WorldWideScience

Sample records for streptococcus pneumoniae-infected rats

  1. Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Muhammad Rafiullah Khan

    2011-01-01

    In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

  2. Streptococcus pneumoniae urinary tract infection in pedeatrics.

    Science.gov (United States)

    Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence

    2017-06-01

    Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.

  3. Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection

    Science.gov (United States)

    McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz

    1984-12-01

    A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.

  4. Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae.

    Science.gov (United States)

    Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T

    2017-07-01

    Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

  5. Factors associated with colonization of Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

  6. Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.

    Science.gov (United States)

    Sánchez, A; Robaina, R; Pérez, G; Cairoli, E

    2016-04-01

    Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.

  7. Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Lei Jiao

    2016-01-01

    Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.

  8. Lung abscess caused by Streptococcus pneumoniae serotype 6B

    Directory of Open Access Journals (Sweden)

    Yuhei Ito

    Full Text Available Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess. Keywords: Streptococcus pneumoniae, Lung abscess, Serotype 6B, Penicillin-resistant Streptococcus pneumoniae

  9. A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yokoyama T

    2011-12-01

    Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

  10. Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

    NARCIS (Netherlands)

    D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)

    2015-01-01

    textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

  11. Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia induce distinct host responses.

    Science.gov (United States)

    McConnell, Kevin W; McDunn, Jonathan E; Clark, Andrew T; Dunne, W Michael; Dixon, David J; Turnbull, Isaiah R; Dipasco, Peter J; Osberghaus, William F; Sherman, Benjamin; Martin, James R; Walter, Michael J; Cobb, J Perren; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M

    2010-01-01

    Pathogens that cause pneumonia may be treated in a targeted fashion by antibiotics, but if this therapy fails, then treatment involves only nonspecific supportive measures, independent of the inciting infection. The purpose of this study was to determine whether host response is similar after disparate infections with similar mortalities. Prospective, randomized controlled study. Animal laboratory in a university medical center. Pneumonia was induced in FVB/N mice by either Streptococcus pneumoniae or two different concentrations of Pseudomonas aeruginosa. Plasma and bronchoalveolar lavage fluid from septic animals was assayed by a microarray immunoassay measuring 18 inflammatory mediators at multiple time points. The host response was dependent on the causative organism as well as kinetics of mortality, but the pro-inflammatory and anti-inflammatory responses were independent of inoculum concentration or degree of bacteremia. Pneumonia caused by different concentrations of the same bacteria, Pseudomonas aeruginosa, also yielded distinct inflammatory responses; however, inflammatory mediator expression did not directly track the severity of infection. For all infections, the host response was compartmentalized, with markedly different concentrations of inflammatory mediators in the systemic circulation and the lungs. Hierarchical clustering analysis resulted in the identification of five distinct clusters of the host response to bacterial infection. Principal components analysis correlated pulmonary macrophage inflammatory peptide-2 and interleukin-10 with progression of infection, whereas elevated plasma tumor necrosis factor sr2 and macrophage chemotactic peptide-1 were indicative of fulminant disease with >90% mortality within 48 hrs. Septic mice have distinct local and systemic responses to Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia. Targeting specific host inflammatory responses induced by distinct bacterial infections could represent a

  12. Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man.

    Science.gov (United States)

    Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel

    2015-03-02

    We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

  13. Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

    Directory of Open Access Journals (Sweden)

    Florry E van den Boogaard

    Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

  14. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo

    2011-12-01

    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

  15. Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

    NARCIS (Netherlands)

    D. Bogaert (Debby)

    2004-01-01

    markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

  16. Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.

    Science.gov (United States)

    Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius

    2014-01-01

    Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

  17. NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE

    NARCIS (Netherlands)

    Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.

    2011-01-01

    The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

  18. Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

    Directory of Open Access Journals (Sweden)

    Williams Thomas

    2012-09-01

    Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

  19. Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

    Directory of Open Access Journals (Sweden)

    Mario Ferrer-Navarro

    2018-05-01

    Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

  20. Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Chong Jie Hao

    2016-03-01

    Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.

  1. C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

    Directory of Open Access Journals (Sweden)

    Catherine Hyams

    2010-01-01

    Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

  2. Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

    DEFF Research Database (Denmark)

    Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina

    2004-01-01

    Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. pernillemartens@yahoo.com BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

  3. The LuxS/AI-2 Quorum-Sensing System of Streptococcus pneumoniae Is Required to Cause Disease, and to Regulate Virulence- and Metabolism-Related Genes in a Rat Model of Middle Ear Infection

    Directory of Open Access Journals (Sweden)

    Mukesh K. Yadav

    2018-05-01

    Full Text Available Objective:Streptococcus pneumoniae colonizes the nasopharynx of children, and from nasopharynx it could migrate to the middle ear and causes acute otitis media (AOM. During colonization and AOM, the pneumococcus forms biofilms. In vitro biofilm formation requires a functional LuxS/AI-2 quorum-sensing system. We investigated the role of LuxS/AI-2 signaling in pneumococcal middle ear infection, and identified the genes that are regulated by LuxS/AI-2 during pneumococcal biofilm formation.Methods:Streptococcus pneumoniae D39 wild-type and an isogenic D39ΔluxS strain were utilized to evaluate in vitro biofilm formation, and in vivo colonization and epithelial damage using a microtiter plate assay and a rat model of pneumococcal middle ear infection, respectively. Biofilm structures and colonization and epithelial damage were evaluated at the ultrastructural level by scanning electron microscopy and confocal microscopy. Microarrays were used to investigate the global genes that were regulated by LuxS/AI-2 during biofilm formation.Results: The biofilm biomass and density of D39ΔluxS were significantly (p < 0.05 lower than those of D39 wild-type. SEM and confocal microscopy revealed that D39ΔluxS formed thin biofilms in vitro compared with D39 wild-type. The in vivo model of middle ear infection showed that D39ΔluxS resulted in ~60% less (p < 0.05 bacterial colonization than the wild-type. SEM analysis of the rat middle ears revealed dense biofilm-like cell debris deposited on the cilia in wild-type D39-infected rats. However, little cell debris was deposited in the middle ears of the D39ΔluxS-inoculated rats, and the cilia were visible. cDNA-microarray analysis revealed 117 differentially expressed genes in D39ΔluxS compared with D39 wild-type. Among the 66 genes encoding putative proteins and previously characterized proteins, 60 were significantly downregulated, whereas 6 were upregulated. Functional annotation revealed that genes involved in

  4. Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae.

    Science.gov (United States)

    Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan

    2016-02-01

    Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  5. Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

    Science.gov (United States)

    Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

    2015-07-01

    Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

    Directory of Open Access Journals (Sweden)

    Raga-Luria Xavier

    2009-03-01

    Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

  7. Lung abscess caused by Streptococcus pneumoniae serotype 6B.

    Science.gov (United States)

    Ito, Yuhei; Toyoshima, Hirokazu; Suzuki, Takehiro; Iwamoto, Keisuke; Sasano, Hajime; Itani, Hidetoshi; Kondo, Shigeto; Tanigawa, Motoaki

    2018-01-01

    Lung abscess has been considered to be a rare complication of pneumococcal infection, and most cases are reported to be Streptococcus pneumoniae serotype 3. A 67-year-old man presented with fever and was diagnosed to have lung abscess caused by S. pneumoniae serotype 6B. The minimal inhibitory concentration (MIC) of penicillin for the isolate was 1 μg/mL. He was treated with high-dose intravenous sulbactam/ampicillin as definitive therapy based on susceptibility testing for S. pneumoniae and recovered successfully without surgical intervention. S. pneumoniae serotype 6B can cause lung abscess.

  8. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    Energy Technology Data Exchange (ETDEWEB)

    Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: antonellonicolini@gmail.com [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)

    2015-07-15

    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  9. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    International Nuclear Information System (INIS)

    Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello

    2015-01-01

    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  10. streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

    African Journals Online (AJOL)

    DR. AMINU

    2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.

  11. Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

    Directory of Open Access Journals (Sweden)

    Dafne C. Andrade

    2018-01-01

    Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

  12. Dual infection by streptococcus and atypical mycobacteria following Ahmed glaucoma valve surgery.

    Science.gov (United States)

    Rao, Aparna; Wallang, Batriti; Padhy, Tapas Ranjan; Mittal, Ruchi; Sharma, Savitri

    2013-07-01

    To report a case of late postoperative endophthalmitis caused by Streptococcus pneumoniae and conjunctival necrosis by Streptococcus pneumoniae and Mycobacterium fortuitum following Ahmed glaucoma valve (AGV) surgery in a young patient. Case report of a 13-year-old boy with purulent exudates and extensive conjunctival necrosis two months following amniotic membrane graft and conjunctival closure (for conjunctival retraction post AGV for secondary glaucoma). The conjunctiva showed extensive necrosis causing exposure of the tube and plate associated with frank exudates in the area adjoining the plate and anterior chamber mandating explantation of the plate along with intravitreal antibiotics. The vitreous aspirate grew Streptococcus pneumoniae while Streptococcus pneumoniae with Mycobacterium fortuitum was isolated from the explanted plate. Despite adequate control of infection following surgery, the final visual outcome was poor owing to disc pallor. Conjunctival necrosis and retraction post-AGV can cause late postoperative co-infections by fulminant and slow-growing organisms. A close follow-up is therefore essential in these cases to prevent sight-threatening complications.

  13. IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

    Directory of Open Access Journals (Sweden)

    Muriel Pichavant

    2015-11-01

    Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

  14. The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment

    Science.gov (United States)

    Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

  15. Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Shepherd, Jennifer; Ibba, Michael

    2013-01-01

    Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...

  16. Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

    Science.gov (United States)

    Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

    2015-01-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  17. The novel species Streptococcus tigurinus and its association with oral infection.

    Science.gov (United States)

    Zbinden, Andrea; Bostanci, Nagihan; Belibasakis, Georgios N

    2015-01-01

    Streptococcus tigurinus is a novel species of viridans streptococci, shown to cause severe invasive infections such as infective endocarditis, spondylodiscitis and meningitis. S. tigurinus belongs to the Streptococcus mitis group and is most closely related to Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae and Streptococcus infantis. The presence of S. tigurinus in the human oral cavity has been documented, including in patients with periodontal disease. This review addresses the available scientific knowledge on S. tigurinus and its association with closely related streptococci, and discusses its putative involvement in common oral infections. While there is as yet no strong evidence on the involvement of S. tigurinus with oral infections, its presence in the oral cavity and its association with endocarditis warrants special attention for a link between oral and systemic infection.

  18. Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Raisa Bu-Coifiu Fanego

    2009-12-01

    Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

  19. Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

    DEFF Research Database (Denmark)

    Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens

    2005-01-01

    OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...

  20. Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child

    OpenAIRE

    MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E

    1993-01-01

    A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

  1. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

    2007-01-01

    textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

  2. Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

    NARCIS (Netherlands)

    Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

    Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

  3. Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

    Directory of Open Access Journals (Sweden)

    Rita Risandi

    2016-09-01

    Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

  4. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

    Directory of Open Access Journals (Sweden)

    Eduardo Walker Zettler

    2004-12-01

    Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

  5. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

    DEFF Research Database (Denmark)

    Molzen, T E; Burghout, P; Bootsma, H J

    2010-01-01

    Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

  6. MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae.

    Science.gov (United States)

    van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els

    2016-05-01

    We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Bacteremia with Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Christensen, J S; Jensen, T G; Kolmos, H J

    2012-01-01

    We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

  8. Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter)

    2010-01-01

    textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

  9. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

    NARCIS (Netherlands)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

    2014-01-01

    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

  10. Replication of type 5 adenovirus promotes middle ear infection by Streptococcus pneumoniae in the chinchilla model of otitis media

    Science.gov (United States)

    Murrah, Kyle A.; Turner, Roberta L.; Pang, Bing; Perez, Antonia C.; Reimche, Jennifer L.; King, Lauren B.; Wren, John; Gandhi, Uma; Swords, W. Edward; Ornelles, David A.

    2015-01-01

    Adenoviral infection is a major risk factor for otitis media. We hypothesized that adenovirus promotes bacterial ascension into the middle ear through the disruption of normal function in the Eustachian tubes due to inflammation-induced changes. An intranasal infection model of the chinchilla was used to test the ability of type 5 adenovirus to promote middle ear infection by Streptococcus pneumoniae. The hyperinflammatory adenovirus mutant dl327 and the nonreplicating adenovirus mutant H5wt300ΔpTP were used to test the role of inflammation and viral replication, respectively, in promotion of pneumococcal middle ear infection. Precedent infection with adenovirus resulted in a significantly greater incidence of middle ear disease by S. pneumoniae as compared to nonadenovirus infected animals. Infection with the adenovirus mutant dl327 induced a comparable degree of bacterial ascension into the middle ear as did infection with the wild-type virus. By contrast, infection with the nonreplicating adenovirus mutant H5wt300ΔpTP resulted in less extensive middle ear infection compared to the wild-type adenovirus. We conclude that viral replication is necessary for adenoviral-induced pneumococcal middle ear disease. PMID:25251686

  11. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)

    The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

  12. Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

    Directory of Open Access Journals (Sweden)

    Neda Hashemi-Sadraei

    2014-01-01

    Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

  13. Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae

    OpenAIRE

    Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman

    2013-01-01

    A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

  14. The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae

    Science.gov (United States)

    2008-03-26

    Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

  15. The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae

    Science.gov (United States)

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

  16. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    Science.gov (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  17. Seeing Streptococcus pneumoniae, a Common Killer Bacteria

    DEFF Research Database (Denmark)

    Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

    2014-01-01

    Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

  18. Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang

    2013-01-01

    DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

  19. Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Gladys Antonia Cueto Montoya

    2007-03-01

    Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

  20. Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Erdem I

    2016-09-01

    Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

  1. A Visual Review of the Human Pathogen Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David

    2017-01-01

    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

  2. Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

    Directory of Open Access Journals (Sweden)

    Peter H. Seeberger

    2017-01-01

    Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

  3. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

    2008-01-01

    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

  4. Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

    NARCIS (Netherlands)

    León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.

    2014-01-01

    Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

  5. Structure of a conjugative element in Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.

    1986-06-01

    The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

  6. [Streptococcus suis infection--clinical manifestations].

    Science.gov (United States)

    Dragojlović, Julijana; Milosević, Branko; Sasić, Neda; Pelemis, Mijomir; Sasić, Milan

    2005-01-01

    Streptococcus suis is a bacterium causing a disease in pigs and rarely in humans. This zoonosis is mostly found as a sporadic disease in individuals that were in contact with the affected or infected pigs: farmers, veterinarians and workers engaged in fresh pork processing. It is assumed that the bacterium enters the body through a cut abrasion in the skin. Initially, the condition resembles a flu, followed by signs of bacteriemia and sepsis. The most frequent clinical manifestation of Streptococcus suis infection is meningitis, leading to hearing loss in over 75% of patients, and subsequent arthritis, endophtalmitis, endocarditis and pneumonia. Toxic shock syndrome with hemorhagic manifestations rarely develops. This study included five male patients aged 22 to 63 years treated in the Intensive Care Unit of the Institute of Infectious and Tropical Diseases in Belgrade, due to Streptococcus suis infection. The aim of this study was to point to the existence of this bacteria in our environment, to describe clinical manifestations of the disease and to point out the importance of its prevention. All patients had epidemiological evidence of being in contact with pork meat. There were no data about diseased pigs. The estimated incubation period was 4 to 8 days. All patients had meningeal signs. Clinical symptoms included shivering, fever, vomiting, headache, malaise, vertigo and tinitus. Three patients presented with alerterd level of awarrness. Four patients developed very severe bilateral hearing impairment, whereas one endophtalmtis and one developed endocarditis. The cerebrospinal fluid (CSF) was opalescent in four patients, and only one patient presented with clear CSF. CSF examination showed typical changes characteristic for bacterial meningitis. Streptoccocus suis was isolated in CSF in all patients, and in one patient the bacteria was isolated in blood as well. All patients underwent treatement with II and III generation cephalosporins and one with one

  7. Clinical presentation and prognostic factors of Streptococcus pneumoniae meningitis according to the focus of infection

    Directory of Open Access Journals (Sweden)

    Samuelsson Susanne

    2005-10-01

    Full Text Available Abstract Background We conducted a nationwide study in Denmark to identify clinical features and prognostic factors in patients with Streptococcus pneumoniae according to the focus of infection. Methods Based on a nationwide registration, clinical information's was prospectively collected from all reported cases of pneumococcal meningitis during a 2-year period (1999–2000. Clinical and laboratory findings at admission, clinical course and outcome of the disease including follow-up audiological examinations were collected retrospectively. The focus of infection was determined according to the clinical diagnosis made by the physicians and after review of the medical records. Results 187 consecutive cases with S. pneumoniae meningitis were included in the study. The most common focus was ear (30%, followed by lung (18%, sinus (8%, and other (2%. In 42% of cases a primary infection focus could not be determined. On admission, fever and an altered mental status were the most frequent findings (in 93% and 94% of cases, respectively, whereas back rigidity, headache and convulsion were found in 57%, 41% and 11% of cases, respectively. 21% of patients died during hospitalisation (adults: 27% vs. children: 2%, Fisher Exact Test, P P = 0.0005. Prognostic factors associated with fatal outcome in univariate logistic regression analysis were advanced age, presence of an underlying disease, history of headache, presence of a lung focus, absence of an otogenic focus, having a CT-scan prior to lumbar puncture, convulsions, requirement of assisted ventilation, and alterations in various CSF parameters (WBC P P = 0.005. Conclusion These results emphasize the prognostic importance of an early recognition of a predisposing focus to pneumococcal meningitis.

  8. Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia.

    Science.gov (United States)

    Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A

    2014-01-01

    Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

  9. Analysis of invasive pneumonia-causing strains of Streptococcus pneumoniae: serotypes and antimicrobial susceptibility.

    Science.gov (United States)

    Yoshioka, Cristina R M; Martinez, Marina B; Brandileone, Maria C C; Ragazzi, Selma B; Guerra, Maria L L S; Santos, Silvia R; Shieh, Huei H; Gilio, Alfredo E

    2011-01-01

    To identify the most common pneumococcal serotypes in children hospitalized with invasive pneumonia, correlate isolated serotypes with those included in conjugate vaccines, and ascertain the sensitivity of the isolated pneumococcal strains to penicillin and other antibiotics. From January 2003 to October 2008, a retrospective study of hospitalized children with a diagnosis of Streptococcus pneumoniae pneumonia was conducted at the university hospital of Universidade de São Paulo. Criteria for inclusion were: age greater than 29 days and less than 15 years, radiological and clinical diagnosis of pneumonia, and isolation of Streptococcus pneumoniae in blood cultures and/or pleural effusion. The study included 107 children. The most common serotypes were 14 (36.5%), 1 (16%), 5 (14.6%), 6B (6.3%) and 3 (4.2%). The proportion of identified serotypes contained in the heptavalent, 10-valent and 13-valent conjugate vaccines was 53.1, 86.5, and 96.9%, respectively. Pneumococcal strains were sensitive to penicillin (minimum inhibitory concentration, MIC ≤ 2 µg/mL) in 100 cases (93.5%) and displayed intermediate resistance (MIC = 4 µg/mL) in 7 cases (6.5%). No strains were penicillin-resistant (MIC ≥ 8 µg/mL) according to the Clinical and Laboratory Standards Institute 2008 standards. Tested isolates were highly sensitive to vancomycin, rifampicin, ceftriaxone, clindamycin, erythromycin, and chloramphenicol. Our results confirm a significant potential impact of conjugate vaccines, mainly 10-valent and 13-valent, on invasive pneumonia. Furthermore, susceptibility testing results show that penicillin is still the treatment of choice for invasive pneumonia in our setting.

  10. EFFECT OF TOBRACEF IN CARBAPENEM RESISTANT PNEUMONIA INFECTION

    OpenAIRE

    A. Ahmad, V.K. Dwivedi * , and M. Chaudhary

    2010-01-01

    To determine ef ect of Tobracef and imipenem drug on antioxidant enzyme actvity and lipid peroxidation leveland some biochemical parametrs in carbapenem resistant pneumonia infection rat model. Total 40 rats wereselected and diveded into 4 groups of 10 rats each. Group I was control group; group II was infected via A.baumanni bacterial strain. Group III and IV were infected plus treated group with tobracef and imipenemdrugs.Our results showed that a significant (p

  11. Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

    Science.gov (United States)

    Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

    2017-08-01

    Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

  12. The Streptococcus sanguinis competence regulon is not required for infective endocarditis virulence in a rabbit model.

    Science.gov (United States)

    Callahan, Jill E; Munro, Cindy L; Kitten, Todd

    2011-01-01

    Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility in S. sanguinis. Strains deleted for the comCDE or comX master regulatory genes were created. Using a rabbit endocarditis model in conjunction with a variety of virulence assays, we determined that both mutants possessed infectivity equivalent to that of a virulent control strain, and that measures of disease were similar in rabbits infected with each strain. These results suggest that the com regulon is not required for S. sanguinis infective endocarditis virulence in this model. We propose that the different roles of the S. sanguinis, S. pneumoniae, and S. mutans com regulons in virulence can be understood in relation to the pathogenic mechanisms employed by each species.

  13. Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates.

    Science.gov (United States)

    Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto

    2015-02-01

    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

  14. Metabolic response to Klebsiella pneumoniae infection in an experimental rat model.

    Directory of Open Access Journals (Sweden)

    Fangcong Dong

    Full Text Available Bacteremia, the presence of viable bacteria in the blood stream, is often associated with several clinical conditions. Bacteremia can lead to multiple organ failure if managed incorrectly, which makes providing suitable nutritional support vital for reducing bacteremia-associated mortality. In order to provide such information, we investigated the metabolic consequences of a Klebsiella pneumoniae (K. pneumoniae infection in vivo by employing a combination of (1H nuclear magnetic resonance spectroscopy and multivariate data analysis. K. pneumoniae was intravenously infused in rats; urine and plasma samples were collected at different time intervals. We found that K. pneumoniae-induced bacteremia stimulated glycolysis and the tricarboxylic acid cycle and also promoted oxidation of fatty acids and creatine phosphate to facilitate the energy-demanding host response. In addition, K. pneumoniae bacteremia also induced anti-endotoxin, anti-inflammatory and anti-oxidization responses in the host. Furthermore, bacteremia could cause a disturbance in the gut microbiotal functions as suggested by alterations in a range of amines and bacteria-host co-metabolites. Our results suggest that supplementation with glucose and a high-fat and choline-rich diet could ameliorate the burdens associated with bacteremia. Our research provides underlying pathological processes of bacteremia and a better understanding of the clinical and biochemical manifestations of bacteremia.

  15. Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.

    2010-01-01

    Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

  16. S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells.

    Science.gov (United States)

    Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

    2012-01-01

    Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

  17. The influence of Streptococcus pneumoniae nasopharyngeal colonization on the clinical outcome of the respiratory tract infections in preschool children.

    Science.gov (United States)

    Petraitiene, Sigita; Alasevicius, Tomas; Staceviciene, Indre; Vaiciuniene, Daiva; Kacergius, Tomas; Usonis, Vytautas

    2015-09-30

    Streptococcus pneumoniae (SPn) is an important pathogen causing a variety of clinical manifestations. The effects of SPn nasopharyngeal colonization on respiratory tract infections are poorly studied. We evaluated the association of SPn colonization with features of respiratory tract infections. Children under the age of 6 years who visited a primary care physician because of respiratory tract infections were enrolled in the study. History was taken, children were clinically assessed by the physician, and nasopharyngeal swabs were obtained and cultured for SPn. Positive samples were serotyped. Associations of SPn colonization with clinical signs and symptoms, recovery duration, absence from day care centre, frequencies of specific diagnoses, and treatment with antimicrobials were evaluated. In total 900 children were enrolled. The prevalence of SPn colonization was 40.8 % (n = 367). There were minor differences between male and female subjects (199 of 492, 40.4 % vs 168 of 408, 41.2 %, p = 0.825). Children with and without siblings had similar colonization rates (145 of 334, 43.4 % vs 219 of 562, 39.0 %, p = 0.187). Clinical signs and symptoms were not associated with SPn colonization. Children colonized with SPn had longer recovery duration compared to non-colonized children (114 of 367, 31.1 % vs 98 of 533, 18.4 %, p vs 94 of 284, 33.1 %, p = 0.001). Pneumonia, sinusitis, and acute otitis media were more frequently diagnosed in children colonized with SPn. Children attending day care centres had significantly higher prevalence of SPn colonization (270 of 367, 44.4 % vs 338 of 533, 33.1 %, p = 0.001). Children with pneumonia, sinusitis and acute otitis media were more frequently treated with antimicrobials than children with other diagnoses. SPn nasopharyngeal colonization has a negative impact on the course of respiratory tract infection, likely because of SPn being the cause of the disease or a complicating factor. It is also associated

  18. The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

    Science.gov (United States)

    2006-07-06

    P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

  19. Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

    Directory of Open Access Journals (Sweden)

    Amauri Noda Albelo

    2011-09-01

    Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

  20. Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-10-01

    Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia

  1. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-04-01

    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11

  2. The post-vaccine microevolution of invasive Streptococcus pneumoniae

    NARCIS (Netherlands)

    Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L

    2015-01-01

    The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

  3. Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

    International Nuclear Information System (INIS)

    Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo

    2011-01-01

    The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

  4. The Streptococcus sanguinis Competence Regulon Is Not Required for Infective Endocarditis Virulence in a Rabbit Model

    OpenAIRE

    Callahan, Jill E.; Munro, Cindy L.; Kitten, Todd

    2011-01-01

    Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility i...

  5. Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

    Directory of Open Access Journals (Sweden)

    Dharm Raj Bhatta

    2014-02-01

    Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

  6. The Streptococcus sanguinis competence regulon is not required for infective endocarditis virulence in a rabbit model.

    Directory of Open Access Journals (Sweden)

    Jill E Callahan

    Full Text Available Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility in S. sanguinis. Strains deleted for the comCDE or comX master regulatory genes were created. Using a rabbit endocarditis model in conjunction with a variety of virulence assays, we determined that both mutants possessed infectivity equivalent to that of a virulent control strain, and that measures of disease were similar in rabbits infected with each strain. These results suggest that the com regulon is not required for S. sanguinis infective endocarditis virulence in this model. We propose that the different roles of the S. sanguinis, S. pneumoniae, and S. mutans com regulons in virulence can be understood in relation to the pathogenic mechanisms employed by each species.

  7. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

    2008-01-01

    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

  8. Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

    DEFF Research Database (Denmark)

    Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie

    2008-01-01

    A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....

  9. Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children.

    Science.gov (United States)

    Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh

    2011-01-01

    The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

  10. Effect of experimental influenza A virus infection on isolation of Streptococcus pneumoniae and other aerobic bacteria from the oropharynges of allergic and nonallergic adult subjects.

    Science.gov (United States)

    Wadowsky, R M; Mietzner, S M; Skoner, D P; Doyle, W J; Fireman, P

    1995-04-01

    Intranasal challenge with both influenza A virus and Streptococcus pneumoniae promotes otitis media with S. pneumoniae in chinchillas. We investigated whether influenza A virus infection promotes oropharyngeal colonization with S. pneumoniae and other middle ear pathogens by selectively inhibiting commensal bacteria. On study day 0, 12 allergic and 15 nonallergic adult subjects were intranasally inoculated with influenza A/Kawasaki (H1N1) virus. Every subject was infected with the virus as demonstrated by nasal shedding or seroconversion. Average upper respiratory symptom scores and nasal secretion weights from the entire subject group were elevated between days 2 and 6 (acute phase) and were not significantly different between allergic and nonallergic subjects. S. pneumoniae was not isolated from any subject prior to the virus challenge but was isolated in heavy density from 4 (15%) subjects on day 6 (P = 0.055). Staphylococcus aureus was isolated more frequently from the nonallergic subjects than from the allergic subjects on days 2 (80 versus 25%, respectively) 4, (67 versus 17%, respectively), and 6 (73 versus 25%, respectively) (P < 0.05). The isolation rates of other middle ear pathogens were not significantly different before virus challenge and during the acute and resolution phases (days 27 to 30) of the experimental infection for the entire subject group or either the allergic or nonallergic subgroup. Densities and isolation rates of commensal bacteria from the entire subject group were similar throughout the observational period. These results suggest that the virus infection promoted S. pneumoniae colonization of the oropharynx and that nonallergic persons may be more vulnerable to colonization with S. aureus than allergic persons. The altered colonization rates were not attributed to inhibition of commensal bacteria.

  11. ROLE OF STREPTOCOCCUS PNEUMONIAE IN THE STRUCTURE OF BACTERIAL INFECTIONS IN THE CHILDREN HOSPITALIZED TO INPATIENT HOSPITALS IN MOSCOW IN 2011–2012

    Directory of Open Access Journals (Sweden)

    A. A. Baranov

    2013-01-01

    Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

  12. JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

    Lifescience Database Archive (English)

    Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

  13. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    OpenAIRE

    Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.

    2010-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

  14. Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

    Directory of Open Access Journals (Sweden)

    Alessandro Perazzo

    2014-03-01

    Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

  15. Pneumococcal pneumonia: clinical features, diagnosis and management in HIV-infected and HIV noninfected patients.

    Science.gov (United States)

    Madeddu, Giordano; Fois, Alessandro Giuseppe; Pirina, Pietro; Mura, Maria Stella

    2009-05-01

    In this review, we focus on the clinical features, diagnosis and management of pneumococcal pneumonia in HIV-infected and noninfected patients, with particular attention to the most recent advances in this area. Classical clinical features are found in young adults, whereas atypical forms occur in immunocompromised patients including HIV-infected individuals. Bacteremic pneumococcal pneumonia is more frequently observed in HIV-infected and also in low-risk patients, according to the Pneumonia Severity Index (PSI). Pneumococcal pneumonia diagnostic process includes physical examination, radiologic findings and microbiologic diagnosis. However, etiologic diagnosis using traditional culture methods is difficult to obtain. In this setting, urinary antigen test, which recognizes Streptococcus pneumoniae cell wall C-polysaccharide, increases the probability of etiologic diagnosis. A correct management approach is crucial in reducing pneumococcal pneumonia mortality. The use of the PSI helps clinicians in deciding between inpatient and outpatient management in immunocompetent individuals, according to Infectious Diseases Society of America (IDSA)-American Thoracic Society (ATS) guidelines. Recent findings support PSI utility also in HIV-infected patients. Recently, efficacy of pneumococcal vaccine in reducing pneumococcal disease incidence has been evidenced in both HIV-infected and noninfected individuals. Rapid diagnosis and correct management together with implementation of preventive measures are crucial in order to reduce pneumococcal pneumonia related incidence and mortality in HIV-infected and noninfected patients.

  16. Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

    Centers for Disease Control (CDC) Podcasts

    2012-11-02

    Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

  17. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    NARCIS (Netherlands)

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

    2015-01-01

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  18. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    NARCIS (Netherlands)

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  19. Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

    Directory of Open Access Journals (Sweden)

    María Hortal

    2000-09-01

    xico (47,0% y los menores a Colombia (12,1%. La resistencia a la penicilina se asoció con un reducido número de serotipos capsulares, fundamentalmente el 14 y el 23F, el primero resistente a la penicilina y a la trimetoprima-sulfametoxazol, y el segundo multirresistente. La frecuencia de la resistencia a la trimetoprima-sulfametoxazol fue elevada en todos los países y el valor máximo correspondió a Argentina (58,0%. La disminución de la susceptibilidad al cloranfenicol tuvo baja frecuencia, salvo en Colombia (23,4%. La resistencia a la eritromicina fue baja en todos los países y todos los aislados fueron sensibles a la vancomicina.Community-acquired pneumonia is one of the leading causes of infant morbidity and mortality. Studies conducted in developing countries indicate that the most serious symptoms of pneumonia are associated with bacterial causes, mainly Streptococcus pneumoniae, followed by Haemophilus influenzae type b. Managing those infections in children under two years of age is hindered by the lack of appropriate vaccines and by the decreased susceptibility of S. pneumoniae to penicillin and other antibiotics. In 1993, at the initiative of the Regional System for Vaccines of the Pan American Health Organization, and with funding from the Canadian International Development Agency, a study was designed to identify the S. pneumoniae capsular types that cause invasive disease in Latin American children under 5 years of age. The objective of the study was to determine the ideal composition of a conjugate vaccine that could be used in Latin America, and the penicillin susceptibility of the S. pneumoniae isolates. The initiative was undertaken in Argentina, Brazil, Chile, Colombia, Mexico, and Uruguay. This report analyzes the information that the participating countries generated on pneumococcal pneumonia. A total of 3 393 children were found with systemic S. pneumoniae infections, of which 1 578 corresponded to pneumonias. The analysis focused on 1 409 cases

  20. Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M

    2010-01-01

    Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

  1. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    OpenAIRE

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

  2. Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus.

    Science.gov (United States)

    Lewis, Megan L; Surewaard, Bas G J

    2018-03-01

    Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

  3. Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2008-09-01

    Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

  4. Streptococcus pneumoniae from Palestinian nasopharyngeal carriers: serotype distribution and antimicrobial resistance.

    Directory of Open Access Journals (Sweden)

    Abedelmajeed Nasereddin

    Full Text Available Infections of Streptococcus pneumoniae in children can be prevented by vaccination; left untreated, they cause high morbidity and fatalities. This study aimed at determining the nasopharyngeal carrier rates, serotype distribution and antimicrobial resistance patterns of S. pneumoniae in healthy Palestinian children under age two prior to the full introduction of the pneumococcal 7-valent conjugate vaccine (PCV7, which was originally introduced into Palestine in a pilot trial in September, 2010. In a cross sectional study, nasopharyngeal specimens were collected from 397 healthy children from different Palestinian districts between the beginning of November 2012 to the end of January 2013. Samples were inoculated into blood agar and suspected colonies were examined by amplifying the pneumococcal-specific autolysin gene using a real-time PCR. Serotypes were identified by a PCR that incorporated different sets of specific primers. Antimicrobial susceptibility was measured by disk diffusion and MIC methods. The resulting carrier rate of Streptococcus pneumoniae was 55.7% (221/397. The main serotypes were PCV7 serotypes 19F (12.2%, 23F (9.0%, 6B (8.6% and 14 (4% and PCV13 serotypes 6A (13.6% and 19A (4.1%. Notably, serotype 6A, not included in the pilot trial (PCV7 vaccine, was the most prevalent. Resistance to more than two drugs was observed for bacteria from 34.1% of the children (72/211 while 22.3% (47/211 carried bacteria were susceptible to all tested antibiotics. All the isolates were sensitive to cefotaxime and vancomycin. Any or all of these might impinge on the type and efficacy of the pneumococcal conjugate vaccines and antibiotics to be used for prevention and treatment of pneumococcal disease in the country.

  5. [Orbital cellulitis complicated by subperiosteal abscess due to Streptococcus pyogenes infection].

    Science.gov (United States)

    Ruíz Carrillo, José Daniel; Vázquez Guerrero, Edwin; Mercado Uribe, Mónica Cecilia

    Orbital cellulitis is an infectious disease that is very common in pediatric patients, in which severe complications may develop. Etiological agents related to this disease are Haemophilus influenzae B, Staphylococcus aureus, Streptococcus pneumoniae and Moraxella catarrhalis, which correspond to 95% of cases. Moreover, Streptococcus beta hemolytic and anaerobic microorganisms may also be present corresponding to < 5% of the cases. We present an uncommon case of cellulitis complicated by sub-periosteal abscess caused by Streptococcus pyogenes (Group A beta hemolytic streptococcus). A 9-year-old male patient with a history of deficit disorder and hyperactivity since 5 years of age. His current condition started with erythema in the external edge of the right eye, increase in peri-orbicular volume with limitation of eyelid opening, progression to proptosis, pain with eye movements and conjunctival purulent discharge. Image studies reported subperiosteal abscess and preseptal right with extraocular cellulitis. The patient started with empirical antibiotic treatment, surgical drainage and culture of purulent material from which Streptococcus pyogenes was isolated. Due to the implementation of vaccination schemes against H. influenza and S. pneumoniae since the 90s, the cases by these pathogens have decreased, causing new bacteria to take place as the cause of the infection. The importance of considering S. pyogenes as an etiology of orbital cellulitis is the rapid progression to abscess formation, and the few cases described in the literature. Copyright © 2017 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  6. Controlled Human Infection for Vaccination Against Streptococcus Pyogenes

    Science.gov (United States)

    2018-04-26

    Streptococcus Pyogenes Pharyngitis; Streptococcus Pharyngitis; Strep Throat; Streptococcus Pyogenes Infection; Group A Streptococcus: B Hemolytic Pharyngitis; Group A Streptococcal Infection; Gram-Positive Bacterial Infections; Bacterial Infections

  7. Antibiotic resistance of Streptococcus pneumoniae in children with acute otitis media treatment failure.

    Science.gov (United States)

    Zielnik-Jurkiewicz, Beata; Bielicka, Anna

    2015-12-01

    The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Epidemiology of culture-confirmed infections of Streptococcus pneumoniae (2012-2015) and nasopharyngeal carriage in children and households in Taiwan (2014-2015).

    Science.gov (United States)

    Janapatla, Rajendra Prasad; Su, Lin-Hui; Chen, Hsin-Hang; Chang, Hsin-Ju; Tsai, Tian-Chi; Chen, Po-Yen; Chen, Chyi-Liang; Chiu, Cheng-Hsun

    2017-06-01

    An observational study was performed to investigate the carriage rate and serotypes of Streptococcus pneumoniae in the 13-valent pneumococcal conjugate vaccine (PCV13) era in Taiwan. From March 2014 to March 2015 a total of 500 healthy children and their households (631 adults) were enrolled from two large medical centres for nasopharyngeal carriage survey. Clinical isolates were prospectively collected from June 2012 to May 2015 at Chang Gung Memorial Hospital. We applied a multiplex polymerase chain reaction in addition to culture to detect S. pneumoniae. S. pneumoniae was isolated from 12.0 % of the children and 3.6 % of the households. In the children's cohort only 23.3 % of the isolates could be assigned to PCV13 serotypes; non-vaccine serotypes were predominant (76.6 %) and the most frequently detected non-vaccine serotypes were 15A/F and 15B/C (both 13.3 %), followed by 23A (6.7 %). In the household cohort, 21.7 % belonged to PCV13 serotypes, and 78.3 % to non-vaccine serotypes. Clinical analysis of culture-confirmed pneumococcal infection showed that infection caused by PCV13 serotypes decreased by 47 % from 83 % in 2012-2013 to 44 % in 2014-2015, while infection caused by non-PCV13 serotypes increased from 17 to 56 %. Among the carriage isolates a significantly higher percentage belonged to serogroup 15 compared to serogroup 19 (26.6 vs 6.66 %, 2014-2015; P=0.003). Therefore, clinical isolates belonging to serogroup 15 were more prevalent than those belonging to serogroup 19 (44.1 vs 32.3 %, 2014-2015; P=0.318). The isolation of non-vaccine serotypes and unknown serotypes after the introduction of PCV13 in children highlights the importance of continued surveillance for emerging serotypes.

  9. Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

    NARCIS (Netherlands)

    D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)

    2000-01-01

    textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

  10. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

    Science.gov (United States)

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

    2010-12-03

    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

  11. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    Directory of Open Access Journals (Sweden)

    Welinder-Olsson Christina

    2010-12-01

    Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

  12. Streptococcus pneumoniae serotype-2 childhood meningitis in Bangladesh: a newly recognized pneumococcal infection threat.

    Directory of Open Access Journals (Sweden)

    Samir K Saha

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of meningitis in countries where pneumococcal conjugate vaccines (PCV targeting commonly occurring serotypes are not routinely used. However, effectiveness of PCV would be jeopardized by emergence of invasive pneumococcal diseases (IPD caused by serotypes which are not included in PCV. Systematic hospital based surveillance in Bangladesh was established and progressively improved to determine the pathogens causing childhood sepsis and meningitis. This also provided the foundation for determining the spectrum of serotypes causing IPD. This article reports an unprecedented upsurge of serotype 2, an uncommon pneumococcal serotype, without any known intervention. METHODS AND FINDINGS: Cases with suspected IPD had blood or cerebrospinal fluid (CSF collected from the beginning of 2001 till 2009. Pneumococcal serotypes were determined by capsular swelling of isolates or PCR of culture-negative CSF specimens. Multicenter national surveillance, expanded from 2004, identified 45,437 patients with suspected bacteremia who were blood cultured and 10,618 suspected meningitis cases who had a lumber puncture. Pneumococcus accounted for 230 culture positive cases of meningitis in children <5 years. Serotype-2 was the leading cause of pneumococcal meningitis, accounting for 20.4% (45/221; 95% CI 15%-26% of cases. Ninety eight percent (45/46 of these serotype-2 strains were isolated from meningitis cases, yielding the highest serotype-specific odds ratio for meningitis (29.6; 95% CI 3.4-256.3. The serotype-2 strains had three closely related pulsed field gel electrophoresis types. CONCLUSIONS: S. pneumoniae serotype-2 was found to possess an unusually high potential for causing meningitis and was the leading serotype-specific cause of childhood meningitis in Bangladesh over the past decade. Persisting disease occurrence or progressive spread would represent a major potential infection threat since serotype-2

  13. The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿

    OpenAIRE

    Kowalko, J. E.; Sebert, M. E.

    2008-01-01

    The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

  14. Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans

    Science.gov (United States)

    Shanker, Erin; Federle, Michael J.

    2017-01-01

    The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

  15. N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2016-01-01

    In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

  16. Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

    Directory of Open Access Journals (Sweden)

    Flores Nava Gerardo

    2014-07-01

    Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

  17. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children.

    Science.gov (United States)

    Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M

    2011-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

  18. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction

    OpenAIRE

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.

    2015-01-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

  19. Validation of an immunodiagnostic assay for detection of 13 Streptococcus pneumoniae serotype-specific polysaccharides in human urine.

    Science.gov (United States)

    Pride, Michael W; Huijts, Susanne M; Wu, Kangjian; Souza, Victor; Passador, Sherry; Tinder, Chunyan; Song, Esther; Elfassy, Arik; McNeil, Lisa; Menton, Ronald; French, Roger; Callahan, Janice; Webber, Chris; Gruber, William C; Bonten, Marc J M; Jansen, Kathrin U

    2012-08-01

    To improve the clinical diagnosis of pneumococcal infection in bacteremic and nonbacteremic community-acquired pneumonia (CAP), a Luminex technology-based multiplex urinary antigen detection (UAD) diagnostic assay was developed and validated. The UAD assay can simultaneously detect 13 different serotypes of Streptococcus pneumoniae by capturing serotype-specific S. pneumoniae polysaccharides (PnPSs) secreted in human urine. Assay specificity is achieved by capturing the polysaccharides with serotype-specific monoclonal antibodies (MAbs) on spectrally unique microspheres. Positivity for each serotype was based on positivity cutoff values calculated from a standard curve run on each assay plate together with positive- and negative-control urine samples. The assay is highly specific, since significant signals are detected only when each PnPS was paired with its homologous MAb-coated microspheres. Validation experiments demonstrated excellent accuracy and precision. The UAD assay and corresponding positivity cutoff values were clinically validated by assessing 776 urine specimens obtained from patients with X-ray-confirmed CAP. The UAD assay demonstrated 97% sensitivity and 100% specificity using samples obtained from patients with bacteremic, blood culture-positive CAP. Importantly, the UAD assay identified Streptococcus pneumoniae (13 serotypes) in a proportion of individuals with nonbacteremic CAP, a patient population for which the pneumococcal etiology of CAP was previously difficult to assess. Therefore, the UAD assay provides a specific, noninvasive, sensitive, and reproducible tool to support vaccine efficacy as well as epidemiological evaluation of pneumococcal disease, including CAP, in adults.

  20. Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

    Science.gov (United States)

    Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

    2014-08-01

    Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

  1. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    OpenAIRE

    Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez

    2011-01-01

    La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

  2. The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

    NARCIS (Netherlands)

    Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.

    2014-01-01

    Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

  3. The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yayan J

    2014-10-01

    Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

  4. Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Edwin J. Asturias

    2003-12-01

    Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

  5. Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

    Directory of Open Access Journals (Sweden)

    C. Mayoral

    2008-03-01

    Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

  6. Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

    Directory of Open Access Journals (Sweden)

    Jung-Pin Chen

    2007-01-01

    Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

  7. Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

    Directory of Open Access Journals (Sweden)

    José María Guevara-Duncan

    2008-03-01

    Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

  8. Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

    Directory of Open Access Journals (Sweden)

    Mirian Domenech

    2017-07-01

    Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

  9. Capsular Polysaccharide Expression in Commensal Streptococcus Species

    DEFF Research Database (Denmark)

    Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong

    2016-01-01

    Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...

  10. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

    2016-01-01

    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  11. SUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIS.

    Science.gov (United States)

    Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena

    2016-01-01

    Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

  12. Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression.

    Science.gov (United States)

    Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa

    2015-02-02

    There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

  13. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  14. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    NARCIS (Netherlands)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

    2015-01-01

    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

  15. Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures.

    Science.gov (United States)

    Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal

    2017-07-01

    Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  16. 99mTcN-gatifloxacin dithiocarbamate complex. A novel multi-drug-resistance Streptococcus pneumoniae (MRSP) infaction radiotracer

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Mohammad Rafiullah Khan

    2011-01-01

    Gatifloxacin (GTN) was derivatized to its dithiocarbamate derivative and its radiolabeling with technetium-99m ( 99m Tc) using the [ 99m Tc≡N] 2+ core was investigated. The appropriateness of the 99m TcN - gatifloxacin dithiocarbamate ( 99m TcN - GTND) complex as a potential multi-drug-resistance Streptococcus pneumoniae (MRSP) infection radiotracer was evaluated in terms of stability in saline, serum, in vitro binding with MRSP and biodistribution in artificially MRSP infected Male Wistar Rats (MWR). In saline the 99m TcN - GTND complex showed more than 90% labeling yield up to 4 h with a maximum yield of 98.25 ± 0.20%, after reconstitution. In serum the 99m TcN - GTND complex showed stability up to 16 h of incubation with the appearance of insignificant 15.95% undesirable side products. The 99m TcN - GTND complex demonstrated saturated in vitro binding with MRSP with a maximum value of 75.50 ± 1.00% (at 90 min). In MWR model of group A, almost six times higher uptake of the labeled GTND was monitored in the muscle of MWR infected with live MRSP as compared to the inflamed and normal muscles. Based on the higher labeling yield in saline, in vitro stability in serum, saturated in vitro binding with live MRSP and promising biodistribution in MWR model we recommend 99m TcN - gatifloxacin dithiocarbamate complex as a potential MRSP infection radiotracer. (author)

  17. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    OpenAIRE

    Aura Lucía Leal; Castañeda Elizabeth

    1999-01-01

    Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

  18. The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans.

    Science.gov (United States)

    Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian

    2018-03-01

    Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

  19. The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Dong Wook Kim

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

  20. Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2008-10-01

    Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

  1. TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins.

    Science.gov (United States)

    Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy

    2014-10-01

    Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

  2. The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar Yadav

    Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

  3. Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza

    Science.gov (United States)

    Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian

    2009-01-01

    Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

  4. The clinical features of respiratory infections caused by the Streptococcus anginosus group.

    Science.gov (United States)

    Noguchi, Shingo; Yatera, Kazuhiro; Kawanami, Toshinori; Yamasaki, Kei; Naito, Keisuke; Akata, Kentaro; Shimabukuro, Ikuko; Ishimoto, Hiroshi; Yoshii, Chiharu; Mukae, Hiroshi

    2015-10-26

    The Streptococcus anginosus group (SAG) play important roles in respiratory infections. It is ordinarily difficult to distinguish them from contaminations as the causative pathogens of respiratory infections because they are often cultured in respiratory specimens. Therefore, it is important to understand the clinical characteristics and laboratory findings of respiratory infections caused by the SAG members. The aim of this study is to clarify the role of the SAG bacteria in respiratory infections. A total of 30 patients who were diagnosed with respiratory infections which were caused by the SAG bacteria between January 2005 and February 2015 were retrospectively evaluated. Respiratory infections caused by the SAG were mostly seen in male patients with comorbid diseases and were typically complicated with pleural effusion. Pleural effusion was observed in 22 (73.3%) patients. Empyema was observed in half of the 22 patients with pleural effusion. S. intermedius, S. constellatus and S. anginosus were detected in 16 (53.3 %), 11 (36.7 %) and 3 (10.0 %) patients, respectively. Six patients had mixed-infections. The duration from the onset of symptoms to the hospital visit was significantly longer in "lung abscess" patients than in "pneumonia" patients among the 24 patients with single infections, but not among the six patients with mixed-infection. The peripheral white blood cell counts of the "pneumonia" patients were higher than those of the "lung abscess" patients and S. intermedius was identified significantly more frequently in patients with pulmonary and pleural infections (pneumonia and lung abscess) than in patients with bacterial pleurisy only. In addition, the patients in whom S. intermedius was cultured were significantly older than those in whom S. constellatus was cultured. Respiratory infections caused by the SAG bacteria tended to be observed more frequently in male patients with comorbid diseases and to more frequently involve purulent formation. In

  5. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    NARCIS (Netherlands)

    Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.

    2011-01-01

    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

  6. Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

    Directory of Open Access Journals (Sweden)

    Gonzalo Angulo

    2016-11-01

    Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

  7. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo

    2011-12-01

    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

  8. Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Feroze Ahmed Ganaie

    2015-01-01

    Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

  9. Molecular epidemiology of C. pneumoniae infections

    Directory of Open Access Journals (Sweden)

    Alisa Shurdhi

    2010-06-01

    Full Text Available Introduction. Chlamydophila pneumoniae (C. pneumoniae is one of the most common respiratory pathogen, with an incidence of infection varying from 6% to 20%. The present study aimed to assess the incidence of C. pneumoniae infections in patients with acute respiratory diseases using a RealTime PCR (RT-PCR method. Methods. In the period January 2007-December 2008 279 biological samples coming from patients (190 males and 89 females with acute respiratory infections was collected and tested. Samples have been extracted using NucliSens easyMag Biomerieu according to manufacturer’s instructions and amplified by LightCycler Real-Time PCR Roche for the detection of C. pneumoniae DNA. Results. Data analysis revealed a higher prevalence of C. pneumoniae infections in male patients (7.9% than in females (5.6%. In addition, it is interesting to note that the incidence of C. pneumoniae infection was higher 28.6% in the period February - April. Conclusions. The results obtained in this study confirm the utility of molecular techniques in laboratory diagnosis and epidemiological investigations of respiratory infection caused by C. pneumoniae. RT-PCR have proved to be a rapid and a reliable technique to monitor and treat opportunely C. pneumoniae infections to avoid short and medium/long term complications.

  10. Brain-derived neurotrophic factor reduces inflammation and hippocampal apoptosis in experimental Streptococcus pneumoniae meningitis.

    Science.gov (United States)

    Xu, Danfeng; Lian, Di; Wu, Jing; Liu, Ying; Zhu, Mingjie; Sun, Jiaming; He, Dake; Li, Ling

    2017-08-04

    Streptococcus pneumoniae meningitis is a serious inflammatory disease of the central nervous system (CNS) and is associated with high morbidity and mortality rates. The inflammatory processes initiated by recognition of bacterial components contribute to apoptosis in the hippocampal dentate gyrus. Brain-derived neurotrophic factor (BDNF) has long been recommended for the treatment of CNS diseases due to its powerful neuro-survival properties, as well as its recently reported anti-inflammatory and anti-apoptotic effects in vitro and in vivo. In this study, we investigated the effects of BDNF-related signaling on the inflammatory response and hippocampal apoptosis in experimental models of pneumococcal meningitis. Pretreatment with exogenous BDNF or the tropomyosin-receptor kinase B (TrkB) inhibitor k252a was performed to assess the activation or inhibition of the BDNF/TrkB-signaling axis prior to intracisternal infection with live S. pneumoniae. At 24 h post-infection, rats were assessed for clinical severity and sacrificed to harvest the brains. Paraffin-embedded brain sections underwent hematoxylin and eosin staining to evaluate pathological severity, and cytokine and chemokine levels in the hippocampus and cortex were evaluated by enzyme-linked immunosorbent assay. Additionally, apoptotic neurons were detected in the hippocampal dentate gyrus by terminal deoxynucleotidyl transferase dUTP-nick-end labeling, key molecules associated with the related signaling pathway were analyzed by real-time polymerase chain reaction and western blot, and the DNA-binding activity of nuclear factor kappa B (NF-κB) was measured by electrophoretic mobility shift assay. Rats administered BDNF exhibited reduced clinical impairment, pathological severity, and hippocampal apoptosis. Furthermore, BDNF pretreatment suppressed the expression of inflammatory factors, including tumor necrosis factor α, interleukin (IL)-1β, and IL-6, and increased the expression of the anti

  11. Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

    Science.gov (United States)

    Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

    2009-09-18

    The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

  12. Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

    NARCIS (Netherlands)

    Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.

    2011-01-01

    To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

  13. Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Nazir A. Brohi

    2016-12-01

    Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

  14. Epidemiological studies of potent environment pathogen streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Brohi, N.A.; Tunio, S.A.

    2016-01-01

    A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

  15. AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

    Directory of Open Access Journals (Sweden)

    Lindsey R Brown

    Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

  16. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Haley R Pipkins

    Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

  17. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease

    Science.gov (United States)

    Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.

    2015-01-01

    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  18. Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae.

    Science.gov (United States)

    Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

    2014-02-07

    Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

  19. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

    Science.gov (United States)

    Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M

    2016-01-01

    The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  20. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

    Directory of Open Access Journals (Sweden)

    Catrin E Moore

    Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

  1. Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.

    2013-01-01

    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

  2. Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

    NARCIS (Netherlands)

    van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.

    1997-01-01

    In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

  3. Isolation of Streptococcus tigurinus - a novel member of Streptococcus mitis group from a case of periodontitis.

    Science.gov (United States)

    Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S

    2014-08-01

    Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  4. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae.

    Science.gov (United States)

    Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne

    2016-01-26

    Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

  5. Generation of genic diversity among Streptococcus pneumoniae strains via horizontal gene transfer during a chronic polyclonal pediatric infection.

    Directory of Open Access Journals (Sweden)

    N Luisa Hiller

    2010-09-01

    Full Text Available Although there is tremendous interest in understanding the evolutionary roles of horizontal gene transfer (HGT processes that occur during chronic polyclonal infections, to date there have been few studies that directly address this topic. We have characterized multiple HGT events that most likely occurred during polyclonal infection among nasopharyngeal strains of Streptococcus pneumoniae recovered from a child suffering from chronic upper respiratory and middle-ear infections. Whole genome sequencing and comparative genomics were performed on six isolates collected during symptomatic episodes over a period of seven months. From these comparisons we determined that five of the isolates were genetically highly similar and likely represented a dominant lineage. We analyzed all genic and allelic differences among all six isolates and found that all differences tended to occur within contiguous genomic blocks, suggestive of strain evolution by homologous recombination. From these analyses we identified three strains (two of which were recovered on two different occasions that appear to have been derived sequentially, one from the next, each by multiple recombination events. We also identified a fourth strain that contains many of the genomic segments that differentiate the three highly related strains from one another, and have hypothesized that this fourth strain may have served as a donor multiple times in the evolution of the dominant strain line. The variations among the parent, daughter, and grand-daughter recombinant strains collectively cover greater than seven percent of the genome and are grouped into 23 chromosomal clusters. While capturing in vivo HGT, these data support the distributed genome hypothesis and suggest that a single competence event in pneumococci can result in the replacement of DNA at multiple non-adjacent loci.

  6. Inter-observer variation in the interpretation of chest radiographs for pneumonia in community-acquired lower respiratory tract infections

    Energy Technology Data Exchange (ETDEWEB)

    Hopstaken, R.M. E-mail: rogier.hopstaken@hag.unimaas.nl; Witbraad, T.; Engelshoven, J.M.A. van; Dinant, G.J

    2004-08-01

    AIM: To assess inter-observer variation in the interpretation of chest radiographs of individuals with pneumonia versus those without pneumonia. MATERIALS AND METHODS: Chest radiographs of out-patients with a lower respiratory tract infection (LRTI) were assessed for the presence of infiltrates by radiologists from three local hospitals and were reassessed by one university hospital radiologist. Various measures of inter-observer agreement were calculated. RESULTS: The observed proportional agreement was 218 in 243 patients (89.7%). Kappa was 0.53 (moderate agreement) with a 95% confidence interval of 0.37 to 0.69. The observed positive agreement (59%) was much lower than for negative agreement (94%). Kappa was considerably lower, if chronic obstructive pulmonary disease was present ({kappa}=0.20) or Streptococcus pneumoniae ({kappa}=-0.29) was the infective agent. CONCLUSION: The overall inter-observer agreement adjusted for chance was moderate. Inter-observer agreement in cases with pneumonia was much worse than the agreement in negative (i.e. non-pneumonia) cases. A general practitioner's selection of patients with a higher chance of having pneumonia for chest radiography would thus not improve the observer agreement.

  7. Inter-observer variation in the interpretation of chest radiographs for pneumonia in community-acquired lower respiratory tract infections

    International Nuclear Information System (INIS)

    Hopstaken, R.M.; Witbraad, T.; Engelshoven, J.M.A. van; Dinant, G.J.

    2004-01-01

    AIM: To assess inter-observer variation in the interpretation of chest radiographs of individuals with pneumonia versus those without pneumonia. MATERIALS AND METHODS: Chest radiographs of out-patients with a lower respiratory tract infection (LRTI) were assessed for the presence of infiltrates by radiologists from three local hospitals and were reassessed by one university hospital radiologist. Various measures of inter-observer agreement were calculated. RESULTS: The observed proportional agreement was 218 in 243 patients (89.7%). Kappa was 0.53 (moderate agreement) with a 95% confidence interval of 0.37 to 0.69. The observed positive agreement (59%) was much lower than for negative agreement (94%). Kappa was considerably lower, if chronic obstructive pulmonary disease was present (κ=0.20) or Streptococcus pneumoniae (κ=-0.29) was the infective agent. CONCLUSION: The overall inter-observer agreement adjusted for chance was moderate. Inter-observer agreement in cases with pneumonia was much worse than the agreement in negative (i.e. non-pneumonia) cases. A general practitioner's selection of patients with a higher chance of having pneumonia for chest radiography would thus not improve the observer agreement

  8. Port d’Entrée for Respiratory Infections – Does the Influenza A Virus Pave the Way for Bacteria?

    Directory of Open Access Journals (Sweden)

    Nikolai Siemens

    2017-12-01

    Full Text Available Bacterial and viral co-infections of the respiratory tract are life-threatening and present a global burden to the global community. Staphylococcus aureus, Streptococcus pneumoniae, and Streptococcus pyogenes are frequent colonizers of the upper respiratory tract. Imbalances through acquisition of seasonal viruses, e.g., Influenza A virus, can lead to bacterial dissemination to the lower respiratory tract, which in turn can result in severe pneumonia. In this review, we summarize the current knowledge about bacterial and viral co-infections of the respiratory tract and focus on potential experimental models suitable for mimicking this disease. Transmission of IAV and pneumonia is mainly modeled by mouse infection. Few studies utilizing ferrets, rats, guinea pigs, rabbits, and non-human primates are also available. The knowledge gained from these studies led to important discoveries and advances in understanding these infectious diseases. Nevertheless, mouse and other infection models have limitations, especially in translation of the discoveries to humans. Here, we suggest the use of human engineered lung tissue, human ex vivo lung tissue, and porcine models to study respiratory co-infections, which might contribute to a greater translation of the results to humans and improve both, animal and human health.

  9. [Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient].

    Science.gov (United States)

    Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi

    2005-01-01

    We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

  10. Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

    Directory of Open Access Journals (Sweden)

    Cecilia Ortiz Rodríguez

    2003-06-01

    Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

  11. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    International Nuclear Information System (INIS)

    Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick

    2005-01-01

    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  12. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

    Energy Technology Data Exchange (ETDEWEB)

    Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)

    2005-10-01

    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

  13. Detection of Streptococcus pneumoniae in whole blood by PCR.

    Science.gov (United States)

    Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

    1995-03-01

    Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

  14. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

    1995-01-01

    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  15. Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response trhough Toll-like receptors 2, 4, and 9 in species-specific patterns

    DEFF Research Database (Denmark)

    Mogensen, T.H.; Paludan, Søren Riis; Kilian, Mogens

    2006-01-01

    activation by live bacteria. Here, we demonstrate that live Streptococcus pneumoniae, Haemophilus influenzae type b, and Neisseria meningitidis, the three principal causes of bacterial meningitis, use distinct sets of TLRs to trigger the inflammatory response. Using human embryonic kidney 293 cell lines......, each overexpressing one type of TLR, we found that S. pneumoniae triggered activation of the transcription factor nuclear factor-kappaB and expression of interleukin-8, only in cells expressing TLR2 or -9. The same response was evoked by H. influenzae in cells expressing TLR2 or -4 and by N...... and confirmed the essential role of these TLRs and also identified differential functions of TLRs in activation of the inflammatory response. Collectively, we here demonstrate that S. pneumoniae, H. influenzae, and N. meningitidis each activate several TLRs in species-specific patterns and show that infection...

  16. Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

    NARCIS (Netherlands)

    Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

    2016-01-01

    Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

  17. High-resolution CT findings in Streptococcus milleri pulmonary infection

    International Nuclear Information System (INIS)

    Okada, F.; Ono, A.; Ando, Y.; Nakayama, T.; Ishii, H.; Hiramatsu, K.; Sato, H.; Kira, A.; Otabe, M.; Mori, H.

    2013-01-01

    Aim: To assess pulmonary high-resolution computed tomography (CT) findings in patients with acute Streptococcus milleri pulmonary infection. Materials and methods: Sixty consecutive patients with acute S. milleri pneumonia who had undergone high-resolution CT chest examinations between January 2004 and March 2010 were retrospectively identified. Twenty-seven patients with concurrent infections were excluded. The final study group comprised 33 patients (25 men, 8 women; aged 20–88 years, mean 63.1 years) with S. milleri infection. The patients' clinical findings were assessed. Parenchymal abnormalities, enlarged lymph nodes, and pleural effusion were evaluated on high-resolution CT. Results: Underlying conditions included malignancy (n = 15), a smoking habit (n = 11), and diabetes mellitus (n = 8). CT images of all patients showed abnormal findings, including ground-glass opacity (n = 24), bronchial wall thickening (n = 23), consolidation (n = 17), and cavities (n = 7). Pleural effusion was found in 18 patients, and complex pleural effusions were found in seven patients. Conclusion: Pulmonary infection caused by S. milleri was observed mostly in male patients with underlying conditions such as malignancy or a smoking habit. The CT findings in patients with S. milleri consisted mainly of ground-glass opacity, bronchial wall thickening, pleural effusions, and cavities

  18. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

    NARCIS (Netherlands)

    Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.

    2009-01-01

    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

  19. Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

    OpenAIRE

    Suits, Michael D.; Boraston, Alisdair B.

    2013-01-01

    PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

  20. Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms.

    Science.gov (United States)

    Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E

    2013-09-10

    Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

  1. Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

    Directory of Open Access Journals (Sweden)

    Carolina Firacative

    2009-04-01

    Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

  2. Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

    Directory of Open Access Journals (Sweden)

    Fortino Solórzano-Santos

    2005-07-01

    Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

  3. Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

    Directory of Open Access Journals (Sweden)

    Casey L Pell

    Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

  4. Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012

    Science.gov (United States)

    Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.

    2016-01-01

    Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

  5. Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

    NARCIS (Netherlands)

    Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.

    2008-01-01

    Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

  6. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

    Directory of Open Access Journals (Sweden)

    Pui-Ying Iroh Tam

    Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

  7. Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

    Science.gov (United States)

    Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

    2016-01-01

    Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

  8. Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.

    Science.gov (United States)

    Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor

    2017-11-14

    The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

  9. Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae.

    Science.gov (United States)

    Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose

    2015-01-01

    Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

  10. A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

    Directory of Open Access Journals (Sweden)

    Lance K. Blevins

    2017-11-01

    Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

  11. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Raphaël Laurenceau

    Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

  12. A visual review of the human pathogen Streptococcus pneumoniae.

    Science.gov (United States)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt

    2017-11-01

    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol.

    Science.gov (United States)

    Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto

    2015-06-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

    Directory of Open Access Journals (Sweden)

    Cristina R. M. Yoshioka

    2011-02-01

    Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

  15. Internamento devido a PAC por Streptococcus pneumoniae – Avaliação de factores de mortalidade

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo

    2008-09-01

    Full Text Available Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS -CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade.Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Rev Port Pneumol 2008; XIV (5: 601-615 Abstract: Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for

  16. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae

    OpenAIRE

    Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar

    2004-01-01

    INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...

  17. Shear Stress Enhances Chemokine Secretion from Chlamydia pneumoniae-infected Monocytes.

    Science.gov (United States)

    Evani, Shankar J; Dallo, Shatha F; Murthy, Ashlesh K; Ramasubramanian, Anand K

    2013-09-01

    Chlamydia pneumoniae is a common respiratory pathogen that is considered a highly likely risk factor for atherosclerosis. C. pneumoniae is disseminated from the lung into systemic circulation via infected monocytes and lodges at the atherosclerotic sites. During transit, C. pneumoniae -infected monocytes in circulation are subjected to shear stress due to blood flow. The effect of mechanical stimuli on infected monocytes is largely understudied in the context of C. pneumoniae infection and inflammation. We hypothesized that fluid shear stress alters the inflammatory response of C. pneumoniae -infected monocytes and contributes to immune cell recruitment to the site of tissue damage. Using an in vitro model of blood flow, we determined that a physiological shear stress of 7.5 dyn/cm 2 for 1 h on C. pneumoniae -infected monocytes enhances the production of several chemokines, which in turn is correlated with the recruitment of significantly large number of monocytes. Taken together, these results suggest synergistic interaction between mechanical and chemical factors in C. pneumoniae infection and associated inflammation.

  18. Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

    Directory of Open Access Journals (Sweden)

    Radhika Raman

    2017-01-01

    Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

  19. Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.

    2017-01-01

    Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

  20. Pleural empyema and streptococcal toxic shock syndrome due to Streptococcus pyogenes in a healthy Spanish traveler in Japan

    Directory of Open Access Journals (Sweden)

    Tetsuya Sakai

    2017-01-01

    Full Text Available Group A Streptococcus (GAS, Streptococcus pyogenes causes invasive infections including streptococcal toxic shock syndrome (STSS and local infections. To our knowledge, this is the first report of a case of an invasive GAS infection with pneumonia and pleural empyema (PE followed by STSS (disseminated intravascular coagulation [DIC] and acute renal insufficiency in a healthy male adult. He received combined supportive therapies of PE drainage, anti-DIC agent, hemodialysis, and antimicrobials and eventually made a clinical recovery. GAS isolated from PE was found to have emm1/speA genes, suggestive of a pathogenic strain. Clinicians should be aware of the possibility of this disease entity (pneumonia, PE, and STSS in healthy male adults as well as children and adult women.

  1. LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

    2015-01-01

    Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

  2. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  3. Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Pan F

    2018-05-01

    Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

  4. Severe asthma exacerbation: role of acute Chlamydophila pneumoniae and Mycoplasma pneumoniae infection.

    Science.gov (United States)

    Cosentini, Roberto; Tarsia, Paolo; Canetta, Ciro; Graziadei, Giovanna; Brambilla, Anna Maria; Aliberti, Stefano; Pappalettera, Maria; Tantardini, Francesca; Blasi, Francesco

    2008-05-30

    Chlamydophila pneumoniae and Mycoplasma pneumoniae are associated with acute exacerbation of bronchial asthma (AEBA). The aim of this study was to evaluate the correlation between these acute bacterial infections and the severity of AEBA. We prospectively analysed consecutive patients admitted to the Emergency Department with acute asthma exacerbation. In every patient peak expiratory flow (PEF) measurement was performed on admission, and spirometry during follow-up. Serology for Chlamydophila and Mycoplasma pneumoniae was performed on admission and after 4-8 weeks. Fifty-eight patients completed the study. Acute atypical infections (AAI) was observed in 22/58 cases; we found single acute C. pneumoniae in 19 cases, single acute M. pneumoniae in 2 cases, and double acute infection in one case. Functional impairment on admission was greater in patients with AAI than in patients without AAI (PEF 205 +/- 104 L/min vs 276 +/- 117 p = 0.02) and persisted until visit 2 (FEV1% 76.30 +/- 24.54 vs FEV1% 92.91 +/- 13.89, p = 0.002). Moreover, the proportion of patients who presented with severe AEBA was significantly greater in the group with AAI than in the group without AAI (15/22 vs 12/36, p = 0.01; OR 4.29, 95% CI 1.38-13.32). Our data suggest an association between acute atypical infection and a more severe AEBA.

  5. Immune Thrombocytopenia Associated with Mycoplasma pneumoniae Infection

    Directory of Open Access Journals (Sweden)

    Catarina Gouveia

    2018-01-01

    Full Text Available Immune thrombocytopenia (ITP related to Mycoplasma pneumoniae infection is a rare condition and usually associated with a severe clinical course. We here report a case of a young man with a clinical diagnosis of severe ITP secondary to M. pneumoniae infection. The clinical features, therapy and outcome are presented.

  6. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  7. Severe asthma exacerbation: role of acute Chlamydophila pneumoniae and Mycoplasma pneumoniae infection

    Directory of Open Access Journals (Sweden)

    Pappalettera Maria

    2008-05-01

    Full Text Available Abstract Background Chlamydophila pneumoniae and Mycoplasma pneumoniae are associated with acute exacerbation of bronchial asthma (AEBA. The aim of this study was to evaluate the correlation between these acute bacterial infections and the severity of AEBA. Methods We prospectively analysed consecutive patients admitted to the Emergency Department with acute asthma exacerbation. In every patient peak expiratory flow (PEF measurement was performed on admission, and spirometry during follow-up. Serology for Chlamydophila and Mycoplasma pneumoniae was performed on admission and after 4–8 weeks. Results Fifty-eight patients completed the study. Acute atypical infections (AAI was observed in 22/58 cases; we found single acute C. pneumoniae in 19 cases, single acute M. pneumoniae in 2 cases, and double acute infection in one case. Functional impairment on admission was greater in patients with AAI than in patients without AAI (PEF 205 ± 104 L/min vs 276 ± 117 p = 0.02 and persisted until visit 2 (FEV1% 76.30 ± 24.54 vs FEV1% 92.91 ± 13.89, p = 0.002. Moreover, the proportion of patients who presented with severe AEBA was significantly greater in the group with AAI than in the group without AAI (15/22 vs 12/36, p = 0.01; OR 4.29, 95% CI 1.38–13.32. Conclusion Our data suggest an association between acute atypical infection and a more severe AEBA.

  8. Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

    Directory of Open Access Journals (Sweden)

    Bowers Jolene R

    2012-01-01

    Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

  9. ADULT RESPIRATORY-DISTRESS SYNDROME (ARDS) DUE TO BACTEREMIC PNEUMOCOCCAL PNEUMONIA

    NARCIS (Netherlands)

    MANNES, GPM; BOERSMA, WG; BAUR, CHJM; POSTMUS, PE

    We describe a patient, who had no pre-existing disease, with bacteraemic pneumococcal pneumonia and adult respiratory distress syndrome (ARDS), a rare complication. In spite of the use of antibiotics and intensive treatment the mortality rate of this kind of infection remains high. Streptococcus

  10. Health related quality of life in patients with community-acquired pneumococcal pneumonia in France

    OpenAIRE

    Andrade, Luiz Flavio; Saba, Grèce; Ricard, Jean-Damien; Messika, Jonathan; Gaillat, Jacques; Bonnin, Pierre; Chidiac, Christian; Illes, Hajnal-Gabriela; Laurichesse, Henri; Detournay, Bruno; Petitpretz, Patrick; de Pouvourville, Gérard

    2018-01-01

    Background Community Acquired Pneumococcal Pneumonia is a lung infection that causes serious health problems and can lead to complications and death. The aim of this study was to observe and analyze health related quality of life after a hospital episode for patients with community acquired pneumococcal pneumonia in France. Methods A total of 524 individuals were enrolled prospectively in the study and were followed for 12 months after hospital discharge. Presence of streptococcus pneumoniae ...

  11. Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

    NARCIS (Netherlands)

    Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

    The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

  12. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)

    OpenAIRE

    Ion, Bogdan; Kazim, Erum; Gauld, James

    2014-01-01

    Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

  13. Community-acquired pneumonia in children - a changing spectrum of disease.

    Science.gov (United States)

    le Roux, David M; Zar, Heather J

    2017-10-01

    Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented.

  14. Community-acquired pneumonia in children. A changing spectrum of disease

    International Nuclear Information System (INIS)

    Le Roux, David M.; Zar, Heather J.

    2017-01-01

    Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented. (orig.)

  15. Community-acquired pneumonia in children. A changing spectrum of disease

    Energy Technology Data Exchange (ETDEWEB)

    Le Roux, David M. [Red Cross War Memorial Children' s Hospital, Cape Town (South Africa); New Somerset Hospital, Department of Paediatrics, Cape Town (South Africa); Zar, Heather J. [Red Cross War Memorial Children' s Hospital, Cape Town (South Africa)

    2017-10-15

    Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented. (orig.)

  16. Chlamydia pneumoniae infection-associated erythema multiforme

    Directory of Open Access Journals (Sweden)

    Shinsaku Imashuku

    2013-06-01

    Full Text Available There is a well-known correlation between Herpes simplex (HSV infection and erythema multiforme (EM. More recently, in Japan, it was found that Chlamydia pneumoniae (Cp may promote the development of EM. All cases of Cp infection-associated EM that had been diagnosed in our clinic over the past two years (from 2011 to 2012 were analyzed. Cp infection was diagnosed on the basis of a significant increase (>2.00 in anti-Cp IgM titers, as measured by the HITAZYME-ELISA test. There were 7 cases of Cp-EM, one male and 6 females. Median age was 13 years (range 3-29 years. It is recommended that the possible involvement of Cp infection, besides HSV or Mycoplasma pneumoniae infections, should be considered in all cases of EM.

  17. [Antibiotic resistance analysis of Streptococcus pneumoniae isolates from the hospitalized children in Shanxi Children's Hospital from 2012 to 2014].

    Science.gov (United States)

    Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H

    2017-02-02

    Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0

  18. Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

    LENUS (Irish Health Repository)

    Vickers, I

    2011-03-01

    The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

  19. [THE DIAGNOSTIC APPROACHES TO VERIFICATION OF STREPTOCOCCUS INFECTION IN PATIENTS WITH INFECTIOUS MONONUCLEOSIS].

    Science.gov (United States)

    Kim, M A; Labushkina, A V; Simovanian, E N; Kharseeva, G G

    2015-11-01

    The Rostovskii state medical university of Minzdrav of Russia, 344022 Rostov-on-Don, Russia The analysis is applied concerning significance of laboratory techniques of verification of streptococcus infection (bacteriological analysis, detection of anti-streptolysin O in pair serums) in 148 patients with infectious mononucleosis aged from 3 to 15 years. The content of anti-streptolysin O exceeded standard in 41 ± 4.8% of patients with concomitant in acute period and in 49.5 ± 4.9% during period of re-convalescence. This data differed from analogous indicator in patients with negative result of examination on streptococcus infection independently of period of disease (9.3 ± 2.8%). The exceeding of standard of anti-streptolysin O was detected more frequently (t ≥ 2, P ≥ 95%) in patients with isolation of Streptococcus pyogenes (56.9 ± 5.8%) than in patients with Streptococcus viridans (31.2 ± 6.5%). The concentration of anti-streptolysin 0 in patients with concomitant streptococcus infection varied within limits 200-1800 IE/ml. The minimal level of anti-streptolysin O (C = 200 IE/mI) was detected independently of type of isolated Streptococcus and period of disease. The high levels of anti-streptolysin O were observed exclusively in patients with isolation of Streptococcus pyogenes. In blood serum ofpatient with concomitant streptococcus infection (Streptococcus pyogenes + Streptococcus viridans) increasing of level of anti-streptolysin O was detected in dynamics of diseases from minimal (C = 200 IE/ ml) to moderately high (200 mononucleosis the anamnesis data is to be considered. The complex bacteriological and serological examination ofpatients is to be implemented This is necessary for early detection ofpatients with streptococcus infection and decreasing risk of formation of streptococcus carrier state.

  20. Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient.

    Science.gov (United States)

    Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J

    2013-09-01

    Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

  1. Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media.

    Science.gov (United States)

    Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn

    2017-03-01

    This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

  2. Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold

    OpenAIRE

    Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej

    2001-01-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

  3. Peritonitis in a llama caused by Streptococcus equi subsp. zooepidemicus.

    Science.gov (United States)

    Hewson, J; Cebra, C K

    2001-01-01

    A 7-month-old, male llama was diagnosed with peritonitis caused by Streptococcus equi subsp. zooepidemicus. Clinical findings, medical treatment, and case outcome are described. Hematogenous dissemination from suspected pneumonia is proposed as the route of infection in this case. Possible transmission of the organism through contact with horses is discussed. PMID:11424579

  4. A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall.

    Science.gov (United States)

    Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

    We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

  5. Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

    Directory of Open Access Journals (Sweden)

    Patrícia A. G. Velasquez

    2009-12-01

    Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

  6. Four country healthcare-associated infection prevalence survey: pneumonia and lower respiratory tract infections.

    LENUS (Irish Health Repository)

    Humphreys, H

    2010-03-01

    In 2006, the Hospital Infection Society was funded by the respective health services in England, Wales, Northern Ireland and the Republic of Ireland to conduct a prevalence survey of healthcare-associated infection (HCAI). Here, we report the prevalence of pneumonia and lower respiratory tract infection other than pneumonia (LRTIOP) in these four countries. The prevalence of all HCAIs was 7.59% (5743 out of 75 694). Nine hundred (15.7%) of these infections were pneumonia, and 402 (7.0%) were LRTIOP. The prevalence of both infections was higher for males than for females, and increased threefold from those aged <35 to those aged >85 years (P<0.001). At the time of the survey or in the preceding seven days, 23.7% and 18.2% of patients with pneumonia and LRTIOP, respectively, were mechanically ventilated compared to 5.2% of patients in the whole study population. Meticillin-resistant Staphylococcus aureus (MRSA) was the cause of pneumonia and LRTIOP in 7.6% and 18.1% of patients, respectively (P<0.001). More patients with LRTIOP (4.2%) had concurrent diarrhoea due to Clostridium difficile compared to patients with pneumonia (2.4%), but this did not reach statistical significance. Other HCAIs were present in 137 (15.2%) of patients with pneumonia and 66 (16.4%) of those with LRTIOP. The results suggest that reducing instrumentation, such as mechanical ventilation where possible, should help reduce infection. The higher prevalence of MRSA as a cause of LRTIOP suggests a lack of specificity in identifying the microbial cause and the association with C. difficile emphasises the need for better use of antibiotics.

  7. Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

    NARCIS (Netherlands)

    Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.

    2008-01-01

    The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

  8. Community-acquired pneumonia among smokers.

    Science.gov (United States)

    Almirall, Jordi; Blanquer, José; Bello, Salvador

    2014-06-01

    Recent studies have left absolutely no doubt that tobacco increases susceptibility to bacterial lung infection, even in passive smokers. This relationship also shows a dose-response effect, since the risk reduces spectacularly 10 years after giving up smoking, returning to the level of non-smokers. Streptococcus pneumoniae is the causative microorganism responsible for community-acquired pneumonia (CAP) most frequently associated with smoking, particularly in invasive pneumococcal disease and septic shock. It is not clear how it acts on the progress of pneumonia, but there is evidence to suggest that the prognosis for pneumococcal pneumonia is worse. In CAP caused by Legionella pneumophila, it has also been observed that smoking is the most important risk factor, with the risk rising 121% for each pack of cigarettes smoked a day. Tobacco use may also favor diseases that are also known risk factors for CAP, such as periodontal disease and upper respiratory viral infections. By way of prevention, while giving up smoking should always be proposed, the use of the pneumococcal vaccine is also recommended, regardless of the presence of other comorbidities. Copyright © 2013 SEPAR. Published by Elsevier Espana. All rights reserved.

  9. Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

    Directory of Open Access Journals (Sweden)

    Lêda Lúcia M. Ferreira

    2001-06-01

    ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

  10. The effect of immunization with pneumococcal conjugated vaccines on Streptococcus pneumoniae resistance patterns in acute otitis media

    Directory of Open Access Journals (Sweden)

    Tal Marom

    2017-10-01

    Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.

  11. Time-resolved dual RNA-seq reveals extensive rewiring of lung epithelial and pneumococcal transcriptomes during early infection

    NARCIS (Netherlands)

    Aprianto, Rieza; Slager, Jelle; Holsappel, Siger; Veening, Jan-Willem

    2016-01-01

    BACKGROUND: Streptococcus pneumoniae, the pneumococcus, is the main etiological agent of pneumonia. Pneumococcal infection is initiated by bacterial adherence to lung epithelial cells. The exact transcriptional changes occurring in both host and microbe during infection are unknown. Here, we

  12. A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China.

    Science.gov (United States)

    Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun

    2018-03-01

    The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  13. Effects of deletion of the Streptococcus pneumoniae lipoprotein diacylglyceryl transferase gene lgt on ABC transporter function and on growth in vivo.

    Directory of Open Access Journals (Sweden)

    Suneeta Chimalapati

    Full Text Available Lipoproteins are an important class of surface associated proteins that have diverse roles and frequently are involved in the virulence of bacterial pathogens. As prolipoproteins are attached to the cell membrane by a single enzyme, prolipoprotein diacylglyceryl transferase (Lgt, deletion of the corresponding gene potentially allows the characterisation of the overall importance of lipoproteins for specific bacterial functions. We have used a Δlgt mutant strain of Streptococcus pneumoniae to investigate the effects of loss of lipoprotein attachment on cation acquisition, growth in media containing specific carbon sources, and virulence in different infection models. Immunoblots of triton X-114 extracts, flow cytometry and immuno-fluorescence microscopy confirmed the Δlgt mutant had markedly reduced lipoprotein expression on the cell surface. The Δlgt mutant had reduced growth in cation depleted medium, increased sensitivity to oxidative stress, reduced zinc uptake, and reduced intracellular levels of several cations. Doubling time of the Δlgt mutant was also increased slightly when grown in medium with glucose, raffinose and maltotriose as sole carbon sources. These multiple defects in cation and sugar ABC transporter function for the Δlgt mutant were associated with only slightly delayed growth in complete medium. However the Δlgt mutant had significantly reduced growth in blood or bronchoalveolar lavage fluid and a marked impairment in virulence in mouse models of nasopharyngeal colonisation, sepsis and pneumonia. These data suggest that for S. pneumoniae loss of surface localisation of lipoproteins has widespread effects on ABC transporter functions that collectively prevent the Δlgt mutant from establishing invasive infection.

  14. Dalbavancin Activity When Tested against Streptococcus pneumoniae Isolated in Medical Centers on Six Continents (2011 to 2014).

    Science.gov (United States)

    Jones, Ronald N; Schuchert, Jason E; Mendes, Rodrigo E

    2016-06-01

    Dalbavancin, a novel lipoglycopeptide, was approved for use in 2014 by regulatory agencies in the United States and Europe for the treatment of skin and skin structure infections. The activity of dalbavancin was also widely assessed by determination of its activity against Streptococcus pneumoniae clinical isolates collected from patients on six continents monitored during two time intervals (2011 to 2013 and 2014). A total of 18,186 pneumococcal isolates were obtained from 49 nations and submitted to a monitoring laboratory as part of the SENTRY Antimicrobial Surveillance Program for reference susceptibility testing. The potency of dalbavancin against S. pneumoniae was consistent across the years that it was monitored, with the MIC50 and MIC90 being 0.015 and 0.03 μg/ml, respectively, and all isolates were inhibited by ≤0.12 μg/ml. The activity of dalbavancin was not adversely influenced by nonsusceptibility to β-lactams (ceftriaxone or penicillin), macrolides, clindamycin, fluoroquinolones, or tetracyclines or multidrug resistance (MDR). Regional variations in dalbavancin activity were not detected, but S. pneumoniae strains isolated in the Asia-Pacific region were more likely to be nonsusceptible to penicillin and ceftriaxone as well as to be MDR than strains isolated in North or South America and Europe. Direct comparisons of potency illustrated that dalbavancin (MIC50 and MIC90, 0.015 and 0.03 μg/ml, respectively) was 16-fold or more active than vancomycin (MIC50, 0.25 μg/ml), linezolid (MIC50, 1 μg/ml), levofloxacin (MIC50, 1 μg/ml), ceftriaxone (MIC90, 1 μg/ml), and penicillin (MIC90, 2 μg/ml). In conclusion, dalbavancin had potent and consistent activity against this contemporary (2011 to 2014) collection of S. pneumoniae isolates. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

    NARCIS (Netherlands)

    K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

    2000-01-01

    textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

  16. Endocytosis‒Mediated Invasion and Pathogenicity of Streptococcus agalactiae in Rat Cardiomyocyte (H9C2)

    OpenAIRE

    Pooja, Sharma; Pushpanathan, Muthuirulan; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2015-01-01

    Streptococcus agalactiae infection causes high mortality in cardiovascular disease (CVD) patients, especially in case of setting prosthetic valve during cardiac surgery. However, the pathogenesis mechanism of S. agalactiae associate with CVD has not been well studied. Here, we have demonstrated the pathogenicity of S. agalactiae in rat cardiomyocytes (H9C2). Interestingly, both live and dead cells of S. agalactiae were uptaken by H9C2 cells. To further dissect the process of S. agalactiae int...

  17. Antimicrobial Susceptibility/Resistance of Streptococcus Pneumoniae

    Science.gov (United States)

    Karcic, Emina; Aljicevic, Mufida; Bektas, Sabaheta; Karcic, Bekir

    2015-01-01

    Introduction: Pneumococcal infections are a major cause of morbidity and mortality worldwide, whose treatment is threatened with an increase in the number of strains resistant to antibiotic therapy. Goal: The main goal of this research was to investigate the presence of antimicrobial susceptibility/resistance of S. pneumoniae. Material and methods: Taken are swabs of the nose and nasopharynx, eye and ear. In vitro tests that were made in order to study the antimicrobial resistance of pneumococci are: disk diffusion method and E-test. Results: The resistance to inhibitors of cell wall synthesis was recorded at 39.17%, protein synthesis inhibitors 19.67%, folate antagonists 47.78% and quinolone in 1.11%. S. pneumoniae has shown drug resistance to erythromycin in 45%, clindamycin in 45%, chloramphenicol–0.56%, rifampicin–6.11%, tetracycline–4.67%, penicillin-G in 4.44%, oxacillin in 73.89%, ciprofloxacin in 1.11% and trimethoprim-sulfamethoxazole in 5.34% of cases. Conclusion: The highest resistance pneumococcus showed to erythromycin, clindamycin and trimethoprim-sulfamethoxazole and these should be avoided in the treatment. The least resistance pneumococcus showed to tetracycline, rifampicin, chloramphenicol, penicillin-G and ciprofloxacin. PMID:26236165

  18. Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

    Directory of Open Access Journals (Sweden)

    Marta I. C. MEDEIROS

    1998-01-01

    Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

  19. Radiosynthesis and biodistribution of 99mTc-tricarbonyl complex of temafloxacin dithiocarbamate. A potential Streptococci pneumoniae infection radiotracer

    International Nuclear Information System (INIS)

    Syed Qaiser Shah; Muhammad Rafiullah Khan

    2011-01-01

    In the current investigation the complexation of derivatized temafloxacin with 99m Tc using [ 99m Tc(CO) 3 (H 2 O) 3 ] + precursor was assessed. The tricarbonyl complex of the temafloxacin dithiocarbamate ( 99m Tc(CO) 3 -TAND) was characterized in terms of radiochemical purity (RCP) yield in saline, in vitro radiochemical stability in serum, in vitro binding with Streptococci pneumoniae and biodistribution in male Wister rats (MWR) artificially infected with living and heat killed Streptococci pneumoniae. The 99m Tc(CO) 3 -TAND complex showed 98.10 ± 15% RCP value at 30 min of the reconstitution and remained more than 90% stable up to 120 min in normal saline at room temperature. In serum a stable behavior with the appearance of 15.30% unwanted side product up to 16 h of incubation was observed. A saturated in vitro binding with Streptococci pneumoniae was observed. The complex showed almost six times higher uptake in the infected muscle as compared to the inflamed and normal muscles of the MWR infected with living Streptococci pneumoniae. Insignificant difference in the uptake of the tracer in the infected, inflamed and normal muscles of the MWR infected with heat killed Streptococci pneumoniae was noted. Based on the elevated RCP in saline, in vitro stability in serum at 37 deg C, saturated in vitro binding with pathogens and better biodistribution behavior with higher accumulation of the tracer in target organs confirmed the suitability of the 99m Tc(CO) 3 -TAND complex as promising infection radiotracer. (author)

  20. [Increasing incidence of community-acquired pneumonia caused by atypical microorganisms].

    Science.gov (United States)

    Tazón-Varela, M A; Alonso-Valle, H; Muñoz-Cacho, P; Gallo-Terán, J; Piris-García, X; Pérez-Mier, L A

    2017-09-01

    Knowing the most common microorganisms in our environment can help us to make proper empirical treatment decisions. The aim is to identify those microorganisms causing community-acquired pneumonia. An observational, descriptive and prospective study was conducted, including patients over 14 years with a clinical and radiographic diagnosis of community-acquired pneumonia during a 383 consecutive day period. A record was made of sociodemographic variables, personal history, prognostic severity scales, progress, and pathogenic agents. The aetiological diagnosis was made using blood cultures, detection of Streptococcus pneumoniae and Legionella pneumophila urinary antigens, sputum culture, influenza virus and Streptococcus pyogenes detection. Categorical variables are presented as absolute values and percentages, and continuous variables as their means and standard deviations. Of the 287 patients included in the study (42% women, mean age 66±22 years), 10.45% died and 70% required hospital admission. An aetiological diagnosis was achieved in 43 patients (14.98%), with 16 microorganisms found in 59 positive samples. The most frequently isolated pathogen was Streptococcus pneumonia (24/59, 41%), followed by gram-negative enteric bacilli, Klebsiella pneumonia, Escherichia coli, Serratia marcescens and Enterobacter cloacae isolated in 20% of the samples (12/59), influenza virus (5/59, 9%), methicillin-resistant Staphylococcus aureus (3/59, 5%), Pseudomonas aeruginosa (2/59, 3%), Moraxella catarrhalis (2/59, 3%), Legionella pneumophila (2/59, 3%), and Haemophilus influenza (2/59, 3%). Polymicrobial infections accounted for 14% (8/59). A high percentage of atypical microorganisms causing community-acquired pneumonia were found. Copyright © 2016 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Recurrent Streptococcus Pneumoniae Meningitis in a Child with Split Hand and Foot Malformation and Undiagnosed Mondini Dysplasia.

    Science.gov (United States)

    Katarzyna, Mazur-Melewska; Jarosław, Szydłowski; Katarzyna, Jończyk-Potoczna; Wojciech, Służewski; Magdalena, Figlerowicz

    Recurrent bacterial meningitis is a life-threatening infection of the central nervous system that is mostly connected with anatomical abnormalities of the skull, chronic parameningeal infections and immunodeficiencies. It's rarely seen, but when it occurs an extensive investigation should be carried out to discover the responsible factor, so that further episodes can be prevented. We report on a child with split hand and foot (SHFM), confirmed incorrect karyotype 46, XY, t(7:12)(q21.2;q21.3) and a fourth episode of fulminant meningitis caused by penicillin-resistant Streptococcus pneumoniae . After a broad evaluation of factors predisposing to recurrent meningitis, the undiagnosed malformation of his inner and middle ears - Mondini dysplasia was found. We suggest examining all children with SHFM for hearing impairment before they develop recurrent meningitis. The time when the radiological procedure for searching for inner ear dysplasia should be performed could be a controversial issue: before or after the first episode of meningitis. From the epidemiological point of view, high-resolution computer tomography scanning of the temporal bones should be considered after the diagnosis of deafness in a child with SHFM related to 7q21 deletion.

  2. Hospital-acquired Klebsiella pneumoniae infections in a paediatric ...

    African Journals Online (AJOL)

    is an important preventable cause of increased ... between July 2003 and December 2010, who developed a hospital-acquired Klebsiella pneumoniae infection, was undertaken to describe the trend in ..... Bacterial nosocomial pneumonia in.

  3. Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

    Science.gov (United States)

    Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

    2015-01-01

    Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

  4. Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

    2010-01-01

    3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

  5. Premedication with Clarithromycin Is Effective against Secondary Bacterial Pneumonia during Influenza Virus Infection in a Pulmonary Emphysema Mouse Model.

    Science.gov (United States)

    Harada, Tatsuhiko; Ishimatsu, Yuji; Hara, Atsuko; Morita, Towako; Nakashima, Shota; Kakugawa, Tomoyuki; Sakamoto, Noriho; Kosai, Kosuke; Izumikawa, Koichi; Yanagihara, Katsunori; Mukae, Hiroshi; Kohno, Shigeru

    2016-09-01

    Secondary bacterial pneumonia (SBP) during influenza increases the severity of chronic obstructive pulmonary disease (COPD) and its associated mortality. Macrolide antibiotics, including clarithromycin (CAM), are potential treatments for a variety of chronic respiratory diseases owing to their pharmacological activities, in addition to antimicrobial action. We examined the efficacy of CAM for the treatment of SBP after influenza infection in COPD. Specifically, we evaluated the effect of CAM in elastase-induced emphysema mice that were inoculated with influenza virus (strain A/PR8/34) and subsequently infected with macrolide-resistant Streptococcus pneumoniae CAM was administered to the emphysema mice 4 days prior to influenza virus inoculation. Premedication with CAM improved pathologic responses and bacterial load 2 days after S. pneumoniae inoculation. Survival rates were higher in emphysema mice than control mice. While CAM premedication did not affect viral titers or exert antibacterial activity against S. pneumoniae in the lungs, it enhanced host defense and reduced inflammation, as evidenced by the significant reductions in total cell and neutrophil counts and interferon (IFN)-γ levels in bronchoalveolar lavage fluid and lung homogenates. These results suggest that CAM protects against SBP during influenza in elastase-induced emphysema mice by reducing IFN-γ production, thus enhancing immunity to SBP, and by decreasing neutrophil infiltration into the lung to prevent injury. Accordingly, CAM may be an effective strategy to prevent secondary bacterial pneumonia in COPD patients in areas in which vaccines are inaccessible or limited. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  6. Mycoplasma pneumonia-associated Acute Hepatitis in an Adult Patient without Lung Infection

    Directory of Open Access Journals (Sweden)

    Shou-Wu Lee

    2009-04-01

    Full Text Available Mycoplasma pneumonia is a major cause of respiratory infections in school-aged children. Most M. pneumonia infections in adults involve the respiratory tract. Extrapulmonary manifestations of M. pneumonia infection may be found in the skin, cardiovascular, neurologic and hematologic systems. Concomitant liver disease is rare in adults. Here, we report an unusual case of a patient who presented with fever and abdominal pain, but without pulmonary manifestations. The laboratory work-up demonstrated a hepatocellular pattern of acute hepatitis caused by M. pneumonia infection. Symptoms subsided and laboratory parameters improved with antibiotics treatment. Thus, this case can help raise clinicians' awareness of the possibility of M. pneumonia infection, with or without lung involvement, as a part of the evaluation of undetermined hepatitis.

  7. SpxB is a suicide gene of Streptococcus pneumoniae and confers a selective advantage in an in vivo competitive colonization model.

    Science.gov (United States)

    Regev-Yochay, Gili; Trzcinski, Krzysztof; Thompson, Claudette M; Lipsitch, Marc; Malley, Richard

    2007-09-01

    The human bacterial pathogen Streptococcus pneumoniae dies spontaneously upon reaching stationary phase. The extent of S. pneumoniae death at stationary phase is unusual in bacteria and has been conventionally attributed to autolysis by the LytA amidase. In this study, we show that spontaneous pneumococcal death is due to hydrogen peroxide (H(2)O(2)), not LytA, and that the gene responsible for H(2)O(2) production (spxB) also confers a survival advantage in colonization. Survival of S. pneumoniae in stationary phase was significantly prolonged by eliminating H(2)O(2) in any of three ways: chemically by supplementing the media with catalase, metabolically by growing the bacteria under anaerobic conditions, or genetically by constructing DeltaspxB mutants that do not produce H(2)O(2). Likewise, addition of H(2)O(2) to exponentially growing S. pneumoniae resulted in a death rate similar to that of cells in stationary phase. While DeltalytA mutants did not lyse at stationary phase, they died at a rate similar to that of the wild-type strain. Furthermore, we show that the death process induced by H(2)O(2) has features of apoptosis, as evidenced by increased annexin V staining, decreased DNA content, and appearance as assessed by transmission electron microscopy. Finally, in an in vivo rat model of competitive colonization, the presence of spxB conferred a selective advantage over the DeltaspxB mutant, suggesting an explanation for the persistence of this gene. We conclude that a suicide gene of pneumococcus is spxB, which induces an apoptosis-like death in pneumococci and confers a selective advantage in nasopharyngeal cocolonization.

  8. The response regulator YycF inhibits expression of the fatty acid biosynthesis repressor FabT in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Mohedano, Maria L.; Amblar, Mónica; La Fuente, De Alicia; Wells, Jerry M.; López, Paloma

    2016-01-01

    The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression.

  9. Clinically Relevant ESBL-Producing K. pneumoniae ST307 and E. coli ST38 in an Urban West African Rat Population

    Directory of Open Access Journals (Sweden)

    Katharina Schaufler

    2018-02-01

    Full Text Available High-risk ESBL-producing Enterobacteriaceae (ESBL-E have been described in wild birds and rodents worldwide. Rats are of special interest not only due to their indicator role for environmental pollution with multi-resistant bacteria but also as possible infection source. Data on the presence of high-risk ESBL-E in urban wildlife from Africa remain scarce, however. Twenty-nine animals from three different rat (Rattus species were captured in the city of Conakry (Guinea, West Africa in 2015. Rectal swabs were analyzed for ESBL-E using selective media. Species typing and phenotypic antimicrobial resistance analysis to broad-spectrum beta-lactams and other classes of antimicrobials was performed for Enterobacteriaceae-like isolates using the VITEK®2 system (BioMérieux, Germany. Confirmed ESBL-producing E. coli and K. pneumoniae were whole-genome sequenced and resistance genes, phylogenetic background and genes related to bacterial fitness and virulence were analyzed. In total, six of twenty-nine rats (20% carried ESBL-E (K. pneumoniae and E. coli. All ESBL-producers were multi-drug resistant with blaCTX−M−15 as the dominating ESBL-type. Interestingly, ESBL-associated clonal lineages E. coli ST38 and K. pneumoniae ST307 were found. The ESBL-plasmid in K. pneumoniae ST307 revealed high sequence similarities to pKPN3-307_TypeC, a >200 kbp IncFII plasmid originating from a human clinical ST307 isolate. This was in contrast to the core genome: the rat isolate was distantly related to the human clinical ST307 isolate (27 SNPs/Mbp. In addition, we identified π-fimbrial, capsule 2, and glycogen synthesis clusters in the rodent ST307 isolate, whose involvement in the adaptation to survival outside the host and in human urinary tracts has been suggested. Our results demonstrate the presence of clinically relevant, ESBL-producing K. pneumoniae ST307 and E. coli ST38 clonal lineages in an urban West African rat population. The human community is likely

  10. Effect of treatment duration on pharmacokinetic/pharmacodynamic indices correlating with therapeutic efficacy of ceftazidime in experimental Klebsiella pneumoniae lung infection

    NARCIS (Netherlands)

    I.A.J.M. Bakker-Woudenberg (Irma); M.T. ten Kate (Marian); W.H.F. Goessens (Wil); J.W. Mouton (Johan)

    2006-01-01

    textabstractThe pharmacokinetic/pharmacodynamic (PK/PD) indices that define the therapeutic effect of the betalactam ceftazidime in a rat model of Klebsiella pneumoniae lung infection were investigated in relation to treatment duration and treatment endpoint. Treatment was started 24 h after

  11. Combined pericarditis and pneumonia caused by Legionella infection

    DEFF Research Database (Denmark)

    Svendsen, Jesper Hastrup; Jønsson, V; Niebuhr, U

    1987-01-01

    During a one year period acute pericarditis was diagnosed in 16 consecutive patients without acute infarction or malignancy. In two of these patients with both pericarditis and pneumonia Legionella infection was present. One case was caused by Legionella longbeachae and the other by both Legionella...... longbeachae and Legionella jordanis. When pericarditis is associated with pneumonia Legionella infection should be sought so that effective treatment with erythromycin may be started early....

  12. LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

    Science.gov (United States)

    Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

    2006-02-01

    The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

  13. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

    2006-01-01

    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

  14. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

    2006-07-01

    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

  15. Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

    NARCIS (Netherlands)

    HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

    Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

  16. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Natalie Maricic

    2016-01-01

    Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

  17. New antimicrobial nitrofuran, trans-5-amino-3-[2-(5-nitro-2-furyl)vinyl]-delta2-1,2,4-oxadiazole: antimicrobial efficacy in mice, rats, and guinea pigs.

    Science.gov (United States)

    McRipley, R J; Gadebusch, H H; Pansy, F; Semar, R

    1974-09-01

    A new antimicrobial nitrofuran designated SQ 18,506 showed some therapeutic activity when administered orally to mice infected with Escherichia coli, Salmonella schottmuelleri, Shigella flexneri, or Klebsiella pneumoniae. Animals infected parenterally with Streptococcus pyogenes, Proteus mirabilis, Mycobacterium tuberculosis, and Candida albicans, or topically with Trichophyton mentagrophytes, did not respond to therapy with the drug at the dosage levels used. The compound was as effective as metronidazole in the topical treatment of experimental trichomonal infections in mice and in guinea pigs and as effective as nystatin, candicidin, or a sulfanilamide-aminacrine hydrochloride cream in the treatment of a candidal vaginal infection in rats. The chemotherapeutic efficacy of SQ 18,506 in experimental vaginitis caused by Escherichia coli in the rat surpassed that shown by four commercial products available for the treatment of bacterial vaginitis.

  18. New Antimicrobial Nitrofuran, trans-5-Amino-3-[2-(5-Nitro-2-Furyl)Vinyl]-Δ2 -1,2,4-Oxadiazole: Antimicrobial Efficacy in Mice, Rats, and Guinea pigs

    Science.gov (United States)

    McRipley, R. J.; Gadebusch, H. H.; Pansy, F.; Semar, R.

    1974-01-01

    A new antimicrobial nitrofuran designated SQ 18,506 showed some therapeutic activity when administered orally to mice infected with Escherichia coli, Salmonella schottmuelleri, Shigella flexneri, or Klebsiella pneumoniae. Animals infected parenterally with Streptococcus pyogenes, Proteus mirabilis, Mycobacterium tuberculosis, and Candida albicans, or topically with Trichophyton mentagrophytes, did not respond to therapy with the drug at the dosage levels used. The compound was as effective as metronidazole in the topical treatment of experimental trichomonal infections in mice and in guinea pigs and as effective as nystatin, candicidin, or a sulfanilamide-aminacrine hydrochloride cream in the treatment of a candidal vaginal infection in rats. The chemotherapeutic efficacy of SQ 18,506 in experimental vaginitis caused by Escherichia coli in the rat surpassed that shown by four commercial products available for the treatment of bacterial vaginitis. PMID:15830472

  19. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

  20. Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

    Science.gov (United States)

    Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

    2015-07-01

    The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

  1. Chlamydia pneumoniae hides inside apoptotic neutrophils to silently infect and propagate in macrophages.

    Directory of Open Access Journals (Sweden)

    Jan Rupp

    Full Text Available BACKGROUND: Intracellular pathogens have developed elaborate strategies for silent infection of preferred host cells. Chlamydia pneumoniae is a common pathogen in acute infections of the respiratory tract (e.g. pneumonia and associated with chronic lung sequelae in adults and children. Within the lung, alveolar macrophages and polymorph nuclear neutrophils (PMN are the first line of defense against bacteria, but also preferred host phagocytes of chlamydiae. METHODOLOGY/PRINCIPAL FINDINGS: We could show that C. pneumoniae easily infect and hide inside neutrophil granulocytes until these cells become apoptotic and are subsequently taken up by macrophages. C. pneumoniae infection of macrophages via apoptotic PMN results in enhanced replicative activity of chlamydiae when compared to direct infection of macrophages, which results in persistence of the pathogen. Inhibition of the apoptotic recognition of C. pneumoniae infected PMN using PS- masking Annexin A5 significantly lowered the transmission of chlamydial infection to macrophages. Transfer of apoptotic C. pneumoniae infected PMN to macrophages resulted in an increased TGF-ss production, whereas direct infection of macrophages with chlamydiae was characterized by an enhanced TNF-alpha response. CONCLUSIONS/SIGNIFICANCE: Taken together, our data suggest that C. pneumoniae uses neutrophil granulocytes to be silently taken up by long-lived macrophages, which allows for efficient propagation and immune protection within the human host.

  2. The changing epidemiology of group B streptococcus bloodstream infection

    DEFF Research Database (Denmark)

    Ballard, Mark S; Schønheyder, Henrik C; Knudsen, Jenny Dahl

    2016-01-01

    Background Population-based studies conducted in single regions or countries have identified significant changes in the epidemiology of invasive group B streptococcus (GBS) infection. However, no studies have concurrently compared the epidemiology of GBS infections among multiple different region...

  3. Population Structure of Rat-Derived Pneumocystis carinii in Danish Wild Rats

    DEFF Research Database (Denmark)

    Palmer, Robert J.; Settnes, Osvald P.; Lodal, Jens

    2000-01-01

    The rat model of Pneumocystis carinii pneumonia is frequently used to study human P. carinii infection, but there are many differences between the rat and human infections. We studied naturally acquired P. carinii in wild rats to examine the relevance of the rat model for human infection. P. cari...

  4. Live Attenuated Influenza Vaccine Enhances Colonization of Streptococcus pneumoniae and Staphylococcus aureus in Mice

    Science.gov (United States)

    Mina, Michael J.; McCullers, Jonathan A.; Klugman, Keith P.

    2014-01-01

    ABSTRACT Community interactions at mucosal surfaces between viruses, like influenza virus, and respiratory bacterial pathogens are important contributors toward pathogenesis of bacterial disease. What has not been considered is the natural extension of these interactions to live attenuated immunizations, and in particular, live attenuated influenza vaccines (LAIVs). Using a mouse-adapted LAIV against influenza A (H3N2) virus carrying the same mutations as the human FluMist vaccine, we find that LAIV vaccination reverses normal bacterial clearance from the nasopharynx and significantly increases bacterial carriage densities of the clinically important bacterial pathogens Streptococcus pneumoniae (serotypes 19F and 7F) and Staphylococcus aureus (strains Newman and Wright) within the upper respiratory tract of mice. Vaccination with LAIV also resulted in 2- to 5-fold increases in mean durations of bacterial carriage. Furthermore, we show that the increases in carriage density and duration were nearly identical in all aspects to changes in bacterial colonizing dynamics following infection with wild-type (WT) influenza virus. Importantly, LAIV, unlike WT influenza viruses, had no effect on severe bacterial disease or mortality within the lower respiratory tract. Our findings are, to the best of our knowledge, the first to demonstrate that vaccination with a live attenuated viral vaccine can directly modulate colonizing dynamics of important and unrelated human bacterial pathogens, and does so in a manner highly analogous to that seen following wild-type virus infection. PMID:24549845

  5. [Ceftaroline fosamil in community-acquired and nosocomial pneumonia].

    Science.gov (United States)

    Calbo, Esther; Zaragoza, Rafael

    2014-03-01

    Community-acquired pneumonia (CAP) is a common infection in developed countries and causes a large number of hospital admissions and deaths. In recent years, the incidence of this disease has increased, caused by progressive population aging. Following the introduction of the conjugate vaccine against Streptococcus pneumoniae, there have been significant epidemiological changes that require close monitoring because of the possible emergence of new patterns of resistance. This article aims to review the role of ceftaroline fosamil, a new parenteral cephalosporin with antibacterial activity against Gram-negative and Gram-positive pathogens, in the treatment of pneumonia. Several in vitro and in vivo studies have shown the efficacy of ceftaroline fosamil against penicillin-resistant S. pneumoniae and methicillin-resistant Staphylococcus aureus (MRSA). Additionally, ceftaroline has shown similar efficacy and safety to ceftriaxone in the treatment of community-acquired pneumonia with severe prognosis (prognostic severity index III and IV) in two phase III clinical trials. Although a non-inferiority design was used for these clinical trials, some data suggest a superior efficacy of ceftaroline, with earlier clinical response and higher cure rate in infections caused by S. pneumoniae, making this drug particularly interesting for critically-ill patients admitted to the intensive care unit. Ceftaroline may also be considered for empirical and directed treatment of MRSA pneumonia. Copyright © 2014 Elsevier España, S.L. All rights reserved.

  6. Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

    OpenAIRE

    Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

    2009-01-01

    Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

  7. Clostridium Difficile Infection Due to Pneumonia Treatment: Mortality Risk Models.

    Science.gov (United States)

    Chmielewska, M; Zycinska, K; Lenartowicz, B; Hadzik-Błaszczyk, M; Cieplak, M; Kur, Z; Wardyn, K A

    2017-01-01

    One of the most common gastrointestinal infection after the antibiotic treatment of community or nosocomial pneumonia is caused by the anaerobic spore Clostridium difficile (C. difficile). The aim of this study was to retrospectively assess mortality due to C. difficile infection (CDI) in patients treated for pneumonia. We identified 94 cases of post-pneumonia CDI out of the 217 patients with CDI. The mortality issue was addressed by creating a mortality risk models using logistic regression and multivariate fractional polynomial analysis. The patients' demographics, clinical features, and laboratory results were taken into consideration. To estimate the influence of the preceding respiratory infection, a pneumonia severity scale was included in the analysis. The analysis showed two statistically significant and clinically relevant mortality models. The model with the highest prognostic strength entailed age, leukocyte count, serum creatinine and urea concentration, hematocrit, coexisting neoplasia or chronic obstructive pulmonary disease. In conclusion, we report on two prognostic models, based on clinically relevant factors, which can be of help in predicting mortality risk in C. difficile infection, secondary to the antibiotic treatment of pneumonia. These models could be useful in preventive tailoring of individual therapy.

  8. Prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae in China: a meta-analysis.

    Science.gov (United States)

    Wang, Lin; Fu, Jinjian; Liang, Zhuoxin; Chen, Jichang

    2017-12-13

    To explore the overall prevalence and serotype distribution of nasopharyngeal carriage of Streptococcus pneumoniae(S. pneumoniae) among healthy children. A search for pneumococcal nasopharyngeal carriage studies including children published up to July 31th, 2016 was conducted to describe carriage in China. The review also describes antibiotic resistance in and serotypes of S. pneumoniae and assesses the impact of vaccination on carriage in this region. Summary measures for overall prevalence, antibiotic resistance, and serotype distributions extracted from the analyzed data were determined with 95% confidence intervals (CIs) using random-effects models. Heterogeneity was assessed using I 2 test statistics. Thirty-seven studies were included in this review, and the majority of studies (64.9%) were located in the pre-introduction period of 7-valent pneumococcal conjugate vaccine (PCV7) in China. The pooled prevalence of S. pneumoniae nasopharyngeal carriage was 21.4% (95% CI: 18.3-24.4%). Carriage was highest in children attending kindergartens [24.5%, (19.7-29.3%)] and decreased with increasing age. Before the introduction of PCV7 into China, the prevalence of S. pneumoniae nasopharyngeal carriage was 25.8% (20.7-30.9%), the pooled carriage of S. pneumoniae sharply dropped into the 14.1% (11.3-16.9%) by PCV7 vaccination period (P China, the penicillin resistance rate in S. pneumoniae isolated from healthy children was 31.9% (21.2-42.6%); however, this rate sharply decreased after the introduction of PCV7 in China [21.6%, (7.4-35.9%)], and the difference between the rates during these two time periods was statistically significant (P value China. PCV7 immunization was found to be associated with reduction of nasopharyngeal colonization of S. pneumoniae. Conjugate vaccination coverage was slightly affected by the introduction of PCV7 into China because of low vaccination rate. The government should implement timely adjusted conjugate vaccination strategies based on

  9. Meningoencephalitis in farmed monosex Nile tilapia (Oreochromis niloticus L. caused by Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Adikesavalu Harresh

    2017-09-01

    Full Text Available Aquaculture of tilapia is a new research venture in India. With intensification in farming practices, tilapia are increasingly susceptible to bacterial infections. This article describes the isolation and identification of pathogenic bacteria from cultured monosex Nile tilapia, Oreochromis niloticus (L., that experienced moderate to severe mortalities in West Bengal, India between September and August 2014 and histopathological alterations in various organs. Gram-positive diplococci, identified as Streptococcus agalactiae with Streptococcus identification kits and 16S rDNA sequencing analysis, were isolated from the brain, operculum, and kidney. Other bacteria from the kidney were identified as Aeromonas sobria, A. caviae, Klebsiella pneumoniae ssp. pneumoniae, Escherichia coli, and Enterobacter cloacae. Staphylococcus epidermis was isolated from opercular hemorrhages. Histological sections of the infected tilapia brain revealed meningoencephalitis and granulomatous lesions. Sections from other organs indicated congestion, hemorrhagic and hyperplastic cells, necrosis, vacuolation, hemosiderin deposition, hypertrophic nuclei, melanomacrophage aggregation, and ruptured veins. This report is the first description of S. agalactiae as a primary pathogen causing meningoencephalitis in cultured tilapia in India.

  10. PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

    NARCIS (Netherlands)

    LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

    1992-01-01

    A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

  11. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Sandra M Carvalho

    Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  12. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Science.gov (United States)

    Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E

    2013-01-01

    Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  13. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Mott, Brittney [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States); Thamake, Sanjay [Radio-Isotope Therapy of America Foundation (United States); Vishwanatha, Jamboor; Jones, Harlan P., E-mail: harlan.jones@unthsc.edu [University of North Texas Health Science Center, Department of Molecular Biology and Immunology (United States)

    2013-05-15

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 {+-} 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-{gamma} cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  14. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    International Nuclear Information System (INIS)

    Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

    2013-01-01

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  15. Intranasal delivery of nanoparticle-based vaccine increases protection against S. pneumoniae

    Science.gov (United States)

    Mott, Brittney; Thamake, Sanjay; Vishwanatha, Jamboor; Jones, Harlan P.

    2013-05-01

    Nanoparticle (NP) technologies are becoming commonplace in the development of vaccine delivery systems to protect against various diseases. The current study determined the efficacy of intranasal delivery of a 234 ± 87.5 nm poly lactic-co-glycolic acid nanoparticle vaccine construct in establishing protection against experimental respiratory pneumococcal infection. Nanoparticles encapsulating heat-killed Streptococcus pneumoniae (NP-HKSP) were retained in the lungs 11 days following nasal administration compared to empty NP. Immunization with NP-HKSP produced significant resistance against S. pneumoniae infection compared to administration of HKSP alone. Increased protection correlated with a significant increase in antigen-specific Th1-associated IFN-γ cytokine response by pulmonary lymphocytes. This study establishes the efficacy of NP-based technology as a non-invasive and targeted approach for nasal-pulmonary immunization against pulmonary infections.

  16. Streptococcus anginosus infections: crossing tissue planes.

    Science.gov (United States)

    Sunwoo, Bernie Y; Miller, Wallace T

    2014-10-01

    Streptococcus anginosus has long been recognized to cause invasive pyogenic infections. This holds true for thoracic infections where S. anginosus has a propensity for abscess and empyema formation. Early diagnosis is important given the significant morbidity and mortality associated with thoracic S. anginosus infections. Yet, distinguishing thoracic S. anginosus clinically is difficult. We present three cases of thoracic S. anginosus that demonstrated radiographic extension across tissue planes, including the interlobar fissure, diaphragm, and chest wall. Few infectious etiologies are known to cross tissue planes. Accordingly, we propose S. anginosus be considered among the differential diagnosis of potential infectious etiologies causing radiographic extension across tissue planes.

  17. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  18. Phosphorylation of the Streptococcus pneumoniae cell wall biosynthesis enzyme MurC by a eukaryotic-like Ser/Thr kinase.

    Science.gov (United States)

    Falk, Shaun P; Weisblum, Bernard

    2013-03-01

    Streptococcus pneumoniae contains a single Ser/Thr kinase-phosphatase pair known as StkP-PhpP. Here, we report the interaction of StkP-PhpP with S. pneumoniae UDP-N-acetylmuramoyl:L-alanine ligase, MurC, an enzyme that synthesizes an essential intermediate of the cell wall peptidoglycan pathway. Combinatorial phage display using StkP as target selected the peptide sequence YEVCGSDTVGC as an interacting partner and subsequently confirmed by ELISA. The phage peptide sequence YEVCGSDTVGC aligns closely with the MurC motif spanning S. pneumoniae amino acid coordinates 31-37. We show that MurC is phosphorylated by StkP and that phosphoMurC is dephosphorylated by PhpP. These data suggest a link between StkP-PhpP with the coordinated regulation of cell wall biosynthesis via MurC. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  19. Streptococcus suis infection

    Science.gov (United States)

    Feng, Youjun; Zhang, Huimin; Wu, Zuowei; Wang, Shihua; Cao, Min; Hu, Dan; Wang, Changjun

    2014-01-01

    Streptococcus suis (S. suis) is a family of pathogenic gram-positive bacterial strains that represents a primary health problem in the swine industry worldwide. S. suis is also an emerging zoonotic pathogen that causes severe human infections clinically featuring with varied diseases/syndromes (such as meningitis, septicemia, and arthritis). Over the past few decades, continued efforts have made significant progress toward better understanding this zoonotic infectious entity, contributing in part to the elucidation of the molecular mechanism underlying its high pathogenicity. This review is aimed at presenting an updated overview of this pathogen from the perspective of molecular epidemiology, clinical diagnosis and typing, virulence mechanism, and protective antigens contributing to its zoonosis. PMID:24667807

  20. Aspirin-triggered resolvin D1 reduces pneumococcal lung infection and inflammation in a viral and bacterial coinfection pneumonia model.

    Science.gov (United States)

    Wang, Hao; Anthony, Desiree; Yatmaz, Selcuk; Wijburg, Odilia; Satzke, Catherine; Levy, Bruce; Vlahos, Ross; Bozinovski, Steven

    2017-09-15

    Formyl peptide receptor 2/lipoxin A 4 (LXA 4 ) receptor (Fpr2/ALX) co-ordinates the transition from inflammation to resolution during acute infection by binding to distinct ligands including serum amyloid A (SAA) and Resolvin D1 (RvD1). Here, we evaluated the proresolving actions of aspirin-triggered RvD1 (AT-RvD1) in an acute coinfection pneumonia model. Coinfection with Streptococcus pneumoniae and influenza A virus (IAV) markedly increased pneumococcal lung load and neutrophilic inflammation during the resolution phase. Fpr2/ALX transcript levels were increased in the lungs of coinfected mice, and immunohistochemistry identified prominent Fpr2/ALX immunoreactivity in bronchial epithelial cells and macrophages. Levels of circulating and lung SAA were also highly increased in coinfected mice. Therapeutic treatment with exogenous AT-RvD1 during the acute phase of infection (day 4-6 post-pneumococcal inoculation) significantly reduced the pneumococcal load. AT-RvD1 also significantly reduced neutrophil elastase (NE) activity and restored total antimicrobial activity in bronchoalveolar lavage (BAL) fluid (BALF) of coinfected mice. Pneumonia severity, as measured by quantitating parenchymal inflammation or alveolitis was significantly reduced with AT-RvD1 treatment, which also reduced the number of infiltrating lung neutrophils and monocytes/macrophages as assessed by flow cytometry. The reduction in distal lung inflammation in AT-RvD1-treated mice was not associated with a significant reduction in inflammatory and chemokine mediators. In summary, we demonstrate that in the coinfection setting, SAA levels were persistently increased and exogenous AT-RvD1 facilitated more rapid clearance of pneumococci in the lungs, while concurrently reducing the severity of pneumonia by limiting excessive leukocyte chemotaxis from the infected bronchioles to distal areas of the lungs. © 2017 The Author(s).

  1. Residence of Streptococcus pneumoniae and Moraxella catarrhalis within polymicrobial biofilm promotes antibiotic resistance and bacterial persistence in vivo.

    Science.gov (United States)

    Perez, Antonia C; Pang, Bing; King, Lauren B; Tan, Li; Murrah, Kyle A; Reimche, Jennifer L; Wren, John T; Richardson, Stephen H; Ghandi, Uma; Swords, W Edward

    2014-04-01

    Otitis media (OM) is an extremely common pediatric ailment caused by opportunists that reside within the nasopharynx. Inflammation within the upper airway can promote ascension of these opportunists into the middle ear chamber. OM can be chronic/recurrent in nature, and a wealth of data indicates that in these cases, the bacteria persist within biofilms. Epidemiological data demonstrate that most cases of OM are polymicrobial, which may have significant impact on antibiotic resistance. In this study, we used in vitro biofilm assays and rodent infection models to examine the impact of polymicrobial infection with Moraxella catarrhalis and Streptococcus pneumoniae (pneumococcus) on biofilm resistance to antibiotic treatment and persistence in vivo. Consistent with prior work, M. catarrhalis conferred beta-lactamase-dependent passive protection from beta-lactam killing to pneumococci within polymicrobial biofilms. Moreover, pneumococci increased resistance of M. catarrhalis to macrolide killing in polymicrobial biofilms. However, pneumococci increased colonization in vivo by M. catarrhalis in a quorum signal-dependent manner. We also found that co-infection with M. catarrhalis affects middle ear ascension of pneumococci in both mice and chinchillas. Therefore, we conclude that residence of M. catarrhalis and pneumococci within the same biofilm community significantly impacts resistance to antibiotic treatment and bacterial persistence in vivo. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  2. Streptococcus suis, an emerging drug-resistant animal and human pathogen

    Directory of Open Access Journals (Sweden)

    Claudio ePalmieri

    2011-11-01

    Full Text Available Streptococcus suis, a major porcine pathogen, has been receiving growing attention not only for its role in severe and increasingly reported infections in humans, but also for its involvement in drug resistance. Recent studies and the analysis of sequenced genomes have been providing important insights into the S. suis resistome, and have resulted in the identification of resistance determinants for tetracyclines, macrolides, aminoglycosides, chloramphenicol, antifolate drugs, streptothricin, and cadmium salts. Resistance gene-carrying genetic elements described so far include integrative and conjugative elements, transposons, genomic islands, phages, and chimeric elements. Some of these elements are similar to those reported in major streptococcal pathogens such as Streptococcus pyogenes, Streptococcus pneumoniae, and Streptococcus agalactiae and share the same chromosomal insertion sites. The available information strongly suggests that S. suis is an important antibiotic resistance reservoir that can contribute to the spread of resistance genes to the above-mentioned streptococci. S. suis is thus a paradigmatic example of possible intersections between animal and human resistomes.

  3. Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mafalda X Henriques

    Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

  4. Nasopharyngeal colonization and invasive disease are enhanced by the cell wall hydrolases LytB and LytC of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Elisa Ramos-Sevillano

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a common colonizer of the human nasopharynx and one of the major pathogens causing invasive disease worldwide. Dissection of the molecular pathways responsible for colonization, invasion, and evasion of the immune system will provide new targets for antimicrobial or vaccine therapies for this common pathogen. METHODOLOGY/PRINCIPAL FINDINGS: We have constructed mutants lacking the pneumococcal cell wall hydrolases (CWHs LytB and LytC to investigate the role of these proteins in different phases of the pneumococcal pathogenesis. Our results show that LytB and LytC are involved in the attachment of S. pneumoniae to human nasopharyngeal cells both in vitro and in vivo. The interaction of both proteins with phagocytic cells demonstrated that LytB and LytC act in concert avoiding pneumococcal phagocytosis mediated by neutrophils and alveolar macrophages. Furthermore, C3b deposition was increased on the lytC mutant confirming that LytC is involved in complement evasion. As a result, the lytC mutant showed a reduced ability to successfully cause pneumococcal pneumonia and sepsis. Bacterial mutants lacking both LytB and LytC showed a dramatically impaired attachment to nasopharyngeal cells as well as a marked degree of attenuation in a mouse model of colonization. In addition, C3b deposition and phagocytosis was more efficient for the double lytB lytC mutant and its virulence was greatly impaired in both systemic and pulmonary models of infection. CONCLUSIONS/SIGNIFICANCE: This study confirms that the CWHs LytB and LytC of S. pneumoniae are essential virulence factors involved in the colonization of the nasopharynx and in the progress of invasive disease by avoiding host immunity.

  5. In silico assessment of virulence factors in strains of Streptococcus oralis and Streptococcus mitis isolated from patients with Infective Endocarditis

    DEFF Research Database (Denmark)

    Rasmussen, Louise H.; Iversen, Katrine Højholt; Dargis, Rimtas

    2017-01-01

    Streptococcus oralis and Streptococcus mitis belong to the Mitis group, which are mostly commensals in the human oral cavity. Even though S. oralis and S. mitis are oral commensals, they can be opportunistic pathogens causing infective endocarditis. A recent taxonomic re-evaluation of the Mitis...

  6. Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

    DEFF Research Database (Denmark)

    Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.

    2013-01-01

    Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

  7. Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Kathleen E Stevens

    2011-08-01

    Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

  8. High Levels of Genetic Recombination during Nasopharyngeal Carriage and Biofilm Formation in Streptococcus pneumoniae

    Science.gov (United States)

    Marks, Laura R.; Reddinger, Ryan M.; Hakansson, Anders P.

    2012-01-01

    ABSTRACT Transformation of genetic material between bacteria was first observed in the 1920s using Streptococcus pneumoniae as a model organism. Since then, the mechanism of competence induction and transformation has been well characterized, mainly using planktonic bacteria or septic infection models. However, epidemiological evidence suggests that genetic exchange occurs primarily during pneumococcal nasopharyngeal carriage, which we have recently shown is associated with biofilm growth, and is associated with cocolonization with multiple strains. However, no studies to date have comprehensively investigated genetic exchange during cocolonization in vitro and in vivo or the role of the nasopharyngeal environment in these processes. In this study, we show that genetic exchange during dual-strain carriage in vivo is extremely efficient (10−2) and approximately 10,000,000-fold higher than that measured during septic infection (10−9). This high transformation efficiency was associated with environmental conditions exclusive to the nasopharynx, including the lower temperature of the nasopharynx (32 to 34°C), limited nutrient availability, and interactions with epithelial cells, which were modeled in a novel biofilm model in vitro that showed similarly high transformation efficiencies. The nasopharyngeal environmental factors, combined, were critical for biofilm formation and induced constitutive upregulation of competence genes and downregulation of capsule that promoted transformation. In addition, we show that dual-strain carriage in vivo and biofilms formed in vitro can be transformed during colonization to increase their pneumococcal fitness and also, importantly, that bacteria with lower colonization ability can be protected by strains with higher colonization efficiency, a process unrelated to genetic exchange. PMID:23015736

  9. Digital gene expression analysis in mice lung with coinfection of influenza and streptococcus pneumoniae.

    Science.gov (United States)

    Luo, Jun; Zhou, Linlin; Wang, Hongren; Qin, Zhen; Xiang, Li; Zhu, Jie; Huang, Xiaojun; Yang, Yuan; Li, Wanyi; Wang, Baoning; Li, Mingyuan

    2017-12-22

    Influenza A virus (IAV) and Streptococcus pneumoniae (SP) are two major upper respiratory tract pathogens that can also cause infection in polarized bronchial epithelial cells to exacerbate disease in coinfected individuals which may result in significant morbidity. However, the underlying molecular mechanism is poorly understood. Here, we employed BALB/c ByJ mice inflected with SP, IAV, IAV followed by SP (IAV+SP) and PBS (Control) as models to survey the global gene expression using digital gene expression (DGE) profiling. We attempt to gain insights into the underlying genetic basis of this synergy at the expression level. Gene expression profiles were obtain using the Illimina/Hisseq sequencing technique, and further analyzed by enrichment analysis of Gene Ontology (GO) and Pathway function. The hematoxylin-eosin (HE) staining revealed different tissue changes in groups during which IAV+SP group showed the most severe cell apoptosis. Compared with Control, a total of 2731, 3221 and 3946 differentially expressed genes (DEGs) were detected in SP, IAV and IAV+SP respectively. Besides, sixty-two GO terms were identified by Gene Ontology functional enrichment analysis, such as cell killing, biological regulation, response to stimulus, signaling, biological adhesion, enzyme regulator activity, receptor regulator activity and translation regulator activity. Pathway significant enrichment analysis indicated the dysregulation of multiple pathways, including apoptosis pathway. Among these, five selected genes were further verified by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). This study shows that infection with SP, IAV or IAV+SP induces apoptosis with different degrees which might provide insights into the molecular mechanisms to facilitate further research.

  10. Endolymphatic sac involvement in bacterial meningitis

    DEFF Research Database (Denmark)

    Møller, Martin Nue; Brandt, Christian; Østergaard, Christian

    2015-01-01

    The commonest sequelae of bacterial meningitis are related to the inner ear. Little is known about the inner ear immune defense. Evidence suggests that the endolymphatic sac provides some protection against infection. A potential involvement of the endolymphatic sac in bacterial meningitis...... is largely unaccounted for, and thus the object of the present study. A well-established adult rat model of Streptococcus pneumoniae meningitis was employed. Thirty adult rats were inoculated intrathecally with Streptococcus pneumoniae and received no additional treatment. Six rats were sham...... days. Bacteria invaded the inner ear through the cochlear aquaduct. On days 5-6, the bacteria invaded the endolymphatic sac through the endolymphatic duct subsequent to invasion of the vestibular endolymphatic compartment. No evidence of direct bacterial invasion of the sac through the meninges...

  11. Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

    Directory of Open Access Journals (Sweden)

    S F Swedan

    2016-01-01

    Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

  12. Association between salivary level of infection with Streptococcus mutans/Lactobacilli and caries-risk factors in mothers.

    Science.gov (United States)

    Latifi-Xhemajli, B; Véronneau, J; Begzati, A; Bytyci, A; Kutllovci, T; Rexhepi, A

    2016-03-01

    Understanding factors in mothers associated with high and low salivary levels of Streptococcus mutans and Lactobacilli is an important strategy for early childhood caries prevention. Aim of the study was to identify the association between salivary levels of Streptococcus mutans/Lactobacillus and potential caries risk factors in mothers. Cross-sectional design used a voluntary sample of 300 mothers of young children. Close-ended questions and observations were used to identify mothers' potential caries risk factors. The presence of Streptococcus mutans and Lactobacilli was determined using the CRT bacteria test (Ivoclar Vivadent). All collected information was converted into frequency and proportion describing the prevalence factor in correlation with Streptococcus mutans and Lactobacilli cariogenic bacteria levels of infection. Results Sample participants showed a high caries risk based on socioeconomic, behavioural and clinical factors. also showed high levels (>105) of Streptococcus mutans and Lactobacilli infections among 28% of mothers. Three factors were significantly associated with Streptococcus mutans infection: level of education, past caries experiences, and observable dental plaque, whereas, a fourth factor, frequency of daily tooth brushing, was associated to Lactobacilli infection. This study showed that easily collectible informations such as maternal level of education, frequency of daily tooth brushing and past clinical factors tend to be associated with high level of Streptococcus mutans and Lactobacilli infections in caregivers.

  13. Lung abscess in a child secondary to Mycoplasma pneumoniae infection.

    Science.gov (United States)

    Ruffini, E; De Petris, L; Candelotti, P; Tulli, M; Sabatini, M R; Luciani, L; Carlucci, A

    2014-01-01

    We present a case of a lung abscess in a child 6-year-old admitted with a history of right hemithorax pain lasting for 15 days and the onset of mild fever in the last two days. Etiological research showed positivity of IgM antibodies to Mycoplasma pneumoniae after seven days of admission. The child has been successfully treated with antibiotic therapy, without the use of macrolides, for a duration of 4 weeks. Our study suggests that the Mycoplasma pneumoniae infection may predispose to severe infections, such as lung abscess, caused by typical respiratory pathogens. The reported case of lung abscess is one of the few reported in the literature in the modern antibiotic era and is the first preceded by Mycoplasma pneumoniae infection.

  14. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    Directory of Open Access Journals (Sweden)

    Laura ePaixão

    2015-10-01

    Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  15. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism.

    Science.gov (United States)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

    2015-01-01

    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

  16. Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae.

    Science.gov (United States)

    Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P

    2009-10-01

    Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

  17. Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae.

    OpenAIRE

    Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G

    1990-01-01

    Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

  18. Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.

    OpenAIRE

    Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G

    1993-01-01

    Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

  19. Detecting Mycoplasma pneumoniae infections in nasopharyngeal ...

    African Journals Online (AJOL)

    Muhi Kadhem Wannas Al-Janabi

    2017-08-19

    Aug 19, 2017 ... M. pneumonia in a respective bulk among pediatric patients with ... adults [3]. It is also a major cause of community acquired pneumo- nia affecting ..... various ways, where an infection with this organism may precede the onset ...

  20. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  1. Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

    NARCIS (Netherlands)

    Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M

    2016-01-01

    After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.

  2. Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children.

    Science.gov (United States)

    Chochua, Sopio; D'Acremont, Valérie; Hanke, Christiane; Alfa, David; Shak, Joshua; Kilowoko, Mary; Kyungu, Esther; Kaiser, Laurent; Genton, Blaise; Klugman, Keith P; Vidal, Jorge E

    2016-01-01

    We assessed nasopharyngeal (NP) carriage of five pathogens in febrile children with and without acute respiratory infection (ARI) of the upper (URTI) or lower tract, attending health facilities in Tanzania. NP swabs collected from children (N = 960) aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp), H. influenzae (Hi), M. catarrhalis (Mc), S. aureus (Sa), and N. meningitidis (Nm). We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR) and endpoint pneumonia. Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014). Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03), or clinical pneumonia (p<0.001) than non-ARI, and in children with clinical pneumonia (p = 0.0007) than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases. Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

  3. Increased Nasopharyngeal Density and Concurrent Carriage of Streptococcus pneumoniae, Haemophilus influenzae, and Moraxella catarrhalis Are Associated with Pneumonia in Febrile Children.

    Directory of Open Access Journals (Sweden)

    Sopio Chochua

    Full Text Available We assessed nasopharyngeal (NP carriage of five pathogens in febrile children with and without acute respiratory infection (ARI of the upper (URTI or lower tract, attending health facilities in Tanzania.NP swabs collected from children (N = 960 aged 2 months to 10 years, and with a temperature ≥38°C, were utilized to quantify bacterial density of S. pneumoniae (Sp, H. influenzae (Hi, M. catarrhalis (Mc, S. aureus (Sa, and N. meningitidis (Nm. We determined associations between presence of individual species, densities, or concurrent carriage of all species combination with respiratory diseases including clinical pneumonia, pneumonia with normal chest radiography (CXR and endpoint pneumonia.Individual carriage, and NP density, of Sp, Hi, or Mc, but not Sa, or Nm, was significantly associated with febrile ARI and clinical pneumonia when compared to febrile non-ARI episodes. Density was also significantly increased in severe pneumonia when compared to mild URTI (Sp, p<0.002; Hi p<0.001; Mc, p = 0.014. Accordingly, concurrent carriage of Sp+, Hi+, and Mc+, in the absence of Sa- and Nm-, was significantly more prevalent in children with ARI (p = 0.03, or clinical pneumonia (p<0.001 than non-ARI, and in children with clinical pneumonia (p = 0.0007 than URTI. Furthermore, Sp+, Hi+, and Mc+ differentiated children with pneumonia with normal CXR, or endpoint pneumonia, from those with URTI, and non-ARI cases.Concurrent NP carriage of Sp, Hi, and Mc was a predictor of clinical pneumonia and identified children with pneumonia with normal CXR and endpoint pneumonia from those with febrile URTI, or non-ARI episodes.

  4. Streptococcus uberis and Staphylococcus aureus forefoot and blood stream co-infection in a haemodialysis patient: a case report.

    Science.gov (United States)

    Valentiny, Christine; Dirschmid, Harald; Lhotta, Karl

    2015-05-28

    Streptococcus uberis, the most frequent cause of mastitis in lactating cows, is considered non-pathogenic for humans. Only a few case reports have described human infections with this microorganism, which is notoriously difficult to identify. We report the case of a 75-year-old male haemodialysis patient, who developed a severe foot infection with osteomyelitis and bacteraemia. Both Streptococcus uberis and Staphylococcus aureus were identified in wound secretion and blood samples using mass spectrometry. The presence of Streptococcus uberis was confirmed by superoxide dismutase A sequencing. The patient recovered after amputation of the forefoot and antibiotic treatment with ampicillin/sulbactam. He had probably acquired the infection while walking barefoot on cattle pasture land. This is the first case report of a human infection with Streptococcus uberis with identification of the microorganism using modern molecular technology. We propose that Staphylococcus aureus co-infection was a prerequisite for deep wound and bloodstream infection with Streptococcus uberis.

  5. Xylitol-supplemented nutrition enhances bacterial killing and prolongs survival of rats in experimental pneumococcal sepsis

    Science.gov (United States)

    Renko, Marjo; Valkonen, Päivi; Tapiainen, Terhi; Kontiokari, Tero; Mattila, Pauli; Knuuttila, Matti; Svanberg, Martti; Leinonen, Maija; Karttunen, Riitta; Uhari, Matti

    2008-01-01

    Background Xylitol has antiadhesive effects on Streptococcus pneumoniae and inhibits its growth, and has also been found to be effective in preventing acute otitis media and has been used in intensive care as a valuable source of energy. Results We evaluated the oxidative burst of neutrophils in rats fed with and without xylitol. The mean increase in the percentage of activated neutrophils from the baseline was higher in the xylitol-exposed group than in the control group (58.1% vs 51.4%, P = 0.03 for the difference) and the mean induced increase in the median strength of the burst per neutrophil was similarly higher in the xylitol group (159.6 vs 140.3, P = 0.04). In two pneumococcal sepsis experiments rats were fed either a basal powder diet (control group) or the same diet supplemented with 10% or 20% xylitol and infected with an intraperitoneal inoculation of S. pneumoniae after two weeks. The mean survival time was 48 hours in the xylitol groups and 34 hours in the control groups (P Xylitol has beneficial effects on both the oxidative killing of bacteria in neutrophilic leucocytes and on the survival of rats with experimental pneumococcal sepsis. PMID:18334022

  6. Infecciones por Streptococcus agalactiae en un servicio de neonatología abierto Infections due to Streptococcus agalactiae at an open neonatology service

    Directory of Open Access Journals (Sweden)

    Manuel Díaz Álvarez

    2008-12-01

    Full Text Available INTRODUCCIÓN. El objetivo del presente estudio fue conocer las características clínicas y epidemiológicas de las infecciones por estreptococo del grupo B en recién nacidos egresados de los hospitales maternos. MÉTODOS. Se realizó un estudio descriptivo, que incluyó a recién nacidos consecutivos con infecciones por Streptococcus agalactiae, ingresados en el Servicio de Neonatología del Hospital Pediátrico Universitario «Juan M. Márquez» entre febrero de 1992 y diciembre del 2007. Se procesaron y analizaron distintas variables clínicas y epidemiológicas, con cálculo de tasas de incidencia y letalidad, así como relación entre variables categóricas. RESULTADOS. Hubo 76 recién nacidos con infección por Streptococcus agalactiae, lo cual constituyó una tasa promedio anual de 1,9 x 100 ingresos. Predominaron las infecciones de inicio tardío y las adquiridas en la comunidad (89,5 % y 93,4 %, respectivamente. La meningitis fue la forma clínica más frecuente, seguida de la bacteriemia aislada. Hubo 56 de 76 recién nacidos con bacteriemia (73,7 %. El Streptococcus agalactiae tuvo elevada sensibilidad ante la penicilina, la eritromicina, la vancomicina, la cefotaxima y el cloranfenicol. Hubo 7 fallecidos (9,2 % y todos fueron pacientes con infección del sistema nervioso central. CONCLUSIONES. Streptococcus agalactiae es un agente causal de infecciones que afectan al recién nacido, tanto en la comunidad como en el medio hospitalario. Estas infecciones pueden ser letales en algunos pacientes con infección del sistema nervioso central con bacteriemia o sin ella, aún manteniendo un patrón de elevada susceptibilidad a los antibióticos betalactámicos.INTRODUCCIÓN. The objective of the present study was to know the clinical and epidemiological characteristics of the infections caused by group B Streptococcus in newborns discharged from maternal hospitals. METHODS. A descriptive study that included consecutive infants with

  7. Molecular characterization of the presence of Eubacterium spp and Streptococcus spp in endodontic infections.

    Science.gov (United States)

    Fouad, A F; Kum, K-Y; Clawson, M L; Barry, J; Abenoja, C; Zhu, Q; Caimano, M; Radolf, J D

    2003-08-01

    Eubacterium spp. and Streptococcus spp. are virulent, commonly identified microorganisms in endodontic infections. The purpose of this study was to use molecular methods to identify these organisms in 22 infected root canals that include eight cases with preoperative clinical symptoms and five cases with a history of diabetes mellitus. The presence of Streptococcus spp. and Eubacterium spp. was examined using two sets of PCR primers specific with multiple species within the respective genera. Positive specimens had their PCR products sequenced and phylogenetically analyzed to identify the specific species. Sixteen specimens (73%) contained Eubacterium spp. and nine (41%) were positive for Streptococcus spp. Eubacterium infirmum was the most prevalent Eubacterium sp. This organism was significantly associated with a history of diabetes (OR = 9.6; P = 0.04). Streptococcus anginosus was the most common Streptococcus sp., but neither it nor any of the other streptococci were significantly associated with the clinical parameters evaluated.

  8. Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone.

    Science.gov (United States)

    Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town

    2015-07-21

    The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

  9. CNS autoimmune disease after Streptococcus pyogenes infections: animal models, cellular mechanisms and genetic factors

    Science.gov (United States)

    Cutforth, Tyler; DeMille, Mellissa MC; Agalliu, Ilir; Agalliu, Dritan

    2016-01-01

    Streptococcus pyogenes infections have been associated with two autoimmune diseases of the CNS: Sydenham’s chorea (SC) and Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcus infections (PANDAS). Despite the high frequency of pharyngeal streptococcus infections among children, only a small fraction develops SC or PANDAS. This suggests that several factors in combination are necessary to trigger autoimmune complications: specific S. pyogenes strains that induce a strong immune response toward the host nervous system; genetic susceptibility that predispose children toward an autoimmune response involving movement or tic symptoms; and multiple infections of the throat or tonsils that lead to a robust Th17 cellular and humoral immune response when untreated. In this review, we summarize the evidence for each factor and propose that all must be met for the requisite neurovascular pathology and behavioral deficits found in SC/PANDAS. PMID:27110222

  10. Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

    Science.gov (United States)

    Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

    2017-08-14

    The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  11. Magnetic resonance imaging of lung infections in children

    Energy Technology Data Exchange (ETDEWEB)

    Peltola, Ville; Ruuskanen, Olli [Turku University Hospital, Department of Paediatrics, Turku (Finland); Svedstroem, Erkki [Turku University Hospital, Department of Radiology, Turku (Finland)

    2008-11-15

    The advantages and limitations of MRI in lung infections in children have not been well established. This article illustrates the MRI findings in children with pneumonia caused by Mycoplasma pneumoniae, Streptococcus pneumoniae, and other pathogens. Lung parenchymal, pleural, and lymph node abnormalities are well characterized by MRI. Loculation of pleural fluid is detected in children with empyema. Contrast enhancement may be useful in the differentiation of active inflammation from noninflammatory changes. MRI can be particularly useful in the follow-up of children with chronic pulmonary diseases. (orig.)

  12. Understanding Pneumonia

    Science.gov (United States)

    ... and Diseases > Lung Disease Lookup > Pneumonia Learn About Pneumonia Pneumonia is a common lung infection caused by ... vaccinated and practicing good health habits What Is Pneumonia? Pneumonia is an infection in one or both ...

  13. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Lisa Sanguinetti

    Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  14. Comparison of transmission dynamics between Streptococcus uberis and Streptococcus agalactiae intramammary infections.

    Science.gov (United States)

    Leelahapongsathon, Kansuda; Schukken, Ynte Hein; Pinyopummintr, Tanu; Suriyasathaporn, Witaya

    2016-02-01

    The objectives of study were to determine the transmission parameters (β), durations of infection, and basic reproductive numbers (R0) of both Streptococcus agalactiae and Streptococcus uberis as pathogens causing mastitis outbreaks in dairy herds. A 10-mo longitudinal study was performed using 2 smallholder dairy herds with mastitis outbreaks caused by Strep. agalactiae and Strep. uberis, respectively. Both herds had poor mastitis control management and did not change their milking management during the entire study period. Quarter milk samples were collected at monthly intervals from all lactating animals in each herd for bacteriological identification. The durations of infection for Strep. uberis intramammary infection (IMI) and Strep. agalactiae IMI were examined using Kaplan-Meier survival curves, and the Kaplan-Meier survival functions for Strep. uberis IMI and Strep. agalactiae IMI were compared using log rank survival-test. The spread of Strep. uberis and Strep. agalactiae through the population was determined by transmission parameter, β, the probability per unit of time that one infectious quarter will infect another quarter, assuming that all other quarters are susceptible. For the Strep. uberis outbreak herd (31 cows), 56 new infections and 28 quarters with spontaneous cure were observed. For the Strep. agalactiae outbreak herd (19 cows), 26 new infections and 9 quarters with spontaneous cure were observed. The duration of infection for Strep. agalactiae (mean=270.84 d) was significantly longer than the duration of infection for Strep. uberis (mean=187.88 d). The transmission parameters (β) estimated (including 95% confidence interval) for Strep. uberis IMI and Strep. agalactiae IMI were 0.0155 (0.0035-0.0693) and 0.0068 (0.0008-0.0606), respectively. The R0 (including 95% confidence interval) during the study were 2.91 (0.63-13.47) and 1.86 (0.21-16.61) for Strep. uberis IMI and Strep. agalactiae IMI, respectively. In conclusion, the transmission

  15. Etiology of community-acquired pneumonia in hospitalized patients in Jordan

    International Nuclear Information System (INIS)

    Al-Ali, Musa K.; Batchoun, R. G.; Al-Nour, Tariq M.

    2006-01-01

    To ascertain the causative organisms of community acquired pneumonia (Cap) in Jordanian patients requiring hospital admission. A prospective study of both adults and children admitted to Princess Basma and Princess Rahma Teaching Hospitals in Irbid, Jordan with a diagnosis of CAP over a 6-month period from April to October 2002. A total of 35 adult patients were admitted with a mean age of 47 years, and 63 children with a mean age of 3 years. A pathogen was isolated from 25 (71%) adults, and from 17 (27%) children, and sputum cultures gave the best diagnostic yield. In adults Streptococcus pneumoniae was the most common isolate (26%), followed by Chlamydia pneumoniae (23%), Haemophilus influenzae (17%), Mycoplasma pneumoniae (9%), and Legionella pneumophila and Klebsiella pneumoniae (6%) each. Seven of the 9 gram negative isolates were from patients with some co morbid illness. While in children, Chlamydia pneumoniae was the most common (14%), followed by Mycoplasma pneumoniae (6%), and Streptococcus pneumoniae, Haemophilus influenzae, and Pseudomonas aeruginosa (3%) each. Streptococcus pneumoniae and atypical microorganisms are the most common cause of CAP in previously healthy adults; while in those with associated co morbid illness, gram negative organisms are the likely cause. In children, the overall detection rate of causative organisms was low with atypical microorganisms being the most common. (author)

  16. Carbapenem-resistant Klebsiella pneumoniae colonization in pediatric and neonatal intensive care units: risk factors for progression to infection.

    Science.gov (United States)

    Akturk, Hacer; Sutcu, Murat; Somer, Ayper; Aydın, Derya; Cihan, Rukiye; Ozdemir, Aslı; Coban, Asuman; Ince, Zeynep; Citak, Agop; Salman, Nuran

    2016-01-01

    Little is known about factors associated with carbapenem-resistant Klebsiella pneumoniae infections in pediatric patients, who are initally colonized with carbapenem-resistant Klebsiella pneumoniae. A retrospective case-control study was conducted involving pediatric and neonatal intensive care units throughout a five-year period (January 2010-December 2014). Clinical and microbiological data were extracted from Hospital Infection Control Committee reports and patients' medical records. Risk factors were assessed in carbapenem-resistant Klebsiella pneumoniae colonized patients who developed subsequent systemic infection (cases) and compared to carbapenem-resistant Klebsiella pneumoniae colonized patients who did not develop infection (controls). Throughout the study period, 2.6% of patients admitted to neonatal intensive care units and 3.6% of patients admitted to pediatric intensive care units had become colonized with carbapenem-resistant Klebsiella pneumoniae. After a mean of 10.6±1.9 days (median: 7 days, range: 2-38 days) following detection of colonization, 39.0% of the carbapenem-resistant Klebsiella pneumoniae colonized patients in pediatric intensive care units and 18.1% of carbapenem-resistant Klebsiella pneumoniae colonized patients in neonatal intensive care units developed systemic carbapenem-resistant Klebsiella pneumoniae infection. Types of systemic carbapenem-resistant Klebsiella pneumoniae infections included bacteremia (n=15, 62.5%), ventilator-associated pneumonia (n=4, 16.6%), ventriculitis (n=2, 8.3%), intraabdominal infections (n=2, 8.3%), and urinary tract infection (n=1, 4.1%). A logistic regression model including parameters found significant in univariate analysis of carbapenem resistant Klebsiella pneumoniae colonization and carbapenem resistant Klebsiella pneumoniae infection groups revealed underlying metabolic disease (OR: 10.1; 95% CI: 2.7-37.2), previous carbapenem use (OR: 10.1; 95% CI: 2.2-40.1), neutropenia (OR: 13.8; 95% CI: 3

  17. Chronic Chlamydia pneumoniae infection and bronchial asthma: Is there a link?

    Directory of Open Access Journals (Sweden)

    Agarwal A

    2008-01-01

    Full Text Available Purpose: Besides well-defined environmental causes, accumulating evidence suggests that respiratory tract infections play an important role in the pathogenesis of asthma. Among these Chlamydia pneumoniae infection has been discussed as possibly inducing the development of asthma. Methods: This study was designed to investigate the presence of anti chlamydial IgG, IgA, and IgM antibodies by ELISA in serum samples of 60 adults with a clinical history of asthma and 100 healthy age and sex matched controls. All the samples positive for Chlamydial genus specific IgG antibodies were then subjected to Chlamydia pneumoniae species specific IgG antibody ELISA. Results: The IgG anti chlamydial antibody-positivity rate in the patients with bronchial asthma (80% was significantly higher in all age groups than that in the healthy age and sex matched controls (59%. No significant association was observed for IgA and IgM anti chlamydial antibodies. C. pneumoniae species specific IgG antibody seroprevalence was also found to be significantly higher in all age groups in comparison to controls (61.66% vs 38%. Conclusions: Serological evidence of chronic infection with C. pneumoniae was more frequent in patients with asthma compared with control subjects. Our results support the correlation of bronchial asthma and chronic infection with C. pneumoniae in Indian population.

  18. Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study.

    Science.gov (United States)

    Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru

    2013-07-01

    The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

  19. Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Richard A Adegbola

    Full Text Available Infection with Streptococcus pneumoniae is a major cause of childhood morbidity and mortality worldwide, especially in low income countries where pneumococcal conjugate vaccines (PCVs are still underused. In countries where PCVs have been introduced, much of their efficacy has resulted from their impact on nasopharyngeal carriage in vaccinated children. Understanding the epidemiology of carriage for S. pneumoniae and other common respiratory bacteria in developing countries is crucial for implementing appropriate vaccination strategies and evaluating their impact.We have systematically reviewed published studies reporting nasopharyngeal or oropharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, and Neisseria meningitidis in children and adults in low and lower-middle income countries. Studies reporting pneumococcal carriage for healthy children <5 years of age were selected for a meta-analysis. The prevalences of carriage for S. pneumoniae, H. influenzae, and M. catarrhalis were generally higher in low income than in lower-middle income countries and were higher in young children than in adults. The prevalence of S. aureus was high in neonates. Meta-analysis of data from young children before the introduction of PCVs showed a pooled prevalence estimate of 64.8% (95% confidence interval, 49.8%-76.1% in low income countries and 47.8% (95% confidence interval, 44.7%-50.8% in lower-middle income countries. The most frequent serotypes were 6A, 6B, 19A, 19F, and 23F.In low and lower-middle income countries, pneumococcal carriage is frequent, especially in children, and the spectrum of serotypes is wide. However, because data are limited, additional studies are needed to adequately assess the impact of PCV introduction on carriage of respiratory bacteria in these countries.

  20. Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

    Directory of Open Access Journals (Sweden)

    Eric S Donkor

    Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

  1. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  2. Evaluation of anti-pneumococcal capsular antibodies as adjunctive therapy in experimental pneumococcal meningitis

    DEFF Research Database (Denmark)

    Brandt, Christian; Frimodt-Moller, N; Lundgren, Jens Dilling

    2006-01-01

    OBJECTIVE: Bacteraemia concomitant with meningitis has been shown to greatly affect outcome. Consequently, the efficacy of serotype-specific anti-pneumococcal antiserum (APAS) was investigated in a rat model of pneumococcal meningitis. METHODS: Rats were infected with Streptococcus pneumoniae...... serotype 3. All rats received ceftriaxone starting 26 h post-infection. APAS was administered either at the time of infection or 26 h post-infection and effects were compared with rats treated with antibiotics only. RESULTS AND CONCLUSION: A significant clinical benefit was found when APAS was given...... at the time of infection whereas no effect was found when administered 26 h after infection. This work indicates that the clinical value of using APAS in pneumococcal meningitis may be limited...

  3. Polarity of recombination in transformation of Streptococcus pneumoniae.

    Science.gov (United States)

    Pasta, F; Sicard, M A

    1999-03-16

    In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

  4. FEATURES OF PNEUMONIA IN HIV-INFECTED PATIENTS

    Directory of Open Access Journals (Sweden)

    M. T. Vatutin

    2016-01-01

    Full Text Available The article presents the clinical, diagnostic and treatment features of pneumocystis pneumonia in HIV-infected patients. The clinical case of diagnosis verification in a patient 58 years old with severe respiratory failure is described.

  5. An Assay of RNA Synthesis in Hepatic Nuclei from Control and Streptococcus pneumoniae-Infected Rats

    Science.gov (United States)

    1982-02-22

    26) as modified by pended in 2.0 ml of 1.0 N KOH and incu- McNamara et al. (27). Nuclei (about 0.25 mg bated for 20 hr at 370 to hydrolyze RNA (28...containing hydrolyzed RNA was ml yeast RNA, 18 units pyruvate kinase, I counted in Scintisol. The pellet was solubi- mM cytidine triphosphate (CTP), I mM...WC. Lecithin biosynthesis in liver mi- 16. Blobel G, Potter VR. Nuclei from rat liver, isolation tochondrial fractions. Biochem Biophys Res Coin

  6. [The influence of Chlamydia pneumoniae infection on acute coronary syndromes].

    Science.gov (United States)

    Gajek, Jacek; Choroszy-Król, Irena; Zyśko, Dorota; Teryks-Wołyniec, Dorota; Halawa, Bogumił

    2003-07-01

    Chlamydia pneumoniae is one of the infectious factors the role of which is considered in the process of atherosclerosis and its complications. Of the study was to assess the incidence of Ch. pneumoniae infection in the patients with acute coronary events. The study was carried out in 36 patients, mean age 61.2 +/- 13.4 years, 27 men and 9 women hospitalised in our Department with the diagnosis of previous or recent acute myocardial infarction. The control group consisted of 19 subjects, aged 61.1 +/- 14.3 years, 10 men and 9 women hospitalised due to other reasons. In all studied patients during the first 24 hours venous blood was taken for the assessment of fibrinogen and C-reactive protein (CRP) concentrations and titres of IgA and IgG anti-Ch. pneumoniae antibodies, and pharyngeal swabs were done for Ch. pneumoniae assessment. Positive swab tests were found in 19% of the patients, positive IgG titres in 80% and IgA in 64% of the patients. In the control group the corresponding values were 11, 79, 42%, respectively. In the patients with positive IgG titres, negative IgA titre result was observed in 21% and in the control group in 53% (p < 0.05). The CRP level was significantly higher in the studied patients than in the control group (24.2 vs 4.2 mg/l; p < 0.05). 1. The high percentage of positive serologic tests and rare positive results of pharyngeal swabs indicate a frequent contact with Ch. pneumoniae in human population. 2. Ch. pneumoniae infection exerts no significant influence on the unspecific markers of inflammation. 3. The higher frequency of seroconversion-positive IgG and negative IgA titres--in the control group indicates the role of prolonged or acute Ch. pneumoniae infection in the development or progression of coronary atherosclerosis and its complications.

  7. The Association Between Chlamydia pneumoniae Infection and Ischemic Stroke

    Directory of Open Access Journals (Sweden)

    Eini

    2014-10-01

    Full Text Available Background Chlamydia pneumoniae has been linked with increased risk of cardiovascular diseases; however, data on stroke and cerebrovascular accidents are sparse. Objectives The aim of this study was to determine the association between C. pneumoniae infection and ischemic stroke. Patients and Methods In a case-control study, 141 patients, admitted with ischemic stroke, were compared with gender and age-matched control subjects (n = 141. Using an enzyme-linked immunosorbent assay kit, the presence of C. pneumoniae IgG and IgA in the patients’ sera was determined. The data were analyzed by SPSS software (version 15 and were compared between the two groups using T-test and chi square test. Results The mean ages of the case and control groups were 68.97 ± 12.29 and 66.95 ± 6.68 years old, respectively. The difference between these two groups was not statistically significant (P = 0.102. The seroprevalence of C. pneumoniae-specific IgG were 78.7% in the patients with stroke and 52.5% in the control group. The difference between the two groups was statistically significant (P = 0.0001. The seroprevalence of C. pneumoniae-specific IgA were 41.1% in the stroke and 15.6% in the control group. The difference between the two groups was statistically significant (P = 0.0001. Conclusions The results supported the hypothesis that serological evidence of C. pneumoniae infection may be associated with an increased risk of ischemic stroke and cerebrovascular accident.

  8. Economic aspects of hospital treated pneumococcal pneumonia and the results of Pneumo 23 vaccine use in Serbia

    Directory of Open Access Journals (Sweden)

    Adžić Tatjana

    2008-01-01

    Full Text Available INTRODUCTION In Serbia, there is a significant number of persons suffering of pneumococcal pneumonia. Persons aged 65 years or older, immunocompromised patients, patients with co-morbidities, such as chronic obstructive lung disease and congestive heart failure, are at the highest risk for developing pneumococcal pneumonia. Most of the patients are treated empirically, although it is often overlooked that Streptococcus pneumoniae can be resistant to the used antibiotics. The treatment costs of such inpatients and outpatients are very high. In Serbia, immunization of persons at risk to develop the diseases caused by Streptococcus pneumoniae is carried out using pneumococcus polysaccharide vaccine according to clinical indications. The exact number of immunized persons and the total number of registered patients are still unknown, but it is certain of being unjustifiably low. OBJECTIVE The goal of the study was to investigate, during a one-year period, the number and basic characteristics of persons hospitably treated for pneumonia, the type of cause of the infection, applied antibiotic medications, duration and costs of hospital treatment at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade. METHOD We retrospectively analyzed the medical records of patients with pneumonia treated at the Institute for Lung Diseases and Tuberculosis of the Clinical Centre of Serbia in Belgrade during 2006. RESULTS During the observed one-year period, 290 patients underwent hospital treatment, of whom the cause of the infection was confirmed in 116 (40%. The average duration of hospitalization was 12 days, with treatment cost of 32,031.74 RSD (402.42 EUR per patient. The treatment cost per patient including general and intensive care was 18,290.01 RSD (229.78 EUR. The distribution cost of Pneumo 23 vaccine in Serbia, without purchase tax, was 746.90 RSD (9.38 EUR. CONCLUSION Pneumococcal pneumonia is a significant medical

  9. Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1997-04-01

    Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

  10. Antibacterial activity of Euphorbia hirta against Streptococcus ...

    African Journals Online (AJOL)

    This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.

  11. Streptococcus iniae and Streptococcus agalactiae

    Science.gov (United States)

    Streptococcus iniae and S. agalactiae are economically important Gram positive bacterial pathogens of cultured and wild fish with a worldwide distribution. Both bacteria are potential zoonotic pathogens and have been associated most often with infections in immunocompromised people. Streptococcus in...

  12. Virome and bacteriome characterization of children with pneumonia and asthma in Mexico City during winter seasons 2014 and 2015.

    Science.gov (United States)

    Romero-Espinoza, Jose A; Moreno-Valencia, Yazmin; Coronel-Tellez, Rodrigo H; Castillejos-Lopez, Manuel; Hernandez, Andres; Dominguez, Aaron; Miliar-Garcia, Angel; Barbachano-Guerrero, Arturo; Perez-Padilla, Rogelio; Alejandre-Garcia, Alejandro; Vazquez-Perez, Joel A

    2018-01-01

    Acute asthma exacerbations and pneumonia are important causes of morbidity and mortality in children and may coexist in the same children, although symptom overlap may lead to difficulties in diagnosis. Microbial and viral diversity and differential abundance of either may play an important role in infection susceptibility and the development of acute and chronic respiratory diseases. To describe the virome and bacteriome present in the upper respiratory tract of hospitalized children with a clinical diagnosis of asthma and pneumonia during an acute exacerbation and an acute respiratory illness ARI episode respectively. During the winter seasons of 2013-2014 and 2014-2015, 134 nasopharyngeal swabs samples of children pneumonia. The virome and bacteriome were characterized using Whole Genome Sequencing (WGS) and in-house bioinformatics analysis pipeline. The Asthma group was represented mainly by RV-C, BoV-1 and RSV-B and the pneumonia group by Bacteriophage EJ-1 and TTMV. TTV was found in both groups with a similar amount of reads. About bacterial composition Moraxella catarrhalis, Propionibacterium acnes and Acinetobacter were present in asthma and Veillonella parvula and Mycoplasma pneumoniae in pneumonia. Streptococcus pneumoniae and Haemophilus influenzae were mostly found with both asthma and pneumonia. Our results show a complex viral and bacterial composition in asthma and pneumonia groups with a strong association of RV-C presence in asthmatic children. We observed Streptococcus pneumoniae and Haemophilus influenzae concurrently in both groups.

  13. Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

    DEFF Research Database (Denmark)

    Møller, Kirsten; Harder, Eva; Wandall, Johan

    1999-01-01

    We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

  14. The impact of HIV infection on childhood pneumonia: comparison ...

    African Journals Online (AJOL)

    infected children. While the pattern of HIV-related pneumonia in African adults is well documented and is recognised as quite different from that which occurs among HIV-infected adults in high-income regions, less is known of the situation in ...

  15. Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

  16. Management of KPC-producing Klebsiella pneumoniae infections.

    Science.gov (United States)

    Bassetti, M; Giacobbe, D R; Giamarellou, H; Viscoli, C; Daikos, G L; Dimopoulos, G; De Rosa, F G; Giamarellos-Bourboulis, E J; Rossolini, G M; Righi, E; Karaiskos, I; Tumbarello, M; Nicolau, D P; Viale, P L; Poulakou, G

    2018-02-01

    Klebsiella pneumoniae carbapenemase (KPC)-producing K. pneumoniae (KPC-KP) has become one of the most important contemporary pathogens, especially in endemic areas. To provide practical suggestion for physicians dealing with the management of KPC-KP infections in critically ill patients, based on expert opinions. PubMed search for relevant publications related to the management of KPC-KP infections. A panel of experts developed a list of 12 questions to be addressed. In view of the current lack of high-level evidence, they were asked to provide answers on the bases of their knowledge and experience in the field. The panel identified several key aspects to be addressed when dealing with KPC-KP in critically ill patients (preventing colonization in the patient, preventing infection in the colonized patient and colonization of his or her contacts, reducing mortality in the infected patient by rapidly diagnosing the causative agent and promptly adopting the best therapeutic strategy) and provided related suggestions that were based on the available observational literature and the experience of panel members. Diagnostic technologies could speed up the diagnosis of KPC-KP infections. Combination treatment should be preferred to monotherapy in cases of severe infections. For non-critically ill patients without severe infections, results from randomized clinical trials are needed for ultimately weighing benefits and costs of using combinations rather than monotherapy. Multifaceted infection control interventions are needed to decrease the rates of colonization and cross-transmission of KPC-KP. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  17. Role of ceftazidime dose regimen on the selection of resistant Enterobacter cloacae in the intestinal flora of rats treated for an experimental pulmonary infection

    NARCIS (Netherlands)

    W.H.F. Goessens (Wil); J.W. Mouton (Johan); M.T. ten Kate (Marian); A.J. Bijl; A. Ott (Alewijn); I.A.J.M. Bakker-Woudenberg (Irma)

    2007-01-01

    textabstractObjectives: The effect of ceftazidime dosing increments and frequency of dosing on the selection of ceftazidime-resistant Enterobacter cloacae in the intestine was studied in rats, during treatment of a pulmonary infection caused by Klebsiella pneumoniae. Methods: Rats with pulmonary

  18. Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

    Directory of Open Access Journals (Sweden)

    K.L. Ravi Kumar

    2014-01-01

    Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

  19. Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

    Science.gov (United States)

    Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

    2001-01-01

    Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

  20. Experimental pneumococcal meningitis in mice: a model of intranasal infection

    NARCIS (Netherlands)

    Zwijnenburg, P. J.; van der Poll, T.; Florquin, S.; van Deventer, S. J.; Roord, J. J.; van Furth, A. M.

    2001-01-01

    Effective laboratory animal models of bacterial meningitis are needed to unravel the pathophysiology of this disease. Previous models have failed to simulate human meningitis by using a directly intracerebral route of infection. Hyaluronidase is a virulence factor of Streptococcus pneumoniae. In

  1. Intermingled Klebsiella pneumoniae Populations Between Retail Meats and Human Urinary Tract Infections

    OpenAIRE

    Davis, Gregg S.; Waits, Kara; Nordstrom, Lora; Weaver, Brett; Aziz, Maliha; Gauld, Lori; Grande, Heidi; Bigler, Rick; Horwinski, Joseph; Porter, Stephen; Stegger, Marc; Johnson, James R.; Liu, Cindy M.; Price, Lance B.

    2015-01-01

    Background. ?Klebsiella pneumoniae is a common colonizer of the gastrointestinal tract of humans, companion animals, and livestock. To better understand potential contributions of foodborne K. pneumoniae to human clinical infections, we compared K. pneumoniae isolates from retail meat products and human clinical specimens to assess their similarity based on antibiotic resistance, genetic relatedness, and virulence. Methods. ?Klebsiella pneumoniae was isolated from retail meats from Flagstaff ...

  2. Local Th17/IgA immunity correlate with protection against intranasal infection with Streptococcus pyogenes.

    Directory of Open Access Journals (Sweden)

    Rasmus Mortensen

    Full Text Available Streptococcus pyogenes (group A streptococcus, GAS is responsible for a wide array of infections. Respiratory transmission via droplets is the most common mode of transmission but it may also infect the host via other routes such as lesions in the skin. To advance the development of a future vaccine against GAS, it is therefore important to investigate how protective immunity is related to the route of vaccine administration. To explore this, we examined whether a parenterally administered anti-GAS vaccine could protect against an intranasal GAS infection or if this would require locally primed immunity. We foundd that a parenteral CAF01 adjuvanted GAS vaccine offered no protection against intranasal infection despite inducing strong systemic Th1/Th17/IgG immunity that efficiently protected against an intraperitoneal GAS infection. However, the same vaccine administered via the intranasal route was able to induce protection against repeated intranasal GAS infections in a murine challenge model. The lack of intranasal protection induced by the parenteral vaccine correlated with a reduced mucosal recall response at the site of infection. Taken together, our results demonstrate that locally primed immunity is important for the defense against intranasal infection with Streptococcus pyogenes.

  3. Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey

    Science.gov (United States)

    Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz

    2014-01-01

    Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

  4. Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Paterson, Neil G.; Riboldi-Tunnicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

    2006-01-01

    The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6 1 22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress

  5. Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo [Pharmaceutical Research Center, Meiji Seika Kaisha Ltd, 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567 (Japan)

    2008-04-01

    The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.

  6. Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo

    2008-01-01

    The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

  7. Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunnicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

    2006-07-01

    The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6{sub 1}22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress.

  8. Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

    Directory of Open Access Journals (Sweden)

    Ana Paula Gomes de Oliveira Magalhães

    2003-07-01

    Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

  9. Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae.

    Science.gov (United States)

    Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B

    2015-01-01

    Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

  10. Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.

    Science.gov (United States)

    Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak

    2014-08-01

    The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

  11. Prevotella intermedia induces severe bacteremic pneumococcal pneumonia in mice with upregulated platelet-activating factor receptor expression.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Nakamura, Shigeki; Harada, Tatsuhiko; Hasegawa, Hiroo; Izumikawa, Koichi; Ishimatsu, Yuji; Kakeya, Hiroshi; Nishimura, Masaharu; Kohno, Shigeru

    2014-02-01

    Streptococcus pneumoniae is the leading cause of respiratory infection worldwide. Although oral hygiene has been considered a risk factor for developing pneumonia, the relationship between oral bacteria and pneumococcal infection is unknown. In this study, we examined the synergic effects of Prevotella intermedia, a major periodontopathic bacterium, on pneumococcal pneumonia. The synergic effects of the supernatant of P. intermedia (PiSup) on pneumococcal pneumonia were investigated in mice, and the stimulation of pneumococcal adhesion to human alveolar (A549) cells by PiSup was assessed. The effects of PiSup on platelet-activating factor receptor (PAFR) transcript levels in vitro and in vivo were analyzed by quantitative real-time PCR, and the differences between the effects of pneumococcal infection induced by various periodontopathic bacterial species were verified in mice. Mice inoculated with S. pneumoniae plus PiSup exhibited a significantly lower survival rate, higher bacterial loads in the lungs, spleen, and blood, and higher inflammatory cytokine levels in the bronchoalveolar lavage fluid (macrophage inflammatory protein 2 and tumor necrosis factor alpha) than those infected without PiSup. In A549 cells, PiSup increased pneumococcal adhesion and PAFR transcript levels. PiSup also increased lung PAFR transcript levels in mice. Similar effects were not observed in the supernatants of Porphyromonas gingivalis or Fusobacterium nucleatum. Thus, P. intermedia has the potential to induce severe bacteremic pneumococcal pneumonia with enhanced pneumococcal adhesion to lower airway cells.

  12. Searching for Helicobacter pylori and Chlamydia pneumoniae in primary endodontic infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-04-01

    The purpose of this study was to search samples from primary endodontic infections for the presence of two common human bacterial pathogens - Helicobacter pylori and Chlamydia pneumoniae. Genomic DNA isolated from samples taken from 25 root canals of teeth with asymptomatic (chronic) apical periodontitis and 25 aspirates from acute apical abscess was initially amplified by the multiple displacement amplification approach and then used as template in species-specific polymerase chain reaction (PCR) for detection of H. pylori and C. pneumoniae. All clinical samples were positive for the presence of bacterial DNA. However, no clinical sample was positive for either H. pylori or C. pneumoniae. Neither H. pylori nor C. pneumoniae were found in samples from primary endodontic infections. These findings suggest that these species are not candidate endodontic pathogens and that the necrotic root canal does not serve as a reservoir for these human pathogens in healthy patients.

  13. Complete Atrioventricular Block Complicating Mitral Infective Endocarditis Caused by Streptococcus Agalactiae

    OpenAIRE

    Arai, Masaru; Nagashima, Koichi; Kato, Mahoto; Akutsu, Naotaka; Hayase, Misa; Ogura, Kanako; Iwasawa, Yukino; Aizawa, Yoshihiro; Saito, Yuki; Okumura, Yasuo; Nishimaki, Haruna; Masuda, Shinobu; Hirayama, Atsushi

    2016-01-01

    Patient: Male, 74 Final Diagnosis: Infective endocarditis Symptoms: Apetite loss ? fever Medication: ? Clinical Procedure: Transesophageal echocardiography Specialty: Cardiology Objective: Rare co-existance of disease or pathology Background: Infective endocarditis (IE) involving the mitral valve can but rarely lead to complete atrioventricular block (CAVB). Case Report: A 74-year-old man with a history of infective endocarditis caused by Streptococcus gordonii (S. gordonii) presented to our ...

  14. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia.

    Science.gov (United States)

    Schuijt, Tim J; Lankelma, Jacqueline M; Scicluna, Brendon P; de Sousa e Melo, Felipe; Roelofs, Joris J T H; de Boer, J Daan; Hoogendijk, Arjan J; de Beer, Regina; de Vos, Alex; Belzer, Clara; de Vos, Willem M; van der Poll, Tom; Wiersinga, W Joost

    2016-04-01

    Pneumonia accounts for more deaths than any other infectious disease worldwide. The intestinal microbiota supports local mucosal immunity and is increasingly recognised as an important modulator of the systemic immune system. The precise role of the gut microbiota in bacterial pneumonia, however, is unknown. Here, we investigate the function of the gut microbiota in the host defence against Streptococcus pneumoniae infections. We depleted the gut microbiota in C57BL/6 mice and subsequently infected them intranasally with S. pneumoniae. We then performed survival and faecal microbiota transplantation (FMT) experiments and measured parameters of inflammation and alveolar macrophage whole-genome responses. We found that the gut microbiota protects the host during pneumococcal pneumonia, as reflected by increased bacterial dissemination, inflammation, organ damage and mortality in microbiota-depleted mice compared with controls. FMT in gut microbiota-depleted mice led to a normalisation of pulmonary bacterial counts and tumour necrosis factor-α and interleukin-10 levels 6 h after pneumococcal infection. Whole-genome mapping of alveolar macrophages showed upregulation of metabolic pathways in the absence of a healthy gut microbiota. This upregulation correlated with an altered cellular responsiveness, reflected by a reduced responsiveness to lipopolysaccharide and lipoteichoic acid. Compared with controls, alveolar macrophages derived from gut microbiota-depleted mice showed a diminished capacity to phagocytose S. pneumoniae. This study identifies the intestinal microbiota as a protective mediator during pneumococcal pneumonia. The gut microbiota enhances primary alveolar macrophage function. Novel therapeutic strategies could exploit the gut-lung axis in bacterial infections. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  15. Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

    International Nuclear Information System (INIS)

    Furqan, S.; Paracha, S.A.U.

    2014-01-01

    Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

  16. CT features of legionella pneumonia, compared with streptococcal pneumonia. A collaborative study

    International Nuclear Information System (INIS)

    Tokuda, Hitoshi; Sakai, Fumikazu; Goto, Hajime

    2007-01-01

    Legionella pneumophila pneumonia (LPP) is of serious concern for chest physicians for its potential lethality and difficulty of diagnosis. In spite of widespread use of urine antigen detection method, it remains one of the most difficult-to-treat disease among community acquired pneumonia. We investigated CT images of 38 cases of LPP, comparing them with wide spread Streptococcus pneumoniae pneumonia (SPP). We find that sharply demarcated consolidation scattered in ground-glass opacity is the most striking and pathognomonic feature of LPP, which is rarely found in SPP. Bronchiolitis was not found in LPP, while it is a relatively common finding in SPP, which could be the second clue of differentiation of these two diseases. (author)

  17. Dusuqing granules (DSQ) suppress inflammation in Klebsiella pneumonia rat via NF-κB/MAPK signaling.

    Science.gov (United States)

    Mei, Xue; Wang, Hao-Xun; Li, Jian-Sheng; Liu, Xiao-Hui; Lu, Xiao-Fan; Li, Ya; Zhang, Wei-Yu; Tian, Yan-Ge

    2017-04-17

    Dusuqing granules (DSQ) have been used in the treatment of bacterial pneumonia clinically, with remarkable benefits. This study was initiated to explore the effects of DSQ on pulmonary inflammation by regulating nuclear factor (NF)-κB/mitogen-activated protein kinase (MAPK) signaling in bacterial pneumonia rats. Rat model was duplicated with Klebsiella pneumonia by a one-time intratracheal injection. Rats were randomized into control, model, DSQ and levofloxacin (LVX) groups. After administrated with appropriate medicines for 7 days, lung tissues were harvested and prepared for pathological analysis, and interleukin (IL)-1, IL-6, monocyte chemotactic protein (MCP)-1and macrophage inflammatory protein (MIP)-2 detections. NF-κB mRNA was measured by real-time qPCR, and the phosphorylation and total proteins of P38MAPK, JNK46/54, ERK42/44 were determined by Western blotting. Marked pathological impairments were observed in model rats, whereas were improved in DSQ group. The cytokines levels, NF-κB mRNA expression and the phosphorylation of P38MAPK, JNK46/54 and ERK42/44 proteins were significantly higher in model group, and were significantly depressed in DSQ group. The protective effects of DSQ on Klebsiella pneumonia might be attributed to its inactivative effects of NF-κB/ MAPK pathway.

  18. Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Neiers, F.; Madhurantakam, C.; Fälker, S.; Normark, S.; Henriques-Normark, B.; Achour, A.

    2008-01-01

    Crystallization conditions and preliminary X-ray diffraction analysis of the S. pneumoniae-derived pilus-associated protein sortase C are reported. The pilus-associated sortase C from Streptococcus pneumoniae (SrtC or Srt-2) acts as a polymerase for the pilus subunit proteins RrgA and RrgB. Here, the crystallization and preliminary X-ray diffraction analysis of three crystal forms of SrtC are reported. One crystal form belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 48.9, b = 96.9, c = 98.9 Å, α = β = γ = 90°. The other two crystal forms belong to space group P222, with unit-cell parameters a = 48.8, b = 97.2, c = 99.2 Å, α = β = γ = 90° and a = 48.6, b = 96.5, c = 98.8 Å, α = β = γ = 90°, respectively. Preliminary analysis indicates the presence of two molecules in the asymmetric unit of the crystal for all three forms

  19. Extended Spectrum β-Lactamase (ESBL) in Klebsiella Pneumoniae ...

    African Journals Online (AJOL)

    Pseudomonas aeruginosa, Streptococcus Pneumoniae and Serratia spp. Two of the children died in spite of early use of appropriate antibiotics as determined by antibiotic susceptibility testing. Phenotypic and molecualr investigation showed extended-spectrum β-lactamase (ESBL) producing K. pneumoniae to be ...

  20. Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

    Science.gov (United States)

    Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

    2012-05-01

    Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

  1. Antibiotic Treatment of Hospitalized Patients with Pneumonia Complicated by Clostridium Difficile Infection.

    Science.gov (United States)

    Zycinska, K; Chmielewska, M; Lenartowicz, B; Hadzik-Blaszczyk, M; Cieplak, M; Kur, Z; Krupa, R; Wardyn, K A

    2016-01-01

    Clostridium difficile infection (CDI) is one of the most common gastrointestinal complication after antimicrobial treatment. It is estimated that CDI after pneumonia treatment is connected with a higher mortality than other causes of hospitalization. The aim of the study was to assess the relationship between the kind of antibiotic used for pneumonia treatment and mortality from post-pneumonia CDI. We addressed the issue by examining retrospectively the records of 217 patients who met the diagnostic criteria of CDI. Ninety four of those patients (43.3 %) came down with CDI infection after pneumonia treatment. Fifty of the 94 patients went through severe or severe and complicated CDI. The distribution of antecedent antibiotic treatment of pneumonia in these 50 patients was as follows: ceftriaxone in 14 (28 %) cases, amoxicillin with clavulanate in 9 (18 %), ciprofloxacin in 8 (16.0 %), clarithromycin in 7 (14 %), and cefuroxime and imipenem in 6 (12 %) each. The findings revealed a borderline enhancement in the proportion of deaths due to CDI in the ceftriaxone group compared with the ciprofloxacin, cefuroxime, and imipenem groups. The corollary is that ceftriaxone should be shunned in pneumonia treatment. The study demonstrates an association between the use of a specific antibiotic for pneumonia treatment and post-pneumonia mortality in patients who developed CDI.

  2. Clinical characteristics of children with Mycoplasma pneumoniae infection hospitalized during the Danish 2010-2012 epidemic

    DEFF Research Database (Denmark)

    Sørensen, Cristel M; Schønning, Kristian; Rosenfeldt, Vibeke

    2013-01-01

    Mycoplasma pneumoniae is a common cause of community-acquired pneumonia. Pneumonia may be the most severe manifestation of respiratory M. pneumoniae infection. The most typical symptoms in children are cough and wheezing, which are often accompanied by upper respiratory tract manifestations...

  3. Effect and mechanism of calpains on pediatric lobar pneumonia.

    Science.gov (United States)

    Yin, Genquan; Zeng, Qiang; Zhao, Haijin; Wu, Peiqiong; Cai, Shaoxi; Deng, Li; Jiang, Wenhui

    2017-07-04

    Lobar pneumonia, one of the community-acquired pneumonia (CAP), is a common pediatric low respiratory tract infection. Calpains are Ca 2+ -activated cysteine proteases whose activation mechanism is elusive. The present study was undertaken to detect the role and mechanism of calpains in pediatric lobar pneumonia. The human acute lung infection model (ALIM) was constructed and infected by Streptococcus. Enzyme-linked immunosorbent assay (ELISA) was used to measure interleukin (IL)-6, IL-8 and tumor necrosis factor (TNF)-α. We observed the lactate dehydrogenase (LDH) release, calpains activity and calpain inhibitor effects in ALIM. The expression of proliferating cell nuclear antigen (PCNA) protein was quantified by western blotting. Then the effects of calpain 1 and 2 knockdown on expressions of inflammation factors and PCNA protein, LDH release and apoptosis were evaluated in lung MRC-5 cells. In constructed ALIM, expressions of IL-6 (P < 0.01), IL-8 (P < 0.01), TNF-α (P < 0.05) and PCNA protein (P < 0.05) were significantly reduced by the calpain inhibitor. Expressions of IL-6, IL-8, TNF-α, PCNA protein and relative LDH release were statistically reduced by the small interfering (si) RNA-calpain 1 and 2 in MRC-5 cells (P < 0.05). Calpains silence increased apoptotic cells from 5% (negative control) to more than 20% in MRC-5 cells. The present study suggests that calpains possess a significant effect on inflammations, cell proliferation and apoptosis. Suppression of calpains may provide a potential therapeutic target of lobar pneumonia.

  4. Streptococcus sinensis may react with Lancefield group F antiserum.

    Science.gov (United States)

    Woo, Patrick C Y; Teng, Jade L L; Leung, Kit-wah; Lau, Susanna K P; Tse, Herman; Wong, Beatrice H L; Yuen, Kwok-yung

    2004-11-01

    Lancefield group F streptococci have been found almost exclusively as members of the 'Streptococcus milleri' group, although they have been reported very occasionally in some other streptococcal species. Among 302 patients with bacteraemia caused by viridans streptococci over a 6-year period, three cases were caused by Streptococcus sinensis (type strain HKU4T, HKU5 and HKU6). All three patients had infective endocarditis complicating their underlying chronic rheumatic heart diseases. Gene sequencing showed no base differences between the 16S rRNA gene sequences of HKU5 and HKU6 and that of HKU4T. All three strains were Gram-positive, non-spore-forming cocci arranged in chains. All grew on sheep blood agar as alpha-haemolytic, grey colonies of 0.5-1 mm in diameter after 24 h incubation at 37 degrees C in ambient air. Lancefield grouping revealed that HKU5 and HKU6 were Lancefield group F, but HKU4T was non-groupable with Lancefield groups A, B, C, D, F or G antisera. HKU4T was identified by the Vitek system (GPI), API system (20 STREP) and ATB system (ID32 STREP) as 99 % Streptococcus intermedius, 51.3 % S. intermedius and 99.9 % Streptococcus anginosus, respectively. Using the same tests, HKU5 was identified as 87 % Streptococcus sanguinis/Streptococcus gordonii, 59 % Streptococcus salivarius and 99.6 % S. anginosus, respectively, and HKU6 as 87 % S. sanguinis/S. gordonii, 77 % Streptococcus pneumoniae and 98.3 % S. anginosus, respectively. The present data revealed that a proportion of Lancefield group F streptococci could be S. sinensis. Lancefield group F streptococci should not be automatically reported as 'S. milleri'.

  5. Decreased expression of liver X receptor-α in macrophages infected with Chlamydia pneumoniae in human atherosclerotic arteries in situ.

    Science.gov (United States)

    Bobryshev, Yuri V; Orekhov, Alexander N; Killingsworth, Murray C; Lu, Jinhua

    2011-01-01

    In in vitro experiments, Chlamydia pneumoniae has been shown to infect macrophages and to accelerate foam cell formation. It has been hypothesized that the C. pneumoniae infection affects foam cell formation by suppressing the expression of liver X receptors (LXR), but whether such an event occurs in human atherosclerosis is not known. In this study we examined carotid artery segments, obtained by endarterectomy, in which the presence of C. pneumoniae was confirmed by both polymerase chain reaction and immunohistochemistry. The expression of LXR-α in macrophages infected with C. pneumoniae and macrophages that were not infected was compared using a quantitative immunohistochemical analysis. The analysis revealed a 2.2-fold reduction in the expression of LXR-α in C. pneumoniae-infected cells around the lipid cores in atherosclerotic plaques. In the cytoplasm of laser-capture microdissected cells that were immunopositive for C. pneumoniae, electron microscopy demonstrated the presence of structures with the appearance of elementary, reticulate and aberrant bodies of C. pneumoniae. We conclude that LXR-α expression is reduced in C. pneumoniae-infected macrophages in human atherosclerotic lesions which supports the hypothesis that C. pneumoniae infection might suppress LXR expression in macrophages transforming into foam cells. Copyright © 2011 S. Karger AG, Basel.

  6. Molecular evidence of Chlamydophila pneumoniae infection in reptiles in Argentina.

    Science.gov (United States)

    Frutos, María C; Monetti, Marina S; Ré, Viviana E; Cuffini, Cecilia G

    2014-01-01

    In the central area of Argentina, the epidemiological and molecular characteristics of Chlamydophila pneumoniae infections in reptiles are still unknown. A nested polymerase chain reaction of the rpoB gene was used to detect C. pneumoniae in cloacal swab samples from 19 reptiles at a recreational area. Eleven (57.89%) reptiles were positive; the sequencing and phylogenetic analysis confirmed the presence of this bacterium. Neither C. pneumoniae DNA in the caregivers pharynges nor IgM antibodies anti-C. pneumoniae in their serum samples were detected; however, caregivers presented very high titers of IgG anti-C. pneumoniae. The detection of C. pneumoniae DNA in reptiles demonstrated the circulation of this agent in the recreational area and could be responsible for the exacerbated immune response of the personnel handling the reptiles, which suggests a potential zoonotic cycle. This is the first report of the detection of C. pneumoniae in reptiles in Argentina. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  7. Clonal relationships among penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates recovered in Greece and France.

    Science.gov (United States)

    Syrogiannopoulos, G A; Doit, C; Grivea, I N; Geslin, P; Bingen, E

    2001-01-01

    In January 1996 the emergence of penicillin-susceptible, multiresistant serotype 6B Streptococcus pneumoniae isolates resistant to chloramphenicol, tetracycline, erythromycin, clindamycin and trimethoprim-sulfamethoxazole was observed in young carriers in the city of Patras, located in the southwestern region of Greece. Later, a significant spread of pneumococci with this unusual phenotype was noted in carriers living in various other areas of the country. Using restriction fragment length polymorphism of the ribosomal RNA genes, clonal relationships were found between these Greek strains and serotype 6B penicillin-susceptible, multiresistant pneumococci isolated in France between January 1992 and September 1996. The French and Greek isolates appear to have a common ancestry.

  8. Multiple organ dysfunction syndrome associated with Mycoplasma pneumoniae infection

    Directory of Open Access Journals (Sweden)

    Shu-Bo Zhai

    2012-03-01

    Full Text Available In this study, we report one case of a three-year-old boy infected with Mycoplasma pneumonia (MP and presenting concomitant multiple organ damage of the heart, kidney, lung and liver, among others, together with a brief review for the diagnosis and treatment of MP infection with multiple organ dysfunction syndrome (MODS.

  9. Comparison of viral infection in healthcare-associated pneumonia (HCAP) and community-acquired pneumonia (CAP)

    Science.gov (United States)

    Park, Kyoung Un; Lee, Sang Hoon; Lee, Yeon Joo; Park, Jong Sun; Cho, Young-Jae; Yoon, Ho Il; Lee, Choon-Taek

    2018-01-01

    Background Although viruses are known to be the second most common etiological factor in community-acquired pneumonia (CAP), the respiratory viral profile of the patients with healthcare-associated pneumonia (HCAP) has not yet been elucidated. We investigated the prevalence and the clinical impact of respiratory virus infection in adult patients with HCAP. Methods Patients admitted with HCAP or CAP, between January and December 2016, to a tertiary referral hospital in Korea, were prospectively enrolled, and virus identification was performed using reverse-transcription polymerase chain reaction (RT-PCR). Results Among 452 enrolled patients (224 with HCAP, 228 with CAP), samples for respiratory viruses were collected from sputum or endotracheal aspirate in 430 (95.1%) patients and from nasopharyngeal specimens in 22 (4.9%) patients. Eighty-seven (19.2%) patients had a viral infection, and the proportion of those with viral infection was significantly lower in the HCAP than in the CAP group (13.8% vs 24.6%, p = 0.004). In both the HCAP and CAP groups, influenza A was the most common respiratory virus, followed by entero-rhinovirus. The seasonal distributions of respiratory viruses were also similar in both groups. In the HCAP group, the viral infection resulted in a similar length of hospital stay and in-hospital mortality as viral–bacterial coinfection and bacterial infection, and the CAP group showed similar results. Conclusions The prevalence of viral infection in patients with HCAP was lower than that in patients with CAP, and resulted in a similar prognosis as viral–bacterial coinfection or bacterial infection. PMID:29447204

  10. Incidence of Hospitalized Pneumococcal Pneumonia among Adults in Guatemala, 2008-2012.

    Science.gov (United States)

    Contreras, Carmen Lucía; Verani, Jennifer R; Lopez, María Renee; Paredes, Antonio; Bernart, Chris; Moscoso, Fabiola; Roldan, Aleida; Arvelo, Wences; Lindblade, Kim A; McCracken, John P

    2015-01-01

    Streptococcus pneumoniae is a leading cause of pneumonia worldwide. However, the burden of pneumococcal pneumonia among adults in low- and middle-income countries is not well described. Data from 2008-2012 was analyzed from two surveillance sites in Guatemala to describe the incidence of pneumococcal pneumonia in adults. A case of hospitalized pneumococcal pneumonia was defined as a positive pneumococcal urinary antigen test or blood culture in persons aged ≥ 18 years hospitalized with an acute respiratory infection (ARI). Among 1595 adults admitted with ARI, 1363 (82%) had either urine testing (n = 1286) or blood culture (n = 338) performed. Of these, 188 (14%) had pneumococcal pneumonia, including 173 detected by urine only, 8 by blood culture only, and 7 by both methods. Incidence rates increased with age, with the lowest rate among 18-24 year-olds (2.75/100,000) and the highest among ≥65 year-olds (31.3/100,000). The adjusted incidence of hospitalized pneumococcal pneumonia was 18.6/100,000 overall, with in-hospital mortality of 5%. An important burden of hospitalized pneumococcal pneumonia in adults was described, particularly for the elderly. However, even adjusted rates likely underestimate the true burden of pneumococcal pneumonia in the community. These data provide a baseline against which to measure the indirect effects of the 2013 introduction of the pneumococcal conjugate vaccine in children in Guatemala.

  11. An Update on the Management Of Hospital-Acquired Pneumonia in the Elderly

    Directory of Open Access Journals (Sweden)

    Chao-Hsien Lee

    2008-12-01

    Full Text Available Pneumonia is the leading cause of infection-related death and represents the fifth cause of mortality in the elderly. There are several reported risk factors for acquiring pneumonia at an older age, such as alcoholism, lung and heart diseases, nursing home residence, and swallowing disorders. Hospital-acquired pneumonia (HAP is reviewed, with an emphasis on multidrug-resistant (MDR bacterial pathogens, such as Pseudomonas aeruginosa, Acinetobacter species, and methicillin-resistant Staphylococcus aureus. The clinical characteristics of pneumonia in the elderly differ substantially compared with younger patients, and the severity of the disease is strongly associated with increased age and age-related comorbid disorders. Streptococcus pneumoniae is the pathogen most frequently responsible for pneumonia in the elderly with early HAP without risk factors for MDR; enteric Gram-negative rods should be considered in nursing home-associated pneumonia, as well as anaerobes in patients with aspiration pneumonia. Special attention should be given to preventive measures such as vaccination, oral care, and nutrition. The management of HAP should be instituted early with: appropriate use of antibiotics in adequate doses; avoidance of excessive use of antibiotics by de-escalation of initial antibiotic therapy, based on microbiologic cultures and the clinical response of the patient; and reduction of the duration of treatment to the minimum effective period.

  12. [Bacteremic pneumococcal pneumonia].

    Science.gov (United States)

    Pineda Solas, V; Pérez Benito, A; Domingo Puiggros, M; Larramona Carrera, H; Segura Porta, F; Fontanals Aymerich, D

    2002-11-01

    Streptococcus pneumonia is the most common bacterial cause of community-acquired pneumonia in children. The reference standard for etiological diagnosis is isolation of S. pneumoniae from blood Since the advent of conjugate vaccines, disease caused by this organism can now be prevented. Many studies have been performed of the global incidence of invasive pneumococcal infections and of pneumococcal meningitis but few studies investigated bacteremic pneumococcal pneumonia and its complications in children. To determine the incidence, patient characteristics, clinical signs, laboratory data, percentage and days of hospitalization, response to antibiotic treatment, antibiotic resistance, complications and causal serogroups of bacteremic pneumococcal pneumonia in our environment in order to estimate requirements for systematic vaccination programs. From January 1990 to May 2001, data on all pediatric cases of invasive pneumococcal infections diagnosed in our hospital were collected. Several characteristics of patients with bacteremic pneumococcal pneumonia were analyzed. Bacteremic pneumococcal pneumonia was diagnosed in patients with positive blood or pleural fluid cultures for S. pneumoniae and radiographically evident pulmonary infiltrate. The incidence of both types of pneumonia were determined according to population census data. All S. pneumonia strains were sent to the Pneumococci Reference Laboratory of the Instituto Carlos III in Madrid for serotyping. We estimated the serotype coverage of the pneumococcal 7-valent conjugate vaccine according to the serotypes included in this vaccine and their distribution. Forty cases of bacteremic pneumococcal pneumonia were diagnosed, yielding an incidence of 17,10 and 5 cases per 10(5) children aged less than 2, 4 and 15 years old respectively. The mean age was 50 months and 43% were aged less than 4 years. Peaks occurred in January, March, April and May. A total of 77.5% of the patients were admitted to hospital and the

  13. Chlamydia pneumoniae acute liver infection affects hepatic cholesterol and triglyceride metabolism in mice.

    Science.gov (United States)

    Marangoni, Antonella; Fiorino, Erika; Gilardi, Federica; Aldini, Rita; Scotti, Elena; Nardini, Paola; Foschi, Claudio; Donati, Manuela; Montagnani, Marco; Cevenini, Monica; Franco, Placido; Roda, Aldo; Crestani, Maurizio; Cevenini, Roberto

    2015-08-01

    Chlamydia pneumoniae has been linked to atherosclerosis, strictly associated with hyperlipidemia. The liver plays a central role in the regulation of lipid metabolism. Since in animal models C. pneumoniae can be found at hepatic level, this study aims to elucidate whether C. pneumoniae infection accelerates atherosclerosis by affecting lipid metabolism. Thirty Balb/c mice were challenged intra-peritoneally with C. pneumoniae elementary bodies and thirty with Chlamydia trachomatis, serovar D. Thirty mice were injected with sucrose-phosphate-glutamate buffer, as negative controls. Seven days after infection, liver samples were examined both for presence of chlamydia and expression of genes involved in inflammation and lipid metabolism. C. pneumoniae was isolated from 26 liver homogenates, whereas C. trachomatis was never re-cultivated (P triglycerides levels compared both with negative controls (P metabolism. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  14. Grepafloxacin Clinical Program for Lower Respiratory Tract Infections

    Directory of Open Access Journals (Sweden)

    Arne C Rodloff

    1998-01-01

    Full Text Available The present paper evaluates the clinical trial program in lower respiratory tract infections treated with a new fluoroquinolone antibiotic, grepafloxacin. Unlike older quinolones, grepafloxacin has excellent activity against Gram-positive organisms, which include Streptococcus pneumoniae and “atypical” pathogens Legionella species. Mycoplasma pneumoniae and Chlamydia pneumoniae. Grepafloxacin has a long half-life of 12 to 15 h, which allows once daily dosing. Six studies have been conducted regarding community-acquired lower respiratory tract infections (LRTls, four about community-acquired pneumonia (CAP and two about acute bacterial exacerbations of chronic bronchitis (ABECB . In these studies, grepafloxacin demonstrated clinical equivalence with standard therapies. but, in patients with documented infections. grepafloxacin was statistically superior to amoxycillin in both CAP and ABECB. The new fluoroquinolone has a good safety profile, comparable with that of ciprofloxacin. The most common adverse effects of grepafloxacin were nausea and a metallic taste; however, these effects resulted in only a few discontinuations of therapy. With the increasing prevalence of resistance in pathogens isolated from community-acquired LRTIs, grepafloxacin offers a good alternative for monotherapy in these patients.

  15. Virome and bacteriome characterization of children with pneumonia and asthma in Mexico City during winter seasons 2014 and 2015

    Science.gov (United States)

    Romero-Espinoza, Jose A.; Moreno-Valencia, Yazmin; Coronel-Tellez, Rodrigo H.; Castillejos-Lopez, Manuel; Hernandez, Andres; Dominguez, Aaron; Miliar-Garcia, Angel; Barbachano-Guerrero, Arturo; Perez-Padilla, Rogelio; Alejandre-Garcia, Alejandro

    2018-01-01

    Background Acute asthma exacerbations and pneumonia are important causes of morbidity and mortality in children and may coexist in the same children, although symptom overlap may lead to difficulties in diagnosis. Microbial and viral diversity and differential abundance of either may play an important role in infection susceptibility and the development of acute and chronic respiratory diseases. Objectives To describe the virome and bacteriome present in the upper respiratory tract of hospitalized children with a clinical diagnosis of asthma and pneumonia during an acute exacerbation and an acute respiratory illness ARI episode respectively. Methods During the winter seasons of 2013–2014 and 2014–2015, 134 nasopharyngeal swabs samples of children <15 years of age with ARI hospitalized at a referral hospital for respiratory diseases were selected based on clinical diagnosis of asthma or pneumonia. The virome and bacteriome were characterized using Whole Genome Sequencing (WGS) and in-house bioinformatics analysis pipeline. Results The Asthma group was represented mainly by RV-C, BoV-1 and RSV-B and the pneumonia group by Bacteriophage EJ-1 and TTMV. TTV was found in both groups with a similar amount of reads. About bacterial composition Moraxella catarrhalis, Propionibacterium acnes and Acinetobacter were present in asthma and Veillonella parvula and Mycoplasma pneumoniae in pneumonia. Streptococcus pneumoniae and Haemophilus influenzae were mostly found with both asthma and pneumonia. Conclusions Our results show a complex viral and bacterial composition in asthma and pneumonia groups with a strong association of RV-C presence in asthmatic children. We observed Streptococcus pneumoniae and Haemophilus influenzae concurrently in both groups. PMID:29447223

  16. Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae

    Science.gov (United States)

    Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

    2013-01-01

    Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

  17. Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Calum Johnston

    Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

  18. Hypopituitarism as consequence of late neonatal infection by Group B streptococcus: a case report.

    Science.gov (United States)

    Ferreira, Amanda Santana; Fernandes, Ana Lourdes Lima Araújo; Guaragna-Filho, Guilherme

    2015-01-01

    Hypopituitarism is a condition characterized by dysfunction of the pituitary gland hormone production. The insults of the perinatal period, which includes the late infection by Group B Streptococcus, consists in a rare etiology of this condition. We present the case of a 39-days-old infant with meningitis caused by Streptococcus Group B, which showed, among other consequences, hypopituitarism.

  19. Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

    Directory of Open Access Journals (Sweden)

    Tom Li Stephen

    2007-03-01

    Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

  20. Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014.

    Science.gov (United States)

    Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi

    2017-03-01

    Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.

  1. Serological association of Chlamydia pneumoniae infection with age-related macular degeneration: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Xueyu Chen

    Full Text Available We investigated the serological association of Chlamydia pneumoniae infection with age-related macular degeneration (AMD.A systematic review and meta-analysis was performed. PubMed, Embase, Web of Science and the Association of Research in Vision and Ophthalmology abstracts were searched to identify studies investigating the serological association of Chlamydia pneumoniae infection with age-related macular degeneration. The quality of original studies was assessed using the Newcastle-Ottawa scale. Heterogeneity was explored with meta-regression. The odds ratios (ORs and standardized mean differences (SMD of Chlamydia pneumoniae infection between AMD patients and controls were pooled.In total, 9 studies met the inclusion criteria using the Newcastle-Ottawa scale scores ranging from 4 to 9. There was heterogeneity among studies due to a difference in the study designs and measurement of exposure to Chlamydia pneumoniae infection. The overall OR of Chlamydia pneumoniae infection with AMD was 1.11 (95% confidence interval: 0.78-1.57, P = 0.56. The overall SMD of antibody titer between AMD and control was 0.43 (95% confidence interval: -0.12 to 0.99, P = 0.13.Evidence from the current published literature suggested no statistically significant association between Chlamydia pneumoniae infection and AMD.

  2. Serological association of Chlamydia pneumoniae infection with age-related macular degeneration: a systematic review and meta-analysis.

    Science.gov (United States)

    Chen, Xueyu; Jhanji, Vishal; Chen, Chupeng; Chen, Haoyu

    2014-01-01

    We investigated the serological association of Chlamydia pneumoniae infection with age-related macular degeneration (AMD). A systematic review and meta-analysis was performed. PubMed, Embase, Web of Science and the Association of Research in Vision and Ophthalmology abstracts were searched to identify studies investigating the serological association of Chlamydia pneumoniae infection with age-related macular degeneration. The quality of original studies was assessed using the Newcastle-Ottawa scale. Heterogeneity was explored with meta-regression. The odds ratios (ORs) and standardized mean differences (SMD) of Chlamydia pneumoniae infection between AMD patients and controls were pooled. In total, 9 studies met the inclusion criteria using the Newcastle-Ottawa scale scores ranging from 4 to 9. There was heterogeneity among studies due to a difference in the study designs and measurement of exposure to Chlamydia pneumoniae infection. The overall OR of Chlamydia pneumoniae infection with AMD was 1.11 (95% confidence interval: 0.78-1.57, P = 0.56). The overall SMD of antibody titer between AMD and control was 0.43 (95% confidence interval: -0.12 to 0.99, P = 0.13). Evidence from the current published literature suggested no statistically significant association between Chlamydia pneumoniae infection and AMD.

  3. Klebsiella pneumoniae Infection Leads to a Poor Visual Outcome in Endogenous Endophthalmitis: A 12-year Experience in Southern Taiwan.

    Science.gov (United States)

    Chen, Shih-Chou; Lee, Ying-Yen; Chen, Ya-Hsin; Lin, Huey-Shyan; Wu, Tsung-Tien; Sheu, Shwu-Jiuan

    2017-12-01

    To compare the characteristics, visual outcome, and prognostic factors of patients with endogenous endophthalmitis and to determine the association of endophthalmitis with Klebsiella pneumoniae infection. We retrospectively analyzed records of patients diagnosed with endogenous endophthalmitis from January 2002 to August 2013. A total of 86 patients were diagnosed with endogenous endophthalmitis; 48 patients were infected with K. pneumoniae, 28 patients were infected with other pathogens, and 10 were culture-negative. Diabetes mellitus was more prevalent among patients infected with K. pneumoniae. Liver abscess and urinary tract infection were the leading sources of infection in patients with and without a K. pneumoniae infection, respectively. In patients with endogenous endophthalmitis, poor initial vision (pendogenous endophthalmitis.

  4. Streptococcus agalactiae infection in domestic rabbits, Oryctolagus cuniculus.

    Science.gov (United States)

    Ren, S Y; Geng, Y; Wang, K Y; Zhou, Z Y; Liu, X X; He, M; Peng, X; Wu, C Y; Lai, W M

    2014-12-01

    Streptococcus agalactiae (Group B streptococcus, GBS) has emerged as an important pathogen that affects humans and animals, including aquatic species. In August 2011, a severe infectious disease affecting rabbits, which caused 42% mortality, occurred in Mianyang, Sichuan Province, China. The main clinical signs included acute respiratory distress syndrome, fever, paddling and convulsions. A Gram-positive, chain-forming coccus was isolated from the primary organs and tissues of diseased rabbits and then identified as S. agalactiae by morphology, biochemical and physiological characteristics, 16S rDNA and gyrB gene sequences analysis. All isolates of S. agalactiae showed a similar antibiotic susceptibility, which were sensitive to florfenicol, ampicillin,gentamicin and norfloxacin, as well as being resistant to penicillin, amoxicillin and tetracycline. To our knowledge, this is the first report on S. agalactiae natural infection in domestic rabbits. © 2013 Blackwell Verlag GmbH.

  5. Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis.

    Science.gov (United States)

    Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E

    2015-02-18

    Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

  6. [Clinical studies on flomoxef in respiratory tract infections].

    Science.gov (United States)

    Kanegae, H; Yamada, H; Yamaguchi, T; Kuroki, S; Katoh, O

    1987-10-01

    Flomoxef (FMOX, 6315-S) is a new oxacephem with a broad spectrum of antimicrobial activity. We used FMOX for treatment of 13 patients with respiratory tract infections including 4 cases of pneumonia, 5 of lung abscess and 4 of exacerbation of the chronic airway diseases. FMOX showed excellent in vitro antimicrobial activities against clinical isolates including 4 strains of Streptococcus pneumoniae, 2 strains of Haemophilus influenzae and each one strain of Escherichia coli and Klebsiella pneumoniae. Clinical responses were excellent in 3 cases, good in 7 and fair or poor in 3. No side effect was observed, but abnormal laboratory findings caused by FMOX administration were found in 2 cases; hypertransaminasemia and eosinophilia. However, neither of them was severe. From the above results, it is considered that FMOX will be useful for treatment of patients with respiratory tract infections.

  7. Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

    DEFF Research Database (Denmark)

    Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S

    2005-01-01

    A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

  8. [Investigation of antimicrobial resistance of Klebsiella pneumoniae and Pseudomonas aeruginosa isolates from rat-like animals around a hospital in Guangzhou].

    Science.gov (United States)

    Zhong, Xue-Shan; Ge, Jing; Chen, Shao-Wei; Xiong, Yi-Quan; Zheng, Xue-Yan; Qiu, Min; Huo, Shu-Ting; Chen, Qing

    2016-05-01

    To investigate antimicrobial resistance of Klebsiella pneumoniae and Pseudomonas aeruginosa isolates in fecal samples from rat-like animals. Rat-like animals were captured using cages around a hospital and the neighboring residential area between March and October, 2015. K. pneumoniae and P. aeruginosa were isolated from the fecal samples of the captured animals. Antimicrobial susceptibility test was performed according to the guidelines of Clinical and Laboratory Standards Institute (2014). A total of 329 rat-like animals were captured, including 205 Suncus murinus, 111 Rattus norvegicus, 5 Rattus flavipectus and 8 Mus musculus. The positivity rates of K. pneumoniae and P. aeruginosa were 78.4% and 34.7% in the fecal samples from the captured animals, respectively. K. pneumoniae isolates from Suncus murinus showed a high resistance to ampicillin, cephazolin, nitrofurantoin, piperacillin and cefotaxime (with resistance rates of 100%, 51.2%, 44.2%, 37.2%, and 23.3%, respectively), and K. pneumoniae isolates from Rattus spp. showed a similar drug-resistance profile. The prevalence rates of multidrug resistance and ESBLs were 40.9% and 10.7%, respectively. P. aeruginosa from both Suncus murinus and Rattus spp. exhibited the highest resistance rates to aztreonam (12.4% and 16.0%, respectively), followed by penicillins and fluoroquinolones. P. aeruginosa isolates were susceptible to cephems, aminoglycosides and carbapenems (with resistance rates below 5%). K. pneumoniae and P. aeruginosa isolated from rat-like animals showed drug-resistance profiles similar to those of the strains isolated from clinical patients, suggesting that the possible transmission of K. pneumoniae and P. aeruginosa between rat-like animals and human beings.

  9. Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome.

    Science.gov (United States)

    Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng

    2016-10-01

    Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

  10. Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

    Science.gov (United States)

    Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

    2013-08-01

    Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

  11. Atypical hemolytic uremic syndrome triggered by varicella infection

    Directory of Open Access Journals (Sweden)

    Pauline Condom

    2017-01-01

    The current case describes an aHUS associated to varicella infection as demonstrated by the simultaneous occurrence of the viral infection and aHUS manifestations. Apart from typical Hemolytic Uremic Syndrome which is triggered by bacteria mostly Shiga toxin producing Echerichia coli and Streptococcus pneumoniae or Shigella, aHUS may be linked to viral infections such as HIV, EBV and enteroviruses, but very rarely by varicella. This case highlights a possible even rare complication of varicella infection a very common childhood disease. This complication could be avoided by to anti-VZV vaccination.

  12. Gene expression patterns in blood leukocytes discriminate patients with acute infections

    Science.gov (United States)

    Allman, Windy; Chung, Wendy; Mejias, Asuncion; Ardura, Monica; Glaser, Casey; Wittkowski, Knut M.; Piqueras, Bernard; Banchereau, Jacques; Palucka, A. Karolina; Chaussabel, Damien

    2007-01-01

    Each infectious agent represents a unique combination of pathogen-associated molecular patterns that interact with specific pattern-recognition receptors expressed on immune cells. Therefore, we surmised that the blood immune cells of individuals with different infections might bear discriminative transcriptional signatures. Gene expression profiles were obtained for 131 peripheral blood samples from pediatric patients with acute infections caused by influenza A virus, Gram-negative (Escherichia coli) or Gram-positive (Staphylococcus aureus and Streptococcus pneumoniae) bacteria. Thirty-five genes were identified that best discriminate patients with influenza A virus infection from patients with either E coli or S pneumoniae infection. These genes classified with 95% accuracy (35 of 37 samples) an independent set of patients with either influenza A, E coli, or S pneumoniae infection. A different signature discriminated patients with E coli versus S aureus infections with 85% accuracy (34 of 40). Furthermore, distinctive gene expression patterns were observed in patients presenting with respiratory infections of different etiologies. Thus, microarray analyses of patient peripheral blood leukocytes might assist in the differential diagnosis of infectious diseases. PMID:17105821

  13. Características laboratoriais das ceratites e conjuntivites causadas por Streptococcus sp Laboratorial findings of Streptococcus keratitis and conjunctivitis

    Directory of Open Access Journals (Sweden)

    Helena Parente Solari

    2004-10-01

    Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial

  14. [Prevention of perinatal infection caused by group B beta-hemolytic streptococcus].

    Science.gov (United States)

    Bevilacqua, G

    1999-01-01

    Streptococcus agalactiae strains or group B streptococci (GBS) are the leading cause of bacterial pneumoniae, sepsis and meningitis in neonates. GBS is also a major cause of bacteriemia in pregnant women. Colonization of the human rectovaginal tract with GBS is a risk factor associated with chorioamnionitis and transmission of the infection to the infant. Neonatal exposure to high concentrations of GBS, mainly during vaginal delivery, leads to colonisation of the lung airways and subsequent onset of severe diseases like pneumonia, sepsis and menigitis. GBS is present in the genitourinary tract of 10% to 40% of pregnant women, about 50% of the newborns of these mothers will be colonised during delivery and of these neonates, 1% to 2% present a severe invasive disease. The early-onset disease, appear in the neonates within 7 days of life and more than 90% occur within the first day of life. Fatal infection is associated commonly with fulminat and overwhelming early-onset disease. Maternal-intrapartum chemoprophylaxis is able to prevent the transmission of GBS to the newborn and to reduce the frequency and the severity of early onset disease. In many countries, in particular in US, several recommendations have been proposed to prevent the perinatal GBS infection. In this paper some recommendations to prevent GBS disease of the newborn, performed in collaboration with Italian Society of Perinatal Medicine, are presented. The most important problem in the prevention programme is the identification of the cases to treat, since it is not possible to give antibiotics to all the women. We combine two strategies for the identification of the women to be treated, one risk based and the other screening based. Intra-partum administration of ampicillin or penicillin is recommended for the women with one or more risk-factors (labour = 18 hours, intrapartum temperature > = 38 degrees C, previous infant with invasive GBS disease, diabetes) and for women with collect vaginal and

  15. Chlamydia pneumoniae Infection in Atherosclerotic Lesion Development through Oxidative Stress: A Brief Overview

    Directory of Open Access Journals (Sweden)

    Rosa Sessa

    2013-07-01

    Full Text Available Chlamydia pneumoniae, an obligate intracellular pathogen, is known as a leading cause of respiratory tract infections and, in the last two decades, has been widely associated with atherosclerosis by seroepidemiological studies, and direct detection of the microorganism within atheroma. C. pneumoniae is presumed to play a role in atherosclerosis for its ability to disseminate via peripheral blood mononuclear cells, to replicate and persist within vascular cells, and for its pro-inflammatory and angiogenic effects. Once inside the vascular tissue, C. pneumoniae infection has been shown to induce the production of reactive oxygen species in all the cells involved in atherosclerotic process such as macrophages, platelets, endothelial cells, and vascular smooth muscle cells, leading to oxidative stress. The aim of this review is to summarize the data linking C. pneumoniae-induced oxidative stress to atherosclerotic lesion development.

  16. Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.

    Science.gov (United States)

    Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E

    2011-01-01

    Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

  17. Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

    Directory of Open Access Journals (Sweden)

    Clara Inés Agudelo

    2009-04-01

    Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

  18. Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Gregg, Katie J.; Boraston, Alisdair B.

    2009-01-01

    The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

  19. Evaluación de un medio para la conservación de Streptococcus pneumoniae a partir de muestras nasofaríngeas

    Directory of Open Access Journals (Sweden)

    Nacxiry Fonseca

    2000-09-01

    Full Text Available La Organización Mundial de la Salud (OMS llegó a un consenso. en 1998, acerca de la metodologia general para el estudio de portadores de Streptococcus pneumoniae Esta metodología incluía un nuevo medio para el transporte y el almacenamiento de muestras nasofaringeas, compuesto portriptona, glucosa, glicerol y leche descremada, denominado STGG. Este medio fue evaluado oor nuestro laboratorio, en marzo de 1999. en un grupo de 15 niños menores de 5 años asistentes a una guarderia de Bogotá. Se les tomó una muestia nasofaringea que se colocó en el medio STGG y, posteriormente, se valoró el crecimiento de S. pneumoniae en cuatro momentos diferentes: 0, 5 , 10 y 30 días después de la toma de la muestra. La recuperación inicial de S. pneumoniae fue de 73% (11/15. En todas las 11 muestras de las que se obtuvo un crecimiento inicial, fue posible recuperar S. pneumoniae en los diferentes tiempos de observación, aún en las muestras con crecimiento en un solo cuadrante. En el tiempo 0 y a los 30 días, 7 de las 11 muestras presentaron un crecimiento de abundante a moderado. Con los datos obtenidos, se logró demostrar que el medio STGG es capaz de mantener, a largo plazo, la viabilidad de S. pneumoniae en muestras nasofaringeas de niños portadores de este microorganismo.

  20. Early Mycoplasma pneumoniae infection presenting as multiple pulmonary masses: an unusual presentation in a child

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Edward; Altes, Talissa; Anupindi, Sudha A. [The Children' s Hospital of Philadelphia, Department of Radiology, Philadelphia, PA (United States)

    2008-04-15

    Mycoplasma pneumoniae is a major cause of community-acquired pneumonia. Because most children are not imaged prior to onset of clinical symptoms, the appearance of early Mycoplasma infection has not been extensively studied. We present the case of an 11-year-old boy with large pulmonary masses incidentally detected during spine MRI evaluation for scoliosis. Eight days later, the patient developed acute respiratory symptoms, and the masses seen previously had evolved into a diffuse bronchiolitis. Diagnostic testing identified Mycoplasma pneumoniae as the likely etiology. We briefly review chest CT findings of infection by Mycoplasma and compare them to this unusual presentation of Mycoplasma pneumonia with subclinical imaging findings. (orig.)

  1. Early Mycoplasma pneumoniae infection presenting as multiple pulmonary masses: an unusual presentation in a child

    International Nuclear Information System (INIS)

    Yang, Edward; Altes, Talissa; Anupindi, Sudha A.

    2008-01-01

    Mycoplasma pneumoniae is a major cause of community-acquired pneumonia. Because most children are not imaged prior to onset of clinical symptoms, the appearance of early Mycoplasma infection has not been extensively studied. We present the case of an 11-year-old boy with large pulmonary masses incidentally detected during spine MRI evaluation for scoliosis. Eight days later, the patient developed acute respiratory symptoms, and the masses seen previously had evolved into a diffuse bronchiolitis. Diagnostic testing identified Mycoplasma pneumoniae as the likely etiology. We briefly review chest CT findings of infection by Mycoplasma and compare them to this unusual presentation of Mycoplasma pneumonia with subclinical imaging findings. (orig.)

  2. Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

    Directory of Open Access Journals (Sweden)

    Aura Lucía Leal

    1999-03-01

    Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

  3. The clinical features of respiratory infections caused by the Streptococcus anginosus group

    OpenAIRE

    Noguchi, Shingo; Yatera, Kazuhiro; Kawanami, Toshinori; Yamasaki, Kei; Naito, Keisuke; Akata, Kentaro; Shimabukuro, Ikuko; Ishimoto, Hiroshi; Yoshii, Chiharu; Mukae, Hiroshi

    2015-01-01

    Background The Streptococcus anginosus group (SAG) play important roles in respiratory infections. It is ordinarily difficult to distinguish them from contaminations as the causative pathogens of respiratory infections because they are often cultured in respiratory specimens. Therefore, it is important to understand the clinical characteristics and laboratory findings of respiratory infections caused by the SAG members. The aim of this study is to clarify the role of the SAG bacteria in respi...

  4. Phylogenetic analysis of emergent Streptococcus pneumoniae serotype 22F causing invasive pneumococcal disease using whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Walter H B Demczuk

    Full Text Available Since implementation of the 13-valent polyvalent conjugate vaccine (PCV13 in Canada during 2010, the proportion of PCV13 serotypes causing invasive pneumococcal disease (IPD has declined from 55% (n = 1492 in 2010 to 31% (n = 764 in 2014. A concurrent increase of non-PCV13 serotypes has occurred and 22F has become the most prevalent serotype in Canada increasing from 7% (n = 183 to 11% (n = 283. Core single nucleotide variant phylogenetic analysis was performed on 137 Streptococcus pneumoniae serotype 22F isolates collected across Canada from 2005-2015. Six phylogenetic lineages (n = 117 were identified among a serotype 22F/ST433 clonal complex (CC, including a recently expanding erythromycin-resistant clone. Erythromycin-resistance was observed in 25 isolates possessing ermB, mef or a 23S rRNA A2061G point mutation; 2 penicillin-resistant isolates had recombinant pbp1a, pbp2a and/or pbp2x; 3 tetracycline-resistant isolates contained tetM; and 1 isolate was multidrug-resistant. Virulence factor analysis indicated a high level of homogeneity among the 22F/ST433 clonal complex strains. A group of 6 phylogenetic outlier strains had differing MLST, antimicrobial resistance and molecular profiles suggestive of capsule switching events. While capsule switch events among S. pneumoniae serotype 22F has been observed, increasing prevalence of S. pneumoniae serotype 22F can be attributed to an evolving homogenous clone expanding nationally through local transmission events.

  5. Local Th17/IgA immunity correlate with protection against intranasal infection with Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Mortensen, Rasmus; Christensen, Dennis; Hansen, Lasse Bøllehuus

    2017-01-01

    Streptococcus pyogenes (group A streptococcus, GAS) is responsible for a wide array of infections. Respiratory transmission via droplets is the most common mode of transmission but it may also infect the host via other routes such as lesions in the skin. To advance the development of a future...... vaccine against GAS, it is therefore important to investigate how protective immunity is related to the route of vaccine administration. To explore this, we examined whether a parenterally administered anti-GAS vaccine could protect against an intranasal GAS infection or if this would require locally...... primed immunity. We foundd that a parenteral CAF01 adjuvanted GAS vaccine offered no protection against intranasal infection despite inducing strong systemic Th1/Th17/IgG immunity that efficiently protected against an intraperitoneal GAS infection. However, the same vaccine administered via...

  6. Incidence of Hospitalized Pneumococcal Pneumonia among Adults in Guatemala, 2008-2012

    Science.gov (United States)

    Contreras, Carmen Lucía; Verani, Jennifer R.; Lopez, María Renee; Paredes, Antonio; Bernart, Chris; Moscoso, Fabiola; Roldan, Aleida; Arvelo, Wences; Lindblade, Kim A.; McCracken, John P.

    2015-01-01

    Background Streptococcus pneumoniae is a leading cause of pneumonia worldwide. However, the burden of pneumococcal pneumonia among adults in low- and middle-income countries is not well described. Methods Data from 2008–2012 was analyzed from two surveillance sites in Guatemala to describe the incidence of pneumococcal pneumonia in adults. A case of hospitalized pneumococcal pneumonia was defined as a positive pneumococcal urinary antigen test or blood culture in persons aged ≥ 18 years hospitalized with an acute respiratory infection (ARI). Results Among 1595 adults admitted with ARI, 1363 (82%) had either urine testing (n = 1286) or blood culture (n = 338) performed. Of these, 188 (14%) had pneumococcal pneumonia, including 173 detected by urine only, 8 by blood culture only, and 7 by both methods. Incidence rates increased with age, with the lowest rate among 18–24 year-olds (2.75/100,000) and the highest among ≥65 year-olds (31.3/100,000). The adjusted incidence of hospitalized pneumococcal pneumonia was 18.6/100,000 overall, with in-hospital mortality of 5%. Conclusions An important burden of hospitalized pneumococcal pneumonia in adults was described, particularly for the elderly. However, even adjusted rates likely underestimate the true burden of pneumococcal pneumonia in the community. These data provide a baseline against which to measure the indirect effects of the 2013 introduction of the pneumococcal conjugate vaccine in children in Guatemala. PMID:26488871

  7. Radiographic features of Mycoplasma pneumoniae pneumonia: differential diagnosis and performance timing

    International Nuclear Information System (INIS)

    Miyashita, Naoyuki; Sugiu, Tadaaki; Kawai, Yasuhiro; Oda, Keiko; Yamaguchi, Tetsuya; Ouchi, Kazunobu; Kobashi, Yoshihiro; Oka, Mikio

    2009-01-01

    The Japanese Respiratory Society guidelines propose a differential diagnosis for atypical pneumonia and bacterial pneumonia using a scoring system for the selection of appropriate antibiotic. In order to improve this scoring system, the guidelines are seeking new specific parameter. The purpose of this study was to clarify the pattern of abnormalities with Mycoplasma pneumoniae pneumonia on chest computed tomography (CT) and whether the radiographic findings could distinguish M. pneumoniae pneumonia from Streptococcus pneumoniae pneumonia. A retrospective review was performed of the CT findings of 64 cases and 68 cases where M. pneumoniae and S. pneumoniae, respectively, were the only pathogen identified by the panel of diagnostic tests used. Of the 64 patients with M. pneumoniae pneumonia, bronchial wall thickening was observed most frequently (81%), followed by centrilobular nodules (78%), ground-glass attenuation (78%), and consolidation (61%). Bronchial wall thickening and centrilobular nodules were observed more often in M. pneumoniae patients than in S. pneumoniae patients (p < 0.0001). The presence of bilateral bronchial wall thickening or centrilobular nodules was only seen in patients with M. pneumoniae pneumonia. Using the scoring system of the Japanese Respiratory Society guidelines and chest CT findings, 97% of M. pneumoniae patients were suspected to be M. pneumoniae pneumonia without serology. When comparing the CT findings between early stage and progressed stage in the same patients with severe pneumonia, the radiographic features of early stage M. pneumoniae pneumonia were not observed clearly in the progressed stage. The present results indicate that the diagnosis of M. pneumoniae pneumonia would appear to be reliable when found with a combination of bronchial wall thickening and centrilobular nodules in the CT findings. However, these CT findings are not observed in progressed severe M. pneumoniae pneumonia patients

  8. Streptococcus pneumoniae eradicates preformed Staphylococcus aureus biofilms through a mechanism requiring physical contact

    Directory of Open Access Journals (Sweden)

    Faidad Khan

    2016-09-01

    Full Text Available Staphylococcus aureus (Sau strains are a main cause of disease, including nosocomial infections which have been linked to the production of biofilms and the propagation of antibiotic resistance strains such as methicillin-resistant Staphylococcus aureus (MRSA. A previous study found that Streptococcus pneumoniae (Spn strains kill planktonic cultures of Sau strains. In this work, we have further evaluated in detail the eradication of Sau biofilms and investigated ultrastructural interactions of the biofilmicidal effect. Spn strain D39, which produces the competence stimulating peptide 1 (CSP1, reduced Sau biofilms within 8 h of inoculation, while TIGR4, producing CSP2, eradicated Sau biofilms and planktonic cells within 4 h. Differences were not attributed to pherotypes as other Spn strains producing different pheromones eradicated Sau within 4 h. Experiments using Transwell devices, which physically separated both species growing in the same well, demonstrated that direct contact between Spn and Sau was required to efficiently eradicate Sau biofilms and biofilm-released planktonic cells. Physical contact-mediated killing of Sau was not related to production of hydrogen peroxide as an isogenic TIGR4spxB mutant eradicated Sau bacteria within 4 h. Confocal micrographs confirmed eradication of Sau biofilms by TIGR4 and allowed us to visualize ultrastructural point of contacts between Sau and Spn. A time-course study further demonstrated spatial colocalization of Spn chains and Sau tetrads as early as 30 min post-inoculation (Pearson’s coefficient >0.72. Finally, precolonized biofilms produced by Sau strain Newman, or MRSA strain USA300, were eradicated by mid-log phase cultures of washed TIGR4 bacteria within 2 h post-inoculation. In conclusion, Spn strains rapidly eradicate pre-colonized Sau aureus biofilms, including those formed by MRSA strains, by a mechanism(s requiring bacterium-bacterium contact, but independent from the production of

  9. Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Daniel J P Engelmoer

    Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

  10. CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

    Directory of Open Access Journals (Sweden)

    Colette G. Ngo Ndjom

    2017-06-01

    Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

  11. Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types.

    Science.gov (United States)

    Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu

    2016-10-20

    There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

  12. Incidence, risk factors and outcome of nosocomial pneumonia in patients with central nervous system infections

    Directory of Open Access Journals (Sweden)

    Gajović Olgica

    2011-01-01

    Full Text Available Introduction. Pneumonia is the most frequent nosocomial infection in intensive care units. The reported frequency varies with definition, the type of hospital or intensive care units and the population of patients. The incidence ranges from 6.8-27%. Objective. The objective of this study was to determine the frequency, risk factors and mortality of nosocomial pneumonia in intensive care patients. Methods. We analyzed retrospectively and prospectively the collected data of 180 patients with central nervous system infections who needed to stay in the intensive care unit for more than 48 hours. This study was conducted from 2003 to 2009 at the Clinical Centre of Kragujevac. Results. During the study period, 54 (30% patients developed nosocomial pneumonia. The time to develop pneumonia was 10±6 days. We found that the following risk factors for the development of nosocomial pneumonia were statistically significant: age, Glasgow Coma Scale (GCS score <9, mechanical ventilation, duration of mechanical ventilation, tracheostomy, presence of nasogastric tube and enteral feeding. The most commonly isolated pathogens were Klebsiella-Enterobacter spp. (33.3%, Pseudomonas aeruginosa (24.1%, Acinetobacter spp. (16.6% and Staphylococcus aureus (25.9%. Conclusion. Nosocomial pneumonia is the major cause of morbidity and mortality of patients with central nervous system infections. Patients on mechanical ventilation are particularly at a high risk. The mortality rate of patients with nosocomial pneumonia was 54.4% and it was five times higher than in patients without pneumonia.

  13. Combination vaccine against invasive meningococcal B and pneumococcal infections: Potential epidemiological and economic impact in the Netherlands

    NARCIS (Netherlands)

    J.M. Bos; H.C. Rüumke (Hans); K. Welte (Karl); L. Spanjaard (Lodewijk); L. van Alphen (Loek); M.J. Postma (Maarten)

    2006-01-01

    textabstractBackground: Streptococcus pneumoniae and Neisseria meningitidis group B are among the main causes of invasive bacterial meningitis infections in infants. Worldwide, these diseases lead to significant mortality, morbidity and costs. The societal impact is especially severe since the

  14. Co-Transcriptomes of Initial Interactions In Vitro between Streptococcus Pneumoniae and Human Pleural Mesothelial Cells.

    Directory of Open Access Journals (Sweden)

    Claire J Heath

    Full Text Available Streptococcus pneumoniae (Spn is a major causative organism of empyema, an inflammatory condition occurring in the pleural sac. In this study, we used human and Spn cDNA microarrays to characterize the transcriptional responses occurring during initial contact between Spn and a human pleural mesothelial cell line (PMC in vitro. Using stringent filtering criteria, 42 and 23 Spn genes were up-and down-regulated respectively. In particular, genes encoding factors potentially involved in metabolic processes and Spn adherence to eukaryotic cells were up-regulated e.g. glnQ, glnA, aliA, psaB, lytB and nox. After Spn initial contact, 870 human genes were differentially regulated and the largest numbers of significant gene expression changes were found in canonical pathways for eukaryotic initiation factor 2 signaling (60 genes out of 171, oxidative phosphorylation (32/103, mitochondrial dysfunction (37/164, eIF4 and p70S6K signaling (28/142, mTOR signaling (27/182, NRF2-mediated oxidative stress response (20/177, epithelial adherens junction remodeling (11/66 and ubiquitination (22/254. The cellular response appeared to be directed towards host cell survival and defense. Spn did not activate NF-kB or phosphorylate p38 MAPK or induce cytokine production from PMC. Moreover, Spn infection of TNF-α pre-stimulated PMC inhibited production of IL-6 and IL-8 secretion by >50% (p<0.01. In summary, this descriptive study provides datasets and a platform for examining further the molecular mechanisms underlying the pathogenesis of empyema.

  15. Etiology of childhood community acquired pneumonia and its implications for vaccination

    Directory of Open Access Journals (Sweden)

    Nascimento-Carvalho Cristiana M.C.

    2001-01-01

    Full Text Available Pneumonia is an important cause of morbidity and mortality among children throughout the world. Vaccines are available for some organisms, but they are underutilized and/or still in development. To evaluate the potential impact of vaccines, we review studies in which the etiology of childhood community-acquired pneumonia was recorded. In North America and Europe (9 studies, the etiology of pneumonia was established in 62% of studied children (range 43%-88% by use of noninvasive specific methods for microbiologic diagnosis. The most often identified agents were S. pneumoniae (22%, respiratory syncytial virus (RSV (20%, Haemophilus influenzae (7%, and Mycoplasma pneumoniae (15%. In Africa and South America (8 studies, bacteria were recovered from 56% (range 32%-68% of severely ill children studied by lung aspirate. The most often isolated bacteria were Streptococcus pneumoniae (33% and Haemophilus influenzae (21%. A high percentage of H. influenzae strains were not serotype b. Throughout the world, children requiring hospitalization were most likely to have infection caused by pneumococcus H. influenzae or RSV. Out patients also had Mycoplasma pneumoniae. Countries in Africa and Asia recorded 2 to 10 times more children with pneumonia (7 to 40/100 annually than in the USA. Widespread use of pneumococcal and H. influenzae type b conjugate vaccines could reduce the frequency of childhood pneumonia by one-third. Further reduction will require development of non-type b H. influenzae, RSV and M. pneumoniae vaccines. This could result in a > 50% reduction of pneumonia in children. This goal should be sought and achieved as soon as possible.

  16. Indication for fiberoptic bronchoscopy in HIV-infected patients suspected for Pneumocystis carinii pneumonia

    DEFF Research Database (Denmark)

    Orholm, M; Lundgren, Jens Dilling; Nielsen, T L

    1990-01-01

    During a six-month period, 40 consecutive fiberoptic bronchoscopic procedures including bronchoalveolar lavage, bronchial brushing and forceps biopsy were performed in local anaesthesia on 34 HIV-infected males presenting symptoms compatible with Pneumocystis carinii pneumonia. In 23 examinations...... did not differ with regard to history, clinical examination, immunology, serology or chest radiograph. We conclude that fiberoptic bronchoscopy should be performed on wide indications in HIV-infected patients with symptoms compatible with P. carinii pneumonia. The procedure is easily performed...

  17. Nocardia brasiliensis Infection Complicating Cryptogenic Organizing Pneumonia.

    Science.gov (United States)

    Fernandes, Alison M; Sluzevich, Jason C; Mira-Avendano, Isabel

    2017-01-01

    Pulmonary nocardiosis is a severe and uncommon opportunistic infection caused by Nocardia species. We present a patient with cryptogenic organizing pneumonia who was receiving long-term immunosuppressive therapy, whose treatment course was complicated by cutaneous and pulmonary nocardiosis. Tissue cultures confirmed Nocardia brasiliensis . Nocardiosis should be a diagnostic consideration for patients treated with long-term immunosuppression who have worsening pulmonary symptoms and relapsing pustular skin lesions.

  18. Nocardia brasiliensis Infection Complicating Cryptogenic Organizing Pneumonia

    OpenAIRE

    Fernandes, Alison M.; Sluzevich, Jason C.; Mira-Avendano, Isabel

    2017-01-01

    Pulmonary nocardiosis is a severe and uncommon opportunistic infection caused by Nocardia species. We present a patient with cryptogenic organizing pneumonia who was receiving long-term immunosuppressive therapy, whose treatment course was complicated by cutaneous and pulmonary nocardiosis. Tissue cultures confirmed Nocardia brasiliensis. Nocardiosis should be a diagnostic consideration for patients treated with long-term immunosuppression who have worsening pulmonary symptoms and relapsing p...

  19. Detection of Mycoplasma pneumoniae by two polymerase chain reactions and role of M. pneumoniae in acute respiratory tract infections in pediatric patients

    NARCIS (Netherlands)

    Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H

    Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI

  20. Detection of IgM and IgG antibodies to Chlamydophila pneumoniae in pediatric community-acquired lower respiratory tract infections

    Directory of Open Access Journals (Sweden)

    Surinder Kumar

    2011-01-01

    Full Text Available Context: Chlamydophila pneumoniae (C. pneumoniae is an emerging infectious agent with a spectrum of clinical manifestations including lower and upper respiratory tract infections. Aims: To investigate the role of C. pneumoniae in community-acquired lower respiratory tract infections (LRTIs in children using serological tests. Settings and Design: Two hundred children, age 2 months to 12 years, hospitalized for community-acquired LRTIs were investigated for C. pneumoniae etiology. Materials and Methods: We investigated 200 children hospitalized for community-acquired LRTIs, using ELISA for detecting anti-C. pneumoniae IgM and IgG antibodies. The demographic, clinical and radiological findings for C. pneumoniae antibody positive and C. pneumoniae antibody negative cases were compared. Statistical Analysis Used: Data analysis was performed by Chi-square test and Fisher′s exact tests using Epi Info (2002. Results: Clinical and radiological findings in both the groups were comparable. Serological evidence of C. pneumoniae infection was observed in 12 (6% patients; specific IgM antibodies were detected in 11 (91.67%; specific IgG antibodies in 1 (8.33% patients, while 4-fold rise in C. pneumoniae IgG antibody titers were noted in none of the patients. Conclusions: C. pneumoniae has a role in community-acquired LRTIs, even in children aged < 5 years. Serological detection using ELISA would enable pediatricians in better management of C. pneumoniae infections.

  1. Combination vaccine against invasive meningococcal B and pneumococcal infections - Potential epidemiological and economic impact in The Netherlands

    NARCIS (Netherlands)

    Bos, J.M.; Rumke, H.C.; Welte, R.; Spanjaard, L.; van Alphen, L.; Postma, M.J.

    2006-01-01

    Background: Streptococcus pneumoniae and Neisseria meningitidis group B are among the main causes of invasive bacterial meningitis infections in infants. Worldwide, these diseases lead to significant mortality, morbidity and costs. The societal impact is especially severe since the majority of cases

  2. Ablation of the Leptin receptor in Myeloid Cells Impairs Pulmonary Clearance of Streptococcus Pneumoniae and Alveolar Macrophage Bactericidal Function.

    Science.gov (United States)

    Mancuso, Peter; Curtis, Jeffrey L; Freeman, Christine M; Peters-Golden, Marc; Weinberg, Jason B; Myers, Martin G

    2018-03-22

    Leptin is a pleiotropic hormone produced by white adipose tissue that regulates appetite and many physiologic functions including the immune response to infection. Genetic leptin deficiency in humans and mice impairs host defenses against respiratory tract infections. Since leptin deficiency is associated with obesity and other metabolic abnormalities, we generated mice that lack the leptin receptor (LepRb) in cells of the myeloid linage (LysM-LepRb-KO) to evaluate its impact in lean metabolically normal mice in a murine model of pneumococcal pneumonia. We observed higher lung and spleen bacterial burdens in LysM-LepRb-KO mice following an intratracheal challenge with S. pneumoniae. Although numbers of leukocytes recovered from bronchoalveolar lavage fluid did not differ between groups, we did observe higher levels of pulmonary IL-13 and TNFα in LysM-LepRb-KO mice 48 h post-infection. Phagocytosis and killing of ingested S. pneumoniae were also impaired in alveolar macrophages (AM)s from LysM-LepRb-KO mice in vitro, and was associated with reduced LTB4 and enhanced PGE2 synthesis in vitro. Pretreatment of AMs with LTB4 and the cyclooxygenase inhibitor, indomethacin, restored phagocytosis but not bacterial killing in vitro. These results, confirm our previous observations in leptin-deficient (ob/ob) and fasted mice, and demonstrate that decreased leptin action, as opposed to metabolic irregularities associated with obesity or starvation, are responsible for the defective host defense against pneumococcal pneumonia. They also provide novel targets for therapeutic intervention in humans with bacterial pneumonia.

  3. Acute Glomerulonephritis in a Child with Chlamydia pneumoniae Infection: A Case Report

    Directory of Open Access Journals (Sweden)

    Giovanna Vitaliti

    2013-01-01

    Full Text Available Background. Infectious diseases seem to be an important and independent risk factor for renal failure, but the underlying mechanism of renal involvement during some kinds of infectious diseases is still unclear, even if the literature data report immunomediated and/or autoimmune mechanisms to explain the pathogenic relationship between the two diseases. In paediatric patients, Chlamydia pneumoniae is a rare cause of renal complications and it may manifest in several ways, mainly involving the respiratory system, even if also renal and glomerulalr complications, have been described. Case Diagnosis/Treatment. Herein we report a case of a 3-year-old child who developed an acute glomerulonephritis that was chronologically, clinically, and biologically related to a previous Chlamydia pneumoniae infection. On our knowledge, in the literature it is the youngest patient with renal involvement during course of Chlamydia pneumoniae infection ever reported. Conclusions. The present case supports the hypothesis of a rather close causal relationship between this infective agent and renal and glomerular symptoms occurred in this child, during an acute episode of respiratory disease.

  4. Haemophilus influenzae pneumonia in human immunodeficiency virus-infected patients. The Grupo Andaluz para el Estudio de las Enfermedades Infecciosas.

    Science.gov (United States)

    Cordero, E; Pachón, J; Rivero, A; Girón, J A; Gómez-Mateos, J; Merino, M D; Torres-Tortosa, M; González-Serrano, M; Aliaga, L; Collado, A; Hernández-Quero, J; Barrera, A; Nuño, E

    2000-03-01

    Although Haemophilus influenzae is a common etiologic agent of pneumonia in patients infected with human immunodeficiency virus (HIV), the characteristics of this pneumonia have not been adequately assessed. We have prospectively studied features of H. influenzae pneumonia in 26 consecutive HIV-infected inpatients. Most of these patients were severely immunosuppressed; 73.1% had a CD4+ cell count caused by H. influenzae affects mainly patients with advanced HIV disease, and since its clinical and radiological features may be diverse, this etiology should be considered when pneumonia occurs in patients with advanced HIV infection. The mortality rate associated with H. influenzae pneumonia is not higher than that occurring in the general population.

  5. Nocardia brasiliensis Infection Complicating Cryptogenic Organizing Pneumonia

    Directory of Open Access Journals (Sweden)

    Alison M. Fernandes

    2017-01-01

    Full Text Available Pulmonary nocardiosis is a severe and uncommon opportunistic infection caused by Nocardia species. We present a patient with cryptogenic organizing pneumonia who was receiving long-term immunosuppressive therapy, whose treatment course was complicated by cutaneous and pulmonary nocardiosis. Tissue cultures confirmed Nocardia brasiliensis. Nocardiosis should be a diagnostic consideration for patients treated with long-term immunosuppression who have worsening pulmonary symptoms and relapsing pustular skin lesions.

  6. Impact of bacteremia on the pathogenesis of experimental pneumococcal meningitis

    DEFF Research Database (Denmark)

    Brandt, Christian T; Holm, David; Liptrot, Matthew

    2008-01-01

    BACKGROUND: Bacteremia plays a major role in the outcome of pneumococcal meningitis. This experimental study investigated how bacteremia influences the pathophysiologic profile of the brain. METHODS: Rats with Streptococcus pneumoniae meningitis were randomized to 1 of 3 groups of infected study...... rats: (1) rats with attenuated bacteremia resulting from intravenous injection of serotype-specific pneumococcal antibody, (2) rats with early-onset bacteremia resulting from concomitant intravenous infection, or (3) a meningitis control group. The blood-brain barrier (BBB) breakdown, ventricle size......, brain water distribution, and brain pathologic findings were analyzed using magnetic resonance morphological and functional imaging. Laboratory data and clinical disease scores were obtained. RESULTS: Attenuation of the bacteremic component of pneumococcal meningitis improved clinical disease symptoms...

  7. Predicting pneumococcal community-acquired pneumonia in the emergency department: evaluation of clinical parameters.

    Science.gov (United States)

    Huijts, S M; Boersma, W G; Grobbee, D E; Gruber, W C; Jansen, K U; Kluytmans, J A J W; Kuipers, B A F; Palmen, F; Pride, M W; Webber, C; Bonten, M J M

    2014-12-01

    The aim of this study was to quantify the value of clinical predictors available in the emergency department (ED) in predicting Streptococcus pneumoniae as the cause of community-acquired pneumonia (CAP). A prospective, observational, cohort study of patients with CAP presenting in the ED was performed. Pneumococcal aetiology of CAP was based on either bacteraemia, or S. pneumoniae being cultured from sputum, or urinary immunochromatographic assay positivity, or positivity of a novel serotype-specific urinary antigen detection test. Multivariate logistic regression was used to identify independent predictors and various cut-off values of probability scores were used to evaluate the usefulness of the model. Three hundred and twenty-eight (31.0%) of 1057 patients with CAP had pneumococcal CAP. Nine independent predictors for pneumococcal pneumonia were identified, but the clinical utility of this prediction model was disappointing, because of low positive predictive values or a small yield. Clinical criteria have insufficient diagnostic capacity to predict pneumococcal CAP. Rapid antigen detection tests are needed to diagnose S. pneumoniae at the time of hospital admission. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  8. CD4+ T-cell Responses Among Adults and Young Children In Response to Streptococcus pneumoniae and Haemophilus influenzae Vaccine Candidate Protein Antigens

    OpenAIRE

    Sharma, Sharad K.; Roumanes, David; Almudevar, Anthony; Mosmann, Tim R.; Pichichero, Michael E.

    2013-01-01

    We characterized cytokine profiles of CD4+ T-helper (h) cells in adults and young children to ascertain if responses occur to next-generation candidate vaccine antigens PspA, PcpA, PhtD, PhtE, Ply, LytB of Streptococcus pneumonia (Spn) and Protein D and OMP26 of non-typeable Haemophilus influenzae (NTHi). Adults had vaccine antigen-specific Th1 - and Th2 cells responsive to all antigens evaluated whereas young children had significant numbers of vaccine antigen-specific CD4+ T cells producing...

  9. Combination vaccine against invasive meningococcal B and pneumococcal infections: potential epidemiological and economic impact in the Netherlands

    NARCIS (Netherlands)

    Bos, Jasper M.; Rümke, Hans C.; Welte, Robert; Spanjaard, Lodewijk; van Alphen, Loek; Postma, Maarten J.

    2006-01-01

    Streptococcus pneumoniae and Neisseria meningitidis group B are among the main causes of invasive bacterial meningitis infections in infants. Worldwide, these diseases lead to significant mortality, morbidity and costs. The societal impact is especially severe since the majority of cases occur in

  10. Experimental corticosteroid induction of Pneumocystis carinii pneumonia in piglets

    DEFF Research Database (Denmark)

    Nielsen, Jens; Bille-Hansen, Vivi; Settnes, O.P.

    1999-01-01

    Animal models of Pneumocystis carinii (Pc) pneumonia (PCP) play a central role in research on the Pc microorganism itself and the disease, especially the pathogenesis and the host defence. The classic rat model with corticosteroid-induced reactivation of a latent infection has been most widely used...... of the frontal lung lobes and/or atelectatic looking diaphragmatic lobes. Histopathologically, there was a focal interstitial pneumonia. Alveolar walls and interstitia had mononuclear cell infiltrations and the alveolar lumina were occluded by foamy acidophilic honeycomb material with a varying number of Pc...

  11. In vivo capsular switch in Streptococcus pneumoniae--analysis by whole genome sequencing.

    Directory of Open Access Journals (Sweden)

    Fen Z Hu

    Full Text Available Two multidrug resistant strains of Streptococcus pneumoniae - SV35-T23 (capsular type 23F and SV36-T3 (capsular type 3 were recovered from the nasopharynx of two adult patients during an outbreak of pneumococcal disease in a New York hospital in 1996. Both strains belonged to the pandemic lineage PMEN1 but they differed strikingly in virulence when tested in the mouse model of IP infection: as few as 1000 CFU of SV36 killed all mice within 24 hours after inoculation while SV35-T23 was avirulent.Whole genome sequencing (WGS of the two isolates was performed (i to test if these two isolates belonging to the same clonal type and recovered from an identical epidemiological scenario only differed in their capsular genes? and (ii to test if the vast difference in virulence between the strains was mostly - or exclusively - due to the type III capsule. WGS demonstrated extensive differences between the two isolates including over 2500 single nucleotide polymorphisms in core genes and also differences in 36 genetic determinants: 25 of which were unique to SV35-T23 and 11 unique to strain SV36-T3. Nineteen of these differences were capsular genes and 9 bacteriocin genes.Using genetic transformation in the laboratory, the capsular region of SV35-T23 was replaced by the type 3 capsular genes from SV36-T3 to generate the recombinant SV35-T3* which was as virulent as the parental strain SV36-T3* in the murine model and the type 3 capsule was the major virulence factor in the chinchilla model as well. On the other hand, a careful comparison of strains SV36-T3 and the laboratory constructed SV35-T3* in the chinchilla model suggested that some additional determinants present in SV36 but not in the laboratory recombinant may also contribute to the progression of middle ear disease. The nature of this determinants remains to be identified.

  12. Severe Streptococcus infection in spotted hyenas in the Ngorongoro Crater, Tanzania.

    Science.gov (United States)

    Höner, Oliver P; Wachter, Bettina; Speck, Stephanie; Wibbelt, Gudrun; Ludwig, Arne; Fyumagwa, Robert D; Wohlsein, Peter; Lieckfeldt, Dietmar; Hofer, Heribert; East, Marion L

    2006-06-15

    In a population of spotted hyenas (Crocuta crocuta) monitored between 1996 and 2005 in the Ngorongoro Crater, Tanzania, 16 individuals from five of eight social groups displayed clinical signs of an infection, including severe unilateral swelling of the head followed by abscess formation at the mandibular angle, respiratory distress, mild ataxia, and lethargy. Two (12.5%) of these 16 individuals died within days of developing signs. Clinical signs in hyenas were first noted in 2001, and most cases occurred between September 2002 and February 2003, suggesting an outbreak of infection during this period. Histopathological examination of internal organs from one hyena that died with signs revealed morphological changes consistent with severe bacterial infection. Phenotypic examination and phylogenetic analysis of the 16S rRNA gene of the causative agent of infection revealed a Lancefield group C Streptococcus with a high level of homology to S. equi subsp. ruminatorum, a subspecies of S. equi recently described in domestic sheep (Ovis aries) and goats (Capra hircus) with mastitis in Spain. Strains similar to this bacterium were also isolated from two hyenas without obvious clinical signs, suggesting that hyenas may be 'carriers' of this bacterium, and from a sympatric Burchell's zebra (Equus burchelli), a herbivore species often consumed by hyenas. To our knowledge this is the first report of a Streptococcus infection in these two wildlife species. The high genetic similarity between the hyena and zebra isolates indicates that inter-specific transmission may occur, possibly when hyenas consume infected zebra carcasses.

  13. Streptococcus Agalactiae Research on Secretion Vaginal and Anal Pregnant Women of a City of Paulista Northwest

    Directory of Open Access Journals (Sweden)

    Cátia Rezende

    2015-12-01

    Full Text Available Streptococcus agalactiae has great medical importance in infections associated with severe neonatal morbidity and mortality. It is the most frequent bacterium isolated from the tables of septicemia, pneumonia and neonatal meningitis. This study aimed to determine the prevalence of anal and vaginal colonization of S. agalactiae in pregnant women at different gestational ages. We evaluated the incidence of colonization by S. agalactiae in 129 pregnant women of any age. Two samples of secretion were collected for culture: a perianal swab and a vaginal swab. Each of the two swabs were inoculated in test tubes containing Todd-Hewitt broth and subcultured on blood agar. After a period of 24 to 48 hours, the colonies suggestive of S. agalactiae were submitted to morfotintorial analysis and to biochemical tests for identification. Among 129 women studied, 3 (2.33% have tested positive for Streptococcus agalactiae and 126 (97.67% were negative. The results presented in this work are inferior to the data from other studies, however, the methodology used was compatible with most authors. Even so this rate is considered a relevant value taking into account the importance of Streptococcus agalactiae infections in pregnant women and newborns, emphasizing the importance of encouraging the culture of vaginal and anal secretion for the detection of Streptococcus agalactiae in surveys of prenatal care.

  14. Etiologic agents of central nervous system infections among febrile hospitalized patients in the country of Georgia.

    Directory of Open Access Journals (Sweden)

    Tamar Akhvlediani

    Full Text Available OBJECTIVES: There is a large spectrum of viral, bacterial, fungal, and prion pathogens that cause central nervous system (CNS infections. As such, identification of the etiological agent requires multiple laboratory tests and accurate diagnosis requires clinical and epidemiological information. This hospital-based study aimed to determine the main causes of acute meningitis and encephalitis and enhance laboratory capacity for CNS infection diagnosis. METHODS: Children and adults patients clinically diagnosed with meningitis or encephalitis were enrolled at four reference health centers. Cerebrospinal fluid (CSF was collected for bacterial culture, and in-house and multiplex RT-PCR testing was conducted for herpes simplex virus (HSV types 1 and 2, mumps virus, enterovirus, varicella zoster virus (VZV, Streptococcus pneumoniae, HiB and Neisseria meningitidis. RESULTS: Out of 140 enrolled patients, the mean age was 23.9 years, and 58% were children. Bacterial or viral etiologies were determined in 51% of patients. Five Streptococcus pneumoniae cultures were isolated from CSF. Based on in-house PCR analysis, 25 patients were positive for S. pneumoniae, 6 for N. meningitidis, and 1 for H. influenzae. Viral multiplex PCR identified infections with enterovirus (n = 26, VZV (n = 4, and HSV-1 (n = 2. No patient was positive for mumps or HSV-2. CONCLUSIONS: Study findings indicate that S. pneumoniae and enteroviruses are the main etiologies in this patient cohort. The utility of molecular diagnostics for pathogen identification combined with the knowledge provided by the investigation may improve health outcomes of CNS infection cases in Georgia.

  15. Etiologic Agents of Central Nervous System Infections among Febrile Hospitalized Patients in the Country of Georgia

    Science.gov (United States)

    Akhvlediani, Tamar; Bautista, Christian T.; Shakarishvili, Roman; Tsertsvadze, Tengiz; Imnadze, Paata; Tatishvili, Nana; Davitashvili, Tamar; Samkharadze, Tamar; Chlikadze, Rusudan; Dvali, Natia; Dzigua, Lela; Karchava, Mariam; Gatserelia, Lana; Macharashvili, Nino; Kvirkvelia, Nana; Habashy, Engy Emil; Farrell, Margaret; Rowlinson, Emily; Sejvar, James; Hepburn, Matthew; Pimentel, Guillermo; Dueger, Erica; House, Brent; Rivard, Robert

    2014-01-01

    Objectives There is a large spectrum of viral, bacterial, fungal, and prion pathogens that cause central nervous system (CNS) infections. As such, identification of the etiological agent requires multiple laboratory tests and accurate diagnosis requires clinical and epidemiological information. This hospital-based study aimed to determine the main causes of acute meningitis and encephalitis and enhance laboratory capacity for CNS infection diagnosis. Methods Children and adults patients clinically diagnosed with meningitis or encephalitis were enrolled at four reference health centers. Cerebrospinal fluid (CSF) was collected for bacterial culture, and in-house and multiplex RT-PCR testing was conducted for herpes simplex virus (HSV) types 1 and 2, mumps virus, enterovirus, varicella zoster virus (VZV), Streptococcus pneumoniae, HiB and Neisseria meningitidis. Results Out of 140 enrolled patients, the mean age was 23.9 years, and 58% were children. Bacterial or viral etiologies were determined in 51% of patients. Five Streptococcus pneumoniae cultures were isolated from CSF. Based on in-house PCR analysis, 25 patients were positive for S. pneumoniae, 6 for N. meningitidis, and 1 for H. influenzae. Viral multiplex PCR identified infections with enterovirus (n = 26), VZV (n = 4), and HSV-1 (n = 2). No patient was positive for mumps or HSV-2. Conclusions Study findings indicate that S. pneumoniae and enteroviruses are the main etiologies in this patient cohort. The utility of molecular diagnostics for pathogen identification combined with the knowledge provided by the investigation may improve health outcomes of CNS infection cases in Georgia. PMID:25369023

  16. Antibiotic Susceptibility of Periodontal Streptococcus Constellatus and Streptococcus Intermedius Clinical Isolates

    NARCIS (Netherlands)

    Rams, Thomas E; Feik, Diane; Mortensen, Joel E; Degener, John E; van Winkelhoff, Arie J

    2014-01-01

    Background: Streptococcus constellatus and Streptococcus intermedius in subgingival dental plaque biofilms may contribute to forms of periodontitis that resist treatment with conventional mechanical root debridement/surgical procedures and may additionally participate in some extraoral infections.

  17. Hypoxia determines survival outcomes of bacterial infection through HIF-1α-dependent reprogramming of leukocyte metabolism

    OpenAIRE

    Thompson, A.A.R.; Dickinson, R.S.; Murphy, F.; Thomson, J.P.; Marriott, H.M.; Tavares, A.; Willson, J.; Williams, L.; Lewis, A.; Mirchandani, A.; Coelho, P.D.S.; Doherty, C.; Ryan, E.; Watts, E.; Morton, N.M.

    2017-01-01

    Hypoxia and bacterial infection frequently coexist, in both acute and chronic clinical settings, and typically result in adverse clinical outcomes. To ameliorate this morbidity, we investigated the interaction between hypoxia and the host response. In the context of acute hypoxia, both Staphylococcus aureus and Streptococcus pneumoniae infections rapidly induced progressive neutrophil-mediated morbidity and mortality, with associated hypothermia and cardiovascular compromise. Preconditioning ...

  18. Etiology of severe pneumonia in Ecuadorian children.

    Directory of Open Access Journals (Sweden)

    Sivani Jonnalagadda

    Full Text Available In Latin America, community-acquired pneumonia remains a major cause of morbidity and mortality among children. Few studies have examined the etiology of pneumonia in Ecuador.This observational study was part of a randomized, double blind, placebo-controlled clinical trial conducted among children aged 2-59 months with severe pneumonia in Quito, Ecuador. Nasopharyngeal and blood samples were tested for bacterial and viral etiology by polymerase chain reaction. Risk factors for specific respiratory pathogens were also evaluated.Among 406 children tested, 159 (39.2% had respiratory syncytial virus (RSV, 71 (17.5% had human metapneumovirus (hMPV, and 62 (15.3% had adenovirus. Streptococcus pneumoniae was identified in 37 (9.2% samples and Mycoplasma pneumoniae in three (0.74% samples. The yearly circulation pattern of RSV (P = 0.0003 overlapped with S. pneumoniae, (P = 0.03 with most cases occurring in the rainy season. In multivariable analysis, risk factors for RSV included younger age (adjusted odds ratio [aOR] = 1.9, P = 0.01 and being underweight (aOR = 1.8, P = 0.04. Maternal education (aOR = 0.82, P = 0.003, pulse oximetry (aOR = 0.93, P = 0.005, and rales (aOR = 0.25, P = 0.007 were associated with influenza A. Younger age (aOR = 3.5, P = 0.007 and elevated baseline respiratory rate were associated with HPIV-3 infection (aOR = 0.94, P = 0.03.These results indicate the importance of RSV and influenza, and potentially modifiable risk factors including undernutrition and future use of a RSV vaccine, when an effective vaccine becomes available.ClinicalTrials.gov NCT 00513929.

  19. Sensitivity, Specificity, and Positivity Predictors of the Pneumococcal Urinary Antigen Test in Community-Acquired Pneumonia.

    Science.gov (United States)

    Molinos, Luis; Zalacain, Rafael; Menéndez, Rosario; Reyes, Soledad; Capelastegui, Alberto; Cillóniz, Catia; Rajas, Olga; Borderías, Luis; Martín-Villasclaras, Juan J; Bello, Salvador; Alfageme, Inmaculada; Rodríguez de Castro, Felipe; Rello, Jordi; Ruiz-Manzano, Juan; Gabarrús, Albert; Musher, Daniel M; Torres, Antoni

    2015-10-01

    Detection of the C-polysaccharide of Streptococcus pneumoniae in urine by an immune-chromatographic test is increasingly used to evaluate patients with community-acquired pneumonia. We assessed the sensitivity and specificity of this test in the largest series of cases to date and used logistic regression models to determine predictors of positivity in patients hospitalized with community-acquired pneumonia. We performed a multicenter, prospective, observational study of 4,374 patients hospitalized with community-acquired pneumonia. The urinary antigen test was done in 3,874 cases. Pneumococcal infection was diagnosed in 916 cases (21%); 653 (71%) of these cases were diagnosed exclusively by the urinary antigen test. Sensitivity and specificity were 60 and 99.7%, respectively. Predictors of urinary antigen positivity were female sex; heart rate≥125 bpm, systolic blood pressureantibiotic treatment; pleuritic chest pain; chills; pleural effusion; and blood urea nitrogen≥30 mg/dl. With at least six of all these predictors present, the probability of positivity was 52%. With only one factor present, the probability was only 12%. The urinary antigen test is a method with good sensitivity and excellent specificity in diagnosing pneumococcal pneumonia, and its use greatly increased the recognition of community-acquired pneumonia due to S. pneumoniae. With a specificity of 99.7%, this test could be used to direct simplified antibiotic therapy, thereby avoiding excess costs and risk for bacterial resistance that result from broad-spectrum antibiotics. We also identified predictors of positivity that could increase suspicion for pneumococcal infection or avoid the unnecessary use of this test.

  20. Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

    Directory of Open Access Journals (Sweden)

    A. Corso

    2009-03-01

    Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

  1. Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Mantese Orlando C.

    2003-01-01

    Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência

  2. Nasal immunization of mice with Lactobacillus casei expressing the Pneumococcal Surface Protein A: induction of antibodies, complement deposition and partial protection against Streptococcus pneumoniae challenge.

    Science.gov (United States)

    Campos, Ivana B; Darrieux, Michelle; Ferreira, Daniela M; Miyaji, Eliane N; Silva, Débora A; Arêas, Ana Paula M; Aires, Karina A; Leite, Luciana C C; Ho, Paulo L; Oliveira, Maria Leonor S

    2008-04-01

    Strategies for the development of new vaccines against Streptococcus pneumoniae infections try to overcome problems such as serotype coverage and high costs, present in currently available vaccines. Formulations based on protein candidates that can induce protection in animal models have been pointed as good alternatives. Among them, the Pneumococcal Surface Protein A (PspA) plays an important role during systemic infection at least in part through the inhibition of complement deposition on the pneumococcal surface, a mechanism of evasion from the immune system. Antigen delivery systems based on live recombinant lactic acid bacteria (LAB) represents a promising strategy for mucosal vaccination, since they are generally regarded as safe bacteria able to elicit both systemic and mucosal immune responses. In this work, the N-terminal region of clade 1 PspA was constitutively expressed in Lactobacillus casei and the recombinant bacteria was tested as a mucosal vaccine in mice. Nasal immunization with L. casei-PspA 1 induced anti-PspA antibodies that were able to bind to pneumococcal strains carrying both clade 1 and clade 2 PspAs and to induce complement deposition on the surface of the bacteria. In addition, an increase in survival of immunized mice after a systemic challenge with a virulent pneumococcal strain was observed.

  3. Development of infection with Streptococcus bovis and Aspergillus sp. in irradiated mice after glycopeptide therapy

    International Nuclear Information System (INIS)

    Brook, I.; Tom, S.P.; Ledney, G.D.

    1993-01-01

    The use of ofloxacin and glycopeptides was evaluated for the treatment of infections arising in C3H/HeN female mice irradiated with 8.3 Gy from a 60 Co source. The 21 day regimen began 72 h after irradiation when each of five sets of experimental animals received three antimicrobial therapy regimens and a saline-treated control group. With 40 mice in each group, 20 were used to monitor survival, 20 for the recovery of bacteria from the liver culture. Treatment groups were oral ofloxacin; oral or intramuscular vancomycin oral teicoplanin, ofloxacin and vancomycin; ofloxacin and teicoplanin; or saline. Bacteria recovered from saline treated mice were Enterobacteriaceae and Streptococcus spp. By comparison, fewer Enterobacteriaceae were isolated from ofloxacin treated mice and fewer Streptococcus spp. in both vancomycin and teicoplanin treated mice. However, glycopeptide-treated mice developed infection with Aspergillis fumigatus and glycopeptide resistant Streptococcus bovis. Mortality rates within 60 days of irradiation were 100% in all treatment and control groups with the exception of ofloxacin which was 25%-35%. These data suggest that glycopeptide therapy increases rates of systemic infection with fungi and antibiotic resistant bacteria in irradiated mice. (Author)

  4. Development of infection with Streptococcus bovis and Aspergillus sp. in irradiated mice after glycopeptide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Brook, I.; Tom, S.P.; Ledney, G.D. (Armed Forces Radiobiology Research Inst., Bethesda, MD (United States))

    1993-11-01

    The use of ofloxacin and glycopeptides was evaluated for the treatment of infections arising in C3H/HeN female mice irradiated with 8.3 Gy from a [sup 60]Co source. The 21 day regimen began 72 h after irradiation when each of five sets of experimental animals received three antimicrobial therapy regimens and a saline-treated control group. With 40 mice in each group, 20 were used to monitor survival, 20 for the recovery of bacteria from the liver culture. Treatment groups were oral ofloxacin; oral or intramuscular vancomycin oral teicoplanin, ofloxacin and vancomycin; ofloxacin and teicoplanin; or saline. Bacteria recovered from saline treated mice were Enterobacteriaceae and Streptococcus spp. By comparison, fewer Enterobacteriaceae were isolated from ofloxacin treated mice and fewer Streptococcus spp. in both vancomycin and teicoplanin treated mice. However, glycopeptide-treated mice developed infection with Aspergillis fumigatus and glycopeptide resistant Streptococcus bovis. Mortality rates within 60 days of irradiation were 100% in all treatment and control groups with the exception of ofloxacin which was 25%-35%. These data suggest that glycopeptide therapy increases rates of systemic infection with fungi and antibiotic resistant bacteria in irradiated mice. (Author).

  5. [Clinical evaluations of flomoxef in respiratory tract infections].

    Science.gov (United States)

    Mikasa, K; Sawaki, M; Ako, H; Narita, N

    1987-10-01

    Flomoxef (FMOX, 6315-S), a new antibacterial drug, was administered to 9 cases with respiratory tract infections for a duration of 8 approximately 16 days at a daily dose of 2 g. Diagnosis of these patients were bronchopneumonia 5 cases, chronic bronchitis 3 cases and acute bronchitis 1 case. From transtracheal aspiration several organisms were isolated; Haemophilus influenzae was isolated in 3 cases, Streptococcus pneumoniae in 3 cases, H. influenzae plus Branhamella catarrhalis in 1 case, Streptococcus dysgalactiae plus Neisseria meningitidis in 1 case and Corynebacterium pseudodiphtheriticum in 1 case. The clinical efficacy was good in all 9 cases, the efficacy rate was 100%. All the bacteria were eliminated. Side effects were not observed. From these results, it appears that FMOX is a valuable drug in the treatment of respiratory tract infections.

  6. Modulation of Quorum Sensing in a Gram Positive Pathogen by Linear Imprinted Copolymers with anti-Infective Properties

    NARCIS (Netherlands)

    Motib, Anfal; Guerreiro, Antonio; Al-Bayati, Firas; Piletska, Elena; Manzoor, Irfan; Shafeeq, Sulman; Kadam, Anagha; Kuipers, Oscar; Hiller, Luisa; Cowen, Todd; Piletsky, Sergey; Andrew, Peter; Yesilkaya, Hasan

    2017-01-01

    Here we describe the development, characterization and biological testing of a new type of linear molecularly imprinted polymer (LMIP) designed to act as anti-infective by blocking the quorum sensing (QS) mechanism and so preventing virulence of the pathogen Streptococcus pneumoniae. The LMIP is

  7. Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

    DEFF Research Database (Denmark)

    Wolter, Nicole; Smith, Anthony M; Farrell, David J

    2008-01-01

    A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...

  8. Rac1 regulates the NLRP3 inflammasome which mediates IL-1beta production in Chlamydophila pneumoniae infected human mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Julia Eitel

    Full Text Available Chlamydophila pneumoniae causes acute respiratory tract infections and has been associated with development of asthma and atherosclerosis. The production of IL-1β, a key mediator of acute and chronic inflammation, is regulated on a transcriptional level and additionally on a posttranslational level by inflammasomes. In the present study we show that C. pneumoniae-infected human mononuclear cells produce IL-1β protein depending on an inflammasome consisting of NLRP3, the adapter protein ASC and caspase-1. We further found that the small GTPase Rac1 is activated in C. pneumoniae-infected cells. Importantly, studies with specific inhibitors as well as siRNA show that Rac1 regulates inflammasome activation in C. pneumoniae-infected cells. In conclusion, C. pneumoniae infection of mononuclear cells stimulates IL-1β production dependent on a NLRP3 inflammasome-mediated processing of proIL-1β which is controlled by Rac1.

  9. Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

    Directory of Open Access Journals (Sweden)

    Teufert Karen

    2004-05-01

    Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

  10. Necrotizing soft tissue infections caused by Streptococcus pyogenes and Streptococcus dysgalactiae subsp. equisimilis of groups C and G in western Norway.

    Science.gov (United States)

    Bruun, T; Kittang, B R; de Hoog, B J; Aardal, S; Flaatten, H K; Langeland, N; Mylvaganam, H; Vindenes, H A; Skrede, S

    2013-12-01

    Streptococcus pyogenes (group A streptococcus, GAS) is a major cause of necrotizing soft tissue infection (NSTI). On rare occasions, other β-haemolytic streptococci may also cause NSTI, but the significance and nature of these infections has not been thoroughly investigated. In this study, clinical and molecular characteristics of NSTI caused by GAS and β-haemolytic Streptococcus dysgalactiae subsp. equisimilis of groups C and G (GCS/GGS) in western Norway during 2000-09 are presented. Clinical data were included retrospectively. The bacterial isolates were subsequently emm typed and screened for the presence of genes encoding streptococcal superantigens. Seventy cases were identified, corresponding to a mean annual incidence rate of 1.4 per 100 000. Sixty-one of the cases were associated with GAS, whereas GCS/GGS accounted for the remaining nine cases. The in-hospital case fatality rates of GAS and GCS/GGS disease were 11% and 33%, respectively. The GCS/GGS patients were older, had comorbidities more often and had anatomically more superficial disease than the GAS patients. High age and toxic shock syndrome were associated with mortality. The Laboratory Risk Indicator for Necrotizing Fasciitis laboratory score showed high values (≥6) in only 31 of 67 cases. Among the available 42 GAS isolates, the most predominant emm types were emm1, emm3 and emm4. The virulence gene profiles were strongly correlated to emm type. The number of superantigen genes was low in the four available GCS/GGS isolates. Our findings indicate a high frequency of streptococcal necrotizing fasciitis in our community. GCS/GGS infections contribute to the disease burden, but differ from GAS cases in frequency and predisposing factors. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  11. Limited Interactions between Streptococcus Suis and Haemophilus Parasuis in In Vitro Co-Infection Studies

    Science.gov (United States)

    Mathieu-Denoncourt, Annabelle; Letendre, Corinne; Auger, Jean-Philippe; Segura, Mariela; Aragon, Virginia; Lacouture, Sonia; Gottschalk, Marcelo

    2018-01-01

    Streptococcus suis and Haemophilus parasuis are normal inhabitants of the porcine upper respiratory tract but are also among the most frequent causes of disease in weaned piglets worldwide, causing inflammatory diseases such as septicemia, meningitis and pneumonia. Using an in vitro model of infection with tracheal epithelial cells or primary alveolar macrophages (PAMs), it was possible to determine the interaction between S. suis serotype 2 and H. parasuis strains with different level of virulence. Within H. parasuis strains, the low-virulence F9 strain showed higher adhesion levels to respiratory epithelial cells and greater association levels to PAMs than the high-virulence Nagasaki strain. Accordingly, the low-virulence F9 strain induced, in general, higher levels of pro-inflammatory cytokines than the virulent Nagasaki strain from both cell types. In general, S. suis adhesion levels to respiratory epithelial cells were similar to H. parasuis Nagasaki strain. Yet, S. suis strains induced a significantly lower level of pro-inflammatory cytokine expression from epithelial cells and PAMs than those observed with both H. parasuis strains. Finally, this study has shown that, overall and under the conditions used in the present study, S. suis and H. parasuis have limited in vitro interactions between them and use probably different host receptors, regardless to their level of virulence. PMID:29316613

  12. LocZ Is a New Cell Division Protein Involved in Proper Septum Placement in Streptococcus pneumoniae

    Science.gov (United States)

    Holečková, Nela; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

    2014-01-01

    ABSTRACT How bacteria control proper septum placement at midcell, to guarantee the generation of identical daughter cells, is still largely unknown. Although different systems involved in the selection of the division site have been described in selected species, these do not appear to be widely conserved. Here, we report that LocZ (Spr0334), a newly identified cell division protein, is involved in proper septum placement in Streptococcus pneumoniae. We show that locZ is not essential but that its deletion results in cell division defects and shape deformation, causing cells to divide asymmetrically and generate unequally sized, occasionally anucleated, daughter cells. LocZ has a unique localization profile. It arrives early at midcell, before FtsZ and FtsA, and leaves the septum early, apparently moving along with the equatorial rings that mark the future division sites. Consistently, cells lacking LocZ also show misplacement of the Z-ring, suggesting that it could act as a positive regulator to determine septum placement. LocZ was identified as a substrate of the Ser/Thr protein kinase StkP, which regulates cell division in S. pneumoniae. Interestingly, homologues of LocZ are found only in streptococci, lactococci, and enterococci, indicating that this close phylogenetically related group of bacteria evolved a specific solution to spatially regulate cell division. PMID:25550321

  13. Determination of Serotypes and Antibiotic Resistance in Streptococcus Pneumoniae

    Directory of Open Access Journals (Sweden)

    Deniz Akgun Karapinar

    2016-01-01

    Full Text Available Aim: In this study, the distribution of serogroup/serotype and antibiotic susceptibility testing of Streptococcus pneumoniae strains, recovered from pediatric and adult patients were evaluated. Material and Method: A total of 80 clinical isolates recovered from 19 pediatric and 61 adult patients were performed by latex aglutination method and antibiotic susceptibility tests in Istanbul University, Istanbul Faculty of Medicine, Medical Microbiology Laboratories. Results: Sixty-two strains (76 %, were serogroup/serotyped and 18 (23 % strains couldn%u2019t serogroup/serotyped. The most frequent identified serogroups were 19, 14, 23, 6, 4 in pediatrics, and 3, 19, 23 and 9 in adults. In adults, serogroups 3, 9, 5, 8, 18, 1, 15 were determined, but these serogroups weren%u2019t found in pediatrics. Vaccine serotypes rates were found as 53 % in pediatric and as 85 % in adults. The serogroups 2, 7, 10, 11, 12, 17, 20, 22, 33 were not detected, which are available in vaccine serotypes. Only 1 (1 % strain was found to exhibit low level resistance to penicillin and high level resistance wasn%u2019t found in any strain. Resistant results for trimethoprim-sulfamethoxazole, erythromycin, chloramphenicol and ofloxacin were found as 45 (56 %, 22 (27.5 %, 7 (9 %, 2 (2.5 %, respectively. All strains were found susceptible to vancomycin, linezolid and levofloxacin. The most resistant serogroups were 19, 23, 9 and 14 in the tested antibiotics. Multidrug resistance was found in 9 (11 % strains and these strains were found as serogroups 19, 23, 9, 6 and 14. Discussion: The epidemiological studies are important that the distribution of serotype and antibiotic resistance vary depending on many factors like age, and geographic region.

  14. Epidemiology of human coronavirus NL63 infection among hospitalized patients with pneumonia in Taiwan.

    Science.gov (United States)

    Huang, Su-Hua; Su, Mei-Chi; Tien, Ni; Huang, Chien-Jhen; Lan, Yu-Ching; Lin, Chen-Sheng; Chen, Chao-Hsien; Lin, Cheng-Wen

    2017-12-01

    Human coronavirus (HCoV) NL63 is recognized in association with upper or lower respiratory tract illnesses in children. This study surveyed the prevalence of HCoV-NL63 and influenza viruses in patients with influenza-like illness in Taiwan during 2010-2011. Throat samples from 107 hospitalized patients with pneumonia and 175 outpatients with influenza-like illness were examined using real-time polymerase chain reaction assays with virus-specific primers, and then virus-positive specimens were confirmed by sequencing the polymerase chain reaction products. HCoV-NL63 infection was identified in 8.4% (9/107) of hospitalized patients with pneumonia, but not found in outpatients with influenza-like illness. Age distribution of HCoV-NL63 infection in hospitalized patients with pneumonia indicated that the group aged 16-25 years (20%) had the highest positive rate compared with the other groups, and exhibited a similar age-specific pattern to influenza A/H1N1 infection, but not influenza A/H3N2 and B infections in hospitalized patients. Seasonal prevalence of HCoV-NL63 infection was late winter, overlapping the highest peak of the influenza A/H1N1 epidemic during December 2010 to March 2011 in Taiwan. Co-infection of HCoV-NL63 and influenza A/H1N1 was detected in three hospitalized patients. Clinical manifestation analysis indicated that the main symptoms for HCoV-NL63 infection included fever (88.9%), cough (77.8%), and pneumonia (100%). Co-infection caused significantly higher rates of breathing difficulties, cough, and sore throat than those of single infection with HCoV-NL63 and influenza A/H1N1. Phylogenetic analysis indicated a low level of heterogeneity between Taiwan and global HCoV-NL63 strains. Understanding epidemiology of HCoV-NL63 in Taiwan provides an insight for worldwide surveillance of HCoV-NL63 infection. Copyright © 2015. Published by Elsevier B.V.

  15. AbiA, a Lactococcal Abortive Infection Mechanism Functioning in Streptococcus thermophilus

    OpenAIRE

    Tangney, Mark; Fitzgerald, Gerald F.

    2002-01-01

    The lactococcal abortive infection mechanisms AbiA and AbiG were introduced into Streptococcus thermophilus 4035, and a range of phages capable of infecting this host were examined for sensitivity to these mechanisms. AbiA proved effective against six phages when examined at a growth temperature of 30°C but had no effect on any of the phages when tested at 37 or 42°C. AbiG failed to affect any of the S. thermophilus phages at 30, 37, or 42°C.

  16. AbiA, a lactococcal abortive infection mechanism functioning in Streptococcus thermophilus.

    Science.gov (United States)

    Tangney, Mark; Fitzgerald, Gerald F

    2002-12-01

    The lactococcal abortive infection mechanisms AbiA and AbiG were introduced into Streptococcus thermophilus 4035, and a range of phages capable of infecting this host were examined for sensitivity to these mechanisms. AbiA proved effective against six phages when examined at a growth temperature of 30 degrees C but had no effect on any of the phages when tested at 37 or 42 degrees C. AbiG failed to affect any of the S. thermophilus phages at 30, 37, or 42 degrees C.

  17. Group B streptococcus exploits vaginal epithelial exfoliation for ascending infection.

    Science.gov (United States)

    Vornhagen, Jay; Armistead, Blair; Santana-Ufret, Verónica; Gendrin, Claire; Merillat, Sean; Coleman, Michelle; Quach, Phoenicia; Boldenow, Erica; Alishetti, Varchita; Leonhard-Melief, Christina; Ngo, Lisa Y; Whidbey, Christopher; Doran, Kelly S; Curtis, Chad; Waldorf, Kristina M Adams; Nance, Elizabeth; Rajagopal, Lakshmi

    2018-04-09

    Thirteen percent of pregnancies result in preterm birth or stillbirth, accounting for fifteen million preterm births and three and a half million deaths annually. A significant cause of these adverse pregnancy outcomes is in utero infection by vaginal microorganisms. To establish an in utero infection, vaginal microbes enter the uterus by ascending infection; however, the mechanisms by which this occurs are unknown. Using both in vitro and murine models of vaginal colonization and ascending infection, we demonstrate how a vaginal microbe, group B streptococcus (GBS), which is frequently associated with adverse pregnancy outcomes, uses vaginal exfoliation for ascending infection. GBS induces vaginal epithelial exfoliation by activation of integrin and β-catenin signaling. However, exfoliation did not diminish GBS vaginal colonization as reported for other vaginal microbes. Rather, vaginal exfoliation increased bacterial dissemination and ascending GBS infection, and abrogation of exfoliation reduced ascending infection and improved pregnancy outcomes. Thus, for some vaginal bacteria, exfoliation promotes ascending infection rather than preventing colonization. Our study provides insight into mechanisms of ascending infection by vaginal microbes.

  18. Experimental alveolitis in rats: microbiological, acute phase response and histometric characterization of delayed alveolar healing.

    Science.gov (United States)

    Rodrigues, Moacyr Tadeu Vicente; Cardoso, Camila Lopes; Carvalho, Paulo Sérgio Perri de; Cestari, Tânia Mary; Feres, Magda; Garlet, Gustavo Pompermaier; Ferreira, Osny

    2011-01-01

    The pathogenesis of alveolitis is not well known and therefore experimental situations that mimic some features of this disease should be developed. In this study, the evolution of the experimentally induced infection in rat sockets is characterized, which leads to clinical signs of suppurative alveolitis with remarkable wound healing disturbs. Non-infected (Group I) and experimentally infected sockets in Rattus novergicus (Group II) were histometrically evaluated regarding the kinetics of alveolar healing. In addition, the characterization of the present bacteria in inoculation material and the serum levels of C-reactive protein (CRP) were performed. The detected species were Capnocytophaga ochracea, Fusobacterium nucleatum ss nucleatum, Prevotella melaninogenica, Streptococcus anginosus, Treponema socranskii and Streptococcus sanguis. All experimentally infected rats developed suppurative alveolitis, showing higher levels of CRP in comparison to those non-infected ones. Furthermore, infected rats presented a significant delayed wound healing as measured by the histometric analysis (higher persistent polymorphonuclear infiltrate and lower density of newly formed bone). These findings indicate that rat sockets with experimentally induced infection produced higher levels of serum CRP, showing the potential of disseminated infection and a disturb in the alveolar repair process in an interesting experimental model for alveolitis studies.

  19. Prevalence of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae isolates reported by laboratories in the southern and eastern Mediterranean region.

    Science.gov (United States)

    Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H

    2009-03-01

    Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.

  20. Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

    Directory of Open Access Journals (Sweden)

    Sonia Ktari

    2017-12-01

    Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

  1. Pneumonia in HIV-infected persons: increased risk with cigarette smoking and treatment interruption

    DEFF Research Database (Denmark)

    Gordin, Fred M; Roediger, Mollie P; Girard, Pierre-Marie

    2008-01-01

    RATIONALE: Bacterial pneumonia is a major cause of morbidity for HIV-infected persons and contributes to excess mortality in this population. OBJECTIVES: To evaluate the frequency and risk factors for occurrence of bacterial pneumonia in the present era of potent antiretroviral therapy. METHODS: We...... evaluated data from a randomized trial of episodic antiretroviral therapy. The study, Strategies for Management of Antiretroviral Therapy, enrolled 5,472 participants at 318 sites in 33 countries. Study patients had more than 350 CD4 cells at baseline. Diagnosis of bacterial pneumonia was confirmed...... by a blinded clinical-events committee. MEASUREMENTS AND MAIN RESULTS: During a mean follow-up of 16 months, 116 participants (2.2%) developed at least one episode of bacterial pneumonia. Patients randomized to receive episodic antiretroviral therapy were significantly more likely to develop pneumonia than...

  2. Secondary Bacterial Infections Associated with Influenza Pandemics

    Science.gov (United States)

    Morris, Denise E.; Cleary, David W.; Clarke, Stuart C.

    2017-01-01

    Lower and upper respiratory infections are the fourth highest cause of global mortality (Lozano et al., 2012). Epidemic and pandemic outbreaks of respiratory infection are a major medical concern, often causing considerable disease and a high death toll, typically over a relatively short period of time. Influenza is a major cause of epidemic and pandemic infection. Bacterial co/secondary infection further increases morbidity and mortality of influenza infection, with Streptococcus pneumoniae, Haemophilus influenzae, and Staphylococcus aureus reported as the most common causes. With increased antibiotic resistance and vaccine evasion it is important to monitor the epidemiology of pathogens in circulation to inform clinical treatment and development, particularly in the setting of an influenza epidemic/pandemic. PMID:28690590

  3. Secondary Bacterial Infections Associated with Influenza Pandemics

    Directory of Open Access Journals (Sweden)

    Denise E. Morris

    2017-06-01

    Full Text Available Lower and upper respiratory infections are the fourth highest cause of global mortality (Lozano et al., 2012. Epidemic and pandemic outbreaks of respiratory infection are a major medical concern, often causing considerable disease and a high death toll, typically over a relatively short period of time. Influenza is a major cause of epidemic and pandemic infection. Bacterial co/secondary infection further increases morbidity and mortality of influenza infection, with Streptococcus pneumoniae, Haemophilus influenzae, and Staphylococcus aureus reported as the most common causes. With increased antibiotic resistance and vaccine evasion it is important to monitor the epidemiology of pathogens in circulation to inform clinical treatment and development, particularly in the setting of an influenza epidemic/pandemic.

  4. The Receptor for Advanced Glycation End Products Impairs Host Defense in Pneumococcal Pneumonia

    NARCIS (Netherlands)

    van Zoelen, Marieke A. D.; Schouten, Marcel; de Vos, Alex F.; Florquin, Sandrine; Meijers, Joost C. M.; Nawroth, Peter P.; Bierhaus, Angelika; van der Poll, Tom

    2009-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia. The receptor for advanced glycation end products (RAGE) is a multiligand receptor that is expressed ubiquitously in the lungs. Engagement of RAGE leads to activation of multiple intracellular signaling pathways,

  5. A case of urticarial vasculitis in a female patient with lupus: Mycoplasma pneumoniae infection or lupus reactivation?

    Science.gov (United States)

    Diplomatico, Mario; Gicchino, Maria Francesca; Ametrano, Orsola; Marzuillo, Pierluigi; Olivieri, Alma Nunzia

    2017-05-01

    A 17-year-old female patient affected by systemic lupus erythematosus (SLE) (who had been taking 300 mg/die of hydroxychloroquine for 3 years), Graves' disease (treated with 10 mg/die of tapazole), and celiac disease came to our attention for urticarial vasculitis. She had been taking prednisone (25 mg/die) for 3 days, and her blood tests showed high levels of Mycoplasma pneumoniae IgM and IgG antibodies. The association between urticaria and M. pneumoniae infections can be present in up to 7% of the cases and, to the best of our knowledge, only two reports of urticarial vasculitis and M. pneumoniae in adults are available in the literature. Urticarial vasculitis can also be a rare cutaneous manifestation of SLE (affecting 2% of the patients), and our case is the first in the literature describing the coexistence of M. pneumoniae infection, SLE, and urticarial vasculitis in a pediatric patient, a case that rises an important differential diagnosis issue about the origin of urticarial vasculitis: SLE reactivation or urticarial vasculitis due to M. pneumoniae infection?

  6. Pneumonia due to Enterobacter cancerogenus infection.

    Science.gov (United States)

    Demir, Tülin; Baran, Gamze; Buyukguclu, Tuncay; Sezgin, Fikriye Milletli; Kaymaz, Haci

    2014-11-01

    Enterobacter cancerogenus (formerly known as CDC Enteric Group 19; synonym with Enterobacter taylorae) has rarely been associated with human infections, and little is known regarding the epidemiology and clinical significance of this organism. We describe a community-acquired pneumonia case in a 44-year-old female due to E. cancerogenus. Identification and antimicrobial susceptibility of the microorganism was performed by the automatized VITEK 2 Compact system (bioMerieux, France). The clinical case suggests that E. cancerogenus is a potentially pathogenic microorganism in determined circumstances; underlying diseases such as bronchial asthma, empiric antibiotic treatment, wounds, diagnostic, or therapeutic instruments.

  7. Gut Microbiota Contributes to Resistance Against Pneumococcal Pneumonia in Immunodeficient Rag-/- Mice.

    Science.gov (United States)

    Felix, Krysta M; Jaimez, Ivan A; Nguyen, Thuy-Vi V; Ma, Heqing; Raslan, Walid A; Klinger, Christina N; Doyle, Kristian P; Wu, Hsin-Jung J

    2018-01-01

    Streptococcus pneumoniae causes infection-related mortality worldwide. Immunocompromised individuals, including young children, the elderly, and those with immunodeficiency, are especially vulnerable, yet little is known regarding S. pneumoniae- related pathogenesis and protection in immunocompromised hosts. Recently, strong interest has emerged in the gut microbiota's impact on lung diseases, or the "gut-lung axis." However, the mechanisms of gut microbiota protection against gut-distal lung diseases like pneumonia remain unclear. We investigated the role of the gut commensal, segmented filamentous bacteria (SFB), against pneumococcal pneumonia in immunocompetent and immunocompromised mouse models. For the latter, we chose the Rag -/- model, with adaptive immune deficiency. Immunocompetent adaptive protection against S. pneumoniae infection is based on antibodies against pneumococcal capsular polysaccharides, prototypical T cell independent-II (TI-II) antigens. Although SFB colonization enhanced TI-II antibodies in C57BL/6 mice, our data suggest that SFB did not further protect these immunocompetent animals. Indeed, basal B cell activity in hosts without SFB is sufficient for essential protection against S. pneumoniae . However, in immunocompromised Rag -/- mice, we demonstrate a gut-lung axis of communication, as SFB influenced lung protection by regulating innate immunity. Neutrophil resolution is crucial to recovery, since an unchecked neutrophil response causes severe tissue damage. We found no early neutrophil recruitment differences between hosts with or without SFB; however, we observed a significant drop in lung neutrophils in the resolution phase of S. pneumoniae infection, which corresponded with lower CD47 expression, a molecule that inhibits phagocytosis of apoptotic cells, in SFB-colonized Rag -/- mice. SFB promoted a shift in lung neutrophil phenotype from inflammatory neutrophils expressing high levels of CD18 and low levels of CD62L, to pro

  8. [Macrolide-resistant Streptococcus pneumoniae on the islands of Gran Canaria and Lanzarote (Spain): molecular mechanisms and serogroup relationships].

    Science.gov (United States)

    Artiles, Fernando; Horcajada-Herrera, Iballa; Noguera-Catalán, Javier; Alamo-Antúnez, Isabel; Bordes-Benítez, Ana; Lafarga-Capuz, Bernardo

    2007-11-01

    Macrolide resistance in Streptococcus pneumoniae is coded by the ermB and mefA/E genes. The aim of this study was to determine the status of macrolide-resistance, the molecular mechanisms involved, the serogroup relationships, and the level of co-resistance in S. pneumoniae isolates from Gran Canaria and Lanzarote, in the Canary Islands, Spain. Macrolide resistance phenotypes were investigated in 261 S. pneumoniae clinical isolates over a two-year period (2004 and 2005). Genotypes were determined by PCR (detection of ermB and mefA/E genes). Overall macrolide resistance was 40.6% (106 isolates); 79.2% (84) of resistant isolates presented the MLSB phenotype (98.8% harbored the ermB gene), with a predominance of serogroup 19, and 20.8% (22) presented the M phenotype (77.3% displayed the mefA/E gene), all associated with serogroup 14. Worthy of note, the M phenotype was found in 8 invasive isolates from Lanzarote (80%) all from serogroup 14. The ermB and mefA/E genes were detected in 7 isolates belonging to serogroup 19. Absence of co-resistance was observed most frequently in serogroup 14 (66.7%). Co-resistance with penicillin G, tetracycline, and trimethoprim-sulfamethoxazole was associated with serogroup 19 (36.8%). Two isolates (0.8%) were resistant to telithromycin. The frequency of macrolide resistance mechanisms in the Canary Islands is different from that observed in the rest of Spain, particularly in Lanzarote, where 80% of isolates harbored the mefA/E gene and belonged to serogroup 14.

  9. A severe infective endocarditis successfully treated with linezolid

    Directory of Open Access Journals (Sweden)

    Graziano Antonio Minafra

    2010-03-01

    Full Text Available Despite significant improvements in surgical and medical therapy, prosthetic valve endocarditis (PVE is a diagnostic and therapeutic challenge and is often associated with a severe prognosis. We report a case of a 59-year-old woman, with  PVE and bacterial endocarditis (Streptococcus bovis successfully treated with linezolid. Linezolid is a bacteriostatic oxazolidinone antibiotic that has been proven to be effective for the treatment of patients with pneumonia, skin and soft tissue infections, and infections due to Gram-positive cocci. Linezolid is not yet recognised as a standard therapy for infective endocarditis, but its use becomes a necessity when infection is due to multidrug-resistant microorganisms.

  10. C-reactive protein, procalcitonin, clinical pulmonary infection score, and pneumonia severity scores in nursing home acquired pneumonia.

    Science.gov (United States)

    Porfyridis, Ilias; Georgiadis, Georgios; Vogazianos, Paris; Mitis, Georgios; Georgiou, Andreas

    2014-04-01

    Patients with nursing home acquired pneumonia (NHAP) present a distinct group of lower respiratory track infections with different risk factors, clinical presentation, and mortality rates. To evaluate the diagnostic value of clinical pulmonary infection score (CPIS), C-reactive protein, and procalcitonin and to compare the accuracy of pneumonia severity scores (confusion, urea nitrogen, breathing frequency, blood pressure, ≥ 65 y of age [CURB-65]; pneumonia severity index; NHAP index; systolic blood pressure, multilobar involvement, albumin, breathing frequency, tachycardia, confusion, oxygen, arterial pH [SMART-COP]; and systolic blood pressure, oxygen, age > 65 y, breathing frequency [SOAR]) in predicting in-patient mortality from NHAP. Nursing home residents admitted to the hospital with acute respiratory illness were enrolled in the study. Subjects were classified as having NHAP (Group A) or other pulmonary disorders (Group B). Clinical, imaging, and laboratory data were assessed to compute CPIS and severity scores. C-reactive protein and procalcitonin were measured by immunonephelometry and immunoassay, respectively. Fifty-eight subjects were diagnosed with NHAP (Group A) and 29 with other pulmonary disorders (Group B). The mean C-reactive protein ± SD was 16.38 ± 8.6 mg/dL in Group A and 5.2 ± 5.6 mg/dL in Group B (P 1.1 ng/mL was an independent predictor of in-patient mortality. Of the pneumonia severity scores, CURB-65 showed greater accuracy in predicting in-patient mortality (area under the curve of 0.68, 95% CI 0.53-0.84, P = .06). CPIS, procalcitonin, and C-reactive protein are reliable for the diagnosis of NHAP. Procalcitonin and CURB-65 are accurate in predicting in-patient mortality in NHAP.

  11. Pneumonia (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Pneumonia KidsHealth / For Parents / Pneumonia What's in this article? ... the Doctor? Print en español Neumonía What Is Pneumonia? Pneumonia is an infection of the lungs . The ...

  12. The potential of methylethylpiridinol in treatment of bacterial infections caused by Klebsiella pneumoniae (experimental study

    Directory of Open Access Journals (Sweden)

    V. M. Brykhanov

    2016-01-01

    Full Text Available Aim. Investigated the activity of methylethylpiridinol (6-methyl-2-ethyl-pyridin-3-ol hydrochloride in the comprehensive treatment of the experimental bacterial infection caused by Klebsiella pneumoniae.Materials and methods. The study was conducted on clinical isolates of Klebsiella pneumoniae. At the first stage of the study (in vitro studied the effect of methylethylpiridinol in concentrations 0,25–4 mM on the growth of the strain and the activity of the sublethal concentrations of antibiotics – gentamicin, ciprofloxacin, tetracycline, ceftazidime. In the second stage of the study (in vivo in rats Wistar simulated bacterial peritonitis by intraperitoneal injection of a suspension of Klebsiella pneumoniae and investigated the effect of methylethylpiridinol (80 mg/kg on the effectiveness of antibiotic therapy with gentamicin (30 mg/kg, ciprofloxacin (50 mg/kg, ceftazidime (120 mg/kg or tetracycline (80 mg/kg. The animal blood plasma was determined ceruloplasmin concentration (marker of the intensity of infectious-inflammatory process and thiobarbiturate-jet products, erythrocytes – the concentration of reduced glutathione, catalase and glutathione peroxidase.Results. It is found that a methylethylpiridinol inhibits the development of periodic bacterial cultures, but exhibits a pronounced antagonism with respect to gentamicin. Antioxidant slightly increases the activity of ciprofloxacin and tetracycline. The bacteriostatic effect of antioxidant reduces the action of ceftazidime in vitro. In conditions of chemotherapy by using of gentamicin and ciprofloxacin additional injection of methylethylpiridinol leads to the preservation of ceruloplasmin level to the level of non-treated animals without showing the antioxidant effect. Ceftazidime exhibits antioxidant effect, reduces the introduction of methylethylpiridinol. The antioxidant properties of methylethylpiridinol did not appear in the application of

  13. Hospital Outcomes of Adult Respiratory Tract Infections with Extended-Spectrum B-Lactamase (ESBL) Producing Klebsiella Pneumoniae

    OpenAIRE

    Loh, Li-Cher; Nor Izran Hanim bt Abdul Samad,; Rosdara Masayuni bt Mohd Sani,; Raman, Sree; Thayaparan, Tarmizi; Kumar, Shalini

    2007-01-01

    Klebsiella pneumoniae ranks high as a cause of adult pneumonia requiring hospitalization in Malaysia. To study whether extended-spectrum b-lactamase (ESBL) producing K. pneumoniae was linked to hospital outcomes, we retrospectively studied 441 cases of adult respiratory tract infections with microbial proven K. pneumoniae from an urban-based university teaching hospital between 2003 and 2004. 47 (10.6%) cases had ESBL. Requirement for ventilation and median length of hospital stay, were great...

  14. Streptococcus equi subspecies zooepidemicus Infections in Humans by Zoonotic Transmission from Horses

    Centers for Disease Control (CDC) Podcasts

    2013-06-12

    Dr. Mike Miller reads an abridged version of the Emerging Infectious Diseases’ article, Streptococcus equi subspecies zooepidemicus Infections in Humans by Zoonotic Transmission from Horses.  Created: 6/12/2013 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 7/3/2013.

  15. Unexplained Dyspnea in a Young Adult with Epstein–Barr Virus Infectious Mononucleosis: Pulmonary Involvement or Co-Infection with Mycoplasma pneumoniae Pneumonia?

    Science.gov (United States)

    Cunha, Burke A.; Herrarte Fornos, Scarlet

    2017-01-01

    Clinically, in young immunocompetent adults, Epstein-Barr virus (EBV) usually manifests as infectious mononucleosis (IM). Typical clinical findings of EBV IM include fever, profound fatigue, pharyngitis, bilateral posterior cervical adenopathy, and splenomegaly. Respiratory involvement with EBV IM may occur, but is distinctly rare. We present a case of a 20 year old female who with classic EBV IM, but was inexplicably dyspneic and hypoxemic. Further diagnostic testing confirmed co-infection with Mycoplasma pneumoniae. As a non-zoonotic atypical community-acquired pneumonia (CAP), M. pneumoniae may rarely be accompanied by severe hypoxemia and even acute respiratory distress syndrome. She represented a diagnostic dilemma regarding the cause of her hypoxemia, i.e., due to EBV IM with pulmonary involvement or severe M. pneumoniae CAP. The patient slowly recovered with respiratory quinolone therapy. PMID:28869530

  16. Unexplained Dyspnea in a Young Adult with Epstein-Barr Virus Infectious Mononucleosis: Pulmonary Involvement or Co-Infection with Mycoplasma pneumoniae Pneumonia?

    Science.gov (United States)

    Cunha, Burke A; Herrarte Fornos, Scarlet

    2017-09-04

    Clinically, in young immunocompetent adults, Epstein-Barr virus (EBV) usually manifests as infectious mononucleosis (IM). Typical clinical findings of EBV IM include fever, profound fatigue, pharyngitis, bilateral posterior cervical adenopathy, and splenomegaly. Respiratory involvement with EBV IM may occur, but is distinctly rare. We present a case of a 20 year old female who with classic EBV IM, but was inexplicably dyspneic and hypoxemic. Further diagnostic testing confirmed co-infection with Mycoplasma pneumoniae . As a non-zoonotic atypical community-acquired pneumonia (CAP), M. pneumoniae may rarely be accompanied by severe hypoxemia and even acute respiratory distress syndrome. She represented a diagnostic dilemma regarding the cause of her hypoxemia, i.e., due to EBV IM with pulmonary involvement or severe M. pneumoniae CAP. The patient slowly recovered with respiratory quinolone therapy.

  17. Familias de la proteína de superficie PspA de Streptococcus pneumoniae: Relación con serotipos y localización Pneumococcal surface protein A (PspA families: Relation with serotypes and clinical site of infection

    Directory of Open Access Journals (Sweden)

    Clara Mayoral

    2010-10-01

    . These properties convert PspA as ideal candidate for the formulation of a pneumococcal vaccine. Investigations of the PspA families were mostly carried out on prevalent serotypes in other countries. The aim of this study was to identify PspA families from Streptococcus pneumoniae isolates of our region as well as to associate them to prevalent serotypes or pathologies. We studied 70 isolates from pediatric patients with invasive infections. PCR was performed using specific primers for each family. In these studies we observed that 60% were PspA family 1, 34% were PspA family 2 and 6% remained unclassified. Serotypes 1 and 5 presented only family 1; serotypes 14, 6B, 19F y 18C showed genes from both families. Family 1 was observed respectively in 60 y 50% of pneumonias and meningitis. The family 2 was identified in 33 and 50% of pneumonias and meningitis. This information about the PspA family distribution could become a valuable contribution to develop an effective regional vaccine using recombinant PspA as immunogen.

  18. CHLAMYDIA PNEUMONIAE – THE PREVALENCE OF ANTIBODIES IN HEALTHY POPULATION AND IN PATIENTS WITH COMMUNITY ACQUIRED PNEUMONIA

    Directory of Open Access Journals (Sweden)

    Darja Keše

    2001-06-01

    Full Text Available Background. To determinate the prevalence rates of Chlamydia pneumoniae infections in Slovenia and to evaluate the importance of C. pneumoniae infections at patients with community acquired pneumonia (CAP.Materials and methods. With the microimmunofluorescence test (micro-IF we evaluated the presence of C. pneumoniae specific antibodies in 1036 healthy subjects, in two periods of time, in 1991–93 and 1997–1998. We also tested the pair sera collected from 2118 patients with CAP between 1993–1999.Results. We demonstrated that C. pneumoniae infections are common in our population, as we detected IgG antibodies in 43.1% of healthy population. The prevalence rate of C. pneumoniae infections statistically significant increased in two periods of time. Acute C. pneumoniae infections were proved in 15.9% of all patients with CAP.Conclusions. C. pneumoniae is important respiratory pathogen also in our community. The infections are more common in older patients. Because C. pneumoniae like other Chlamydia species has tendency to cause chronic disease, it is reasonable to diagnose this bacterium in respiratory patients. It is also recommended to test convalescent sera at serologic laboratory diagnosis.

  19. Epidemic of Mycoplasma pneumoniae infection in Denmark, 2010 and 2011

    DEFF Research Database (Denmark)

    Uldum, S A; Bangsborg, Jette Marie; Gahrn-Hansen, Bente

    2012-01-01

    Denmark experienced two waves of Mycoplasma pneumoniae infection during autumn and early winter in 2010 and 2011, respectively. Both affected the whole country. The proportion of positive results was almost the same for both, indicating that the two waves were probably of equal size. High macrolide...

  20. [Mycoplasma pneumoniae meningoencephalitis].

    Science.gov (United States)

    Cambonie, G; Sarran, N; Leboucq, N; Luc, F; Bongrand, A F; Slim, G; Lassus, P; Fournier-Favre, S; Montoya, F; Astruc, J; Rieu, D

    1999-03-01

    Severe central nervous system diseases, such as encephalitis, have been reported in association with Mycoplasma pneumoniae infections. After an ENT infection, a 9-year-old boy with Down's syndrome developed encephalitis revealed by an acute alteration in consciousness. Head computed tomography showed, after 2 weeks, an infiltration in the basal ganglia region. The diagnosis of Mycoplasma pneumoniae encephalitis was made; recovery was complete in a few weeks. Mycoplasma pneumoniae infection should be considered in all cases of acute encephalopathy; yet the pathogenesis of the disorder is unknown and the treatment uncertain.

  1. Systemic bacteraemia in children presenting with clinical pneumonia and the impact of non-typhoid salmonella (NTS).

    Science.gov (United States)

    Schwarz, Norbert G; Sarpong, Nimako; Hünger, Frank; Marks, Florian; Acquah, Samuel Ek; Agyekum, Alex; Nkrumah, Bernard; Loag, Wibke; Hagen, Ralf M; Evans, Jennifer A; Dekker, Denise; Fobil, Julius N; Meyer, Christian G; May, Jürgen; Adu-Sarkodie, Yaw

    2010-11-04

    The diagnosis and antimicrobial treatment of pneumonia in African children in the absence of diagnostic means such as x-ray facilities or microbiological laboratories relies primarily on clinical symptoms presented by the patients. In order to assess the spectrum of bacterial pathogens, blood cultures were performed in children fulfilling the clinical criteria of pneumonia. In total, 1032 blood cultures were taken from children between 2 months and 5 years of age who were admitted to a rural hospital in Ghana between September 2007 and July 2009. Pneumonia was diagnosed clinically and according to WHO criteria classified as "non-severe pneumonia" and "severe pneumonia" ("severe pneumonia" includes the WHO categories "severe pneumonia" and "very severe pneumonia"). The proportion of bacteriaemia with non-typhoid salmonella (NTS) was similar in children with pneumonia (16/173, 9.2%) compared to children hospitalized for other reasons (112/859, 13%). NTS were the predominant organisms isolated from children with clinical pneumonia and significantly more frequent than Streptococcus pneumoniae (8/173, 4.6%). Nine percent (9/101) of children presenting with severe pneumonia and 10% (7/72) of children with non-severe pneumonia were infected with NTS. Nineteen out of 123 NTS isolates (15%) were susceptible to aminopenicillins (amoxycillin/ampicillin), 23/127 (18%) to chlorampenicol, and 23/98 (23%) to co-trimoxazole. All NTS isolates were sensitive to ceftriaxone and ciprofloxacin. In Sub-saharan Africa, sepsis with NTS should be considered in children with symptoms of pneumonia and aminopenicillins might often not be the adequate drugs for treatment.

  2. Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Tijmen J Hommes

    Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

  3. AtlA Mediates Extracellular DNA Release, Which Contributes to Streptococcus mutans Biofilm Formation in an Experimental Rat Model of Infective Endocarditis.

    Science.gov (United States)

    Jung, Chiau-Jing; Hsu, Ron-Bin; Shun, Chia-Tung; Hsu, Chih-Chieh; Chia, Jean-San

    2017-09-01

    Host factors, such as platelets, have been shown to enhance biofilm formation by oral commensal streptococci, inducing infective endocarditis (IE), but how bacterial components contribute to biofilm formation in vivo is still not clear. We demonstrated previously that an isogenic mutant strain of Streptococcus mutans deficient in autolysin AtlA (Δ atlA ) showed a reduced ability to cause vegetation in a rat model of bacterial endocarditis. However, the role of AtlA in bacterial biofilm formation is unclear. In this study, confocal laser scanning microscopy analysis showed that extracellular DNA (eDNA) was embedded in S. mutans GS5 floes during biofilm formation on damaged heart valves, but an Δ atlA strain could not form bacterial aggregates. Semiquantification of eDNA by PCR with bacterial 16S rRNA primers demonstrated that the Δ atlA mutant strain produced dramatically less eDNA than the wild type. Similar results were observed with in vitro biofilm models. The addition of polyanethol sulfonate, a chemical lysis inhibitor, revealed that eDNA release mediated by bacterial cell lysis is required for biofilm initiation and maturation in the wild-type strain. Supplementation of cultures with calcium ions reduced wild-type growth but increased eDNA release and biofilm mass. The effect of calcium ions on biofilm formation was abolished in Δ atlA cultures and by the addition of polyanethol sulfonate. The VicK sensor, but not CiaH, was found to be required for the induction of eDNA release or the stimulation of biofilm formation by calcium ions. These data suggest that calcium ion-regulated AtlA maturation mediates the release of eDNA by S. mutans , which contributes to biofilm formation in infective endocarditis. Copyright © 2017 American Society for Microbiology.

  4. Identification of an N-terminal 27 kDa fragment of Mycoplasma pneumoniae P116 protein as specific immunogen in M. pneumoniae infections

    Directory of Open Access Journals (Sweden)

    Chourasia Bishwanath

    2010-12-01

    Full Text Available Abstract Background Mycoplasma pneumoniae is an important cause of respiratory tract infection and is increasingly being associated with other diseases such as asthma and extra-pulmonary complications. Considerable cross-reactivity is known to exist between the whole cell antigens used in the commercial serological testing assays. Identification of specific antigens is important to eliminate the risk of cross-reactions among different related organisms. Adherence of M. pneumoniae to human epithelial cells is mediated through a well defined apical organelle to which a number of proteins such as P1, P30, P116 and HMW1-3 have been localized, and are being investigated for adhesion, gliding and immunodiagnostic purposes. Methods A 609 bp fragment P116(N-27, corresponding to the N-terminal region of M. pneumoniae P116 gene was cloned and expressed. A C-terminal fragment P1(C-40, of P1 protein of M. pneumoniae was also expressed. Three IgM ELISA assays based on P116(N-27, P1(C-40 and (P116 (N-27 + P1(C-40 proteins were optimized and a detailed analysis comparing the reactivity of these proteins with a commercial kit was carried out. Comparative statistical analysis of these assays was performed with the SPSS version 15.0. Results The expressed P116(N-27 protein was well recognized by the patient sera and was immunogenic in rabbit. P1(C-40 of M. pneumoniae was also immunogenic in rabbit. In comparison to the reference kit, which is reported to be 100% sensitive and 75% specific, ELISA assay based on purified P116(N-27, P1(C-40 and (P116(N-27 + P1(C-40 proteins showed 90.3%, 87.1% and 96.8% sensitivity and 87.0%, 87.1% and 90.3% specificity respectively. The p value for all the three assays was found to be Conclusion This study shows that an N-terminal fragment of P116 protein holds a promise for serodiagnosis of M. pneumoniae infection. The IgM ELISA assays based on the recombinant proteins seem to be suitable for the use in serodiagnosis of acute M

  5. Outcome of meningitis caused by Streptococcus pneumoniae and Haemophilus influenzae type b in children in The Gambia.

    Science.gov (United States)

    Goetghebuer, T; West, T E; Wermenbol, V; Cadbury, A L; Milligan, P; Lloyd-Evans, N; Adegbola, R A; Mulholland, E K; Greenwood, B M; Weber, M W

    2000-03-01

    In developing countries, endemic childhood meningitis is a severe disease caused most commonly by Streptococcus pneumoniae or Haemophilus influenzae type b (Hib). Although many studies have shown that fatality rates associated with meningitis caused by these organisms are high in developing countries, little is known about the long-term outcome of survivors. The purpose of this study was to assess the importance of disabilities following pneumococcal and Hib meningitis in The Gambia. 257 children aged 0-12 years hospitalized between 1990 and 1995 with culture-proven S. pneumoniae (n = 134) or Hib (n = 123) meningitis were included retrospectively in the study. 48% of children with pneumococcal meningitis and 27% of children with Hib meningitis died whilst in hospital. Of the 160 survivors, 89 (55%) were followed up between September 1996 and October 1997. Of the children with pneumococcal meningitis that were traced, 58% had clinical sequelae; half of them had major disabilities preventing normal adaptation to social life. 38% of survivors of Hib meningitis had clinical sequelae, a quarter of whom had major disabilities. Major handicaps found were hearing loss, mental retardation, motor abnormalities and seizures. These data show that despite treatment with effective antibiotics, pneumococcal and Hib meningitis kill many Gambian children and leave many survivors with severe sequelae. Hib vaccination is now given routinely in The Gambia; an effective pneumococcal vaccine is needed.

  6. Aetiology and prediction of pneumonia in lower respiratory tract infection in primary care

    DEFF Research Database (Denmark)

    Holm, Anette; Nexoe, Joergen; Bistrup, Lene A

    2007-01-01

    of Infectious Diseases, Odense University Hospital, Denmark. METHOD: A total of 364 adults diagnosed with community-acquired LRTI by their GP were studied with chest radiography, vital signs, biochemical markers of inflammation (C-reactive protein [CRP] and leukocyte count), and microbiological examinations......BACKGROUND: Knowledge of predominant pathogens and their association with outcome are of importance for the management of lower respiratory tract infection (LRTI). As antibiotic therapy is indicated in pneumonia and not in acute bronchitis, a predictor of pneumonia is needed. AIM: To describe......; this emphasises the importance of coverage of S. pneumoniae when treatment is indicated. CRP should not be introduced for diagnosis of radiographic pneumonia in general practice before its use has been investigated in prospective, controlled intervention trials using CRP-guided treatment algorithms....

  7. Strain-specific virulence phenotypes of Streptococcus pneumoniae assessed using the Chinchilla laniger model of otitis media.

    Directory of Open Access Journals (Sweden)

    Michael L Forbes

    2008-04-01

    Full Text Available Streptococcus pneumoniae [Sp] infection is associated with local and systemic disease. Our current understanding of the differential contributions of genetic strain variation, serotype, and host response to disease phenotype is incomplete. Using the chinchilla model of otitis media [OM] we investigated the disease phenotype generated by the laboratory strain TIGR4 and each of thirteen clinical strains (BS68-75, BS290, BS291, BS293, BS436 and BS437; eleven of the thirteen strains have been genomically sequenced.For each strain 100 colony forming units were injected bilaterally into the tympanic bullae of 6 young adult chinchillas under general anesthesia. All animals were examined daily for local and systemic disease by a blinded observer. Pneumatic otoscopy was used to evaluate local disease, and behavioral assessments served as the measure of systemic disease. Virulence scoring was performed using a 4-point scale to assess four clinical parameters [severity and rapidity of local disease onset; and severity and rapidity of systemic disease onset] during a 10-day evaluation period. Highly significant variation was observed among the strains in their ability to cause disease and moribundity.As expected, there was a significant correlation between the rapidity of systemic disease onset and severity of systemic disease; however, there was little correlation between the severity of otoscopic changes and severity of systemic disease. Importantly, it was observed that different strains of the same serotype produced as broad an array of disease phenotypes as did strains of different serotypes. We attribute these phenotypic differences among the strains to the high degree of genomic plasticity that we have previously documented.

  8. Pneumonia caused by Pittsburgh pneumonia agent: radiologic manifestations

    International Nuclear Information System (INIS)

    Muder, R.R.; Reddy, S.C.; Yu, V.L.; Kroboth, F.J.

    1984-01-01

    Using an objective scoring system, chest radiographs were reviewed in 23 cases of pneumonia due to the Pittsburgh pneumonia agent (PPA, Tatlockia micdadei, Legionella micdadei), including six cases of pneumonia with simultaneous isolation of PPA and L pneumophila (Legionnaires' disease). Infiltrates were typically segmental to lobar; nodular infiltrates were noted in three cases. Spread to additional lobes after presentation occurred in four of 17 PPA infections. Pneumonia caused by both PPA and L pneumophila was unusually severe, with involvement of all lobes occurring in four of six cases, compared with one of 17 cases of PPA infection (p>0.02). Radiographic severity did not correlate with underlying disease, immune status, or outcome. The majority of patients receiving erythromycin demonstrated objective radiologic improvement. In a patients, population that included nonimmunosuppressed patient, nodule formation and rapid radiologic progression were not found to be characteristic of PPA pneumonia

  9. Udder infections with Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus uberis at calving in dairy herds with suboptimal udder health.

    Science.gov (United States)

    Lundberg, Å; Nyman, A-K; Aspán, A; Börjesson, S; Unnerstad, H Ericsson; Waller, K Persson

    2016-03-01

    Udder infections with Staphylococcus aureus, Streptococcus dysgalactiae, and Streptococcus uberis are common causes of bovine mastitis. To study these pathogens in early lactation, a 12-mo longitudinal, observational study was carried out in 13 herds with suboptimal udder health. The aims of the study were to investigate the occurrence of these pathogens and to identify if presence of the 3 pathogens, and of genotypes within the pathogens, differed with respect to herd, season, and parity. Quarter milk samples, collected at calving and 4 d in milk (DIM), were cultured for the 3 pathogens. Genotyping of staphylococcal and streptococcal isolates was performed using spa typing and pulsed-field gel electrophoresis, respectively. For each of the 3 pathogens, cows with an udder infection at calving or 4 DIM were allocated to 1 of 4 infection types: cleared (pathogen present only at calving), persistent (pathogen present in the same quarter at calving and 4 DIM), new (pathogen present only at 4 DIM), or cleared/new (pathogen present in 1 quarter at calving and in another quarter at 4 DIM). Associations between season or parity and overall occurrence of pathogens or infection types were determined using univariable mixed-effect logistic-regression models and the Fisher's exact test, respectively. The most commonly occurring pathogen was Staph. aureus, followed by Strep. dysgalactiae and Strep. uberis. Persistent infections were the most common infection type among Staph. aureus-infected cows, whereas cleared infections were the most common among Strep. dysgalactiae- and Strep. uberis-positive cows. The proportion of cows with persistent Staph. aureus infections and the proportion of cows having a Strep. uberis infection at calving or 4 DIM were higher in the multiparous cows than in primiparous cows. Infections with Strep. dysgalactiae were less common during the early housing season than during the late housing or pasture seasons, whereas persistent Strep. uberis

  10. Erythema Nodosum and Mycoplasma pneumoniae Infections in Childhood: Further Observations in Two Patients and a Literature Review.

    Science.gov (United States)

    Greco, Filippo; Catania, Roberta; Pira, Alice Le; Saporito, Marco; Scalora, Luisa; Aguglia, Maria Giovanna; Smilari, Pierluigi; Sorge, Giovanni

    2015-04-01

    Erythema nodosum (EN) is the most frequent panniculitis in childhood and has been associated with various conditions, such as infectious and autoimmune disorders, medications, and malignancies. The author reports on two children affected with EN associated with Mycoplasma pneumoniae infection, which occurred in one patient without pulmonary detection. The available literature on EN and M. pneumoniae infection in childhood is also reviewed.

  11. Focus on JNJ-Q2, a novel fluoroquinolone, for the management of community-acquired bacterial pneumonia and acute bacterial skin and skin structure infections

    Directory of Open Access Journals (Sweden)

    Jones TM

    2016-06-01

    Full Text Available Travis M Jones,1,2 Steven W Johnson,1,3 V Paul DiMondi,1,4 Dustin T Wilson,1,2 1Department of Pharmacy Practice, College of Pharmacy and Health Sciences, Campbell University, Buies Creek, 2Department of Pharmacy, Duke University Hospital, Durham, 3Department of Pharmacy, Forsyth Medical Center, Novant Health, Winston-Salem, 4Department of Pharmacy, Durham VA Medical Center, Durham, NC, USA Abstract: JNJ-Q2 is a novel, fifth-generation fluoroquinolone that has excellent in vitro and in vivo activity against a variety of Gram-positive and Gram-negative organisms. In vitro studies indicate that JNJ-Q2 has potent activity against pathogens responsible for acute bacterial skin and skin structure infections (ABSSSI and community-acquired bacterial pneumonia (CABP, such as Staphylococcus aureus and Streptococcus pneumoniae. JNJ-Q2 also has been shown to have a higher barrier to resistance compared to other agents in the class and it remains highly active against drug-resistant organisms, including methicillin-resistant S. aureus, ciprofloxacin-resistant methicillin-resistant S. aureus, and drug-resistant S. pneumoniae. In two Phase II studies, the efficacy of JNJ-Q2 was comparable to linezolid for ABSSSI and moxifloxacin for CABP. Furthermore, JNJ-Q2 was well tolerated, with adverse event rates similar to or less than other fluoroquinolones. With an expanded spectrum of activity and low potential for resistance, JNJ-Q2 shows promise as an effective treatment option for ABSSSI and CABP. Considering its early stage of development, the definitive role of JNJ-Q2 against these infections and its safety profile will be determined in future Phase III studies. Keywords: JNJ-Q2, fluoroquinolone, ABSSSI, CABP, MRSA

  12. Drug treatment of pneumococcal pneumonia in the elderly.

    Science.gov (United States)

    Neralla, Sridhar; Meyer, Keith C

    2004-01-01

    Streptococcus pneumoniae has been recognised as a major cause of pneumonia since the time of Sir William Osler. Drug-resistant S. pneumoniae (DRSP), which have gradually become resistant to penicillins as well as more recently developed macrolides and fluoroquinolones, have emerged as a consequence of indiscriminate use of antibacterials coupled with the ability of the pneumococcus to adapt to a changing antibacterial milieu. Pneumococci use cell wall choline components to bind platelet-activating factor receptors, colonise mucosal surfaces and evade innate immune defenses. Numerous virulence factors that include hyaluronidase, neuraminidase, iron-binding proteins, pneumolysin and autolysin then facilitate cytolysis of host cells and allow tissue invasion and bloodstream dissemination. Changes in pneumococcal cell wall penicillin-binding proteins account for resistance to penicillins, mutations in the ermB gene cause high-level macrolide resistance and mutations in topoisomerase IV genes coupled with GyrA gene mutations alter DNA gyrase and lead to high-level fluoroquinolone resistance. Risk factors for lower respiratory tract infections in the elderly include age-associated changes in oral clearance, mucociliary clearance and immune function. Other risks for developing pneumonia include poor nutrition, hypoalbuminaemia, bedridden status, aspiration, recent viral infection, the presence of chronic organ dysfunction syndromes including parenchymal lung disease and recent antibacterial therapy. Although the incidence of infections caused by DRSP is rising, the effect of an increase in the prevalence of resistant pneumococci on mortality is not clear. When respiratory infections occur, rapid diagnosis and prompt, empirical administration of appropriate antibacterial therapy that ensures adequate coverage of DRSP is likely to increase the probability of a successful outcome when treating community-acquired pneumonia in elderly patients, particularly those with multiple

  13. Prevention and treatment strategy in pregnant women with group B streptococcal infection.

    Science.gov (United States)

    Tevdorashvili, G; Tevdorashvili, D; Andghuladze, M; Tevdorashvili, M

    2015-04-01

    Group B streptococcus (GBS; Streptococcus agalactiae) are encapsulated gram-positive cocci belonging to Lancefield group B, that frequently colonizes the human genital and gastrointestinal tracts. It is an important cause of illness in three categories of population: infants, pregnant women, and adults with underlying medical conditions. In pregnant women and postpartum women, GBS is a frequent cause of asymptomatic bacteriuria, urinary tract infection, upper genital tract infection (i.e. intraamniotic infection or chorioamnionitis), postpartum endometritis (8%), pneumonia (2%), puerperal sepsis (2%), and bacteremia without a focal site (31%). It also can cause focal infections such as pneumonia, meningitis, and endocarditis, albeit rarely. Invasive maternal infection with GBS is associated with pregnancy loss and preterm delivery. Prior to the widespread use of maternal intrapartum chemoprophylaxis, maternal colonization with GBS conferred an increased risk of chorioamnionitis, and early postpartum infection. The serotype distribution of invasive GBS infection in pregnant women is similar to that of early-onset neonatal disease. The most common GBS serotypes causing invasive disease in adults and neonates are Ia, Ib, III, and V. Vaccination of adolescent women is considered an ideal solution. However, recent reports (April 2015) have shown that serotype IV GBS is emerging in pregnant carriers and causing infections in neonates and adults. This emergence is of concern because GBS conjugate vaccines that are being developed to prevent invasive disease may protect only against serotypes Ia, Ib, II, III, and V, or combinations thereof. Though research for the development of such a vaccine is underway, a good candidate vaccine has yet to surface.

  14. PASTA repeats of the protein kinase StkP interconnect cell constriction and separation of Streptococcus pneumoniae.

    Science.gov (United States)

    Zucchini, Laure; Mercy, Chryslène; Garcia, Pierre Simon; Cluzel, Caroline; Gueguen-Chaignon, Virginie; Galisson, Frédéric; Freton, Céline; Guiral, Sébastien; Brochier-Armanet, Céline; Gouet, Patrice; Grangeasse, Christophe

    2018-02-01

    Eukaryotic-like serine/threonine kinases (eSTKs) with extracellular PASTA repeats are key membrane regulators of bacterial cell division. How PASTA repeats govern eSTK activation and function remains elusive. Using evolution- and structural-guided approaches combined with cell imaging, we disentangle the role of each PASTA repeat of the eSTK StkP from Streptococcus pneumoniae. While the three membrane-proximal PASTA repeats behave as interchangeable modules required for the activation of StkP independently of cell wall binding, they also control the septal cell wall thickness. In contrast, the fourth and membrane-distal PASTA repeat directs StkP localization at the division septum and encompasses a specific motif that is critical for final cell separation through interaction with the cell wall hydrolase LytB. We propose a model in which the extracellular four-PASTA domain of StkP plays a dual function in interconnecting the phosphorylation of StkP endogenous targets along with septal cell wall remodelling to allow cell division of the pneumococcus.

  15. Recurrent Streptococcus pyogenes genital infection in a woman: test and treat the partner!

    Directory of Open Access Journals (Sweden)

    Emilienne Verkaeren

    2014-12-01

    Full Text Available Group A Streptococcus (GAS is a well-known cause of vulvovaginitis in prepubescent girls, but it is rarely described in adult women. We describe the case of a 64-year-old woman who presented with endometritis revealed by GAS bacteraemia, followed by recurrent vulvovaginitis due to a wild-type strain of GAS. She relapsed twice despite amoxicillin treatment. Her husband was found to be an asymptomatic carrier after GAS was identified in nasal and rectal swabs. She was cured after eradication of carriage in both herself and her husband with amoxicillin and rifampin. When recurrent Streptococcus pyogenes genital infections occur, test and treat the partner.

  16. Seasonal Variation of Escherichia coli, Staphylococcus aureus, and Streptococcus pneumoniae Bacteremia According to Acquisition and Patient Characteristics

    DEFF Research Database (Denmark)

    Gradel, Kim Oren; Nielsen, Stig Lønberg; Pedersen, Court

    2016-01-01

    subgroups by combining the following characteristics: species, acquisition, age group, gender, CCI level, and location of infection. Assuming a sinusoidal model, seasonal variation was assessed by the peak-to-trough (PTT) ratio with a 95% confidence interval (CI). RESULTS In total, we included 16,006 E...... variation was observed for S. aureus. S. pneumoniae showed high seasonal variation, which did not differ according to acquisition (overall PTT ratio, 3.42; 95% CI, 3.10-3.83). CONCLUSIONS Seasonal variation was mainly related to the species although the place of acquisition was important for E. coli. Infect....... coli, 6,924 S. aureus, and 4,884 S. pneumoniae bacteremia cases. For E. coli, the seasonal variation was highest for community-acquired cases (PTT ratio, 1.24; 95% CI, 1.17-1.32), was diminished for HCA (PTT ratio, 1.14; 95% CI, 1.04-1.25), and was missing for hospital-acquired cases. No seasonal...

  17. Limited Interactions between Streptococcus Suis and Haemophilus Parasuis in In Vitro Co-Infection Studies

    Directory of Open Access Journals (Sweden)

    Annabelle Mathieu-Denoncourt

    2018-01-01

    Full Text Available Streptococcus suis and Haemophilus parasuis are normal inhabitants of the porcine upper respiratory tract but are also among the most frequent causes of disease in weaned piglets worldwide, causing inflammatory diseases such as septicemia, meningitis and pneumonia. Using an in vitro model of infection with tracheal epithelial cells or primary alveolar macrophages (PAMs, it was possible to determine the interaction between S. suis serotype 2 and H. parasuis strains with different level of virulence. Within H. parasuis strains, the low-virulence F9 strain showed higher adhesion levels to respiratory epithelial cells and greater association levels to PAMs than the high-virulence Nagasaki strain. Accordingly, the low-virulence F9 strain induced, in general, higher levels of pro-inflammatory cytokines than the virulent Nagasaki strain from both cell types. In general, S. suis adhesion levels to respiratory epithelial cells were similar to H. parasuis Nagasaki strain. Yet, S. suis strains induced a significantly lower level of pro-inflammatory cytokine expression from epithelial cells and PAMs than those observed with both H. parasuis strains. Finally, this study has shown that, overall and under the conditions used in the present study, S. suis and H. parasuis have limited in vitro interactions between them and use probably different host receptors, regardless to their level of virulence.

  18. Streptococcus phocae infections associated with starvation in Cape fur seals : case report

    Directory of Open Access Journals (Sweden)

    M.M. Henton

    1999-07-01

    Full Text Available Mortalities and abortions associated with starvation occurred at Cape Cross, Namibia, in Cape fur seals (Arctocephalus pusillus pusillus. Affected seals showed lethargy and emaciation, and the most common pathological signs were those of a respiratory infection, both in adults and offspring. Streptococcus phocae was isolated from adult seals, a cub and aborted foetuses.

  19. [Microbiology of bronchoalveolar lavage in infants with bacterial community-acquired pneumonia with poor outcome].

    Science.gov (United States)

    García-Elorriaga, Guadalupe; Palma-Alaniz, Laura; García-Bolaños, Carlos; Ruelas-Vargas, Consuelo; Méndez-Tovar, Socorro; Del Rey-Pineda, Guillermo

    Community-acquired pneumonia (CAP) is one of the most common infectious causes of morbidity and mortality in children <5 years of age. The aim of the study was to clarify the bacterial etiologic diagnosis in infants with CAP. A prospective, cross-sectional and descriptive study in patients 6 months to 2 years 11 months of age with CAP with poor outcome was conducted. Patients were admitted to the Pediatric Pneumology Service and underwent bronchoscopy with bronchoalveolar lavage (BAL), taking appropriate measures during the procedure to limit the risk of contamination. Aerobic bacteria isolated were Moraxella sp. 23%, Streptococcus mitis 23%, Streptococcus pneumoniae 18%, Haemophilus influenzae 12%, Streptococcus oralis 12%, and Streptococcus salivarius 12%. In contrast to other reports, we found Moraxella sp. to be a major bacterial pathogen, possibly because of improved detection with bronchoscopy plus BAL. Copyright © 2015 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  20. Pneumonia (image)

    Science.gov (United States)

    Pneumonia is an inflammation of the lungs caused by an infection. Many different organisms can cause it, including bacteria, viruses, and fungi. Pneumonia is a common illness that affects millions of ...