 is expressed in a portion of basal epithelial cells. Prostate tumors were either Sox2-positive or Sox2-negative, with the percentage of Sox2-positive tumors increasing with Gleason Score and metastases. In the castration-resistant prostate cancer cell line CWR-R1, endogenous expression of Sox2 was repressed by AR signaling, and AR chromatin-IP shows that AR binds the enhancer element within the Sox2 promoter. Likewise, in normal prostate epithelial cells and human embryonic stem cells, increased AR signaling also decreases Sox2 expression. Resistance to the anti-androgen MDV3100 results in a marked increase in Sox2 expression within three prostate cancer cell lines, and in the castration-sensitive LAPC-4 prostate cancer cell line ectopic expression of Sox2 was sufficient to promote castration-resistant tumor formation. Loss of Sox2 expression in the castration-resistant CWR-R1 prostate cancer cell line inhibited cell growth. Up-regulation of Sox2 was not associated with increased CD133 expression but was associated with increased FGF5 (Fibroblast Growth Factor 5) expression. These data propose a model of elevated Sox2 expression due to loss of AR-mediated repression during castration, and consequent castration-resistance via mechanisms not involving induction of canonical embryonic stem cell pathways. PMID:23326489
High dietary zinc feeding promotes persistence of multi-resistant E. coli in the swine gut.
Ciesinski, Lisa; Guenther, Sebastian; Pieper, Robert; Kalisch, Martin; Bednorz, Carmen; Wieler, Lothar H
2018-01-01
High levels of zinc oxide are used frequently as feed additive in pigs to improve gut health and growth performance and are still suggested as an alternative to antimicrobial growth promoters. However, we have recently described an increase of multi-resistant E. coli in association to zinc feeding in piglets. This previous study focused on clonal diversity of E. coli, observing the effect on multi-resistant strains by chance. To shed further light into this highly important topic and falsify our previous findings, we performed a zinc pig feeding trial where we specifically focused on in-depth analysis of antimicrobial resistant E. coli. Under controlled experimental conditions, piglets were randomly allocated to a high dietary zinc (zinc group) and a background zinc feeding group (control group). At different ages samples were taken from feces, digesta, and mucosa and absolute E. coli numbers were determined. A total of 2665 E. coli isolates were than phenotypically tested for antimicrobial resistance and results were confirmed by minimum inhibitory concentration testing for random samples. In piglets fed with high dietary zinc, we detected a substantial increase of multi-resistant E. coli in all gut habitats tested, ranging from 28.9-30.2% multi-resistant E. coli compared to 5.8-14.0% in the control group. This increase was independent of the total number of E. coli. Interestingly, the total amount of the E. coli population decreased over time. Thus, the increase of the multi-resistant E. coli populations seems to be linked with persistence of the resistant population, caused by the influence of high dietary zinc feeding. In conclusion, these findings corroborate our previous report linking high dietary zinc feeding of piglets with the occurrence of antimicrobial resistant E. coli and therefore question the feeding of high dietary zinc oxide as alternative to antimicrobial growth promoters.
Directory of Open Access Journals (Sweden)
Franciane Rios Senger
2016-01-01
Full Text Available ABSTRACT: Background and Objectives: Streptococcus agalactiae (GBS is part of the female genital tract microbiota, however, its clinical significance is related to infections in newborns and can cause severe cases of pneumonia, septicemia and meningitis. Thus, the aim of this study is to determine the prevalence of colonization by S. agalactiae in pregnant women and analyze the sensitivity profile of the isolated front of antimicrobials. Methods: Vaginal and anorectal samples of pregnant women over 30 weeks of gestation were collected from February to June 2013. The samples were stored in Stuart transport medium and then inoculated in Todd-Hewitt broth added gentamicin and acid nalidixic with subsequent subculture on blood agar plates. For identification were performed Gram test, catalase, CAMP and latex agglutination. Furthermore, the antimicrobial susceptibility tests and the test for the detection of resistance induced clindamycin in the samples resistant to erythromycin were conducted. They are also assessed, through interviews, demographic, socioeconomic and clinical and obstetric data. Results: It was observed colonization in 22.5% (18/80 of the pregnant women. The strains were sensitive to most of the antibiotics tested except erythromycin, showing a resistance of 22.2% (4/18 isolates. However, none of the samples erythromycin resistant had induced resistance to clindamycin. Conclusion: The high maternal colonization by S. agalactiae found emphasize the importance of isolation of this bacterium in late pregnancy, preventing the occurrence of neonatal infection. KEYWORDS: Streptococcus agalactiae. Pregnancy. Prevalence.
Caldelari, I.; Loeliger, B.; Langen, H.; Glauser, M. P.; Moreillon, P.
2000-01-01
Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log10 CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost ≤2 log10 CFU/ml/24 h. The mutants had unchanged penicillin-binding proteins but contained increased amounts of two proteins ...
Howard, Leigh; Edwards, Kathryn; Griffin, Marie; Gil, Ana; Minaya, Gina; Mercado, Erik; Ochoa, Theresa; Lanata, Claudio; Grijalva, Carlos G
2017-01-01
Abstract Background Despite widespread use of pneumococcal conjugate vaccines (PCVs), Streptococcus pneumoniae (pneumococcus) remains an important cause of pneumonia. Prior to widespread PCV use, we found a high prevalence of nasopharyngeal (NP) colonization with pneumococcus resistant to multiple antibiotic classes among young children in the rural highlands of Peru. We sought to confirm contemporary resistance profiles among young children, their mothers, and animal contacts in the post-PCV era. Methods We enrolled eligible members of Peruvian households whose children had participated in our previous study. Mothers were questioned about antibiotic use for themselves and their children age <3 years. NP samples were collected from children, mothers, and their animal contacts including cows, guinea pigs, and dogs, when available. Samples were cultured for pneumococcus using standard methods and routine disk antibiotic susceptibility testing was performed. Drinking water and milk samples were tested, when available, for the presence of β-lactam and tetracycline residues (IDEXX Β-Tetra testing kit; Westbrook, ME). Results Members of 47 households were enrolled, including 50 children and 47 mothers (3 sibling pairs). The median (IQR) age of children was 1.2 years (0.6-2.2) and number of household members was 5 (4-6). Sixteen of 50 (32%) children and 7/47 (15%) mothers had received antibiotics in the prior 6 months (Fig 1). Pneumococcus was detected in 31/50 (62%) children, 9/47 (19%) mothers, and 1/31 (3%) guinea pigs. Pneumococci were not detected in dogs (n = 29) or cows (n = 7). Resistance to multiple classes of antibiotics, including TMP-SMX, tetracyclines, and β-lactams, was common among children and adults (Fig 2). No antibiotic residues were detected in water (n = 41) or milk (n = 7) samples. Conclusion Pneumococcal colonization was common among young children, less prevalent among adults, and rare among animals. Resistance to macrolides and
Streptococcus oriloxodontae sp. nov., isolated from the oral cavities of elephants.
Shinozaki-Kuwahara, Noriko; Saito, Masanori; Hirasawa, Masatomo; Takada, Kazuko
2014-11-01
Two strains were isolated from oral cavity samples of healthy elephants. The isolates were Gram-positive, catalase-negative, coccus-shaped organisms that were tentatively identified as a streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequence analysis suggested classification of these organisms in the genus Streptococcus with Streptococcus criceti ATCC 19642(T) and Streptococcus orisuis NUM 1001(T) as their closest phylogenetic neighbours with 98.2 and 96.9% gene sequence similarity, respectively. When multi-locus sequence analysis using four housekeeping genes, groEL, rpoB, gyrB and sodA, was carried out, similarity of concatenated sequences of the four housekeeping genes from the new isolates and Streptococcus mutans was 89.7%. DNA-DNA hybridization experiments suggested that the new isolates were distinct from S. criceti and other species of the genus Streptococcus. On the basis of genotypic and phenotypic differences, it is proposed that the novel isolates are classified in the genus Streptococcus as representatives of Streptococcus oriloxodontae sp. nov. The type strain of S. oriloxodontae is NUM 2101(T) ( =JCM 19285(T) =DSM 27377(T)). © 2014 IUMS.
Streptococcus caprae sp. nov., isolated from Iberian ibex (Capra pyrenaica hispanica).
Vela, A I; Mentaberre, G; Lavín, S; Domínguez, L; Fernández-Garayzábal, J F
2016-01-01
Biochemical and molecular genetic studies were performed on a novel Gram-stain-positive, catalase-negative, coccus-shaped organism isolated from tonsil samples of two Iberian ibexes. The micro-organism was identified as a streptococcal species based on its cellular, morphological and biochemical characteristics. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus, but the organism did not correspond to any species of this genus. The nearest phylogenetic relative of the unknown coccus from ibex was Streptococcus porci 2923-03T (96.6 % 16S rRNA gene sequence similarity). Analysis based on rpoB and sodA gene sequences revealed sequence similarity values lower than 86.0 and 83.8 %, respectively, from the type strains of recognized Streptococcus species. The novel bacterial isolate was distinguished from Streptococcus porci and other Streptococcus species using biochemical tests. Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as representing a novel species of the genus Streptococcus, for which the name Streptococcus caprae sp. nov. is proposed. The type strain is DICM07-02790-1CT ( = CECT 8872T = CCUG 67170T).
Rhamnolipids production by multi-metal-resistant and plant-growth-promoting rhizobacteria.
Singh, Anil Kumar; Cameotra, Swaranjit Singh
2013-07-01
The biosurfactant-producing Pseudomonas aeruginosa A11, with plant-growth-promoting (PGP) and multi-metal-resistant (MMR) features was isolated from the rhizosphere of a wild plant Parthenium hysterophorus. The strain A11 was able to utilize glycerol as a carbon source and produce 4,436.9 mg/L of biosurfactant after 120 h of incubation. The biosurfactants was characterized as rhamnolipids (RLs) by thin layer chromatography, Fourier transform infrared spectroscopy, nuclear magnetic resonance, and liquid chromatography-mass spectrometry analysis. Eight different RLs congeners were detected with RhaRhaC₁₀C₁₀ being most abundant. The purified rhamnolipid, dirhamnolipid, and monorhamnolipid reduced the surface tension of water to 29, 36, and 42 mN/m with critical micelle concentration of 83, 125, and 150 mg/L, respectively. The strain A11 demonstrated resistance against all the metals detected in rhizosphere except Hg and Ni. The strain A11 also possessed plant-growth-promoting features like siderophores, hydrogen cyanide, catalase, ammonia production, and phosphate solubilization. The dirhamnolipids formed crystals upon incubation at 4 °C, thus making separation of dirhamnolipids easy. Biosurfactant-producing ability along with MMR and PGP traits of the strain A11 makes it a potential candidate for application in the bacterial assisted enhancement of phytoremediation of heavy-metal-contaminated sites.
Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...
African Journals Online (AJOL)
Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...
CcpA and CodY Coordinate Acetate Metabolism in Streptococcus mutans.
Kim, Jeong Nam; Burne, Robert A
2017-04-01
In the dental caries pathogen Streptococcus mutans , phosphotransacetylase (Pta) and acetate kinase (Ack) convert pyruvate into acetate with the concomitant generation of ATP. The genes for this pathway are tightly regulated by multiple environmental and intracellular inputs, but the basis for differential expression of the genes for Pta and Ack in S. mutans had not been investigated. Here, we show that inactivation in S. mutans of ccpA or codY reduced the activity of the ackA promoter, whereas a ccpA mutant displayed elevated pta promoter activity. The interactions of CcpA with the promoter regions of both genes were observed using electrophoretic mobility shift and DNase protection assays. CodY bound to the ackA promoter region but only in the presence of branched-chain amino acids (BCAAs). DNase footprinting revealed that the upstream region of both genes contains two catabolite-responsive elements ( cre1 and cre2 ) that can be bound by CcpA. Notably, the cre2 site of ackA overlaps with a CodY-binding site. The CcpA- and CodY-binding sites in the promoter region of both genes were further defined by site-directed mutagenesis. Some differences between the reported consensus CodY binding site and the region protected by S. mutans CodY were noted. Transcription of the pta and ackA genes in the ccpA mutant strain was markedly different at low pH relative to transcription at neutral pH. Thus, CcpA and CodY are direct regulators of transcription of ackA and pta in S. mutans that optimize acetate metabolism in response to carbohydrate, amino acid availability, and environmental pH. IMPORTANCE The human dental caries pathogen Streptococcus mutans is remarkably adept at coping with extended periods of carbohydrate limitation during fasting periods. The phosphotransacetylase-acetate kinase (Pta-Ack) pathway in S. mutans modulates carbohydrate flux and fine-tunes the ability of the organisms to cope with stressors that are commonly encountered in the oral cavity. Here, we
Endocarditis caused by Streptococcus canis: an emerging zoonosis?
Lacave, Guillaume; Coutard, Aymeric; Troché, Gilles; Augusto, Sandrine; Pons, Stéphanie; Zuber, Benjamin; Laurent, Virginie; Amara, Marlène; Couzon, Brigitte; Bédos, Jean-Pierre; Pangon, Béatrice; Grimaldi, David
2016-02-01
We report a human case of infective endocarditis caused by Streptococcus canis. Identification was carried out from positive blood culture using mass spectrometry and SodA gene sequencing. S. canis related zoonotic invasive infections may have been previously underdiagnosed due to inadequate identification of group G Streptococcus species.
Transcriptional Analysis of the bgIP Gene from Streptococcus mutans
2006-04-21
bglP gene from Streptococcus mutans Christopher K Cote1,2 and Allen L Honeyman*1,3 Address: 1Department of Medical Microbiology and Immunology... Streptococcus mutans . A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately...longisporum [3], Lactobacillus plantarium [4], Bacillus subtilis [5,6], and Streptococcus mutans [7]. All of these organisms rely on the phosphoe
International Nuclear Information System (INIS)
Syed Qaiser Shah; Mohammad Rafiullah Khan
2011-01-01
Gatifloxacin (GTN) was derivatized to its dithiocarbamate derivative and its radiolabeling with technetium-99m ( 99m Tc) using the [ 99m Tc≡N] 2+ core was investigated. The appropriateness of the 99m TcN - gatifloxacin dithiocarbamate ( 99m TcN - GTND) complex as a potential multi-drug-resistance Streptococcus pneumoniae (MRSP) infection radiotracer was evaluated in terms of stability in saline, serum, in vitro binding with MRSP and biodistribution in artificially MRSP infected Male Wistar Rats (MWR). In saline the 99m TcN - GTND complex showed more than 90% labeling yield up to 4 h with a maximum yield of 98.25 ± 0.20%, after reconstitution. In serum the 99m TcN - GTND complex showed stability up to 16 h of incubation with the appearance of insignificant 15.95% undesirable side products. The 99m TcN - GTND complex demonstrated saturated in vitro binding with MRSP with a maximum value of 75.50 ± 1.00% (at 90 min). In MWR model of group A, almost six times higher uptake of the labeled GTND was monitored in the muscle of MWR infected with live MRSP as compared to the inflamed and normal muscles. Based on the higher labeling yield in saline, in vitro stability in serum, saturated in vitro binding with live MRSP and promising biodistribution in MWR model we recommend 99m TcN - gatifloxacin dithiocarbamate complex as a potential MRSP infection radiotracer. (author)
Human milk oligosaccharides inhibit growth of group B Streptococcus
Lin, Ann E; Autran, Chloe A; Szyszka, Alexandra; Escajadillo, Tamara; Huang, Mia; Godula, Kamil; Prudden, Anthony R; Boons, Geert-Jan; Lewis, Amanda L; Doran, Kelly S; Nizet, Victor; Bode, Lars
2017-01-01
Streptococcus agalactiae (group B Streptococcus, GBS) is a leading cause of invasive bacterial infections in newborns, typically acquired vertically during childbirth secondary to maternal vaginal colonization. Human milk oligosaccharides (HMOs) have important nutritional and biological activities
[Streptococcus suis infection--clinical manifestations].
Dragojlović, Julijana; Milosević, Branko; Sasić, Neda; Pelemis, Mijomir; Sasić, Milan
2005-01-01
Streptococcus suis is a bacterium causing a disease in pigs and rarely in humans. This zoonosis is mostly found as a sporadic disease in individuals that were in contact with the affected or infected pigs: farmers, veterinarians and workers engaged in fresh pork processing. It is assumed that the bacterium enters the body through a cut abrasion in the skin. Initially, the condition resembles a flu, followed by signs of bacteriemia and sepsis. The most frequent clinical manifestation of Streptococcus suis infection is meningitis, leading to hearing loss in over 75% of patients, and subsequent arthritis, endophtalmitis, endocarditis and pneumonia. Toxic shock syndrome with hemorhagic manifestations rarely develops. This study included five male patients aged 22 to 63 years treated in the Intensive Care Unit of the Institute of Infectious and Tropical Diseases in Belgrade, due to Streptococcus suis infection. The aim of this study was to point to the existence of this bacteria in our environment, to describe clinical manifestations of the disease and to point out the importance of its prevention. All patients had epidemiological evidence of being in contact with pork meat. There were no data about diseased pigs. The estimated incubation period was 4 to 8 days. All patients had meningeal signs. Clinical symptoms included shivering, fever, vomiting, headache, malaise, vertigo and tinitus. Three patients presented with alerterd level of awarrness. Four patients developed very severe bilateral hearing impairment, whereas one endophtalmtis and one developed endocarditis. The cerebrospinal fluid (CSF) was opalescent in four patients, and only one patient presented with clear CSF. CSF examination showed typical changes characteristic for bacterial meningitis. Streptoccocus suis was isolated in CSF in all patients, and in one patient the bacteria was isolated in blood as well. All patients underwent treatement with II and III generation cephalosporins and one with one
Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae
International Nuclear Information System (INIS)
Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang
2013-01-01
DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%
Capsular Polysaccharide Expression in Commensal Streptococcus Species
DEFF Research Database (Denmark)
Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong
2016-01-01
Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...
Liu, Jia; Zhang, Jianying; Guo, Lihong; Zhao, Wei; Hu, Xiaoli; Wei, Xi
2017-07-01
Efflux pumps are a mechanism associated with biofilm formation and resistance. There is limited information regarding efflux pumps in Streptococcus mutans, a major pathogen in dental caries. The aim of this study was to investigate potential roles of a putative efflux pump (LmrB) in S. mutans biofilm formation and susceptibility. Upon lmrB inactivation and antimicrobial exposure, the biofilm structure and expression of other efflux pumps were examined using confocal laser scanning microscopy (CLSM) and qRT-PCR. lmrB inactivation resulted in biofilm structural changes, increased EPS formation and EPS-related gene transcription (p < 0.05), but no improvement in susceptibility was observed. The expression of most efflux pump genes increased upon lmrB inactivation when exposed to antimicrobials (p < 0.05), suggesting a feedback mechanism that activated the transcription of other efflux pumps to compensate for the loss of lmrB. These observations imply that sole inactivation of lmrB is not an effective solution to control biofilms.
Aciduricity and acid tolerance mechanisms of Streptococcus anginosus.
Sasaki, Minoru; Kodama, Yoshitoyo; Shimoyama, Yu; Ishikawa, Taichi; Kimura, Shigenobu
2018-04-17
Although Streptococcus anginosus constitutes a proportion of the normal flora of the gastrointestinal and genital tracts, and the oral cavity, it has been reported that S. anginosus infection could be closely associated with abscesses at various body sites, infective endocarditis, and upper gastrointestinal cancers. The colonization in an acidic environment due to the aciduricity of S. anginosus could be the etiology of the systemic infection of the bacteria. To elucidate the aciduricity and acid tolerance mechanisms of the microbe, we examined the viability and growth of S. anginosus under acidic conditions. The viabilities of S. anginosus NCTC 10713 and Streptococcus mutans ATCC 25175 at pH 4.0 showed as being markedly higher than those of Streptococcus sanguinis ATCC 10556, Streptococcus gordonii ATCC 10558, and Streptococcus mitis ATCC 49456; however, the viability was partially inhibited by dicyclohexylcarbodiimide, an H + -ATPase inhibitor, suggesting that H + -ATPase could play a role in the viability of S. anginosus under acidic conditions. In addition, S. anginosus NCTC 10713 could grow at pH 5.0 and showed a marked arginine deiminase (ADI) activity, unlike its ΔarcA mutant, deficient in the gene encoding ADI, and other streptococcal species, which indicated that ADI could also be associated with aciduricity. These results suggest that S. anginosus has significant aciduric properties, which can be attributed to these enzyme activities.
Streptococcus pyogenes pharyngeal colonization resulting in recurrent, prepubertal vulvovaginitis.
Hansen, Megan T; Sanchez, Veronica T; Eyster, Kathleen; Hansen, Keith A
2007-10-01
Recurrent, prepubertal, vaginal infections are an uncommon, troublesome problem for the patient and her family. Failure of initial therapy to alleviate vulvovaginitis may be related to vulvar skin disease, foreign body, sexual abuse, pinworms, reactions to medications, anatomic anomalies, or allergies. This report describes a case of recurrent Streptococcus pyogenes vulvovaginitis secondary to presumed vaginal re-inoculation from pharyngeal colonization. A 4-yr-old presented with one year of culture proven, recurrent Streptococcus pyogenes vulvovaginitis. Her symptoms repeatedly resolved with penicillin therapy, but continued to recur following cessation of antibiotic therapy. Evaluation included physical examination, trans-abdominal pelvic ultrasound, and vaginoscopy which all revealed normal upper and lower genital tract anatomy. Both the patient and her mother demonstrated culture proven, Group A Streptococcus pharyngeal colonization. Because of the possibility of repeated inoculations of the vaginal area from the colonized pharynx, they were both treated for decolonization with a regimen of amoxicillin and rifampin for ten days. Following this therapy there was resolution of vaginal symptoms with no further recurrence. Follow-up pharyngeal culture done on both mother and child on their last visit were negative for Group A Streptococcus. This case demonstrated an unusual specific cause of recurrent vaginitis resulting from presumed self or maternal re-inoculation with group A beta-hemolytic streptococcus from pharyngeal colonization. Group A beta-hemolytic streptococcus are consistently sensitive to penicillin, but up to 25% of acute pharyngitis cases treated with penicillin having continued asymptomatic, bacterial carriage within the nasopharynx. Thus initial alleviation of symptoms in a patient with Group A beta-hemolytic vulvovaginitis treated with penicillin, can have continued asymptomatic pharyngeal colonization which can result in recurrence of the
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Czech Academy of Sciences Publication Activity Database
Hussain, H.; Branny, Pavel; Allan, E.
2006-01-01
Roč. 188, č. 4 (2006), s. 1628-1632 ISSN 0021-9193 Institutional research plan: CEZ:AV0Z50200510 Keywords : streptococcus mutans * stpk * pathogenesis Subject RIV: EE - Microbiology, Virology Impact factor: 3.993, year: 2006
Hernández-Serrano, Olga; Griffin, Kenneth W; García-Fernández, José Manuel; Orgilés, Mireia; Espada, José P
2013-01-01
The objective of the present study was to examine the contribution of three intervention components (public commitment, resistance to advertising, and leisure promotion) on alcohol and protective variables in a school-based substance use prevention program. Participants included 480 Spanish students aged from 14 to 16 who received the Saluda prevention program in one of the following five experimental conditions: complete program, program minus public commitment, program minus resistance to advertising, program minus leisure promotion, and a waiting-list control. The students completed self-report surveys at pretest, posttest, and 6-month follow-up assessments. When excluding the healthy leisure promotion component, the Saluda program showed no loss of efficacy neither on alcohol use nor on other substance-related variables, while public commitment and resistance to advertising improved the aforementioned program's efficacy.
Kim, M A; Labushkina, A V; Simovanian, E N; Kharseeva, G G
2015-11-01
The Rostovskii state medical university of Minzdrav of Russia, 344022 Rostov-on-Don, Russia The analysis is applied concerning significance of laboratory techniques of verification of streptococcus infection (bacteriological analysis, detection of anti-streptolysin O in pair serums) in 148 patients with infectious mononucleosis aged from 3 to 15 years. The content of anti-streptolysin O exceeded standard in 41 ± 4.8% of patients with concomitant in acute period and in 49.5 ± 4.9% during period of re-convalescence. This data differed from analogous indicator in patients with negative result of examination on streptococcus infection independently of period of disease (9.3 ± 2.8%). The exceeding of standard of anti-streptolysin O was detected more frequently (t ≥ 2, P ≥ 95%) in patients with isolation of Streptococcus pyogenes (56.9 ± 5.8%) than in patients with Streptococcus viridans (31.2 ± 6.5%). The concentration of anti-streptolysin 0 in patients with concomitant streptococcus infection varied within limits 200-1800 IE/ml. The minimal level of anti-streptolysin O (C = 200 IE/mI) was detected independently of type of isolated Streptococcus and period of disease. The high levels of anti-streptolysin O were observed exclusively in patients with isolation of Streptococcus pyogenes. In blood serum ofpatient with concomitant streptococcus infection (Streptococcus pyogenes + Streptococcus viridans) increasing of level of anti-streptolysin O was detected in dynamics of diseases from minimal (C = 200 IE/ ml) to moderately high (200 mononucleosis the anamnesis data is to be considered. The complex bacteriological and serological examination ofpatients is to be implemented This is necessary for early detection ofpatients with streptococcus infection and decreasing risk of formation of streptococcus carrier state.
Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Lei Jiao
2016-01-01
Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.
Nomoto, R; Maruyama, F; Ishida, S; Tohya, M; Sekizaki, T; Osawa, Ro
2015-02-01
In order to clarify the taxonomic position of serotypes 20, 22 and 26 of Streptococcus suis, biochemical and molecular genetic studies were performed on isolates (SUT-7, SUT-286(T), SUT-319, SUT-328 and SUT-380) reacted with specific antisera of serotypes 20, 22 or 26 from the saliva of healthy pigs as well as reference strains of serotypes 20, 22 and 26. Comparative recN gene sequencing showed high genetic relatedness among our isolates, but marked differences from the type strain S. suis NCTC 10234(T), i.e. 74.8-75.7 % sequence similarity. The genomic relatedness between the isolates and other strains of species of the genus Streptococcus, including S. suis, was calculated using the average nucleotide identity values of whole genome sequences, which indicated that serotypes 20, 22 and 26 should be removed taxonomically from S. suis and treated as a novel genomic species. Comparative sequence analysis revealed 99.0-100 % sequence similarities for the 16S rRNA genes between the reference strains of serotypes 20, 22 and 26, and our isolates. Isolate STU-286(T) had relatively high 16S rRNA gene sequence similarity with S. suis NCTC 10234(T) (98.8 %). SUT-286(T) could be distinguished from S. suis and other closely related species of the genus Streptococcus using biochemical tests. Due to its phylogenetic and phenotypic similarities to S. suis we propose naming the novel species Streptococcus parasuis sp. nov., with SUT-286(T) ( = JCM 30273(T) = DSM 29126(T)) as the type strain. © 2015 IUMS.
Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.
Sánchez, A; Robaina, R; Pérez, G; Cairoli, E
2016-04-01
Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.
Swinkels, J.M.; Rooijendijk, J.G.A.; Zadoks, R.N.; Hogeveen, H.
2005-01-01
The economic effect of lactational antibiotic treatment of chronic subclinical intramammary infections due to Streptococcus uberis or Streptococcus dysgalactiae was explored by means of partial budgeting. Effects at cow level and herd level were modelled, including prevention of clinical mastitis
Directory of Open Access Journals (Sweden)
Alireza Zakeri
2017-12-01
Full Text Available Hyaluronic acid (HA is a high molecular weight linear polysaccharide, endowed with unique physiological and biological properties. Given its unique properties, HA have unprecedented applications in the fields of medicine and cosmetics. The ever growing demand for HA production is the driving force behind the need for finding and developing novel and amenable sources of the HA producers. Microbial fermentation of Streptococcus zooepidemicus deemed as one the most expeditious and pervasive methods of HA production. Herein, a wild type Streptococcus zooepidemicus, intrinsically expressing high levels of HA, was selected and optimized for HA production. HasA gene was amplified and introduced into the wild type Streptococcus zooepidemicus, under the control of Nisin promoter. The HasA over-expression increased the HA production, while the molecular weight was decreased. In order to compensate for molecular weight loss, the glucose concentration was increased to an optimum amount of 90 g/L. It is hypostatizes that excess glucose would rectify the distribution of the monomers and each HasA molecule would be provided with sufficient amount of substrates to lengthen the HA molecules. Arriving at an improved strain and optimized cultivating condition would pave the way for industrial grade HA production with high quality and quantity. Keywords: Streptococcus zooepidemicus, Hyaluronic acid, HasA, Glucose, Molecular weight
Directory of Open Access Journals (Sweden)
Johan Waldemarsson
Full Text Available The surface-localized M protein of Streptococcus pyogenes is a major virulence factor that inhibits phagocytosis, as determined ex vivo. Because little is known about the role of M protein in vivo we analyzed the contribution of different M protein regions to virulence, using the fibrinogen (Fg-binding M5 protein and a mouse model of acute invasive infection. This model was suitable, because M5 is required for mouse virulence and binds mouse and human Fg equally well, as shown here. Mixed infection experiments with wild type bacteria demonstrated that mutants lacking the N-terminal hypervariable region (HVR or the Fg-binding B-repeat region were strongly attenuated, while a mutant lacking the conserved C-repeats was only slightly attenuated. Because the HVR of M5 is not required for phagocytosis resistance, our data imply that this HVR plays a major but unknown role during acute infection. The B-repeat region is required for phagocytosis resistance and specifically binds Fg, suggesting that it promotes virulence by binding Fg. However, B-repeat mutants were attenuated even in Fg-deficient mice, implying that the B-repeats may have a second function, in addition to Fg-binding. These data demonstrate that two distinct M5 regions, including the HVR, are essential to virulence during the early stages of an infection. In particular, our data provide the first in vivo evidence that the HVR of an M protein plays a major role in virulence, focusing interest on the molecular role of this region.
Detection of antibiotic resistance in clinical bacterial strains from pets
Poeta, P.; Rodrigues, J.
2008-01-01
The identification of different bacterial strains and the occurrence of antibiotic resistance were investigated in several infection processes of pets as skin abscess with purulent discharge, bronco alveolar fluid, earwax, urine, mammary, and eye fluid. Streptococcus spp. and Staphylococcus spp. were the most detected in the different samples. A high frequency of antimicrobial resistance has been observed and this could reflect the wide use of antimicrobials in pets, making the effectiveness ...
Directory of Open Access Journals (Sweden)
Colette G. Ngo Ndjom
2017-06-01
Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.
Yoshioka, Cristina R M; Martinez, Marina B; Brandileone, Maria C C; Ragazzi, Selma B; Guerra, Maria L L S; Santos, Silvia R; Shieh, Huei H; Gilio, Alfredo E
2011-01-01
To identify the most common pneumococcal serotypes in children hospitalized with invasive pneumonia, correlate isolated serotypes with those included in conjugate vaccines, and ascertain the sensitivity of the isolated pneumococcal strains to penicillin and other antibiotics. From January 2003 to October 2008, a retrospective study of hospitalized children with a diagnosis of Streptococcus pneumoniae pneumonia was conducted at the university hospital of Universidade de São Paulo. Criteria for inclusion were: age greater than 29 days and less than 15 years, radiological and clinical diagnosis of pneumonia, and isolation of Streptococcus pneumoniae in blood cultures and/or pleural effusion. The study included 107 children. The most common serotypes were 14 (36.5%), 1 (16%), 5 (14.6%), 6B (6.3%) and 3 (4.2%). The proportion of identified serotypes contained in the heptavalent, 10-valent and 13-valent conjugate vaccines was 53.1, 86.5, and 96.9%, respectively. Pneumococcal strains were sensitive to penicillin (minimum inhibitory concentration, MIC ≤ 2 µg/mL) in 100 cases (93.5%) and displayed intermediate resistance (MIC = 4 µg/mL) in 7 cases (6.5%). No strains were penicillin-resistant (MIC ≥ 8 µg/mL) according to the Clinical and Laboratory Standards Institute 2008 standards. Tested isolates were highly sensitive to vancomycin, rifampicin, ceftriaxone, clindamycin, erythromycin, and chloramphenicol. Our results confirm a significant potential impact of conjugate vaccines, mainly 10-valent and 13-valent, on invasive pneumonia. Furthermore, susceptibility testing results show that penicillin is still the treatment of choice for invasive pneumonia in our setting.
Directory of Open Access Journals (Sweden)
Elisa Ramos-Sevillano
Full Text Available BACKGROUND: Specific antibodies mediate humoral and cellular protection against invading pathogens such as Streptococcus pneumoniae by activating complement mediated immunity, promoting phagocytosis and stimulating bacterial clearance. The emergence of pneumococcal strains with high levels of antibiotic resistance is of great concern worldwide and a serious threat for public health. METHODOLOGY/PRINCIPAL FINDINGS: Flow cytometry was used to determine whether complement-mediated immunity against three antibiotic-resistant S. pneumoniae clinical isolates is enhanced in the presence of sub-inhibitory concentrations of cefditoren and ceftriaxone. The binding of acute phase proteins such as C-reactive protein and serum amyloid P component, and of complement component C1q, to pneumococci was enhanced in the presence of serum plus either of these antibiotics. Both antibiotics therefore trigger the activation of the classical complement pathway against S. pneumoniae. C3b deposition was also increased in the presence of specific anti-pneumococcal antibodies and sub-inhibitory concentrations of cefditoren and ceftriaxone confirming that the presence of these antibiotics enhances complement-mediated immunity to S. pneumoniae. CONCLUSIONS/SIGNIFICANCE: Using cefditoren and ceftriaxone to promote the binding of acute phase proteins and C1q to pneumococci, and to increase C3b deposition, when anti-pneumococcal antibodies are present, might help reduce the impact of antibiotic resistance in S. pneumoniae infections.
Aortitis with bacteraemia by Streptococcus equi Zooepidemicus
International Nuclear Information System (INIS)
Betancur, Carlos Alberto; Giraldo, Juan David; Saldarriaga Eugenia Lucia
2005-01-01
Infections by Streptococcus equi subspecies zooepidemicus occur in animals. In human beings these infections are generally accidental, and few cases have been reported. We present the case of a 56-year-old male, a butcher, who presented with abdominal pain. Aneurismatic dilatation of the aorta below the renal arteries was documented by CT-scanning. A purulent collection and arterial ulceration were found during surgery; Streptococcus equi zooepidemicus was isolated from the collection and from blood cultures
Directory of Open Access Journals (Sweden)
Edmondo Campisi
2016-08-01
Full Text Available Neonatal invasive disease caused by group B Streptococcus (GBS represents a significant public health care concern globally. However, data related to disease burden, serotype distribution and molecular epidemiology in China and other Asian countries are very few and specifically relative to confined regions. The aim of this study was to investigate the genetic characteristics of GBS isolates recovered from neonates with invasive disease during 2013-2014 at Guangzhou and Changsha hospitals in southern mainland China. We assessed the capsular polysaccharide (CPS type, pilus islands (PIs distribution and hvgA gene presence in a panel of 26 neonatal clinical isolates, of which 8 were recovered from Early Onset Disease (EOD and 18 from Late Onset Disease (LOD. Among 26 isolates examined, five serotypes were identified. Type III was the most represented (15 cases, particularly among LOD strains (n=11, followed by types Ib (n=5, V (n=3, Ia (n=2 and II (n=1. We performed whole-genome sequencing (WGS analysis and antimicrobial susceptibility testing on the 14 serotype III isolates belonging to the hypervirulent Clonal Complex 17 (serotype III-CC17.The presence of PI-2b alone was associated with 13 out of 14 serotype III-CC17 strains. Genome analysis led us to identify two multi-drug resistance gene clusters harbored in two new versions of integrative and conjugative elements (ICEs, carrying five or eight antibiotic resistance genes, respectively. These ICEs replaced the 16 kb-locus that normally contains the PI-1 operon. All isolates harboring the identified ICEs showed multiple resistances to aminoglycoside, macrolide and tetracycline antibiotic classes. In conclusion, we report the first whole-genome sequence analysis of 14 GBS serotype III-CC17 strains isolated in China, representing the most prevalent lineage causing neonatal invasive disease. The acquisition of newly identified ICEs conferring multiple antibiotic resistances could in part explain
Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing
2017-03-01
Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in
International Nuclear Information System (INIS)
Simbaqueba, Jaime; Cotes, Alba Marina; Barrero, Luz Stella
2011-01-01
Induced systemic resistance (ISR) is a mechanism by which plants enhance defenses against any stress condition. ISR and growth promotion are enhanced when tomato (Solanum lycopersicum) is inoculated with several strains of Trichoderma ssp. this study aims to genetically map tomato candidate genes involved in ISR and growth promotion induced by the Colombian native isolate Trichoderma koningiopsis th003. Forty-nine candidate genes previously identified on tomato plants treated with th003 and T. hamatum T382 strains were evaluated for polymorphisms and 16 of them were integrated on the highly saturated genetic linkage map named TOMATO EXPEN 2000. The location of six unigenes was similar to the location of resistance gene analogs (RGAS), defense related ests and resistance QTLs previously reported, suggesting new possible candidates for these quantitative trait loci (QTL) regions. The candidate gene-markers may be used for future ISR or growth promotion assisted selection in tomato.
Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children
DEFF Research Database (Denmark)
Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.
2015-01-01
in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...
Bacteremia with Streptococcus pneumoniae
DEFF Research Database (Denmark)
Christensen, J S; Jensen, T G; Kolmos, H J
2012-01-01
We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...
Directory of Open Access Journals (Sweden)
Raisa Bu-Coifiu Fanego
2009-12-01
Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni
Are Sewage Treatment Plants Promoting Antibiotic Resistance?
1. Introduction 1.1. How bacteria exhibit resistance 1.1.1. Resistance to -lactams 1.1.2. Resistance to sulphonamides and trimethoprim 1.1.3. Resistance to macrolides 1.1.4. Resistance to fluoroquinolones 1.1.5. Resistance to tetracyclines 1.1.6. Resistance to nitroimidaz...
Directory of Open Access Journals (Sweden)
Aura Lucía Leal
1999-03-01
Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus
Directory of Open Access Journals (Sweden)
Aura Lucía Leal
1997-10-01
Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia
Directory of Open Access Journals (Sweden)
Aura Lucía Leal
1997-04-01
Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11
Directory of Open Access Journals (Sweden)
Wanman, CH.
2007-09-01
Full Text Available Fish with an average length of 3.0-4.0 inches vaccinated with formalin-killed vaccine of Streptococcus sp. either by intraperitoneal injection and immersion methods had a survival rate of 100% indicating that the vaccine is safe to be used with sea bass. The highest efficacy was received when the vaccine containing bacterin at 2.50x1010 CFU/ml. Injection of vaccine together with adjuvant (CFA was highly effective against Streptococcus sp. infection. The relative percent survival (RPS of fish injected with vaccine alone and vaccine plus adjuvant were 100 (10 days post vaccination, 54.06 and 92.29 (20 days post vaccination and 31.58 and 73.68 (30 days post vaccination respectively. The fish which received vaccine by hyperosmotic immersion showed higher resistance to the disease than by direct immersion with the RPS of 30.77 and 71.80 (10 days post vaccination, 9.75 and 70.73 (20 days post vaccination and 7.14 and 16.67 (30 days post vaccination for direct immersion and hyperosmotic immersion, respectively.
Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G
1993-01-01
Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...
Streptococcus suis meningitis can require a prolonged treatment course
Directory of Open Access Journals (Sweden)
Jean Dejace
2017-12-01
Full Text Available We report a case of recrudescent Streptococcus suis meningitis requiring a prolonged treatment course. A few similar cases can be found in the burgeoning literature on what remains a relatively uncommon disease in humans, and these patients should be monitored carefully upon completion of therapy. Keywords: Meningitis, Relapse, Duration, Streptococcus suis
Shewmaker, P L; Whitney, A M; Humrighouse, B W
2016-03-01
Phenotypic, genotypic, and antimicrobial characteristics of six phenotypically distinct human clinical isolates that most closely resembled the type strain of Streptococcus halichoeri isolated from a seal are presented. Sequencing of the 16S rRNA, rpoB, sodA, and recN genes; comparative whole-genome analysis; conventional biochemical and Rapid ID 32 Strep identification methods; and antimicrobial susceptibility testing were performed on the human isolates, the type strain of S. halichoeri, and type strains of closely related species. The six human clinical isolates were biochemically indistinguishable from each other and showed 100% 16S rRNA, rpoB, sodA, and recN gene sequence similarity. Comparative 16S rRNA gene sequencing analysis revealed 98.6% similarity to S. halichoeri CCUG 48324(T), 97.9% similarity to S. canis ATCC 43496(T), and 97.8% similarity to S. ictaluri ATCC BAA-1300(T). A 3,530-bp fragment of the rpoB gene was 98.8% similar to the S. halichoeri type strain, 84.6% to the S. canis type strain, and 83.8% to the S. ictaluri type strain. The S. halichoeri type strain and the human clinical isolates were susceptible to the antimicrobials tested based on CLSI guidelines for Streptococcus species viridans group with the exception of tetracycline and erythromycin. The human isolates were phenotypically distinct from the type strain isolated from a seal; comparative whole-genome sequence analysis confirmed that the human isolates were S. halichoeri. On the basis of these results, a novel subspecies, Streptococcus halichoeri subsp. hominis, is proposed for the human isolates and Streptococcus halichoeri subsp. halichoeri is proposed for the gray seal isolates. The type strain of the novel subspecies is SS1844(T) = CCUG 67100(T) = LMG 28801(T). Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Clancy, K. Anne; Pearson, Sylvia; Bowen, William H.; Burne, Robert A.
2000-01-01
Dental caries results from prolonged plaque acidification that leads to the establishment of a cariogenic microflora and demineralization of the tooth. Urease enzymes of oral bacteria hydrolyze urea to ammonia, which can neutralize plaque acids. To begin to examine the relationship between plaque ureolytic activity and the incidence of dental caries, recombinant, ureolytic strains of Streptococcus mutans were constructed. Specifically, the ureABCEFGD operon from Streptococcus salivarius 57.I was integrated into the S. mutans chromosome in such a way that the operon was transcribed from a weak, cognate promoter in S. mutans ACUS4 or a stronger promoter in S. mutans ACUS6. Both strains expressed NiCl2-dependent urease activity, but the maximal urease levels in ACUS6 were threefold higher than those in ACUS4. In vitro pH drop experiments demonstrated that the ability of the recombinant S. mutans strains to moderate a decrease in pH during the simultaneous metabolism of glucose and urea increased proportionately with the level of urease activity expressed. Specific-pathogen-free rats that were infected with ACUS6 and fed a cariogenic diet with drinking water containing 25 mM urea and 50 μM NiCl2 had relatively high levels of oral urease activity, as well as dramatic decreases in the prevalence of smooth-surface caries and the severity of sulcal caries, relative to controls. Urease activity appears to influence plaque biochemistry and metabolism in a manner that reduces cariogenicity, suggesting that recombinant, ureolytic bacteria may be useful to promote dental health. PMID:10768953
Directory of Open Access Journals (Sweden)
Jovanović Luka
2016-01-01
Full Text Available Introduction: Group B streptococcus (GBS is a significant human pathogen. GBS colonizes the vagina and it is one of the most important causes of early neonatal sepsis and meningitis. In many countries, screening of pregnant women and intrapartal use of antibiotics are common practice. Macrolide and lincosamide resistant strains of GBS are a significant problem, because these antibiotics are the second line therapy in case of penicillin allergy. Aim: Our aim was to investigate the frequency of antibiotic resistant strains of GBS and to detect macrolide resistance phenotypes in GBS strains obtained from pregnant women in Belgrade. Material and Methods: 105 GBS isolates were obtained from vaginal swabs of pregnant women attending two Gynecology and Obstetrics Centers in Belgrade. The isolates were tested for antimicrobial susceptibility pattern and D test were performed on Mueller Hinton agar. Results: Macrolide and lincosamide resistance was found in 30.4 %, and 23.8 % of isolates, respectively. There was a high frequency of tetracycline resistant strains (88.6 %. Most frequent macrolide resistant phenotype was iMLSb (macrolide and inducibile lincosamide resistance (62.4%. Conclusion: The results of our study indicate that there is a high level of macrolide resistance among GBS isolates in Serbia and the active surveillance is needed.
Streptococcus himalayensis sp. nov., isolated from the respiratory tract of Marmota himalayana.
Niu, Lina; Lu, Shan; Lai, Xin-He; Hu, Shoukui; Chen, Cuixia; Zhang, Gui; Yang, Jing; Jin, Dong; Wang, Yi; Lan, Ruiting; Lu, Gang; Xie, Yingping; Ye, Changyun; Xu, Jianguo
2017-02-01
Five strains of Gram-positive-staining, catalase-negative, coccus-shaped, chain-forming organisms isolated separately from the respiratory tracts of five Marmota himalayana animals in the Qinghai-Tibet Plateau of China were subjected to phenotypic and molecular taxonomic analyses. Comparative analysis of the 16S rRNA gene indicated that these singular organisms represent a new member of the genus Streptococcus, being phylogenetically closest to Streptococcus marmotae DSM 101995T (98.4 % similarity). The groEL, sodA and rpoB sequence analysis showed interspecies similarity values between HTS2T and Streptococcus. marmotae DSM 101995T, its closest phylogenetic relative based on 16S rRNA gene sequences, of 98.2, 78.8 and 93.7 %, respectively. A whole-genome phylogenetic tree built from 82 core genes of genomes from 16 species of the genus Streptococcus validated that HTS2T forms a distinct subline and exhibits specific phylogenetic affinity with S. marmotae. In silico DNA-DNA hybridization of HTS2T showed an estimated DNA reassociation value of 40.5 % with Streptococcus. marmotae DSM 101995T. On the basis of their phenotypic characteristics and phylogenetic findings, it is proposed that the five isolates be classified as representatives of a novel species of the genus Streptococcus, Streptococcus himalayensis sp. nov. The type strain is HTS2T (=DSM 101997T=CGMCC 1.15533T). The genome of Streptococcus himalayensis sp. nov. strain HTS2T contains 2195 genes with a size of 2 275 471 bp and a mean DNA G+C content of 41.3 mol%.
Pang, R; Li, Y; Dong, Y; Liang, Z; Zhang, Y; Zhang, W
2014-12-01
Imidacloprid resistance in the brown planthopper, Nilaparvata lugens, is primarily the result of the over-expression of cytochrome P450 monooxygenases. Here, a field-collected strain of N. lugens was shown to be highly resistant to both imidacloprid and buprofezin. Insecticide exposure and quantitative real-time PCR revealed that its resistance was mainly associated with a cytochrome P450 gene, CYP6AY1. CYP6AY1 is known to metabolize imidacloprid but its effect on buprofezin is unclear. In the 5'-untranslated region of CYP6AY1, a novel alternative splicing was detected. After a 1990-bp promoter region was cloned, its basal luciferase activity was assessed. Furthermore, genotyping studies identified 12 variations in the promoter region that discriminated between the field-collected and control strain. Finally, survival bioassays revealed a single nucleotide polymorphism and an insertion-deletion polymorphism linked to buprofezin and imidacloprid resistance. Mutagenesis of these sites enhanced the promoter activity of CYP6AY1. These results suggest that promoter polymorphisms may affect P450-mediated multiple insecticide resistance of pests. © 2014 The Royal Entomological Society.
Treatment of acute otitis media - challenges in the era of antibiotic resistance.
Dagan, R
2000-12-08
The last decade is characterized by the increase in antibiotic resistance among respiratory bacterial pathogens in the presence of only modest progress in the development of new antibacterial agents to overcome this resistance. A series of recent studies show clearly that the increased resistance among the main AOM pathogens (namely Streptococcus pneumoniae and Haemophilus influenzae) is associated with a dramatic decrease in bacteriologic response to antibiotic treatment, which in turn has an impact on clinical response. Thus, the individual patient is affected by the increasing antibiotic resistance. Moreover, the society as a whole is now also affected because the carriage and spread of antibiotic resistant AOM pathogens is remarkably impacted by antibiotic treatment. New studies show the remarkable ability of antibiotics to rapidly promote nasopharyngeal carriage and spread of antibiotic-resistant AOM pathogens. In these studies, the increase in carriage of antibiotic resistant S. pneumoniae is shown already after 3-4 days from initiation of antibiotic treatment and may last for weeks to months after treatment. Children carrying antibiotic-resistant organisms transmit those organisms to their family and to their day care centers and thus a vicious cycle is created in which increased antibiotic resistance with decreased response leads to increased antibiotic use, which in turn leads to further increase in resistance. New antibiotics are not likely to improve this situation. It is clear that the challenge in the next decade is to prevent AOM rather than to treat it. Efforts to prevent AOM include improved environmental factors, immunization with bacterial and viral vaccines and some creative measures such as prevention of colonization and attachment to epithelium of AOM pathogens. Whether these efforts will prove successful or, even if successful, will only modify the clinical and bacteriologic picture presenting new challenges, only time will tell.
Directory of Open Access Journals (Sweden)
Marta I. C. MEDEIROS
1998-01-01
Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.
Dai, Lei; Sahin, Orhan; Tang, Yizhi; Zhang, Qijing
2017-12-15
Campylobacter jejuni is a leading cause of foodborne illnesses worldwide. As a microaerophilic organism, C. jejuni must be able to defend against oxidative stress encountered both in the host and in the environment. How Campylobacter utilizes a mutation-based mechanism for adaptation to oxidative stress is still unknown. Here we present a previously undescribed phenotypic and genetic mechanism that promotes the emergence of oxidative stress-resistant mutants. Specifically, we showed that a naturally occurring mutator phenotype, resulting from a loss of function mutation in the DNA repair enzyme MutY, increased oxidative stress resistance (OX R ) in C. jejuni We further demonstrated that MutY malfunction did not directly contribute to the OX R phenotype but increased the spontaneous mutation rate in the peroxide regulator gene perR , which functions as a repressor for multiple genes involved in oxidative stress resistance. Mutations in PerR resulted in loss of its DNA binding function and derepression of PerR-controlled oxidative stress defense genes, thereby conferring an OX R phenotype and facilitating Campylobacter survival under oxidative stress. These findings reveal a new mechanism that promotes the emergence of spontaneous OX R mutants in bacterial organisms. IMPORTANCE Although a mutator phenotype has been shown to promote antibiotic resistance in many bacterial species, little is known about its contribution to the emergence of OX R mutants. This work describes the link between a mutator phenotype and the enhanced emergence of OX R mutants as well as its underlying mechanism involving DNA repair and mutations in PerR. Since DNA repair systems and PerR are well conserved in many bacterial species, especially in Gram positives, the same mechanism may operate in multiple bacterial species. Additionally, we developed a novel method that allows for rapid quantification of spontaneous OX R mutants in a bacterial population. This method represents a technical
Group A Streptococcus Prevents Mast Cell Degranulation to Promote Extracellular Trap Formation
Directory of Open Access Journals (Sweden)
Mary Clark
2018-02-01
Full Text Available The resurgence of Group A Streptococcus (GAS infections in the past two decades has been a rising major public health concern. Due to a large number of GAS infections occurring in the skin, mast cells (MCs, innate immune cells known to localize to the dermis, could play an important role in controlling infection. MCs can exert their antimicrobial activities either early during infection, by degranulation and release of antimicrobial proteases and the cathelicidin-derived antimicrobial peptide LL-37, or by forming antibacterial MC extracellular traps (MCETs in later stages of infection. We demonstrate that MCs do not directly degranulate in response to GAS, reducing their ability to control bacterial growth in early stages of infection. However, MC granule components are highly cytotoxic to GAS due to the pore-forming activity of LL-37, while MC granule proteases do not significantly affect GAS viability. We therefore confirmed the importance of MCETs by demonstrating their capacity to reduce GAS survival. The data therefore suggests that LL-37 from MC granules become embedded in MCETs, and are the primary effector molecule by which MCs control GAS infection. Our work underscores the importance of a non-traditional immune effector cell, utilizing a non-conventional mechanism, in the defense against an important human pathogen.
Recombination-deficient Streptococcus sanguis
International Nuclear Information System (INIS)
Daneo-Moore, L.; Volpe, A.
1985-01-01
A UV-sensitive derivative was obtained from Streptococcus sanguis Challis. The organism could be transformed with a number of small streptococcal plasmids at frequencies equal to, or 1 logarithm below, the transformation frequencies for the parent organism. However, transformation with chromosomal DNA was greatly impaired in the UV-sensitive derivative
Safari, D.
2010-01-01
Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the
Hoogenkamp, M.A.; Crielaard, W.; ten Cate, J.M.; Wever, R.; Hartog, A.F.; Renirie, R.
2009-01-01
The aim of this study was to investigate the antimicrobial activity of vanadium chloroperoxidase (VCPO) reaction products on planktonic and biofilm cellsof Streptococcus mutans C180-2. Planktonic and biofilm cells were incubated in a buffered reaction mixture containing VCPO, halide (either chloride
POOLMAN, B; BOSMAN, B; KONINGS, WN
1987-01-01
The decreased response of the energy metabolism of lactose-starved Streptococcus cremoris upon readdition of lactose is caused by a decrease of the glycolytic activity. The decrease in glycolysis is accompanied by a decrease in the activities of glyceraldehyde-3-phosphate dehydrogenase and
Directory of Open Access Journals (Sweden)
Manuel Díaz Álvarez
2008-12-01
Full Text Available INTRODUCCIÓN. El objetivo del presente estudio fue conocer las características clínicas y epidemiológicas de las infecciones por estreptococo del grupo B en recién nacidos egresados de los hospitales maternos. MÉTODOS. Se realizó un estudio descriptivo, que incluyó a recién nacidos consecutivos con infecciones por Streptococcus agalactiae, ingresados en el Servicio de Neonatología del Hospital Pediátrico Universitario «Juan M. Márquez» entre febrero de 1992 y diciembre del 2007. Se procesaron y analizaron distintas variables clínicas y epidemiológicas, con cálculo de tasas de incidencia y letalidad, así como relación entre variables categóricas. RESULTADOS. Hubo 76 recién nacidos con infección por Streptococcus agalactiae, lo cual constituyó una tasa promedio anual de 1,9 x 100 ingresos. Predominaron las infecciones de inicio tardío y las adquiridas en la comunidad (89,5 % y 93,4 %, respectivamente. La meningitis fue la forma clínica más frecuente, seguida de la bacteriemia aislada. Hubo 56 de 76 recién nacidos con bacteriemia (73,7 %. El Streptococcus agalactiae tuvo elevada sensibilidad ante la penicilina, la eritromicina, la vancomicina, la cefotaxima y el cloranfenicol. Hubo 7 fallecidos (9,2 % y todos fueron pacientes con infección del sistema nervioso central. CONCLUSIONES. Streptococcus agalactiae es un agente causal de infecciones que afectan al recién nacido, tanto en la comunidad como en el medio hospitalario. Estas infecciones pueden ser letales en algunos pacientes con infección del sistema nervioso central con bacteriemia o sin ella, aún manteniendo un patrón de elevada susceptibilidad a los antibióticos betalactámicos.INTRODUCCIÓN. The objective of the present study was to know the clinical and epidemiological characteristics of the infections caused by group B Streptococcus in newborns discharged from maternal hospitals. METHODS. A descriptive study that included consecutive infants with
Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena
2016-01-01
Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.
International Nuclear Information System (INIS)
Kim, Tae-O; Im, Dong-Won; Jung, Ha Yun; Kwon, Seong Jung; Heo, Yong-Seok
2012-01-01
Enoyl-acyl carrier protein reductase (FabK) from S. mutans strain UA159 was cloned, overexpressed, purified and crystallized. X-ray diffraction data were collected to a resolution of 2.40 Å. A triclosan-resistant flavoprotein termed FabK is the sole enoyl-acyl carrier protein reductase in Streptococcus pneumoniae and Streptococcus mutans. In this study, FabK from S. mutans strain UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 2.40 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P6 2 , with unit-cell parameters a = b = 105.79, c = 44.15 Å. The asymmetric unit contained one molecule, with a corresponding V M of 2.05 Å 3 Da −1 and a solvent content of 39.9%
Phenotypical characteristics of group B streptococcus in parturients
Directory of Open Access Journals (Sweden)
Jose Antonio Simoes
Full Text Available Colonization by Group B Streptococcus (GBS is highly prevalent among pregnant women, with prevalence rates ranging between 4% and 30%. The infection may be transmitted vertically and may result in serious neonatal consequences. In the period from November 2003 to May 2004, a cross-sectional study was carried out among 316 parturients at the Jundiaí Teaching Hospital to establish the prevalence of genital GBS colonization, to identify the factors associated with colonization and the characteristic phenotypes of these streptococci. Samples from rectal and vaginal areas were collected for selective culture in Todd-Hewitt broth. Susceptibility to 7 antimicrobial agents was tested using the antibiotic diffusion disk technique, and the isolated strains were classified using specific antisera. The prevalence of GBS colonization was 14.6%. No strain was resistant to penicillin, ampicillin, erythromycin or nitrofurantoin. The majority of strains were sensitive to cephalothin. Greatest resistance was to gentamicin (76.1%, followed by clindamycin (17.4%. The most frequent serotype was Ib (23.9%, followed by serotypes II and Ia (19.6% and 17.4%, respectively. There was no correlation between serotype and greater antimicrobial resistance. In conclusion, the prevalence of GBS in parturients was high and penicillin continues to be the drug of choice for intrapartum prophylaxis. The most frequent serotype (Ib found in this study differs from those found in the majority of studies carried out in other countries, revealing the need to identify prevalent serotypes in each region so that specific vaccines can be designed.
PERBEDAAN DAYA HAMBAT PASTA GIGI BERBAHAN HERBAL TERHADAP PERTUMBUHAN STREPTOCOCCUS MUTANS
Directory of Open Access Journals (Sweden)
Susi Susi
2015-09-01
Full Text Available AbstrakKaries gigi dan penyakit periodontal dapat dicegah dengan mengontrol pembentukan plak secara teratur. Penggunaan pasta gigi herbal dapat memberikan efek kimia untuk mengontrol pembentukan plak. Studi terdahulu mendapatkan bahwa pasta gigi herbal dapat mengurangi jumlah bakteri utama pada rongga mulut yaitu Streptococcus mutans. Penelitian ini bertujuan untuk meneliti perbedaan daya hambat beberapa pasta gigi herbal (mengandung siwak, cengkeh, dan daun sirih terhadap pertumbuhan Streptococcus mutans. Metode penelitian adalah eksperimental dengan meletakkan cakram yang sudah direndam dengan pasta gigi ke medium agar darah yang mengandung koloni Streptococcus mutans. Uji daya hambat bakteri dilakukan dengan metode difusi. Terbentuknya zona bening di sekitar koloni bakteri menunjukkan adanya penghambatan pertumbuhan bakteri uji. Hasil uji satu arah ANOVA menunjukkan adanya perbedaan daya hambat yang bermakna antar pasta gigi herbal yang digunakan (p<0.05. Ketiga pasta gigi didapakan memiliki kemampuan antibakteri kuat dengan rata-rata zona hambat 16.075 mm, 13.375 mm dan 11.080 mm. Jadi dapat disimpulkan bahwa pasta gigi herbal mempunyai efek anti bakteri terhadap pertumbuhan Streptococcus mutans dengan efek anti bakteri terkuat di tunjukkan oleh pasta gigi mengandung cengkeh.AbstractDental caries and periodontal disease can be eliminated by regularly control plaque formation. The usage of herbal toothpaste is able to give chemical effect toward plaque control. Previous studies shown that the usage of herbal toothpaste was able to reduce the growth of Streptococcus mutans, the main bacteria in the mouth. The study aimed at investigating the difference of zone of inhibition of several herbal toothpastes (siwak- , cloves- , and betel leaves- contained toward the growth of Streptococcus mutans.This study was experimental research using disc that had been immersed and subsequently put it onto Blood agar medium that contain Streptococcus mutans
Deb, Debasish; Shrestha, Ankita; Maiti, Indu B.; Dey, Nrisingha
2018-01-01
Development of disease-resistant plant varieties achieved by engineering anti-microbial transgenes under the control of strong promoters can suffice the inhibition of pathogen growth and simultaneously ensure enhanced crop production. For evaluating the prospect of such strong promoters, we comprehensively characterized the full-length transcript promoter of Cassava Vein Mosaic Virus (CsVMV; -565 to +166) and identified CsVMV8 (-215 to +166) as the highest expressing fragment in both transient and transgenic assays. Further, we designed a new chimeric promoter ‘MUASCsV8CP’ through inter-molecular hybridization among the upstream activation sequence (UAS) of Mirabilis Mosaic Virus (MMV; -297 to -38) and CsVMV8, as the core promoter (CP). The MUASCsV8CP was found to be ∼2.2 and ∼2.4 times stronger than the CsVMV8 and CaMV35S promoters, respectively, while its activity was found to be equivalent to that of the CaMV35S2 promoter. Furthermore, we generated transgenic tobacco plants expressing the totiviral ‘Killer protein KP4’ (KP4) under the control of the MUASCsV8CP promoter. Recombinant KP4 was found to accumulate both in the cytoplasm and apoplast of plant cells. The agar-based killing zone assays revealed enhanced resistance of plant-derived KP4 against two deuteromycetous foliar pathogenic fungi viz. Alternaria alternata and Phoma exigua var. exigua. Also, transgenic plants expressing KP4 inhibited the growth progression of these fungi and conferred significant fungal resistance in detached-leaf and whole plant assays. Taken together, we establish the potential of engineering “in-built” fungal stress-tolerance in plants by expressing KP4 under a novel chimeric caulimoviral promoter in a transgenic approach. PMID:29556246
Corrosion of dental alloys in artificial saliva with Streptococcus mutans.
Lu, Chunhui; Zheng, Yuanli; Zhong, Qun
2017-01-01
A comparative study of the corrosion resistance of CoCr and NiCr alloys in artificial saliva (AS) containing tryptic soy broth (Solution 1) and Streptococcus mutans (S. mutans) species (Solution 2) was performed by electrochemical methods, including open circuit potential measurements, impedance spectroscopy, and potentiodynamic polarization. The adherence of S. mutans to the NiCr and CoCr alloy surfaces immersed in Solution 2 for 24 h was verified by scanning electron microscopy, while the results of electrochemical impedance spectroscopy confirmed the importance of biofilm formation for the corrosion process. The R(QR) equivalent circuit was successfully used to fit the data obtained for the AS mixture without S. mutans, while the R(Q(R(QR))) circuit was found to be more suitable for describing the biofilm properties after treatment with the AS containing S. mutans species. In addition, a negative shift of the open circuit potential with immersion time was observed for all samples regardless of the solution type. Both alloys exhibited higher charge transfer resistance after treatment with Solution 2, and lower corrosion current densities were detected for all samples in the presence of S. mutans. The obtained results suggest that the biofilm formation observed after 24 h of exposure to S. mutans bacteria might enhance the corrosion resistance of the studied samples by creating physical barriers that prevented oxygen interactions with the metal surfaces.
Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Nazir A. Brohi
2016-12-01
Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation
Epidemiological studies of potent environment pathogen streptococcus pneumoniae
International Nuclear Information System (INIS)
Brohi, N.A.; Tunio, S.A.
2016-01-01
A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)
Effect of silver-loaded PMMA on Streptococcus mutans in a drip flow reactor.
Williams, Dustin L; Epperson, Richard Tyler; DeGrauw, Jeffery P; Nielsen, Mattias B; Taylor, Nicholas B; Jolley, Ryan D
2017-09-01
Orthodontic retention has been proposed as a life-long commitment for patients who desire to maintain straight teeth. However, the presence of foreign material increases risk of bacterial colonization and caries formation, of which Streptococcus mutans is a key contributor. Multiple studies have assessed the ability of silver to be added to base plate material and resist attachment of S. mutans. However, it does not appear that long-term washout in connection with biofilm growth under physiologically relevant conditions has been taken into consideration. In this study, silver was added to base plate material and exposed to short- or long-term washout periods. Materials were then assessed for their ability to resist biofilm formation of S. mutans using a drip flow reactor that modeled the human oral environment. Data indicated that silver was able to resist biofilm formation following short-term washout, but long-term washout periods resulted in a lack of ability to resist biofilm formation. These data will be important for future development of base plate materials to achieve long-term antimicrobial efficacy to reduce risk of caries formation and benefit patients in the long term. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 2632-2639, 2017. © 2017 Wiley Periodicals, Inc.
Multidrug resistant bacteria isolated from septic arthritis in horses
Directory of Open Access Journals (Sweden)
Rodrigo G. Motta
Full Text Available ABSTRACT: Septic arthritis is a debilitating joint infectious disease of equines that requires early diagnosis and immediate therapeutic intervention to prevent degenerative effects on the articular cartilage, as well as loss of athletic ability and work performance of the animals. Few studies have investigated the etiological complexity of this disease, as well as multidrug resistance of isolates. In this study, 60 horses with arthritis had synovial fluid samples aseptically collected, and tested by microbiological culture and in vitro susceptibility test (disk diffusion using nine antimicrobials belonging to six different pharmacological groups. Bacteria were isolated in 45 (75.0% samples, as follows: Streptococcus equi subsp. equi (11=18.3%, Escherichia coli (9=15.0%, Staphylococcus aureus (6=10.0%, Streptococcus equi subsp. zooepidemicus (5=8.3%, Staphylococcus intermedius (2=3.3%, Proteus vulgaris (2=3.3%, Trueperella pyogenes (2=3.3%, Pseudomonas aeruginosa (2=3.3%, Klebsiella pneumoniae (1=1.7%, Rhodococcus equi (1=1.7%, Staphylococcus epidermidis (1=1.7%, Klebsiella oxytoca (1=1.7%, Nocardia asteroides (1=1.7%, and Enterobacter cloacae (1=1.7%. Ceftiofur was the most effective drug (>70% efficacy against the pathogens in the disk diffusion test. In contrast, high resistance rate (>70% resistance was observed to penicillin (42.2%, enrofloxacin (33.3%, and amikacin (31.2%. Eleven (24.4% isolates were resistant to three or more different pharmacological groups and were considered multidrug resistant strains. The present study emphasizes the etiological complexity of equine septic arthritis, and highlights the need to institute treatment based on the in vitro susceptibility pattern, due to the multidrug resistance of isolates. According to the available literature, this is the first report in Brazil on the investigation of the etiology. of the septic arthritis in a great number of horses associated with multidrug resistance of the isolates.
9230 FECAL ENTEROCOCCUS/STREPTOCOCCUS GROUPS
In 1903 the genus name Enterococcus was proposed for gram-positive, catalase-negative, coccoid-shaped bacterial of intestinal origin. Several years later, it was suggested that the genus name be changed to Streptococcus because of the organisms' ability to form chains of coccoid...
Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.
Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel
2017-11-01
One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).
Delayed-onset streptococcus pyogenes endophthalmitis following Ahmed glaucoma valve implantation.
Bayraktar, Zerrin; Kapran, Ziya; Bayraktar, Sükrü; Acar, Nur; Unver, Yaprak Banu; Gök, Kemran
2005-01-01
To report a case of delayed-onset Streptococcus pyogenes endophthalmitis following implantation of an Ahmed glaucoma valve. A 10-year-old patient presented with acute endophthalmitis 1 year after Ahmed glaucoma valve implantation. The conjunctiva and Tenon's capsule over the valve plate had been penetrated by one of the polypropylene fixation sutures. The valve was removed, and pars plana vitrectomy was performed. Vitreous specimens and removal of the discharge over the plate revealed Streptococcus pyogenes. This is the first documented case of Streptococcus pyogenes endophthalmitis following Ahmed glaucoma valve implantation. We think the conjunctival buttonhole caused by the polypropylene suture provided an entry site for the infection. (c) Japanese Ophthalmological Society 2005.
Yang, J; Yoshida, Y; Cisar, J O
2014-02-01
Interbacterial adhesion between streptococci and actinomyces promotes early dental plaque biofilm development. Recognition of coaggregation receptor polysaccharides (RPS) on strains of Streptococcus sanguinis, Streptococcus gordonii and Streptococcus oralis by Actinomyces spp. type 2 fimbriae is the principal mechanism of these interactions. Previous studies of genetic loci for synthesis of RPS (rps) and RPS precursors (rml, galE1 and galE2) in S. gordonii 38 and S. oralis 34 revealed differences between these strains. To determine whether these differences are strain-specific or species-specific, we identified and compared loci for polysaccharide biosynthesis in additional strains of these species and in several strains of the previously unstudied species, S. sanguinis. Genes for synthesis of RPS precursors distinguished the rps loci of different streptococci. Hence, rml genes for synthesis of TDP-L-Rha were in rps loci of S. oralis strains but at other loci in S. gordonii and S. sanguinis. Genes for two distinct galactose epimerases were also distributed differently. Hence, galE1 for epimerization of UDP-Glc and UDP-Gal was in galactose operons of S. gordonii and S. sanguinis strains but surprisingly, this gene was not present in S. oralis. Moreover, galE2 for epimerization of both UDP-Glc and UDP-Gal and UDP-GlcNAc and UDP-GalNAc was at a different locus in each species, including rps operons of S. sanguinis. The findings provide insight into cell surface properties that distinguish different RPS-producing streptococci and open an approach for identifying these bacteria based on the arrangement of genes for synthesis of polysaccharide precursors. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
A Study of Streptococcus Viridans in the Maxillofacial Region
Directory of Open Access Journals (Sweden)
Y. Refoua
2005-12-01
Full Text Available Statement of Problem: Streptococcus viridans is one of the most important microorganisms in the establishment of infections leading to dental caries and heart valve damages. Therefore the diagnosis and prevention of these infections is critical in health care.Purpose: The aim of this in-vivo study was to determine the prevalence of viridans streptococci in abscesses occurring in the maxillofacial region.Materials and Methods: The study sample consisted of 39 patients with maxillofacial abscesses, referred to the Department of Oral Surgery Faculty of Dentistry Tehran University of Medical Sciences and Dr. Shariati Hospital, Tehran University of Medical Sciences. Extra-oral incision, drainage and pus collection followed by culture, staining and biochemical and sugar fermentation tests were carried out for all participants.Results: In the present study %53.84 and 46.16% of the patients had negative and positive culture results, respectively. In the positive culture group, %2.5 of the viridans streptococci were streptococcus salivarius, %4.6 streptococcus sanguis and %17.9 were streptococcus mutans.Conclusion: The findings of this study showed that viridans streptococci are an important factor in the development of metastatic and maxillofacial infections which can pose a significant threat to the patient’s life.
International Nuclear Information System (INIS)
Roychoudhury, Paromita; Ghosh, Utpal; Bhattacharyya, Nitai P.; Chaudhuri, Keya
2006-01-01
The cellular response to ionizing radiation is mediated by a complex interaction of number of proteins involving different pathways. Previously, we have shown that up regulation of mitochondrial genes ND1, ND4, and COX1 transcribed from the heavy strand promoter (P H ) has been increased in a radio-resistant cell strain designated as M5 in comparison with the parental Chinese hamster V79 cells. These genes are also up regulated in Chinese hamster V79 cells VB13 that express exogenous human Bcl2. In the present study, the expression of the gene ND6 that is expressed from the light strand promoter (P L ) was found to be similar in both the cell lines, as determined by RT-PCR. To test the possibility that this differential expression of mitochondrial genes under these two promoters was mediated by differences in proteins' affinity to interact with these promoters, we have carried out electrophoretic mobility shift assay (EMSA) using mitochondrial cell extracts from these two cell lines. Our result of these experiments revealed that two different proteins formed complex with the synthetic promoters and higher amount of protein from M5 cell extracts interacted with the P H promoter in comparison to that observed with cell extracts from Chinese hamster V79 cells. The promoter-specific differential binding of proteins was also observed in VB13. These results showed that differential mitochondrial gene expression observed earlier in the radio-resistant M5 cells was due to enhanced interaction proteins with the promoters P H and mediated by the expression of Bcl2
Rivière, Maxence; Louit, Loic; Strokosch, Alasdair; Seitz, Laurent B
2017-04-01
Rivière, M, Louit, L, Strokosch, A, and Seitz, LB. Variable resistance training promotes greater strength and power adaptations than traditional resistance training in elite youth rugby league players. J Strength Cond Res 31(4): 947-955, 2017-The purpose of this study was to examine the strength, velocity, and power adaptations in youth rugby league players in response to a variable resistance training (VRT) or traditional free-weight resistance training (TRAD) intervention. Sixteen elite youth players were assigned to a VRT or TRAD group and completed 2 weekly upper- and lower-body strength and power sessions for 6 weeks. Training programs were identical except that the VRT group trained the bench press exercise with 20% of the prescribed load coming from elastic bands. Bench press 1 repetition maximum (1RM) and bench press mean velocity and power at 35, 45, 65, 75, and 85% of 1RM were measured before and after the training intervention, and the magnitude of the changes was determined using effect sizes (ESs). The VRT group experienced larger increases in both absolute (ES = 0.46 vs. 0.20) and relative (ES = 0.41 vs. 0.19) bench press 1RM. Similar results were observed for mean velocity as well as both absolute and relative mean power at 35, 45, 65, 75, and 85% of 1RM. Furthermore, both groups experienced large gains in both velocity and power in the heavier loads but small improvements in the lighter loads. The improvements in both velocity and power against the heavier loads were larger for the VRT group, whereas smaller differences existed between the 2 groups in the lighter loads. Variable resistance training using elastic bands may offer a greater training stimulus than traditional free-weight resistance training to improve upper-body strength, velocity, and power in elite youth rugby league players.
Directory of Open Access Journals (Sweden)
María Marín
2017-07-01
Full Text Available Lactational mastitis constitutes one of the main causes of undesired weaning, depriving the mother–infant pair from the benefits of breastfeeding; therefore, this condition should be considered a relevant public health issue. The role of specific microorganisms remains unclear since human milk cultures and antibiotic susceptibility testing (AST are not routinely performed, despite the fact that this would be key to ensure an early and effective diagnosis and treatment. The objective of this study was to describe the culturable microbial diversity in 647 milk samples from breastfeeding women with clinical symptoms of mastitis by Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF VITEK MS technology and to analyze the antimicrobial susceptibility profiles of a collection of isolates from these samples by the VITEK 2 AST system. Staphylococcus epidermidis was the most common species isolated from mastitis samples (87.6%, while Staphylococcus aureus was detected in 22.1%. Streptococci constituted the second (68.6% most prevalent bacterial group, with Streptococcus mitis/oralis, Streptococcus salivarius, and Streptococcus parasanguinis detected with frequencies of 40.8, 36.8, and 14.4%, respectively. The antibiotic susceptibility profiles of 642 staphylococcal isolates indicated a remarkable resistance to benzylpenicillin (88.3% and erythromycin (67.3% with differences between species. A high percentage of Staphylococcus isolates were resistant to at least one antibiotic (Staphylococcus hominis, 100%; S. epidermidis, 98.2%; S. aureus, 92.9%; Staphylococcus lugdunensis, 90.5% and the percentage of multidrug-resistance (MDR isolates was noticeable (S. hominis, 81%; S. epidermidis, 64.4%; S. aureus, 11.5%; S. lugdunensis, 10.5%. In relation to streptococcal isolates (n = 524, AST revealed high or moderate percentages of resistance to erythromycin (68.7%, benzylpenicillin (63.7%, ampicillin (51.5%, and tetracycline
Ciandrini, E; Campana, R; Baffone, W
2017-06-01
This research investigates the ability of live and heat-killed (HK) Lactic Acid Bacteria (LAB) to interfere with Streptococcus mutans ATCC 25175 and Streptococcus oralis ATCC 9811 during biofilm formation. Eight Lactobacillus spp. and two oral colonizers, pathogenic Streptococcus mutans and resident Streptococcus oralis, were characterized for their aggregation abilities, cell surface properties and biofilm formation ability on titanium surface. Then, the interference activity of selected live and HK Lactobacillus spp. during S. mutans and S. oralis biofilm development were performed. The cell-free culture supernatants (CFCS) anti-biofilm activity was also determined. LAB possess good abilities of auto-aggregation (from 14.19 to 28.97%) and of co-aggregation with S. oralis. The cell-surfaces characteristics were most pronounced in S. mutans and S. oralis, while the highest affinities to xylene and chloroform were observed in Lactobacillus rhamnosus ATCC 53103 (56.37%) and Lactobacillus paracasei B21060 (43.83%). S. mutans and S. oralis developed a biofilm on titanium surface, while LAB showed a limited or no ability to create biofilm. Live and HK L. rhamnosus ATCC 53103 and L. paracasei B21060 inhibited streptococci biofilm formation by competition and displacement mechanisms with no substantial differences. The CFCSs of both LAB strains, particularly the undiluted one of L. paracasei B21060, decreased S. mutans and S. oralis biofilm formation. This study evidenced the association of LAB aggregation abilities and cell-surface properties with the LAB-mediated inhibition of S. mutans and S. oralis biofilm formation. Lactobacilli showed different mechanisms of action and peculiar strain-specific characteristics, maintained also in the heat-killed LAB. Copyright © 2017 Elsevier Ltd. All rights reserved.
Molecular Epidemiology and Genomics of Group A Streptococcus
Bessen, Debra E.; McShan, W. Michael; Nguyen, Scott V.; Shetty, Amol; Agrawal, Sonia; Tettelin, Hervé
2014-01-01
Streptococcus pyogenes (group A streptococcus; GAS) is a strict human pathogen with a very high prevalence worldwide. This review highlights the genetic organization of the species and the important ecological considerations that impact its evolution. Recent advances are presented on the topics of molecular epidemiology, population biology, molecular basis for genetic change, genome structure and genetic flux, phylogenomics and closely related streptococcal species, and the long- and short-term evolution of GAS. The application of whole genome sequence data to addressing key biological questions is discussed. PMID:25460818
Lifescience Database Archive (English)
Full Text Available MeCab user dictionary for science technology term Streptococcus mitis 名詞 一般 * * * * Streptococcus mit...is ... MeSH D034361 200906051281920120 C LS07 UNKNOWN_2 Streptococcus mitis
Numanović, Fatima; Smajlović, Jasmina; Gegić, Merima; Delibegović, Zineta; Bektaš, Sabaheta; Halilović, Emir; Nurkić, Jasmina
2017-02-01
Aim To determine the prevalence rate and resistance profile of Streptococcus agalactiae (S. agalactiae) in vaginal swabs of pregnant and adult non-pregnant women in the Tuzla region, Bosnia and Herzegovina (B&H), as well as its association with other aerobic bacteria. Methods This prospective study included 200 women, 100 pregnant and 100 adult non-pregnant. The research was conducted at the Institute of Microbiology, University Clinical Center Tuzla from October to December 2015. Standard aerobic microbiological techniques were used for isolation and identification of S. agalactiae and other aerobic bacteria. Antimicrobial susceptibility was determined by the disk diffusion and microdilution method(VITEK 2/AES instrument). Results Among 200 vaginal swabs, 17 (8.50%) were positive for S. agalactiae, e. g., 7% (7/100) of pregnant and 10% (10/100) of adult non-pregnant women. In the pregnant group, 71.4% (5/7) of S. agalactiae isolates were susceptible to clindamycin and 85.7%(6/7) to erythromycin. In the adult non-pregnant group, only resistance to clindamycin was observed in one patient (1/10; 10%). S. agalactiae as single pathogen was isolated in 57.14% (4/7) of pregnant and 60% (6/10) of adult non-pregnant S. agalactiae positive women. In mixed microbial cultures S. agalactiae was most frequently associated with Enterococcus faecalis and Escherichia coli. Conclusion The rate of S. agalactiae positive women in the population of pregnant and adult non-pregnant women of Tuzla Canton, B&H is comparable with other European countries. Large studies are needed to develop a common national strategy for the prevention of S. agalactiae infection in B&H, especially during pregnancy. Copyright© by the Medical Assotiation of Zenica-Doboj Canton.
Imidacloprid Promotes High Fat Diet-Induced Adiposity and Insulin Resistance in Male C57BL/6J Mice.
Sun, Quancai; Xiao, Xiao; Kim, Yoo; Kim, Daeyoung; Yoon, Kyoon Sup; Clark, John M; Park, Yeonhwa
2016-12-14
Imidacloprid, a neonicotinoid insecticide widely used in agriculture worldwide, has been reported to promote adipogenesis and cause insulin resistance in vitro. The purpose of the current study was to determine the effects of imidacloprid and its interaction with dietary fat in the development of adiposity and insulin resistance using male C57BL/6J mice. Imidacloprid (0.06, 0.6, or 6 mg/kg bw/day) was mixed in a low-fat (4% w/w) or high-fat (20% w/w) diet and given to mice ad libitum for 12 weeks. Imidacloprid significantly promoted high fat diet-induced body weight gain and adiposity. In addition, imidacloprid treatment with the high fat diet resulted in impaired glucose metabolism. Consistently, there were significant effects of imidacloprid on genes regulating lipid and glucose metabolisms, including the AMP-activated protein kinase-α (AMPKα) pathway in white adipose tissue and liver. These results suggest that imidacloprid may potentiate high fat diet-induced adiposity and insulin resistance in male C57BL/6J mice.
Gabriel, Ndakalimwe Naftal; Qiang, Jun; He, Jie; Ma, Xin Yu; Kpundeh, Mathew D; Xu, Pao
2015-06-01
This study investigated effects of dietary Aloe vera on growth performance, some haemato-biochemical parameters and disease resistance against Streptococcus iniae in tilapia (GIFT). Five groups were designed including a basal diet (control) and 100% A. vera powder incorporated in fish feed at 0.5% 1%, 2%, and 4%/kg feed, which were administered for 8 weeks. Fish fed 0.5%, 1%, and 2% A. vera supplemented diet significantly improved (p vera diet at 1% and 2%/kg feed. Feed efficiency ratio, feed conversion ratio, and hepatosomatic index were significantly enhanced in 4% A. vera supplemented fish over unsupplemented ones (p vera supplemented fish showed a significant increase (p vera supplemented fish showed a decrease (p vera diet at 2% and 4% A. vera/kg feed than those fed unsupplemented diet. Unchallenged fish fed 0.5%, 1%, and 2% A. vera showed significantly higher values (p vera supplemented diet. There was a significant increase (p vera unsupplemented fish and those supplemented with A. vera diet at 1%/kg feed increased significantly (p vera supplemented diet maintained higher values at all experimental stages among groups. There was a significant correlation (p Aloe had no significant effect (p > 0.05) on the survival of the fish when compared to the control; no mortality was recorded in challenge trial. Overall, our results indicated that dietary aloe supplementation could improve growth, feed utilization, and haemato-biochemical parameters of cultured tilapia. Copyright © 2015 Elsevier Ltd. All rights reserved.
streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris
African Journals Online (AJOL)
DR. AMINU
2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.
Hu, Yun; Kan, Yunchao; Zhang, Zhengtian; Lu, Zhanning; Li, Yanqiu; Leng, Chaoliang; Ji, Jun; Song, Shiyang; Shi, Hongfei
2018-02-23
Streptococcus agalactiae is a causal agent of bovine mastitis and is treated by β-lactam antibiotics (BLAs). Compared to penicillin-resistant S. agalactiae from humans, resistant strains in bovine are rarely reported. In this study, we aimed to investigate BLA resistance and mutations in penicillin-binding proteins (PBPs) of S. agalactiae in central and northeast China. The minimum inhibitory concentrations (MICs) of 129 penicillin-resistant S. agalactiae isolates from cows with mastitis were determined, and the related PBP genes were detected and sequenced. All strains were unsusceptible to penicillin G and mostly resistant to ampicillin, cefalexin, and ceftiofur sodium. One hundred twenty-nine strains were divided into 4 clonal groups and 8 sequence types by multilocus sequence typing analysis. We found a set of new substitutions in PBP1B, PBP2B, and PBP2X from most strains isolated from three provinces. The strains with high PBP mutations showed a broader unsusceptible spectrum and higher MICs than those with few or single mutation. Our research indicates unpredicted mutations in the PBP genes of S. agalactiae isolated from cows with mastitis treated by BLAs. This screening is the first of S. agalactiae from cattle.
Directory of Open Access Journals (Sweden)
Fortino Solórzano-Santos
2005-07-01
Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials
Setchanova, Lena Petrova; Alexandrova, Alexandra; Dacheva, Daniela; Mitov, Ivan; Kaneva, Radka; Mitev, Vanio
2015-02-01
A pneumococcal conjugate vaccine (PCV10) was introduced in Bulgarian national immunization program since April 2010. Clonal composition based on pulsed-field gel electrophoresis and multilocus sequence typing genotyping of 52 serotype 19A Streptococcus pneumoniae isolates was analyzed. These were invasive and respiratory isolates collected between 1992 and 2013 from both children (78.8% clone. The most frequent sequence type (ST) was ST230 (48.1%) and together with four other closely related STs (15.4%), belonging to ST1611, ST276, ST7466, and ST2013, which were single- and double-locus variants; they were included in the main CC230. The disappearance of highly drug-resistant ST663 clone and emergence of new clones as CC320 and CC199 was also observed among the rest 19A isolates. A comparison of clonal composition between invasive and noninvasive isolates did not show a great genetic diversity among both kinds of isolates. Continuous surveillance of serotype 19A population following the introduction of PCV10 is essential to evaluate the impact of the vaccine on the epidemiology of this serotype.
Xie, Pin; Hao, Xiuli; Herzberg, Martin; Luo, Yantao; Nies, Dietrich H; Wei, Gehong
2015-01-01
To better understand the diversity of metal resistance genetic determinant from microbes that survived at metal tailings in northwest of China, a highly elevated level of heavy metal containing region, genomic analyses was conducted using genome sequence of three native metal-resistant plant growth promoting bacteria (PGPB). It shows that: Mesorhizobium amorphae CCNWGS0123 contains metal transporters from P-type ATPase, CDF (Cation Diffusion Facilitator), HupE/UreJ and CHR (chromate ion transporter) family involved in copper, zinc, nickel as well as chromate resistance and homeostasis. Meanwhile, the putative CopA/CueO system is expected to mediate copper resistance in Sinorhizobium meliloti CCNWSX0020 while ZntA transporter, assisted with putative CzcD, determines zinc tolerance in Agrobacterium tumefaciens CCNWGS0286. The greenhouse experiment provides the consistent evidence of the plant growth promoting effects of these microbes on their hosts by nitrogen fixation and/or indoleacetic acid (IAA) secretion, indicating a potential in-site phytoremediation usage in the mining tailing regions of China. Copyright © 2014. Published by Elsevier B.V.
Qamar, N; Rehman, Y; Hasnain, S
2017-09-01
The aim of the study was to explore irrigation water polluted with industrial waste and corresponding cropland to screen bacteria for As detoxification and plant growth promotion. Plant growth-promoting (PGP) As-resistant cropland bacteria were isolated from contaminated irrigation water and corresponding agricultural soil. Phylogenetic analysis revealed that the isolates belonged to two distinct bacterial lineages; Firmicutes and γ-Proteobacteria. Maximum As(V) resistance was exhibited by Klebsiella pneumoniae T22 and Klebsiella oxytoca N53 (550 mmol l -1 ), whereas maximum resistance against As(III) was exhibited by K. oxytoca N53 (200 mmol l -1 ). Maximum As(V) reduction was shown by K. pneumoniae T22 (6·7 mmol l -1 ), whereas maximum As(III) oxidation was exhibited by Bacillus subtilis T23 (4·8 mmol l -1 ). As resistance genes arsB and ACR3 were detected in many of the isolates through polymerase chain reaction. Many of these isolates exhibited PGP traits such as hydrogen cyanide and auxin production as well as phosphate solubilization. The bacterial strains were able to enhance Triticum aestivum growth both in the absence and presence of As, and statistically significant increase in shoot and root lengths was observed especially in case of Acinetobacter lwoffii T24 and Citrobacter freundii N52-treated plants. Cropland bacteria have the ability to support plant growth. Bacteria of croplands irrigated with industrially polluted water develop resistance against toxicants. These bacteria are helpful for the plant growth in such contaminated lands. The bacteria capable of both As detoxification and plant growth promotion, such as A. lwoffii T24 and C. freundii N52, are ideal for remediation and reclamation of polluted lands for agriculture purposes. © 2017 The Society for Applied Microbiology.
Evaluation of the surveillance program of Streptococcus agalactiae in Danish dairy herds
DEFF Research Database (Denmark)
Andersen, H. J.; Pedersen, L. H.; Aarestrup, Frank Møller
2003-01-01
The aim of this study was to evaluate the Danish surveillance program of Streptococcus agalactiae in dairy herds with respect to 1) fluctuation over time of the presence of S. agalactiae in bulk tank milk, 2) sensitivity and specificity of the bacteriological method used, and 3) contamination...... the isolates. Streptococcus agalactiae was found in eight of 96 herds in which S. agalactiae had never previously been found during the surveillance program. Streptococcus agalactiae was not found in all seven sampling rounds in any of the eight herds. Comparing the approved method with supplemental findings...
Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.
Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor
2017-11-14
The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.
Anti-Restriction Protein, KlcAHS, Promotes Dissemination of Carbapenem Resistance
Directory of Open Access Journals (Sweden)
Xiaofei Jiang
2017-05-01
Full Text Available Carbapenemase-producing Klebsiella pneumoniae (KPC has emerged and spread throughout the world. A retrospective analysis was performed on carbapenem-resistant K. pneumoniae isolated at our teaching hospital during the period 2009–2010, when the initial outbreak occurred. To determine the mechanism(s that underlies the increased infectivity exhibited by KPC, Multilocus Sequence Typing (MLST was conducted. A series of plasmids was also extracted, sequenced and analyzed. Concurrently, the complete sequences of blaKPC−2-harboring plasmids deposited in GenBank were summarized and aligned. The blaKPC−2 and KlcAHS genes in the carbapenem-resistant K. pneumoniae isolates were examined. E. coli strains, carrying different Type I Restriction and Modification (RM systems, were selected to study the interaction between RM systems, anti-RM systems and horizontal gene transfer (HGT. The ST11 clone predominated among 102 carbapenem-resistant K. pneumoniae isolates, all harbored the blaKPC−2 gene; 98% contained the KlcAHS gene. KlcAHS was one of the core genes in the backbone region of most blaKPC−2 carrying plasmids. Type I RM systems in the host bacteria reduced the rate of pHS10842 plasmid transformation by 30- to 40-fold. Presence of the anti-restriction protein, KlcAHS, on the other hand, increased transformation efficiency by 3- to 6-fold. These results indicate that RM systems can significantly restrict HGT. In contrast, KlcAHS can disrupt the RM systems and promote HGT by transformation. These findings suggest that the anti-restriction protein, KlcAHS, represents a novel mechanism that facilitates the increased transfer of blaKPC-2 and KlcAHS-carrying plasmids among K. pneumoniae strains.
The fitness cost of antibiotic resistance in Streptococcus pneumoniae: insight from the field.
Directory of Open Access Journals (Sweden)
M Cyrus Maher
Full Text Available Laboratory studies have suggested that antibiotic resistance may result in decreased fitness in the bacteria that harbor it. Observational studies have supported this, but due to ethical and practical considerations, it is rare to have experimental control over antibiotic prescription rates.We analyze data from a 54-month longitudinal trial that monitored pneumococcal drug resistance during and after biannual mass distribution of azithromycin for the elimination of the blinding eye disease, trachoma. Prescription of azithromycin and antibiotics that can create cross-resistance to it is rare in this part of the world. As a result, we were able to follow trends in resistance with minimal influence from unmeasured antibiotic use. Using these data, we fit a probabilistic disease transmission model that included two resistant strains, corresponding to the two dominant modes of resistance to macrolide antibiotics. We estimated the relative fitness of these two strains to be 0.86 (95% CI 0.80 to 0.90, and 0.88 (95% CI 0.82 to 0.93, relative to antibiotic-sensitive strains. We then used these estimates to predict that, within 5 years of the last antibiotic treatment, there would be a 95% chance of elimination of macrolide resistance by intra-species competition alone.Although it is quite possible that the fitness cost of macrolide resistance is sufficient to ensure its eventual elimination in the absence of antibiotic selection, this process takes time, and prevention is likely the best policy in the fight against resistance.
Djavaheri, M.
2007-01-01
The plant growth-promoting rhizobacterium Pseudomonas fluorescens WCS374r effectively suppresses fusarium wilt in radish by induced systemic resistance (ISR). In radish, WCS374r-mediated ISR depends partly on iron-regulated metabolites. Under iron-limiting conditions, P. fluorescens WCS374r produces
Seeing Streptococcus pneumoniae, a Common Killer Bacteria
DEFF Research Database (Denmark)
Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth
2014-01-01
Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...
Rurangirwa, F R; Teitzel, C A; Cui, J; French, D M; McDonough, P L; Besser, T
2000-03-01
beta-Haemolytic, catalase-positive, Gram-positive cocci that formed chains in broth media but did not react with Lancefield group antisera were isolated from skin lesions, spleen, liver and lungs of nine opossums, including eight from a research colony and one from a wildlife rehabilitation organization. The isolates had vigorous catalase activity that was retained on initial passage on non-blood-containing media, but this activity was lost in subsequent passages. The use of standard phenotypic tests did not lead to satisfactory identification of these organisms beyond the genus level, even if the aberrant catalase reaction was not considered. The 16S rRNA gene sequence of the isolates was most similar (96%) to Streptococcus dysgalactiae, but distinct from that species as 16S rRNA gene similarity of different strains of S. dysgalactiae was > 99%. Characterization of biochemical reactions and cell-wall fatty acid profiles also revealed significant differences between the opossum isolates and all other known Streptococcus spp., thus it is proposed as a new species with the name Streptococcus didelphis, sp. nov. The type strain is ATCC 700828T.
Directory of Open Access Journals (Sweden)
Margarida Carrolo
Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.
Fouad, A F; Kum, K-Y; Clawson, M L; Barry, J; Abenoja, C; Zhu, Q; Caimano, M; Radolf, J D
2003-08-01
Eubacterium spp. and Streptococcus spp. are virulent, commonly identified microorganisms in endodontic infections. The purpose of this study was to use molecular methods to identify these organisms in 22 infected root canals that include eight cases with preoperative clinical symptoms and five cases with a history of diabetes mellitus. The presence of Streptococcus spp. and Eubacterium spp. was examined using two sets of PCR primers specific with multiple species within the respective genera. Positive specimens had their PCR products sequenced and phylogenetically analyzed to identify the specific species. Sixteen specimens (73%) contained Eubacterium spp. and nine (41%) were positive for Streptococcus spp. Eubacterium infirmum was the most prevalent Eubacterium sp. This organism was significantly associated with a history of diabetes (OR = 9.6; P = 0.04). Streptococcus anginosus was the most common Streptococcus sp., but neither it nor any of the other streptococci were significantly associated with the clinical parameters evaluated.
Comparing the cariogenic species Streptococcus sobrinus and S. mutans on whole genome level
Directory of Open Access Journals (Sweden)
Georg Conrads
2014-12-01
Full Text Available Background: Two closely related species of mutans streptococci, namely Streptococcus mutans and Streptococcus sobrinus, are associated with dental caries in humans. Their acidogenic and aciduric capacity is directly associated with the cariogenic potential of these bacteria. To survive acidic and temporarily harsh conditions in the human oral cavity with hundreds of other microbial co-colonizers as competitors, both species have developed numerous mechanisms for adaptation. Objectives: The recently published novel genome information for both species is used to elucidate genetic similarities but especially differences and to discuss the impact on cariogenicity of the corresponding phenotypic properties including adhesion, carbohydrate uptake and fermentation, acid tolerance, signaling by two component systems, competence, and oxidative stress resistance. Conclusions: S. sobrinus can down-regulate the SpaA-mediated adherence to the pellicle. It has a smaller number of two-component signaling systems and bacteriocin-related genes than S. mutans, but all or even more immunity proteins. It lacks the central competence genes comC, comS, and comR. There are more genes coding for glucosyltransferases and a novel energy production pathway formed by lactate oxidase, which is not found in S. mutans. Both species show considerable differences in the regulation of fructan catabolism. However, both S. mutans and S. sobrinus share most of these traits and should therefore be considered as equally virulent with regard to dental caries.
Chlorophyll mediated photodynamic inactivation of blue laser on Streptococcus mutans
Astuti, Suryani Dyah; Zaidan, A.; Setiawati, Ernie Maduratna; Suhariningsih
2016-03-01
Photodynamic inactivation is an inactivation method in microbial pathogens that utilize light and photosensitizer. This study was conducted to investigate photodynamic inactivation effects of low intensity laser exposure with various dose energy on Streptococcus mutans bacteria. The photodynamic inactivation was achieved with the addition of chlorophyll as photosensitizers. To determine the survival percentage of Streptococcus mutans bacteria after laser exposure, the total plate count method was used. For this study, the wavelength of the laser is 405 nm and variables of energy doses are 1.44, 2.87, 4.31, 5.74, 7.18, and 8.61 in J/cm2. The results show that exposure to laser with energy dose of 7.18 J/cm2 has the best photodynamic inactivation with a decrease of 78% in Streptococcus
Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji
2012-03-01
The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited
DEFF Research Database (Denmark)
Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina
2004-01-01
Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. pernillemartens@yahoo.com BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...
The antibacterial effect of four mouthwashes against streptococcus mutans and escherichia coli.
Ghapanchi, Janan; Lavaee, Fatemeh; Moattari, Afagh; Shakib, Mahmood
2015-04-01
To evaluate the antimicrobial properties of several mouthwash concentrations on oral Streptococcus mutans and Escherichia coli. The study was conducted at Shiraz Medicine School in 2011. Serial dilutions of Chlorohexidin, Oral B and Persica and Irsha (2,4,8,16,64,128) were prepared in Muller-Hinton media. Minimum inhibitory concentration was visually determined and defined as the lowest concentration of each oral washing which inhibited > 95% growth reduction compared to the growth control well. Chlorhexidine, Oral B and Irsha mouthwash inhibited Streptococcus mutans even with diluted concentrations. Also, Chlorhexidine and Oral B prohibited Escherichia coli with different potencies. But Persica had no antimicrobial activity against either Escherichia coli or Streptococcus mutans. Chlorhexidine, Irsha, and Oral B mouthwashes can be used for antimicrobial effects, especially on Streptococcus mutans. This chemical activity of mouthwashes is an adjuvant for mechanical removing of plaque. However, the antimicrobial effect of Persicaremains controversial.
Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.
Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius
2014-01-01
Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.
Antibacterial activity and mechanism of berberine against Streptococcus agalactiae.
Peng, Lianci; Kang, Shuai; Yin, Zhongqiong; Jia, Renyong; Song, Xu; Li, Li; Li, Zhengwen; Zou, Yuanfeng; Liang, Xiaoxia; Li, Lixia; He, Changliang; Ye, Gang; Yin, Lizi; Shi, Fei; Lv, Cheng; Jing, Bo
2015-01-01
The antibacterial activity and mechanism of berberine against Streptococcus agalactiae were investigated in this study by analyzing the growth, morphology and protein of the S. agalactiae cells treated with berberine. The antibacterial susceptibility test result indicated minimum inhibition concentration (MIC) of berberine against Streptococcus agalactiae was 78 μg/mL and the time-kill curves showed the correlation of concentration-time. After the bacteria was exposed to 78 μg/mL berberine, the fragmentary cell membrane and cells unequal division were observed by the transmission electron microscopy (TEM), indicating the bacterial cells were severely damaged. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) study demonstrated that berberine could damage bacterial cells through destroying cellular proteins. Meanwhile, Fluorescence microscope revealed that berberine could affect the synthesis of DNA. In conclusion, these results strongly suggested that berberine may damage the structure of bacterial cell membrane and inhibit synthesis of protein and DNA, which cause Streptococcus agalactiae bacteria to die eventually.
Directory of Open Access Journals (Sweden)
Atul Kakrana
2017-12-01
Full Text Available The root-knot nematode (RKN, Meloidogyne incognita, is an obligate, sedentary endoparasite that infects a large number of crops and severely affects productivity. The commonly used nematode control strategies have their own limitations. Of late, RNA interference (RNAi has become a popular approach for the development of nematode resistance in plants. Transgenic crops capable of expressing dsRNAs, specifically in roots for disrupting the parasitic process, offer an effective and efficient means of producing resistant crops. We identified nematode-responsive and root-specific (NRRS promoters by using microarray data from the public domain and known conserved cis-elements. A set of 51 NRRS genes was identified which was narrowed down further on the basis of presence of cis-elements combined with minimal expression in the absence of nematode infection. The comparative analysis of promoters from the enriched NRRS set, along with earlier reported nematode-responsive genes, led to the identification of specific cis-elements. The promoters of two candidate genes were used to generate transgenic plants harboring promoter GUS constructs and tested in planta against nematodes. Both promoters showed preferential expression upon nematode infection, exclusively in the root in one and galls in the other. One of these NRRS promoters was used to drive the expression of splicing factor, a nematode-specific gene, for generating host-delivered RNAi-mediated nematode-resistant plants. Transgenic lines expressing dsRNA of splicing factor under the NRRS promoter exhibited upto a 32% reduction in number of galls compared to control plants.
Plasmids replicatable in Bacillus subtilis, E. coli and lactic acid streptococcus bacteria
Kok, Jan; Maat, Jan; van der Vossen, Josephus Mauritius; Venema, Gerard
1997-01-01
The claimed invention is drawn to a recombinant plasmid which can replicate in Bacillus subtilis, Escherichia coli, and lactic acid Streptococcus bacteria comprising the replication of origin from Streptococcus cremoris plasmid pWV01 as its origin of replication, in addition to coding marker genes
Genetic analysis of Streptococcus agalactiae strains isolated from neonates and their mothers.
Melchers, W.J.G.; Bakkers, J.M.J.E.; Toonen, M.; Kuppeveld, F.J.M. van; Trijbels-Smeulders, M.J.A.M.; Hoogkamp-Korstanje, J.A.A.
2003-01-01
Streptococcus agalactiae or group B streptococcus (GBS) is the most common cause of neonatal sepsis and meningitis in neonates. One of the major questions is whether the GBS strains able to cause neonatal invasive disease have peculiar genetic features. A collection of S. agalactiae strains,
Weissella confusa: a rare cause of vancomycin-resistant Gram-positive bacteraemia.
Kumar, Anil; Augustine, Deepthi; Sudhindran, S; Kurian, Anu M; Dinesh, Kavitha R; Karim, Shamsul; Philip, Rosamma
2011-10-01
We describe a case of bacteraemia caused by Weissella confusa in a 48-year-old male who was operated on for adenocarcinoma of the gastro-oesophageal junction and maintained on total parenteral nutrition. Blood cultures were positive for a vancomycin-resistant streptococcus-like organism which was identified as W. confusa by 16S rRNA gene sequencing.
Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.
Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K
2016-02-01
A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.
STREPTOCOCCUS: A WORLDWIDE FISH HEALTH PROBLEM
Streptococcus iniae and S. agalactiae are important emergent pathogens that affect many fish species worldwide, especially in warm-water regions. In marine and freshwater systems, these Gram-positive bacteria cause significant economic losses, estimated at hundreds of millions of dollars annually. ...
NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE
Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.
2011-01-01
The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are
Saini, Shalini; Bharati, Kavita; Shaha, Chandrima; Mukhopadhyay, Chinmay K
2017-09-05
Micronutrients are essential for survival and growth for all the organisms including pathogens. In this manuscript, we report that zinc (Zn) chelator N,N,N',N'-tetrakis(2-pyridinylmethyl)-1,2-ethylenediamine (TPEN) affects growth and viability of intracellular pathogen Leishmania donovani (LD) by a concentration and time dependent manner. Simultaneous addition of zinc salt reverses the effect of TPEN. Further experiments provide evidence of apoptosis-like death of the parasite due to Zn-depletion. TPEN treatment enhances caspase-like activity suggesting increase in apoptosis-like events in LD. Specific inhibitors of cathepsin B and Endoclease G block TPEN-induced leishmanial death. Evidences show involvement of reactive oxygen species (ROS) potentially of extra-mitochondrial origin in TPEN-induced LD death. Pentavalent antimonials remained the prime source of treatment against leishmaniasis for several decades; however, antimony-resistant Leishmania is now common source of the disease. We also reveal that Zn-depletion can promote apoptosis-like death in antimony-resistant parasites. In summary, we present a new finding about the role of zinc in the survival of drug sensitive and antimony-resistant LD.
Effects of Salts and Metal Oxides on Electrochemical and Optical Properties of Streptococcus mutans
Kawai, Tsuyoshi; Nagame, Seigo; Kambara, Masaki; Yoshino, Katsumi
1994-10-01
The effects of calcium salts and metal oxide powders on electrochemical, optical and biological properties of Streptococcus mutans have been studied as a novel method to determine the strain. Electrochemical signals of Streptococcus mutans show remarkable decrease in the presence of saturated calcium salts such as CaHPO4, Ca3(PO4)2, and Ca5(PO4)3OH depending on the strains of Streptococcus mutans: Ingbritt, NCTC-10449, or GS-5. The number of viable cells also decreases upon addition of these powders. The effects of metal oxides such as ZnO and BaTiO3 on the electrochemical characteristics and photoluminescence of Streptococcus mutans have also been studied.
Occurrence, isolation and DNA identification of Streptococcus ...
African Journals Online (AJOL)
ajl yemi
2011-11-28
Nov 28, 2011 ... Streptococcus thermophilus involved in Algerian ... among reference, and wild strains of S. thermophilus and for their differentiation from Enterococcus spp. ..... Isolation and characterization of Lactobacillus delbrueckii ssp.
Zerovalent bismuth nanoparticles inhibit Streptococcus mutans growth and formation of biofilm
Directory of Open Access Journals (Sweden)
Hernandez-Delgadillo R
2012-04-01
Full Text Available Rene Hernandez-Delgadillo1, Donaji Velasco-Arias2, David Diaz2, Katiushka Arevalo-Niño1, Marianela Garza-Enriquez1, Myriam A De la Garza-Ramos1, Claudio Cabral-Romero11Instituto de Biotecnologia, Centro de Investigacion y Desarrollo en Ciencias de la Salud, CIDICS, Facultad de Odontologia, Universidad Autonoma de Nuevo Leon, UANL, Monterrey, Nuevo Leon, 2Facultad de Quimica, Universidad Nacional Autonoma de Mexico, Distrito Federal, MexicoBackground and methods: Despite continuous efforts, the increasing prevalence of resistance among pathogenic bacteria to common antibiotics has become one of the most significant concerns in modern medicine. Nanostructured materials are used in many fields, including biological sciences and medicine. While some bismuth derivatives has been used in medicine to treat vomiting, nausea, diarrhea, and stomach pain, the biocidal activity of zerovalent bismuth nanoparticles has not yet been studied. The objective of this investigation was to analyze the antimicrobial activity of bismuth nanoparticles against oral bacteria and their antibiofilm capabilities.Results: Our results showed that stable colloidal bismuth nanoparticles had 69% antimicrobial activity against Streptococcus mutans growth and achieved complete inhibition of biofilm formation. These results are similar to those obtained with chlorhexidine, the most commonly used oral antiseptic agent. The minimal inhibitory concentration of bismuth nanoparticles that interfered with S. mutans growth was 0.5 mM.Conclusion: These results suggest that zerovalent bismuth nanoparticles could be an interesting antimicrobial agent to be incorporated into an oral antiseptic preparation.Keywords: zerovalent bismuth nanoparticles, antimicrobial agent, biofilm, Streptococcus mutans
Dual infection by streptococcus and atypical mycobacteria following Ahmed glaucoma valve surgery.
Rao, Aparna; Wallang, Batriti; Padhy, Tapas Ranjan; Mittal, Ruchi; Sharma, Savitri
2013-07-01
To report a case of late postoperative endophthalmitis caused by Streptococcus pneumoniae and conjunctival necrosis by Streptococcus pneumoniae and Mycobacterium fortuitum following Ahmed glaucoma valve (AGV) surgery in a young patient. Case report of a 13-year-old boy with purulent exudates and extensive conjunctival necrosis two months following amniotic membrane graft and conjunctival closure (for conjunctival retraction post AGV for secondary glaucoma). The conjunctiva showed extensive necrosis causing exposure of the tube and plate associated with frank exudates in the area adjoining the plate and anterior chamber mandating explantation of the plate along with intravitreal antibiotics. The vitreous aspirate grew Streptococcus pneumoniae while Streptococcus pneumoniae with Mycobacterium fortuitum was isolated from the explanted plate. Despite adequate control of infection following surgery, the final visual outcome was poor owing to disc pallor. Conjunctival necrosis and retraction post-AGV can cause late postoperative co-infections by fulminant and slow-growing organisms. A close follow-up is therefore essential in these cases to prevent sight-threatening complications.
Directory of Open Access Journals (Sweden)
Denise Madalena Palomari Spolidorio
2003-07-01
Full Text Available The aim of this study was to determine whether random amplified polymorphic DNA (AP-PCR analysis is able to differentiate genetically different clones of mutans streptococci, in 22 Brazilian family members. Stimulated saliva samples were collected from fathers, mothers and infants. For 5-18 months babies with erupting primary dentition, plaque samples were collected using sterile tooth pick tips. From these samples, mutans streptococci were isolated on SB-20 agar plates. After growth, representative colonies were identified by biochemical methods on the basis of carbohydrate fermentation. Streptococcus mutans isolates were obtained from all family members and AP-PCR typed separately with a random primer (OPA-13. Bacterial cell lysates were used as template in PCR reactions and the amplified DNA fragments obtained were compared by agarose gel electrophoresis. Results demonstrated that the father shared the baby's genotype in three families and the mother shared the baby's genotype in 12 families seven babies harbored Streptococcus mutans strains similar to those of their siblings. The technique was able to demonstrate the genetic Streptococcus mutans in Brazilian family members.O objetivo deste estudo foi determinar, através da técnica de reação em cadeia da polimerase com primers arbitrários (AP-PCR a capacidade de diferenciar clones geneticamente distintos de Streptococcus mutans e estabelecer o grau de similaridade intrafamilial para os isolados. Para o presente estudo, foram selecionadas 22 famílias brasileiras. Amostras de saliva foram coletadas de todos os membros das famílias. Das crianças com idade entre 5-18 meses obteve-se amostras de placa dental. Após o isolamento das colônias com características morfológicas, realizou-se a identificação bioquímica com base na fermentação de carboidratos. O polimorfismo genético de Streptococcus mutans foi pesquisado através da técnica de AP-PCR utilizando-se o primer OPA-13. Os
Soekanto, Sri Angky; Bachtiar, Endang W.; Jiwanakusuma, Pramodanti; Gladea, Zahara; Sahlan, Muhamad
2018-02-01
This study was to evaluate the effect of Propolis Honey candy on Streptococcus mutans prevalence in caries and caries-free subject. The subject of this research was caries and caries-free subjects. The Streptococcus mutans colony was counted in saliva samples before and after a 7-day period of consuming Propolis Honey candy, Honey candy, and "X" candy. The Streptococcus mutans was proliferated in a TYS20B gelatin medium for 48 hours. The number of Streptococcus mutans colonies was expressed in CFU/ml. Compared with the pre-treatment group, the number of Streptococcus mutans colonies in the treatment group tends to show a statistically significant reduction (pcaries-free subject. In caries subject, the result of Propolis honey candy were also lower (2.2×107 CFU/ml) than before (5.8×109 CFU/ml). The study showed a decrease in the number of Streptococcus mutans colonies from caries and caries-free subjects after propolis honey candy consumption.
DEFF Research Database (Denmark)
Wegener, Henrik Caspar; Aarestrup, Frank Møller; Jensen, Lars Bogø
1999-01-01
on the Tn1546 transposon. Furthermore, glycopeptide-resistant strains, as well as resistance determinants, can be transmitted from animals to humans. Two antimicrobial classes expected to provide the future therapeutic options for treatment of infections with vancomycin-resistant enterococci have analogues......Supplementing animal feed with antimicrobial agents to enhance growth has been common practice for more than 30 years and is estimated to constitute more than half the total antimicrobial use worldwide. The potential public health consequences of this use have been debated; however, until recently......, clear evidence of a health risk was not available. Accumulating evidence now indicates that the use of the glycopeptide avoparcin as a growth promoter has created in food animals a major reservoir of Enterococcus faecium, which contains the high level glycopeptide resistance determinant vanA, located...
Distribusi Streptococcus mutans pada Tepi Tumpatan Glass Ionomer
Directory of Open Access Journals (Sweden)
Abdul Muthalib
2015-10-01
Full Text Available Secondary caries always occurs as a result of the filling not being hermetically. Purposes of this research is to prove whether there is a leak on the border of the tooth enamel and border between the Glass-ionomer filling with the Streptococcus mutans infection with parameter of SMAAPPI (Simplified S. mutans Approximal Plaque Index by Keeni et al, 1981. The subject of the research were 20 patients who came to the Dental Clinic at University of Indonesia with criteria possessing Glass-ionomer filling at the lower jaws. Collection of the samples were dental plaque gathered using a 1.5 mm excavator to scrape one way direction from the enamel, along the border between the enamel and Glass-ionomer filling and Glass-ionomer filling's surface. Isolation with medium transport sem-synthetic Cariostat and TSY20B and identification by using biochemical test. isolated colony strain local Streptococcus mutans from enamel, the border enamel and Glass-ionomer and the surface of the Glass-ionomer. The results were Streptococcus mutans were found from enamel 3006 colonies, on the border between the enamel and Glass-ionomer 143 colonies and on the surface of the Glss-ionomer 7291 colonies. Amoung of Streptococcus mutans colony obtained on the border of the enamel and Glass-ionomer were smaller compared to the surface of the Glass-ionomer and tooth enamel. Concluded that the leak of the filling was not caused by the number of distributed Streptooccus mutans colonies on the side, because the fluoroapatite fastener occurred due to the Glass-ionomer releasing in fluor along the border of the filling.
Directory of Open Access Journals (Sweden)
Junping eWang
2015-09-01
Full Text Available Muramidase-released protein (MRP is as an important virulence marker of Streptococcus suis (S. suis serotype 2. Our previous works have shown that MRP can bind human fibrinogen (hFg; however, the function of this interaction in S.suis meningitis is not known. In this study, we found that the deletion of mrp significantly impairs the hFg-mediated adherence and traversal ability of S. suis across human cerebral microvascular endothelial cells (hCMEC/D3. Measurement of the permeability to Lucifer yellow in vitro and Evans blue extravasation in vivo show that the MRP-hFg interaction significantly increases the permeability of the blood-brain barrier (BBB. In the mouse meningitis model, wild type S. suis caused higher bacterial loads in the brain and more severe histopathological signs of meningitis than the mrp mutant at day 3 post-infection. Western blot analysis and immunofluorescence observations reveal that the MRP-hFg interaction can destroy the cell adherens junction protein p120-catenin of hCMEC/D3. These results indicate that the MRP-hFg interaction is important in the development of S. suis meningitis.
Streptococcus suis meningitis in the Netherlands
van de Beek, Diederik; Spanjaard, Lodewijk; de Gans, Jan
2008-01-01
We present four patients with Streptococcus suis meningitis identified during a 3.5-year prospective surveillance study in the Netherlands. All cases were associated with exposure to pigs. Patients presented with classic symptoms and signs of bacterial meningitis. Outcome was characterized by severe
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-12-01
Full Text Available In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type strain grown at a restricted concentration of cysteine (0.03 mM to one grown at a high concentration of cysteine (50 mM in chemically-define medium (CDM revealed elevated expression of various genes/operons, i.e. spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes.
Vaillancourt, Katy; LeBel, Geneviève; Frenette, Michel; Fittipaldi, Nahuel; Gottschalk, Marcelo; Grenier, Daniel
2015-01-01
Bacteriocins are antimicrobial peptides of bacterial origin that are considered as a promising alternative to the use of conventional antibiotics. Recently, our laboratory reported the purification and characterization of two lantibiotics, suicin 90-1330 and suicin 3908, produced by the swine pathogen and zoonotic agent Streptococcus suis (serotype 2). In this study, a novel bacteriocin produced by S. suis has been identified and characterized. The producing strain S. suis 65 (serotype 2) was found to belong to the sequence type 28, that includes strains known to be weakly or avirulent in a mouse model. The bacteriocin, whose production was only possible following growth on solid culture medium, was purified to homogeneity by cationic exchange and reversed-phase high-pressure liquid chromatography. The bacteriocin, named suicin 65, was heat, pH and protease resistant. Suicin 65 was active against all S. suis isolates tested, including antibiotic resistant strains. Amino acid sequencing of the purified bacteriocin by Edman degradation revealed the presence of modified amino acids suggesting a lantibiotic. Using the partial sequence obtained, a blast was performed against published genomes of S. suis and allowed to identify a putative lantibiotic locus in the genome of S. suis 89-1591. From this genome, primers were designed and the gene cluster involved in the production of suicin 65 by S. suis 65 was amplified by PCR. Sequence analysis revealed the presence of ten open reading frames, including a duplicate of the structural gene. The structural genes (sssA and sssA') of suicin 65 encodes a 25-amino acid residue leader peptide and a 26-amino acid residue mature peptide yielding an active bacteriocin with a deducted molecular mass of 3,005 Da. Mature suicin 65 showed a high degree of identity with class I type B lantibiotics (globular structure) produced by Streptococcus pyogenes (streptococcin FF22; 84.6%), Streptococcus macedonicus (macedocin ACA-DC 198; 84
Directory of Open Access Journals (Sweden)
Katy Vaillancourt
Full Text Available Bacteriocins are antimicrobial peptides of bacterial origin that are considered as a promising alternative to the use of conventional antibiotics. Recently, our laboratory reported the purification and characterization of two lantibiotics, suicin 90-1330 and suicin 3908, produced by the swine pathogen and zoonotic agent Streptococcus suis (serotype 2. In this study, a novel bacteriocin produced by S. suis has been identified and characterized. The producing strain S. suis 65 (serotype 2 was found to belong to the sequence type 28, that includes strains known to be weakly or avirulent in a mouse model. The bacteriocin, whose production was only possible following growth on solid culture medium, was purified to homogeneity by cationic exchange and reversed-phase high-pressure liquid chromatography. The bacteriocin, named suicin 65, was heat, pH and protease resistant. Suicin 65 was active against all S. suis isolates tested, including antibiotic resistant strains. Amino acid sequencing of the purified bacteriocin by Edman degradation revealed the presence of modified amino acids suggesting a lantibiotic. Using the partial sequence obtained, a blast was performed against published genomes of S. suis and allowed to identify a putative lantibiotic locus in the genome of S. suis 89-1591. From this genome, primers were designed and the gene cluster involved in the production of suicin 65 by S. suis 65 was amplified by PCR. Sequence analysis revealed the presence of ten open reading frames, including a duplicate of the structural gene. The structural genes (sssA and sssA' of suicin 65 encodes a 25-amino acid residue leader peptide and a 26-amino acid residue mature peptide yielding an active bacteriocin with a deducted molecular mass of 3,005 Da. Mature suicin 65 showed a high degree of identity with class I type B lantibiotics (globular structure produced by Streptococcus pyogenes (streptococcin FF22; 84.6%, Streptococcus macedonicus (macedocin ACA
[Antibacterial activity of rare Streptomyces species against clinical resistant bacteria].
Boughachiche, Faiza; Reghioua, Sihem; Zerizer, Habiba; Boulahrouf, Abderrahmane
2012-01-01
In the search for new antibiotics from Steptomyces, investigating extremes habitats enhances the probability of isolating novel producers. In this context, the antibacterial activity of four Streptomyces strains isolated from Ezzmoul saltpans was studied. Two of them showed antibacterial activity against antibiotic's resistant bacteria (Bacillus cereus: β-lactamines and sulfamides resistant, Streptococcus faecalis: penicillin, tetracycline and cotrimoxazole resistant, and Staphylococcus aureus Mu 50: vancomycine resistant). The most active Streptomyces strain produces one type of polar bioactive molecules that resists to temperature variation and light exposition. Its activity appears in the first culture day and reaches its maximal value in the fourth day. The second strain presents themoresistant activity that reaches its maximal value in the first culture day. It produces two types of bioactive molecules, one is polar and the second is non polar (according to thin layer chromatography technique results).
Seol, B; Kelneric, Z; Hajsig, D; Madic, J; Naglic, T
1996-03-01
The minimal inhibitory concentrations (MICs) for thirty-three epidemiologicaly unrelated clinical isolates of Streptococcus suis capsular type 2 were determined in relation to ampicillin, ampicillin-sulbactam, amoxicillin, clavulanate-amoxicillin, penicillin G, cephalexin, gentamicin, streptomycin, erythromycin, tylosin and doxycycline, using the microtitre broth dilution procedure described by the U.S. National Committee for Clinical Laboratory Standards (NCCLS). Gentamicin was the most active compound tested, with an MIC for 90% of the strains tested (MIC(90)) of 0.4 mg/L. Overall, 70% of strains were resistant to doxycycline (MIC(90) > or = 100.0 mg/L), followed by penicillin G (51% of strains) (MIC(90) + or = 100.0 mg/L). Resistance to amoxicillin and ampicillin was 36.4% (MIC(90) 12.5 mg/L) and 33.3% (MIC(90) 50.0 mg/L), respectively. 15.2% of S. suis strains were resistant to streptomycin, tylosin and cephalexin with MIC90 values of 25.0 mg/L, 12.5 mg/L and 25.0 mg/L, respectively. A combination of ampicillin and sulbactam (MIC(90) 6.3 mg/L) and a combination of amoxicillin and clavulanate (MIC(90) 3.1 mg/L) as well as erythromycin (1.6 mg/L) were of the same efficacy, with a total of 9.1% resistant S. suis strains. This high percentage of resistance to doxycycline and penicillin G precludes the use of these antibiotics as empiric therapy of swine diseases.
Teng, Jade L L; Huang, Yi; Tse, Herman; Chen, Jonathan H K; Tang, Ying; Lau, Susanna K P; Woo, Patrick C Y
2014-10-20
Streptococcus sinensis is a recently discovered human pathogen isolated from blood cultures of patients with infective endocarditis. Its phylogenetic position, as well as those of its closely related species, remains inconclusive when single genes were used for phylogenetic analysis. For example, S. sinensis branched out from members of the anginosus, mitis, and sanguinis groups in the 16S ribosomal RNA gene phylogenetic tree, but it was clustered with members of the anginosus and sanguinis groups when groEL gene sequences used for analysis. In this study, we sequenced the draft genome of S. sinensis and used a polyphasic approach, including concatenated genes, whole genomes, and matrix-assisted laser desorption ionization-time of flight mass spectrometry to analyze the phylogeny of S. sinensis. The size of the S. sinensis draft genome is 2.06 Mb, with GC content of 42.2%. Phylogenetic analysis using 50 concatenated genes or whole genomes revealed that S. sinensis formed a distinct cluster with Streptococcus oligofermentans and Streptococcus cristatus, and these three streptococci were clustered with the "sanguinis group." As for phylogenetic analysis using hierarchical cluster analysis of the mass spectra of streptococci, S. sinensis also formed a distinct cluster with S. oligofermentans and S. cristatus, but these three streptococci were clustered with the "mitis group." On the basis of the findings, we propose a novel group, named "sinensis group," to include S. sinensis, S. oligofermentans, and S. cristatus, in the Streptococcus genus. Our study also illustrates the power of phylogenomic analyses for resolving ambiguities in bacterial taxonomy. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Directory of Open Access Journals (Sweden)
Sonia Ktari
2017-12-01
Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia
Van Doan, Hien; Hoseinifar, Seyed Hossein; Tapingkae, Wanaporn; Khamtavee, Pimporn
2017-03-01
The present study evaluates the effects of dietary kefir and low molecular weight sodium alginate (LWMSA) (singular or combined) on non-specific immune response, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus). Fish with average weight of 18.60 ± 0.04 g were supplied and randomly stocked in sixteen glass tanks (150 L) at density of 20 fish per tank. Fish were fed experimental diets as follows: 0 g kg -1 LMWSA (Control, Diet 1), 10 g kg -1 LMWSA (Diet 2), 40 g kg -1 kefir (Diet 3), and 10 g kg -1 LMWSA + 40 g kg -1 kefir (Diet 4) for 50 days. At the end of the feeding trial, serum lysozyme (SL), phagocytosis (PI), respiratory burst (RB), and alternative complement (ACH50) activities as well as growth performance were measured. Singular and combined administration of kefir and low molecular weight sodium alginate (LMWSA) significantly increased serum SL, PI, RB, and ACH50 activities compared control group (P < 0.05); the highest innate immune responses were observed in fish fed combinational diet (kefir + LMWSA) (P < 0.05). The results of experimental challenge revealed significantly higher resistance against Streptococcus agalactiae in fish fed supplemented diets and the highest post challenge survival rate was observed in synbiotic diet (P < 0.05). Similar results obtained in case of growth parameters. Feeding on supplemented diet significantly improved SGR and FCR and the highest growth parameters was observed in fish fed synbiotic diet (P < 0.05). These finding revealed that combined administration of dietary kefir and LMWSA can be considered for improving immune response, disease resistance and growth performance of Nile tilapia. Copyright © 2017 Elsevier Ltd. All rights reserved.
Comparing the cariogenic species Streptococcus sobrinus and S. mutans on whole genome level
Conrads, G.; de Soet, J.J.; Song, L.; Henne, K.; Sztajer, H.; Wagner-Döbler, I.; Zeng, A.P.
2014-01-01
Background: Two closely related species of mutans streptococci, namely Streptococcus mutans and Streptococcus sobrinus, are associated with dental caries in humans. Their acidogenic and aciduric capacity is directly associated with the cariogenic potential of these bacteria. To survive acidic and
Cigarette smoke promotes drug resistance and expansion of cancer stem cell-like side population.
Directory of Open Access Journals (Sweden)
Yi An
Full Text Available It is well known that many patients continue to smoke cigarettes after being diagnosed with cancer. Although smoking cessation has typically been presumed to possess little therapeutic value for cancer, a growing body of evidence suggests that continued smoking is associated with reduced efficacy of treatment and a higher incidence of recurrence. We therefore investigated the effect of cigarette smoke condensate (CSC on drug resistance in the lung cancer and head and neck cancer cell lines A549 and UMSCC-10B, respectively. Our results showed that CSC significantly increased the cellular efflux of doxorubicin and mitoxantrone. This was accompanied by membrane localization and increased expression of the multi-drug transporter ABCG2. The induced efflux of doxorubicin was reversed upon addition of the specific ABCG2 inhibitor Fumitremorgin C, confirming the role of ABCG2. Treatment with CSC increased the concentration of phosphorylated Akt, while addition of the PI3K inhibitor LY294002 blocked doxorubicin extrusion, suggesting that Akt activation is required for CSC-induced drug efflux. In addition, CSC was found to promote resistance to doxorubicin as determined by MTS assays. This CSC-induced doxurbicin-resistance was mitigated by mecamylamine, a nicotinic acetylcholine receptor inhibitor, suggesting that nicotine is at least partially responsible for the effect of CSC. Lastly, CSC increased the size of the side population (SP, which has been linked to a cancer stem cell-like phenotype. In summary, CSC promotes chemoresistance via Akt-mediated regulation of ABCG2 activity, and may also increase the proportion of cancer stem-like cells, contributing to tumor resilience. These findings underscore the importance of smoking cessation following a diagnosis of cancer, and elucidate the mechanisms of continued smoking that may be detrimental to treatment.
The influence of oral Veillonella species on biofilms formed by Streptococcus species.
Mashima, Izumi; Nakazawa, Futoshi
2014-08-01
Oral Veillonella, Veillonella atypica, Veillonella denticariosi, Veillonella dispar, Veillonella parvula, Veillonella rogosae, and Veillonella tobetsuensis are known as early colonizers in oral biofilm formation. To investigate the role of oral Veillonella, biofilms formed by the co-culture of Streptococcus gordonii, Streptococcus mutans, Streptococcus salivarius, or Streptococcus sanguinis, with oral Veillonella were examined at the species level. The amount of biofilm formed by S. mutans, S. gordonii, and S. salivarius in the presence of the six Veillonella species was greater than that formed in the control experiments, with the exception of S. mutans with V. dispar. In contrast, in the case of biofilm formation by S. sanguinis, the presence of Veillonella species reduced the amount of the biofilm, with the exception of V. parvula and V. dispar. The time-dependent changes in the amount of biofilm and the number of planktonic cells were grouped into four patterns over the 24 combinations. Only that of S. gordonii with V. tobetsuensis showed a unique pattern. These results indicate that the mode of action of this combination differed from that of the other combinations with respect to biofilm formation. It is possible that there may be several factors involved in the interaction between Streptococcus and Veillonella species. Copyright © 2014 Elsevier Ltd. All rights reserved.
Streptococcus caviae sp. nov., isolated from guinea pig faecal samples.
Palakawong Na Ayudthaya, Susakul; Hilderink, Loes J; Oost, John van der; Vos, Willem M de; Plugge, Caroline M
2017-05-01
A novel cellobiose-degrading and lactate-producing bacterium, strain Cavy grass 6T, was isolated from faecal samples of guinea pigs (Cavia porcellus). Cells of the strain were ovalshaped, non-motile, non-spore-forming, Gram-stain-positive and facultatively anaerobic. The strain gr at 25-40 °C (optimum 37 °C) and pH 4.5-9.5 (optimum 8.0). Phylogenetic analysis based on 16S rRNA gene sequences showed that strain Cavy grass 6T belongs to the genus Streptococcus with its closest relative being Streptococcus devriesei CCUG 47155T with only 96.5 % similarity. Comparing strain Cavy grass 6T and Streptococcus devriesei CCUG 47155T, average nucleotide identity and level of digital DNA-DNA hybridization dDDH were only 86.9 and 33.3 %, respectively. Housekeeping genes groEL and gyrA were different between strain Cavy grass 6T and other streptococci. The G+C content of strain Cavy grass 6T was 42.6±0.3 mol%. The major (>10 %) cellular fatty acids of strain Cavy grass 6T were C16:0, C20 : 1ω9c and summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c). Strain Cavy grass 6T ferment a range of plant mono- and disaccharides as well as polymeric carbohydrates, including cellobiose, dulcitol, d-glucose, maltose, raffinose, sucrose, l-sorbose, trehalose, inulin and dried grass extract, to lactate, formate, acetate and ethanol. Based on phylogenetic and physiological characteristics, Cavy grass 6T can be distinguished from other members of the genus Streptococcus. Therefore, a novel species of the genus Streptococcus, family Streptococcaceae, order Lactobacillales is proposed, Streptococcuscaviae sp. nov. (type strain Cavy grass 6T=TISTR 2371T=DSM 102819T).
Evans, A; Leishman, S J; Walsh, L J; Seow, W K
2015-06-01
Oral antiseptics are valuable in controlling oral infections caused by cariogenic bacteria. The aim of this study was to investigate the effects of mouthrinses and pure antiseptic compounds on Streptococcus mutans and non-mutans bacteria (Streptococcus sanguinis and Lactobacillus acidophilus). The agar diffusion assay was employed to determine bacterial growth inhibition. Commercial mouthrinses containing chlorhexidine gluconate (0.2%), cetylpyridinium chloride (0.05%) and sodium fluoride (0.05%) produced statistically similar growth inhibition of S. mutans, S. sanguinis and L. acidophilus (with zones of inhibition ranging from 7.56 ± 0.52 mm to 7.39 ± 0.53 mm, 17.44 ± 0.94 mm to 18.31 ± 0.62 mm and 8.61 ± 1.43 to 8.67 ± 1.43 mm respectively, p > 0.05). The chlorhexidine mouthwash produced the greatest mean growth inhibition of S. sanguinis and S. mutans compared to all other mouthrinses tested (p mutans could be detected were chlorhexidine gluconate at 0.005% (wt/vol), cetylpyridinium chloride 0.01% (wt/ vol), povidone iodine 10% (wt/vol) and sodium hypochlorite 0.5% (vol/vol). Chlorhexidine (0.01%), cetylpyridinium chloride (0.01%), povidone iodine (10%) and sodium hypochlorite (0.5%) are effective at inhibiting the growth of S. mutans, S. sanguinis and L. acidophilus. © 2015 Australian Dental Association.
Wang, Bing-Yan; Kuramitsu, Howard K
2005-01-01
Streptococcus mutans has been recognized as an important etiological agent in human dental caries. Some strains of S. mutans also produce bacteriocins. In this study, we sought to demonstrate that bacteriocin production by S. mutans strains GS5 and BM71 was mediated by quorum sensing, which is dependent on a competence-stimulating peptide (CSP) signaling system encoded by the com genes. We also demonstrated that interactions with some other oral streptococci interfered with S. mutans bacteriocin production both in broth and in biofilms. The inhibition of S. mutans bacteriocin production by oral bacteria was stronger in biofilms than in broth. Using transposon Tn916 mutagenesis, we identified a gene (sgc; named for Streptococcus gordonii challisin) responsible for the inhibition of S. mutans bacteriocin production by S. gordonii Challis. Interruption of the sgc gene in S. gordonii Challis resulted in attenuated inhibition of S. mutans bacteriocin production. The supernatant fluids from the sgc mutant did not inactivate the exogenous S. mutans CSP as did those from the parent strain Challis. S. gordonii Challis did not inactivate bacteriocin produced by S. mutans GS5. Because S. mutans uses quorum sensing to regulate virulence, strategies designed to interfere with these signaling systems may have broad applicability for biological control of this caries-causing organism.
DEFF Research Database (Denmark)
Emborg, Hanne-Dorthe; Andersen, J. S.; Seyfarth, Anne Mette
2003-01-01
and streptogramin. By February 1998, all antimicrobial growth promoters (AGPs) were withdrawn from the Danish broiler production. The present study investigates, by logistic regression analyses, the (1) changes in the occurrence of AGP resistance among E. faecium from broilers and broiler meat from the fourth...... quarter of 1995 to the fourth quarter of 2001 and (2) relations between the occurrence of AGP resistance among E. faecium isolates from Danish broilers and AGP resistance among E. faecium isolates from the broiler meat of Danish and unknown origin collected in the same quarter within the year....... In the present study, we showed that after the AGP withdrawal, a significant decline in resistance to avilamycin, erythromycin, vancomycin and virginiamycin was observed among E. faecium from broilers and broiler meat. In addition, a decline in the occurrence of AGP resistance among E. faecium from Danish...
[Orbital cellulitis complicated by subperiosteal abscess due to Streptococcus pyogenes infection].
Ruíz Carrillo, José Daniel; Vázquez Guerrero, Edwin; Mercado Uribe, Mónica Cecilia
Orbital cellulitis is an infectious disease that is very common in pediatric patients, in which severe complications may develop. Etiological agents related to this disease are Haemophilus influenzae B, Staphylococcus aureus, Streptococcus pneumoniae and Moraxella catarrhalis, which correspond to 95% of cases. Moreover, Streptococcus beta hemolytic and anaerobic microorganisms may also be present corresponding to < 5% of the cases. We present an uncommon case of cellulitis complicated by sub-periosteal abscess caused by Streptococcus pyogenes (Group A beta hemolytic streptococcus). A 9-year-old male patient with a history of deficit disorder and hyperactivity since 5 years of age. His current condition started with erythema in the external edge of the right eye, increase in peri-orbicular volume with limitation of eyelid opening, progression to proptosis, pain with eye movements and conjunctival purulent discharge. Image studies reported subperiosteal abscess and preseptal right with extraocular cellulitis. The patient started with empirical antibiotic treatment, surgical drainage and culture of purulent material from which Streptococcus pyogenes was isolated. Due to the implementation of vaccination schemes against H. influenza and S. pneumoniae since the 90s, the cases by these pathogens have decreased, causing new bacteria to take place as the cause of the infection. The importance of considering S. pyogenes as an etiology of orbital cellulitis is the rapid progression to abscess formation, and the few cases described in the literature. Copyright © 2017 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
Gao, Ke; Li, Gang; Qu, Yiping; Wang, Maode; Cui, Bo; Ji, Meiju; Shi, Bingyin; Hou, Peng
2016-02-23
Increasing evidences have implicated somatic gain-of-function mutations at the telomerase reverse transcriptase (TERT) promoter as one of the major mechanisms that promote transcriptional activation of TERT and subsequently maintain telomere length in human cancers including glioma. To investigate the prognostic value of these mutations and telomere length, individually and their coexistence, in gliomas, we analyzed two somatic mutations C228T and C250T in the TERT promoter, relative telomere length (RTL), IDH1 mutation and MGMT methylation in 389 glioma patients, and explored their associations with patient characteristics and clinical outcomes. Our data showed that C228T and C250T mutations were found in 17.0% (66 of 389) and 11.8% (46 of 389) of gliomas, respectively, and these two mutations were mutually exclusive in this cancer. Moreover, they were significantly associated with WHO grade. We also found that the RTL was significant longer in gliomas than in meningiomas and normal brain tissues (Median, 0.89 vs. 0.44 and 0.50; P radiotherapy. Collectively, TERT promoter mutations and long RTL are not only prognostic factors for poor clinical outcomes, but also the predictors of radiotherapy resistance in gliomas.
Kawashima, Junko; Nakajo, Kazuko; Washio, Jumpei; Mayanagi, Gen; Shimauchi, Hidetoshi; Takahashi, Nobuhiro
2013-12-01
Actinomyces are predominant oral bacteria; however, their cariogenic potential in terms of acid production and fluoride sensitivity has not been elucidated in detail and compared with that of other caries-associated oral bacteria, such as Streptococcus. Therefore, this study aimed to elucidate and compare the acid production and growth of Actinomyces and Streptococcus in the presence of bicarbonate and fluoride to mimic conditions in the oral cavity. Acid production from glucose was measured by pH-stat at pH 5.5 and 7.0 under anaerobic conditions. Growth rate was assessed by optical density in anaerobic culture. Although Actinomyces produced acid at a lower rate than did Streptococcus, their acid production was more tolerant of fluoride (IDacid production 50 = 110-170 ppm at pH 7.0 and 10-13 ppm at pH 5.5) than that of Streptococcus (IDacid production 50 = 36-53 ppm at pH 7.0 and 6.3-6.5 ppm at pH 5.5). Bicarbonate increased acid production by Actinomyces with prominent succinate production and enhanced their fluoride tolerance (IDacid production 50 = 220-320 ppm at pH 7.0 and 33-52 ppm at pH 5.5). Bicarbonate had no effect on these variables in Streptococcus. In addition, although the growth rate of Actinomyces was lower than that of Streptococcus, Actinomyces growth was more tolerant of fluoride (IDgrowth 50 = 130-160 ppm) than was that of Streptococcus (IDgrowth 50 = 27-36 ppm). These results indicate that oral Actinomyces are more tolerant of fluoride than oral Streptococcus, and bicarbonate enhances the fluoride tolerance of oral Actinomyces. Because of the limited number of species tested here, further study is needed to generalize these findings to the genus level. © 2013 The Societies and Wiley Publishing Asia Pty Ltd.
DEFF Research Database (Denmark)
Aarestrup, Frank Møller; Bager, Flemming; Andersen, J. S.
2000-01-01
This study describes the changes in the occurrence of resistance to avilamycin among Enterococcus faecium from broilers in Denmark and the epidemiological association between usage of avilamycin for growth promotion and the occurrence of avilamycin-resistant E, faecium on broiler farms....... The consumption of avilamycin for growth promotion increased from 10 kg in 1990 to 2,740 kg 1996 and decreased in the following years to only 7 kg in 1998, Most of this has been used for broilers. As part of the nationwide monitoring program for antimicrobial resistance, a total of 473 E, faecium isolates from...... broilers and 290 isolates from pigs have been tested for their susceptibility to avilamycin from 1995 to 1998, A very limited number of isolates from pigs were resistant to avilamycin, whereas the occurrence of resistance among isolates from broilers increased from 63.6% at the end of 1995 to a maximum...
Streptococcus equi subsp zooepidemicus Invades and Survives in Epithelial Cells
DEFF Research Database (Denmark)
Skive, Bolette; Rohde, Manfred; Molinari, Gabriella
2017-01-01
Streptococcus equi subsp. zooepidemicus (S. zooepidemicus) is an opportunistic pathogen of several species including humans. S. zooepidemicus is found on mucus membranes of healthy horses, but can cause acute and chronic endometritis. Recently S. zooepidemicus was found able to reside in the endo......Streptococcus equi subsp. zooepidemicus (S. zooepidemicus) is an opportunistic pathogen of several species including humans. S. zooepidemicus is found on mucus membranes of healthy horses, but can cause acute and chronic endometritis. Recently S. zooepidemicus was found able to reside...
Directory of Open Access Journals (Sweden)
Marcos Noronha Frey
2011-12-01
Full Text Available O Streptococcus agalactie é um importante micro-organismo causador de doenças em gestantes, neonatos, idosos (maiores de 65 anos de idade, e portadores de doenças crônicas debilitantes, sendo um patógeno incomum em pacientes que não se enquadrem nestas faixas etárias ou perfil clínico (1-5, e, raramente, é descrito como agente causador de doenças sexualmente transmissíveis. Descrevemos o caso de um adulto jovem hígido de 19 anos, apresentando lesões ulceradas genitais e oral, assim como corrimento uretral e ocular, sugestivas de terem sido causadas pelo Streptococcus agalactie, e adquiridas através do contato sexual (doenças sexualmente transmissíveis.Streptococcus agalactiae is an important microorganism involved in a number of conditions in pregnant women, newborns, elderly people (over 65 years of age and individuals with chronic disabling illnesses. This pathogen is infrequently found among patients outside this age range or clinical profile(1-5 and is rarely reported in the etiology of sexually transmitted diseases. Here we describe a case of an otherwise healthy 19 year-old male, who presented with ulcerative genital and oral lesions in association with urethral and ocular discharge, suggestive of Streptococcus agalactiae infection acquired through sexual contact.
Van den Bogert, Bartholomeus; Boekhorst, Jos; Herrmann, Ruth; Smid, Eddy J.; Zoetendal, Erwin G.; Kleerebezem, Michiel
2013-01-01
The human small-intestinal microbiota is characterised by relatively large and dynamic Streptococcus populations. In this study, genome sequences of small-intestinal streptococci from S. mitis, S. bovis, and S. salivarius species-groups were determined and compared with those from 58 Streptococcus strains in public databases. The Streptococcus pangenome consists of 12,403 orthologous groups of which 574 are shared among all sequenced streptococci and are defined as the Streptococcus core genome. Genome mining of the small-intestinal streptococci focused on functions playing an important role in the interaction of these streptococci in the small-intestinal ecosystem, including natural competence and nutrient-transport and metabolism. Analysis of the small-intestinal Streptococcus genomes predicts a high capacity to synthesize amino acids and various vitamins as well as substantial divergence in their carbohydrate transport and metabolic capacities, which is in agreement with observed physiological differences between these Streptococcus strains. Gene-specific PCR-strategies enabled evaluation of conservation of Streptococcus populations in intestinal samples from different human individuals, revealing that the S. salivarius strains were frequently detected in the small-intestine microbiota, supporting the representative value of the genomes provided in this study. Finally, the Streptococcus genomes allow prediction of the effect of dietary substances on Streptococcus population dynamics in the human small-intestine. PMID:24386196
Structure of a conjugative element in Streptococcus pneumoniae
Energy Technology Data Exchange (ETDEWEB)
Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.
1986-06-01
The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.
Latifi-Xhemajli, B; Véronneau, J; Begzati, A; Bytyci, A; Kutllovci, T; Rexhepi, A
2016-03-01
Understanding factors in mothers associated with high and low salivary levels of Streptococcus mutans and Lactobacilli is an important strategy for early childhood caries prevention. Aim of the study was to identify the association between salivary levels of Streptococcus mutans/Lactobacillus and potential caries risk factors in mothers. Cross-sectional design used a voluntary sample of 300 mothers of young children. Close-ended questions and observations were used to identify mothers' potential caries risk factors. The presence of Streptococcus mutans and Lactobacilli was determined using the CRT bacteria test (Ivoclar Vivadent). All collected information was converted into frequency and proportion describing the prevalence factor in correlation with Streptococcus mutans and Lactobacilli cariogenic bacteria levels of infection. Results Sample participants showed a high caries risk based on socioeconomic, behavioural and clinical factors. also showed high levels (>105) of Streptococcus mutans and Lactobacilli infections among 28% of mothers. Three factors were significantly associated with Streptococcus mutans infection: level of education, past caries experiences, and observable dental plaque, whereas, a fourth factor, frequency of daily tooth brushing, was associated to Lactobacilli infection. This study showed that easily collectible informations such as maternal level of education, frequency of daily tooth brushing and past clinical factors tend to be associated with high level of Streptococcus mutans and Lactobacilli infections in caregivers.
Directory of Open Access Journals (Sweden)
Xiao-Na Pan
Full Text Available Nowadays, drug resistance still represents a major obstacle to successful acute myeloid leukemia (AML treatment and the underlying mechanism is not fully elucidated. Here, we found that high expression of c-Myc was one of the cytogenetic characteristics in the drug-resistant leukemic cells. c-Myc over-expression in leukemic cells induced resistance to chemotherapeutic drugs, enhanced colony formation capacity and inhibited cell differentiation induced by all-trans retinoic acid (ATRA. Meanwhile, inhibition of c-Myc by shRNA or specific c-Myc inhibitor 10058-F4 rescued the sensitivity to cytotoxic drugs, restrained the colony formation ability and promoted differentiation. RT-PCR and western blotting analysis showed that down-regulation of C/EBPβ contributed to the poor differentiation state of leukemic cells induced by c-Myc over-expression. Importantly, over-expression of C/EBPβ could reverse c-Myc induced drug resistance. In primary AML cells, the c-Myc expression was negatively correlated with C/EBPβ. 10058-F4, displayed anti-proliferative activity and increased cellular differentiation with up-regulation of C/EBPβ in primary AML cells. Thus, our study indicated that c-Myc could be a novel target to overcome drug resistance, providing a new approach in AML therapy.
Jensen, Anders; Scholz, Christian F P; Kilian, Mogens
2016-11-01
The Mitis group of the genus Streptococcus currently comprises 20 species with validly published names, including the pathogen S. pneumoniae. They have been the subject of much taxonomic confusion, due to phenotypic overlap and genetic heterogeneity, which has hampered a full appreciation of their clinical significance. The purpose of this study was to critically re-examine the taxonomy of the Mitis group using 195 publicly available genomes, including designated type strains for phylogenetic analyses based on core genomes, multilocus sequences and 16S rRNA gene sequences, combined with estimates of average nucleotide identity (ANI) and in silico and in vitro analyses of specific phenotypic characteristics. Our core genomic phylogenetic analyses revealed distinct clades that, to some extent, and from the clustering of type strains represent known species. However, many of the genomes have been incorrectly identified adding to the current confusion. Furthermore, our data show that 16S rRNA gene sequences and ANI are unsuitable for identifying and circumscribing new species of the Mitis group of the genus Streptococci. Based on the clustering patterns resulting from core genome phylogenetic analysis, we conclude that S. oligofermentans is a later synonym of S. cristatus. The recently described strains of the species Streptococcus dentisani includes one previously referred to as 'S. mitis biovar 2'. Together with S. oralis, S. dentisani and S. tigurinus form subclusters within a coherent phylogenetic clade. We propose that the species S. oralis consists of three subspecies: S. oralis subsp. oralis subsp. nov., S. oralis subsp. tigurinus comb. nov., and S. oralis subsp. dentisani comb. nov.
21 CFR 866.3740 - Streptococcus spp. serological reagents.
2010-04-01
... (CONTINUED) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Serological Reagents § 866.3740 Streptococcus... derived from clinical specimens. The identification aids in the diagnosis of diseases caused by bacteria...
DAF-16 employs the chromatin remodeller SWI/SNF to promote stress resistance and longevity.
Riedel, Christian G; Dowen, Robert H; Lourenco, Guinevere F; Kirienko, Natalia V; Heimbucher, Thomas; West, Jason A; Bowman, Sarah K; Kingston, Robert E; Dillin, Andrew; Asara, John M; Ruvkun, Gary
2013-05-01
Organisms are constantly challenged by stresses and privations and require adaptive responses for their survival. The forkhead box O (FOXO) transcription factor DAF-16 (hereafter referred to as DAF-16/FOXO) is a central nexus in these responses, but despite its importance little is known about how it regulates its target genes. Proteomic identification of DAF-16/FOXO-binding partners in Caenorhabditis elegans and their subsequent functional evaluation by RNA interference revealed several candidate DAF-16/FOXO cofactors, most notably the chromatin remodeller SWI/SNF. DAF-16/FOXO and SWI/SNF form a complex and globally co-localize at DAF-16/FOXO target promoters. We show that specifically for gene activation, DAF-16/FOXO depends on SWI/SNF, facilitating SWI/SNF recruitment to target promoters, to activate transcription by presumed remodelling of local chromatin. For the animal, this translates into an essential role for SWI/SNF in DAF-16/FOXO-mediated processes, in particular dauer formation, stress resistance and the promotion of longevity. Thus, we give insight into the mechanisms of DAF-16/FOXO-mediated transcriptional regulation and establish a critical link between ATP-dependent chromatin remodelling and lifespan regulation.
Directory of Open Access Journals (Sweden)
Rita Risandi
2016-09-01
Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae. Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental research with design
Zadoks, Ruth Nicolet
2002-01-01
Mastitis is the most common and costly production disease affecting dairy cows. Staphylococcus aureus and Streptococcus uberis are two major mastitis-causing pathogens. Staphylococcus aureus is traditionally classified as contagious pathogen, while Streptococcus uberis is classified as environmental
Wang, Bing-Yan; Kuramitsu, Howard K.
2005-01-01
Streptococcus mutans has been recognized as an important etiological agent in human dental caries. Some strains of S. mutans also produce bacteriocins. In this study, we sought to demonstrate that bacteriocin production by S. mutans strains GS5 and BM71 was mediated by quorum sensing, which is dependent on a competence-stimulating peptide (CSP) signaling system encoded by the com genes. We also demonstrated that interactions with some other oral streptococci interfered with S. mutans bacterio...
Morales-Covarrubias, Maria Soledad; Del Carmen Bolan-Mejía, María; Vela Alonso, Ana Isabel; Fernandez-Garayzabal, Jose F; Gomez-Gil, Bruno
2018-05-01
Strain CAIM 1838 T , isolated from the hepatopancreas of a cultured diseased Pacific white shrimp (Penaeus vannamei), was subjected to characterization by a polyphasic taxonomic approach. On the basis of 16S rRNA gene sequence analysis, strain CAIM 1838 T was most closely related to Streptococcus bovimastitidis 99.3 % and to other species of the Pyogenes clade of Streptococcus with lower similarity values. Average nucleotide identity values and the genome-to-genome distance of strain CAIM 1838 T , as compared with the type strains, confirmed the separate species status with closely related species of the genus Streptococcus and were all below the thresholds to delimit a species, 93.1 and 49.4 %, respectively. The DNA G+C content was 38.1 mol%. Differential phylogenetic distinctiveness together with phenotypic properties obtained in this study revealed that strain CAIM 1838 T could be differentiated from the closely related species. Based on these results it is proposed that strain CAIM 1838 T represents a novel species in the genus Streptococcus, for which the name Streptococcus penaeicida sp. nov is proposed (type strain, CAIM 1838 T =CECT 8596 T ,=DSM26545 T ), is proposed.
Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru
2013-07-01
The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.
Directory of Open Access Journals (Sweden)
Wei Bao
Full Text Available Mechanisms governing the metastasis of endometrial carcinoma (EC are poorly defined. Recent data support a role for the cell surface receptor tyrosine kinase TrkB in the progression of several human tumors. Here we present evidence for a direct role of TrkB in human EC. Immunohistochemical analysis revealed that TrkB and its secreted ligand, brain-derived neurotrophic factor (BDNF, are more highly expressed in EC than in normal endometrium. High TrkB levels correlated with lymph node metastasis (p<0.05 and lymphovascular space involvement (p<0.05 in EC. Depletion of TrkB by stable shRNA-mediated knockdown decreased the migratory and invasive capacity of cancer cell lines in vitro and resulted in anoikis in suspended cells. Conversely, exogenous expression of TrkB increased cell migration and invasion and promoted anoikis resistance in suspension culture. Furthermore, over-expression of TrkB or stimulation by BDNF resulted in altered the expression of molecular mediators of the epithelial-to-mesenchymal transition (EMT. RNA interference (RNAi-mediated depletion of the downstream regulator, Twist, blocked TrkB-induced EMT-like transformation. The use of in vivo models revealed decreased peritoneal dissemination in TrkB-depleted EC cells. Additionally, TrkB-depleted EC cells underwent mesenchymal-to-epithelial transition and anoikis in vivo. Our data support a novel function for TrkB in promoting EMT and resistance to anoikis. Thus, TrkB may constitute a potential therapeutic target in human EC.
Directory of Open Access Journals (Sweden)
Tatiana Castro Abreu Pinto
Full Text Available Streptococcus agalactiae is a common agent of clinical and subclinical bovine mastitis and an important cause of human infections, mainly among pregnant women, neonates and nonpregnant adults with underlying diseases. The present study describes the genetic and phenotypic diversity among 392 S. agalactiae human and bovine strains isolated between 1980 and 2006 in Brazil. The most prevalent serotypes were Ia, II, III and V and all the strains were susceptible to penicillin, vancomycin and levofloxacin. Resistance to clindamycin, chloramphenicol, erythromycin, rifampicin and tetracycline was observed. Among the erythromycin resistant strains, mefA/E, ermA and, mainly, ermB gene were detected, and a shift of prevalence from the macrolide resistance phenotype to the macrolidelincosamide- streptogramin B resistance phenotype over the years was observed. The 23 macrolide-resistant strains showed 19 different pulsed-field gel electrophoresis profiles. Regarding macrolide resistance, a major concern in S. agalactiae epidemiology, the present study describes an increase in erythromycin resistance from the 80s to the 90s followed by a decrease in the 2000-2006 period. Also, the genetic heterogeneity described points out that erythromycin resistance in Brazil is rather due to horizontal gene transmission than to spreading of specific macrolide-resistant clones.
Directory of Open Access Journals (Sweden)
Glauber P Arêas
2014-11-01
Full Text Available Streptococcus pyogenes is responsible for a variety of infectious diseases and immunological complications. In this study, 91 isolates of S. pyogenes recovered from oropharynx secretions were submitted to antimicrobial susceptibility testing, emm typing and pulsed-field gel electrophoresis (PFGE analysis. All isolates were susceptible to ceftriaxone, levofloxacin, penicillin G and vancomycin. Resistance to erythromycin and clindamycin was 15.4%, which is higher than previous reports from this area, while 20.9% of the isolates were not susceptible to tetracycline. The macrolide resistance phenotypes were cMLSB (10 and iMLSB (4. The ermB gene was predominant, followed by the ermA gene. Thirty-two emm types and subtypes were found, but five (emm1, emm4, emm12, emm22, emm81 were detected in 48% of the isolates. Three new emm subtypes were identified (emm1.74, emm58.14, emm76.7. There was a strong association between emm type and PFGE clustering. A variety of PFGE profiles as well as emm types were found among tetracycline and erythromycin-resistant isolates, demonstrating that antimicrobial resistant strains do not result from the expansion of one or a few clones. This study provides epidemiological data that contribute to the development of suitable strategies for the prevention and treatment of such infections in a poorly studied area.
Streptococcus agalactiae has emerged as an economically important bacterial pathogen affecting global aquaculture. Worldwide aquaculture losses due to S. agalactiae are estimated around U.S. $1 billion, annually. Streptococcus agalactiae also known as a Lancefield Group B Streptococcus (GBS) is a Gr...
Directory of Open Access Journals (Sweden)
Haoqin Jiang
2016-08-01
Full Text Available Streptococcus agalactiae, a colonizing agent in pregnant women and the main cause of neonatal sepsis and meningitis, has been increasingly associated with invasive disease in nonpregnant adults. We collected a total of 87 non-repetitive S. agalactiae isolates causing community-acquired (CA and hospital-acquired (HA infections in nonpregnant adults from a teaching hospital in Shanghai between 2009 and 2013. We identified and characterized their antibiotic resistance, sequence type (ST, serotype, virulence, and biofilm formation. The most frequent STs were ST19 (29.9%, ST23 (16.1%, ST12 (13.8%, and ST1 (12.6%. ST19 had significantly different distributions between CA- and HA-group B Streptococci (GBS isolates. The most frequent serotypes were III (32.2%, Ia (26.4%, V (14.9%, Ib (13.8%, and II (5.7%. Serotype III/ST19 was significantly associated with levofloxacin resistance in all isoates. The HA-GBS multidrug resistant rate was much higher than that of CA-GBS. Virulence genes pavA, cfb were found in all isolates. Strong correlations exist between serotype Ib (CA and HA and surface protein genes spb1 and bac, serotype III (HA and surface protein gene cps and GBS pilus cluster. The serotype, epidemic clone, PFGE-based genotype, and virulence gene are closely related between CA-GBS and HA-GBS, and certain serotypes and clone types were significantly associated with antibiotic resistance. However, CA-GBS and HA-GBS still had significant differences in their distribution of clone types, antibiotic resistance, and specific virulence genes, which may provide a basis for infection control.
DAF-16/FOXO employs the chromatin remodeller SWI/SNF to promote stress resistance and longevity
Riedel, Christian G.; Dowen, Robert H.; Lourenco, Guinevere F.; Kirienko, Natalia V.; Heimbucher, Thomas; West, Jason A.; Bowman, Sarah K.; Kingston, Robert E.; Dillin, Andrew; Asara, John M.; Ruvkun, Gary
2013-01-01
Organisms are constantly challenged by stresses and privations and require adaptive responses for their survival. The transcription factor DAF-16/FOXO is central nexus in these responses, but despite its importance little is known about how it regulates its target genes. Proteomic identification of DAF-16/FOXO binding partners in Caenorhabditis elegans and their subsequent functional evaluation by RNA interference (RNAi) revealed several candidate DAF-16/FOXO cofactors, most notably the chromatin remodeller SWI/SNF. DAF-16/FOXO and SWI/SNF form a complex and globally colocalize at DAF-16/FOXO target promoters. We show that specifically for gene-activation, DAF-16/FOXO depends on SWI/SNF, facilitating SWI/SNF recruitment to target promoters, in order to activate transcription by presumed remodelling of local chromatin. For the animal, this translates into an essential role of SWI/SNF for DAF-16/FOXO-mediated processes, i.e. dauer formation, stress resistance, and the promotion of longevity. Thus we give insight into the mechanisms of DAF-16/FOXO-mediated transcriptional regulation and establish a critical link between ATP-dependent chromatin remodelling and lifespan regulation. PMID:23604319
Erdoğrul, Özlem Turgay; Dığak, Metin
2014-01-01
In this study the presence of Streptococcus faecalis in the white cheeses made from pasteurize milk sold in Kahramanmaraş were examined. For this purpose, 22 cheese samples were taken. At the end of this study, all of the samples have Streptococcus faecalis (100%). It was concluded that the examined white cheese samples were inadequate from in reads of hygienic quality by Streptococcus faecalis.
Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E
2001-01-01
In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.
Anti-Streptococcus pyogenes Activity of Selected Medicinal Plant ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research August 2013; 12 (4): 535-540. ISSN: 1596-5996 .... Table 1: Antibacterial activity of selected Thai medicinal plants against Streptococcus pyogenes NPRC 101. Botanical ..... Naphthoquinones,.
Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A
2014-01-01
Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.
Human case of bacteremia caused by Streptococcus canis sequence type 9 harboring the scm gene.
Taniyama, Daisuke; Abe, Yoshihiko; Sakai, Tetsuya; Kikuchi, Takahide; Takahashi, Takashi
2017-01-01
Streptococcus canis (Sc) is a zoonotic pathogen that is transferred mainly from companion animals to humans. One of the major virulence factors in Sc is the M-like protein encoded by the scm gene, which is involved in anti-phagocytic activities, as well as the recruitment of plasminogen to the bacterial surface in cooperation with enolase, and the consequent enhancement of bacterial transmigration and survival. This is the first reported human case of uncomplicated bacteremia following a dog bite, caused by Streptococcus canis harboring the scm gene. The similarity of the 16S rRNA from the infecting species to that of the Sc type strain, as well as the amplification of the species-specific cfg gene, encoding a co-hemolysin, was used to confirm the species identity. Furthermore, the isolate was confirmed as sequence type 9. The partial scm gene sequence harbored by the isolate was closely related to those of other two Sc strains. While this isolate did not possess the erm (A), erm (B), or mef (A), macrolide/lincosamide resistance genes, it was not susceptible to azithromycin: its susceptibility was intermediate. Even though human Sc bacteremia is rare, clinicians should be aware of this microorganism, as well as Pasteurella sp., Prevotella sp., and Capnocytophaga sp., when examining and treating patients with fever who maintain close contact with companion animals.
Zheng, Wenning; Tan, Mui Fern; Old, Lesley A; Paterson, Ian C; Jakubovics, Nicholas S; Choo, Siew Woh
2017-06-07
Streptococcus gordonii and Streptococcus sanguinis are pioneer colonizers of dental plaque and important agents of bacterial infective endocarditis (IE). To gain a greater understanding of these two closely related species, we performed comparative analyses on 14 new S. gordonii and 5 S. sanguinis strains using various bioinformatics approaches. We revealed S. gordonii and S. sanguinis harbor open pan-genomes and share generally high sequence homology and number of core genes including virulence genes. However, we observed subtle differences in genomic islands and prophages between the species. Comparative pathogenomics analysis identified S. sanguinis strains have genes encoding IgA proteases, mitogenic factor deoxyribonucleases, nickel/cobalt uptake and cobalamin biosynthesis. On the contrary, genomic islands of S. gordonii strains contain additional copies of comCDE quorum-sensing system components involved in genetic competence. Two distinct polysaccharide locus architectures were identified, one of which was exclusively present in S. gordonii strains. The first evidence of genes encoding the CylA and CylB system by the α-haemolytic S. gordonii is presented. This study provides new insights into the genetic distinctions between S. gordonii and S. sanguinis, which yields understanding of tooth surfaces colonization and contributions to dental plaque formation, as well as their potential roles in the pathogenesis of IE.
Two Gene Clusters Coordinate Galactose and Lactose Metabolism in Streptococcus gordonii
Zeng, Lin; Martino, Nicole C.
2012-01-01
Streptococcus gordonii is an early colonizer of the human oral cavity and an abundant constituent of oral biofilms. Two tandemly arranged gene clusters, designated lac and gal, were identified in the S. gordonii DL1 genome, which encode genes of the tagatose pathway (lacABCD) and sugar phosphotransferase system (PTS) enzyme II permeases. Genes encoding a predicted phospho-β-galactosidase (LacG), a DeoR family transcriptional regulator (LacR), and a transcriptional antiterminator (LacT) were also present in the clusters. Growth and PTS assays supported that the permease designated EIILac transports lactose and galactose, whereas EIIGal transports galactose. The expression of the gene for EIIGal was markedly upregulated in cells growing on galactose. Using promoter-cat fusions, a role for LacR in the regulation of the expressions of both gene clusters was demonstrated, and the gal cluster was also shown to be sensitive to repression by CcpA. The deletion of lacT caused an inability to grow on lactose, apparently because of its role in the regulation of the expression of the genes for EIILac, but had little effect on galactose utilization. S. gordonii maintained a selective advantage over Streptococcus mutans in a mixed-species competition assay, associated with its possession of a high-affinity galactose PTS, although S. mutans could persist better at low pHs. Collectively, these results support the concept that the galactose and lactose systems of S. gordonii are subject to complex regulation and that a high-affinity galactose PTS may be advantageous when S. gordonii is competing against the caries pathogen S. mutans in oral biofilms. PMID:22660715
Richards, Vincent P.; Lang, Ping; Pavinski Bitar, Paulina D.; Lefébure, Tristan; Schukken, Ynte H.; Zadoks, Ruth N.; Stanhope, Michael J.
2011-01-01
In addition to causing severe invasive infections in humans, Streptococcus agalactiae, or group B Streptococcus (GBS), is also a major cause of bovine mastitis. Here we provide the first genome sequence for S. agalactiae isolated from a cow diagnosed with clinical mastitis (strain FSL S3-026). Comparison to eight S. agalactiae genomes obtained from human disease isolates revealed 183 genes specific to the bovine strain. Subsequent polymerase chain reaction (PCR) screening for the presence/absence of a subset of these loci in additional bovine and human strains revealed strong differentiation between the two groups (Fisher exact test: p S. agalactiae with Streptococcus uberis (nisin U operon) and Streptococcus dysgalactiae subsp. dysgalactiae (lactose operon). We also found evidence for LGT, involving the salivaricin operon, between the bovine S. agalactiae strain and either Streptococcus pyogenes or Streptococcus salivarius. Our findings provide insight intomechanismsfacilitatingenvironmentaladaptationandacquisitionofpotential virulence factors, while highlighting both the key role LGT has played in the recent evolution of the bovine S. agalactiae strain, and the importance of LGT among pathogens within a shared environment. PMID:21536150
Cariogenicity features of Streptococcus mutans in presence of rubusoside.
Chu, Jinpu; Zhang, Tieting; He, Kexin
2016-05-11
One promising way of reducing caries is by using sucrose substitutes in food. rubusoside is a prototype sweet substance isolated from the leaves of the plant Rubrus suavissimus S. Lee. (Rosaceae), and is rated sweeter than sucrose. The purpose of this study was to investigate the effects of rubusoside on Streptococcus mutans growth, acidogenicity, and adherence to glass in vitro. The effects of rubusoside on the growth and glass surface adhering of Streptococcus mutans were investigated by measuring the optical density of the culture at 540 nm with a spectrophotometer. Rubusoside influence on Streptococcus mutans acidogenicity was determined by measuring the pH of the culture. Sucrose, glucose, maltose, fructose and xylitol were designed to compare with rubusoside. S. mutans growth in the rubusoside-treated group was significantly lower than that in the sucrose, glucose, maltose and fructose groups (p 0.05). Sucrose-treated S. mutans exhibited the highest adherence to glass, and rubusoside-treated S. mutans exhibited the lowest. S. mutans adherence to a glass surface and acidogenicity with sucrose were significantly reduced by rubusoside. Rubusoside may have some potential as a non-cariogenic, non-caloric sweetener.
Whole genome shotgun sequencing of Indian strains of Streptococcus agalactiae
Directory of Open Access Journals (Sweden)
Balaji Veeraraghavan
2017-12-01
Full Text Available Group B streptococcus is known as a leading cause of neonatal infections in developing countries. The present study describes the whole genome shotgun sequences of four Group B Streptococcus (GBS isolates. Molecular data on clonality is lacking for GBS in India. The present genome report will add important information on the scarce genome data of GBS and will help in deriving comparative genome studies of GBS isolates at global level. This Whole Genome Shotgun project has been deposited at DDBJ/ENA/GenBank under the accession numbers NHPL00000000 – NHPO00000000.
Tonomura, Shuichi; Ihara, Masafumi; Kawano, Tomohiro; Tanaka, Tomotaka; Okuno, Yoshinori; Saito, Satoshi; Friedland, Robert P; Kuriyama, Nagato; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko; Toyoda, Kazunori; Nagatsuka, Kazuyuki
2016-02-05
Oral infectious diseases are epidemiologically associated with stroke. We previously showed that oral Streptococcus mutans with the cnm gene encoding a collagen-binding Cnm protein induced intracerebral hemorrhage (ICH) experimentally and was also associated with cerebral microbleeds (CMBs) in our population-based cohort study. We therefore investigated the roles of cnm-positive Streptococcus mutans in this single hospital-based, observational study that enrolled 100 acute stroke subjects. The cnm gene in Streptococcus mutans isolated from saliva was screened using PCR techniques and its collagen-binding activities examined. CMBs were evaluated on T2* gradient-recalled echo MRI. One subject withdrew informed consent and 99 subjects (63 males) were analyzed, consisting of 67 subjects with ischemic stroke, 5 with transient ischemic attack, and 27 with ICH. Eleven cases showed Streptococcus mutans strains positive for cnm. The presence of cnm-positive Streptococcus mutans was significantly associated with ICH [OR vs. ischemic stroke, 4.5; 95% CI, 1.17-19.1] and increased number of deep CMBs [median (IQR), 3 (2-9) vs. 0 (0-1), p = 0.0002]. In subjects positive for Streptococcus mutans, collagen binding activity was positively correlated with the number of deep CMBs (R(2) = 0.405; p < 0.0001). These results provide further evidence for the key role of oral health in stroke.
Directory of Open Access Journals (Sweden)
AP Jiménez
2007-01-01
Full Text Available Las estreptococosis son un conjunto de enfermedades ocasionadas por un grupo de cocos Gram positivos con similares signologías que involucran distintos órganos en los individuos afectados. La identiÀcación precisa de cada uno de estos microorganismos no se logra de manera deÀnitiva por los métodos tradicionales microbiológicos, por lo que se debe acudir a otro tipo de metodologías como las técnicas de biología molecular. En 1999 se identiÀcó por primera vez en Colombia la estreptococosis en híbridos de tilapias de cultivo. La pos-terior secuenciación del ADN de distintos aislamientos obtenidos de varias regiones del país demostró un 98,8% de aÀnidad con el Streptococcus agalactiae. El presente estudio pretende deÀnir si hasta la fecha existe solo esta especie de Streptococcus en el país causan-do infección o enfermedad en tilapias de cultivo o, por el contrario, son varias las especies que intervienen en los cuadros infecciosos. Se evaluaron aislamientos de tejidos, de agua y fango de los sitios de cultivo, así como de lugares de expendio de tilapia roja (Oreochromissp., utilizando técnicas microbiológicas, inmunoperoxidasa indirecta (IPI y PCR, espe-cíÀcas para el aislamiento e identiÀcación del S. agalactiae. Los resultados del presente estudio demostraron que hasta la fecha en el país únicamente se ha identiÀcado la especie S. agalactiae causando infección o enfermedad en tilapias. No tenemos evidencia de que otros Streptococcus reportados internacionalmente como S. iniae y otros Gram positivos causen estreptococosis en Colombia.La tilapia parece ser el principal reservorio del S. agalactiae en el país, y el riesgo zoonótico, aunque existe, es mínimo si se toman las medidas apropia-das de bioseguridad.
Wang, Ping; Tong, Jing-jing; Ma, Xiu-hua; Song, Feng-li; Fan, Ling; Guo, Cui-mei; Shi, Wei; Yu, Sang-jie; Yao, Kai-hu; Yang, Yong-hong
2015-01-01
To investigate the serotypes, antibiotic susceptibilities, and multi-locus sequence type (MLST) profiles of Streptococcus agalactiae (S. agalactiae) in Beijing to provide references for the prevention and treatment of S. agalactiae infections. All isolates were identified using the CAMP test and the latex-agglutination assay and serotyped using a Strep-B-Latex kit, after which they were assessed for antibiotic susceptibility, macrolide-resistance genes, and MLST profiles. In total, 56 S. agalactiae isolates were identified in 863 pregnant women (6.5%). Serotypes Ia, Ib, II, III, and V were identified, among which types III (32.1%), Ia (17.9%), Ib (16.1%), and V (14.3%) were the predominant serotypes. All isolates were susceptible to penicillin and ceftriaxone. The nonsusceptiblity rates measured for erythromycin, clarithromycin, azithromycin, telithromycin, clindamycin, tetracycline, and levofloxacin were 85.7%, 92.9%, 98.2%, 30.4%, 73.2%, 91%, and 39.3%, respectively. We identified 14 sequence types (STs) for the 56 isolates, among which ST19 (30.4%) was predominant. The rate of fluoroquinolone resistance was higher in serotype III than in the other serotypes. Among the 44 erythromycin-resistant isolates, 32 (72.7%) carried ermB. S. agalactiae isolates of the serotypes Ia, Ib, III, and V are common in Beijing. Among the S. agalactiae isolates, the macrolide and clindamycin resistance rates are extremely high. Most of the erythromycin-resistant isolates carry ermB.
Streptococcus agalactiae vaginitis: nonhemolytic variant on the Liofilchem® Chromatic StreptoB
Savini, Vincenzo; Marrollo, Roberta; D’Antonio, Marianna; D’Amario, Claudio; Fazii, Paolo; D’Antonio, Domenico
2013-01-01
Streptococcus agalactiae (group B Streptococcus, GBS) vaginal pathogenicity is not uniformly acknowledged throughout the literature; accordingly, in women, genital itching and burning, along with leukorrhea are commonly and almost exclusively referred to bacterial vaginosis, candidiasis and trichomoniasis. Conversely, GBS virulence for vagina was recognized in the past, as the organism has been observed to potentially cause local inflammation and discharge, as well as lactobacilli rarefaction...
Partial purification of the ATP-driven calcium pump of Streptococcus sanguis
International Nuclear Information System (INIS)
Lynn, A.R.; Rosen, B.P.
1986-01-01
ATP-dependent transport of calcium has been observed in several species of streptococci as uptake of 45 Ca 2+ into everted membrane vesicles. Membranes from Streptococcus sanguis and Streptococcus faecalis were solubilized with octyl-β-D-glucoside or Triton X-100, and the extracts reconstituted into proteoliposomes containing Escherichia coli or soybean phospholipid. Calcium transport in reconstituted proteoliposomes was insensitive to the ionophores nigericin and valinomycin and was unaffected by the F 0 F 1 inhibitor N,N'-dicyclohexylcarbodiimide. Uptake was inhibited by ortho-vanadate with a K/sub i/ in the micromolar range. These results demonstrate that the reconstituted transport activities are not the result of ATP-driven proton pumping via the F 0 F 1 coupled to a calcium/proton antiporter and suggest that existence of a calcium translocating ATPase. Partial purification of the transport activity from Streptococcus sanguis has been achieved using density gradient centrifugation and FPLC
Factors associated with colonization of Streptococcus pneumoniae ...
African Journals Online (AJOL)
with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).
Directory of Open Access Journals (Sweden)
Herluinus Mafranenda DN
2014-03-01
Full Text Available Background: Achasin and mytimacin-AF are proteins of snail mucus (Achatina fulica which have antimicrobial activity. Snail mucus is suspected to have other proteins which have antimicrobial activity against Streptococcus mutans and Aggregatibacter actinomycetemcomitans the oral pathologic bacteria. Purpose: The study were aimed to characterize the proteins of snail mucus (Achatina fulica that have antimicrobial activities to Streptococcus mutans and Actinobacillus actinomycetemcomitans, and to compared the antimicrobial effect of achasin and mytimacin-AF. Methods: The sample of study was the mucus of snails which were taken from Yogyakarta Province. The isolation and characterization of protein were conducted by using SDS-PAGE method, electroelution, and dialysis. Nano drop test was conducted to determine protein concentration. The sensitivity test was conducted by using dilution test, and followed by spectrophotometry and paper disc diffusion tests. Results: The study showed that proteins successfully characterized from snail mucus (Achatina fulica were proteins with molecular weights of 83.67 kDa (achasin, 50.81 kDa, 15 kDa, 11.45 kDa (full amino acid sequence of mytimacin-AF and 9.7 kDa (mytimacin-AF. Based on the dilution test, Achasin had better antimicrobial activities against Streptococcus mutans, while mytimacin-AF had better antimicrobial activities against Aggregatibacter actinomycetemcomitans. But the paper disc diffusion test result showed that Achasin had antimicrobial activities against Streptococcus mutans and Aggregatibacter actinomycetemcomitans, while mytimacin-AF had no antimicrobial activities. Conclusion: The proteins with molecular weights of 50.81 kDa, 15 kDa, 11.45 kDa were considered as new antimicrobial proteins isolated from snail mucus. Achasin, had better antimicrobial activities against Streptococcus mutans, while mytimacin-AF had better antimicrobial activities against Aggregatibacter actinomycetemcomitans
Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.
Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E
2011-01-01
Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during
Duquenne, C; Dernis, E; Zehrouni, A; Bizon, A; Duquenne, M
2017-09-01
Streptococcus milleri (Streptococcus anginosus, intermedius and constellatus) are commensal organisms, which can become pathogenic and cause infection with frequent abscess formation, local or metastatic extension. Osteomyelitis of the skull has been rarely reported in this type of infection. Skull osteomyelitis due to Streptococcus milleri is reported in a 61-year-old immunocompetent man without any medical history, occurring 10 months after a head injury without any wound or complication at initial presentation. A progressive right parieto-occipital headache with worsening and increased acute phase reactants evoked a giant cell arteritis. After few days of corticosteroid therapy (0.5 mg/kg/day), diagnosis of subcutaneous abscess associated to an extensive osteomyelitis of the skull due to Streptococcus milleri was diagnosed. The outcome was favorable after drainage of one liter of pus, irrigation, debridement and antibiotherapy by amoxicillin for 8 weeks. It is necessary to discuss the differential diagnosis of giant cell arteritis particularly when symptoms are unusual. Even a short-term corticosteroid therapy may dramatically exacerbate an undetected infection. Copyright © 2017. Published by Elsevier SAS.
Directory of Open Access Journals (Sweden)
Walter H B Demczuk
Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.
Do, T; Gilbert, S C; Klein, J; Warren, S; Wade, W G; Beighton, D
2011-10-01
A collection of Streptococcus sanguinis strains from patients with endocarditis (n = 21) and from the oral cavity (n = 34) was subjected to a multi-locus sequence typing analysis using seven housekeeping genes, carbamoyl-phosphate synthetase (carB), Co/Zn/Cd efflux system component (czcD), d-alanyl-d-alanine ligase (ddl), DNA polymerase III (dnaX), glucose-6-phosphate dehydrogenase (gdh), DNA-directed RNA polymerase, beta subunit (rpoB) and superoxide dismutase (sodA). The scheme was expanded by the inclusion of two the putative virulence genes, bacitracin-resistance protein (bacA) and saliva-binding protein (ssaB), to increase strain discrimination. Extensive intra-species recombination was apparent in all genes but inter-species recombination was also apparent with strains apparently harbouring gdh and ddl from unidentified sources and one isolate harboured a sodA allele apparently derived from Streptococcus oralis. The recombination/mutation ratio for the concatenated housekeeping gene sequences was 1.67 (95% confidence limits 1.25-2.72) and for the two virulence genes the r/m ratio was 3.99 (95% confidence limits 1.61-8.72); recombination was the major driver for genetic variation. All isolates were distinct and the endocarditis strains did not form distinct sub-clusters when the data were analysed using ClonalFrame. These data support the widely held opinion that infecting S. sanguinis strains are opportunistic human pathogens. © 2011 John Wiley & Sons A/S.
Leitner, Eva; Zollner-Schwetz, Ines; Zarfel, Gernot; Masoud-Landgraf, Lilian; Gehrer, Michael; Wagner-Eibel, Ute; Grisold, Andrea J; Feierl, Gebhard
2015-12-01
An increase of severe infections caused by Streptococcus dysgalactiae subsp. equisimilis (SDSE) similar to infections caused by Streptococcus pyogenes has been reported over the last years. Little is known about infections with SDSE in Austria. Therefore, we investigated a collection of 113 SDSE invasive and non-invasive isolates from different infection sites and type of infections as well as patients' characteristics. The isolates were phenotypically identified and emm typed using the enlarged emm database from the Centers for Disease Control and Prevention. Additionally, 13 antimicrobial agents were tested using EUCAST guidelines and virulence genes were investigated. Severe SDSE infections were most common in elderly men with underlying diseases especially diabetes mellitus. With VitekMS identification of SDSE isolates was successful to the species level only. Emm typing revealed 24 different emm types, one new type and one new subtype. StG485, stG6, stC74a, stG643, and stG480 were the predominant types in this study, stC74a and stG652 in invasive infections and stG643, stC74a and stG485 in non-invasive infections. Resistance was observed to tetracycline (62%), macrolides (13%) with one M phenotype, and clindamycin (12%) presenting 6 constitutive MLS(B) phenotypes and 8 inducible MLS(B) phenotypes. Levofloxacin resistance was detected only in one isolate. All isolates tested for virulence genes were positive for scpA, ska, saga and slo. Superantigenic genes were negative except speG(dys) (positive 17/34; 50%). This paper presents the first report of SDSE infections in Austria. Severe SDSE infections were found mainly in elderly men with underlying diseases. SDSE isolates demonstrated substantial emm type diversity without association with infections site or invasiveness. Analysis of virulence genes showed no significant difference between invasive and non-invasive infections. Copyright © 2015 Elsevier GmbH. All rights reserved.
Callahan, Jill E.; Munro, Cindy L.; Kitten, Todd
2011-01-01
Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility i...
Detection and quantification of Streptococcus pneumoniae from ...
African Journals Online (AJOL)
The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...
Pinheiro, Sandra Marisa de Oliveira Sequeira
2009-01-01
Dissertação de Mestrado em Biologia Clínica Laboratorial Streptococcus agalactiae (Grupo B de Lancefield, EGB), um microrganismo comensal do homem, reconhecido em 1920 como o agente etiológico da mastite bovina, tem sido associado a infecções em parturientes e recém-nascidos, sendo o principal agente de septicemia e meningite neonatal. Para evitar a infecção perinatal recomenda-se a pesquisa da bactéria na região vagino-perianal durante o terceiro semestre de gravidez, indicando o tratamen...
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Sayyahfar, Shirin; Fahimzad, Alireza; Naddaf, Amir; Tavassoli, Sara
2015-12-01
The aim of this study was to evaluate the antibiotic susceptibility of Group A streptococcus (GAS) to antibiotics usually used in Iran for treatment of GAS pharyngitis in children. From 2011 to 2013, children 3-15 years of age with acute tonsillopharyngitis who attended Mofid Children's Hospital clinics and emergency ward and did not meet the exclusion criteria were enrolled in a prospective study in a sequential manner. The isolates strains from throat culture were identified as GAS by colony morphology, gram staining, beta hemolysis on blood agar, sensitivity to bacitracin, a positive pyrrolidonyl aminopeptidase (PYR) test result, and the presence of Lancefield A antigen determined by agglutination test. Antimicrobial susceptibility was identified by both disk diffusion and broth dilution methods. From 200 children enrolled in this study, 59 (30%) cases were culture positive for GAS. All isolates were sensitive to penicillin G. The prevalence of erythromycin, azithromycin, and clarithromycin resistance by broth dilution method was 33.9%, 57.6%, and 33.9%, respectively. Surprisingly, 8.4% of GAS strains were resistant to rifampin. In this study, 13.5% and 32.2% of the strains were resistant to clindamycin and ofloxacin, respectively. The high rate of resistance of GAS to some antibiotics in this study should warn physicians, especially in Iran, to use antibiotics restrictedly and logically to prevent the rising of resistance rates in future. It also seems that continuous local surveillance is necessary to achieve the best therapeutic option for GAS treatment.
Directory of Open Access Journals (Sweden)
Bayeh Abera
2014-01-01
Full Text Available Aim: To determine profiles of non-chlamydia conjunctival bacteria and their antimicrobial susceptibility from adults who underwent trachomatous trichiasis surgery in rural areas of Ethiopia. Materials and Methods: A cross-sectional study was conducted in rural districts in West Gojjam administrative zone. Conjunctival swabs were collected during surgery and transported using Stuart transport broth (Oxoid, UK. Antibiotic susceptibility of conjunctival isolates was determined using the Kirby-Bauer disc-diffusion method. Results: Non-chlamydia pathogenic bacteria were recovered from conjunctiva of 438 (31% participants before treatment. The isolated conjunctival bacteria were Staphylococcus aureus, coagulase-negative Staphylococci, Streptococcus group (A, C, F and G, Enterococci, Streptococcus pneumoniae, Moraxella spp., Escherichia coli, Citrobacter spp., Proteus spp., Klebsiella spp., Pseudomonas spp. and Enterobacter spp. Overall, resistance rates of 57.8% to azithromycin and 68.5% to chloramphenicol were found. However, 86-94.4% sensitivity was demonstrated to ciprofloxacin and norfloxacin. Moderate sensitivity rates (61.8-78.4% were observed to ceftriaxone, tetracycline and cotrimoxazole. Conclusion: Fluoroquinolones that have activity against the majority of bacterial isolates were potent at in vitro. However, unacceptably high levels of resistance to azithromycin and chloramphenicol in rural community indicated a need for further study and antimicrobial resistance surveillance.
Wasfi, Reham; Abd El-Rahman, Ola A; Zafer, Mai M; Ashour, Hossam M
2018-03-01
Streptococcus mutans contributes significantly to dental caries, which arises from homoeostasic imbalance between host and microbiota. We hypothesized that Lactobacillus sp. inhibits growth, biofilm formation and gene expression of Streptococcus mutans. Antibacterial (agar diffusion method) and antibiofilm (crystal violet assay) characteristics of probiotic Lactobacillus sp. against Streptococcus mutans (ATCC 25175) were evaluated. We investigated whether Lactobacillus casei (ATCC 393), Lactobacillus reuteri (ATCC 23272), Lactobacillus plantarum (ATCC 14917) or Lactobacillus salivarius (ATCC 11741) inhibit expression of Streptococcus mutans genes involved in biofilm formation, quorum sensing or stress survival using quantitative real-time polymerase chain reaction (qPCR). Growth changes (OD600) in the presence of pH-neutralized, catalase-treated or trypsin-treated Lactobacillus sp. supernatants were assessed to identify roles of organic acids, peroxides and bacteriocin. Susceptibility testing indicated antibacterial (pH-dependent) and antibiofilm activities of Lactobacillus sp. against Streptococcus mutans. Scanning electron microscopy revealed reduction in microcolony formation and exopolysaccharide structural changes. Of the oral normal flora, L. salivarius exhibited the highest antibiofilm and peroxide-dependent antimicrobial activities. All biofilm-forming cells treated with Lactobacillus sp. supernatants showed reduced expression of genes involved in exopolysaccharide production, acid tolerance and quorum sensing. Thus, Lactobacillus sp. can inhibit tooth decay by limiting growth and virulence properties of Streptococcus mutans. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.
Effect of Teucrium Polium-Containing Chewing Gum on Reducing Salivary Streptococcus Mutans Counts
Directory of Open Access Journals (Sweden)
Somayeh Khoramian Tusi
2018-06-01
Full Text Available Introduction: Several studies have reported the antibacterial effect of Teucrium polium extract. In this study, we sought to determine the effect of a chewing gum containing the aqueous extract of Teucrium polium on the level of salivary Streptococcus mutans. Materials and Methods: In this double-blind clinical trial, 20 dental students were randomly assigned to two groups of intervention and control. The intervention group received a chewing gum containing the aqueous extract of Teucrium polium, and the control group received a chewing gum without any plant extract. Each person chewed the gum for 20 minutes three times a day (after each meal for three weeks. Unstimulated saliva samples were collected at the beginning of the experiment before the use of the gums and one day after the final gum consumption. The quantitative polymerase chain reaction (qPCR technique was employed to determine the bacterial level. The colonization rate of Streptococcus mutans was compared between the two groups by using t-test in SPSS, version 21. Results: There was no significant difference between the two groups in terms of Streptococcus mutans counts before the intervention (P>0.05. The consumption of Teucrium polium extract-containing chewing gum in comparison with the placebo gum significantly diminished the number of Streptococcus mutans colonies (P=0.002. Conclusion: The results of this study showed that the chewing gum containing the aqueous extract of Teucrium polium significantly lowered the colonization rate of Streptococcus mutans in human saliva.
Directory of Open Access Journals (Sweden)
Pirbalouti Ghasemi Abdollah
2011-01-01
Full Text Available Streptococcus iniae is among the major pathogens of a large number of fish species cultured in fresh and marine recirculating and net pen production systems. Ten Iranian medicinal plants were assessed for their antimicrobial activity against Streptococcus iniae isolates obtained from diseased Oncorhynchus mykiss (Salmonidae; Walbaum, 1972 collected from fish farms in Iran. The antibacterial activity of ethanol extracts of Punica granatum, Quercus branti, Glycyrrhiza glabra and essential oils of Heracleum lasiopetalum, Satureja bachtiarica, Thymus daenensis, Myrtus communis, Echinophora platyloba, Kelussia odoratissima and Stachys lavandulifolia against Steptococcus iniae was evaluated by disc diffusion and serial dilution assays. Most of the extracts and essential oils showed a relatively high antibacterial activity against Streptococcus iniae. Of the plants studied, the most active extracts were those obtained from the essential oils of Satureja bachtiarica, Echinophora platyloba, Thymus daenensis and the ethanol extract of Quercus branti. Some of the extracts were active against Streptococcus iniae. Two essential oils showed lower MIC values; Heracleum lasiopetalum (78 μg/ml and Satureja bachtiarica (39 μg/ml. The essential oil of Satureja bachtiarica could be an important source of antibacterial compounds against the Streptococcus iniae isolated from rainbow trout.
Draft Genome Sequence of Type Strain Streptococcus gordonii ATCC 10558
DEFF Research Database (Denmark)
Rasmussen, Louise Hesselbjerg; Dargis, Rimtas; Christensen, Jens Jørgen Elmer
2016-01-01
Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis of infect......Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis...
P-body proteins regulate transcriptional rewiring to promote DNA replication stress resistance.
Loll-Krippleber, Raphael; Brown, Grant W
2017-09-15
mRNA-processing (P-) bodies are cytoplasmic granules that form in eukaryotic cells in response to numerous stresses to serve as sites of degradation and storage of mRNAs. Functional P-bodies are critical for the DNA replication stress response in yeast, yet the repertoire of P-body targets and the mechanisms by which P-bodies promote replication stress resistance are unknown. In this study we identify the complete complement of mRNA targets of P-bodies during replication stress induced by hydroxyurea treatment. The key P-body protein Lsm1 controls the abundance of HHT1, ACF4, ARL3, TMA16, RRS1 and YOX1 mRNAs to prevent their toxic accumulation during replication stress. Accumulation of YOX1 mRNA causes aberrant downregulation of a network of genes critical for DNA replication stress resistance and leads to toxic acetaldehyde accumulation. Our data reveal the scope and the targets of regulation by P-body proteins during the DNA replication stress response.P-bodies form in response to stress and act as sites of mRNA storage and degradation. Here the authors identify the mRNA targets of P-bodies during DNA replication stress, and show that P-body proteins act to prevent toxic accumulation of these target transcripts.
Meningitis por Streptococcus suis
Geffner Sclarsky, D. E.; Moreno Muñoz, R.; Campillo Alpera, Mª.S.; Pardo Serrano, F.J.; Gómez Gómez, A.; Martínez-Lozano, Mª.D.
2001-01-01
La infección humana por Streptococcus suis (S. suis) es una zoonosis, con un riesgo ocupacional conocido y que suele presentarse como meningitis purulenta, que tiene baja mortalidad y frecuentes secuelas de hipoacusia y ataxia. Se han publicado menos de 150 casos humanos desde el informe original de hace 30 años. Hay una reconocida distribución geográfica viviendo la mayoría de los afectados en el norte de Europa y el sudeste Asiático. En España se han comunicado dos pacientes con enfermedad ...
Enhanced adhesion of Streptococcus mutans to hydroxyapatite after exposure to saliva.
Spengler, Christian; Thewes, Nicolas; Nolle, Friederike; Faidt, Thomas; Umanskaya, Natalia; Hannig, Matthias; Bischoff, Markus; Jacobs, Karin
2017-07-01
Streptococcus mutans cells form robust biofilms on human teeth and are strongly related to caries incidents. Hence, understanding the adhesion of S. mutans in the human oral cavity is of major interest for preventive dentistry. In this study, we report on atomic force microscopy-based single-cell force spectroscopy measurements of S. mutans cells to hydroxyapatite surfaces. We observe for almost all measurements a significant difference in adhesion strength for S. mutans as well as for Staphylococcus carnosus cells. However, the increase in adhesion strength after saliva exposure is much higher for S. mutans cells compared to S. carnosus cells. Our results demonstrate that S. mutans cells are well adapted to their natural environment, the oral cavity. This ability promotes the biofilm-forming capability of that species and hence the production of caries-provoking acids. In consequence, understanding the fundamentals of this mechanism may pave a way towards more effective caries-reducing techniques. Copyright © 2017 John Wiley & Sons, Ltd.
Evaluation of a Group A Streptococcus synthetic oligosaccharide as vaccine candidate.
Kabanova, Anna; Margarit, Immaculada; Berti, Francesco; Romano, Maria R; Grandi, Guido; Bensi, Giuliano; Chiarot, Emiliano; Proietti, Daniela; Swennen, Erwin; Cappelletti, Emilia; Fontani, Paola; Casini, Daniele; Adamo, Roberto; Pinto, Vittoria; Skibinski, David; Capo, Sabrina; Buffi, Giada; Gallotta, Marilena; Christ, William J; Campbell, A Stewart; Pena, John; Seeberger, Peter H; Rappuoli, Rino; Costantino, Paolo
2010-12-10
Bacterial infections caused by Group A Streptococcus (GAS) are a serious health care concern that currently cannot be prevented by vaccination. The GAS cell-wall polysaccharide (GAS-PS) is an attractive vaccine candidate due to its constant expression pattern on different bacterial strains and protective properties of anti-GAS-PS antibodies. Here we report for the first time the immunoprotective efficacy of glycoconjugates with synthetic GAS oligosaccharides as compared to those containing the native GAS-PS. A series of hexa- and dodecasaccharides based on the GAS-PS structure were prepared by chemical synthesis and conjugated to CRM(197). When tested in mice, the conjugates containing the synthetic oligosaccharides conferred levels of immunoprotection comparable to those elicited by the native conjugate. Antisera from immunized rabbits promoted phagocytosis of encapsulated GAS strains. Furthermore we discuss variables that might correlate with glycoconjugate immunogenicity and demonstrate the potential of the synthetic approach that benefits from increased antigen purity and facilitated manufacturing. Copyright © 2010 Elsevier Ltd. All rights reserved.
Antibacterial activity of Euphorbia hirta against Streptococcus ...
African Journals Online (AJOL)
This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.
Directory of Open Access Journals (Sweden)
K.L. Ravi Kumar
2014-01-01
Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking
Blond, M H; Gold, F; Pierre, F; Quentin, R; Aujard, Y
2001-10-01
Perinatal group B streptococcal infection has been the subject of numerous studies and despite guidelines established during the last decade remains a frequent disease with high mortality. The basic aim of the guidelines is to screen for Streptococcus agalactiae during the antepartum period in order to institute antibiotic therapy during delivery. A critical review of the literature highlights the real impact and adverse effect of these guidelines: difficult application (only two-thirds of all maternity units have a protocol and compliance is only 75%), maternal risks of antibiotic therapy (especially the emergence of resistant Gram negative bacteria), fetal risks (accentuation of neonatal sepsis with resistant strains, retarded neonatal infections, frequent use of antibiotics with a broader spectrum, higher frequency of nosocomial sepsis).
Directory of Open Access Journals (Sweden)
Radhika Raman
2017-01-01
Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%
Swildens, B.
2009-01-01
DETECTION AND TRANSMISSION OF EXTRACELLULAR FACTOR PRODUCING STREPTOCOCCUS SUIS SEROTYPE 2 STRAINS IN PIGS INTRODUCTION Streptococcus suis (S.suis) has been implicated in the etiology of many diseases among which meningitis in pigs. The virulent extracellular factor-positive strains of S.suis
Fan, Qin; Liu, Shuliang; Li, Juan; Huang, Tingting
2012-05-01
To analyze the antimicrobial susceptibility of lactic acid bacteria (LAB) from yogurt, and to provide references for evaluating the safety of LAB and screening safe strains. The sensitivity of 43 LAB strains, including 14 strains of Streptococcus thermophilus, 12 strains of Lactobacillus acidophilus, 9 strains of Lactobacillus bulgaricus and 8 strains of Bifidobacterium, to 22 antibiotics were tested by agar plate dilution method. All 43 LAB strains were resistant to trimethoprim, nalidixic acid, ciprofloxacin, lomefloxacin, danofloxacin and polymyxin E. Their resistances to kanamycin, tetracycline, clindamycin, doxycycline and cephalothin were varied. The sensitivity to other antibiotics were sensitive or moderate. All isolates were multidrug-resistant. The antimicrobial resistance of tested LAB strains was comparatively serious, and continuously monitoring their antimicrobial resistance and evaluating their safety should be strengthened.
Directory of Open Access Journals (Sweden)
Ana Beatriz de Almeida Corrêa
2011-12-01
Full Text Available Streptococcus agalactiae isolates are more common among pregnant women, neonates and nonpregnant adults with underlying diseases compared to other demographic groups. In this study, we evaluate the genetic and phenotypic diversity in S. agalactiae strains from Rio de Janeiro (RJ that were isolated from asymptomatic carriers. We analysed these S. agalactiae strains using pulsed-field gel electrophoresis (PFGE, serotyping and antimicrobial susceptibility testing, as well as by determining the macrolide resistance phenotype, and detecting the presence of the ermA/B, mefA/E and lnuB genes. The serotypes Ia, II, III and V were the most prevalent serotypes observed. The 60 strains analysed were susceptible to penicillin, vancomycin and levofloxacin. Resistance to clindamycin, chloramphenicol, erythromycin, rifampin and tetracycline was observed. Among the erythromycin and/or clindamycin resistant strains, the ermA, ermB and mefA/E genes were detected and the constitutive macrolides, lincosamides and streptogramin B-type resistance was the most prevalent phenotype observed. The lnuB gene was not detected in any of the strains studied. We found 56 PFGE electrophoretic profiles and only 22 of them were allocated in polymorphism patterns. This work presents data on the genetic diversity and prevalent capsular serotypes among RJ isolates. Approximately 85% of these strains came from pregnant women; therefore, these data may be helpful in developing future prophylaxis and treatment strategies for neonatal syndromes in RJ.
Streptococcus azizii sp. nov., isolated from naïve weanling mice.
Shewmaker, Patricia Lynn; Whitney, Anne M; Gulvik, Christopher A; Lipman, Neil S
2017-12-01
Three isolates of a previously reported novel catalase-negative, Gram-stain-positive, coccoid, alpha-haemolytic, Streptococcus species that were associated with meningoencephalitis in naïve weanling mice were further evaluated to confirm their taxonomic status and to determine additional phenotypic and molecular characteristics. Comparative 16S rRNA gene sequence analysis showed nearly identical intra-species sequence similarity (≥99.9 %), and revealed the closest phylogenetically related species, Streptococcus acidominimus and Streptococcuscuniculi, with 97.0 and 97.5 % sequence similarity, respectively. The rpoB, sodA and recN genes were identical for the three isolates and were 87.6, 85.7 and 82.5 % similar to S. acidominimus and 89.7, 86.2 and 80.7 % similar to S. cuniculi, respectively. In silico DNA-DNA hybridization analyses of mouse isolate 12-5202 T against S. acidominimus CCUG 27296 T and S. cuniculi CCUG 65085 T produced estimated values of 26.4 and 25.7 % relatedness, and the calculated average nucleotide identity values were 81.9 and 81.7, respectively. These data confirm the taxonomic status of 12-5202 T as a distinct Streptococcus species, and we formally propose the type strain, Streptococcusazizii 12-5202 T (=CCUG 69378 T =DSM 103678 T ). The genome of Streptococcus azizii sp. nov. 12-5202 T contains 2062 total genes with a size of 2.34 Mbp, and an average G+C content of 42.76 mol%.
Feng, Youjun; Zhang, Huimin; Wu, Zuowei; Wang, Shihua; Cao, Min; Hu, Dan; Wang, Changjun
2014-01-01
Streptococcus suis (S. suis) is a family of pathogenic gram-positive bacterial strains that represents a primary health problem in the swine industry worldwide. S. suis is also an emerging zoonotic pathogen that causes severe human infections clinically featuring with varied diseases/syndromes (such as meningitis, septicemia, and arthritis). Over the past few decades, continued efforts have made significant progress toward better understanding this zoonotic infectious entity, contributing in part to the elucidation of the molecular mechanism underlying its high pathogenicity. This review is aimed at presenting an updated overview of this pathogen from the perspective of molecular epidemiology, clinical diagnosis and typing, virulence mechanism, and protective antigens contributing to its zoonosis. PMID:24667807
Energy Technology Data Exchange (ETDEWEB)
Miao, Xiaobing; Wu, Yaxun [Department of Pathology, Affiliated Cancer Hospital of Nantong University, Nantong 226361, Jiangsu (China); Wang, Yuchan [Department of Pathogen, Medical College, Nantong University, Nantong 226001, Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226001, Jiangsu (China); Zhu, Xinghua; Yin, Haibing [Department of Pathology, Affiliated Cancer Hospital of Nantong University, Nantong 226361, Jiangsu (China); He, Yunhua [Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226001, Jiangsu (China); Li, Chunsun; Liu, Yushan; Lu, Xiaoyun; Chen, Yali; Shen, Rong [Department of Pathology, Affiliated Cancer Hospital of Nantong University, Nantong 226361, Jiangsu (China); Xu, Xiaohong, E-mail: xuxiaohongnantong@126.com [Department of Oncology, Affiliated Cancer Hospital of Nantong University, Nantong 226361, Jiangsu (China); He, Song, E-mail: hesongnt@126.com [Department of Pathology, Affiliated Cancer Hospital of Nantong University, Nantong 226361, Jiangsu (China)
2016-08-15
YB-1 is a multifunctional protein, which has been shown to correlate with resistance to treatment of various tumor types. This study investigated the expression and biologic function of YB-1 in diffuse large B-cell lymphoma (DLBCL). Immunohistochemical analysis showed that the expression statuses of YB-1 and pYB-1{sup S102} were reversely correlated with the clinical outcomes of DLBCL patients. In addition, we found that YB-1 could promote the proliferation of DLBCL cells by accelerating the G1/S transition. Ectopic expression of YB-1 could markedly increase the expression of cell cycle regulators cyclin D1 and cyclin E. Furthermore, we found that adhesion of DLBCL cells to fibronectin (FN) could increase YB-1 phosphorylation at Ser102 and pYB-1{sup S102} nuclear translocation. In addition, overexpression of YB-1 could increase the adhesion of DLBCL cells to FN. Intriguingly, we found that YB-1 overexpression could confer drug resistance through cell-adhesion dependent and independent mechanisms in DLBCL. Silencing of YB-1 could sensitize DLBCL cells to mitoxantrone and overcome cell adhesion-mediated drug resistance (CAM-DR) phenotype in an AKT-dependent manner. - Highlights: • The expression statuses of YB-1 and pYB-1{sup S102} are reversely correlated with outcomes of DLBCL patients. • YB-1 promotes cell proliferation by accelerating G1/S transition in DLBCL. • YB-1 confers drug resistance to mitoxantrone in DLBCL.
DEFF Research Database (Denmark)
Aarestrup, Frank Møller; Kruse, H.; Tast, E.
2000-01-01
This study compares the susceptibility of Enterococcus faecium isolated from pigs and poultry in Denmark, Finland, and Norway to antimicrobial agents used for growth promotion. E. faecium was isolated from 211 broilers and 55 pigs in Denmark in 1997, from Norwegian 55 poultry farms (turkey and br......%) of the virginiamycin-resistant isolates from pigs in Denmark. This study indicates that the use of antimicrobial agents for growth promotion in Denmark, Finland, and Norway have selected for resistance to most of these drugs among E. faecium in food animals....... as resistant to monensin or salinomycin. In general, an association between the usage of antimicrobial agents in the respective countries and the occurrence of associated resistance was observed. Resistance to avilamycin was frequently observed among isolates from broilers in Denmark, where avilamycin has been...... used, whereas all isolates from Finland and Norway, where these drugs have not been used, were susceptible. The same phenomenon could be observed for avoparcin, bacitracin, tylosin, and virginiamycin; resistance was frequently observed among isolates from where these antimicrobials have been widely...
Whole-cell vaccine of Streptococcus agalactiae in Oreochromis sp. with immersion method
Directory of Open Access Journals (Sweden)
, Sukenda
2015-05-01
Full Text Available ABSTRACT The study was aimed to evaluate the efficacy of formalin-killed non-hemolytic Streptococcus agalactiae N14G and NK1 isolates whole-killed vaccine to prevent streptococcosis in tilapia. Ten fishes were reared in a tank 60x30x35 cm3 with an average body weight at 10.79±0.99 g. Fish was vaccinated through bath immersion at a concentration of 109 cfu/mL. Fish was subsequently challenged by intraperitonial injection of Streptococcus agalactiae 105 cfu/mL at 11 days post-vaccination. Parameters observed were survival, relative percent survival (RPS, total leukocyte, phagocytic activity, antibody titer, total erythrocyte, haemoglobin level, haematocrit level, dan water quality. Samplings were performed in day-0, 20, and 30 after vaccination. Both vaccines have shown higher survival (60% and RPS (40% when challenged with pathogenic Streptococcus N14G isolates than other treatments. Based on RPS percentage observed, those vaccine were still not sufficiently effective to combat S. agalactiae infection. Keywords: tilapia, bath immersion, Streptococcus agalactiae, whole-cell vaccine ABSTRAK Penelitian ini bertujuan untuk mengevaluasi efikasi vaksin formalin-killed cell Streptococcus agalactiae tipe isolat nonhemolitik N14G dan NK1 se utuh yang diberikan melalui perendaman dalam mencegah penyakit streptococcosis pada ikan nila. Ikan nila yang digunakan memiliki bobot 10,79±0,99 g, dipelihara sebanyak sepuluh ekor dalam akuarium ukuran 60x30x35 cm3. Ikan divaksinasi dengan metode perendaman dengan dosis 109 cfu/mL. Uji tantang dilakukan pada hari ke-11 pascavaksinasi dengan dosis 105 cfu/mL. Parameter yang diamati meliputi sintasan (SR, sintasan relatif/relative percent survival (RPS, total leukosit, aktivitas fagositik, titer antibodi, total eritrosit, kadar hemoglobin, kadar hematokrit, dan kualitas air. Pengamatan parameter dilakukan pada hari ke-0, ke-10, ke-20, dan ke-30. Hasil penelitian menunjukkan perlakuan kedua vaksin yang diinfeksi
Wani, Parvaze Ahmad; Khan, Mohammad Saghir
2013-07-01
Pollution of the biosphere by heavy metals is a global threat that has accelerated dramatically since the beginning of industrial revolution. The aim of the study is to check the resistance of RL9 towards the metals and to observe the effect of Rhizobium species on growth, pigment content, protein and nickel uptake by lentil in the presence and absence of nickel. The multi metal tolerant and plant growth promoting Rhizobium strain RL9 was isolated from the nodules of lentil. The strain not only tolerated nickel but was also tolerant o cadmium, chromium, nickel, lead, zinc and copper. The strain tolerated nickel 500 μg/mL, cadmium 300 μg/mL, chromium 400 μg/mL, lead 1,400 μg/mL, zinc 1,000 μg/mL and copper 300 μg/mL, produced good amount of indole acetic acid and was also positive for siderophore, hydrogen cyanide and ammonia. The strain RL9 was further assessed with increasing concentrations of nickel when lentil was used as a test crop. The strain RL9 significantly increased growth, nodulation, chlorophyll, leghaemoglobin, nitrogen content, seed protein and seed yield compared to plants grown in the absence of bioinoculant but amended with nickel The strain RL9 decreased uptake of nickel in lentil compared to plants grown in the absence of bio-inoculant. Due to these intrinsic abilities strain RL9 could be utilized for growth promotion as well as for the remediation of nickel in nickel contaminated soil.
Species identification of Streptococcus bovis group isolates causing bacteremia
DEFF Research Database (Denmark)
Agergaard, Charlotte N; Knudsen, Elisa; Dargis, Rimtas
2017-01-01
This study compared two MALDI-TOF MS systems (Biotyper and VITEK MS) on clinical Streptococcus bovis group isolates (n=66). The VITEK MS gave fewer misidentifications and a higher rate of correct identifications than the Biotyper. Only the identification of S. lutetiensis by the VITEK MS was reli......This study compared two MALDI-TOF MS systems (Biotyper and VITEK MS) on clinical Streptococcus bovis group isolates (n=66). The VITEK MS gave fewer misidentifications and a higher rate of correct identifications than the Biotyper. Only the identification of S. lutetiensis by the VITEK MS...
Llor, Carles; Boada, Albert; Pons-Vigués, Mariona; Grenzner, Elisabet; Juvé, Rosa; Almeda, Jesús
2018-01-01
The information available on antibiotic resistance patterns are generally based on specimens from hospitalised individuals. This study was aimed at evaluating the antibiotic resistance rate of nasal carriage strains of Staphylococcus aureus and Streptococcus pneumoniae in healthy individuals, in accordance with age and gender, attended in Primary Care Centres (PCC). Cross-sectional study. Seven PCC in the Barcelona area. Healthy nasal carriers aged 4years or more who did not present with any sign of infectious disease, and had not taken any antibiotic or had been hospitalised in the previous 3months. A total of 3,969 nasal swabs valid for identification were collected between 2010 and 2011 and were sent to one central microbiological laboratory for isolation of both pathogens. Resistance to common antibiotics was determined on the basis of the current European Committee on Antimicrobial Susceptibility Testing guidelines on cut-off points. The prevalence of methicillin-resistant S.aureus was 1.3% (95%CI: 0.5-2.1%), with resistance rates of 87.1% to phenoxymethylpenicillin and 11.6% to azithromycin, with no significant differences with age and gender. A total of 2.4% (95CI%: 0.1-4.7%) of the pneumococcal strains were highly resistant to both phenoxymethylpenicillin and macrolides, whereas the highest resistance rates were to cefaclor (53.3%), followed by tetracycline (20%) and cefuroxime (12.1%). These pathogens have lower resistance rates in the community than in the hospital setting. Primary Care physicians must be more aware of the current antimicrobial resistance, in order to ensure prudent use of antibiotics. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.
Nguyen, Scott V; McShan, William M
2014-01-01
Streptococcus pyogenes is a significant pathogen of humans, annually causing over 700,000,000 infections and 500,000 deaths. Virulence in S. pyogenes is closely linked to mobile genetic elements like phages and chromosomal islands (CI). S. pyogenes phage-like chromosomal islands (SpyCI) confer a complex mutator phenotype on their host. SpyCI integrate into the 5' end of DNA mismatch repair (MMR) gene mutL, which also disrupts downstream operon genes lmrP, ruvA, and tag. During early logarithmic growth, SpyCI excise from the bacterial chromosome and replicate as episomes, relieving the mutator phenotype. As growth slows and the cells enter stationary phase, SpyCI reintegrate into the chromosome, again silencing the MMR operon. This system creates a unique growth-dependent and reversible mutator phenotype. Additional CI using the identical attachment site in mutL have been identified in related species, including Streptococcus dysgalactiae subsp. equisimilis, Streptococcus anginosus, Streptococcus intermedius, Streptococcus parauberis, and Streptococcus canis. These CI have small genomes, which range from 13 to 20 kB, conserved integrase and DNA replication genes, and no identifiable genes encoding capsid proteins. SpyCI may employ a helper phage for packaging and dissemination in a fashion similar to the Staphylococcus aureus pathogenicity islands (SaPI). Outside of the core replication and integration genes, SpyCI and related CI show considerable diversity with the presence of many indels that may contribute to the host cell phenotype or fitness. SpyCI are a subset of a larger family of streptococcal CI who potentially regulate the expression of other host genes. The biological and phylogenetic analysis of streptococcal chromosomal islands provides important clues as to how these chromosomal islands help S. pyogenes and other streptococcal species persist in human populations in spite of antibiotic therapy and immune challenges.
Antimicrobial resistance and molecular epidemiology of streptococci from bovine mastitis
DEFF Research Database (Denmark)
Rato, Márcia G.; Bexiga, Ricardo; Florindo, Carlos
2013-01-01
Streptococcus agalactiae (Group B Streptococcus, GBS), Streptococcus dysgalactiae subsp. dysgalactiae (Group C Streptococcus, GCS) and Streptococcus uberis are relevant mastitis pathogens, a highly prevalent and costly disease in dairy industry due to antibiotherapy and loss in milk production. T...
Directory of Open Access Journals (Sweden)
M. Quiroga
2008-06-01
Full Text Available This study was performed to determine the susceptibility patterns and the colonization rate of Group B Streptococcus (GBS in a population of pregnant women. From January 2004 to December 2006, vaginal-rectal swabs were obtained from 1105 women attending Dr. Ramón Madariaga Hospital, in Posadas, Misiones, Argentina. The carriage rate of GBS among pregnant women was 7.6%. A total of 62 GBS strains were randomly selected for in vitro susceptibility testing to penicillin G, ampicillin, tetracycline, levofloxacin, gatifloxacin, ciprofloxacin, quinupristin-dalfopristin, linezolid, vancomycin, rifampicin, trimethoprim-sulfametoxazol, nitrofurantoin, gentamicin, clindamycin and erythromycin, and determination of resistance phenotypes. No resistance to penicillin, ampicillin, quinupristin-dalfopristin, linezolid, and vancomycin was found. Of the isolates examined 96.8%, 98.3%, 46.8%, and 29.0% were susceptible to rifampicin, nitrofurantoin, trimethoprim-sulfametoxazol and tetracycline, respectively. Rank order of susceptibility for the quinolones was: gatifloxacin (98.4% > levofloxacin (93.5% > ciprofloxacin (64.5%. The rate of resistance to erythromycin (9.7% was higher than that of other reports from Argentina. High-level resistance to gentamicin was not detected in any of the isolates. Based on our finding of 50% of GBS isolates with MIC to gentamicin equal o lower than 8 µg/ml, a concentration used in one of the selective media recommended for GBS isolation, we suggested, at least in our population, the use of nalidixic acid and colistin in selective media with the aim to improve the sensitivity of screening cultures for GBS carriage in women.Esse estudo objetivou determinar os padrões de sensibilidade a antibióticos e as taxas de colonização de Streptococcus do grupo B (GBS em uma população de mulheres grávidas. Entre janeiro de 2004 e dezembro de 2006, foram obtidos swabs vaginais-retais de 1105 mulheres no Hospital Dr. Ramon Madariaga, em
Directory of Open Access Journals (Sweden)
La Mantia I
2017-06-01
Full Text Available Ignazio La Mantia, Attilio Varricchio, Giorgio Ciprandi Associazione Italiana Vie Aeree Superiori, Naples, Italy Abstract: Recurrence of acute otitis media (RAOM is a relevant issue in the clinical practice. “Bacteriotherapy” has been proposed as an option in children with RAOM. Streptococcus salivarius 24SMB nasal spray has been previously demonstrated to reduce the risk of acute otitis media (AOM in otitis-prone children. The current retrospective and observational study aimed to confirm this outcome in a real-life setting, such as the common pediatric practice. Group A (108 children served as control; group B (159 children was treated with S. salivarius 24SMB and Streptococcus oralis 89a nasal spray after the first AOM episode. Active treatment consisted of 3 monthly courses: 2 puffs per nostril twice/day for a week. Group B showed a significant reduction of AOM episodes in comparison with group A (p<0.0001. Notably, all actively treated children with the highest AOM recurrence had a reduction of recurrence, whereas only 50% of the control group children had reduced RAOM (p<0.0001. Also, severity grade of AOM significantly diminished after the preventive bacteriotherapy (p<0.0001. In conclusion, the current retrospective and observational study demonstrated that S. salivarius 24SMB and S. oralis 89a nasal spray could be effective in the prevention of RAOM in a real-life setting. Keywords: recurrent acute otitis media, bacteriotherapy, Streptococcus salivarius 24SMB, Streptococcus oralis 89a, nasal spray, children
Group B streptococcus exploits vaginal epithelial exfoliation for ascending infection.
Vornhagen, Jay; Armistead, Blair; Santana-Ufret, Verónica; Gendrin, Claire; Merillat, Sean; Coleman, Michelle; Quach, Phoenicia; Boldenow, Erica; Alishetti, Varchita; Leonhard-Melief, Christina; Ngo, Lisa Y; Whidbey, Christopher; Doran, Kelly S; Curtis, Chad; Waldorf, Kristina M Adams; Nance, Elizabeth; Rajagopal, Lakshmi
2018-04-09
Thirteen percent of pregnancies result in preterm birth or stillbirth, accounting for fifteen million preterm births and three and a half million deaths annually. A significant cause of these adverse pregnancy outcomes is in utero infection by vaginal microorganisms. To establish an in utero infection, vaginal microbes enter the uterus by ascending infection; however, the mechanisms by which this occurs are unknown. Using both in vitro and murine models of vaginal colonization and ascending infection, we demonstrate how a vaginal microbe, group B streptococcus (GBS), which is frequently associated with adverse pregnancy outcomes, uses vaginal exfoliation for ascending infection. GBS induces vaginal epithelial exfoliation by activation of integrin and β-catenin signaling. However, exfoliation did not diminish GBS vaginal colonization as reported for other vaginal microbes. Rather, vaginal exfoliation increased bacterial dissemination and ascending GBS infection, and abrogation of exfoliation reduced ascending infection and improved pregnancy outcomes. Thus, for some vaginal bacteria, exfoliation promotes ascending infection rather than preventing colonization. Our study provides insight into mechanisms of ascending infection by vaginal microbes.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Jian, E-mail: zhangjian197011@yahoo.com [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Zhang, Tao [Department of Thoracic Surgery, Tangdu Hospital, The Fourth Military Medical University, Xi' an 710038 (China); Ti, Xinyu; Shi, Jieran; Wu, Changgui; Ren, Xinling [Department of Respiratory Medicine, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China); Yin, Hong, E-mail: yinnhong@yahoo.com [The Medical Image Center, Xijing Hospital, The Fourth Military Medical University, Xi' an 710032 (China)
2010-08-13
Research highlights: {yields} Curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells {yields} Curcumin promotes apoptosis in A549/DDP cells through a miRNA signaling pathway {yields} Curcumin induces A549/DDP cell apoptosis by downregulating miR-186* {yields} miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin -- Abstract: Curcumin extracted from the rhizomes of Curcuma longa L. has been shown to have inhibitory effects on cancers through its anti-proliferative and pro-apoptotic activities. Emerging evidence demonstrates that curcumin can overcome drug resistance to classical chemotherapies. Thus, the mechanisms underlying the anti-tumor activities of curcumin require further study. In our study, we first demonstrated that curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells. Further studies showed that curcumin altered miRNA expression; in particular, significantly downregulated the expression of miR-186* in A549/DDP. In addition, transfection of cells with a miR-186* inhibitor promoted A549/DDP apoptosis, and overexpression of miR-186* significantly inhibited curcumin-induced apoptosis in A549/DDP cells. These observations suggest that miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin.
International Nuclear Information System (INIS)
Zhang, Jian; Zhang, Tao; Ti, Xinyu; Shi, Jieran; Wu, Changgui; Ren, Xinling; Yin, Hong
2010-01-01
Research highlights: → Curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells → Curcumin promotes apoptosis in A549/DDP cells through a miRNA signaling pathway → Curcumin induces A549/DDP cell apoptosis by downregulating miR-186* → miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin -- Abstract: Curcumin extracted from the rhizomes of Curcuma longa L. has been shown to have inhibitory effects on cancers through its anti-proliferative and pro-apoptotic activities. Emerging evidence demonstrates that curcumin can overcome drug resistance to classical chemotherapies. Thus, the mechanisms underlying the anti-tumor activities of curcumin require further study. In our study, we first demonstrated that curcumin had anti-cancer effects on A549/DDP multidrug-resistant human lung adenocarcinoma cells. Further studies showed that curcumin altered miRNA expression; in particular, significantly downregulated the expression of miR-186* in A549/DDP. In addition, transfection of cells with a miR-186* inhibitor promoted A549/DDP apoptosis, and overexpression of miR-186* significantly inhibited curcumin-induced apoptosis in A549/DDP cells. These observations suggest that miR-186* may serve as a potential gene therapy target for refractory lung cancer that is sensitive to curcumin.
Directory of Open Access Journals (Sweden)
Maurilio Lara-Flores
2013-07-01
Full Text Available In this study, the effect as growth promoter of five lactic acid strains (Enterococcus faecium, E. durans, Leuconostoc sp., Streptococcus sp. I and Streptococcus sp. II, isolated from intestinal tract of Nile tilapia (Oreochromis niloticus, was evaluated. Eight isocaloric diets were formulated: one containing 40% of protein as positive control, and seven with 27% protein. Five diets with 27% protein were supplemented with one of the isolated lactic acid bacteria in a concentration of 2.5x10(6 cfu g-1 of diet. A commercial probiotic based on S. faecium and Lactobacillus acidophilus was added at the same concentration to one 27% protein diet as a comparative diet, and the last diet was not supplemented with bacteria (negative control. Tilapia fry (280 mg basal weight stocked in 15 L aquaria at a density of two per liter were fed for 12 weeks with experimental diets. Results showed that fry fed with native bacteria supplemented diets presented significantly higher growth and feeding performance than those fed with control diet. Treatment with Streptococcus sp. I isolated from the intestine of Tilapia produced the best growth and feeding efficiency, suggesting that this bacteria is an appropriate native growth promoter.
Catabolite control of sugar metabolism in Streptococcus thermophilus
Bogaard, van den P.T.C.
2002-01-01
Streptococcus thermophilus
The post-vaccine microevolution of invasive Streptococcus pneumoniae
Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L
2015-01-01
The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped
Metabolic Mechanism for l-Leucine-Induced Metabolome To Eliminate Streptococcus iniae.
Du, Chao-Chao; Yang, Man-Jun; Li, Min-Yi; Yang, Jun; Peng, Bo; Li, Hui; Peng, Xuan-Xian
2017-05-05
Crucial metabolites that modulate hosts' metabolome to eliminate bacterial pathogens have been documented, but the metabolic mechanisms are largely unknown. The present study explores the metabolic mechanism for l-leucine-induced metabolome to eliminate Streptococcus iniae in tilapia. GC-MS-based metabolomics was used to investigate the tilapia liver metabolic profile in the presence of exogenous l-leucine. Thirty-seven metabolites of differential abundance were determined, and 11 metabolic pathways were enriched. Pattern recognition analysis identified serine and proline as crucial metabolites, which are the two metabolites identified in survived tilapias during S. iniae infection, suggesting that the two metabolites play crucial roles in l-leucine-induced elimination of the pathogen by the host. Exogenous l-serine reduces the mortality of tilapias infected by S. iniae, providing a robust proof supporting the conclusion. Furthermore, exogenous l-serine elevates expression of genes IL-1β and IL-8 in tilapia spleen, but not TNFα, CXCR4 and Mx, suggesting that the metabolite promotes a phagocytosis role of macrophages, which is consistent with the finding that l-leucine promotes macrophages to kill both Gram-positive and Gram-negative bacterial pathogens. Therefore, the ability of phagocytosis enhanced by exogenous l-leucine is partly attributed to elevation of l-serine. These results demonstrate a metabolic mechanism by which exogenous l-leucine modulates tilapias' metabolome to enhance innate immunity and eliminate pathogens.
Hypopituitarism as consequence of late neonatal infection by Group B streptococcus: a case report.
Ferreira, Amanda Santana; Fernandes, Ana Lourdes Lima Araújo; Guaragna-Filho, Guilherme
2015-01-01
Hypopituitarism is a condition characterized by dysfunction of the pituitary gland hormone production. The insults of the perinatal period, which includes the late infection by Group B Streptococcus, consists in a rare etiology of this condition. We present the case of a 39-days-old infant with meningitis caused by Streptococcus Group B, which showed, among other consequences, hypopituitarism.
Streptococcus spp. including Streptococcus agalactiae (Lancefield group B streptococci) are considered emerging pathogens responsible for approximately $1 billion USD in annual losses to the global tilapia (Oreochromis sp.) aquaculture industry. This study evaluated a published multiplex PCR capsul...
Pino Rivero, V; Trinidad Ramos, G; González Palomino, A; Pantoja Hernández, C G; Mogollón Cano-Cortés, T; Carrasco Claver, F; Guerra Camacho, M; Blasco Huelva, A
2006-01-01
We report a case of cervical abscess after the ingestion of foreign body (chicken bone) secondary to probable esophageal perforation that it was sent to us with suspicion of mediastinal complication. The girl, 17 years-old, nothing else to arrive our hospitalary center required entrance in ICU due to her severe clinical process: High fever, intense neck-thoracic pain, laterocervical diffuse and progressive left inflammation and bad general state. The CT showed the presence of a well defined abscess and abundant aerial component that dissected the cervical muscles that made necessary to perform drainage verifying intraoperatively no mediastinal involvement. The culture of the purulent collection revealed Streptococcus anginosus/milleri resistant to clindamicine but sensible to penicilina and derivatives. We exposed a serie of considerations at respect of such microorganism and its clinical signification.
Hernández-Serrano, Olga; Griffin, Kenneth W.; García-Fernández, José Manuel; Espada, Mireia; Orgilés José P.
2013-01-01
The objective of the present study was to examine the contribution of three intervention components (public commitment, resistance to advertising, and leisure promotion) on alcohol and protective variables in a school-based substance use prevention program. Participants included 480 Spanish students aged from 14 to 16 who received the…
Regulation of PI-2b Pilus Expression in Hypervirulent Streptococcus agalactiae ST-17 BM110.
Directory of Open Access Journals (Sweden)
Bruno Périchon
Full Text Available The widely spread Streptococcus agalactiae (also known as Group B Streptococcus, GBS "hypervirulent" ST17 clone is strongly associated with neonatal meningitis. The PI-2b locus is mainly found in ST17 strains but is also present in a few non ST17 human isolates such as the ST-7 prototype strain A909. Here, we analysed the expression of the PI-2b pilus in the ST17 strain BM110 as compared to the non ST17 A909. Comparative genome analyses revealed the presence of a 43-base pair (bp hairpin-like structure in the upstream region of PI-2b operon in all 26 ST17 genomes, which was absent in the 8 non-ST17 strains carrying the PI-2b locus. Deletion of this 43-bp sequence in strain BM110 resulted in a 3- to 5-fold increased transcription of PI-2b. Characterization of PI-2b promoter region in A909 and BM110 strains was carried out by RNAseq, primer extension, qRT-PCR and transcriptional fusions with gfp as reporter gene. Our results indicate the presence of a single promoter (Ppi2b with a transcriptional start site (TSS mapped 37 bases upstream of the start codon of the first PI-2b gene. The large operon of 16 genes located upstream of PI-2b codes for the group B carbohydrate (also known as antigen B, a major constituent of the bacterial cell wall. We showed that the hairpin sequence located between antigen B and PI-2b operons is a transcriptional terminator. In A909, increased expression of PI-2b probably results from read-through transcription from antigen B operon. In addition, we showed that an extended 5' promoter region is required for maximal transcription of gfp as a reporter gene in S. agalactiae from Ppi2b promoter. Gene reporter assays performed in Lactococcus lactis strain NZ9000, a related non-pathogenic Gram-positive species, revealed that GBS-specific regulatory factors are required to drive PI-2b transcription. PI-2b expression is up-regulated in the BM110ΔcovR mutant as compared to the parental BM110 strain, but this effect is probably
Institute of Scientific and Technical Information of China (English)
Dyanne Medina-Flores; Gabriela Ulloa-Urizar; Rosella Camere-Colarossi; Stefany Caballero-Garca; Frank Mayta-Tovalino; Juana del Valle-Mendoza
2016-01-01
Objective: To evaluate the cytotoxic and antibacterial effect of Bixa orellana L. (B. orellana) (achiote) methanol extract against Streptococcus mutans (ATCC 25175) (S. mutans) and Streptococcus sanguinis (ATCC 10556) (S. sanguinis). Methods: Two methanol extracts of B. orellana were prepared in vitro, from the seeds and leaves. The antibacterial activity of extracts against S. mutans and S. sanguinis was evaluated using the cup-plate agar diffusion method. The minimum inhibitory concen-tration (MIC) was determined using the microdilution method and the cytotoxic activity was determinated by using the cell line MDCK. Results: A stronger antibacterial effect was observed with the leaves methanolic extract with an inhibition zone of (19.97 ± 1.31) mm against S. mutans and (19.97 ± 1.26) mm against S. sanguinis. The methanolic extract of the seeds had an activity of (15.11 ± 1.03) mm and (16.15 ± 2.15) mm against S. mutans and S. sanguinis, respectively. The MIC of the leaf and the seed extracts against S. sanguinis was 62.5 and 125 mg/mL, respectively, and the MIC of the leaf extract against S. mutans was 62.5 mg/mL, and for the seed extract it was 31.25 mg/mL. The 50%cytotoxic concentration was 366.45 and 325.05 mg/mL for the leaves and seeds extracts, respectively. Conclusions: The experimental findings demonstrated the antibacterial effect of the methanolic extract of B. orellana (achiote) on S. mutans and S. sanguinis. The extract of this plant is cytotoxic at high concentrations.
Institute of Scientific and Technical Information of China (English)
Rosella Camere-Colarossi; Gabriela Ulloa-Urizar; Dyanne Medina-Flores; Stefany Caballero-Garca; Frank Mayta-Tovalino; Juana del Valle-Mendoza
2016-01-01
Objective: To evaluate the antibacterial and cytotoxic effect of Myrciaria dubia (Camu camu) (M. dubia) methanol extract, against Streptococcus mutans (ATCC 25175) (S. mutans) and Streptococcus sanguinis (ATCC 10556) (S. sanguinis). Methods: Two methanol extracts of M. dubia were prepared in vitro, from the seeds and pulp. Ten independent tests were prepared for each type of extract, using 0.12% chlor-hexidine solution as positive control. Agar diffusion test was used by preparing wells with the experimental solutions cultivated in anaerobic conditions for 48 h at 37 ° C. Mean-while, the minimum inhibitory concentration and the cytotoxic effect over MDCK cell line was found. Results: A higher antibacterial effect was observed with the methanol seed extract with an inhibitory halo of (21.36 ± 6.35) mm and (19.21 ± 5.18) mm against S. mutans and S. sanguinis, respectively. The methanol extract of the pulp had an effect of (16.20 ± 2.08) mm and (19.34 ± 2.90) mm, respectively. The minimum inhibitory concentration of the pulp extract was 62.5μg/mL for both strains, whereas for the seed antibacterial activity was observed even at low concentrations. The CC50 of the seeds extract was at a higher con-centration than 800μg/mL and 524.37μg/mL for the pulp extract. Conclusions: The experimental findings demonstrated the antibacterial effect of the methanol extract of M. dubia against S. mutans and S. sanguinis. These extracts were not cytotoxic at high concentrations.
N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae
Directory of Open Access Journals (Sweden)
Muhammad Afzal
2016-09-01
Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.
Characterization of salivary alpha-amylase binding to Streptococcus sanguis
International Nuclear Information System (INIS)
Scannapieco, F.A.; Bergey, E.J.; Reddy, M.S.; Levine, M.J.
1989-01-01
The purpose of this study was to identify the major salivary components which interact with oral bacteria and to determine the mechanism(s) responsible for their binding to the bacterial surface. Strains of Streptococcus sanguis, Streptococcus mitis, Streptococcus mutans, and Actinomyces viscosus were incubated for 2 h in freshly collected human submandibular-sublingual saliva (HSMSL) or parotid saliva (HPS), and bound salivary components were eluted with 2% sodium dodecyl sulfate. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer, alpha-amylase was the prominent salivary component eluted from S. sanguis. Studies with 125 I-labeled HSMSL or 125 I-labeled HPS also demonstrated a component with an electrophoretic mobility identical to that of alpha-amylase which bound to S. sanguis. Purified alpha-amylase from human parotid saliva was radiolabeled and found to bind to strains of S. sanguis genotypes 1 and 3 and S. mitis genotype 2, but not to strains of other species of oral bacteria. Binding of [ 125 I]alpha-amylase to streptococci was saturable, calcium independent, and inhibitable by excess unlabeled alpha-amylases from a variety of sources, but not by secretory immunoglobulin A and the proline-rich glycoprotein from HPS. Reduced and alkylated alpha-amylase lost enzymatic and bacterial binding activities. Binding was inhibited by incubation with maltotriose, maltooligosaccharides, limit dextrins, and starch
Mohd Bakhori, Siti Khadijah; Mahmud, Shahrom; Ling, Chuo Ann; Sirelkhatim, Amna Hassan; Hasan, Habsah; Mohamad, Dasmawati; Masudi, Sam'an Malik; Seeni, Azman; Abd Rahman, Rosliza
2017-09-01
ZnO with two different morphologies were used to study the inhibition of Streptococcus sobrinus and Streptococcus mutans which are closely associated with tooth cavity. Rod-like shaped ZnO-A and plate-like shaped ZnO-B were produced using a zinc boiling furnace. The nanopowders were characterized using energy filtered transmission electron microscopy (EFTEM), X-ray diffraction (XRD), photoluminescence (PL) spectroscopy, Raman spectroscopy and dynamic light scattering (DLS) to confirm the properties of the ZnO polycrystalline wurtzite structures. XRD results show that the calculated crystallite sizes of ZnO-A and ZnO-B were 36.6 and 39.4nm, respectively, whereas DLS revealed particle size distributions of 21.82nm (ZnO-A) and 52.21nm (ZnO-B). PL spectra showed ion vacancy defects related to green and red luminescence for both ZnO particles. These defects evolved during the generation of reactive oxygen species which contributed to the antibacterial activity. Antibacterial activity was investigated using microdilution technique towards S. sobrinus and S. mutans at different nanopowder concentrations. Results showed that ZnO-A exhibited higher inhibition on both bacteria compared with ZnO-B. Moreover, S. mutans was more sensitive compared with S. sobrinus because of its higher inhibition rate. Copyright © 2017 Elsevier B.V. All rights reserved.
Valentiny, Christine; Dirschmid, Harald; Lhotta, Karl
2015-05-28
Streptococcus uberis, the most frequent cause of mastitis in lactating cows, is considered non-pathogenic for humans. Only a few case reports have described human infections with this microorganism, which is notoriously difficult to identify. We report the case of a 75-year-old male haemodialysis patient, who developed a severe foot infection with osteomyelitis and bacteraemia. Both Streptococcus uberis and Staphylococcus aureus were identified in wound secretion and blood samples using mass spectrometry. The presence of Streptococcus uberis was confirmed by superoxide dismutase A sequencing. The patient recovered after amputation of the forefoot and antibiotic treatment with ampicillin/sulbactam. He had probably acquired the infection while walking barefoot on cattle pasture land. This is the first case report of a human infection with Streptococcus uberis with identification of the microorganism using modern molecular technology. We propose that Staphylococcus aureus co-infection was a prerequisite for deep wound and bloodstream infection with Streptococcus uberis.
Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.
Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-05-01
Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.
Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion
DEFF Research Database (Denmark)
Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie
2008-01-01
A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....
Immunogenic properties of Streptococcus agalactiae FbsA fragments.
Directory of Open Access Journals (Sweden)
Salvatore Papasergi
Full Text Available Several species of Gram-positive bacteria can avidly bind soluble and surface-associated fibrinogen (Fng, a property that is considered important in the pathogenesis of human infections. To gain insights into the mechanism by which group B Streptococcus (GBS, a frequent neonatal pathogen, interacts with Fng, we have screened two phage displayed genomic GBS libraries. All of the Fng-binding phage clones contained inserts encoding fragments of FbsA, a protein displaying multiple repeats. Since the functional role of this protein is only partially understood, representative fragments were recombinantly expressed and analyzed for Fng binding affinity and ability to induce immune protection against GBS infection. Maternal immunization with 6pGST, a fragment containing five repeats, significantly protected mouse pups against lethal GBS challenge and these protective effects could be recapitulated by administration of anti-6pGST serum from adult animals. Notably, a monoclonal antibody that was capable of neutralizing Fng binding by 6pGST, but not a non-neutralizing antibody, could significantly protect pups against lethal GBS challenge. These data suggest that FbsA-Fng interaction promotes GBS pathogenesis and that blocking such interaction is a viable strategy to prevent or treat GBS infections.
DEFF Research Database (Denmark)
Kostopoulou, Ourania N; Mohammad, Abdul-Aleem; Bartek, Jiri
2018-01-01
Glioma stem cells (GSCs) are glioblastoma (GBM) cells that are resistant to therapy and can give rise to recurrent tumors. The identification of patient-related factors that support GSCs is thus necessary to design effective therapies for GBM patients. Glucocorticoids (GCs) are used to treat GBM......-associated edema. However, glucocorticoids participate in the physiological response to psychosocial stress, which has been linked to poor cancer prognosis. This raises concern that glucocorticoids affect the tumor and GSCs. Here, we treated primary human GBM cells with dexamethasone and evaluated GC......-driven changes in cell morphology, proliferation, migration, gene expression, secretory activity and growth as neurospheres. Dexamethasone treatment of GBM cells appeared to promote the development of a GSC-like phenotype and conferred resistance to physiological stress and chemotherapy. We also analyzed...
Emergence of antibiotic-resistant bacteria in patients with Fournier gangrene.
Lin, Wei-Ting; Chao, Chien-Ming; Lin, Hsin-Lan; Hung, Ming-Chran; Lai, Chih-Cheng
2015-04-01
This study was conducted to investigate the bacteriology and associated patterns of antibiotic resistance Fournier gangrene. Patients with Fournier's gangrene from 2008 to 2012 were identified from the computerized database in a medical center in southern Taiwan. The medical records of all patients with Fournier's gangrene were reviewed retrospectively. There were 61 microorganisms, including 60 bacteria and one Candida spp, isolated from clinical wound specimens from 32 patients. The most common isolates obtained were Streptococcus spp. (n=12), Peptoniphilus spp. (n=8), Staphylococcus aureus (n=7), Escherichia coli (n=7), and Klebsiella pneumoniae (n=7). Among 21 strains of gram-negative bacilli, five (23.8%) were resistant to fluoroquinolones, and three isolates were resistant to ceftriaxone. Two E. coli strains produced extended-spectrum beta-lactamase. Four of the seven S. aureus isolates were methicillin-resistant. Among 15 anaerobic isolates, nine (60%) were resistant to penicillin, and eight (53.3%) were resistant to clindamycin. Four (26.7%) isolates were resistant to metronidazole. The only independent risk factor associated with mortality was inappropriate initial antibiotic treatment (p=0.021). Antibiotic-resistant bacteria are emerging in the clinical setting of Fournier gangrene. Clinicians should use broad-spectrum antibiotics initially to cover possible antibiotic-resistant bacteria.
Shome, Bibek Ranjan; Bhuvana, Mani; Mitra, Susweta Das; Krithiga, Natesan; Shome, Rajeswari; Velu, Dhanikachalam; Banerjee, Apala; Barbuddhe, Sukhadeo B; Prabhudas, Krishnamshetty; Rahman, Habibar
2012-12-01
Streptococci are one among the major mastitis pathogens which have a considerable impact on cow health, milk quality, and productivity. The aim of the present study was to investigate the occurrence and virulence characteristics of streptococci from bovine milk and to assess the molecular epidemiology and population structure of the Indian isolates using multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). Out of a total of 209 bovine composite milk samples screened from four herds (A-D), 30 Streptococcus spp. were isolated from 29 milk samples. Among the 30 isolates, species-specific PCR and partial 16S rRNA gene sequence analysis identified 17 Streptococcus agalactiae arising from herd A and 13 Streptococcus uberis comprising of 5, 7, and 1 isolates from herds B, C, and D respectively. PCR based screening for virulence genes revealed the presence of the cfb and the pavA genes in 17 and 1 S. agalactiae isolates, respectively. Similarly, in S. uberis isolates, cfu gene was present in six isolates from herd C, the pau A/skc gene in all the isolates from herds B, C, and D, whereas the sua gene was present in four isolates from herd B and the only isolate from herd D. On MLST analysis, all the S. agalactiae isolates were found to be of a novel sequence type (ST), ST-483, reported for the first time and is a single locus variant of the predicted subgroup founder ST-310, while the S. uberis isolates were found to be of three novel sequence types, namely ST-439, ST-474, and ST-475, all reported for the first time. ST-474 was a double locus variant of three different STs of global clonal complex ST-143 considered to be associated with clinical and subclinical mastitis, but ST-439 and ST-475 were singletons. Unique sequence types identified for both S. agalactiae and S. uberis were found to be herd specific. On PFGE analysis, identical or closely related restriction patterns for S. agalactiae ST-483 and S. uberis ST-439 in herds A and B