
Sample records for streptococcus pneumoniae strain

  1. Pneumonia caused by a relatively resistant strain of Streptococcus pneumoniae. (United States)

    Davis, R L; Rompalo, A M; Tartaglione, T A


    A patient with pneumonia caused by a relatively resistant strain of Streptococcus pneumoniae that did not respond to prolonged therapy with intravenous ampicillin is described, and general principles of treatment for such cases are reviewed. The patient was a 16-month-old, 10-kg girl who was admitted to a hospital for treatment of severe smoke inhalation and burns. The patient was intubated immediately, but her respiratory status remained unstable. Chest roentgenograms showed numerous episodes of pneumonia; the organism was later identified as Strep. pneumoniae. Despite empiric therapy with ampicillin and tobramycin followed by a prolonged course of ampicillin and subsequent treatment with cefazolin, the patient's respiratory status did not improve, and she continued to have elevated temperatures. Strep. pneumoniae isolated from her blood was identified as relatively resistant to penicillin but sensitive to chloramphenicol. After a seven-day course of chloramphenicol, the patient recovered and was later discharged. Relatively resistant Strep. pneumoniae (RRSP) infections often occur at sites where high antibiotic concentrations are not achieved, such as in the CNS. Prior antibiotic therapy may increase or have no effect on the incidence of RRSP. The mechanism for RRSP is unknown, and these infections often are not detected until a patient has failed to respond to conventional therapy. Also, the incidence of RRSP has not been determined because many hospitals do not perform susceptibility tests for pneumococcal isolates routinely. Vancomycin or chloramphenicol may be alternates to penicillin for the treatment of RRSP, but antibiotic sensitivities should be determined for each isolate to ensure susceptibility.

  2. Effects of Streptococcus pneumoniae strain background on complement resistance.

    Directory of Open Access Journals (Sweden)

    Catherine Hyams

    Full Text Available BACKGROUND: Immunity to infections caused by Streptococcus pneumoniae is dependent on complement. There are wide variations in sensitivity to complement between S. pneumoniae strains that could affect their ability to cause invasive infections. Although capsular serotype is one important factor causing differences in complement resistance between strains, there is also considerable other genetic variation between S. pneumoniae strains that may affect complement-mediated immunity. We have therefore investigated whether genetically distinct S. pneumoniae strains with the same capsular serotype vary in their sensitivity to complement mediated immunity. METHODOLOGY AND PRINCIPAL FINDINGS: C3b/iC3b deposition and neutrophil association were measured using flow cytometry assays for S. pneumoniae strains with different genetic backgrounds for each of eight capsular serotypes. For some capsular serotypes there was marked variation in C3b/iC3b deposition between different strains that was independent of capsule thickness and correlated closely to susceptibility to neutrophil association. C3b/iC3b deposition results also correlated weakly with the degree of IgG binding to each strain. However, the binding of C1q (the first component of the classical pathway correlated more closely with C3b/iC3b deposition, and large differences remained in complement sensitivity between strains with the same capsular serotype in sera in which IgG had been cleaved with IdeS. CONCLUSIONS: These data demonstrate that bacterial factors independent of the capsule and recognition by IgG have strong effects on the susceptibility of S. pneumoniae to complement, and could therefore potentially account for some of the differences in virulence between strains.

  3. Lactobacillus pentosus strain b240 suppresses pneumonia induced by Streptococcus pneumoniae in mice. (United States)

    Tanaka, A; Seki, M; Yamahira, S; Noguchi, H; Kosai, K; Toba, M; Morinaga, Y; Miyazaki, T; Izumikawa, K; Kakeya, H; Yamamoto, Y; Yanagihara, K; Tashiro, T; Kohda, N; Kohno, S


    Oral administration of probiotics has been known to improve inflammatory responses against infectious diseases. Here, we describe the inhibitory effect of oral intake of heat-killed Lactobacillus pentosus strain b240 (b240) on pneumococcal pneumonia in a murine experimental model.  The mice treated with oral b240 for 21 days before Streptococcus pneumoniae infection exhibited prolonged survival time and less body weight loss, compared with saline-treated control mice. Mild pneumonia with significantly reduced secretion of inflammatory cytokines/chemokines according to related mitogen-activated protein kinase signalling molecules (phosphorylated c-Jun N-terminal kinase) was found in b240-treated mice, whereas severe pneumonia with hypercytokinemia was evident in control mice. Prominent reduction in the number of pneumococci and elevated expression of Toll-like receptor 2 and 4 in the lung tissues was concomitantly noted in b240-treated mice. These findings indicate that b240 has inhibitory effects on pneumococcal pneumonia induced by Strep. pneumoniae infection and improves inflammatory tissue responses, resulting in reduced damages to the respiratory tissues. These results demonstrate that oral administration of b240 might protect host animals from Strep. pneumoniae infection by augmentation of innate immune response. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  4. Decreased virulence of a pneumolysin-deficient strain of Streptococcus pneumoniae in murine meningitis. (United States)

    Wellmer, Andreas; Zysk, Gregor; Gerber, Joachim; Kunst, Tammo; Von Mering, Matthias; Bunkowski, Stefanie; Eiffert, Helmut; Nau, Roland


    Pneumolysin, neuraminidases A and B, and hyaluronidase are virulence factors of Streptococcus pneumoniae that appear to be involved in the pathogenesis of meningitis. In a murine model of meningitis after intracerebral infection using mutants of S. pneumoniae D39, only mice infected with a pneumolysin-deficient strain were healthier at 32 and 36 h, had lower bacterial titers in blood at 36 h, and survived longer than the D39 parent strain. Cerebellar and spleen bacterial titers, meningeal inflammation, and neuronal damage scores remained uninfluenced by the lack of any of the virulence factors.

  5. Evaluation and selection of tandem repeat loci for Streptococcus pneumoniae MLVA strain typing

    Directory of Open Access Journals (Sweden)

    Valjevac Samina


    Full Text Available Abstract Background Precise identification of bacterial pathogens at the strain level is essential for epidemiological purposes. In Streptococcus pneumoniae, the existence of 90 different serotypes makes the typing particularly difficult and requires the use of highly informative tools. Available methods are relatively expensive and cannot be used for large-scale or routine typing of any new isolate. We explore here the potential of MLVA (Multiple Loci VNTR Analysis; VNTR, Variable Number of Tandem Repeats, a method of growing importance in the field of molecular epidemiology, for genotyping of Streptococcus pneumoniae. Results Available genome sequences were searched for polymorphic tandem repeats. The loci identified were typed across a collection of 56 diverse isolates and including a group of serotype 1 isolates from Africa. Eventually a set of 16 VNTRs was proposed for MLVA-typing of S. pneumoniae. These robust markers were sufficient to discriminate 49 genotypes and to aggregate strains on the basis of the serotype and geographical origin, although some exceptions were found. Such exceptions may reflect serotype switching or horizontal transfer of genetic material. Conclusion We describe a simple PCR-based MLVA genotyping scheme for S. pneumoniae which may prove to be a powerful complement to existing tools for epidemiological studies. Using this technique we uncovered a clonal population of strains, responsible for infections in Burkina Faso. We believe that the proposed MLVA typing scheme can become a standard for epidemiological studies of S. pneumoniae.

  6. [Antibiotic resistance in Streptococcus pneumoniae strains isolated from sterile body sites]. (United States)

    Oznur, A K; Ozer, Serdar; Benzonana, Nur A


    Antibiotic resistance in Streptococcus pneumoniae has become an important issue in the last years. Penicillin resistance rates vary among countries and among different regions in countries. It is important to know penicillin resistance rates among isolates, in planning empirical antimicrobial therapy in pneumococcal infections. In this study, the antibiotic resistance rates of S. pneumoniae strains isolated from sterile body sites were investigated with both E-test and disc diffusion methods for penicillin, erythromycin, levofloxacin, and with only disc diffusion method for chloramphenicol, ceftriaxone, vancomycin, rifampin, trimethoprim-sulfamethoxazole (TMP-SMX), clindamycin, and tetracycline. A total of 165 strains were included into the study of which 52 were isolated from blood, 46 from cerebrospinal fluids, 25 from pleural fluids, 24 from dacryocystitis materials, 13 from tympanocentesis materials, 3 from joint fluids and 2 from wound specimens. Intermediate resistance to penicilin was 18.8%, while the resistance rates to TMP-SMX, tetracycline, chloramphenicol, erythromycin and levofloxacin were detected as 21.2%, 10.9%, 9.7%, 5.4% and 0.6%, respectively. None of the isolates were highly resistant to penicillin, nor resistant to vancomycin, ceftriaxone and rifampin. In conclusion, penicillin is still the first line therapeutic agent for pneumococcal infections except for severe infections such as meningitis, in our region.

  7. The impact of pneumolysin on the macrophage response to Streptococcus pneumoniae is strain-dependent.

    Directory of Open Access Journals (Sweden)

    Richard M Harvey

    Full Text Available Streptococcus pneumoniae is the world's leading cause of pneumonia, bacteremia, meningitis and otitis media. A major pneumococcal virulence factor is the cholesterol-dependent cytolysin, which has the defining property of forming pores in cholesterol-containing membranes. In recent times a clinically significant and internationally successful serotype 1 ST306 clone has been found to express a non-cytolytic variant of Ply (Ply306. However, while the pneumococcus is a naturally transformable organism, strains of the ST306 clonal group have to date been virtually impossible to transform, severely restricting efforts to understand the role of non-cytolytic Ply in the success of this clone. In this study isogenic Ply mutants were constructed in the D39 background and for the first time in the ST306 background (A0229467 to enable direct comparisons between Ply variants for their impact on the immune response in a macrophage-like cell line. Strains that expressed cytolytic Ply were found to induce a significant increase in IL-1β release from macrophage-like cells compared to the non-cytolytic and Ply-deficient strains in a background-independent manner, confirming the requirement for pore formation in the Ply-dependent activation of the NLRP3 inflammasome. However, cytolytic activity in the D39 background was found to induce increased expression of the genes encoding GM-CSF (CSF2, p19 subunit of IL-23 (IL23A and IFNβ (IFNB1 compared to non-cytolytic and Ply-deficient D39 mutants, but had no effect in the A0229467 background. The impact of Ply on the immune response to the pneumococcus is highly dependent on the strain background, thus emphasising the importance of the interaction between specific virulence factors and other components of the genetic background of this organism.

  8. Antimicrobial Resistant Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    B Khanal


    Full Text Available Introduction: Pneumococcal infections are important cause of morbidity and mortality. Knowledge of antimicrobial susceptibility patterns plays important role in the selection of appropriate therapy. Present study was undertaken to analyze the susceptibility patterns of pneumococcal isolates against commonly used antimicrobials with special reference to determination of minimum inhibitory concentration (MIC of penicillin in a tertiary care hospital in eastern Nepal. Methods: Twenty-six strains of S. pneumoniae isolated from various clinical specimens submitted to microbiology laboratory were evaluated. All isolates were tested for antimicrobial susceptibility by disk diffusion method. MIC of penicillin was tested by broth dilution method. Results: Of the total isolates 19 (73% were from invasive infections. Seven isolates were resistant to cotrimoxazole. No resistance to penicillin was seen in disk diffusion testing. Less susceptibility to penicillin (MIC 0.1-1.0 mg/L was observed in five (17% isolates. High level resistance to penicillin was not detected. One isolate was multidrug resistant. Conclusions: S. pneumoniaeisolates with intermediate resistance to penicillin prevail in Tertiary Care Hospital in eastern Nepal, causing invasive and noninvasive infections. As intermediate resistance is not detected in routine susceptibility testing, determination of MIC is important. It helps not only in the effective management of life threatening infections but is also essential in continuous monitoring and early detection of resistance. In addition, further study on pneumococcal infections, its antimicrobial resistance profile and correlation with clinical and epidemiological features including serotypes and group prevalence is recommended in future. Keywords: antimicrobial susceptibility pattern, penicillin, Streptococcus pneumoniae.

  9. Bacteremia with Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Christensen, J S; Jensen, T G; Kolmos, H J


    We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

  10. A Novel Metallo-β-Lactamase Involved in the Ampicillin Resistance of Streptococcus pneumoniae ATCC 49136 Strain.

    Directory of Open Access Journals (Sweden)

    Chia-Yu Chang

    Full Text Available Streptococcus pneumoniae, a penicillin-sensitive bacterium, is recognized as a major cause of pneumonia and is treated clinically with penicillin-based antibiotics. The rapid increase in resistance to penicillin and other antibiotics affects 450 million people globally and results in 4 million deaths every year. To unveil the mechanism of resistance of S. pneumoniae is thus an important issue to treat streptococcal disease that might consequently save millions of lives around the world. In this work, we isolated a streptococci-conserved L-ascorbate 6-phosphate lactonase, from S. pneumoniae ATCC 49136. This protein reveals a metallo-β-lactamase activity in vitro, which is able to deactivate an ampicillin-based antibiotic by hydrolyzing the amide bond of the β-lactam ring. The Michaelis parameter (Km = 25 μM and turnover number (kcat = 2 s-1 were obtained when nitrocefin was utilized as an optically measurable substrate. Through confocal images and western blot analyses with a specific antibody, the indigenous protein was recognized in S. pneumoniae ATCC 49136. The protein-overexpressed S. pneumonia exhibits a high ampicillin-tolerance ability in vivo. In contrast, the protein-knockout S. pneumonia reveals the ampicillin-sensitive feature relative to the wild type strain. Based on these results, we propose that this protein is a membrane-associated metallo-β-lactamase (MBL involved in the antibiotic-resistant property of S. pneumoniae.

  11. Identification and characterization of noncoding small RNAs in Streptococcus pneumoniae serotype 2 strain D39. (United States)

    Tsui, Ho-Ching Tiffany; Mukherjee, Dhriti; Ray, Valerie A; Sham, Lok-To; Feig, Andrew L; Winkler, Malcolm E


    We report a search for small RNAs (sRNAs) in the low-GC, gram-positive human pathogen Streptococcus pneumoniae. Based on bioinformatic analyses by Livny et al. (J. Livny, A. Brencic, S. Lory, and M. K. Waldor, Nucleic Acids Res. 34:3484-3493, 2006), we tested 40 candidates by Northern blotting and confirmed the expression of nine new and one previously reported (CcnA) sRNAs in strain D39. CcnA is one of five redundant sRNAs reported by Halfmann et al. (A. Halfmann, M. Kovacs, R. Hakenbeck, and R. Bruckner, Mol. Microbiol. 66:110-126, 2007) that are positively controlled by the CiaR response regulator. We characterized 3 of these 14 sRNAs: Spd-sr17 (144 nucleotides [nt]; decreased in stationary phase), Spd-sr37 (80 nt; strongly expressed in all growth phases), and CcnA (93 nt; induced by competence stimulatory peptide). Spd-sr17 and CcnA likely fold into structures containing single-stranded regions between hairpin structures, whereas Spd-sr37 forms a base-paired structure. Primer extension mapping and ectopic expression in deletion/insertion mutants confirmed the independent expression of the three sRNAs. Microarray analyses indicated that insertion/deletion mutants in spd-sr37 and ccnA exerted strong cis-acting effects on the transcription of adjacent genes, indicating that these sRNA regions are also cotranscribed in operons. Deletion or overexpression of the three sRNAs did not cause changes in growth, certain stress responses, global transcription, or virulence. Constitutive ectopic expression of CcnA reversed some phenotypes of D39 Delta ciaR mutants, but attempts to link CcnA to -E to comC as a target were inconclusive in ciaR(+) strains. These results show that S. pneumoniae, which lacks known RNA chaperones, expresses numerous sRNAs, but three of these sRNAs do not strongly affect common phenotypes or transcription patterns.

  12. Identification and Characterization of Noncoding Small RNAs in Streptococcus pneumoniae Serotype 2 Strain D39 ▿ †


    Tsui, Ho-Ching Tiffany; Mukherjee, Dhriti; Ray, Valerie A.; Sham, Lok-To; Feig, Andrew L.; Winkler, Malcolm E.


    We report a search for small RNAs (sRNAs) in the low-GC, Gram-positive human pathogen Streptococcus pneumoniae. Based on bioinformatic analyses by Livny et al. (J. Livny, A. Brencic, S. Lory, and M. K. Waldor, Nucleic Acids Res. 34:3484-3493, 2006), we tested 40 candidates by Northern blotting and confirmed the expression of nine new and one previously reported (CcnA) sRNAs in strain D39. CcnA is one of five redundant sRNAs reported by Halfmann et al. (A. Halfmann, M. Kovacs, R. Hakenbeck, an...

  13. streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

    African Journals Online (AJOL)


    ABSTRACT. This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate ...

  14. A variable region within the genome of Streptococcus pneumoniae contributes to strain-strain variation in virulence.

    Directory of Open Access Journals (Sweden)

    Richard M Harvey


    Full Text Available The bacterial factors responsible for the variation in invasive potential between different clones and serotypes of Streptococcus pneumoniae are largely unknown. Therefore, the isolation of rare serotype 1 carriage strains in Indigenous Australian communities provided a unique opportunity to compare the genomes of non-invasive and invasive isolates of the same serotype in order to identify such factors. The human virulence status of non-invasive, intermediately virulent and highly virulent serotype 1 isolates was reflected in mice and showed that whilst both human non-invasive and highly virulent isolates were able to colonize the murine nasopharynx equally, only the human highly virulent isolates were able to invade and survive in the murine lungs and blood. Genomic sequencing comparisons between these isolates identified 8 regions >1 kb in size that were specific to only the highly virulent isolates, and included a version of the pneumococcal pathogenicity island 1 variable region (PPI-1v, phage-associated adherence factors, transporters and metabolic enzymes. In particular, a phage-associated endolysin, a putative iron/lead permease and an operon within PPI-1v exhibited niche-specific changes in expression that suggest important roles for these genes in the lungs and blood. Moreover, in vivo competition between pneumococci carrying PPI-1v derivatives representing the two identified versions of the region showed that the version of PPI-1v in the highly virulent isolates was more competitive than the version from the less virulent isolates in the nasopharyngeal tissue, blood and lungs. This study is the first to perform genomic comparisons between serotype 1 isolates with distinct virulence profiles that correlate between mice and humans, and has highlighted the important role that hypervariable genomic loci, such as PPI-1v, play in pneumococcal disease. The findings of this study have important implications for understanding the processes that

  15. Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae




    Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

  16. Detection of Streptococcus pneumoniae DNA in blood cultures by PCR.


    Hassan-King, M; Baldeh, I; Secka, O; Falade, A; Greenwood, B


    We have developed a PCR assay, with primers derived from the autolysin (lyt) gene, for the detection of Streptococcus pneumoniae DNA in blood cultures. The predicted fragment of 247 bp was detected in all strains of pneumococci, embracing 12 different serotypes that were tested. Although DNA extracted from four viridans streptococci spp. Streptococcus oralis, Streptococcus mitis, Streptococcus sanguis, and Streptococcus parasanguis) gave amplification products, these were quite different from...

  17. Activity of LY333328 in Experimental Meningitis Caused by a Streptococcus pneumoniae Strain Susceptible to Penicillin (United States)

    Gerber, Joachim; Smirnov, Alexander; Wellmer, Andreas; Ragheb, Jasmin; Prange, Juliane; Schütz, Eckhardt; Wettich, Klaus; Kalich, Siegfried; Nau, Roland


    In a rabbit model of Streptococcus pneumoniae meningitis single doses of 10 and 2.5 mg of the glycopeptide LY333328 per kg of body weight reduced bacterial titers in cerebrospinal fluid (CSF) almost as rapidly as ceftriaxone at 10 mg/kg/h (changes in log CFU, −0.29 ± 0.21 and −0.26 ± 0.22 versus −0.34 ± 0.15/ml/h). A dose of 1 mg/kg was bacteriostatic (change in log CFU, 0.01 ± 0.11/ml/h). In two animals receiving LY333328 at a dose of 40 mg/kg the bacterial titers were reduced by 0.54 and 0.51 log CFU/ml/h. The penetration of CSF by LY333328 was 1 to 5%. The concentrations of lipoteichoic and teichoic acids in CSF and neuronal damage were similar in ceftriaxone- and LY333328-treated animals. PMID:11408247

  18. What is the mechanism for persistent coexistence of drug-susceptible and drug-resistant strains of Streptococcus pneumoniae? (United States)

    Colijn, Caroline; Cohen, Ted; Fraser, Christophe; Hanage, William; Goldstein, Edward; Givon-Lavi, Noga; Dagan, Ron; Lipsitch, Marc


    The rise of antimicrobial resistance in many pathogens presents a major challenge to the treatment and control of infectious diseases. Furthermore, the observation that drug-resistant strains have risen to substantial prevalence but have not replaced drug-susceptible strains despite continuing (and even growing) selective pressure by antimicrobial use presents an important problem for those who study the dynamics of infectious diseases. While simple competition models predict the exclusion of one strain in favour of whichever is ‘fitter’, or has a higher reproduction number, we argue that in the case of Streptococcus pneumoniae there has been persistent coexistence of drug-sensitive and drug-resistant strains, with neither approaching 100 per cent prevalence. We have previously proposed that models seeking to understand the origins of coexistence should not incorporate implicit mechanisms that build in stable coexistence ‘for free’. Here, we construct a series of such ‘structurally neutral’ models that incorporate various features of bacterial spread and host heterogeneity that have been proposed as mechanisms that may promote coexistence. We ask to what extent coexistence is a typical outcome in each. We find that while coexistence is possible in each of the models we consider, it is relatively rare, with two exceptions: (i) allowing simultaneous dual transmission of sensitive and resistant strains lets coexistence become a typical outcome, as does (ii) modelling each strain as competing more strongly with itself than with the other strain, i.e. self-immunity greater than cross-immunity. We conclude that while treatment and contact heterogeneity can promote coexistence to some extent, the in-host interactions between strains, particularly the interplay between coinfection, multiple infection and immunity, play a crucial role in the long-term population dynamics of pathogens with drug resistance. PMID:19940002

  19. Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

    NARCIS (Netherlands)

    W.T. Hendriksen (Wouter)


    textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

  20. M-ficolin binds selectively to the capsular polysaccharides of Streptococcus pneumoniae serotypes 19B and 19C and of a S. mitis strain

    DEFF Research Database (Denmark)

    Kjær, Troels Rønn; Hansen, Annette G; Sørensen, Uffe B S


    of infections. We investigated the binding selectivity by examining the binding of M-ficolin to a panel of more than 100 different streptococcal strains (Streptococcus pneumoniae and Streptococcus mitis) each expressing distinct polysaccharide structures. M-ficolin binding was observed for three strains only......, the pneumococcal serotypes 19B and 19C and a single mitis strain expressing a similar polysaccharide structure. The bound M-ficolin, in association with MASP-2, mediated complement factor C4 cleavage. Binding to the bacteria was inhibitable by N-acetyl glucosamine indicating that the interaction with the bacterial...... surface takes place via the fibrinogen-like domain. The common N-acetyl mannosamine residue present in the structures of the four capsular polysaccharides of group 19 is linked via a phosphodiester bond. This residue is apparently not a ligand for M-ficolin since the lectin binds to two of the group 19...

  1. Identification and Characterization of Noncoding Small RNAs in Streptococcus pneumoniae Serotype 2 Strain D39 ▿ † (United States)

    Tsui, Ho-Ching Tiffany; Mukherjee, Dhriti; Ray, Valerie A.; Sham, Lok-To; Feig, Andrew L.; Winkler, Malcolm E.


    We report a search for small RNAs (sRNAs) in the low-GC, Gram-positive human pathogen Streptococcus pneumoniae. Based on bioinformatic analyses by Livny et al. (J. Livny, A. Brencic, S. Lory, and M. K. Waldor, Nucleic Acids Res. 34:3484-3493, 2006), we tested 40 candidates by Northern blotting and confirmed the expression of nine new and one previously reported (CcnA) sRNAs in strain D39. CcnA is one of five redundant sRNAs reported by Halfmann et al. (A. Halfmann, M. Kovacs, R. Hakenbeck, and R. Bruckner, Mol. Microbiol. 66:110-126, 2007) that are positively controlled by the CiaR response regulator. We characterized 3 of these 14 sRNAs: Spd-sr17 (144 nucleotides [nt]; decreased in stationary phase), Spd-sr37 (80 nt; strongly expressed in all growth phases), and CcnA (93 nt; induced by competence stimulatory peptide). Spd-sr17 and CcnA likely fold into structures containing single-stranded regions between hairpin structures, whereas Spd-sr37 forms a base-paired structure. Primer extension mapping and ectopic expression in deletion/insertion mutants confirmed the independent expression of the three sRNAs. Microarray analyses indicated that insertion/deletion mutants in spd-sr37 and ccnA exerted strong cis-acting effects on the transcription of adjacent genes, indicating that these sRNA regions are also cotranscribed in operons. Deletion or overexpression of the three sRNAs did not cause changes in growth, certain stress responses, global transcription, or virulence. Constitutive ectopic expression of CcnA reversed some phenotypes of D39 ΔciaR mutants, but attempts to link CcnA to -E to comC as a target were inconclusive in ciaR+ strains. These results show that S. pneumoniae, which lacks known RNA chaperones, expresses numerous sRNAs, but three of these sRNAs do not strongly affect common phenotypes or transcription patterns. PMID:19854910

  2. Characteristics of Streptococcus pneumoniae Strains Colonizing Upper Respiratory Tract of Healthy Preschool Children in Poland

    Directory of Open Access Journals (Sweden)

    Izabela Korona-Glowniak


    Full Text Available Antibiotic resistant and invasive pneumococci may spread temporally and locally in day care centers (DCCs. We examined 267 children attending four DCCs located in the same city and 70 children staying at home in three seasons (autumn, winter, and spring to determine prevalence, serotype distribution, antibiotic resistance patterns, and transmission of pneumococcal strains colonizing upper respiratory tract of healthy children without antipneumococcal vaccination. By pheno- and genotyping, we determined clonality of pneumococci, including drug-resistant strains. The average carriage of pneumococci in three seasons was 38.2%. 73.4% and 80.4% of the isolates belonged to serotypes present in 10- and 13-valent conjugate vaccine, respectively. Among the pneumococcal strains, 33.3% were susceptible to all antimicrobial tested and 39.2% had decreased susceptibility to penicillin. Multidrug resistance was common (35.7%; 97.5% of drug-resistant isolates represented serotypes included to 10- and 13-valent conjugate vaccine. According to BOX-PCR, clonality definitely was observed only in case of serotype 14. Multivariate analysis determined DCC attendance as strongly related to pneumococcal colonization in all three seasons, but important seasonal differences were demonstrated. In children attending DCCs, we observed dynamic turnover of pneumococcal strains, especially penicillin nonsusceptible and multidrug resistant, which were mostly distributed among serotypes included to available pneumococcal conjugate vaccines.

  3. Seeing Streptococcus pneumoniae, a Common Killer Bacteria

    DEFF Research Database (Denmark)

    Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth


    of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer...

  4. Evolution of Streptococcus pneumoniae and its close commensal relatives

    DEFF Research Database (Denmark)

    Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise


    Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... killers worldwide. Population genetic analysis of 118 strains, supported by demonstration of a distinct cell wall carbohydrate structure and competence pheromone sequence signature, shows that S. pneumoniae is one of several hundred evolutionary lineages forming a cluster separate from Streptococcus...... oralis and Streptococcus infantis. The remaining lineages of this distinct cluster are commensals previously collectively referred to as Streptococcus mitis and each represent separate species by traditional taxonomic standard. Virulence genes including the operon for capsule polysaccharide synthesis...

  5. Development and evaluation of a novel vaccine against prevalent invasive multi-drug resistant strains of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Rehab H. Bahy


    Full Text Available Streptococcus pneumoniae is a pathogen that causes serious invasive infections, such as septicemia, meningitis and pneumonia in addition to mild upper respiratory tract infections. Protection from pneumococcal diseases is thought to be mediated mainly by serotype-specific antibodies to capsular antigens. Pneumococcal conjugate vaccine consists of sugars (polysaccharides from the capsule of the bacterium S. pneumoniae that are conjugated to a carrier protein. Three pneumococcal conjugated vaccines, each directed against a group of serotypes, are registered in Egypt; however, local vaccine production is required to cover the most prevalent serotypes. In this work, capsular polysaccharide from the most current and prevalent serotypes in Egypt were extracted, purified and conjugated to bovine serum albumin (BSA. The polysaccharide protein conjugate was purified through ultrafiltration technique and molecular size distribution was compared to an available vaccine. The immunogenicity of the prepared vaccine was examined via two methods: First, by measuring the levels of the elicited antibodies in the sera of the vaccinated mice; second, by challenging the vaccinated groups of mice with approximately 107 CFU of each specific serotype and determining the degree of protection the developled vaccine offers. Our results show that the developed conjugated capsular polysaccharide vaccine is highly immunogenic and protective in mice. This finding illustrates the importance of tracking the most recent and predominant peneumococcal serotypes to generate effective vaccines, instead of using expensive imported vaccines with large number of serotypes which might not be even present in the community.

  6. Clinical Features, Outcomes, and Costs of a Conjunctivitis Outbreak Caused by the ST448 Strain of Streptococcus pneumoniae (United States)

    Zegans, Michael E.; Sanchez, Paul A.; Likosky, Donald S.; Allar, Rory T.; Martin, Michael; Schwartzman, Joseph D.; Pryor, John H.; Turco, John H.; Whitney, Cynthia G.


    Purpose An outbreak of pneumococcal conjunctivitis occurred at Dartmouth College in 2002. We describe the clinical features, outcomes, and costs associated with this outbreak. Methods Six hundred ninety-eight students were diagnosed with conjunctivitis; culture of conjunctival discharge was obtained for 254. A screening protocol was used to evaluate 67 patients. A retrospective survey was offered to all 698 cases and follow-up clinical examination to all patients with culture-confirmed infection (n = 110). Local ophthalmology offices were contacted to develop a cost analysis. The college health service provided conjunctivitis data for nonoutbreak years. Results Of 67 patients evaluated using the screening protocol, findings associated with culture-confirmed Streptococcus pneumoniae conjunctivitis (P conjunctivitis at Dartmouth College. A screening protocol was effective at identifying culture-positive cases. Although most culture-positive patients experienced bilateral conjunctivitis, the clinical course was mild with quick resolution of symptoms after initiating antibiotics and no ocular sequelae. PMID:19421049

  7. Streptococcus pneumoniae and the host cell

    NARCIS (Netherlands)

    Gradstedt, Per Henrik


    Streptococcus pneumoniae is een bacterie die in de menselijke keel-neusholte voorkomt. Vaak is zij ongevaarlijk, maar soms kan zij van leefomgeving veranderen en zich als invasieve ziekteverwekker door het lichaam verspreiden. Dan kan de bacterie longontsteking, bloedvergiftiging of

  8. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)



    Oct 5, 2011 ... detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens .... ventional bacteriological techniques. Therefore, this is ..... Manual of Clinical Microbiology.9th ed. ASM press.

  9. Recombinant expression of Streptococcus pneumoniae capsular polysaccharides in Escherichia coli.


    Kay, EJ; Yates, LE; Terra, VS; Cuccui, J.; Wren, BW


    Currently, Streptococcus pneumoniae is responsible for over 14 million cases of pneumonia worldwide annually, and over 1 million deaths, the majority of them children. The major determinant for pathogenesis is a polysaccharide capsule that is variable and is used to distinguish strains based on their serotype. The capsule forms the basis of the pneumococcal polysaccharide vaccine (PPV23) that contains purified capsular polysaccharide from 23 serotypes, and the pneumococcal conjugate vaccine (...

  10. Antibiotic resistant profile of Streptococcus pneumoniae from the ...

    African Journals Online (AJOL)

    Background: Antimicrobial resistance in Streptococcus pneumoniae has compromised the effectiveness of therapy for pneumococcal diseases and asymptomatic nasopharyngeal carriers play an important role in transmission of resistant strains. Method: Eighty-eight volunteer students attending 2 secondary schools in Jos, ...

  11. Erythromycin-nonsusceptible Streptococcus pneumoniae in Children, 1999–2001


    McEllistrem, M. Catherine; Adams, Jennifer M.; Shutt, Kathleen; Sanza, Laurie T.; Facklam, Richard R.; Whitney, Cynthia G.; Jorgensen, James H.; Harrison, Lee H.


    After increasing from 1995 to 1999, invasive erythromycin-nonsusceptible Streptococcus pneumoniae rates per 100,000 decreased 53.6% in children from Baltimore, Maryland (US), from 1999 to 2001, which was partially attributed to strains related to the mefE-carrying England14-9 clone. The decline in infection rates was likely due to the pneumococcal 7-valent conjugate vaccine.

  12. Detection and quantification of Streptococcus pneumoniae from ...

    African Journals Online (AJOL)

    The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

  13. Streptococcus pneumoniae colonization in remote African Pygmies

    NARCIS (Netherlands)

    Schaumburg, Frieder; Alabi, Abraham; von Eiff, Christof; Flamen, Arnaud; Traore, Hafsatou; Grobusch, Martin Peter; Peters, Georg; Kremsner, Peter Gottfried; van der Linden, Mark


    African Pygmies have many risk factors for invasive pneumococcal disease (IPD), such as low socioeconomic status and low quality of health care. We characterized Streptococcus pneumoniae from Gabonese Pygmies and analyzed risk factors for S. pneumoniae carriage to improve prophylaxis and therapy of

  14. Biochemical, genetic, and serological characterization of two capsule subtypes among Streptococcus pneumoniae Serotype 20 strains: discovery of a new pneumococcal serotype. (United States)

    Calix, Juan J; Porambo, Richard J; Brady, Allison M; Larson, Thomas R; Yother, Janet; Abeygunwardana, Chitrananda; Nahm, Moon H


    The bacterial pathogen Streptococcus pneumoniae expresses one of over 90 structurally distinct polysaccharide (PS) capsule serotypes. Prior PS structural analyses of the vaccine-associated serotype 20 do not agree with reports describing the genes that mediate capsule synthesis. Furthermore, using immunized human sera-based assays, serological differences were recently noted among strains typed as serotype 20. We examined the capsule structures of two serologically dissimilar serotype 20 strains, 20α and 20β, by extensive biochemical analysis. 20α PS was composed of the previously described serotype 20 hexasaccharide repeat unit, whereas the 20β PS was composed of a novel heptasaccharide repeat unit containing an extra branching α-glucose residue. Genetic analysis of the subtypes revealed that 20α may have arisen from a 20β progenitor following loss of function mutation to the glycosyltransferase gene whaF. Conventional serotyping methods using rabbit polyclonal or mouse monoclonal antibodies were unable to distinguish the subtypes. However, genetic analysis of multiple "serotype 20" clinical isolates revealed that all strains contain the 20β genotype. We propose naming bacteria that express the previously described 20α capsule structure 20A and bacteria that express the novel 20β capsule structure 20B, a new pneumococcal serotype.

  15. [Comparison of clinical presentation of mixed pneumonia with Chlamydia pneumoniae and Streptococcus pneumoniae and S. pneumoniae pneumonia]. (United States)

    Fukano, Hiroshi; Miyashita, Naoyuki; Mimura, Kimihiro; Mouri, Keiji; Yoshida, Kouichiro; Kobashi, Yoshihiro; Niki, Yoshihito; Matsushima, Toshiharu


    Chlamydia pneumoniae is a significant cause of both lower and upper acute respiratory illnesses, including community-acquired pneumonia. Furthermore, C. pneumoniae has been reported to frequently cause pneumonia in association with other respiratory pathogens, mainly Streptococcus pneumoniae. In this study, we investigated the clinical presentation of mixed pneumonia with Chlamydia pneumoniae and S. pneumoniae and compared it with S. pneumoniae pneumonia. A total of 13 cases of mixed pneumonia and 58 cases of S. pneumoniae pneumonia identified at Kawasaki Medical School and related hospitals between April 1996 and March 2001 were analyzed. The diagnosis of C. pneumoniae infection was based on isolation and serologic testing of antibodies by the microimmunofluorescence test. The clinical presentation of mixed pneumonia and S. pneumoniae pneumonia was almost identical and no statistical differences were observed between the two groups. This is the same as what was observed before except eleven out of the 13 of the mixed pneumonia patients responded to treatment with only beta-lactam antibiotics. Our results indicated that C. pneumoniae may not be the primary cause of community-acquired pneumonia but it might descript the normal clearance mechanisms, enabling other pathogens to invade.

  16. Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

    DEFF Research Database (Denmark)

    Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie


    A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....


    NARCIS (Netherlands)

    Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.


    The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are


    African Journals Online (AJOL)

    This is a review of literature on the epidemiology, mechanism of resistance, laboratory identification, treatment, prevention and control of Penicillin Resistant Pneumococci (PRP), with emphasis on the problems of identification and reporting in developing countries. Key Words: penicillin, Streptococcus pneumoniae, resistant ...

  19. Streptococcus pneumoniae as a Cause of Salpingitis


    Patterson, David; Johnson, Celeste M.; Monif, Gilles R. G.


    Background: A case of pneumococcal septicemia associated with laparoscopically documented acute salpingitis is reported. Case: Gram-stained cul-de-sac pus revealed gram-positive encapsulated diplococci. Conclusion: This case coupled with reanalysis of prior genital tract involvement in nonpregnant individuals argues that Streptococcus pneumoniae can mimic gonococcal diseases.

  20. Streptococcus equisimilis Pneumonia in a compromised host.


    Siefkin, A D; Peterson, D L; Hansen, B


    A fatal case of Streptococcus equisimilis pneumonia and septicemia is described in a young man with Hodgkin's disease. The disease course consisted of exudative pharyngitis, macular rash, septic shock, disseminated intravascular coagulation, deep vein thrombosis, and pulmonary embolization. S. equisimilis was isolated from blood, throat, and sputum cultures antemortem and from lung cultures at autopsy.

  1. How Does Streptococcus pneumoniae Invade the Brain?

    NARCIS (Netherlands)

    Iovino, Federico; Seinen, Jolien; Henriques-Normark, Birgitta; van Dijl, Jan Maarten

    Streptococcus pneumoniae (the pneumococcus) is the major cause of bacterial meningitis. The mechanisms by which pneumococci from the bloodstream penetrate the blood-brain barrier to reach the brain are not fully understood. Receptor-mediated adhesion of the bacteria to the brain endothelium is

  2. Significant variation in transformation frequency in Streptococcus pneumoniae. (United States)

    Evans, Benjamin A; Rozen, Daniel E


    The naturally transformable bacterium Streptococcus pneumoniae is able to take up extracellular DNA and incorporate it into its genome. Maintaining natural transformation within a species requires that the benefits of transformation outweigh its costs. Although much is known about the distribution of natural transformation among bacterial species, little is known about the degree to which transformation frequencies vary within species. Here we find that there is significant variation in transformation frequency between strains of Streptococcus pneumoniae isolated from asymptomatic carriage, and that this variation is not concordant with isolate genetic relatedness. Polymorphism in the signalling system regulating competence is also not causally related to differences in transformation frequency, although this polymorphism does influence the degree of genetic admixture experienced by bacterial strains. These data suggest that bacteria can evolve new transformation frequencies over short evolutionary timescales. This facility may permit cells to balance the potential costs and benefits of transformation by regulating transformation frequency in response to environmental conditions.

  3. Significant variation in transformation frequency in Streptococcus pneumoniae (United States)

    Evans, Benjamin A; Rozen, Daniel E


    The naturally transformable bacterium Streptococcus pneumoniae is able to take up extracellular DNA and incorporate it into its genome. Maintaining natural transformation within a species requires that the benefits of transformation outweigh its costs. Although much is known about the distribution of natural transformation among bacterial species, little is known about the degree to which transformation frequencies vary within species. Here we find that there is significant variation in transformation frequency between strains of Streptococcus pneumoniae isolated from asymptomatic carriage, and that this variation is not concordant with isolate genetic relatedness. Polymorphism in the signalling system regulating competence is also not causally related to differences in transformation frequency, although this polymorphism does influence the degree of genetic admixture experienced by bacterial strains. These data suggest that bacteria can evolve new transformation frequencies over short evolutionary timescales. This facility may permit cells to balance the potential costs and benefits of transformation by regulating transformation frequency in response to environmental conditions. PMID:23303370

  4. Nonencapsulated Streptococcus pneumoniae: Emergence and Pathogenesis

    Directory of Open Access Journals (Sweden)

    Lance E. Keller


    Full Text Available While significant protection from pneumococcal disease has been achieved by the use of polysaccharide and polysaccharide-protein conjugate vaccines, capsule-independent protection has been limited by serotype replacement along with disease caused by nonencapsulated Streptococcus pneumoniae (NESp. NESp strains compose approximately 3% to 19% of asymptomatic carriage isolates and harbor multiple antibiotic resistance genes. Surface proteins unique to NESp enhance colonization and virulence despite the lack of a capsule even though the capsule has been thought to be required for pneumococcal pathogenesis. Genes for pneumococcal surface proteins replace the capsular polysaccharide (cps locus in some NESp isolates, and these proteins aid in pneumococcal colonization and otitis media (OM. NESp strains have been isolated from patients with invasive and noninvasive pneumococcal disease, but noninvasive diseases, specifically, conjunctivitis (85% and OM (8%, are of higher prevalence. Conjunctival strains are commonly of the so-called classical NESp lineages defined by multilocus sequence types (STs ST344 and ST448, while sporadic NESp lineages such as ST1106 are more commonly isolated from patients with other diseases. Interestingly, sporadic lineages have significantly higher rates of recombination than classical lineages. Higher rates of recombination can lead to increased acquisition of antibiotic resistance and virulence factors, increasing the risk of disease and hindering treatment. NESp strains are a significant proportion of the pneumococcal population, can cause disease, and may be increasing in prevalence in the population due to effects on the pneumococcal niche caused by pneumococcal vaccines. Current vaccines are ineffective against NESp, and further research is necessary to develop vaccines effective against both encapsulated and nonencapsulated pneumococci.

  5. Serotypes and antibiotic susceptibility of Streptococcus pneumoniae isolated from hospitalized patients with community-acquired pneumonia in Italy. (United States)

    Di Pasquale, Marta; Aliberti, Stefano; Azzari, Chara; Moriondo, Maria; Nieddu, Francesco; Blasi, Francesco; Mantero, Marco


    Pneumonia remain an important public health problem. The primary objective was to determine the proportion of community-acquired pneumonia that is attributable to Streptococcus pneumoniae infection; secondary objectives were the description of community-acquired pneumonia attributable to Streptococcus pneumoniae according to socio-demographic and clinical variables, the clinical evolution of community-acquired pneumonia and the description of the serotype distribution of vaccine-preventable disease and antibiotic resistance rate of pneumococcal infections. An observational, prospective study was conducted on consecutive patients coming from the community, who were hospitalized with pneumonia. Data on admission, at discharge and 30 days after discharge were collected. Logistic regression models were used to evaluate the risk factors independently associated with pneumococcal pneumonia. Among the 193 patients enrolled in the study, the etiology of community-acquired pneumonia was identified in 60 patients (33%) and 35 (18%) of evaluable patients had community-acquired pneumonia due to Streptococcus pneumoniae. Of all clinical characteristics, if no previous antibiotic treatment was performed, there was a 13-fold higher risk of presenting community-acquired pneumonia due to Streptococcus pneumoniae (odds ratio, 12.9; 95% confidence interval, 1.42-117.9). Moreover, the most frequent isolated serotypes were 35F, 3 and 24 (29%, 23% and 16%, respectively). The most frequent serotypes in pneumococcal community-acquired pneumonia are 35F, 3, 24, 6 and 7A, and thus almost 50% of Streptococcus pneumoniae strains could be covered by pneumococcal conjugate vaccine 13 in adult patients with risk factors for pneumococcal infections.

  6. Nasopharyngeal carriage of Streptococcus pneumonia in pneumonia-prone age groups in Semarang, Java Island, Indonesia. (United States)

    Farida, Helmia; Severin, Juliëtte A; Gasem, M Hussein; Keuter, Monique; Wahyono, Hendro; van den Broek, Peterhans; Hermans, Peter W M; Verbrugh, Henri A


    Streptococcus pneumoniae is a worldwide occurring pathogen Nasopharyngeal carriage of Streptococcus pneumoniae precedes pneumonia and other pneumococcal diseases in the community. Little is known about S. pneumoniae carriage in Indonesia, complicating strategies to control pneumococcal diseases. We investigated nasopharyngeal carriage of S. pneumoniae in Semarang, Indonesia. A population-based survey was performed in Semarang, Indonesia. Nasopharyngeal swabs and questionnaires were taken from 496 healthy young (6-60 month-old) children and 45-70 year-old adults. Forty-three percent of children aged 6-60 months and 11% of adults aged 45-75 years carried S. pneumoniae. Determinants of carriage were being a child (OR 7.7; 95% CI = 4.5-13.0), passive smoking (OR 2.1; 95% CI = 1.3-3.4), and contact with toddler(s) at home (OR 3.0; 95% CI = 1.9-4.7). The most frequent serotypes found were 6A/B and 15B/C. The current commercially available vaccines cover <50% serotypes found in children. Twenty-four percent of S. pneumoniae strains were penicillin non-susceptible, and 45% were resistant to cotrimoxazol. The limited coverage of commercially available vaccines against the serotypes found in this population, and the high proportion of non-susceptibility to penicillin and cotrimoxazol suggest the need for region-specific information and strategies to control S. pneumoniae.

  7. Comparative study of community-acquired pneumonia caused by Streptococcus pneumoniae, Legionella pneumophila or Chlamydia pneumoniae. (United States)

    Sopena, Nieves; Pedro-Botet, Maria Luisa; Sabrià, Miquel; García-Parés, Delia; Reynaga, Esteban; García-Nuñez, Marian


    The objective of this study was to compare epidemiological data and clinical presentation of community-acquired pneumonia (CAP) caused by Streptococcus pneumoniae, Legionella pneumophila or Chlamydia pneumoniae. From May 1994 to February 1996, 157 patients with S. pneumoniae (n = 68), L. pneumophila (n = 48) and C. pneumoniae (n = 41) pneumonia with definitive diagnosis, were prospectively studied. The following comparisons showed differences at a level of at least p pneumoniae pneumonia had more frequently underlying diseases (HIV infection and neoplasm) and those with C. pneumoniae pneumonia were older and had a higher frequency of chronic obstructive pulmonary disease (COPD), while L. pneumophila pneumonia prevailed in patients without comorbidity, but with alcohol intake. Presentation with cough and expectoration were significantly more frequent in patients with S. pneumoniae or C. pneumoniae pneumonia, while headache, diarrhoea and no response to betalactam antibiotics prevailed in L. pneumophila pneumonia. However, duration of symptoms > or = 7 d was more frequent in C. pneumoniae pneumonia. Patients with CAP caused by L. pneumophila presented hyponatraemia and an increase in CK more frequently, while AST elevation prevailed in L. pneumophila and C. pneumoniae pneumonia. In conclusion, some risk factors and clinical characteristics of patients with CAP may help to broaden empirical therapy against atypical pathogens until rapid diagnostic tests are available.


    Directory of Open Access Journals (Sweden)

    M. Soltani Radd Gh. Behzadian Nejad


    Full Text Available Resistance of Streptococcus pneumoniae against penicillin is considered to be of great importance. While low-resistant strains could be treated by penicillin, treatment of highly resistant strains is very difficult and needs broad-spectrum antibiotics. This study was performed in Imam Khomeini Medical Center, Tehran, Iran, from 1999 to 2001 to evaluate pneumococcal resistance against penicillin and some other antibiotics. Specimens were collected from different hospitals. Samples were cultured and resistance of S. pneumoniae against selected antibiotics was determined. The main aim of this study was to measure minimum inhibitory concentration (MIC and the minimum bactericidal concentration (MBC, using serial dilution method. Disc diffusion method was also performed to be compared with the main procedures (MIC and MBC, on 66 strains obtained from 100 clinical specimens. Five different antibiotics (penicillin, cefazolin, ampicillin, amoxicillin and vancomycin were employed in this study. In the case of penicillin, 47 sensitive strains and 19 highly resistant strains were obtained. No intermediate or low-resistant strain was found. The frequency of resistant strains against other antibiotics was found to be 10.6%, 7.5%, 18.1% and 0%, respectively. All strains were sensitive to vancomycin except for a low resistant one. Care should be taken to choose a suitable drug when being faced with a resistant strain. Vancomycin can be used with confidence to cure infections induced by penicilin-resistant S. pneumoniae.

  9. Resistance patterns of Streptococcus pneumoniae isolated from the ...

    African Journals Online (AJOL)

    Resistance patterns of Streptococcus pneumoniae isolated from the upper respiratory tract of persons attending various clinics of a University Teaching Hospital in Lagos, Nigeria - a preliminary study.

  10. Carbohydrate-dependent gene regulation in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad


    Streptococcus pneumoniae, een Gram-positieve ziekteverwekker voor de mens, kan infecties als longontsteking, meningitis, middenoorontsteking en sepsis veroorzaken en veroorzaakt elk jaar miljoenen sterfgevallen, met name van kinderen en ouderen. Het gedrag van S. pneumoniae kan snel veranderen met

  11. Streptococcus pneumoniae in saliva of Dutch primary school children

    NARCIS (Netherlands)

    Wyllie, Anne L.; Chu, Mei Ling J. N.; Schellens, Mariëlle H. B.; van Engelsdorp Gastelaars, Jody; Jansen, Marc D.; van der Ende, Arie; Bogaert, Debby; Sanders, Elisabeth A. M.; Trzciński, Krzysztof


    While nasopharyngeal sampling is the gold standard for the detection of Streptococcus pneumoniae carriage, historically seen, saliva sampling also seems highly sensitive for pneumococcal detection. We investigated S. pneumoniae carriage in saliva from fifty schoolchildren by conventional and

  12. Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

    Directory of Open Access Journals (Sweden)

    Amauri Noda Albelo


    Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

  13. Capsular Polysaccharide Expression in Commensal Streptococcus Species: Genetic and Antigenic Similarities to Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Uffe B. Skov Sørensen


    Full Text Available Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule production distinguishes S. pneumoniae from closely related commensals of the mitis group streptococci. Based on antigenic and genetic analyses of 187 mitis group streptococci, including 90 recognized serotypes of S. pneumoniae, we demonstrated capsule production by the Wzy/Wzx pathway in 74% of 66 S. mitis strains and in virtually all tested strains of S. oralis (subspecies oralis, dentisani, and tigurinus and S. infantis. Additional analyses of genomes of S. cristatus, S. parasanguinis, S. australis, S. sanguinis, S. gordonii, S. anginosus, S. intermedius, and S. constellatus revealed complete capsular biosynthesis (cps loci in all strains tested. Truncated cps loci were detected in three strains of S. pseudopneumoniae, in 26% of S. mitis strains, and in a single S. oralis strain. The level of sequence identities of cps locus genes confirmed that the structural polymorphism of capsular polysaccharides in S. pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S. pneumoniae raises concerns about potential misidentifications in addition to important questions concerning the consequences for vaccination and host-parasite relationships both for the commensals and for the pathogen.

  14. Capsular Polysaccharide Expression in Commensal Streptococcus Species: Genetic and Antigenic Similarities to Streptococcus pneumoniae. (United States)

    Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong; Tettelin, Hervé; Kilian, Mogens


    Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule production distinguishes S. pneumoniae from closely related commensals of the mitis group streptococci. Based on antigenic and genetic analyses of 187 mitis group streptococci, including 90 recognized serotypes of S. pneumoniae, we demonstrated capsule production by the Wzy/Wzx pathway in 74% of 66 S. mitis strains and in virtually all tested strains of S. oralis (subspecies oralis, dentisani, and tigurinus) and S. infantis Additional analyses of genomes of S. cristatus, S. parasanguinis, S. australis, S. sanguinis, S. gordonii, S. anginosus, S. intermedius, and S. constellatus revealed complete capsular biosynthesis (cps) loci in all strains tested. Truncated cps loci were detected in three strains of S. pseudopneumoniae, in 26% of S. mitis strains, and in a single S. oralis strain. The level of sequence identities of cps locus genes confirmed that the structural polymorphism of capsular polysaccharides in S. pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S. pneumoniae raises concerns about potential misidentifications in addition to important questions concerning the consequences for vaccination and host-parasite relationships both for the commensals and for the pathogen. Expression of a capsular polysaccharide is among the principal virulence factors of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous

  15. [Clinical characteristics of children with Streptococcus pneumoniae septicemia and drug sensitivity of Streptococcus pneumoniae]. (United States)

    Su, Xiao-Yan; Wen, Shun-Hang; Lin, Li; Li, Chang-Chong


    To study the clinical characteristics of children who suffered from Streptococcus pneumoniae (SP) septicemia and the drug sensitivity of SP strains. A retrospective analysis was performed on the clinical data of 25 children with SP septicemia between January 2009 and December 2012. Of the 25 cases, 16 (64%) were aged under 2 years, 5 (20%) were aged 2-5 years, and 4 (16%) were aged over 5 years. Fourteen cases (56%) were complicated by infection of other organs, and 5 cases (20%) had underlying chronic diseases. Fever was the most common clinical manifestation, and the majority presented with remittent fever. Eight patients with pneumonia or pyothorax had pulmonary symptoms. Five patients with purulent meningitis had neurological symptoms, five cases had hepatosplenomegaly and two cases had septic shock. Nineteen cases (76%, 19/25) had significantly elevated white blood cell (WBC) counts, twenty-one cases (84%, 21/25) had significantly elevated serum C-reactive protein (CRP) levels, and eight cases (50%, 8/16) had significantly elevated serum procalcitonin (PCT) levels. The drug sensitivity analysis showed that invasive SP had high resistance rates to penicillin (96%), clindamycin hydrochloride (88%) and erythromycin (84%), and it was completely sensitive to imipenem, vancomycin, levofloxacin and linezolid. The multi-drug resistance rate of invasive SP was up to 88%. Twenty-three cases (92%) were cured or improved after active treatment. SP septicemia is commonly seen in children aged under 2 years. The most common clinical manifestation is fever, accompanied by elevated WBC count, CRP level and PCT level, and it is usually complicated by pulmonary or brain infection. Resistance to multiple antibiotics is very common in SP strains, so it is important to properly use antibiotics according to drug sensitivity test results. Patients who receive active treatment have a good clinical outcome.

  16. Capsular Polysaccharide Expression in Commensal Streptococcus Species: Genetic and Antigenic Similarities to Streptococcus pneumoniae

    National Research Council Canada - National Science Library

    Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong; Tettelin, Hervé; Kilian, Mogens


    Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors...

  17. Streptococcus pneumoniae in saliva of Dutch primary school children. (United States)

    Wyllie, Anne L; Chu, Mei Ling J N; Schellens, Mariëlle H B; van Engelsdorp Gastelaars, Jody; Jansen, Marc D; van der Ende, Arie; Bogaert, Debby; Sanders, Elisabeth A M; Trzciński, Krzysztof


    While nasopharyngeal sampling is the gold standard for the detection of Streptococcus pneumoniae carriage, historically seen, saliva sampling also seems highly sensitive for pneumococcal detection. We investigated S. pneumoniae carriage in saliva from fifty schoolchildren by conventional and molecular methods. Saliva was first culture-enriched for pneumococci, after which, DNA was extracted from all bacterial growth and tested by quantitative-PCR (qPCR) for pneumococcus-specific genes lytA and piaA. Next, serotype composition of the samples was determined by serotype-specific qPCRs, conventional-PCRs (cPCR) and sequencing of cPCR amplicons. Although only 2 (4%) of 50 samples were positive by conventional diagnostic culture, 44 (88%) were positive for pneumococci by qPCR. In total, we detected the presence of at least 81 pneumococcal strains representing 20 serotypes in samples from 44 carriers with 23 carriers (52%) positive for multiple (up to 6) serotypes. The number of serotypes detected per sample correlated with pneumococcal abundance. This study shows that saliva could be used as a tool for future pneumococcal surveillance studies. Furthermore, high rates of pneumococcal carriage and co-carriage of multiple pneumococcal strains together with a large number of serotypes in circulation suggests a ubiquitous presence of S. pneumoniae in saliva of school-aged children. Our results also suggest that factors promoting pneumococcal carriage within individual hosts may weaken competitive interactions between S. pneumoniae strains.

  18. Streptococcus pneumoniae colonization in remote African Pygmies. (United States)

    Schaumburg, Frieder; Alabi, Abraham; von Eiff, Christof; Flamen, Arnaud; Traore, Hafsatou; Grobusch, Martin Peter; Peters, Georg; Kremsner, Peter Gottfried; van der Linden, Mark


    African Pygmies have many risk factors for invasive pneumococcal disease (IPD), such as low socioeconomic status and low quality of health care. We characterized Streptococcus pneumoniae from Gabonese Pygmies and analyzed risk factors for S. pneumoniae carriage to improve prophylaxis and therapy of IPD in this neglected, remotely living African community. Nasopharyngeal carriage of S. pneumoniae, susceptibility, serotypes and risk factors for IPD were assessed in 103 Pygmies in a cross-sectional study. The carriage rate was 37% (n = 38), with the highest proportion (79%, n = 11) in children between two and four years (n = 14). The predominant serotypes were 15A (24%, n = 9), 11A (16%, n = 6) and 6A (13%, n = 5). Non-susceptibility was detected against penicillin (Clinical and Laboratory Standards Institute; CLSI) meningitis breakpoints; (18%, n = 7), trimethoprim/sulfamethoxazole (61%, n = 23), tetracycline (55%, n = 21) and chloramphenicol (3%, n = 1). Among adult participants (n = 51), 69% (n = 35) regularly consumed alcohol and 75% (n = 38) reported to smoke cigarettes. The high proportion of nicotine and drug abuse might increase the risk of IPD. The unusual serotypes challenge a broad coverage by currently marketed vaccines; the broad antibiotic resistance limits the choice of therapy for S. pneumoniae infection.

  19. Regulation of neuraminidase expression in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Gualdi Luciana


    Full Text Available Abstract Background Sialic acid (N-acetylneuraminic acid; NeuNAc is one of the most important carbohydrates for Streptococcus pneumoniae due of its role as a carbon and energy source, receptor for adhesion and invasion and molecular signal for promotion of biofilm formation, nasopharyngeal carriage and invasion of the lung. Results In this work, NeuNAc and its metabolic derivative N-acetyl mannosamine (ManNAc were used to analyze regulatory mechanisms of the neuraminidase locus expression. Genomic and metabolic comparison to Streptococcus mitis, Streptococcus oralis, Streptococcus gordonii and Streptococcus sanguinis elucidates the metabolic association of the two amino sugars to different parts of the locus coding for the two main pneumococcal neuraminidases and confirms the substrate specificity of the respective ABC transporters. Quantitative gene expression analysis shows repression of the locus by glucose and induction of all predicted transcriptional units by ManNAc and NeuNAc, each inducing with higher efficiency the operon encoding for the transporter with higher specificity for the respective amino sugar. Cytofluorimetric analysis demonstrated enhanced surface exposure of NanA on pneumococci grown in NeuNAc and ManNAc and an activity assay allowed to quantify approximately twelve times as much neuraminidase activity on induced cells as opposed to glucose grown cells. Conclusions The present data increase the understanding of metabolic regulation of the nanAB locus and indicate that experiments aimed at the elucidation of the relevance of neuraminidases in pneumococcal virulence should possibly not be carried out on bacteria grown in glucose containing media.

  20. Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Shepherd, Jennifer; Ibba, Michael


    Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...... a combination of both branched and linear muropeptides, deletion of MurM results in a reversion to penicillin sensitivity in strains that were previously resistant. However, since MurM is not required for cell viability, the reason for its functional conservation across all strains of S. pneumoniae has remained...

  1. Evaluation of Two Supplemented Culture Media for Long-Term, Room-Temperature Preservation of Streptococcus pneumoniae Strains

    Directory of Open Access Journals (Sweden)

    Beatriz Quintero Moreno


    Full Text Available Objective. To produce two supplemented agar types in order to store pneumococci for several months at room temperature. Methods. Todd-Hewitt/Hemoglobin/Yeast/Charcoal/Agar (TH-HYC and Todd-Hewitt/Skim-Milk/Yeast/Charcoal/Agar (TH-SYC were used to prepare two supplemented agar types. Nineteen pneumococci isolated from patients or asymptomatic carriers displaying diverse serotypes and multilocus sequence types (MLST were subcultured and stored onto supplemented agar types, in four different tests, at room temperature. Findings. At the end of all tests (4–6 months all noncontaminated subcultures were viable and maintained all phenotypic characteristics. Survival-time curves revealed a slow decrease of viable CFU over time on agar types, but at the end the number of viable CFU was satisfactory (≥2+ of growth. Decreasing of CFU was significantly higher for clinical versus nasopharyngeal isolates. Subcultures contamination rates were 6.25% and 14.58% after 2 and 6 months of storage, respectively. Conclusion. TH-HYC and TH-SYC agar types allowed the viability of pneumococci with several serotypes, MLST, and genetic profiles, after 6 months of storage at room temperature. We consider that these agar types are a valid alternative to preserve pneumococci over an extended period, especially when methods as cryopreservation or lyophilization are not available, and are useful for transporting strains between laboratories.

  2. Evaluation of Two Supplemented Culture Media for Long-Term, Room-Temperature Preservation of Streptococcus pneumoniae Strains (United States)

    Mendoza, Evelyn


    Objective To produce two supplemented agar types in order to store pneumococci for several months at room temperature. Methods Todd-Hewitt/Hemoglobin/Yeast/Charcoal/Agar (TH-HYC) and Todd-Hewitt/Skim-Milk/Yeast/Charcoal/Agar (TH-SYC) were used to prepare two supplemented agar types. Nineteen pneumococci isolated from patients or asymptomatic carriers displaying diverse serotypes and multilocus sequence types (MLST) were subcultured and stored onto supplemented agar types, in four different tests, at room temperature. Findings At the end of all tests (4–6 months) all noncontaminated subcultures were viable and maintained all phenotypic characteristics. Survival-time curves revealed a slow decrease of viable CFU over time on agar types, but at the end the number of viable CFU was satisfactory (≥2+ of growth). Decreasing of CFU was significantly higher for clinical versus nasopharyngeal isolates. Subcultures contamination rates were 6.25% and 14.58% after 2 and 6 months of storage, respectively. Conclusion TH-HYC and TH-SYC agar types allowed the viability of pneumococci with several serotypes, MLST, and genetic profiles, after 6 months of storage at room temperature. We consider that these agar types are a valid alternative to preserve pneumococci over an extended period, especially when methods as cryopreservation or lyophilization are not available, and are useful for transporting strains between laboratories. PMID:29359142

  3. Trend in Antibiotic Resistance of Streptococcus Pneumoniae and Haemophilus Influenzae Strains Isolated from Community Acquired Respiratory Tract Infections in Dakar, Senegal Between 2005 and 2008

    Directory of Open Access Journals (Sweden)

    A. Guèye Ndiaye


    Full Text Available Development of antibiotic resistance among common respiratory pathogens is a major cause of concern worldwide. Streptococcus pneumoniae and Haemophilus influenzae are among the most common respiratory pathogens. In this study, representative samples obtained from 3 different medical centers in Dakar, Senegal were subjected to antibiotic susceptibility testing. The samples were collected from 2005 to 2008 and the data obtained was compared to establish resistance patterns between the two years (i.e. 2005–2006 to 2007–2008. S. pneumoniae exhibited a significant increase in the resistance to azithromycin and the intermediate susceptibility to penicillin G and cotrimoxazole. H. influenzae also exhibited a significant increase in resistance to azithromycin and intermediate susceptibility to chloramphenicol. None of H. influenzae samples were resistant to amoxicillin/clavulanic acid, cephalosporin and fluroquinolones and most of the S. pneumoniae isolates demonstrated high susceptibility to the antibiotics tested. Results from this study will provide greater insights to antibiotic therapy during respiratory tract infections in Dakar, Senegal. This study also establishes the importance of continuous monitoring of antibiotic susceptibility patterns that are often region-specific.

  4. Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana Streptococcus pneumoniae, mechanisms of antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Amauri Noda Albelo


    Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.The Streptococcus pneumoniae, the main causal agent of community pneumonia, leader in the etiology of the otitis media and the meningitis, during the past three decades has increase in a significant way its resistance to the more used therapeutic agents including the beta-lactamase, macrolides, azalides and fluroquinolones. Adaptive versatility of the microorganism allows it to create mechanisms able to overcome to any of these therapeutical aggressions with a variable degree of effectiveness. Authors made a review of the more important mechanisms involved in acquisition of the antimicrobial resistance by S. pneumoniae and some of risk factors involved in the infection due to resistant S. pneumoniae are specified.

  5. Unencapsulated Streptococcus pneumoniae from conjunctivitis encode variant traits and belong to a distinct phylogenetic cluster (United States)

    Valentino, Michael D.; McGuire, Abigail Manson; Rosch, Jason W.; Bispo, Paulo J. M.; Burnham, Corinna; Sanfilippo, Christine M.; Carter, Robert A.; Zegans, Michael E.; Beall, Bernard; Earl, Ashlee M.; Tuomanen, Elaine I.; Morris, Timothy W.; Haas, Wolfgang; Gilmore, Michael S.


    Streptococcus pneumoniae, an inhabitant of the upper respiratory mucosa, causes respiratory and invasive infections as well as conjunctivitis. Strains that lack the capsule, a main virulence factor and the target of current vaccines, are often isolated from conjunctivitis cases. Here we perform a comparative genomic analysis of 271 strains of conjunctivitis-causing S. pneumoniae from 72 postal codes in the US. We find that the vast majority of conjunctivitis strains are members of a distinct cluster of closely related unencapsulated strains. These strains possess divergent forms of pneumococcal virulence factors (such as CbpA and neuraminidases) that are not shared with other unencapsulated nasopharyngeal S. pneumoniae. They also possess putative adhesins that have not been described in encapsulated pneumococci. These findings suggest that the unencapsulated strains capable of causing conjunctivitis utilize a pathogenesis strategy substantially different from that described for S. pneumoniae at other infection sites. PMID:25388376

  6. Streptococcus pneumoniae: the forgotten microorganism in neonatal sepsis. (United States)

    Rodriguez, Beatriz Fernandez; Mascaraque, Luis Rubio; Fraile, Leticia Ruiz; Perez, Irene Cuadrado; Kuder, Krzysztof


    Streptococcus pneumoniae is a rarely cause of neonatal sepsis. Its prevalence is low but with a mortality of 50%. Measures to prevent Streptococcus agalactiae transmission could help to increase Invasive Pneumococcal Disease (IPD) in newborns. Transmission could be from mother intrapartum; or in those cases of late onset sepsis, the community carriers. Systematic vaccination with PCV-7 and PCV-13 has reduced IPD rates. We present a case of a newborn with no perinatal risk factors for infection. In the first 24 hours after surgery of an ovarian cyst, the patient started with bad general condition with fever and regular perfusion. Empiric antibiotic treatment was started. Streptococcus pneumoniae was isolated in blood culture. In neonatal sepsis, we always think in Streptococcus agalactiae. Streptococcus pneumoniae is rare but with a high morbidity and mortality. Systematic vaccination is a measure that has demonstrated a reduction in the incidence of Invasive pneumococcal disease.

  7. Auranofin efficacy against MDR Streptococcus pneumoniae and Staphylococcus aureus infections. (United States)

    Aguinagalde, Leire; Díez-Martínez, Roberto; Yuste, Jose; Royo, Inmaculada; Gil, Carmen; Lasa, Íñigo; Martín-Fontecha, Mar; Marín-Ramos, Nagore Isabel; Ardanuy, Carmen; Liñares, Josefina; García, Pedro; García, Ernesto; Sánchez-Puelles, José M


    Auranofin is an FDA-approved, gold-containing compound in clinical use for the oral treatment of rheumatoid arthritis and has been recently granted by the regulatory authorities due to its antiprotozoal properties. A reprofiling strategy was performed with a Streptococcus pneumoniae phenotypic screen and a proprietary library of compounds, consisting of both FDA-approved and unapproved bioactive compounds. Two different multiresistant S. pneumoniae strains were employed in a sepsis mouse model of infection. In addition, an MRSA strain was tested using both the thigh model and a mesh-associated biofilm infection in mice. The repurposing approach showed the high potency of auranofin against multiresistant clinical isolates of S. pneumoniae and Staphylococcus aureus in vitro and in vivo. Efficacy in the S. pneumoniae sepsis model was obtained using auranofin by the oral route in the dose ranges used for the treatment of rheumatoid arthritis. Thioglucose replacement by alkyl chains showed that this moiety was not essential for the antibacterial activity and led to the discovery of a new gold derivative (MH05) with remarkable activity in vitro and in vivo. Auranofin and the new gold derivative MH05 showed encouraging in vivo activity against multiresistant clinical isolates of S. pneumoniae and S. aureus. The clinical management of auranofin, alone or in combination with other antibiotics, deserves further exploration before use in patients presenting therapeutic failure caused by infections with multiresistant Gram-positive pathogens. Decades of clinical use mean that this compound is safe to use and may accelerate its evaluation in humans. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  8. The post-vaccine microevolution of invasive Streptococcus pneumoniae

    NARCIS (Netherlands)

    Cremers, A.J.H.; Mobegi, F.M.; Jonge, M.I. de; Hijum, S.A.F.T. van; Meis, J.F.; Hermans, P.W.M.; Ferwerda, G.; Bentley, S.D.; Zomer, A.L.


    The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

  9. Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

    Directory of Open Access Journals (Sweden)

    Raga-Luria Xavier


    Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

  10. Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited

    DEFF Research Database (Denmark)

    Martens, Pernille; Worm, Signe Westring; Lundgren, Bettina


    Serotype-specific mortality from invasive Streptococcus pneumoniae disease revisited.Martens P, Worm SW, Lundgren B, Konradsen HB, Benfield T. Department of Infectious Diseases 144, Hvidovre University Hospital, DK-2650 Hvidovre, Denmark. BACKGROUND: Invasive infection...... with Streptococcus pneumoniae (pneumococci) causes significant morbidity and mortality. Case series and experimental data have shown that the capsular serotype is involved in the pathogenesis and a determinant of disease outcome. METHODS: Retrospective review of 464 cases of invasive disease among adults diagnosed...

  11. Streptococcus pneumoniae carriage in the Gaza strip.

    Directory of Open Access Journals (Sweden)

    Gili Regev-Yochay

    Full Text Available BACKGROUND: Pneumococcal infections cause major morbidity and mortality in developing countries. We report the epidemiology of S. pneumoniae carriage in a developing region, the Gaza strip, and evaluate the theoretical coverage of carriage strains by pneumococcal conjugate vaccines (PCVs. METHODOLOGY: In 2009 we conducted a cross-sectional survey of S. pneumoniae carriage in healthy children and their parents, living throughout the Gaza strip. Data were collected and nasopharyngeal swabs were obtained. Antibiotic susceptibilities were determined by Vitek-2 and serotypes by the Quellung reaction. PRINCIPAL FINDINGS: S. pneumoniae carriage was detected in 189/379 (50% of children and 30/376 (8% of parents. Carriage prevalence was highest in children <6 months of age (63%. Significant predictors for child carriage were number of household members and DCC attendance. The proportion of pediatric and adults isolates with serotypes included in PCV7 were 32% and 20% respectively, and 46% and 33% in PCV13 respectively. The most prominent non-vaccine serotypes (NVT were 35B, 15B/C and 23B. Penicillin-nonsusceptible strains were carried by 70% of carriers, penicillin-resistant strains (PRSP by 13% and Multi-drug-resistant (MDR by 30%. Of all PRSP isolates 54% belonged to serotypes included in PCV7 and 71% in the PCV13. Similarly, 59% and 73% of MDR-SP isolates, would theoretically be covered by PCV7 and PCV13, respectively. CONCLUSIONS: This study demonstrates that, PCV13-included strains were carried by 46% and 33% of pediatric and adult subjects respectively. In the absence of definitive data regarding the virulence of the NVT strains, it is difficult to predict the effect of PCVs on IPD in this region.

  12. Genome Evolution to Penicillin Resistance in Serotype 3 Streptococcus pneumoniae by Capsular Switching. (United States)

    Chiba, Naoko; Murayama, Somay Y; Morozumi, Miyuki; Iwata, Satoshi; Ubukata, Kimiko


    Streptococcus pneumoniae isolates of serotype 3 were collected from cases of invasive pneumococcal disease (n = 124) throughout Japan between April 2010 and March 2013. A penicillin-resistant S. pneumoniae (PRSP) isolate from an adult patient, strain KK0981 of serotype 3, was identified among these strains. Whole-genome analysis characterized this PRSP as a recombinant strain derived from PRSP of serotype 23F with the cps locus (20.3 kb) replaced by that of a penicillin-susceptible strain of serotype 3. Copyright © 2017 American Society for Microbiology.

  13. Additive inhibition of complement deposition by pneumolysin and PspA facilitates Streptococcus pneumoniae septicemia. (United States)

    Yuste, Jose; Botto, Marina; Paton, James C; Holden, David W; Brown, Jeremy S


    Streptococcus pneumoniae is a common cause of septicemia in the immunocompetent host. To establish infection, S. pneumoniae has to overcome host innate immune responses, one component of which is the complement system. Using isogenic bacterial mutant strains and complement-deficient immune naive mice, we show that the S. pneumoniae virulence factor pneumolysin prevents complement deposition on S. pneumoniae, mainly through effects on the classical pathway. In addition, using a double pspA-/ply- mutant strain we demonstrate that pneumolysin and the S. pneumoniae surface protein PspA act in concert to affect both classical and alternative complement pathway activity. As a result, the virulence of the pspA-/ply- strain in models of both systemic and pulmonary infection is greatly attenuated in wild-type mice but not complement deficient mice. The sensitivity of the pspA-/ply- strain to complement was exploited to demonstrate that although early innate immunity to S. pneumoniae during pulmonary infection is partially complement-dependent, the main effect of complement is to prevent spread of S. pneumoniae from the lungs to the blood. These data suggest that inhibition of complement deposition on S. pneumoniae by pneumolysin and PspA is essential for S. pneumoniae to successfully cause septicemia. Targeting mechanisms of complement inhibition could be an effective therapeutic strategy for patients with septicemia due to S. pneumoniae or other bacterial pathogens.

  14. A Visual Review of the Human Pathogen Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David


    Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

  15. Cations and oxidative stress response in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Farshchi Andisi, Vahid


    Streptococcus pneumoniae is a bacterium, which colonizes the human nasopharynx and can cause serious disease, such as pneumonia, otitis media, meningitis, and bacteremia. Generally, groups at risk for invasive pneumococcal disease are young children, elderly and immuno-compromised patients, both in

  16. Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

    NARCIS (Netherlands)

    D. Bogaert (Debby)


    markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

  17. Phenotypic differentiation of Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus strains within the "Streptococcus milleri group". (United States)

    Whiley, R A; Fraser, H; Hardie, J M; Beighton, D


    A biochemical scheme was developed by which strains of Streptococcus constellatus, Streptococcus intermedius, and Streptococcus anginosus can reliably be distinguished from within the "Streptococcus milleri group." Strains identified as S. intermedius were differentiated by the ability to produce detectable levels of alpha-glucosidase, beta-galactosidase, beta-D-fucosidase, beta-N-acetylgalactosaminidase, beta-N-acetylglucosaminidase, and sialidase with 4-methylumbelliferyl-linked fluorogenic substrates in microdilution trays after 3 h of incubation at 37 degrees C, together with the production of hyaluronidase. Strains of S. constellatus and S. anginosus were differentiated by the production of alpha-glucosidase and hyaluronidase by the former and the production of beta-glucosidase by the latter. The majority of strains of the S. milleri group obtained from dental plaque were identified as S. intermedius, as were most strains isolated from abscesses of the brain and liver. Strains of S. constellatus and S. anginosus were from a wider variety of infections, both oral and nonoral, than were strains of S. intermedius, with the majority of strains from urogenital infections being identified as S. anginosus. PMID:2380375

  18. An outbreak of Streptococcus pneumoniae in an Italian nursing home.

    Directory of Open Access Journals (Sweden)

    Riccardo Papalia


    Full Text Available Streptococcus pneumoniae is the main cause of community-acquired pneumonia worldwide; pneumonia occurs sporadically in most cases, but rare outbreaks have been reported. We  describe an outbreak occurred in a 21-guests nursing home for elders in Aosta (Italy; outbreak occurred in april 2014 over a 2 weeks period, resulting in 12 out 20 guests affected (all with high fever and respiratory symptoms, two deaths (at home, nine patients referred  to Hospital Emergency Room, and eight admissions. Urinary streptococcus antigen was positive in seven out of eight patient tested. None of the nursing home guests were vaccinated against Streptococcus pneumoniaeThe Hospital Medical Direction and Public Health Service gave support and adopted strategies to contain the outbreak spread.We underline the need for pneumococcal vaccination in nursing homes/ Long-term care facilities; accurate check of hygiene behaviours in those setting is also mandatory.   

  19. Activities of Newer Fluoroquinolones against Ciprofloxacin-Resistant Streptococcus pneumoniae (United States)

    Coyle, Elizabeth A.; Kaatz, Glenn W.; Rybak, Michael J.


    The incidence of ciprofloxacin resistance in Streptococcus pneumoniae is low but steadily increasing, which raises concerns regarding the clinical impact of potential cross-resistance with newer fluoroquinolones. To investigate this problem, we utilized an in vitro pharmacodynamic model and compared the activities of gatifloxacin, grepafloxacin, levofloxacin, moxifloxacin, and trovafloxacin to that of ciprofloxacin against two laboratory-derived, ciprofloxacin-resistant derivatives of S. pneumoniae (strains R919 and R921). Ciprofloxacin resistance in these strains involved the activity of a multidrug efflux pump and possibly, for R919, a mutation resulting in an amino acid substitution in GyrA. Gatifloxacin, grepafloxacin, levofloxacin, moxifloxacin, and trovafloxacin achieved 99.9% killing of both R919 and R921 in ≤28 h. With respect to levofloxacin, significant regrowth of both mutants was observed at 48 h (P < 0.05). For gatifloxacin, grepafloxacin, moxifloxacin, and trovafloxacin, regrowth was minimal at 48 h, with each maintaining 99.9% killing against both mutants. No killing of either R919 or R921 was observed with exposure to ciprofloxacin. During model experiments, resistance to gatifloxacin, grepafloxacin, moxifloxacin, and trovafloxacin did not develop but the MICs of ciprofloxacin and levofloxacin increased 1 to 2 dilutions for both R919 and R921. Although specific area under the concentration-time curve from 0 to 24 h (AUC0–24)/MIC and maximum concentration of drug in serum (Cmax)/MIC ratios have not been defined for the fluoroquinolones with respect to gram-positive organisms, our study revealed that significant regrowth and/or resistance was associated with AUC0–24/MIC ratios of ≤31.7 and Cmax/MIC ratios of ≤3.1. It is evident that the newer fluoroquinolones tested possess improved activity against S. pneumoniae, including strains for which ciprofloxacin MICs were elevated. PMID:11353608

  20. 77 FR 26014 - Prospective Grant of Exclusive License: P4 Peptide From Streptococcus Pneumoniae (United States)


    ... Prospective Grant of Exclusive License: P4 Peptide From Streptococcus Pneumoniae AGENCY: Technology Transfer... polysaccharide vaccine conjugate for prevention of Streptococcus pneumonia infection in humans'') to practice the... ``Functional Epitopes of Streptococcus Pneumoniae PsaA Antigen and Uses Thereof,'' filed 7/ 18/2008, claiming...

  1. Mixed Streptococcus pneumoniae and Streptococcus pyogenes meningitis in an immunocompromised adult patient: a case report. (United States)

    Demerle, Clémence; Ivanov, Vadim; Mercier, Cédric; Costello, Régis; Drancourt, Michel


    Community-acquired meningitis is a monomicrobial infection caused by either viruses or bacteria in the vast majority of patients. We report here one exceptional case of a patient with mixed bacterial meningitis due to Streptococcus pneumoniae and Streptococcus pyogenes. We report the case of a 68-year-old immunocompromised Caucasian man suffering from otitis and then meningitis caused by Streptococcus pneumoniae and Streptococcus pyogenes. Bacteria were undistinguishable by direct microscopic examination of the cerebrospinal fluid. He responded well to treatment with cefotaxime and dexamethasone, with no sequelae observed at the 4-month follow-up. This first reported case of mixed S. pneumoniae and S. pyogenes meningitis illustrates the life-threatening consequences of barotrauma in immunocompromised patients suffering from otorhinolaryngeal infections.

  2. AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

    Directory of Open Access Journals (Sweden)

    Lindsey R Brown

    Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

  3. Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

    Directory of Open Access Journals (Sweden)

    Gladys Antonia Cueto Montoya


    Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

  4. A european-wide study on the role of streptococcus pneumoniae in community-acquired pneumonia among adults: A meta-analysis

    NARCIS (Netherlands)

    Pechlivanoglou, P.; Rozenbaum, M.; Van Der Werf, T.; Lo-Ten-Foe, J.; Postma, M.; Hak, E.


    OBJECTIVES: Community-acquired pneumococcal pneumonia is an important cause of hospitalization and death among adults, but figures on the prevalence of Streptococcus pneumoniae largely vary. We aimed to identify the prevalence of Streptococcus pneumoniae by systematically reviewing all available

  5. Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Natalie Maricic


    Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

  6. Escherichia coli, Streptococcus pneumoniae, 4(1.2%)

    African Journals Online (AJOL)

    INTRODUCTION. Bacterial conjunctivitis is common and affects all age groups. They are mainly caused by bacteria such as. Streptococcus pneumoniae, Haemophilus influenzae , Staphylo- coccus aureus and Neisseria gonorrhoeae in the normal host. In the new born, who often get this infection from the vaginal fluids of ...

  7. Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

    Centers for Disease Control (CDC) Podcasts


    Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

  8. Peptide permeases from Streptococcus pneumoniae affect adherence to eucaryotic cells. (United States)

    Cundell, D R; Pearce, B J; Sandros, J; Naughton, A M; Masure, H R


    To gain access to tissues within the human host, Streptococcus pneumoniae initially colonizes the nasopharynx and then interacts with glycoconjugates on the surfaces of target cells at various sites of infection. Although pneumococcal adhesins are currently unknown, exported proteins on the bacterial surface are potential candidates. To identify bacterial elements involved in this process, mutants of S. pneumoniae with defects in exported proteins were screened for the inability to adhere to cells representative of three in vivo niches: (i) agglutination of bovine erythrocytes, which reflects adherence to cells which reside in the nasopharynx; (ii) human type II pneumocytes (lung cells [LC]), representing the alveolar site of infection; and (iii) human vascular endothelial cells (EC), representing the endovascular site. The capacity of the mutants to adhere during the course of pneumococcal disease was also assessed by using cytokine-activated LC and EC. All of the 30 mutants analyzed produced hemagglutination values comparable with those of the parent strain. Four independent mutants demonstrated a greater than 50% decrease in adherence to both LC and EC. Sequence analysis of the altered alleles from these strains showed that mutations had occurred in two previously identified loci, plpA and ami, which belong to the family of genes encoding protein-dependent peptide permeases. Mutations in the ami locus resulted in an inability to recognize the GalNAc beta 1-4Gal glycoconjugate receptor present on resting LC and EC, whereas mutations in plpA resulted in a failure to recognize a GalNAc beta 1-3Gal glycoconjugate receptor also present on resting cells. Mutations in neither allele affected recognition of GlcNAc receptors present on cytokine-activated LC and EC. These results suggest that peptide permeases modulate pneumococcal adherence to epithelial and endothelial cells either by acting directly as adhesins or by modulating the expression of adhesins on the

  9. Requirement for capsule in colonization by Streptococcus pneumoniae

    National Research Council Canada - National Science Library

    Magee, A D; Yother, J


    .... Using isolates containing defined mutations in the S. pneumoniae capsule locus, we found that expression of the capsular polysaccharide is essential for colonization by the type 2 strain D39 and the type 3 strains A66 and WU2...

  10. Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

    DEFF Research Database (Denmark)

    Wolter, Nicole; Smith, Anthony M; Farrell, David J


    A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) ge...

  11. Rate of Carriage, Serotype Distribution and Penicilin Resistance of Streptococcus pneumoniae in Healty Children


    ŞENER, Burçin


    The purpose of this study was to define carriage rates for Streptococcus pneumoniae in a given population in Ankara and also to determine the sertypes and penicilin resistance of these strains. Oropharyngeal swabs were taken from a total of 661 children between 1 and 11 years of age living in a province of Ankara between January 1995 and January 1997. Serotyping was performed by detection of the Quellung reaction. Penicilin susceptibilities of the isolates were screened by agar dilution metho...

  12. Interference between Streptococcus pneumoniae and Staphylococcus aureus: In Vitro Hydrogen Peroxide-Mediated Killing by Streptococcus pneumoniae


    Regev-Yochay, Gili; Trzciński, Krzysztof; Thompson, Claudette M.; Malley, Richard; Lipsitch, Marc


    The bactericidal activity of Streptococcus pneumoniae toward Staphylococcus aureus is mediated by hydrogen peroxide. Catalase eliminated this activity. Pneumococci grown anaerobically or genetically lacking pyruvate oxidase (SpxB) were not bactericidal, nor were nonpneumococcal streptococci. These results provide a possible mechanistic explanation for the interspecies interference observed in epidemiologic studies.

  13. Interference between Streptococcus pneumoniae and Staphylococcus aureus: In Vitro Hydrogen Peroxide-Mediated Killing by Streptococcus pneumoniae (United States)

    Regev-Yochay, Gili; Trzciński, Krzysztof; Thompson, Claudette M.; Malley, Richard; Lipsitch, Marc


    The bactericidal activity of Streptococcus pneumoniae toward Staphylococcus aureus is mediated by hydrogen peroxide. Catalase eliminated this activity. Pneumococci grown anaerobically or genetically lacking pyruvate oxidase (SpxB) were not bactericidal, nor were nonpneumococcal streptococci. These results provide a possible mechanistic explanation for the interspecies interference observed in epidemiologic studies. PMID:16788209

  14. Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Raisa Bu-Coifiu Fanego


    Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

  15. Capsular Polysaccharide Expression in Commensal Streptococcus Species: Genetic and Antigenic Similarities to Streptococcus pneumoniae


    Skov Sørensen, Uffe B.; Kaihu Yao; Yonghong Yang; Hervé Tettelin; Mogens Kilian


    ABSTRACT Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule production distinguishes S.?pneumoniae from closely related commensals of the mitis group streptococci. Based on antigenic and genetic analyses of 187 mitis group streptococci, including 90 re...

  16. Frequency of Spontaneous Resistance to Peptide Deformylase Inhibitor GSK1322322 in Haemophilus influenzae, Staphylococcus aureus, Streptococcus pyogenes, and Streptococcus pneumoniae. (United States)

    Min, Sharon; Ingraham, Karen; Huang, Jianzhong; McCloskey, Lynn; Rilling, Sarah; Windau, Anne; Pizzollo, Jason; Butler, Deborah; Aubart, Kelly; Miller, Linda A; Zalacain, Magdalena; Holmes, David J; O'Dwyer, Karen


    The continuous emergence of multidrug-resistant pathogenic bacteria is compromising the successful treatment of serious microbial infections. GSK1322322, a novel peptide deformylase (PDF) inhibitor, shows good in vitro antibacterial activity and has demonstrated safety and efficacy in human proof-of-concept clinical studies. In vitro studies were performed to determine the frequency of resistance (FoR) to this antimicrobial agent in major pathogens that cause respiratory tract and skin infections. Resistance to GSK1322322 occurred at high frequency through loss-of-function mutations in the formyl-methionyl transferase (FMT) protein in Staphylococcus aureus (4/4 strains) and Streptococcus pyogenes (4/4 strains) and via missense mutations in Streptococcus pneumoniae (6/21 strains), but the mutations were associated with severe in vitro and/or in vivo fitness costs. The overall FoR to GSK1322322 was very low in Haemophilus influenzae, with only one PDF mutant being identified in one of four strains. No target-based mutants were identified from S. pyogenes, and only one or no PDF mutants were isolated in three of the four S. aureus strains studied. In S. pneumoniae, PDF mutants were isolated from only six of 21 strains tested; an additional 10 strains did not yield colonies on GSK1322322-containing plates. Most of the PDF mutants characterized from those three organisms (35/37 mutants) carried mutations in residues at or in close proximity to one of three highly conserved motifs that are part of the active site of the PDF protein, with 30 of the 35 mutations occurring at position V71 (using the S. pneumoniae numbering system). Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Factors associated with colonization of Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    -fives attending clinic in Mwanza City, Tanzania. ... Number of children at home, positive HIV status and someone smoking showed association with S. pneumoniae carriage but the differences were not statistically significant. The resistance ...

  18. Capsule type of Streptococcus pneumoniae determines growth phenotype.

    Directory of Open Access Journals (Sweden)

    Lucy J Hathaway

    Full Text Available The polysaccharide capsule of Streptococcus pneumoniae defines over ninety serotypes, which differ in their carriage prevalence and invasiveness for poorly understood reasons. Recently, an inverse correlation between carriage prevalence and oligosaccharide structure of a given capsule has been described. Our previous work suggested a link between serotype and growth in vitro. Here we investigate whether capsule production interferes with growth in vitro and whether this predicts carriage prevalence in vivo. Eighty-one capsule switch mutants were constructed representing nine different serotypes, five of low (4, 7F, 14, 15, 18C and four of high carriage prevalence (6B, 9V, 19F, 23F. Growth (length of lag phase, maximum optical density of wildtype strains, nontypeable mutants and capsule switch mutants was studied in nutrient-restricted Lacks medium (MLM and in rich undefined brain heart infusion broth supplemented with 5% foetal calf serum (BHI+FCS. In MLM growth phenotype depended on, and was transferred with, capsule operon type. Colonization efficiency of mouse nasopharynx also depended on, and was transferred with, capsule operon type. Capsule production interfered with growth, which correlated inversely with serotype-specific carriage prevalence. Serotypes with better growth and higher carriage prevalence produced thicker capsules (by electron microscopy, FITC-dextran exclusion assays and HPLC than serotypes with delayed growth and low carriage prevalence. However, expression of cpsA, the first capsule gene, (by quantitative RT-PCR correlated inversely with capsule thickness. Energy spent for capsule production (incorporation of H3-glucose relative to amount of capsule produced was higher for serotypes with low carriage prevalence. Experiments in BHI+FCS showed overall better bacterial growth and more capsule production than growth in MLM and differences between serotypes were no longer apparent. Production of polysaccharide capsule in S

  19. Capsule type of Streptococcus pneumoniae determines growth phenotype. (United States)

    Hathaway, Lucy J; Brugger, Silvio D; Morand, Brigitte; Bangert, Mathieu; Rotzetter, Jeannine U; Hauser, Christoph; Graber, Werner A; Gore, Suzanna; Kadioglu, Aras; Mühlemann, Kathrin


    The polysaccharide capsule of Streptococcus pneumoniae defines over ninety serotypes, which differ in their carriage prevalence and invasiveness for poorly understood reasons. Recently, an inverse correlation between carriage prevalence and oligosaccharide structure of a given capsule has been described. Our previous work suggested a link between serotype and growth in vitro. Here we investigate whether capsule production interferes with growth in vitro and whether this predicts carriage prevalence in vivo. Eighty-one capsule switch mutants were constructed representing nine different serotypes, five of low (4, 7F, 14, 15, 18C) and four of high carriage prevalence (6B, 9V, 19F, 23F). Growth (length of lag phase, maximum optical density) of wildtype strains, nontypeable mutants and capsule switch mutants was studied in nutrient-restricted Lacks medium (MLM) and in rich undefined brain heart infusion broth supplemented with 5% foetal calf serum (BHI+FCS). In MLM growth phenotype depended on, and was transferred with, capsule operon type. Colonization efficiency of mouse nasopharynx also depended on, and was transferred with, capsule operon type. Capsule production interfered with growth, which correlated inversely with serotype-specific carriage prevalence. Serotypes with better growth and higher carriage prevalence produced thicker capsules (by electron microscopy, FITC-dextran exclusion assays and HPLC) than serotypes with delayed growth and low carriage prevalence. However, expression of cpsA, the first capsule gene, (by quantitative RT-PCR) correlated inversely with capsule thickness. Energy spent for capsule production (incorporation of H3-glucose) relative to amount of capsule produced was higher for serotypes with low carriage prevalence. Experiments in BHI+FCS showed overall better bacterial growth and more capsule production than growth in MLM and differences between serotypes were no longer apparent. Production of polysaccharide capsule in S. pneumoniae

  20. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease (United States)

    Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.


    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  1. Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease. (United States)

    Chao, Yashuan; Marks, Laura R; Pettigrew, Melinda M; Hakansson, Anders P


    Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

  2. Role of Streptococcus pneumoniae infection in chronic obstructive pulmonary disease patients in Italy. (United States)

    Mantero, Marco; Aliberti, Stefano; Azzari, Chiara; Moriondo, Maria; Nieddu, Francesco; Blasi, Francesco; Di Pasquale, Marta


    The aim of this study was to determine the incidence of exacerbations due to Streptococcus pneumoniae in chronic obstructive pulmonary disease (COPD) patients during stable state. We conducted a prospective, observational, cohort study including stable COPD patients, who were evaluated at least every 4 months over a 24-month period at the Respiratory Unit of the IRCCS Policlinico Hospital in Milan, Italy, from 2012 to 2015. Sputum samples were collected at enrollment during stable state to evaluate the frequency of S. pneumoniae colonization and in case of an acute exacerbation to evaluate the incidence of pneumococcal infection. A total of 79 stable patients with moderate to very severe COPD were enrolled. A total of 217 samples were collected, and 27% ( n = 59) of those were positive for S. pneumoniae. A total of four exacerbations due to S. pneumoniae occurred during follow up (0.31 per 100 person/month). Among positive samples of S. pneumoniae, 109 serotypes were identified. The most frequent serotypes in moderate-to-severe COPD patients during both stable state and exacerbation were 19F (12%), 18 (10%), 19A and 9V (9%) and 35 F (7%). Only 32% of COPD patients were effectively vaccinated for S. pneumoniae with PPV23 vaccine. The most frequent S. pneumoniae serotypes in COPD patients are 19F, 18, 19A, 9V and 35 F, and that almost 50% of S. pneumoniae strains could be covered by PCV13 in adult COPD patients.

  3. MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae. (United States)

    van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els


    We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus. (United States)

    Lewis, Megan L; Surewaard, Bas G J


    Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

  5. Factors associated with colonization of Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    Number of children at home, positive HIV status and someone smoking showed association with S. pneumoniae carriage but ... The data included general examination of the child, respiratory and cardiovascular systems of the child. Other clinical data included immunization status, HIV status and presence of other chronic ...

  6. Genomic Analysis of a Serotype 5 Streptococcus pneumoniae Outbreak in British Columbia, Canada, 2005–2009

    Directory of Open Access Journals (Sweden)

    Ruth R. Miller


    Full Text Available Background. Streptococcus pneumoniae can cause a wide spectrum of disease, including invasive pneumococcal disease (IPD. From 2005 to 2009 an outbreak of IPD occurred in Western Canada, caused by a S. pneumoniae strain with multilocus sequence type (MLST 289 and serotype 5. We sought to investigate the incidence of IPD due to this S. pneumoniae strain and to characterize the outbreak in British Columbia using whole-genome sequencing. Methods. IPD was defined according to Public Health Agency of Canada guidelines. Two isolates representing the beginning and end of the outbreak were whole-genome sequenced. The sequences were analyzed for single nucleotide variants (SNVs and putative genomic islands. Results. The peak of the outbreak in British Columbia was in 2006, when 57% of invasive S. pneumoniae isolates were serotype 5. Comparison of two whole-genome sequenced strains showed only 10 SNVs between them. A 15.5 kb genomic island was identified in outbreak strains, allowing the design of a PCR assay to track the spread of the outbreak strain. Discussion. We show that the serotype 5 MLST 289 strain contains a distinguishing genomic island, which remained genetically consistent over time. Whole-genome sequencing holds great promise for real-time characterization of outbreaks in the future and may allow responses tailored to characteristics identified in the genome.

  7. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  8. Significant variation in transformation frequency in Streptococcus pneumoniae


    Evans, Benjamin A; Rozen, Daniel E


    The naturally transformable bacterium Streptococcus pneumoniae is able to take up extracellular DNA and incorporate it into its genome. Maintaining natural transformation within a species requires that the benefits of transformation outweigh its costs. Although much is known about the distribution of natural transformation among bacterial species, little is known about the degree to which transformation frequencies vary within species. Here we find that there is significant variation in trans...

  9. Serotype Prevalence and Penicillin-susceptibility of Streptococcus pneumoniae in Oman

    Directory of Open Access Journals (Sweden)

    Mubarak M. Al-Yaqoub


    Full Text Available Objectives: to determine the prevalent serotypes of Streptococcus pneumoniae and the rate of penicillin-nonsusceptibility among pneumococci in Oman.Methods: Pneumococcal isolates encountered during the period of September 2002 to December 2007 in the Royal Hospital were serotyped. Clinical information as well as the penicillin susceptibility reports were retrieved from the hospital information system and medical records.Results: 120 strains of Streptococcus pneumoniae were isolated of which 85 strains were seroptyped. 20 different serotypes were identified; the most common seroptypes were 9A, 6B, 19F, 14 and 23F. 56�0of the strains were not susceptible to pencillin, while 99�0of these were susceptible to ceftriaxone. 74.3�0and 46.1�0of the serotypes are covered by the pneumococcal polysaccharide vaccine and the 7-valent pneumococcal conjugate vaccine respectively.Conclusion: Certain few pneumococcal serotypes such as 9A, 6B and 19F are more prevalent in the Omani community than others. More than half of S. pneumoniae are not susceptible to penicillin while the great majority of the strains are susceptible to ceftriaxone.

  10. Activity of Vancomycin, Teicoplanin and Cephalosporins against Penicillin-Susceptible and Penicillin-Intermediate Streptococcus Pneumoniae

    Directory of Open Access Journals (Sweden)

    Vivian G Loo


    Full Text Available Objective: To report in vitro susceptibilities of penicillin-susceptible and penicillin-intermediate Streptococcus pneumoniae isolates to cephalosporins, vancomycin and teicoplanin.

  11. Trends of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae in Europe

    NARCIS (Netherlands)

    Bruinsma, N; Kristinsson, KG; Bronzwaer, S; Schrijnemakers, P; Degener, J; Tiemersma, E; Hryniewicz, W; Monen, J; Grundmann, H


    Objectives: To forecast trends in resistance to penicillin and erythromycin among Streptococcus pneumoniae in Europe. Methods: Since 1999, the European Antimicrobial Resistance Surveillance System (EARSS) has collected routine antimicrobial susceptibility test results of S. pneumoniae. To observe

  12. A rare case of sepsis in newborn: Streptococcus pneumoniae septicemia. (United States)

    Karabayir, Nalan; Hatipoglu, Nevin; Adal, Erdal; Sanli, Kamuran


    Streptococcus pneumoniae is a rare cause of sepsis in the newborn. The term baby was admitted on complaint of dyspnea, and antibiotherapy was begun after samples for hemocultures were obtained with the suspicion of sepsis according to the clinical and laboratory data. S. pneumoniae was demonstrated in the vaginal culture of the mother of the patient whose lumbar punction and chest roentgenogram were normal but hemoculture revealed the propagation of S. pneumoniae. The patient, treated with antibiotherapy for 14 days, was discharged without any complications. In preventing the probable complications, it is important to absolutely treat the maternal pneumococcal colonization that can cause severe infections in the newborn and also to treat the newborns even if they are asymptomatic.

  13. Genetic regulation of allolysis in response to sub-lethal antibiotic stress in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)



    Full Text Available Dash M, Dash HR, Das S. 2014. Genetic regulation of allolysis in response to sub-lethal antibiotic stress in Streptococcus pneumoniae. Nusantara Bioscience 6: 111-117. Allolysis is the phenomenon of cell lysis induced by other cells of the same species. Gram-positive bacterium Streptococcus pneumoniae, a major human pathogen exhibits competence induced allolysis that increases the genetic recombination and enhances the virulence. During allolysis, a group of non-competent bacterial cells are lysed by another group of competent cells in the same culture. This process is regulated by com operon as well as bacteriocin. In this study, allolysis was induced in Streptococcus pneumoniae MTCC655 by sub-lethal dose of antibiotic (chloramphenicol and the mechanism of allolysis has been deduced by amplification of lytA, lytC and cbpD genes in the bacterium. The strain was found to be resistant to a number of antibiotics including amoxicillin, cefpodoxime, erythromycin and vancomycin. The early onset of allolysis induction from 7-9 h under normal conditions to 2-3 h by sub-lethal dose of chloramphenicol was observed.

  14. Antibiotic resistance of streptococcus pneumoniae and haemophilus influenzae isolated from respiratory tract specimens

    Directory of Open Access Journals (Sweden)

    Hikmet Eda Aliskan


    Full Text Available Purpose: Streptococcus pneumoniae and Haemophilus influenzae are two of the major pathogens in respiratory infections, treatment is usually started empirically. The aim of this study was to detect in vitro resistance rates of S. pneumoniae and H. influenzae strains isolated from different lower respiratory clinical samples to the antibotics which are used for therapy of infections due to these pathogens. Material and Methods: Seventy seven S.pneumoniae and 117 H.influenzae strains, isolated from patients were included in the study. S.pneumoniae isolates which gave an inhibition zone diameter of >20 mm for oxacillin were considered susceptible for penicilin. For the isolates which had an oxacillin zone diameter of 2 mg/l and 31.1 % were intermediately resistant to parenteral penicillin. Resistance rates to antibiotics were as follows: erythromycin 40 %, trimethoprim/sulphametoxazole (TMP/SMX 54.5 % and ofloxacin 6.4%. beta-lactamases were detected in 15.6% of the H.influenzae isolates by nitrocefin positivity. Conclusion: H.influenzae strains (8.6% were identified as beta-lactamase negative ampicillin resistant (BLNAR strains. Resistance rates for other antibiotics were as follows: ampicillin 28.6%, cefaclor 36.5% , cefuroxime 30.1%, clarithromycin 9.6%, cloramphenicol 7% and TMP-SMX 43.9%. [Cukurova Med J 2016; 41(2.000: 201-207

  15. The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Dong Wook Kim

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

  16. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series. (United States)

    Cillóniz, Catia; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Torres, Antoni; Nicolini, Antonello


    In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis.

  17. Ethanol-induced alcohol dehydrogenase E (AdhE) potentiates pneumolysin in Streptococcus pneumoniae. (United States)

    Luong, Truc Thanh; Kim, Eun-Hye; Bak, Jong Phil; Nguyen, Cuong Thach; Choi, Sangdun; Briles, David E; Pyo, Suhkneung; Rhee, Dong-Kwon


    Alcohol impairs the host immune system, rendering the host more vulnerable to infection. Therefore, alcoholics are at increased risk of acquiring serious bacterial infections caused by Streptococcus pneumoniae, including pneumonia. Nevertheless, how alcohol affects pneumococcal virulence remains unclear. Here, we showed that the S. pneumoniae type 2 D39 strain is ethanol tolerant and that alcohol upregulates alcohol dehydrogenase E (AdhE) and potentiates pneumolysin (Ply). Hemolytic activity, colonization, and virulence of S. pneumoniae, as well as host cell myeloperoxidase activity, proinflammatory cytokine secretion, and inflammation, were significantly attenuated in adhE mutant bacteria (ΔadhE strain) compared to D39 wild-type bacteria. Therefore, AdhE might act as a pneumococcal virulence factor. Moreover, in the presence of ethanol, S. pneumoniae AdhE produced acetaldehyde and NADH, which subsequently led Rex (redox-sensing transcriptional repressor) to dissociate from the adhE promoter. An increase in AdhE level under the ethanol condition conferred an increase in Ply and H2O2 levels. Consistently, S. pneumoniae D39 caused higher cytotoxicity to RAW 264.7 cells than the ΔadhE strain under the ethanol stress condition, and ethanol-fed mice (alcoholic mice) were more susceptible to infection with the D39 wild-type bacteria than with the ΔadhE strain. Taken together, these data indicate that AdhE increases Ply under the ethanol stress condition, thus potentiating pneumococcal virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  18. [Nasopharyngeal carriage of Streptococcus pneumoniae in healthy children and multidrug resistance]. (United States)

    Bayer, Müjgan; Aslan, Gönül; Emekdaş, Gürol; Kuyucu, Necdet; Kanik, Arzu


    Nasopharyngeal carriage of Streptococcus pneumoniae plays an important role for the development of invasive disease and the spread of resistant strains within the community. The aims of this study were to determine the carriage rate of nasopharyngeal S. pneumoniae at healthy school children, to search the susceptibility of the strains to various antibiotics and to evaluate the risk factors for nasopharyngeal carriage of penicillin-resistant pneumococci. A total of 1440 healthy children (age range: 6-13 years old) attending to three primary schools which were chosen randomly in Mersin province (Mediterranean region of Turkey) were included to the study between April 2003 to March 2004. The isolation and identification of S. pneumoniae strains from nasopharyngeal samples were performed by conventional culture methods. Antibiotic sensitivity tests were done according to the Clinical Laboratory Standards Institute directions by disk diffusion method, and penisilin MIC values were detected by E-test (AB Biodisk, Solna, Sweden). S.pneumoniae were isolated from 201 (13.9) of the children. The susceptibility rate of the isolates to penicilin was found as 87.1% (n:175), while 12% (n:24) of the strains yielded intermediate and 1% (n:2) yielded high resistance against penicilin. Overall percentages of resistance to trimethoprim-sulfamethoxazole (TMP-SMX) and macrolides were 30% and 4%, respectively. Two out of eight erythromycin (E) resistant strains showed inducible MLS(B) (macrolide, lincosamide and streptogramin B) type while six showed M (due to active efflux system) type of resistance. Resistance to meropenem, vancomycin, ceftriaxone and ciprofloxacin were not detected. Of S. pneumoniae isolates, 20% were found resistant to only one antibiotic (two strains to penicilin; 39 strains to TMP-SMX), 8.9% to two antibiotics (16 strains to penicillin+TMP-SMX; two strains to penicillin+E) and 2.9% to three or more antibiotics (five strains to penicillin+E+TMP-SMX; one strain to

  19. Differences in antibiotic-induced oxidative stress responses between laboratory and clinical isolates of Streptococcus pneumoniae. (United States)

    Dridi, Bédis; Lupien, Andréanne; Bergeron, Michel G; Leprohon, Philippe; Ouellette, Marc


    Oxidants were shown to contribute to the lethality of bactericidal antibiotics in different bacterial species, including the laboratory strain Streptococcus pneumoniae R6. Resistance to penicillin among S. pneumoniae R6 mutants was further shown to protect against the induction of oxidants upon exposure to unrelated bactericidal compounds. In the work described here, we expanded on these results by studying the accumulation of reactive oxygen species in the context of antibiotic sensitivity and resistance by including S. pneumoniae clinical isolates. In S. pneumoniae R6, penicillin, ciprofloxacin, and kanamycin but not the bacteriostatic linezolid, erythromycin, or tetracycline induced the accumulation of reactive oxygen species. For the three bactericidal compounds, resistance to a single molecule prevented the accumulation of oxidants upon exposure to unrelated bactericidal antibiotics, and this was accompanied by a reduced lethality. This phenomenon does not involve target site mutations but most likely implicates additional mutations occurring early during the selection of resistance to increase survival while more efficient resistance mechanisms are being selected or acquired. Bactericidal antibiotics also induced oxidants in sensitive S. pneumoniae clinical isolates. The importance of oxidants in the lethality of bactericidal antibiotics was less clear than for S. pneumoniae R6, however, since ciprofloxacin induced oxidants even in ciprofloxacin-resistant S. pneumoniae clinical isolates. Our results provide a clear example of the complex nature of the mode of action of antibiotics. The adaptive approach to oxidative stress of S. pneumoniae is peculiar, and a better understanding of the mechanism implicated in response to oxidative injury should also help clarify the role of oxidants induced by antibiotics. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. Genome-Wide Identification of Genes Essential for the Survival of Streptococcus pneumoniae in Human Saliva (United States)

    Verhagen, Lilly M.; de Jonge, Marien I.; Burghout, Peter; Schraa, Kiki; Spagnuolo, Lorenza; Mennens, Svenja; Eleveld, Marc J.; van der Gaast-de Jongh, Christa E.; Zomer, Aldert; Hermans, Peter W. M.; Bootsma, Hester J.


    Since Streptococcus pneumoniae transmits through droplet spread, this respiratory tract pathogen may be able to survive in saliva. Here, we show that saliva supports survival of clinically relevant S. pneumoniae strains for more than 24 h in a capsule-independent manner. Moreover, saliva induced growth of S. pneumoniae in growth-permissive conditions, suggesting that S. pneumoniae is well adapted for uptake of nutrients from this bodily fluid. By using Tn-seq, a method for genome-wide negative selection screening, we identified 147 genes potentially required for growth and survival of S. pneumoniae in saliva, among which genes predicted to be involved in cell envelope biosynthesis, cell transport, amino acid metabolism, and stress response predominated. The Tn-seq findings were validated by testing a panel of directed gene deletion mutants for their ability to survive in saliva under two testing conditions: at room temperature without CO2, representing transmission, and at 37°C with CO2, representing in-host carriage. These validation experiments confirmed that the plsX gene and the amiACDEF and aroDEBC operons, involved in respectively fatty acid metabolism, oligopeptide transport, and biosynthesis of aromatic amino acids play an important role in the growth and survival of S. pneumoniae in saliva at 37°C. In conclusion, this study shows that S. pneumoniae is well-adapted for growth and survival in human saliva and provides a genome-wide list of genes potentially involved in adaptation. This notion supports earlier evidence that S. pneumoniae can use human saliva as a vector for transmission. PMID:24586856

  1. Genome-wide identification of genes essential for the survival of Streptococcus pneumoniae in human saliva.

    Directory of Open Access Journals (Sweden)

    Lilly M Verhagen

    Full Text Available Since Streptococcus pneumoniae transmits through droplet spread, this respiratory tract pathogen may be able to survive in saliva. Here, we show that saliva supports survival of clinically relevant S. pneumoniae strains for more than 24 h in a capsule-independent manner. Moreover, saliva induced growth of S. pneumoniae in growth-permissive conditions, suggesting that S. pneumoniae is well adapted for uptake of nutrients from this bodily fluid. By using Tn-seq, a method for genome-wide negative selection screening, we identified 147 genes potentially required for growth and survival of S. pneumoniae in saliva, among which genes predicted to be involved in cell envelope biosynthesis, cell transport, amino acid metabolism, and stress response predominated. The Tn-seq findings were validated by testing a panel of directed gene deletion mutants for their ability to survive in saliva under two testing conditions: at room temperature without CO2, representing transmission, and at 37 °C with CO2, representing in-host carriage. These validation experiments confirmed that the plsX gene and the amiACDEF and aroDEBC operons, involved in respectively fatty acid metabolism, oligopeptide transport, and biosynthesis of aromatic amino acids play an important role in the growth and survival of S. pneumoniae in saliva at 37 °C. In conclusion, this study shows that S. pneumoniae is well-adapted for growth and survival in human saliva and provides a genome-wide list of genes potentially involved in adaptation. This notion supports earlier evidence that S. pneumoniae can use human saliva as a vector for transmission.

  2. Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance


    Gladys Antonia Cueto Montoya; María del Carmen Pérez Cueto


    Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realiz...

  3. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo


    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

  4. Commensal Streptococci Serve as a Reservoir for β-Lactam Resistance Genes in Streptococcus pneumoniae (United States)

    Valdórsson, Oskar; Frimodt-Møller, Niels; Hollingshead, Susan; Kilian, Mogens


    Streptococcus pneumoniae is a leading cause of pneumonia, meningitis, septicemia, and middle ear infections. The incidence of S. pneumoniae isolates that are not susceptible to penicillin has risen worldwide and may be above 20% in some countries. Beta-lactam antibiotic resistance in pneumococci is associated with significant sequence polymorphism in penicillin-binding proteins (PBPs). Commensal streptococci, especially S. mitis and S. oralis, have been identified as putative donors of mutated gene fragments. However, no studies have compared sequences of the involved pbp genes in large collections of commensal streptococci with those of S. pneumoniae. We therefore investigated the sequence diversity of the transpeptidase region of the three pbp genes, pbp2x, pbp2b, and pbp1a in 107, 96, and 88 susceptible and nonsusceptible strains of commensal streptococci, respectively, at the nucleotide and amino acid levels to determine to what extent homologous recombination between commensal streptococci and S. pneumoniae plays a role in the development of beta-lactam resistance in S. pneumoniae. In contrast to pneumococci, extensive sequence variation in the transpeptidase region of pbp2x, pbp2b, and pbp1a was observed in both susceptible and nonsusceptible strains of commensal streptococci, conceivably reflecting the genetic diversity of the many evolutionary lineages of commensal streptococci combined with the recombination events occurring with intra- and interspecies homologues. Our data support the notion that resistance to beta-lactam antibiotics in pneumococci is due to sequences acquired from commensal Mitis group streptococci, especially S. mitis. However, several amino acid alterations previously linked to beta-lactam resistance in pneumococci appear to represent species signatures of the donor strain rather than being causal of resistance. PMID:25845880

  5. Differential Recognition and Hydrolysis of Host Carbohydrate Antigens by Streptococcus pneumoniae Family 98 Glycoside Hydrolases

    Energy Technology Data Exchange (ETDEWEB)

    Higgins, M.; Whitworth, G; El Warry, N; Randriantsoa, M; Samain, E; Burke, R; Vocadlo, D; Boraston, A


    The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-{beta}-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-{beta}-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

  6. Molecular basis for different levels of tet(M) expression in Streptococcus pneumoniae clinical isolates. (United States)

    Grohs, Patrick; Trieu-Cuot, Patrick; Podglajen, Isabelle; Grondin, Sophie; Firon, Arnaud; Poyart, Claire; Varon, Emmanuelle; Gutmann, Laurent


    Seventy-four unrelated clinical isolates of Streptococcus pneumoniae harboring the tet(M) gene were studied. Seven strains with low tetracycline (Tc) MICs (0.25 to 0.5 μg/ml) were found to harbor truncated tet(M) alleles that were inactivated by different frameshift mutations. In contrast, five strains bore deletions in the tet(M) promoter region, among which four displayed increased Tc MICs (16 to 64 μg/ml). The same promoter mutations were detected in Tc-resistant mutants selected in vitro from various susceptible strains. Sequence analysis revealed that these deletions might impede the formation of the transcriptional attenuator located immediately upstream of tet(M). Expression in Enterococcus faecalis of a tet(M) reporter gene transcribed from these promoter mutants conferred a level of Tc resistance similar to that observed in the parental S. pneumoniae strains. These results show that different levels of Tc susceptibility found in clinical isolates of S. pneumoniae can be explained by frameshift mutations within tet(M) and by alterations of the upstream transcriptional attenuator.

  7. Influence of the blood bacterial load on the meningeal inflammatory response in Streptococcus pneumoniae meningitis

    DEFF Research Database (Denmark)

    Østergaard, C; O´Reilly, T; Brandt, C


    was induced by intracisternal injection of approximately 1 x 10(6) CFU Streptococcus pneumoniae, type 3, and the 26 rabbits were either provided with approximately 1 x 10(6) CFU S. pneumoniae intravenously at 0 hour ("bacteraemic" rabbits, n = 9), immunized with paraformaldehyde-killed S. pneumoniae for 5...

  8. The oral commensal Streptococcus mitis shows a mixed memory Th cell signature that is similar to and cross-reactive with Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Stian André Engen

    Full Text Available BACKGROUND: Carriage of and infection with Streptococcus pneumoniae is known to predominantly induce T helper 17 (Th17 responses in humans, but the types of Th cells showing reactivity towards commensal streptococci with low pathogenic potential, such as the oral commensals S. mitis and S. salivarius, remain uncharacterized. METHODS: Memory CD4(+ T helper (Th cell subsets were isolated from healthy human blood donors according to differential expression of chemokine receptors, expanded in vitro using polyclonal stimuli and characterized for reactivity against different streptococcal strains. RESULTS: Th cells responding to S. mitis, S. salivarius and S. pneumoniae were predominantly in a CCR6(+CXCR3(+ subset and produced IFN-γ, and in a CCR6(+CCR4(+ subset and produced IL-17 and IL-22. Frequencies of S. pneumoniae-reactive Th cells were higher than frequencies of S. mitis- and S. salivarius-specific Th cells. S. mitis and S. pneumoniae isogenic capsule knock-out mutants and a S. mitis mutant expressing the serotype 4 capsule of S. pneumoniae showed no different Th cell responses as compared to wild type strains. S. mitis-specific Th17 cells showed cross-reactivity with S. pneumoniae. CONCLUSIONS: As Th17 cells partly control clearance of S. pneumoniae, cross-reactive Th17 cells that may be induced by commensal bacterial species may influence the immune response, independent of capsule expression.

  9. Interspecific plasmid transfer between Streptococcus pneumoniae and Bacillus subtilis

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa, M. (Inst. de Immunologia y Biologia Microbiana, Velazquez, Madrid, Spain); Lopez, P.; Perez-Urena, M.T.; Lacks, S.A.


    The streptococcal plasmids pMV158 and pLS1, grown in Streptococcus pneumoniae, were transformed to Bacillus subtilis by DNA-mediated transformation.The plasmids were unchanged in the new host; no deletions were observed in 80 instances of transfer. Hybrid plasmids were produced by recombining the EcoRI fragment of pBD6 that confers Km/sup r/ with EcoRI-cut pLS1, which confers Tc/sup r/. The simple hybrid, pMP2, was transferable to both species and expressed Tc/sup r/ and Km/sup r/ in both. A derivative, pMP5, which contained an insertion in the pBD6 component, expressed a higher level of kanomycin resistance and was more easily selected in S. pneumoniae. Another derivative, pMP3, which contained an additional EcoRI fragment, presumably of pneumococcal chromosomal DNA, could not be transferred to B. subtilis. Previous findings that monomeric plasmid forms could transform S. pneumoniae but not B. subtilis were confirmed using single plasmid preparations. Although plasmids extracted from either species were readily transferred to S. pneumoniae, successive passage in B. subtilis increased the ability of plasmid extracts to transfer the plasmid to a B. subtilis recipient. This adaptation was tentatively ascribed to an enrichment of multimeric forms in extracts of B. subtilis as compared to S. pneumoniae. A review of host ranges exhibited by plasmids of Gram-positive bacteria suggested differences in their ability to use particular host replication functions. (JMT)

  10. Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

    Directory of Open Access Journals (Sweden)

    Sonia Ktari


    Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

  11. The role of Streptococcus pneumoniae in community-acquired pneumonia among adults in Europe : a meta-analysis

    NARCIS (Netherlands)

    Rozenbaum, M.H.; Pechlivanoglou, P.; Van Der Werf, T.S.; Lo-Ten-Foe, J.R.; Postma, M.J.; Hak, E.

    The primary objective of this meta-analysis was to estimate the prevalence of adult community-acquired pneumonia (CAP) caused by Streptococcus pneumoniae in Europe, adjusted for possible independent covariates. Two reviewers conducted a systematic literature search using PubMed on English-language

  12. ASC and NLRP3 impair host defense during lethal pneumonia caused by serotype 3 Streptococcus pneumoniae in mice

    NARCIS (Netherlands)

    van Lieshout, Miriam H. P.; de Vos, Alex F.; Dessing, Mark C.; de Porto, Alexander P. N. A.; de Boer, Onno J.; de Beer, Regina; Terpstra, Sanne; Florquin, Sandrine; van't Veer, Cornelis; van der Poll, Tom


    Streptococcus (S.) pneumoniae is the most common cause of community-acquired pneumonia. The Nod-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, consisting of NLRP3, ASC (the adaptor apoptosis-associated speck-like protein containing a CARD) and caspase-1, has been implicated in


    Directory of Open Access Journals (Sweden)

    M. A. Lazareva


    Full Text Available Nasopharyngeal colonization with Streptococcus pneumoniae is a source of respiratory mucosal and invasive infections. For effective vaccine prophylaxis of these diseases the national monitoring of the circulating serotypes and antimicrobial resistance of Streptococcus pneumoniae is required. Objective: To analyze serotype diversity and antimicrobial resistance of S. pneumoniae in the nasopharyngeal carriage in children under 5 years. Methods and patients: The study included orphanage, nursery and children not attending preschool institutions (unorganized children without respiratory infections and not receiving antibiotic therapy. Conducted microbiological analysis of nasopharyngeal flora, serotyping of pneumococcus, assess their sensitivity to antibiotics. Results: Nasopharyngeal carriage of S. pneumoniae was found in 23%, Moraxella catarrhalis - in 23%, Haemophilus influenzae - 16% of the 246 children included in the study. Serotype was determined in 54 pneumococcal isolates: predominant serotypes 19F (21%, 6B (15%, 23F (14%, 14 (8%. The coincidence of the spectrum obtained with serotypes members of the PCV7 pneumococcal conjugate vaccines and PKV10, was 81% in PKV13 - 90%. The proportion of strains sensitive to clindamycin, 31%, to macrolides - 40% to trimethoprim / sulfamethoxazole - 60%. Multiple resistance was observed in 37% of the identified pneumococcal serotypes. In erythromycin-resistant strains resistance was caused by the presence of ermB-gene (in 74% of cases or mef-dependent efflux pump as the sole determinant (9%, in 17% of cases – with its association. Maximum antibiotic resistance is observed in pneumococcal vaccine serotypes. Conclusions: The results of the study comparing with previously obtained data shows stability over the past decades the spectrum of pneumococci circulating in the Russian population of children. A substantial increase in pneumococcal resistance to (especially vaccine serotypes antibiotic penicillin

  14. [Epidemiological analysis of Streptococcus pneumoniae in Gifu prefecture and the northern district of Aichi prefecture--2009]. (United States)

    Yamagishi, Yuka; Mikamo, Hiroshige; Sawamura, Haruki; Suematsu, Hiroyuki; Asano, Yuko; Ishigo, Shiomi; Hatano, Masakazu; Matsubara, Shigenori; Ohta, Hirotoshi; Matsukawa, Yoko; Saeki, Hiroikazu; Mutou, Toshihiro; Teraji, Mayumi; Mouri, Tetsuo; Kawahara, Yuki; Akita, Shigeki; Miyabe, Takanori; Okada, Masako; Terada, Hiroshi; Sakuma, Takashi; Morita, Eri; Miyamoto, Naoya; Tuchiya, Yoko; Yamada, Yukiji; Yamaoka, Kazukiyo; Miyaki, Yuki; Tanaka, Kaori; Watanabe, Kunitomo


    High pathogenicity and drug resistance of Streptococcus pneumoniae are serious problem in clinical practice. Since 1999, we have conducted epidemiologic analyses of S. pneumoniae in Chubu district. We report the results of the analysis conducted in 2009. Three hundred and eight (308) S. pneumoniae isolates with a gene coding for autolysin lyt-A, which had been isolated from patients at 21 medical institutions in Gifu prefecture and the northern part of Aichi prefecture in 2009, were enrolled in this study. The strains were classified according to their drug resistance based on the presence of the pbp mutation, and examined for the presence of the two macrolide-resistance genes, ermB and mefA. Moreover, they were serotyped using type-specific antisera. The mean age of the patients from whom these S. pneumoniae strains were isolated, was 23.4 +/- 30.1 years old, and children aged 15 years old or less accounted for 66% of all the patients. Genotype penicillin-susceptible S. pneumoniae (gPSSP), genotype penicillin-intermediate S. pneumoniae (gPISP) and genotype penicillin-resistant S. pneumoniae (gPRSP) were 22 (7.1%), 131 (42.5%) and 155 (50.3%), respectively. The strains with mefA positive and ermB negative, mefA negative and ermB positive, and mefA positive and ermB positive were 80 (26.0%), 153 (49.7%), and 47 (15.3%), respectively. The MIC90 values of tebipenem (TBPM) and faropenem were 0.06 microg/mL and 0.5 microg/mL, respectively. TBPM showed the high bactericidal activity against gPRSP. In carbapenems, panipenem and biapenem exhibited higher bactericidal activities. Quinolone-resistant S. pneumoniae (QRSP) were isolated from 10 (3.2%). QRSP dominated 5 (7.9%) and 3 (1.5%) among the elderly (over 65 years old) and children, respectively. (As for the serotype, serotypes 6, 19 and 23 were 60 (19.5%), 62 (20.1%), and 44 (14.3%), respectively. Further epidemiologic studies on S. pneumoniae might be required also in the future, including the relationship between the

  15. Efficacy of single-dose ceftriaxone in experimental otitis media induced by penicillin- and cephalosporin-resistant Streptococcus pneumoniae.


    Barry, B.; Muffat-Joly, M; Bauchet, J; Faurisson, F; Gehanno, P; Pocidalo, J J; Carbon, C.


    We used a gerbil model of otitis media to assess the efficacy of single-dose ceftriaxone against three Streptococcus pneumoniae strains highly resistant to penicillin (MICs, 4 to 8 micrograms/ml) and with various susceptibilities to ceftriaxone (MICs, 0.5, 4, and 8 micrograms/ml). Middle ear infection was induced by bilateral transbullar challenge with 10(7) bacteria per ear. Antibiotic treatment was administered subcutaneously at 2 h postinfection. Infection status was checked 2 days later b...

  16. Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Haley R Pipkins

    Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

  17. Interferon-γ from Brain Leukocytes Enhances Meningitis by Type 4 Streptococcus pneumoniae (United States)

    Pettini, Elena; Fiorino, Fabio; Cuppone, Anna Maria; Iannelli, Francesco; Medaglini, Donata; Pozzi, Gianni


    Streptococcus pneumoniae is the leading cause of bacterial meningitis. Pneumococcal meningitis is a life-threatening disease with high rates of mortality and neurological sequelae. Immune targeting of S. pneumoniae is essential for clearance of infection; however, within the brain, the induced inflammatory response contributes to pathogenesis. In this study we investigate the local inflammatory response and the role of IFN-γ in a murine model of pneumococcal meningitis induced by intracranial injection of type 4 S. pneumoniae. Lymphoid and myeloid cell populations involved in meningitis, as well as cytokine gene expression, were investigated after infection. Animals were treated with a monoclonal antibody specific for murine IFN-γ to evaluate its role in animal survival. Intracranial inoculation of 3 × 104 colony-forming units of type 4 strain TIGR4 caused 75% of mice to develop meningitis within 4 days. The amount of lymphocytes, NK cells, neutrophils, monocytes and macrophages in the brain increased 48 h post infection. IFN-γ mRNA levels were about 240-fold higher in brains of infected mice compared to controls. Pro-inflammatory cytokines such as IL-1β and TNF-α, and TLR2 were also upregulated. In vivo treatment with anti-IFN-γ antibody increased survival of infected mice. This study shows that IFN-γ produced during meningitis by type 4 S. pneumoniae enhances bacterial pathogenesis exerting a negative effect on the disease outcome. PMID:26648922

  18. Moxifloxacin in experimental Streptococcus pneumoniae cerebritis and meningitis. (United States)

    Djukic, Marija; Böttcher, Tobias; Wellmer, Andreas; Gerber, Joachim; Brocke, Viola V; Eiffert, Helmut; Nau, Roland


    Rifampin, a protein synthesis inhibitor, reduced mortality in a mouse model of meningitis compared to bacteriolytic cephalosporin standard therapy. To assess whether moxifloxacin (known to cause a less rapid bacteriolysis than cephalosporins) can similarly reduce mortality, mice infected with Streptococcus pneumoniae by deep intracerebral injection were treated subcutaneously with either 200 mg/kg of moxifloxacin or ceftriaxone every 8 hours for 5 days (n = 49 each). They were then observed for an additional 8 days. Overall mortalities were 35 and 29 in moxifloxacin- and ceftriaxone-treated mice, respectively (p = 0.29). Kaplan-Meier survival analysis also revealed no statistically significant differences (p = 0.32). Moxifloxacin failed to reduce mortality compared to cephalosporin standard therapy.

  19. Purulent pericarditis and pneumonia caused by Streptococcus equi subsp. zooepidemicus. (United States)

    Held, Jürgen; Schmitz, Roland; van der Linden, Mark; Nührenberg, Thomas; Häcker, Georg; Neumann, Franz-Josef


    Purulent pericarditis is a life-threatening disease that usually manifests following bacteraemia or through spreading from an intrathoracic focus. Only a few cases of this disease have been reported with Lancefield group C streptococci as aetiological agents, and the primary focus in these infections remains unknown. We report a case of purulent pericarditis with septic and cardiogenic shock, caused by Streptococcus equi subsp. zooepidemicus (group C) in a 51-year-old patient. The pathogen was possibly contracted through contact with horses. Most probably, it caused initially pneumonia before spreading to the pericardium, either directly or via the bloodstream. A combined therapeutic approach, consisting of antibiotic therapy and repeated pericardial drainage, was necessary to ensure a clinical cure. After discharge, long-term follow-up for development of constrictive pericarditis is considered mandatory.

  20. Streptococcus pneumoniae resistentes a Penicilina en Lima - Perú

    Directory of Open Access Journals (Sweden)

    Juan Fukuda Sharizawa


    Full Text Available Objetivo: Evaluar la prevalencia de Streptococcus pneumoniae resistente a penicilina (SPRP. Material y métodos: Se realizó un estudio transversal, multicéntrico, entre Noviembre de 1993 y Noviembre de 1994. Cultivos de sangre, líquido cefalorraquídeo (LCR, líquido pleural (LP, material de timpanocentesis y esputo fueron coleccionados de los laboratorios de microbiología de cuatro hospitales de Lima. Las pruebas de concentración inhibitoria mínima (CIM, fueron realizados usando métodos de dilución en agar, en el laboratorio del Instituto de Medicina Tropical. Se aislaron 61 cepas. Resultados: Solo 2 (3.3% fueron resistentes a penicilina (SPRP, con CIM > 0.12 µg/mL. Las otras 59(96.7% fueron susceptibles a penicilina (CIM: 0.006 - 1.00 µg/mL, no se encontraron cepas con alto nivel de resistencia a penicilina (CIM ≥ 2.0 µg/mL. Ambas cepas fueron susceptibles a cefotaxime (CIM = 0.251µg/mL, a trimethoprim/sulfametoxazole (CIM = 8 µg/mL, 16 µg/mL y a cloramfenicol (CIM =1.0 µg/mL, pero fueron resistentes a ampicilina (CIM = 0.5 µg/mL, 1 µg/mL. Cuatro (6.6% cepas de Streptococcus pneumoniae fueron resistentes a ampicilina, (CIM: 0.06 - 4.00 µg/mL. Solo 1 (1.7% fue resistente a trimethoprim/sulfamethoxazole, (CIM: 1.0 - 32.0 µg/mL. Todas las 61 cepas fueron susceptibles a cefotaxime (CIM: 0.007 - 0.251 µg/mL. (Rev Med Hered 1996; 7: 11-16.

  1. Genetic diversity of penicillin-resistant Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    T. A. Savinova


    Full Text Available Fifty five Streptococcus pneumoniae isolates with reduced susceptibility to penicillin, obtained from patients with respiratory tract infections during 2003 –2007, were analyzed by MLST. Ten isolates were identified by MLST as Streptococcus «viridians» group. Among the remaining isolates 33,3% (n=15 belonged to global clonal complex CC81 and demonstrated reduced susceptibility to macrolides, tetracyclynes and chloramphenicol, three isolates were additionally resistant to levofloxacin. Clonal complex CC271 was represented by 5 isolated (11,1%, CC315 – by 4 (8,9%, CC315 – by 3 (6,7%, CC156, CC280 and CC1012 were represented by 2 (4,4% isolates each. Isolates of clonal complexes 271 and 315 demonstrated high level of associated resistance to macrolides. Twelve clonal complexes were represented by single isolates. More than 50% of isolates with reduced susceptibility to penicillin belonged to three global clonal complexes. Probably these clonal complexes were imported to Russia from other geographical regions.

  2. Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates. (United States)

    Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto


    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

  3. Streptococcus pneumoniae Enhances Human Respiratory Syncytial Virus Infection In Vitro and In Vivo.

    Directory of Open Access Journals (Sweden)

    D Tien Nguyen

    Full Text Available Human respiratory syncytial virus (HRSV and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants hospitalized with bronchiolitis or pneumonia. It has been described that respiratory virus infections may predispose for bacterial superinfections, resulting in severe disease. However, studies on the influence of bacterial colonization of the upper respiratory tract on the pathogenesis of subsequent respiratory virus infections are scarce. Here, we have investigated whether pneumococcal colonization enhances subsequent HRSV infection. We used a newly generated recombinant subgroup B HRSV strain that expresses enhanced green fluorescent protein and pneumococcal isolates obtained from healthy children in disease-relevant in vitro and in vivo model systems. Three pneumococcal strains specifically enhanced in vitro HRSV infection of primary well-differentiated normal human bronchial epithelial cells grown at air-liquid interface, whereas two other strains did not. Since previous studies reported that bacterial neuraminidase enhanced HRSV infection in vitro, we measured pneumococcal neuraminidase activity in these cultures but found no correlation with the observed infection enhancement in our model. Subsequently, a selection of pneumococcal strains was used to induce nasal colonization of cotton rats, the best available small animal model for HRSV. Intranasal HRSV infection three days later resulted in strain-specific enhancement of HRSV replication in vivo. One S. pneumoniae strain enhanced HRSV both in vitro and in vivo, and was also associated with enhanced syncytium formation in vivo. However, neither pneumococci nor HRSV were found to spread from the upper to the lower respiratory tract, and neither pathogen was transmitted to naive cage mates by direct contact. These

  4. The molecular basis of glycogen breakdown and transport in Streptococcus pneumoniae. (United States)

    Abbott, D Wade; Higgins, Melanie A; Hyrnuik, Susanne; Pluvinage, Benjamin; Lammerts van Bueren, Alicia; Boraston, Alisdair B


    The genome of Streptococcus pneumoniae strains, as typified by the TIGR4 strain, contain several genes encoding proteins putatively involved in alpha-glucan degradation, modification and synthesis. The extracellular components comprise an ATP binding cassette-transporter with its solute binding protein, MalX, and the hydrolytic enzyme SpuA. We show that of the commonly occurring exogenous alpha-glucans, S. pneumoniae TIGR4 is only able to grow on glycogen in a MalX- and SpuA-dependent manner. SpuA is able to degrade glycogen into a ladder of alpha-1,4-glucooligosaccharides while the high-affinity interaction (K(a) approximately 10(6) M(-1)) of MalX with maltooligosaccharides plays a key role in promoting the selective uptake of the glycogen degradation products that are produced by SpuA. The X-ray crystallographic analyses of apo- and complexed MalX illuminate the protein's specificity for the degradation products of glycogen and its striking ability to recognize the helical structure of the ligand. Overall, the results of this work provide new structural and functional insight into streptococcal alpha-glucan metabolism while supplying biochemical support for the hypothesis that the substrate of the S. pneumoniaealpha-glucan metabolizing machinery is glycogen, which in a human host is abundant in lung epithelial cells, a common target for invasive S. pneumoniae.

  5. Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

    Directory of Open Access Journals (Sweden)

    Bowers Jolene R


    Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

  6. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

    Energy Technology Data Exchange (ETDEWEB)

    Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)


    Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

  7. Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series * (United States)

    Cillóniz, Catia; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Torres, Antoni; Nicolini, Antonello


    Abstract Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. PMID:26398760

  8. Structural and functional analysis of fucose-processing enzymes from Streptococcus pneumoniae. (United States)

    Higgins, Melanie A; Suits, Michael D; Marsters, Candace; Boraston, Alisdair B


    Fucose metabolism pathways are present in many bacterial species and typically contain the central fucose-processing enzymes fucose isomerase (FcsI), fuculose kinase (FcsK), and fuculose-1-phosphate aldolase (FcsA). Fucose initially undergoes isomerization by FcsI producing fuculose, which is then phosphorylated by FcsK. FcsA cleaves the fuculose-1-phosphate product into lactaldehyde and dihydroxyacetone phosphate, which can be incorporated into central metabolism allowing the bacterium to use fucose as an energy source. Streptococcus pneumoniae has fucose-processing operons containing homologs of FcsI, FcsK, and FcsA; however, this bacterium appears unable to utilize fucose as an energy source. To investigate this contradiction, we performed biochemical and structural studies of the S. pneumoniae fucose-processing enzymes SpFcsI, SpFcsK, and SpFcsA. These enzymes are demonstrated to act in a sequential manner to ultimately produce dihydroxyacetone phosphate and have structural features entirely consistent with their observed biochemical activities. Analogous to the regulation of the Escherichia coli fucose utilization operon, fuculose-1-phosphate appears to act as an inducing molecule for activation of the S. pneumoniae fucose operon. Despite our evidence that S. pneumoniae appears to have the appropriate regulatory and biochemical machinery for fucose metabolism, we confirmed the inability of the S. pneumoniae TIGR4 strain to grow on fucose or on the H-disaccharide, which is the probable substrate of the transporter for the pathway. On the basis of these observations, we postulate that the S. pneumoniae fucose-processing pathway has a non-metabolic role in the interaction of this bacterium with its human host. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. 220D-F2 from Rubus ulmifolius kills Streptococcus pneumoniae planktonic cells and pneumococcal biofilms.

    Directory of Open Access Journals (Sweden)

    Sharmila J Talekar

    Full Text Available Streptococcus pneumoniae (pneumococcus forms organized biofilms to persist in the human nasopharynx. This persistence allows the pneumococcus to produce severe diseases such as pneumonia, otitis media, bacteremia and meningitis that kill nearly a million children every year. While bacteremia and meningitis are mediated by planktonic pneumococci, biofilm structures are present during pneumonia and otitis media. The global emergence of S. pneumoniae strains resistant to most commonly prescribed antibiotics warrants further discovery of alternative therapeutics. The present study assessed the antimicrobial potential of a plant extract, 220D-F2, rich in ellagic acid, and ellagic acid derivatives, against S. pneumoniae planktonic cells and biofilm structures. Our studies first demonstrate that, when inoculated together with planktonic cultures, 220D-F2 inhibited the formation of pneumococcal biofilms in a dose-dependent manner. As measured by bacterial counts and a LIVE/DEAD bacterial viability assay, 100 and 200 µg/ml of 220D-F2 had significant bactericidal activity against pneumococcal planktonic cultures as early as 3 h post-inoculation. Quantitative MIC's, whether quantified by qPCR or dilution and plating, showed that 80 µg/ml of 220D-F2 completely eradicated overnight cultures of planktonic pneumococci, including antibiotic resistant strains. When preformed pneumococcal biofilms were challenged with 220D-F2, it significantly reduced the population of biofilms 3 h post-inoculation. Minimum biofilm inhibitory concentration (MBIC50 was obtained incubating biofilms with 100 µg/ml of 220D-F2 for 3 h and 6 h of incubation. 220D-F2 also significantly reduced the population of pneumococcal biofilms formed on human pharyngeal cells. Our results demonstrate potential therapeutic applications of 220D-F2 to both kill planktonic pneumococcal cells and disrupt pneumococcal biofilms.

  10. Characterization of MDR and XDR Streptococcus pneumoniae in Canada, 2007-13. (United States)

    Golden, Alyssa R; Rosenthal, Margot; Fultz, Ben; Nichol, Kimberly A; Adam, Heather J; Gilmour, Matthew W; Baxter, Melanie R; Hoban, Daryl J; Karlowsky, James A; Zhanel, George G


    The goal of this study was to characterize Streptococcus pneumoniae demonstrating MDR (resistant to three or more antimicrobial classes) or XDR (resistant to five or more classes) phenotypes, collected from Canada during the CANWARD 2007-13 study. From 2007 to 2013 inclusive, S. pneumoniae isolates were collected as a part of the CANWARD surveillance study. MDR and XDR isolates were subjected to PFGE, MLST, molecular detection of pneumococcal pili and macrolide resistance determinants mef(A/E) and erm(B), sequencing of PBPs 1A, 2B and 2X and comparison with Pneumococcal Molecular Epidemiology Network (PMEN) clones. Of 2129 S. pneumoniae isolates collected during the CANWARD 2007-13 study, 61 (2.9%) were found to be MDR. Of these MDR isolates, 43 (70.5%) were XDR. The most common serotypes for both MDR and XDR S. pneumoniae were 19A and 19F. Twenty-nine of 61 isolates (48%) demonstrated resistance to clarithromycin, clindamycin, doxycycline, penicillin and trimethoprim/sulfamethoxazole. All isolates possessed at least one macrolide resistance determinant and mutations in PBPs 1A, 2B and 2X. The most common clone was piliated, XDR ST320, an internationally circulating double-locus variant of Taiwan(19F)-14 (ST236). Though the rate of MDR S. pneumoniae has remained relatively stable since 2007, XDR strains have emerged in Canada. These strains are virulent, possess resistance determinants and are related to international clones. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  11. Oxacillin disk diffusion testing for the prediction of penicillin resistance in Streptococcus pneumoniae. (United States)

    Horna, Gertrudis; Molero, María L; Benites, Liliana; Roman, Sigri; Carbajal, Luz; Mercado, Erik; Castillo, María E; Zerpa, Rito; Chaparro, Eduardo; Hernandez, Roger; Silva, Wilda; Campos, Francisco; Saenz, Andy; Reyes, Isabel; Villalobos, Alex; Ochoa, Theresa J


    Objective To 1) describe the correlation between the zones of inhibition in 1-µg oxacillin disk diffusion (ODD) tests and penicillin and ceftriaxone minimum inhibitory concentrations (MICs) of meningeal and non-meningeal strains of Streptococcus pneumoniae and 2) evaluate the usefulness of the ODD test as a predictor of susceptibility to penicillin in S. pneumoniae and as a quick and cost-effective method easily implemented in a routine clinical laboratory setting. Methods S. pneumoniae isolates from healthy nasopharyngeal carriers less than 2 years old, obtained in a multicentric cross-sectional study conducted in various Peruvian hospitals and health centers from 2007 to 2009, were analyzed. Using Clinical and Laboratory Standards Institute (CLSI) breakpoints, the correlation between the zones of inhibition of the ODD test and the MICs of penicillin and ceftriaxone was determined. Results Of the 571 S. pneumoniae isolates, 314 (55%) showed resistance to penicillin (MIC ≥ 0.12 µg/mL) and 124 (21.7%) showed resistance to ceftriaxone (MIC ≥ 1 µg/mL). Comparison of the ODD test zones of inhibition and the penicillin MICs, using the CLSI meningeal breakpoints, showed good correlation (Cohen's kappa coefficient = 0.8239). Conclusions There was good correlation between ODD zones of inhibition and penicillin meningeal breakpoints but weak correlation between the ODD results and non-meningeal breakpoints for both penicillin and ceftriaxone. Therefore, the ODD test appears to be a useful tool for predicting penicillin resistance in cases of meningeal strains of S. pneumoniae, particularly in low- and middle- income countries, where MIC determination is not routinely available.

  12. Onderzoek naar de gevoeligheid van streptococcus pneumoniae, haemophilus influenzae en Moraxella catarrhalis voor antibiotica

    NARCIS (Netherlands)

    de Neeling AJ; Overbeek BP; Timmerman CP; de Jong J; Dessens-Kroon M; van Klingeren B


    The susceptibility to antibiotics of three respiratory pathogens, Haemophilus influenzae, Streptococcus pneumoniae and Moraxella catarrhalis, was determined. The isolates were obtainied in three regional laboratories in the Netherlands and tested using the microdilution method. After incubation

  13. Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

    NARCIS (Netherlands)

    D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)


    textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

  14. Nasopharyngeal co-colonization with Staphylococcus aureus and Streptococcus pneumoniae in children is bacterial genotype independent.

    NARCIS (Netherlands)

    Melles, D.C.; Bogaert, D.; Gorkink, R.F.; Peeters, J.K.; Moorhouse, M.J.; Ott, A.; Leeuwen, W.B. van; Simons, G.; Verbrugh, H.A.; Hermans, P.W.M.; Belkum, A. van


    Bacterial interference between Staphylococcus aureus and Streptococcus pneumoniae in the nasopharynx has been observed during colonization, which might have important clinical implications for the widespread use of pneumococcal conjugate vaccine in young children. This study aimed to determine

  15. Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

    DEFF Research Database (Denmark)

    Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens


    OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...

  16. Antimicrobial susceptibilities and capsular types of invasive Streptococcus pneumoniae isolated in children in Mexico City. (United States)

    Echániz-Aviles, G; Velázquez-Meza, M E; Carnalla-Barajas, M N; Soto-Noguerón, A; Solórzano-Santos, F; Pérez Miravete, A; Gatica-Marquina, R; di Fabio, J L


    As part of the Sistema Regional de Vacunas (SIREVA) initiative, we conducted a surveillance study to determine the relative prevalence of capsular types of Streptococcus pneumoniae and antimicrobial susceptibility of invasive isolates in children less than 5 years old. We collected 220 isolates and found 33 of the 90 known types, with type 23F as the most common followed by types 6A+B, 14, 19F, and 19A. High penicillin resistance was found in 49 strains (22.2%), 31 belonging to type 23F. Twenty-nine (13.1%) were resistant to erythromycin, 95 (43.1%) were resistant to chloramphenicol, and 24 (10.9%) were resistant to cefotaxime. No strains were resistant to vancomycin.

  17. Pherotypes are driving genetic differentiation within Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Ramirez Mario


    Full Text Available Abstract Background The boundaries of bacterial species and the mechanisms underlying bacterial speciation are matters of intense debate. Theoretical studies have shown that recombination acts as a strong cohesive force preventing divergence in bacterial populations. Streptococcus pneumoniae populations have the telltale signs of high recombination with competence implicated as the major driving force behind gene exchange. Competence in S. pneumoniae is triggered by a quorum-sensing mechanism controlled by the competence-stimulating peptide pheromone. Results We studied the distribution of the two major pherotypes in the pneumococcal population and their association with serotype, antimicrobial resistance and genetic lineage. Using multilocus sequence data we evaluated pherotype influence on the dynamics of horizontal gene transfer. We show that pherotype is a clonal property of pneumococci. Standard population genetic analysis and multilocus infinite allele model simulations support the hypothesis that two genetically differentiated populations are defined by the major pherotypes. Conclusion Severe limitations to gene flow can therefore occur in bacterial species in the absence of geographical barriers and within highly recombinogenic populations. This departure from panmixia can have important consequences for our understanding of the response of pneumococci to human imposed selective pressures such as vaccination and antibiotic use.

  18. Streptococcus pneumoniae Serotype 3 among Costa Rican Children with Otitis Media: clinical, epidemiological characteristics and antimicrobial resistance patterns

    Directory of Open Access Journals (Sweden)

    Porat Nurith


    Full Text Available Abstract Background After the introduction of the seven valent-pneumococcal conjugated vaccine into our National Immunization Program, it is important to establish and track local serotype distribution in order to evaluate its impact specially because serotype replacement phenomena has been described. To describe the clinical, epidemiological and antimicrobial resistance patterns of Costa Rican children with otitis media caused by Streptococcus pneumoniae serotype 3. Methods Middle ear fluid samples were obtained from Costa Rican children with otitis media who participated in various antimicrobial clinical trials between 1992 and 2007. Streptococcus pneumoniae was identified according to laboratory standard procedures. Strains were serotyped and antimicrobial susceptibility to penicillin, amoxicillin, cefuroxime, ceftriaxone, azithromycin and levofloxacin was determined by E-test. Results Throughout 1992–2007 a total of 1919 tympanocentesis were performed in children with otitis media (median age: 19 months and yielded a total of 1208 middle ear isolates. The most common pathogens were: Streptococcus pneumoniae, 511 isolates (49%; Non-Typable Haemophilus influenzae, 386 isolates (37%; Moraxella catarrahalis, 100 isolates (9.5%; and Streptococcus pyogenes, 54 isolates (5%. Streptococcus pneumoniae serotyping was performed in 346/511 isolates (68% recovered during years 1999–2006. The most common serotypes were 19F (101/30.0%, 14 (46/13.7%, 3 (34/10.1%, 6B (30/8.9% and 23F (23/6.8%. Analysis performed per years showed a higher prevalence of serotype 3 Streptococcus pneumoniae during the study period 2004 and 2005. During the entire study period (1999–2006 serotype 3 was most commonly isolated in children older than 24 months (61.2% vs 40.6%;P = 0.05 and showed a lower rate of penicillin non-susceptibility (4.0% vs 18%; P = 0.003. Conclusion Streptococcus pneumoniae serotype 3 is an important pathogen in Costa Rican children with otitis media

  19. [Activity of cefpodoxime and other oral beta-lactams against Haemophilus influenzae and Streptococcus pneumoniae with different susceptibilities to penicillin]. (United States)

    Fenoll, A; Robledo, O; Lerma, M; Giménez, M J; Cebrián, L; Casal, J; Aguilar, L; Gómez-Lus, M L


    This study explores the influence on the intrinsic activity of different oral beta-lactams of beta-lactamase production in Haemophilus influenzae and penicillin resistance in Streptococcus pneumoniae. Three substudies were performed: a) a general susceptibility study, analyzing 550 strains received by the Spanish Laboratorio de Referencia de Neumococos throughout February and March 2005; b) a study on the influence of penicillin resistance on the activity of beta-lactams, analyzing 251 penicillin-susceptible strains (MICor=2 mg/l) randomly chosen among those received by the Spanish Laboratorio de Referencia de Neumococos throughout 2005; and c) an H. influenzae susceptibility study analyzing 150 strains received by Instituto Valenciano de Microbiologia throughout 2005. A total of 71% of S. pneumoniae strains were susceptible to penicillin, 21% exhibited intermediate resistance and 8% strains presented full resistance. H. influenzae beta-lactamase production rate was 18.6%. Of the non-beta-lactamase-producing strains, 3% were not susceptible to ampicillin. Cefpodoxime and cefixime exhibited the highest intrinsic activity against H. influenzae, while amoxicillin and cefpodoxime were the most active compounds against S. pneumoniae. All H. influenzae strains were susceptible to oral cephalosporins and amoxicillin/clavulanic acid. The increase in penicillin resistance in S. pneumoniae influenced cefixime, cefaclor and cefuroxime to a higher degree than amoxicillin and cefpodoxime.

  20. Solithromycin inhibition of protein synthesis and ribosome biogenesis in Staphylococcus aureus, Streptococcus pneumoniae, and Haemophilus influenzae. (United States)

    Rodgers, Ward; Frazier, Ashley D; Champney, W Scott


    The continuing increase in antibiotic-resistant microorganisms is driving the search for new antibiotic targets and improved antimicrobial agents. Ketolides are semisynthetic derivatives of macrolide antibiotics, which are effective against certain resistant organisms. Solithromycin (CEM-101) is a novel fluoroketolide with improved antimicrobial effectiveness. This compound binds to the large 50S subunit of the ribosome and inhibits protein biosynthesis. Like other ketolides, it should impair bacterial ribosomal subunit formation. This mechanism of action was examined in strains of Streptococcus pneumoniae, Staphylococcus aureus, and Haemophilus influenzae. The mean 50% inhibitory concentrations (IC50s) for solithromycin inhibition of cell viability, protein synthesis, and growth rate were 7.5, 40, and 125 ng/ml for Streptococcus pneumoniae, Staphylococcus aureus, and Haemophilus influenzae, respectively. The net formation of the 50S subunit was reduced in all three organisms, with IC50s similar to those given above. The rates of 50S subunit formation measured by a pulse-chase labeling procedure were reduced by 75% in cells growing at the IC50 of solithromycin. Turnover of 23S rRNA was stimulated by solithromycin as well. Solithromycin was found to be a particularly effective antimicrobial agent, with IC50s comparable to those of telithromycin and significantly better than those of azithromycin and clarithromycin in these three microorganisms.

  1. Serine protease PrtA from Streptococcus pneumoniae plays a role in the killing of S. pneumoniae by apolactoferrin. (United States)

    Mirza, Shaper; Wilson, Landon; Benjamin, William H; Novak, Jan; Barnes, Stephen; Hollingshead, Susan K; Briles, David E


    It is known that apolactoferrin, the iron-free form of human lactoferrin, can kill many species of bacteria, including Streptococcus pneumoniae. Lactoferricin, an N-terminal peptide of apolactoferrin, and fragments of it are even more bactericidal than apolactoferrin. In this study we found that apolactoferrin must be cleaved by a serine protease in order for it to kill pneumococci. The serine protease inhibitors were able to block killing by apolactoferrin but did not block killing by a lactoferrin-derived peptide. Thus, the killing of pneumococci by apolactoferrin appears to require a protease to release a lactoferricin-like peptide(s). Incubation of apolactoferrin with growing pneumococci resulted in a 12-kDa reduction in its molecular mass, of which about 7 to 8 kDa of the reduction was protease dependent. Capsular type 2 and 19F strains with mutations in the gene encoding the major cell wall-associated serine protease, prtA, lost much of their ability to degrade apolactoferrin and were relatively resistant to killing by apolactoferrin (P mass by about 8 kDa, and greatly enhance the killing activity of the solution containing the apolactoferrin and its cleavage products. Mass spectroscopy revealed that PrtA makes a major cut between amino acids 78 and 79 of human lactoferrin, removing the N-terminal end of the molecule (about 8.6 kDa). The simplest interpretation of these data is that the mechanism by which apolactoferrin kills Streptococcus pneumoniae requires the release of a lactoferricin-like peptide(s) and that it is this peptide(s), and not the intact apolactoferrin, which kills pneumococci.

  2. Toll-Like Receptor Signalling Is Not Involved in Platelet Response to Streptococcus pneumoniae In Vitro or In Vivo.

    Directory of Open Access Journals (Sweden)

    Sacha F de Stoppelaar

    Full Text Available Streptococcus (S. pneumoniae strains vary considerably in their ability to cause invasive disease in humans, which is at least in part determined by the capsular serotype. Platelets have been implicated as sentinel cells in the circulation for host defence. One of their utensils for this function is the expression of Toll-like receptors (TLRs. We here aimed to investigate platelet response to S. pneumoniae and a role for TLRs herein. Platelets were stimulated using four serotypes of S. pneumonia including an unencapsulated mutant strain. In vitro aggregation and flow cytometry assays were performed using blood of healthy volunteers, or blood of TLR knock out and WT mice. For in vivo pneumonia experiments, platelet specific Myd88 knockout (Plt-Myd88-/- mice were used. We found that platelet aggregation was induced by unencapsulated S. pneumoniae only. Whole blood incubation with all S. pneumoniae serotypes tested resulted in platelet degranulation and platelet-leukocyte complex formation. Platelet activation was TLR independent, as responses were not inhibited by TLR blocking antibodies, not induced by TLR agonists and were equally induced in wild-type and Tlr2-/-, Tlr4-/-, Tlr2/4-/-, Tlr9-/- and Myd88-/- blood. Plt-Myd88-/- and control mice displayed no differences in bacterial clearance or immune response to pneumonia by unencapsulated S. pneumoniae. In conclusion, S. pneumoniae activates platelets through a TLR-independent mechanism that is impeded by the bacterial capsule. Additionally, platelet MyD88-dependent TLR signalling is not involved in host defence to unencapsulated S. pneumoniae in vivo.

  3. Two-component system response regulators involved in virulence of Streptococcus pneumoniae TIGR4 in infective endocarditis.

    Directory of Open Access Journals (Sweden)

    My Trihn

    Full Text Available Streptococci resident in the oral cavity have been linked to infective endocarditis (IE. While other viridans streptococci are commonly studied in relation to IE, less research has been focused on Streptococcus pneumoniae. We established for the first time an animal model of S. pneumoniae IE, and examined the virulence of the TIGR4 strain in this model. We hypothesized that two-component systems (TCS may mediate S. pneumoniae TIGR4 strain virulence in IE and examined TCS response regulator (RR mutants of TIGR4 in vivo with the IE model. Thirteen of the 14 RR protein genes were mutagenized, excluding only the essential gene SP_1227. The requirement of the 13 RRs for S. pneumoniae competitiveness in the IE model was assessed in vivo through use of quantitative real-time PCR (qPCR and competitive index assays. Using real-time PCR, several RR mutants were detected at significantly lower levels in infected heart valves compared with a control strain suggesting the respective RRs are candidate virulence factors for IE. The virulence reduction of the ΔciaR mutant was further confirmed by competitive index assay. Our data suggest that CiaR is a virulence factor of S. pneumoniae strain TIGR4 for IE.

  4. Differentiation of Streptococcus pneumoniae conjunctivitis outbreak isolates by matrix-assisted laser desorption ionization-time of flight mass spectrometry. (United States)

    Williamson, Yulanda M; Moura, Hercules; Woolfitt, Adrian R; Pirkle, James L; Barr, John R; Carvalho, Maria Da Gloria; Ades, Edwin P; Carlone, George M; Sampson, Jacquelyn S


    Streptococcus pneumoniae (pneumococcus [Pnc]) is a causative agent of many infectious diseases, including pneumonia, septicemia, otitis media, and conjunctivitis. There have been documented conjunctivitis outbreaks in which nontypeable (NT), nonencapsulated Pnc has been identified as the etiological agent. The use of mass spectrometry to comparatively and differentially analyze protein and peptide profiles of whole-cell microorganisms remains somewhat uncharted. In this report, we discuss a comparative proteomic analysis between NT S. pneumoniae conjunctivitis outbreak strains (cPnc) and other known typeable or NT pneumococcal and streptococcal isolates (including Pnc TIGR4 and R6, Streptococcus oralis, Streptococcus mitis, Streptococcus pseudopneumoniae, and Streptococcus pyogenes) and nonstreptococcal isolates (including Escherichia coli, Enterococcus faecalis, and Staphylococcus aureus) as controls. cPnc cells and controls were grown to mid-log phase, harvested, and subsequently treated with a 10% trifluoroacetic acid-sinapinic acid matrix mixture. Protein and peptide fragments of the whole-cell bacterial isolate-matrix combinations ranging in size from 2 to 14 kDa were evaluated by matrix-assisted laser desorption ionization-time of flight mass spectrometry. Additionally Random Forest analytical tools and dendrogramic representations (Genesis) suggested similarities and clustered the isolates into distinct clonal groups, respectively. Also, a peak list of protein and peptide masses was obtained and compared to a known Pnc protein mass library, in which a peptide common and unique to cPnc isolates was tentatively identified. Information gained from this study will lead to the identification and validation of proteins that are commonly and exclusively expressed in cPnc strains which could potentially be used as a biomarker in the rapid diagnosis of pneumococcal conjunctivitis.

  5. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Margarida Carrolo

    Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

  6. Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

    NARCIS (Netherlands)

    Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.


    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

  7. Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

    NARCIS (Netherlands)

    Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.|info:eu-repo/dai/nl/074307053; Nijland, Reindert; Veening, Jan-Willem

    Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

  8. Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

    DEFF Research Database (Denmark)

    Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M


    Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

  9. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Bijlsma, Jetta J. E.; Burghout, Peter; Moosterman, Tomas G.; Bootsma, Flester J.; de Jong, Anne; Hermans, Peter W. M.; Kuipers, Oscar P.; Kloosterman, Tomas G.; Bootsma, Hester J.

    Streptococcus pneumoniae is a major cause of serious infections such as pneumonia and meningitis in both children and adults worldwide. Here, we describe the development of a high-throughput, genome-wide technique, genomic array footprinting (GAF), for the identification of genes essential for this

  10. Development of genomic array footprinting for identification of conditionally essential genes in Streptococcus pneumoniae.

    NARCIS (Netherlands)

    Bijlsma, J.J.; Burghout, P.J.; Kloosterman, T.G.; Bootsma, H.J.; Jong, A. de.; Hermans, P.W.M.; Kuipers, O.P.


    Streptococcus pneumoniae is a major cause of serious infections such as pneumonia and meningitis in both children and adults worldwide. Here, we describe the development of a high-throughput, genome-wide technique, genomic array footprinting (GAF), for the identification of genes essential for this

  11. Maltose-Dependent Transcriptional Regulation of the mal Regulon by MalR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P


    The maltose regulon (mal regulon) has previously been shown to consist of the mal gene cluster (malMP, malXCD and malAR operons) in Streptococcus pneumoniae. In this study, we have further elucidated the complete mal regulon in S. pneumoniae D39 using microarray analyses and β-galactosidase assays.

  12. N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P


    In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

  13. Multiple mycotic aneurysms due to penicillin nonsusceptible Streptococcus pneumoniae solved with endovascular repair. (United States)

    Rojas, Alvaro; Mertens, Renato; Arbulo, Douglas; Garcia, Patricia; Labarca, Jaime


    Mycotic aneurysm is a life-threatening condition. We report the case of an 83-year-old white female who had pneumonia, and 3 months later she was admitted with multiple sacular mycotic aneurysms due to penicillin nonsusceptible Streptococcus pneumoniae. Successful combination therapy with antibiotics and endovascular repair was done. Copyright 2010. Published by Elsevier Inc.

  14. N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P


    Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

  15. Dried saliva spots : A robust method for detecting Streptococcus pneumoniae carriage by PCR

    NARCIS (Netherlands)

    Krone, Cassandra L.; Oja, Anna E.; van de Groep, Kirsten|info:eu-repo/dai/nl/413649776; Sanders, Elisabeth A M|info:eu-repo/dai/nl/126771960; Bogaert, Debby|info:eu-repo/dai/nl/264105834; Trzcinski, Krzysztof|info:eu-repo/dai/nl/323349609


    The earliest studies in the late 19th century on Streptococcus pneumoniae (S. pneumoniae) carriage used saliva as the primary specimen. However, interest in saliva declined after the sensitive mouse inoculation method was replaced by conventional culture, which made isolation of pneumococci from the

  16. Streptococcus pneumoniae and reactive oxygen species : an unusual approach to living with radicals

    NARCIS (Netherlands)

    Yesilkaya, Hasan; Andisi, Vahid Farshchi; Andrew, Peter W.; Bijlsma, Jetta J. E.

    Streptococcus pneumoniae, an aerotolerant anaerobe, is an important human pathogen that regularly encounters toxic oxygen radicals from the atmosphere and from the host metabolism and immune system. Additionally, S. pneumoniae produces large amounts of H2O2 as a byproduct of its metabolism, which

  17. Dried Saliva Spots: A Robust Method for Detecting Streptococcus pneumoniae Carriage by PCR

    Directory of Open Access Journals (Sweden)

    Cassandra L. Krone


    Full Text Available The earliest studies in the late 19th century on Streptococcus pneumoniae (S. pneumoniae carriage used saliva as the primary specimen. However, interest in saliva declined after the sensitive mouse inoculation method was replaced by conventional culture, which made isolation of pneumococci from the highly polymicrobial oral cavity virtually impossible. Here, we tested the feasibility of using dried saliva spots (DSS for studies on pneumococcal carriage. Saliva samples from children and pneumococcus-spiked saliva samples from healthy adults were applied to paper, dried, and stored, with and without desiccant, at temperatures ranging from −20 to 37 °C for up to 35 days. DNA extracted from DSS was tested with quantitative-PCR (qPCR specifically for S. pneumoniae. When processed immediately after drying, the quantity of pneumococcal DNA detected in spiked DSS from adults matched the levels in freshly spiked raw saliva. Furthermore, pneumococcal DNA was stable in DSS stored with desiccant for up to one month over a broad range of temperatures. There were no differences in the results when spiking saliva with varied pneumococcal strains. The collection of saliva can be a particularly useful in surveillance studies conducted in remote settings, as it does not require trained personnel, and DSS are resilient to various transportation conditions.

  18. Molecular characterization of Streptococcus pneumoniae serotype 1 invasive isolates in Colombia

    Directory of Open Access Journals (Sweden)

    Carolina Duarte


    Full Text Available OBJECTIVE: To determine the genetic relationship between Streptococcus pneumoniae serotype 1 Colombian isolates recovered from invasive disease between 1994 and 2011 and recognized serotype 1 international clones. METHODS: A total of 135 S. pneumoniae serotype 1 isolates with epidemiological and antimicrobial susceptibility data (Clinical and Laboratory Standards Institute, 2012 were studied. The genetic relationship with recognized international clones was established by pulsed-field gel electrophoresis (PFGE with SmaI restriction enzyme. Multilocus sequence typing (MLST was standardized to determine the sequence type (ST in seven isolates representing different clonal groups. Control and reference strain R6, and clones Sweden¹ ST217, Sweden¹ ST304, Sweden¹ ST306, and USA¹ ST615, were used. RESULTS: PFGE revealed that 89.7% of the isolates were associated with Sweden¹ ST306, 3.7% were associated with Sweden¹ ST304, and 6.6% were not clonally related. Using MLST, ST306 was confirmed in six isolates and ST304 in one. CONCLUSIONS: In contrast to Brazil and the United States, where clones Sweden¹ ST304 and ST227 prevail, invasive disease caused by S. pneumoniae serotype 1 in Colombia is principally associated with the dispersion of isolates related to clone Sweden¹ ST306.

  19. Strain Level Streptococcus Colonization Patterns during the First Year of Life

    Directory of Open Access Journals (Sweden)

    Meredith S. Wright


    Full Text Available Pneumococcal pneumonia has decreased significantly since the implementation of the pneumococcal conjugate vaccine (PCV, nevertheless, in many developing countries pneumonia mortality in infants remains high. We have undertaken a study of the nasopharyngeal (NP microbiome during the first year of life in infants from The Philippines and South Africa. The study entailed the determination of the Streptococcus sp. carriage using a lytA qPCR assay, whole metagenomic sequencing, and in silico serotyping of Streptococcus pneumoniae, as well as 16S rRNA amplicon based community profiling. The lytA carriage in both populations increased with infant age and lytA+ samples ranged from 24 to 85% of the samples at each sampling time point. We next developed informatic tools for determining Streptococcus community composition and pneumococcal serotype from metagenomic sequences derived from a subset of longitudinal lytA-positive Streptococcus enrichment cultures from The Philippines (n = 26 infants, 50% vaccinated and South African (n = 7 infants, 100% vaccinated. NP samples from infants were passaged in enrichment media, and metagenomic DNA was purified and sequenced. In silico capsular serotyping of these 51 metagenomic assemblies assigned known serotypes in 28 samples, and the co-occurrence of serotypes in 5 samples. Eighteen samples were not typeable using known serotypes but did encode for capsule biosynthetic cluster genes similar to non-encapsulated reference sequences. In addition, we performed metagenomic assembly and 16S rRNA amplicon profiling to understand co-colonization dynamics of Streptococcus sp. and other NP genera, revealing the presence of multiple Streptococcus species as well as potential respiratory pathogens in healthy infants. A range of virulence and drug resistant elements were identified as circulating in the NP microbiomes of these infants. This study revealed the frequent co-occurrence of multiple S. pneumoniae strains along with

  20. Genome Annotation and Intraviral Interactome for the Streptococcus pneumoniae Virulent Phage Dp-1▿ ¶


    Sabri, Mourad; Häuser, Roman; Ouellette, Marc; Liu, Jing; Dehbi, Mohammed; Moeck, Greg; García, Ernesto; Titz, Björn; Uetz, Peter; Moineau, Sylvain


    Streptococcus pneumoniae causes several diseases, including pneumonia, septicemia, and meningitis. Phage Dp-1 is one of the very few isolated virulent S. pneumoniae bacteriophages, but only a partial characterization is currently available. Here, we confirmed that Dp-1 belongs to the family Siphoviridae. Then, we determined its complete genomic sequence of 56,506 bp. It encodes 72 open reading frames, of which 44 have been assigned a function. We have identified putative promoters, Rho-indepe...

  1. High prevalence of penicillin-nonsusceptible Streptococcus pneumoniae at a community hospital in Oklahoma.


    Moolenaar, R. L.; Pasley-Shaw, R.; Harkess, J. R.; Lee, A; Crutcher, J. M.


    During 1997, Oklahoma City's Hospital A reported penicillin-nonsusceptible Streptococcus pneumoniae in almost 67% of isolates. To confirm this finding, all Hospital A S. pneumoniae isolates from October 23, 1997, through February 19, 1998, were tested for antibiotic susceptibility and repeat-tested at two other hospital laboratories. Medical records of Hospital A patients with invasive S. pneumoniae infections during 1994 through 1997 were also reviewed. These data were compared with 1998 sta...

  2. Decreased Streptococcus pneumoniae susceptibility to oral antibiotics among children in rural Vietnam: a community study

    Directory of Open Access Journals (Sweden)

    Phuc Ho D


    Full Text Available Abstract Background Streptococcus pneumoniae is the most significant bacterial cause of community-acquired pneumonia among children under five years worldwide. Updated resistance information of S. pneumoniae among children is essential to adjust the recommendations for empirical treatment of community-acquired pneumonia, which will have immense implications for local and global health. This study investigated the prevalence of antibiotic resistance in isolated strains of S. pneumoniae and relationship with antibiotic use and demographic factors of children under five in rural Vietnam in 2007. Methods In Bavi district, 847 children 6 to 60 months were selected from 847 households. The main child-caregivers in the households were interviewed weekly using structured questionnaires to collect information of daily illness symptoms and drug use for the selected child over a four-week period (from March through June 2007. In the 3rd week, the children were invited for a clinical examination and to collect nasopharyngeal samples for S. pneumoniae identification. Etest and disk diffusion were used to test antibiotic susceptibility. Results Of 818 participating children, 258 (32% had ongoing respiratory infections, 421 (52% carried S. pneumoniae, and 477 (58% had used antibiotics within the previous three weeks. Of the 421 isolates, 95% were resistant to at least one antibiotic (401/421. Resistance to co-trimoxazole, tetracycline, phenoxymethylpenicillin, erythromycin and ciprofloxacin was 78%, 75%, 75%, 70% and 28%, respectively. Low resistance was noted for amoxicillin (4%, benzylpenicillin (4%, and cefotaxime (2%. The intermediate resistance to amoxicillin was 32%. Multidrug-resistance was seen in 60%. The most common pattern was co-resistance to co-trimoxazole, tetracycline and erythromycin. The proportion of children carrying resistant bacteria was higher among the children who had used antibiotics in the previous three weeks. Conclusions Resistance

  3. Cotrimoxazole resistance in Streptococcus pneumoniae isolated from sputum of HIV-positive patients. (United States)

    Adeleye, A; Uju, L; Idika, N; Sobande, O


    The prevalence and cotrimoxazole susceptibility of Streptococcus pneumoniae isolated from sputum of 100 HIV-positive patients attending the Nigeria Institute of Medical Research clinic was investigated using standard microbiological methods. Eleven of the sputum specimens grew Streptococcus pneumoniae. Antimicrobial susceptibility test showed that all the isolates were sensitive to amoxicillin, augmentin, erythromycin and chloramphenicol but were resistant to cotrimoxazole. Continuous surveillance of S pneumoniae in sputum samples of HIV-positive subjects in this environment is necessary in order to regulate treatment regimen, considering that cotrimoxazole is the drug recommended by WHO for respiratory infections in HIV patients.

  4. Capsular Serotyping of Streptococcus pneumoniae by latex agglutination. (United States)

    Porter, Barbara D; Ortika, Belinda D; Satzke, Catherine


    Latex agglutination reagents are widely used in microbial diagnosis, identification and serotyping. Streptococcus pneumoniae (the pneumococcus) is a major cause of morbidity and mortality world-wide. Current vaccines target the pneumococcal capsule, and there are over 90 capsular serotypes. Serotyping pneumococcal isolates is therefore important for assessing the impact of vaccination programs and for epidemiological purposes. The World Health Organization has recommended latex agglutination as an alternative method to the 'gold standard' Quellung test for serotyping pneumococci. Latex agglutination is a relatively simple, quick and inexpensive method; and is therefore suitable for resource-poor settings as well as laboratories with high-volume workloads. Latex agglutination reagents can be prepared in-house utilizing commercially-sourced antibodies that are passively attached to latex particles. This manuscript describes a method of production and quality control of latex agglutination reagents, and details a sequential testing approach which is time- and cost-effective. This method of production and quality control may also be suitable for other testing purposes.

  5. Molecular size analysis of capsular polysaccharide preparations from Streptococcus pneumoniae. (United States)

    Bednar, B; Hennessey, J P


    Purified capsular polysaccharide preparations from Streptococcus pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F were analyzed by high performance size exclusion chromatography (HPSEC) with multi-angle laser light scattering (MALLS), specific viscosity (SV), and refractive index (RI) detection to determine the molecular size and molar mass of each of the pneumococcal (Pn) polysaccharides. The Mw's of the polysaccharides ranged from a low of 606 kg/mol for Pn4 to a high of 1145 kg/mol for Pn9V, and the z-average radii of gyration ranged from 59 nm for Pn14 to 72 nm for Pn18C. Estimations of molar mass of the highly anionic polysaccharides (all but Pn14) by the universal calibration approach were unsuccessful, resulting in a 27-53% overestimate of the Mw's though application of Mark-Houwink-Sakurada coefficients calculated from the HPSEC-MALLS/SV/RI data resulted in estimates of Mw that were in agreement with the MALLS estimates for all but the Pn4 preparation. These results emphasize the need for direct measurement of both molecular size and intrinsic viscosity distributions for definitive characterization of the molar mass, hydrodynamic volume, rigidity, and drainage of complex biological polymers such as the pneumococcal polysaccharides.

  6. A metalloproteinase secreted by Streptococcus pneumoniae removes membrane mucin MUC16 from the epithelial glycocalyx barrier.

    Directory of Open Access Journals (Sweden)

    Bharathi Govindarajan

    Full Text Available The majority of bacterial infections occur across wet-surfaced mucosal epithelia, including those that cover the eye, respiratory tract, gastrointestinal tract and genitourinary tract. The apical surface of all these mucosal epithelia is covered by a heavily glycosylated glycocalyx, a major component of which are membrane-associated mucins (MAMs. MAMs form a barrier that serves as one of the first lines of defense against invading bacteria. While opportunistic bacteria rely on pre-existing defects or wounds to gain entry to epithelia, non opportunistic bacteria, especially the epidemic disease-causing ones, gain access to epithelial cells without evidence of predisposing injury. The molecular mechanisms employed by these non opportunistic pathogens to breach the MAM barrier remain unknown. To test the hypothesis that disease-causing non opportunistic bacteria gain access to the epithelium by removal of MAMs, corneal, conjunctival, and tracheobronchial epithelial cells, cultured to differentiate to express the MAMs, MUCs 1, 4, and 16, were exposed to a non encapsulated, non typeable strain of Streptococcus pneumoniae (SP168, which causes epidemic conjunctivitis. The ability of strain SP168 to induce MAM ectodomain release from epithelia was compared to that of other strains of S. pneumoniae, as well as the opportunistic pathogen Staphylococcus aureus. The experiments reported herein demonstrate that the epidemic disease-causing S. pneumoniae species secretes a metalloproteinase, ZmpC, which selectively induces ectodomain shedding of the MAM MUC16. Furthermore, ZmpC-induced removal of MUC16 from the epithelium leads to loss of the glycocalyx barrier function and enhanced internalization of the bacterium. These data suggest that removal of MAMs by bacterial enzymes may be an important virulence mechanism employed by disease-causing non opportunistic bacteria to gain access to epithelial cells to cause infection.

  7. Impact of aspirin on the transcriptome ofStreptococcus pneumoniaeD39. (United States)

    Afzal, Muhammad; Shafeeq, Sulman


    Aspirin or acetylsalicylic acid (ASA) is a medicine used to treat pain, fever, and inflammation. Here, we for the very first time reported the genome-wide transcriptional profiling of aspirin-regulated genes in Streptococcus pneumoniae in the presence of 5 mM aspirin in chemically-defined medium (CDM) using microarray analysis. Our results showed that expression of several genes was differentially expressed in the presence of aspirin. These genes were further grouped into COG (Clusters of Orthologous Groups) functional categories based on the putative functions of the corresponding proteins. Most of affected genes belong to COG category E (Amino acid transport and metabolism), G (Carbohydrate transport and metabolism), J (Translation, ribosomal structure and biogenesis), and I (Lipid transport and metabolism). Transcriptional profiling data of aspirin-regulated genes was deposited to Gene Expression Omnibus (GEO) database under accession number GSE94514.

  8. Promoter Identification and Transcription Analysis of Penicillin-Binding Protein Genes in Streptococcus pneumoniae R6. (United States)

    Peters, Katharina; Pipo, Julia; Schweizer, Inga; Hakenbeck, Regine; Denapaite, Dalia


    Penicillin-binding proteins (PBPs) are membrane-associated enzymes, which are involved in the last two steps of peptidoglycan biosynthesis, and some of them are key players in cell division. Furthermore, they are targets of β-lactams, the most widely used antibiotics. Nevertheless, very little is known about the expression and regulation of PBP genes. Using transcriptional mapping, we now determined the promoter regions of PBP genes from the laboratory strain Streptococcus pneumoniae R6 and examined the expression profile of these six promoters. The extended -10 region is highly conserved and complies with a σ(A)-type promoter consensus sequence. In contrast, the -35 region is poorly conserved, indicating the possibility for differential PBP regulation. All PBP promoters were constitutively expressed and highly active during the exponential and early stationary growth phase. However, the individual expression of PBP promoters varied approximately fourfold, with pbp1a being the highest and pbp3 the lowest. Furthermore, the deletion of one nucleotide in the spacer region of the PBP3 promoter reduced pbp3 expression ∼10-fold. The addition of cefotaxime above the minimal inhibitory concentration (MIC) did not affect PBP expression in the penicillin-sensitive R6 strain. No evidence for regulation of S. pneumoniae PBP genes was obtained.

  9. Streptococcus pneumoniae Eradicates Preformed Staphylococcus aureus Biofilms through a Mechanism Requiring Physical Contact. (United States)

    Khan, Faidad; Wu, Xueqing; Matzkin, Gideon L; Khan, Mohsin A; Sakai, Fuminori; Vidal, Jorge E


    Staphylococcus aureus (Sau) strains are a main cause of disease, including nosocomial infections which have been linked to the production of biofilms and the propagation of antibiotic resistance strains such as methicillin-resistant Staphylococcus aureus (MRSA). A previous study found that Streptococcus pneumoniae (Spn) strains kill planktonic cultures of Sau strains. In this work, we have further evaluated in detail the eradication of Sau biofilms and investigated ultrastructural interactions of the biofilmicidal effect. Spn strain D39, which produces the competence stimulating peptide 1 (CSP1), reduced Sau biofilms within 8 h of inoculation, while TIGR4, producing CSP2, eradicated Sau biofilms and planktonic cells within 4 h. Differences were not attributed to pherotypes as other Spn strains producing different pheromones eradicated Sau within 4 h. Experiments using Transwell devices, which physically separated both species growing in the same well, demonstrated that direct contact between Spn and Sau was required to efficiently eradicate Sau biofilms and biofilm-released planktonic cells. Physical contact-mediated killing of Sau was not related to production of hydrogen peroxide as an isogenic TIGR4ΔspxB mutant eradicated Sau bacteria within 4 h. Confocal micrographs confirmed eradication of Sau biofilms by TIGR4 and allowed us to visualize ultrastructural point of contacts between Sau and Spn. A time-course study further demonstrated spatial colocalization of Spn chains and Sau tetrads as early as 30 min post-inoculation (Pearson's coefficient >0.72). Finally, precolonized biofilms produced by Sau strain Newman, or MRSA strain USA300, were eradicated by mid-log phase cultures of washed TIGR4 bacteria within 2 h post-inoculation. In conclusion, Spn strains rapidly eradicate pre-colonized Sau aureus biofilms, including those formed by MRSA strains, by a mechanism(s) requiring bacterium-bacterium contact, but independent from the production of hydrogen peroxide.

  10. Antibiotic innovation may contribute to slowing the dissemination of multiresistant Streptococcus pneumoniae: the example of ketolides.

    Directory of Open Access Journals (Sweden)

    Lulla Opatowski

    Full Text Available BACKGROUND: Despite increasingly frequent bacterial resistance to antibiotics, antibacterial innovation is rare. Ketolides constitute one of the very few new antibiotic classes active against Streptococcus pneumoniae developed during the last 25 years. Their mechanism of action resembles that of macrolides, but they are unaffected by common resistance mechanisms. However, cross-resistance to ketolides has been observed in some macrolide-resistant strains. We examined how new antibiotic exposure may affect overall pneumococcal resistance patterns in the population. The aims of this study were to assess the potential dissemination of newly emerged resistances and to control the selection of strains already multiresistant to existing antimicrobials. METHODOLOGY/PRINCIPAL FINDINGS: We developed an age-structured population model for S. pneumoniae transmission in a human community exposed to heptavalent vaccine, and beta-lactams, macrolides and ketolides. The dynamics of intra-individual selection of resistant strains under antibiotic exposure and interindividual transmission were simulated, with antibiotic-specific resistance mechanisms defining the path to co-resistances and cross-resistances, and parameters concerning the French situation. Results of this simulation study suggest that new antibiotic consumption could markedly slow the diffusion of multiresistant strains. Wider use was associated with slower progression of multiresistance. When ketolides were prescribed to all ages, resistance to them reached 10% after >15 years, while it took >40 years when they were prescribed only to adults. In the scenario according to which new antibiotics totally replaced former antimicrobials, the beta-lactam resistance rate was limited at 70%. CONCLUSIONS: In a context of widespread vaccination and rational use of antibiotics, innovative antibiotic, prescribed to all age groups, may have an added impact on multiresistant-strain dissemination in the

  11. Clones of Streptococcus zooepidemicus from outbreaks of hemorrhagic canine pneumonia and associated immune responses. (United States)

    Velineni, Sridhar; Timoney, John F; Russell, Kim; Hamlen, Heidi J; Pesavento, Patricia; Fortney, William D; Crawford, P Cynda


    Acute hemorrhagic pneumonia caused by Streptococcus zooepidemicus has emerged as a major disease of shelter dogs and greyhounds. S. zooepidemicus strains differing in multilocus sequence typing (MLST), protective protein (SzP), and M-like protein (SzM) sequences were identified from 9 outbreaks in Texas, Kansas, Florida, Nevada, New Mexico, and Pennsylvania. Clonality based on 2 or more isolates was evident for 7 of these outbreaks. The Pennsylvania and Nevada outbreaks also involved cats. Goat antisera against acutely infected lung tissue as well as convalescent-phase sera reacted with a mucinase (Sz115), hyaluronidase (HylC), InlA domain-containing cell surface-anchored protein (INLA), membrane-anchored protein (MAP), SzP, SzM, and extracellular oligopeptide-binding protein (OppA). The amino acid sequences of SzP and SzM of the isolates varied greatly. The szp and szm alleles of the closely related Kansas clone (sequence type 129 [ST-129]) and United Kingdom isolate BHS5 (ST-123) were different, indicating that MLST was unreliable as a predictor of virulence phenotype. Combinations of conserved HylC and serine protease (ScpC) and variable SzM and SzP proteins of S. zooepidemicus strain NC78 were protectively immunogenic for mice challenged with a virulent canine strain. Thus, although canine pneumonia outbreaks are caused by different strains of S. zooepidemicus, protective immune responses were elicited in mice by combinations of conserved or variable S. zooepidemicus proteins from a single strain. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  12. Nasal carriage of Streptococcus pneumoniae serotypes and Staphylococcus aureus in Streptococcus pneumoniae-vaccinated and non-vaccinated young children. (United States)

    Dukers-Muijrers, N H T M; Stobberingh, E; Beisser, P; Boesten, R C H; Jacobs, P; Hoebe, C J P A


    Since the implementation of Streptococcus pneumoniae (SPn) conjugate vaccination (PCV), non-vaccine types have prevailed in invasive pneumococcal disease (IPD), and an increase in Staphylococcus aureus (SA) burden has been suggested. Here, we assess the epidemiology of SA and SPn nasal carriage in 620 children at day-care centres; 141 of these children had received 1-4 PCV7 doses. A higher vaccine dosage was associated with non-vaccine-type SPn carriage. Of all SPn isolates, 45% were PCV7 types, 1% were additional PCV10 types and 22% were the three additional PCV13 types. SA carriage was inversely associated with vaccine-type SPn carriage. SPn serotype 19A showed higher SA co-carriage rates compared to other SPn serotypes. PCV7 implementation does not prevent children from being part of the IPD-related SPn transmission chain. These results contribute to the monitoring of SA- and SPn-related disease and add to the debate on the current national vaccination policy that recently included a change from PCV7 to PCV10.

  13. Filamentous influenza A virus infection predisposes mice to fatal septicemia following superinfection with Streptococcus pneumoniae serotype 3. (United States)

    Speshock, Janice L; Doyon-Reale, Nicole; Rabah, R; Neely, Melody N; Roberts, Paul C


    Previous studies have demonstrated that animals exposed to Streptococcus pneumoniae while recovering from influenza A virus infection exhibit exacerbated disease symptoms. However, many of the current animal models exploring dual viral and bacterial synergistic exacerbations of respiratory disease have utilized mouse-adapted influenza virus and strains of Streptococcus pneumoniae that in themselves are highly lethal to mice. Here we describe a mouse model of bacterial superinfection in which a mild, self-limiting influenza virus infection is followed by mild, self-limiting superinfection with S. pneumoniae serotype 3. S. pneumoniae superinfection results in rapid dissemination of the bacterium from the respiratory tract and systemic spread to all major organs of the mice, resulting in fatal septicemia. This phenomenon in mice was observed in superinfected animals undergoing an active viral infection as well as in mice that had completely cleared the virus 7 to 8 days prior to superinfection. Neutrophils were the predominant cellular inflammatory infiltrate in the lungs of superinfected mice compared to singly infected animals. Among other cytokines and chemokines, the neutrophil activator granulocyte colony-stimulating factor (G-CSF) was found to be significantly overexpressed in the spleens, lungs, and brains of superinfected animals. High G-CSF protein levels were observed in sera and lung lavage fluid from superinfected animals, suggesting that G-CSF is a major contributor to synergistic exacerbation of disease leading to fatal septicemia.

  14. Carriage rate and serotypes of Streptococcus pneumoniae amongst children in Thika Hospital, Kenya

    Directory of Open Access Journals (Sweden)

    Susan Githii


    Full Text Available Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Rates of carriage are highest in infants and the elderly. The objectives of this study were to determine the rate of nasopharyngeal colonization by S. pneumoniae, and to describe the antibiotic resistant patterns and the serotypes of the carried isolates. A cross-sectional study design was used. Nasopharyngeal swabs were collected from 315 children in the months of Octoberand November 2010 and processed to isolate S. pneumoniae. The isolates were serotyped by the Quellung reaction and their antibiotic susceptibilities assessed by the disc diffusion method. The overall nasopharyngeal carriage rate for S. pneumoniae was 17%. Seventeen serotypes were detected amongst 55 strains analysed: 6A, 23F, 19F, 13, 6B, 14A, 20, 7C, 1,15B, 35B, 19A, 11A, 34, 5, 3 and 23A. Susceptibility testing revealed that nearly all (98% were resistant to cotrimoxazole, 9% were resistant to penicillin and 7% to cefotaxime. Resistance to chloramphenicol and erythromycin was 2% and 4%, respectively. All isolates were fully sensitive to tetracycline. High levels of cotrimoxazole resistance and some resistance to other antimicrobial agents commonly used in Thika District Hospital shows that there is need to revise antimicrobial policy in this region in the treatment of invasive pneumococcal infections. The frequent serotypes found in this study have previously been associated with pneumococcal infectionsin children. Several of these serotypes are included in the ten-valent vaccine and therefore useof this vaccine will help reduce pneumococcal infections in Thika.

  15. TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins. (United States)

    Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy


    Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

  16. Septic arthritis of shoeulder caused by Streptococcus pneumoniae serotype 23F in a female infant. Report of a case

    Directory of Open Access Journals (Sweden)

    Flores Nava Gerardo


    Full Text Available We present the case of a female infant previously vaccinated against Streptococcus pneumoniae who developed a septic arthritis in the right shoulder. An artrothomy was performed. The culture of the sy- novial fluid was positive for serotype 23F Streptococcus pneumonia.

  17. Streptococcus pneumoniae triggers progression of pulmonary fibrosis through pneumolysin. (United States)

    Knippenberg, Sarah; Ueberberg, Bianca; Maus, Regina; Bohling, Jennifer; Ding, Nadine; Tort Tarres, Meritxell; Hoymann, Heinz-Gerd; Jonigk, Danny; Izykowski, Nicole; Paton, James C; Ogunniyi, Abiodun D; Lindig, Sandro; Bauer, Michael; Welte, Tobias; Seeger, Werner; Guenther, Andreas; Sisson, Thomas H; Gauldie, Jack; Kolb, Martin; Maus, Ulrich A


    Respiratory tract infections are common in patients suffering from pulmonary fibrosis. The interplay between bacterial infection and fibrosis is characterised poorly. To assess the effect of Gram-positive bacterial infection on fibrosis exacerbation in mice. Fibrosis progression in response to Streptococcus pneumoniae was examined in two different mouse models of pulmonary fibrosis. We demonstrate that wild-type mice exposed to adenoviral vector delivery of active transforming growth factor-β1 (TGFß1) or diphteria toxin (DT) treatment of transgenic mice expressing the DT receptor (DTR) under control of the surfactant protein C (SPC) promoter (SPC-DTR) to induce pulmonary fibrosis developed progressive fibrosis following infection with Spn, without exhibiting impaired lung protective immunity against Spn. Antibiotic treatment abolished infection-induced fibrosis progression. The cytotoxin pneumolysin (Ply) of Spn caused this phenomenon in a TLR4-independent manner, as Spn lacking Ply (SpnΔply) failed to trigger progressive fibrogenesis, whereas purified recombinant Ply did. Progressive fibrogenesis was also observed in AdTGFβ1-exposed Ply-challenged TLR4 KO mice. Increased apoptotic cell death of alveolar epithelial cells along with an attenuated intrapulmonary release of antifibrogenic prostaglandin E2 was found to underlie progressive fibrogenesis in Ply-challenged AdTGFβ1-exposed mice. Importantly, vaccination of mice with the non-cytotoxic Ply derivative B (PdB) substantially attenuated Ply-induced progression of lung fibrosis in AdTGFβ1-exposed mice. Our data unravel a novel mechanism by which infection with Spn through Ply release induces progression of established lung fibrosis, which can be attenuated by protein-based vaccination of mice. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  18. Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

    Directory of Open Access Journals (Sweden)

    Alessandro Perazzo


    Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

  19. Streptococcus pneumoniae serine protease HtrA, but not SFP or PrtA, is a major virulence factor in pneumonia

    NARCIS (Netherlands)

    de Stoppelaar, Sacha F.; Bootsma, Hester J.; Zomer, Aldert; Roelofs, Joris J. T. H.; Hermans, Peter W. M.; van 't Veer, Cornelis; van der Poll, Tom


    Streptococcus (S.) pneumoniae is a common causative pathogen in pneumonia. Serine protease orthologs expressed by a variety of bacteria have been found of importance for virulence. Previous studies have identified two serine proteases in S. pneumoniae, HtrA (high-temperature requirement A) and PrtA

  20. Adenylate kinase from Streptococcus pneumoniae is essential for growth through its catalytic activity

    Directory of Open Access Journals (Sweden)

    Trung Thanh Thach


    Full Text Available Streptococcus pneumoniae (pneumococcus infection causes more than 1.6 million deaths worldwide. Pneumococcal growth is a prerequisite for its virulence and requires an appropriate supply of cellular energy. Adenylate kinases constitute a major family of enzymes that regulate cellular ATP levels. Some bacterial adenylate kinases (AdKs are known to be critical for growth, but the physiological effects of AdKs in pneumococci have been poorly understood at the molecular level. Here, by crystallographic and functional studies, we report that the catalytic activity of adenylate kinase from S. pneumoniae (SpAdK serotype 2 D39 is essential for growth. We determined the crystal structure of SpAdK in two conformations: ligand-free open form and closed in complex with a two-substrate mimic inhibitor adenosine pentaphosphate (Ap5A. Crystallographic analysis of SpAdK reveals Arg-89 as a key active site residue. We generated a conditional expression mutant of pneumococcus in which the expression of the adk gene is tightly regulated by fucose. The expression level of adk correlates with growth rate. Expression of the wild-type adk gene in fucose-inducible strains rescued a growth defect, but expression of the Arg-89 mutation did not. SpAdK increased total cellular ATP levels. Furthermore, lack of functional SpAdK caused a growth defect in vivo. Taken together, our results demonstrate that SpAdK is essential for pneumococcal growth in vitro and in vivo.

  1. High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. (United States)

    Liu, Xue; Gallay, Clement; Kjos, Morten; Domenech, Arnau; Slager, Jelle; van Kessel, Sebastiaan P; Knoops, Kèvin; Sorg, Robin A; Zhang, Jing-Ren; Veening, Jan-Willem


    Genome-wide screens have discovered a large set of essential genes in the opportunistic human pathogen Streptococcus pneumoniae However, the functions of many essential genes are still unknown, hampering vaccine development and drug discovery. Based on results from transposon sequencing (Tn-seq), we refined the list of essential genes in S. pneumoniae serotype 2 strain D39. Next, we created a knockdown library targeting 348 potentially essential genes by CRISPR interference (CRISPRi) and show a growth phenotype for 254 of them (73%). Using high-content microscopy screening, we searched for essential genes of unknown function with clear phenotypes in cell morphology upon CRISPRi-based depletion. We show that SPD_1416 and SPD_1417 (renamed to MurT and GatD, respectively) are essential for peptidoglycan synthesis, and that SPD_1198 and SPD_1197 (renamed to TarP and TarQ, respectively) are responsible for the polymerization of teichoic acid (TA) precursors. This knowledge enabled us to reconstruct the unique pneumococcal TA biosynthetic pathway. CRISPRi was also employed to unravel the role of the essential Clp-proteolytic system in regulation of competence development, and we show that ClpX is the essential ATPase responsible for ClpP-dependent repression of competence. The CRISPRi library provides a valuable tool for characterization of pneumococcal genes and pathways and revealed several promising antibiotic targets. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  2. Genetic transformation of Streptococcus pneumoniae by DNA cloned into the single-stranded bacteriophage f1.


    Barany, F; Boeke, J D


    A Staphylococcus aureus plasmid derivative, pFB9, coding for erythromycin and chloramphenicol resistance was cloned into the filamentous Escherichia coli phage f1. Recombinant phage-plasmid hybrids, designated plasmids, were isolated from E. coli and purified by transformation into Streptococcus pneumoniae. Single-stranded DNA was prepared from E. coli cells infected with two different plasmids, fBB101 and fBB103. Introduction of fully or partially single-stranded DNA into Streptococcus pneum...

  3. The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Yayan J


    Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

  4. C-type Lectin Mincle Recognizes Glucosyl-diacylglycerol of Streptococcus pneumoniae and Plays a Protective Role in Pneumococcal Pneumonia. (United States)

    Behler-Janbeck, Friederike; Takano, Tomotsugu; Maus, Regina; Stolper, Jennifer; Jonigk, Danny; Tort Tarrés, Meritxell; Fuehner, Thomas; Prasse, Antje; Welte, Tobias; Timmer, Mattie S M; Stocker, Bridget L; Nakanishi, Yoichi; Miyamoto, Tomofumi; Yamasaki, Sho; Maus, Ulrich A


    Among various innate immune receptor families, the role of C-type lectin receptors (CLRs) in lung protective immunity against Streptococcus pneumoniae (S. pneumoniae) is not fully defined. We here show that Mincle gene expression was induced in alveolar macrophages and neutrophils in bronchoalveolar lavage fluids of mice and patients with pneumococcal pneumonia. Moreover, S. pneumoniae directly triggered Mincle reporter cell activation in vitro via its glycolipid glucosyl-diacylglycerol (Glc-DAG), which was identified as the ligand recognized by Mincle. Purified Glc-DAG triggered Mincle reporter cell activation and stimulated inflammatory cytokine release by human alveolar macrophages and alveolar macrophages from WT but not Mincle KO mice. Mincle deficiency led to increased bacterial loads and decreased survival together with strongly dysregulated cytokine responses in mice challenged with focal pneumonia inducing S. pneumoniae, all of which was normalized in Mincle KO mice reconstituted with a WT hematopoietic system. In conclusion, the Mincle-Glc-DAG axis is a hitherto unrecognized element of lung protective immunity against focal pneumonia induced by S. pneumoniae.

  5. C-type Lectin Mincle Recognizes Glucosyl-diacylglycerol of Streptococcus pneumoniae and Plays a Protective Role in Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Friederike Behler-Janbeck


    Full Text Available Among various innate immune receptor families, the role of C-type lectin receptors (CLRs in lung protective immunity against Streptococcus pneumoniae (S. pneumoniae is not fully defined. We here show that Mincle gene expression was induced in alveolar macrophages and neutrophils in bronchoalveolar lavage fluids of mice and patients with pneumococcal pneumonia. Moreover, S. pneumoniae directly triggered Mincle reporter cell activation in vitro via its glycolipid glucosyl-diacylglycerol (Glc-DAG, which was identified as the ligand recognized by Mincle. Purified Glc-DAG triggered Mincle reporter cell activation and stimulated inflammatory cytokine release by human alveolar macrophages and alveolar macrophages from WT but not Mincle KO mice. Mincle deficiency led to increased bacterial loads and decreased survival together with strongly dysregulated cytokine responses in mice challenged with focal pneumonia inducing S. pneumoniae, all of which was normalized in Mincle KO mice reconstituted with a WT hematopoietic system. In conclusion, the Mincle-Glc-DAG axis is a hitherto unrecognized element of lung protective immunity against focal pneumonia induced by S. pneumoniae.

  6. Horizontal transmission of Streptococcus pneumoniae in the surgical ward: a rare source of nosocomial wound infection. (United States)

    Guillet, Marlène; Zahar, Jean-Ralph; Timsit, Marc-Olivier; Grandin, Laure; Carbonnelle, Etienne; Join-Lambert, Olivier; Quesne, Gilles; Nassif, Xavier; Mejean, Arnaud; Carbonne, Anne


    Streptococcus pneumoniae is rarely isolated from nosocomial infections. We report an outbreak of 4 nosocomial-acquired surgical site infections due to S pneumoniae after retropubic simple prostatectomy. The likely source was detected in the rhinopharynx of the surgeon. After the implementation of recommendations, no new cases have been recorded. Copyright © 2012 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Mosby, Inc. All rights reserved.

  7. Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae. (United States)

    Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward


    Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail:

  8. Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

    African Journals Online (AJOL)

    Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

  9. LacR Is a Repressor of lacABCD and LacT Is an Activator of lacTFEG, Constituting the lac Gene Cluster in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Kuipers, Oscar P.

    Comparison of the transcriptome of Streptococcus pneumoniae strain D39 grown in the presence of either lactose or galactose with that of the strain grown in the presence of glucose revealed the elevated expression of various genes and operons, including the lac gene cluster, which is organized into

  10. Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

    Directory of Open Access Journals (Sweden)

    Teufert Karen


    Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

  11. Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza (United States)

    Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian


    Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

  12. Biological and Chemical Adaptation to Endogenous Hydrogen Peroxide Production in Streptococcus pneumoniae D39. (United States)

    Lisher, John P; Tsui, Ho-Ching Tiffany; Ramos-Montañez, Smirla; Hentchel, Kristy L; Martin, Julia E; Trinidad, Jonathan C; Winkler, Malcolm E; Giedroc, David P


    The catalase-negative, facultative anaerobe Streptococcus pneumoniae D39 is naturally resistant to hydrogen peroxide (H2O2) produced endogenously by pyruvate oxidase (SpxB). Here, we investigate the adaptive response to endogenously produced H2O2. We show that lactate oxidase, which converts lactate to pyruvate, positively impacts pyruvate flux through SpxB and that ΔlctO mutants produce significantly lower H2O2. In addition, both the SpxB pathway and a candidate pyruvate dehydrogenase complex (PDHC) pathway contribute to acetyl coenzyme A (acetyl-CoA) production during aerobic growth, and the pyruvate format lyase (PFL) pathway is the major acetyl-CoA pathway during anaerobic growth. Microarray analysis of the D39 strain cultured under aerobic versus strict anaerobic conditions shows upregulation of spxB, a gene encoding a rhodanese-like protein (locus tag spd0091), tpxD, sodA, piuB, piuD, and an Fe-S protein biogenesis operon under H2O2-producing conditions. Proteome profiling of H2O2-induced sulfenylation reveals that sulfenylation levels correlate with cellular H2O2 production, with endogenous sulfenylation of ≈50 proteins. Deletion of tpxD increases cellular sulfenylation 5-fold and has an inhibitory effect on ATP generation. Two major targets of protein sulfenylation are glyceraldehyde-3-phosphate dehydrogenase (GapA) and SpxB itself, but targets also include pyruvate kinase, LctO, AdhE, and acetate kinase (AckA). Sulfenylation of GapA is inhibitory, while the effect on SpxB activity is negligible. Strikingly, four enzymes of capsular polysaccharide biosynthesis are sulfenylated, as are enzymes associated with nucleotide biosynthesis via ribulose-5-phosphate. We propose that LctO/SpxB-generated H2O2 functions as a signaling molecule to downregulate capsule production and drive altered flux through sugar utilization pathways. IMPORTANCE Adaptation to endogenous oxidative stress is an integral aspect of Streptococcus pneumoniae colonization and virulence. In

  13. Biological and Chemical Adaptation to Endogenous Hydrogen Peroxide Production in Streptococcus pneumoniae D39 (United States)

    Lisher, John P.; Tsui, Ho-Ching Tiffany; Ramos-Montañez, Smirla; Hentchel, Kristy L.; Martin, Julia E.; Trinidad, Jonathan C.


    ABSTRACT The catalase-negative, facultative anaerobe Streptococcus pneumoniae D39 is naturally resistant to hydrogen peroxide (H2O2) produced endogenously by pyruvate oxidase (SpxB). Here, we investigate the adaptive response to endogenously produced H2O2. We show that lactate oxidase, which converts lactate to pyruvate, positively impacts pyruvate flux through SpxB and that ΔlctO mutants produce significantly lower H2O2. In addition, both the SpxB pathway and a candidate pyruvate dehydrogenase complex (PDHC) pathway contribute to acetyl coenzyme A (acetyl-CoA) production during aerobic growth, and the pyruvate format lyase (PFL) pathway is the major acetyl-CoA pathway during anaerobic growth. Microarray analysis of the D39 strain cultured under aerobic versus strict anaerobic conditions shows upregulation of spxB, a gene encoding a rhodanese-like protein (locus tag spd0091), tpxD, sodA, piuB, piuD, and an Fe-S protein biogenesis operon under H2O2-producing conditions. Proteome profiling of H2O2-induced sulfenylation reveals that sulfenylation levels correlate with cellular H2O2 production, with endogenous sulfenylation of ≈50 proteins. Deletion of tpxD increases cellular sulfenylation 5-fold and has an inhibitory effect on ATP generation. Two major targets of protein sulfenylation are glyceraldehyde-3-phosphate dehydrogenase (GapA) and SpxB itself, but targets also include pyruvate kinase, LctO, AdhE, and acetate kinase (AckA). Sulfenylation of GapA is inhibitory, while the effect on SpxB activity is negligible. Strikingly, four enzymes of capsular polysaccharide biosynthesis are sulfenylated, as are enzymes associated with nucleotide biosynthesis via ribulose-5-phosphate. We propose that LctO/SpxB-generated H2O2 functions as a signaling molecule to downregulate capsule production and drive altered flux through sugar utilization pathways. IMPORTANCE Adaptation to endogenous oxidative stress is an integral aspect of Streptococcus pneumoniae colonization and

  14. Tn5253 family integrative and conjugative elements carrying mef(I) and catQ determinants in Streptococcus pneumoniae and Streptococcus pyogenes. (United States)

    Mingoia, Marina; Morici, Eleonora; Morroni, Gianluca; Giovanetti, Eleonora; Del Grosso, Maria; Pantosti, Annalisa; Varaldo, Pietro E


    The linkage between the macrolide efflux gene mef(I) and the chloramphenicol inactivation gene catQ was first described in Streptococcus pneumoniae (strain Spn529), where the two genes are located in a module designated IQ element. Subsequently, two different defective IQ elements were detected in Streptococcus pyogenes (strains Spy029 and Spy005). The genetic elements carrying the three IQ elements were characterized, and all were found to be Tn5253 family integrative and conjugative elements (ICEs). The ICE from S. pneumoniae (ICESpn529IQ) was sequenced, whereas the ICEs from S. pyogenes (ICESpy029IQ and ICESpy005IQ, the first Tn5253-like ICEs reported in this species) were characterized by PCR mapping, partial sequencing, and restriction analysis. ICESpn529IQ and ICESpy029IQ were found to share the intSp 23FST81 integrase gene and an identical Tn916 fragment, whereas ICESpy005IQ has int5252 and lacks Tn916. All three ICEs were found to lack the linearized pC194 plasmid that is usually associated with Tn5253-like ICEs, and all displayed a single copy of a toxin-antitoxin operon that is typically contained in the direct repeats flanking the excisable pC194 region when this region is present. Two different insertion sites of the IQ elements were detected, one in ICESpn529IQ and ICESpy029IQ, and another in ICESpy005IQ. The chromosomal integration of the three ICEs was site specific, depending on the integrase (intSp 23FST81 or int5252). Only ICESpy005IQ was excised in circular form and transferred by conjugation. By transformation, mef(I) and catQ were cotransferred at a high frequency from S. pyogenes Spy005 and at very low frequencies from S. pneumoniae Spn529 and S. pyogenes Spy029. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. The Regulation of Polysaccharide Specific Humoral Immune Response Against Intact Streptococcus Pneumoniae (United States)


    lymphoid tissue. Injection of pepsin -treated Streptococcus pneumoniae is associated with the rapid accumulation of blood DCs in the marginal zone to...that forced migration of MZB from the marginal zone into the follicle by pharmacologic means [treatment with FTY720 (Cinamon, Zachariah et al. 2008

  16. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

    NARCIS (Netherlands)

    Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

  17. Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

    Directory of Open Access Journals (Sweden)

    Neda Hashemi-Sadraei


    Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

  18. Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis


    Hashemi-Sadraei, Neda; Gupta, Rohan; Machicado, Jorge D.; Govindu, Rukma


    Infective endocarditis (IE) is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC) joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

  19. Transcriptional profiling of UlaR-regulated genes in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Shafeeq, Sulman; Afzal, Muhammad; Henriques-Normark, Birgitta; Kuipers, Oscar P

    The transcriptional regulator UlaR belongs to the family of PRD-containing transcriptional regulators, which are mostly involved in the regulation of carbohydrate metabolism. The role of the transcriptional regulator UlaR in Streptococcus pneumoniae has recently been described [1]. Here, we report

  20. Transcriptome analysis of Streptococcus pneumoniae D39 in the presence of cobalt

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Kuipers, Oscar


    Cobalt (Co2 +) is an important transition metal ion that plays a vital role in cellular physiology of bacteria. The role of Co2 + in the regulation of several genes/operons in Streptococcus pneumoniae has recently been reported [1]. The data described in this article relate to the genome-wide

  1. CodY of Streptococcus pneumoniae : Link between nutritional gene regulation and colonization

    NARCIS (Netherlands)

    Hendriksen, Wouter T.; Bootsma, Hester J.; Estevao, Silvia; Hoogenboezem, Theo; de Jong, Anne; de Groot, Ronald; Kuipers, Oscar P.; Hermans, Peter W. M.

    CodY is a nutritional regulator mainly involved in amino acid metabolism. It has been extensively studied in Bacillus subtilis and Lactococcus lactis. We investigated the role of CodY in gene regulation and virulence of the human pathogen Streptococcus pneumoniae. We constructed a codY mutant and

  2. Enhanced vulnerability for Streptococcus pneumoniae sepsis during asplenia is determined by the bacterial capsule

    NARCIS (Netherlands)

    Lammers, A.J.; Porto, A.P. de; Florquin, S.; Boer, O.J. de; Bootsma, H.J.; Hermans, P.W.M.; Poll, T. van der


    Patients without a spleen are susceptible for overwhelming sepsis with Streptococcus pneumoniae. We investigated the relative contribution of the pneumococcal capsule in the reduced host defense after splenectomy. Sham-operated or splenectomized mice were inoculated with serotype 2 or 4 S.

  3. Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

    NARCIS (Netherlands)

    Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

    Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

  4. Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

    NARCIS (Netherlands)

    Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R


    Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

  5. Carbonic Anhydrase Is Essential for Streptococcus pneumoniae Growth in Environmental Ambient Air

    NARCIS (Netherlands)

    Burghout, Peter; Cron, Lorelei E.; Gradstedt, Henrik; Quintero, Beatriz; Simonetti, Elles; Bijlsma, Jetta J. E.; Bootsma, Hester J.; Hermans, Peter W. M.

    The respiratory tract pathogen Streptococcus pneumoniae needs to adapt to the different levels of carbon dioxide (CO(2)) it encounters during transmission, colonization, and infection. Since CO(2) is important for various cellular processes, factors that allow optimal CO(2) sequestering are likely

  6. The accuracy of using the lytA-gene to distinguish Streptococcus pneumoniae from related species

    DEFF Research Database (Denmark)

    Greve, Thomas; Møller, Jens Kjølseth


    The need for a microbial identification of Streptococcus pneumoniae independent of culture methods has resulted in the introduction of other laboratory principles. The verification of a proper and exclusive gene for the detection of the pneumococcus by the nucleic acid-based tests (NAT) is however...

  7. Antagonism between penicillin and erythromycin against Streptococcus pneumoniae in vitro and in vivo

    DEFF Research Database (Denmark)

    Johansen, H K; Jensen, T G; Dessau, R B


    the effect of the bactericidal agent. In this study, the possible interaction between penicillin and erythromycin was investigated in vitro and in vivo against four clinical isolates of Streptococcus pneumoniae with MICs of penicillin ranging from 0.016 to 0.5 mg/L and of erythromycin from 0. 25 to >128 mg...

  8. Increased Nasopharyngeal Bacterial Titers and Local Inflammation Facilitate Transmission of Streptococcus pneumoniae

    NARCIS (Netherlands)

    Short, K.R.; Reading, P.C.; Wang, N.; Diavatopoulos, D.A.; Wijburg, O.L.


    ABSTRACT The transmission of the bacterium Streptococcus pneumoniae (the pneumococcus) marks the first step toward disease development. To date, our ability to prevent pneumococcal transmission has been limited by our lack of understanding regarding the factors which influence the spread of this

  9. Acquisition of Streptococcus pneumoniae carriage in pilgrims during the 2012 Hajj. (United States)

    Benkouiten, Samir; Gautret, Philippe; Belhouchat, Khadidja; Drali, Tassadit; Salez, Nicolas; Memish, Ziad A; Al Masri, Malak; Fournier, Pierre-Edouard; Brouqui, Philippe


    To investigate the nasal carriage of some respiratory bacterial pathogens that are responsible for infections associated with person-to-person transmission, we conducted a cohort survey of pilgrims departing to Mecca for the 2012 Hajj season. In this report, we demonstrate the acquisition of Streptococcus pneumoniae nasal carriage in returning Hajj pilgrims.

  10. Streptococcus pneumoniae serotype-2 childhood meningitis in Bangladesh: a newly recognized pneumococcal infection threat.

    Directory of Open Access Journals (Sweden)

    Samir K Saha

    Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of meningitis in countries where pneumococcal conjugate vaccines (PCV targeting commonly occurring serotypes are not routinely used. However, effectiveness of PCV would be jeopardized by emergence of invasive pneumococcal diseases (IPD caused by serotypes which are not included in PCV. Systematic hospital based surveillance in Bangladesh was established and progressively improved to determine the pathogens causing childhood sepsis and meningitis. This also provided the foundation for determining the spectrum of serotypes causing IPD. This article reports an unprecedented upsurge of serotype 2, an uncommon pneumococcal serotype, without any known intervention. METHODS AND FINDINGS: Cases with suspected IPD had blood or cerebrospinal fluid (CSF collected from the beginning of 2001 till 2009. Pneumococcal serotypes were determined by capsular swelling of isolates or PCR of culture-negative CSF specimens. Multicenter national surveillance, expanded from 2004, identified 45,437 patients with suspected bacteremia who were blood cultured and 10,618 suspected meningitis cases who had a lumber puncture. Pneumococcus accounted for 230 culture positive cases of meningitis in children <5 years. Serotype-2 was the leading cause of pneumococcal meningitis, accounting for 20.4% (45/221; 95% CI 15%-26% of cases. Ninety eight percent (45/46 of these serotype-2 strains were isolated from meningitis cases, yielding the highest serotype-specific odds ratio for meningitis (29.6; 95% CI 3.4-256.3. The serotype-2 strains had three closely related pulsed field gel electrophoresis types. CONCLUSIONS: S. pneumoniae serotype-2 was found to possess an unusually high potential for causing meningitis and was the leading serotype-specific cause of childhood meningitis in Bangladesh over the past decade. Persisting disease occurrence or progressive spread would represent a major potential infection threat since serotype-2

  11. Diversity of mosaic pbp2x families of penicillin-resistant Streptococcus pneumoniae from Iran and Romania. (United States)

    Mousavi, Seyed Fazlollah; Pana, Marina; Feizabadi, Mohammad; Jalali, Pantea; Ghita, Maria; Denapaite, Dalia; Hakenbeck, Regine


    High rates of penicillin-resistant Streptococcus pneumoniae occur in Romania and the Iran. The mosaic structure of PBP2x was investigated in nine Iranian strains and in 15 strains from Romania to understand their evolutionary history. Mutations potentially important for β-lactam resistance were identified by comparison with related PBP2x of penicillin-sensitive reference S. mitis strains. Two main PBP2x mosaic gene families were recognized. Eight Iranian strains belonged to group 1 PBP2x with a mosaic block highly related to PBP2x of the clone Spain(23F)-1 which is widespread among international penicillin-resistant S. pneumoniae clones. A second unique PBP2x group was observed in Romanian strains; furthermore, three PBP2x represented single mosaic variants. Sequence blocks of the penicillin-sensitive S. mitis 658 were common among PBP2x of strains from both countries. Each PBP2x group contained specific signature mutations within the transpeptidase domain, documenting distinct mutational pathways for the development of penicillin resistance. Copyright © 2017 Mousavi et al.

  12. Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

    Directory of Open Access Journals (Sweden)

    Dharm Raj Bhatta


    Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

  13. Whole genome analysis of linezolid resistance in Streptococcus pneumoniae reveals resistance and compensatory mutations

    Directory of Open Access Journals (Sweden)

    Légaré Danielle


    Full Text Available Abstract Background Several mutations were present in the genome of Streptococcus pneumoniae linezolid-resistant strains but the role of several of these mutations had not been experimentally tested. To analyze the role of these mutations, we reconstituted resistance by serial whole genome transformation of a novel resistant isolate into two strains with sensitive background. We sequenced the parent mutant and two independent transformants exhibiting similar minimum inhibitory concentration to linezolid. Results Comparative genomic analyses revealed that transformants acquired G2576T transversions in every gene copy of 23S rRNA and that the number of altered copies correlated with the level of linezolid resistance and cross-resistance to florfenicol and chloramphenicol. One of the transformants also acquired a mutation present in the parent mutant leading to the overexpression of an ABC transporter (spr1021. The acquisition of these mutations conferred a fitness cost however, which was further enhanced by the acquisition of a mutation in a RNA methyltransferase implicated in resistance. Interestingly, the fitness of the transformants could be restored in part by the acquisition of altered copies of the L3 and L16 ribosomal proteins and by mutations leading to the overexpression of the spr1887 ABC transporter that were present in the original linezolid-resistant mutant. Conclusions Our results demonstrate the usefulness of whole genome approaches at detecting major determinants of resistance as well as compensatory mutations that alleviate the fitness cost associated with resistance.

  14. Intrapartum colonization with Streptococcus pneumoniae, early-onset sepsis and deficient specific neonatal immune responses. (United States)

    Faust, Kirstin; Demmert, Martin; Bendiks, Meike; Göpel, Wolfgang; Herting, Egbert; Härtel, Christoph


    Intrapartum colonization with Streptococcus pneumoniae (S. pneumoniae) is a rare but important risk factor for severe courses of early-onset sepsis (EOS) in the newborn, as underlined in the case of a preterm infant born after 32 weeks of gestation described here. One potential explanation could be an immature immune response of the neonate to S. pneumoniae, however, immunological data in term and preterm infants are scarce. To determine the neonatal immune responses to S. pneumoniae, flow-cytometry analysis of the cytokine production by CD14+ cells was performed after full pathogen stimulation with S. pneumoniae (serotype 18C, derived from an EOS case described here) of cord blood of 10 term (37-41 gestational weeks) and 6 preterm (31-32 gestational weeks) neonates, compared to peripheral venous blood samples of 10 healthy adults in vitro. Neonatal cytokine responses of term and preterm infants to S. pneumoniae are diminished compared to adults. The quantities of cytokine expression were comparable to immune responses induced by other important gram-positive pathogens of EOS such as Streptococcus agalacticae. Severe courses of EOS with S. pneumoniae may be attributed to remarkable deficiencies of the specific neonatal immune response. To protect the neonate from invasive pneumococcal disease, maternal immunization may be an important prevention strategy, as protective antibodies can be transferred through the placenta and vaccination of pregnant women may reduce colonization.

  15. In vitro activities of garenoxacin (BMS-284756) against Streptococcus pneumoniae, viridans group streptococci, and Enterococcus faecalis compared to those of six other quinolones. (United States)

    Grohs, Patrick; Houssaye, Serge; Aubert, Agnès; Gutmann, Laurent; Varon, Emmanuelle


    The activity of garenoxacin, a new quinolone, was determined in comparison with other quinolones against different strains of S. pneumoniae, viridans group streptococci (VGS), and Enterococcus faecalis. Strains were quinolone-susceptible clinical isolates and quinolone-resistant strains with defined mechanisms of resistance obtained from either clinical isolates or derivatives of S. pneumoniae R6. Clinical quinolone-susceptible strains of S. pneumoniae, VGS and E. faecalis showed garenoxacin MICs within a range of 0.03 microg/ml to 0.25 micro g/ml. Garenoxacin MICs increased two- to eightfold when one mutation was present in the ParC quinolone resistance-determining region (QRDR), fourfold when one mutation was present in the GyrA QRDR (S. pneumoniae), 8- to 64-fold when two or three mutations were associated in ParC and GyrA QRDR, and 2,048-fold when two mutations were present in both the GyrA and ParC QRDRs (Streptococcus pneumoniae). Increased active efflux had a moderate effect on garenoxacin MICs for S. pneumoniae and VGS. Against S. pneumoniae, garenoxacin behaved like moxifloxacin and sparfloxacin, being more affected by a single gyrA mutation than by a single parC mutation. Although garenoxacin was generally two- to fourfold more active than moxifloxacin against the different wild-type or mutant strains of S. pneumoniae, VGS, and E. faecalis, it was two- to fourfold less active than gemifloxacin. At four times the respective MIC for each strain, the bactericidal effect of garenoxacin, observed at 6 h for S. pneumoniae and at 24 h for S. oralis and E. faecalis, was not influenced by the presence of mutation either in the ParC or in both the ParC and GyrA QRDRs.

  16. Resistance of Streptococcus pneumoniae to antimicrobials in São Paulo, Brazil: clinical features and serotypes Resistência antimicrobiana de Streptococcus pneumoniae em São Paulo, Brasil: quadro clínico e sorotipos

    Directory of Open Access Journals (Sweden)

    Anna Sara S. Levin


    Full Text Available To study resistance to antimicrobials, serotypes and clinical features of S. pneumoniae in S. Paulo, Brazil, 50 patients with a positive culture were evaluated: 7 were considered carriers and 43 had pneumococcal infections. Pneumonia and meningitis were the most commom infections. Mortality was 34% and underlying diseases were present in 70%. Relative resistance to penicillin occurred in 24% and complete resistance was not detected. Resistance to tetracycline was 32% and to sulfamethoxazole/trimethoprim 32%; one strain had intermediate susceptibility to erythromycin; no resistance was present for chloramphenicol, rifampin or vancomycin. Resistance to at least one of the drugs tested occurred in 62%. Results by the E-test for penicillin were similar to those by the agar dilution method. There were 24 different serotypes and 74% of the strains belonged to the 23-valent vaccine including all the penicillin-resistant strains. In this study S. pneumoniae caused severe infections and presented a high resistance rate to commonly used antimicrobials. Routine surveillance of resistance and the use of vaccination, as well as the restriction of inappropriate use of antimicrobials, are recommended in São Paulo, Brazil.Com a finalidade de estudar resistência a antimicrobianos, sorotipos e quadro clínico de Streptococcus pneumoniae em São Paulo, Brasil, foram avaliados 50 pacientes com culturas positivas: 7 foram considerados portadores e 43 infectados. Pneumonia e meningite foram as infecções mais freqüentes. A letalidade foi de 34% e doenças de base estiveram presentes em 70%. Resistência relativa a penicilina ocorreu em 24% e a resistência completa não foi detectada. Resistência a tetraciclina ocorreu em 32% e a sulfametoxazol/trimetoprim em 32% e houve uma cepa com sensibilidade intermediária a eritromicina. Não houve resistência a cloranfenicol, rifampicina ou vancomicina. Em 62% dos casos houve resistência a pelo menos uma das drogas

  17. Hydrogen peroxide-mediated interference competition by Streptococcus pneumoniae has no significant effect on Staphylococcus aureus nasal colonization of neonatal rats. (United States)

    Margolis, Elisa


    It has been proposed that the relative scarcity of Staphylococcus aureus and Streptococcus pneumoniae cocolonization in the nasopharynxes of humans can be attributed to hydrogen peroxide-mediated interference competition. Previously it has been shown in vitro that H(2)O(2) produced by S. pneumoniae is bactericidal to S. aureus. To ascertain whether H(2)O(2) has this inhibitory effect in the nasal passages of neonatal rats, colonization experiments were performed with S. aureus and S. pneumoniae. The results of these experiments with neonatal rats are inconsistent with the hypothesis that hydrogen peroxide-mediated killing of S. aureus by S. pneumoniae is responsible for the relative scarcity of cocolonization by these bacteria. In mixed-inoculum colonization experiments and experiments where S. aureus invaded the nasopharynxes of rats with established S. pneumoniae populations, the density of S. aureus did not differ whether the S. pneumoniae strain was H(2)O(2) secreting or non-H(2)O(2) secreting (SpxB). Moreover, the advantage of catalase production by S. aureus in competition with a non-catalase-producing strain (KatA) during nasal colonization was no greater in the presence of H(2)O(2)-producing S. pneumoniae than in the presence of non-H(2)O(2)-producing S. pneumoniae.

  18. Affinity of ceftaroline and other beta-lactams for penicillin-binding proteins from Staphylococcus aureus and Streptococcus pneumoniae. (United States)

    Kosowska-Shick, K; McGhee, P L; Appelbaum, P C


    We compared the affinities of ceftaroline for all penicillin-binding proteins (PBPs) with those of ceftriaxone and cefotaxime in 6 Staphylococcus aureus and 7 Streptococcus pneumoniae isolates with various resistance phenotypes. Ceftaroline MICs were PBP1A, -1B, and -2A > PBP2B, and ceftaroline had >or=4-fold higher 50% inhibitory concentrations (IC(50)s) (0.1 to 4 microg/ml) for PBP2X, -2A, -2B, and -3 than those for the other cephalosporins tested. Among 3 penicillin-resistant S. pneumoniae strains, ceftaroline had a high affinity for PBP2X (IC(50), 0.1 to 1 microg/ml), a primary target for cephalosporin PBP binding activity, and high affinities for PBP2B (IC(50), 0.5 to 4 microg/ml) and PBP1A (IC(50), 0.125 to 0.25 microg/ml) as well, both of which are also known as major targets for PBP binding activity of cephalosporins. Ceftaroline PBP affinities in methicillin-susceptible S. aureus strains were greater than or equal to those of the 3 other beta-lactams tested. Ceftaroline bound to PBP2a in methicillin-resistant S. aureus (IC(50), 0.01 to 1 microg/ml) with up to 256-fold-higher affinity than those of other agents. Ceftaroline demonstrated very good PBP affinity against all S. aureus and S. pneumoniae strains tested, including resistant isolates.

  19. Discovery of new inhibitors of resistant Streptococcus pneumoniae penicillin binding protein (PBP) 2x by structure-based virtual screening. (United States)

    Miguet, Laurence; Zervosen, Astrid; Gerards, Thomas; Pasha, Farhan A; Luxen, André; Distèche-Nguyen, Martine; Thomas, Aline


    Penicillin binding proteins (PBPs) are involved in the biosynthesis of the peptidoglycan layer constitutive of the bacterial envelope. They have been targeted for more than half a century by extensively derived molecular scaffolds of penicillins and cephalosporins. Streptococcus pneumoniae resists the antibiotic pressure by inducing highly mutated PBPs that can no longer bind the beta-lactam containing agents. To find inhibitors of PBP2x from Streptococcus pneumoniae (spPBP2x) with novel chemical scaffold so as to circumvent the resistance problems, a hierarchical virtual screening procedure was performed on the NCI database containing approximately 260000 compounds. The calculations involved ligand-based pharmacophore mapping studies and molecular docking simulations in a homology model of spPBP2x from the highly resistant strain 5204. A total of 160 hits were found, and 55 were available for experimental tests. Three compounds harboring two novel chemical scaffolds were identified as inhibitors of the resistant strain 5204-spPBP2x at the micromolar range.

  20. Draft Genome Sequence of Type Strain Streptococcus gordonii ATCC 10558

    DEFF Research Database (Denmark)

    Rasmussen, Louise Hesselbjerg; Dargis, Rimtas; Christensen, Jens Jørgen Elmer


    Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis of infect......Streptococcus gordonii ATCC 10558T was isolated from a patient with infective endocarditis in 1946 and announced as a type strain in 1989. Here, we report the 2,154,510-bp draft genome sequence of S. gordonii ATCC 10558T. This sequence will contribute to knowledge about the pathogenesis...

  1. Antibiotic susceptibilities of genetically characterized Streptococcus milleri group strains. (United States)

    Tracy, M; Wanahita, A; Shuhatovich, Y; Goldsmith, E A; Clarridge, J E; Musher, D M


    Previous studies of the antibiotic susceptibility of Streptococcus milleri group organisms have distinguished among species by using phenotypic techniques. Using 44 isolates that were speciated by 16S rRNA gene sequencing, we studied the MICs and minimum bactericidal concentrations of penicillin, ampicillin, ceftriaxone, and clindamycin for Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus. None of the organisms was resistant to beta-lactam antibiotics, although a few isolates were intermediately resistant; one strain of S. anginosus was tolerant to ampicillin, and another was tolerant to ceftriaxone. Six isolates were resistant to clindamycin, with representation from each of the three species. Relatively small differences in antibiotic susceptibilities among species of the S. milleri group show that speciation is unlikely to be important in selecting an antibiotic to treat infection caused by one of these isolates.

  2. Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

    Directory of Open Access Journals (Sweden)

    Rita Risandi


    Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

  3. Case-control study of pneumonia patients with Streptococcus anginosus group bacteria in their sputum. (United States)

    Hirai, Jun; Sakanashi, Daisuke; Haranaga, Shusaku; Kinjo, Takeshi; Hagihara, Mao; Kato, Hideo; Suematsu, Hiroyuki; Yamagishi, Yuka; Fujita, Jiro; Mikamo, Hiroshige


    In recent years, Streptococcus anginosus group (SAG) bacteria are becoming increasingly recognized as important pneumonia-causing pathogens. Although several small studies have been reported, the features of SAG pneumonia remain unclear, because the identification of SAG from sputum cultures is not routinely performed in most microbiology laboratories. The aim of this study was to elucidate the clinical characteristics of SAG pneumonia. This was a retrospective case-control study utilizing data obtained in our hospital between September 2009 and June 2016. We investigated 31 patients with SAG pneumonia (PWP), and also assessed the difference between the 31 PWP and 37 patients without pneumonia (PWOP) in whose sputum SAG was detected. Seventy-one percent of the patients were men and the median age was 78 years in the PWP. Univariate analysis indicated that the PWP were significantly more often a bed-ridden (p pneumonia (NHCAP) was the more common type of pneumonia (54.8%). S. anginosus was detected significantly more frequently in sputum cultures of PWP than PWOP (p pneumonia, particularly among elderly patients with underlying disease associated with aspiration. NHCAP was the more common type of SAG pneumonia in this study. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Antibiotic susceptibility in Streptococcus pneumoniae, Haemophilus influenzae and Streptococcus pyogenes in Pakistan: a review of results from the Survey of Antibiotic Resistance (SOAR) 2002-15. (United States)

    Zafar, A; Hasan, R; Nizamuddin, S; Mahmood, N; Mukhtar, S; Ali, F; Morrissey, I; Barker, K; Torumkuney, D


    To investigate changes in the antibiotic susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Streptococcus pyogenes from the Survey of Antibiotic Resistance (SOAR) in community-acquired respiratory tract infections (CA-RTIs) between 2002 and 2015 in Pakistan. This is a review based on previously published studies from 2002-03, 2004-06 and 2007-09 and also new data from 2014-15. Susceptibility was determined by Etest(®) or disc diffusion according to CLSI and pharmacokinetic/pharmacodynamic (PK/PD) breakpoints. A total of 706 isolates from CA-RTIs comprising 381 S. pneumoniae, 230 H. influenzae and 95 S. pyogenes were collected between 2002 and 2015 and tested against a range of antibiotics. Antibiotic resistance in S. pneumoniae rose steeply from 2002 to 2009, with isolates non-susceptible to penicillin and macrolides increasing from 10% to 34.1% and from 13%-14% to 29.7%, respectively. Susceptibility to amoxicillin/clavulanic acid (and by inference amoxicillin) remained between 99.4% and 100% from 2002 to 2015. Over the years, the prevalence of susceptibility to cefuroxime was 98%-100% among S. pneumoniae. Resistance in S. pneumoniae to some older antibiotics between 2007 and 2009 was high (86.8% for trimethoprim/sulfamethoxazole and 57.2% for tetracycline). Between 2002 and 2015, ampicillin resistance (β-lactamase-positive strains) among H. influenzae has remained low (between 2.6% and 3.2%) and almost unchanged over the years (H. influenzae was not tested during 2004-06). For S. pyogenes isolates, macrolide resistance reached 22%; however, susceptibility to penicillin, amoxicillin/clavulanic acid and cefuroxime remained stable at 100%. In S. pneumoniae from Pakistan, there has been a clear reduction in susceptibility to key antibiotics since 2002, but not to amoxicillin/clavulanic acid (amoxicillin) or cefuroxime. However, susceptibility in H. influenzae has remained stable. Local antibiotic susceptibility/resistance data are essential to

  5. Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

    DEFF Research Database (Denmark)

    Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S


    A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

  6. Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae. (United States)

    Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon


    Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

  7. Activities of a New Fluoroketolide, HMR 3787, and Its (Des)-Fluor Derivative RU 64399 Compared to Those of Telithromycin, Erythromycin A, Azithromycin, Clarithromycin, and Clindamycin against Macrolide-Susceptible or -Resistant Streptococcus pneumoniae and S. pyogenes (United States)

    Nagai, Kensuke; Davies, Todd A.; Ednie, Lois M.; Bryskier, Andre; Palavecino, Elizabeth; Jacobs, Michael R.; Appelbaum, Peter C.


    Activities of HMR 3787 and RU 64399 were compared to those of three macrolides, telithromycin, and clindamycin against 175 Streptococcus pneumoniae isolates and 121 Streptococcus pyogenes isolates. HMR3787 and telithromycin were the most active compounds tested against pneumococci. Telithromycin and RU 64399 were equally active against macrolide-susceptible (MICs, 0.008 to 0.06 μg/ml) and -resistant S. pyogenes isolates, but HMR 3787 had lower MICs for ermB strains. PMID:11600391

  8. Diversity of Streptococcus mutans strains in bacterial interspecies interactions

    NARCIS (Netherlands)

    Li, X.; Hoogenkamp, M.A.; Ling, J.; Crielaard, W.; Deng, D.M.


    Biofilms are matrix-enclosed microbial population adhere to each other and to surfaces. Compared to planktonic bacterial cells, biofilm cells show much higher levels of antimicrobial resistance. We aimed to investigate Streptococcus mutans strain diversity in biofilm formation and chlorhexidine

  9. Regulation of virulence gene expression resulting from Streptococcus pneumoniae and nontypeable Haemophilus influenzae interactions in chronic disease.

    Directory of Open Access Journals (Sweden)

    Emily K Cope

    Full Text Available Chronic rhinosinusitis (CRS is a common inflammatory disease of the sinonasal cavity mediated, in part, by polymicrobial communities of bacteria. Recent molecular studies have confirmed the importance of Streptococcus pneumoniae and nontypeable Haemophilus influenzae (NTHi in CRS. Here, we hypothesize that interaction between S. pneumoniae and NTHi mixed-species communities cause a change in bacterial virulence gene expression. We examined CRS as a model human disease to validate these polymicrobial interactions. Clinical strains of S. pneumoniae and NTHi were grown in mono- and co-culture in a standard biofilm assay. Reverse transcriptase real-time PCR (RTqPCR was used to measure gene expression of key virulence factors. To validate these results, we investigated the presence of the bacterial RNA transcripts in excised human tissue from patients with CRS. Consequences of physical or chemical interactions between microbes were also investigated. Transcription of NTHi type IV pili was only expressed in co-culture in vitro, and expression could be detected ex vivo in diseased tissue. S. pneumoniae pyruvate oxidase was up-regulated in co-culture, while pneumolysin and pneumococcal adherence factor A were down-regulated. These results were confirmed in excised human CRS tissue. Gene expression was differentially regulated by physical contact and secreted factors. Overall, these data suggest that interactions between H. influenzae and S. pneumoniae involve physical and chemical mechanisms that influence virulence gene expression of mixed-species biofilm communities present in chronically diseased human tissue. These results extend previous studies of population-level virulence and provide novel insight into the importance of S. pneumoniae and NTHi in CRS.

  10. Importance of bacterial replication and alveolar macrophage-independent clearance mechanisms during early lung infection with Streptococcus pneumoniae. (United States)

    Camberlein, Emilie; Cohen, Jonathan M; José, Ricardo; Hyams, Catherine J; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad; Brown, Jeremy S


    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. Shin’iseihaito (Xinyiqingfeitang Suppresses the Biofilm Formation of Streptococcus pneumoniae In Vitro

    Directory of Open Access Journals (Sweden)

    Masaaki Minami


    Full Text Available Streptococcus pneumoniae (S. pneumoniae is the important pathogen that causes otolaryngeal diseases such as sinusitis. S. pneumoniae frequently forms the biofilm to prevent severe circumstances such as antimicrobial agents. Shin’iseihaito (xinyiqingfeitang is a formula of Japanese traditional Kampo medicine that has 9 crude drugs and provides the medicinal usage for sinusitis. The objective of the present study is to reveal the mechanism of antibiofilm activity by Shin’iseihaito extract (SSHT. SSHT significantly inhibited the formation of biofilm from S. pneumoniae ATCC 49619 in dose- and time-dependent manners. SSHT also significantly suppressed the biofilm formation by other five different cps types of S. pneumoniae clinical isolates. We found that the extracts of 8 out of 9 components in Shin’iseihaito had the inhibitory effects of biofilm formation, and the extract of the root of Scutellaria baicalensis had the strongest effect among the ingredients of Shin’iseihaito. We found that the capsule of SSHT-treated S. pneumoniae was significantly thinner than that of the untreated group and that SSHT reduced the hydrophobicity of bacterial cell surface. Our results suggest that Shin’iseihaito may be a useful agent for the treatment of S. pneumoniae-induced sinusitis because of the inhibition of biofilm formation of S. pneumoniae.

  12. High prevalence of penicillin-nonsusceptible Streptococcus pneumoniae at a community hospital in Oklahoma. (United States)

    Moolenaar, R L; Pasley-Shaw, R; Harkess, J R; Lee, A; Crutcher, J M


    During 1997, Oklahoma City's Hospital A reported penicillin-nonsusceptible Streptococcus pneumoniae in almost 67% of isolates. To confirm this finding, all Hospital A S. pneumoniae isolates from October 23, 1997, through February 19, 1998, were tested for antibiotic susceptibility and repeat-tested at two other hospital laboratories. Medical records of Hospital A patients with invasive S. pneumoniae infections during 1994 through 1997 were also reviewed. These data were compared with 1998 statewide sentinel hospital surveillance data for invasive S. pneumoniae. Of 48 S. pneumoniae isolates from Hospital A during October 23, 1997, through February 19, 1998, 31 (65%) were penicillin-nonsusceptible S. pneumoniae, and 23 (48%) were highly penicillin resistant. Similar prevalences were confirmed at the other hospital laboratories; however, significant interlaboratory differences were noted in the determination of third-generation cephalosporin susceptibility. During 1994 through 1997, a trend toward increasing penicillin nonsusceptibility (p <0.05) was noted among S. pneumoniae isolates from nursing home patients. During 1998, 85 (30%) of 282 invasive isolates reported to the state surveillance system were penicillin-nonsusceptible S. pneumoniae; 33 (12%) were highly resistant. The increase in resistance observed is notable; the interlaboratory discrepancies are unexplained. To respond, a vaccination program was implemented at Hospital A, and vaccination efforts were initiated at nursing homes.

  13. Susceptibility pattern of Streptococcus pneumoniae among pre-school children in Kota Bharu, Malaysia. (United States)

    Malik, A S; Ismail, A; Pennie, R A; Naidu, J V


    Streptococcus pneumoniae (S. pneumoniae) is the most common bacterial cause of pneumonia, meningitis, and otitis media, with the highest incidence among young children and the elderly. S. pneumoniae was once routinely susceptible to penicillin, but since the mid-1980s the incidence of resistance to penicillin and other antimicrobial agents has been increasing all over the world. To optimize empirical regimens and initial therapy for S. pneumoniae infections, clinical healthcare providers must be informed about the prevalence and pattern of drug resistance among the isolates in their communities. No such data are available for the Malaysian population. Therefore, this study was designed to determine the antibiotic susceptibility pattern of S. pneumoniae among colonized pre-school children in Kota Bharu, Malaysia. Pharyngeal swabs were collected from children 1 month to 6 years of age. S. pneumoniae isolates were identified according to the standard and tested for penicillin resistance with a 1-microgram oxacillin disk by the Kirby-Bauer disk diffusion methods. Of 355 nasopharyngeal specimens obtained from kindergarten students, in-patients and pediatric clinics over a period of 1 year, S. pneumoniae was isolated from 36 (10 per cent). All isolates, except one, were susceptible to penicillin. The resistant isolates was susceptible to erythromycin, chloramphenicol and cephalosporins.

  14. Effect of Shin’iseihaito (Xinyiqingfeitang on Acute Streptococcus pneumoniae Murine Sinusitis via Macrophage Activation

    Directory of Open Access Journals (Sweden)

    Masaaki Minami


    Full Text Available Streptococcus pneumoniae (S. pneumoniae causes sinusitis. The general treatment of S. pneumonia sinusitis is by using antibiotics; however, one of their serious problems is the attenuation of their effect. Shin’iseihaito (Xinyiqingfeitang, a formula of Japanese traditional Kampo medicine, has been used for the treatment of sinusitis in Japan. In this study, we investigated the efficacy of Shin’iseihaito against S. pneumoniae-caused sinusitis in mice. Oral administration of Shin’iseihaito extract (SSHT decreased the nasal colonization of S. pneumoniae in both prophylactic and therapeutic treatments, respectively, and the former was more effective than the latter. Histopathological analysis revealed that the epithelial tissue from S. pneumoniae-infected nose under SSHT treatment recovered the tissue destruction in comparison to infected nose. We also confirmed this result by scanning electron microscopic analysis. Murine peritoneal macrophages from SSHT-treated mice had significant phagocytic activity in comparison to those from untreated group. We also found that tumor necrosis factor-α, interleukin-1β, interleukin-6, and monocyte chemotactic protein-1 levels and the migration of macrophages from S. pneumoniae-infected mice with the treatment with SSHT were increased compared to those from untreated group. Our data suggest that Shin’iseihaito may be useful for the treatment of S. pneumoniae-induced sinusitis.

  15. Live attenuated influenza vaccine enhances colonization of Streptococcus pneumoniae and Staphylococcus aureus in mice. (United States)

    Mina, Michael J; McCullers, Jonathan A; Klugman, Keith P


    Community interactions at mucosal surfaces between viruses, like influenza virus, and respiratory bacterial pathogens are important contributors toward pathogenesis of bacterial disease. What has not been considered is the natural extension of these interactions to live attenuated immunizations, and in particular, live attenuated influenza vaccines (LAIVs). Using a mouse-adapted LAIV against influenza A (H3N2) virus carrying the same mutations as the human FluMist vaccine, we find that LAIV vaccination reverses normal bacterial clearance from the nasopharynx and significantly increases bacterial carriage densities of the clinically important bacterial pathogens Streptococcus pneumoniae (serotypes 19F and 7F) and Staphylococcus aureus (strains Newman and Wright) within the upper respiratory tract of mice. Vaccination with LAIV also resulted in 2- to 5-fold increases in mean durations of bacterial carriage. Furthermore, we show that the increases in carriage density and duration were nearly identical in all aspects to changes in bacterial colonizing dynamics following infection with wild-type (WT) influenza virus. Importantly, LAIV, unlike WT influenza viruses, had no effect on severe bacterial disease or mortality within the lower respiratory tract. Our findings are, to the best of our knowledge, the first to demonstrate that vaccination with a live attenuated viral vaccine can directly modulate colonizing dynamics of important and unrelated human bacterial pathogens, and does so in a manner highly analogous to that seen following wild-type virus infection. Following infection with an influenza virus, infected or recently recovered individuals become transiently susceptible to excess bacterial infections, particularly Streptococcus pneumoniae and Staphylococcus aureus. Indeed, in the absence of preexisting comorbidities, bacterial infections are a leading cause of severe disease during influenza epidemics. While this synergy has been known and is well studied, what

  16. EARSS: European Antimicrobial Resistance Surveillance System; data from the Netherlands .Incidence and resistance rates for Streptococcus pneumoniae and Staphylococcus aureus

    NARCIS (Netherlands)

    Goettsch WG; Neeling AJ de; CIE; LIO


    In a porspective prevalence and incidence survey in The Netherlands in 1999 antimicrobial susceptibility data on invasive Streptococcus pneumoniae and Staphylococcus aureus infections were collected sithin the framework of European Antomicrobial Resistance Surveillance System (EARSS). The EARSS

  17. Sequencing of the variable region of rpsB to discriminate between Streptococcus pneumoniae and other streptococcal species

    NARCIS (Netherlands)

    Wyllie, Anne L; Pannekoek, Yvonne; Bovenkerk, Sandra; van Engelsdorp Gastelaars, Jody; Ferwerda, Bart; van de Beek, Diederik; Sanders, Elisabeth A M; Trzciński, Krzysztof; van der Ende, Arie

    The vast majority of streptococci colonizing the human upper respiratory tract are commensals, only sporadically implicated in disease. Of these, the most pathogenic is Mitis group member, Streptococcus pneumoniae Phenotypic and genetic similarities between streptococci can cause difficulties in

  18. EARSS: European Antimicrobial Resistance Surveillance System; data from the Netherlands .Incidence and resistance rates for Streptococcus pneumoniae and Staphylococcus aureus

    NARCIS (Netherlands)

    Goettsch WG; de Neeling AJ; CIE; LIO


    Gevoeligheid voor antimicrobiele middelen in Streptococcus pneumoniae en Staphylococcus aureus werd bepaald in 1999 in Nederland binnen het raamwerk van het European antomicrobial Resistance Surveillance System (EARSS). Het EARSS project had in Nederland een dekkingsgraad van 40% van de Nederlandse

  19. IκBζ Regulates Human Monocyte Pro-Inflammatory Responses Induced by Streptococcus pneumoniae (United States)

    Sundaram, Kruthika; Rahman, Mohd. Akhlakur; Mitra, Srabani; Knoell, Daren L.; Woodiga, Shireen A.; King, Samantha J.


    Pneumococcal lung infections represent a major cause of death worldwide. Single nucleotide polymorphisms (SNPs) in the NFKBIZ gene, encoding the transcription factor IκBζ, are associated with increased susceptibility to invasive pneumococcal disease. We hence analyzed how IκBζ might regulate inflammatory responses to pneumococcal infection. We first demonstrate that IκBζ is expressed in human blood monocytes but not in bronchial epithelial cells, in response to wild type pneumococcal strain D39. D39 transiently induced IκBζ in a dose dependent manner, with subsequent induction of downstream molecules involved in host defense. Of these molecules, IκBζ knockdown reduced the expression of IL-6 and GMCSF. Furthermore, IκBζ overexpression increased the activity of IL-6 and GMCSF promoters, supporting the knockdown findings. Pneumococci lacking either pneumolysin or capsule still induced IκBζ. While inhibition of TLR1/TLR2 blocked D39 induced IκBζ expression, TLR4 inhibition did not. Blockade of p38 MAP kinase and NFκB suppressed D39 induced IκBζ. Overall, our data demonstrates that IκBζ regulates monocyte inflammatory responses to Streptococcus pneumoniae by promoting the production of IL-6 and GMCSF. PMID:27597997

  20. Cysteine-mediated gene expression and characterization of the CmbR regulon in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type strain grown at a restricted concentration of cysteine (0.03 mM to one grown at a high concentration of cysteine (50 mM in chemically-define medium (CDM revealed elevated expression of various genes/operons, i.e. spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes.

  1. Streptococcus pneumoniae GAPDH Is Released by Cell Lysis and Interacts with Peptidoglycan.

    Directory of Open Access Journals (Sweden)

    Rémi Terrasse

    Full Text Available Release of conserved cytoplasmic proteins is widely spread among Gram-positive and Gram-negative bacteria. Because these proteins display additional functions when located at the bacterial surface, they have been qualified as moonlighting proteins. The GAPDH is a glycolytic enzyme which plays an important role in the virulence processes of pathogenic microorganisms like bacterial invasion and host immune system modulation. However, GAPDH, like other moonlighting proteins, cannot be secreted through active secretion systems since they do not contain an N-terminal predicted signal peptide. In this work, we investigated the mechanism of GAPDH export and surface retention in Streptococcus pneumoniae, a major human pathogen. We addressed the role of the major autolysin LytA in the delivery process of GAPDH to the cell surface. Pneumococcal lysis is abolished in the ΔlytA mutant strain or when 1% choline chloride is added in the culture media. We showed that these conditions induce a marked reduction in the amount of surface-associated GAPDH. These data suggest that the presence of GAPDH at the surface of pneumococcal cells depends on the LytA-mediated lysis of a fraction of the cell population. Moreover, we demonstrated that pneumococcal GAPDH binds to the bacterial cell wall independently of the presence of the teichoic acids component, supporting peptidoglycan as a ligand to surface GAPDH. Finally, we showed that peptidoglycan-associated GAPDH recruits C1q from human serum but does not activate the complement pathway.

  2. Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

    Directory of Open Access Journals (Sweden)

    Chrispin Chaguza


    Full Text Available Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs. Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate and how many individual recombination events occur per isolate (the frequency. Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions.

  3. Multicentric study in five African countries of antibiotic susceptibility for three main pathogens: Streptococcus pneumoniae, Staphylococcus aureus, and Pseudomonas aeruginosa. (United States)

    Zerouali, Khalid; Ramdani-Bouguessa, Nadjia; Boye, Cheikh; Hammami, Adnane


    Antibiotic resistance is a growing clinical and epidemiological problem. We report on the antibiotic susceptibility of three pathogens isolated from patients in Algeria, Egypt, Morocco, Senegal, and Tunisia during 2010-2011. In total, 218 Streptococcus pneumoniae, 428 Staphylococcus aureus, and 414 Pseudomonas aeruginosa strains were collected. S. pneumoniae resistance was noted against penicillin (30.2%), erythromycin (27.4%), cefpodoxime (19.1%), amoxicillin (12.0%), cefotaxime (7.4%), and levofloxacin (3.2%). All the strains were teicoplanin susceptible. Staphylococcus aureus methicillin resistance differed between countries, from 5.0% in Senegal to 62.7% in Egypt. Levofloxacin resistance was low in all countries, and the highest rate (in Egypt) was still only 13.6% for intermediate and resistant strains combined. Most strains were susceptible to fosfomycin (99.3%) and pristinamycin (94.2%). P. aeruginosa resistance was found against levofloxacin (30.4%), ciprofloxacin (29.9%), tobramycin (19.7%), ceftazidime (19.2%), and imipenem (17.9%), but not colistin. Antibiotic susceptibility varied widely between countries, with resistance typically most prevalent in Egypt.

  4. The polysaccharide capsule of Streptococcus pneumonia partially impedes MyD88-mediated immunity during pneumonia in mice. (United States)

    de Vos, Alex F; Dessing, Mark C; Lammers, Adriana J J; de Porto, Alexander P N A; Florquin, Sandrine; de Boer, Onno J; de Beer, Regina; Terpstra, Sanne; Bootsma, Hester J; Hermans, Peter W; van 't Veer, Cornelis; van der Poll, Tom


    Toll-like receptors (TLR) and the downstream adaptor protein MyD88 are considered crucial for protective immunity during bacterial infections. Streptococcus (S.) pneumoniae is a human respiratory pathogen and a large majority of clinical pneumococcal isolates expresses an external polysaccharide capsule. We here sought to determine the role of pneumococcal capsule in MyD88-mediated antibacterial defense during S. pneumonia pneumonia. Wild type (WT) and Myd88(-/-) mice were inoculated intranasally with serotype 2 S. pneumoniae D39 or with an isogenic capsule locus deletion mutant (D39∆cps), and analysed for bacterial outgrowth and inflammatory responses in the lung. As compared to WT mice, Myd88(-/-) mice infected with D39 demonstrated a modestly impaired bacterial clearance accompanied by decreased inflammatory responses in the lung. Strikingly, while WT mice rapidly cleared D39∆cps, Myd88(-/-) mice showed 105-fold higher bacterial burdens in their lungs and dissemination to blood 24 hours after infection. These data suggest that the pneumococcal capsule impairs recognition of TLR ligands expressed by S. pneumoniae and thereby partially impedes MyD88-mediated antibacterial defense.


    Safari, Dodi; Harimurti, Kuntjoro; Khoeri, Miftahuddin Majid; Waslia, Lia; Mudaliana, Siti; A'yun, Hanun Qurrota; Angeline, Regina; Subekti, Decy


    We studied Staphylococcus aureus and Streptococcus pneumoniae carriage among elderly adults in Jakarta, Indonesia. Nasopharyngeal swabs were collected from 149 adults aged 60-97 years. Both S. aureus and S. pneumoniae were identified by conventional and molecular methods. Methicillin-resistant Staphylococcus aureus (MSRA) was determined by PCR and antibiotic susceptibility using the disk diffusion method. Pneumococcal serotyping was performed with sequential multiplex PCR. We found S. aureus and S. pneumoniae present in 42 and 4 elderly adults respectively, and MRSA prevalence of 6%. Serotypes 3, 6A/B, 15B/C and 35F were identified among the four pneumococcal isolates. The majority of S. aureus isolates were susceptible to chloramphenicol (93%) and sulfamethoxazole/trimethoprim (93%), followed by gentamicin (88%), erythromycin (83%), penicillin (79%) and tetracycline (74%). Thus S. aureus prevalence is higher than that of S. pneumoniae, and a high frequency of MRSA carried by elderly adults in Jakarta, Indonesia.

  6. Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

    DEFF Research Database (Denmark)

    Møller, Kirsten; Harder, Eva; Wandall, Johan


    We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community....... Staphylococcus aureus grew together with a streptococcus in 2 cases. Blood culture was positive in 9 cases (35%). Neurologic complications occurred in 11 patients (42%) and extraneurologic complications in 18 patients (69%). Adverse outcomes occurred in 10 patients (38%), including 3 patients who died...

  7. In Vitro Streptococcus pneumoniae Biofilm Formation and In Vivo Middle Ear Mucosal Biofilm in a Rat Model of Acute Otitis Induced by S. pneumoniae


    Yadav, Mukesh Kumar; Chae, Sung-Won; Song, Jae-Jun


    Objectives Streptococcus pneumoniae is one of the most common pathogens of otitis media (OM) that exists in biofilm, which enhances the resistance of bacteria against antibiotic killing and diagnosis, compared to the free-floating (planktonic) form. This study evaluated biofilm formation by S. pneumoniae on an abiotic surface and in the middle ear cavity in a rat model of OM. Methods In vitro biofilm formation was evaluated by inoculation of a 1:100 diluted S. pneumoniae cell suspension in a ...

  8. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Lisa Sanguinetti

    Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  9. Compensatory evolution of pbp mutations restores the fitness cost imposed by β-lactam resistance in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Andrea G Albarracín Orio


    Full Text Available The prevalence of antibiotic resistance genes in pathogenic bacteria is a major challenge to treating many infectious diseases. The spread of these genes is driven by the strong selection imposed by the use of antibacterial drugs. However, in the absence of drug selection, antibiotic resistance genes impose a fitness cost, which can be ameliorated by compensatory mutations. In Streptococcus pneumoniae, β-lactam resistance is caused by mutations in three penicillin-binding proteins, PBP1a, PBP2x, and PBP2b, all of which are implicated in cell wall synthesis and the cell division cycle. We found that the fitness cost and cell division defects conferred by pbp2b mutations (as determined by fitness competitive assays in vitro and in vivo and fluorescence microscopy were fully compensated by the acquisition of pbp2x and pbp1a mutations, apparently by means of an increased stability and a consequent mislocalization of these protein mutants. Thus, these compensatory combinations of pbp mutant alleles resulted in an increase in the level and spectrum of β-lactam resistance. This report describes a direct correlation between antibiotic resistance increase and fitness cost compensation, both caused by the same gene mutations acquired by horizontal transfer. The clinical origin of the pbp mutations suggests that this intergenic compensatory process is involved in the persistence of β-lactam resistance among circulating strains. We propose that this compensatory mechanism is relevant for β-lactam resistance evolution in Streptococcus pneumoniae.

  10. A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae. (United States)

    Sanguinetti, Lisa; Toti, Simona; Reguzzi, Valerio; Bagnoli, Fabio; Donati, Claudio


    Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

  11. Dynamic changes of TrkB gene expression in Streptococcus pneumoniae meningitis after treatment with antibiotics and dexamethasone. (United States)

    Li, Ling; Shui, Quan-Xiang; Zhao, Zheng-Yan; Zhu, Xiao-Dong; Bao, Wei-Qing


    Although more and more new potent antibiotics have been used, the incidence of neurological sequelae of Streptococcus pneumoniae meningitis has not improved in children over the last decade. The expression of TrkB mRNA, a receptor of brain-derived neurotrophic factor, is associated with the incidence of neurological sequelae of Streptococcus pneumoniae meningitis. Rats of 3 weeks old were used to construct a model of Streptococcus pneumoniae meningitis and served as normal controls. They were administered with antibiotics or antibiotics plus dexamethasone, respectively. The expression of the TrkB gene was detected in the brain by in situ hybridization. In the brains of Streptococcus pneumoniae inoculated rats, TrkB mRNA was significantly up-regulated after inoculation for 24 hours, and then down-regulated in a dose-dependent manner after treatment with antibiotics. This up-regulation was seen after treatment with antibiotics plus dexamethasone. TrkB mRNA expression was also observed in some infiltrating inflammatory cells. The results of the study support the hypothesis that TrkB signal transduction pathways might play an important role in Streptococcus pneumoniae meningitis, probably by protecting the brain from damage. The role of TrkB might be weakened after the treatment with antibiotics. Our findings suggest that targeting TrkB receptors might be a rational strategy for prevention of neurological sequelae caused by Streptococcus pneumoniae meningitis.

  12. [In vitro resistance rates of Streptococcus pneumoniae and Haemophilus influenzae clinical isolates to the antibiotics used in therapy]. (United States)

    Uncu, Hikmet; Colakoğlu, Sule; Turunç, Tuba; Demiroğlu, Yusuf Ziya; Arslan, Hande


    Streptococcus pneumoniae and Haemophilus influenzae which cause infections with high morbidity and mortality all over the world, are also the most important bacterial pathogens of community-acquired pneumoniae. In recent years S. pneumoniae is becoming increasingly resistant to a variety of antibiotics. The aim of this study was to detect the in vitro resistance rates of S. pneumoniae and H. influenzae strains isolated from different clinical samples to the antibiotics which are used in the therapy of infections due to these pathogens. Between the period of January 2005 to May 2006, 77 S. pneumoniae (44 sputum, 20 blood, 8 bronchoalveolar lavage, 4 pleural fluids and 1 tracheal aspirate isolate) and 31 H. influenzae (30 sputum and 1 bronchoalveolar lavage isolate) strains isolated from patients who were admitted to Baskent University Hospital, Research and Practice Center of Adana (located in southern Turkey), were included to the study. The antibiotic susceptibility tests were performed by disc diffusion method according to CLSI (Clinical and Laboratory Standards Institute; M100-S13) guidelines. The MIC values of S. pneumoniae which gave an inhibition zone diameter of > or =19 mm in with disc diffusion test, were detected by E-test (AB Biodisk, Sweden). Intermediate and high resistance rates of pneumococci to penicilin were found as 38.9% (30/77) and 10.4% (8/77), respectively, with a total resistance rate of 49.4%. Trimethoprim-sulphamethoxazole (TMP/SMX), erithromycin, tetracyclin, clindamycin and chloramphenicol were the other antibiotics which followed penicillin with the resistance rates of 42.8%, 37.6%, 31.1%, 23.3% and 10.3%, respectively. Amongst H. influenzae strains, one (3.2%) was found to be a beta-lactamase producer and it was resistant to both ampicillin and azitromycin. Eight (25.8%) of H. influenzae isolates were resistant to TMP/SMX, and two (6.4%) were resistant to chloramphenicol. As a result, the high penicilin and erithromycin resistance rates

  13. Streptococcus pneumoniae Modulates Staphylococcus aureus Biofilm Dispersion and the Transition from Colonization to Invasive Disease. (United States)

    Reddinger, Ryan M; Luke-Marshall, Nicole R; Sauberan, Shauna L; Hakansson, Anders P; Campagnari, Anthony A


    Streptococcus pneumoniae and Staphylococcus aureus are ubiquitous upper respiratory opportunistic pathogens. Individually, these Gram-positive microbes are two of the most common causative agents of secondary bacterial pneumonia following influenza A virus infection, and they constitute a significant source of morbidity and mortality. Since the introduction of the pneumococcal conjugate vaccine, rates of cocolonization with both of these bacterial species have increased, despite the traditional view that they are antagonistic and mutually exclusive. The interactions between S. pneumoniae and S. aureus in the context of colonization and the transition to invasive disease have not been characterized. In this report, we show that S. pneumoniae and S. aureus form stable dual-species biofilms on epithelial cells in vitro When these biofilms are exposed to physiological changes associated with viral infection, S. pneumoniae disperses from the biofilm, whereas S. aureus dispersal is inhibited. These findings were supported by results of an in vivo study in which we used a novel mouse cocolonization model. In these experiments, mice cocolonized in the nares with both bacterial species were subsequently infected with influenza A virus. The coinfected mice almost exclusively developed pneumococcal pneumonia. These results indicate that despite our previous report that S. aureus disseminates into the lungs of mice stably colonized with these bacteria following influenza A virus infection, cocolonization with S. pneumoniae in vitro and in vivo inhibits S. aureus dispersal and transition to disease. This study provides novel insight into both the interactions between S. pneumoniae and S. aureus during carriage and the transition from colonization to secondary bacterial pneumonia.IMPORTANCE In this study, we demonstrate that Streptococcus pneumoniae can modulate the pathogenic potential of Staphylococcus aureus in a model of secondary bacterial pneumonia. We report

  14. Control of competence by related non-coding csRNAs in Streptococcus pneumoniae R6.

    Directory of Open Access Journals (Sweden)

    Anke eLaux


    Full Text Available The two-component regulatory system CiaRH of Streptococcus pneumoniae is involved in ß-lactam resistance, maintenance of cell integrity, bacteriocin production, host colonization, virulence, and competence. The response regulator CiaR controls, among other genes, expression of five highly similar small non-coding RNAs, designated csRNAs. These csRNAs control competence development by targeting comC, encoding the precursor of the competence stimulating peptide CSP, which is essential to initiate the regulatory cascade leading to competence. In addition, another gene product of the CiaR regulon, the serine protease HtrA, is also involved in competence control. In the absence of HtrA, five csRNAs could suppress competence, but one csRNA alone was not effective. To determine if all csRNAs are needed, reporter gene fusions to competence genes were used to monitor competence gene expression in the presence of different csRNAs. These experiments showed that two csRNAs were not enough to prevent competence, but combinations of three csRNAs, csRNA1,2, 3, or csRNA1,2,4 were sufficient. In S. pneumoniae strains expressing only csRNA5, a surprising positive effect was detected on the level of early competence gene expression. Hence, the role of the csRNAs in competence regulation is more complex than anticipated. Mutations in comC (comC8 partially disrupting predicted complementarity to the csRNAs led to competence even in the presence of all csRNAs. Reconstitution of csRNA complementarity to comC8 restored competence suppression. Again, more than one csRNA was needed. In this case, even two mutated csRNAs complementary to comC8, csRNA1-8 and csRNA2-8, were suppressive. In conclusion, competence in S. pneumoniae is additively controlled by the csRNAs via post-transcriptional regulation of comC.

  15. Determination of Characteristics of Erythromycin Resistant Streptococcus pneumoniae with Preferred PCV Usage in Iran.

    Directory of Open Access Journals (Sweden)

    Malihe Talebi

    Full Text Available Amongst 100 Streptococcus pneumoniae isolated from clinical cases and nasopharynx of healthy individuals, 60 erythromycin resistant strains were isolated and characterized using MLST, PFGE, transposon analysis and Quellung reaction. Most of the S. pneumoniae erythromycin resistant (80% were found to be attributable to the ermB-edncoded ribosome methylase activity which differs from the dominant mechanism of macrolide resistance seen in North America. The most predominant transposons were; Tn1545/6003 (27%, Tn6002 (22%, Tn2009 (20%, Tn2010 (17%. Number of the clinical isolates carrying Tn2010 was more significant than the normal flora. The serotypes found were; 14 (33%, 3 (22%, 23F (15%, 19F (15%, 19A (7%, 6A (3%, 9V (3% and 6B (2%. The most prevalent serotypes among the clinical (n = 28 and normal flora (n = 32 isolates were serotypes 14 (46% and 3 (31%, respectively. The most prevalent vaccine serotypes amongst the clinical isolates and the healthy individuals were pneumococcal conjugate vaccines (PCV 13 and PCV10, respectively. PFGE revealed 34 pulsotypes with 9 common and 25 single types. Significant number of the normal isolates belonged to CT5 and CT6. On the other hand, significant number of clinical isolates belonged to CT8 as compared to the normal flora isolates. MLST showed 2 dominant sequence types. ST3130 (23% and ST180 (22% were the most predominant sequence types in the clinical and normal isolates, respectively. There was no significant difference in other sequence types between clinical and normal flora isolates. Three polyclonal complexes including Sweden15A -25, Spain23F-1 and Spain9V-3 constituted 58% of the isolates. Our results suggest that the genetic diversity and transposon distribution were high among S. pneumoniae, particularly in the isolates containing erm(B and double antibiotic resistant genes (erm/mef. The results presented here could influence the change in the current vaccination practices in Iran which currently

  16. An Increase in Streptococcus pneumoniae Serotype 12F

    Centers for Disease Control (CDC) Podcasts


    Dr. Cynthia Whitney, a CDC medical doctor and Epidemiologist, discusses serotype 12F pneumoniae.  Created: 2/8/2018 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID).   Date Released: 2/8/2018.

  17. Impact of aspirin on the transcriptome of Streptococcus pneumoniae D39


    Afzal, Muhammad; Shafeeq, Sulman


    Aspirin or acetylsalicylic acid (ASA) is a medicine used to treat pain, fever, and inflammation. Here, we for the very first time reported the genome-wide transcriptional profiling of aspirin-regulated genes in Streptococcus pneumoniae in the presence of 5?mM aspirin in chemically-defined medium (CDM) using microarray analysis. Our results showed that expression of several genes was differentially expressed in the presence of aspirin. These genes were further grouped into COG (Clusters of Ort...

  18. Region-specific diversification of the highly virulent serotype 1 Streptococcus pneumoniae


    Cornick, Jennifer E.; Chaguza, Chrispin; Harris, Simon R; Yalcin, Feyruz; Senghore, Madikay; Kiran, Anmol M.; Govindpershad, Shanil; Ousmane, Sani; Plessis, Mignon Du; Pluschke, Gerd; Ebruke, Chinelo; McGee, Lesley; Siga?que, Beutel; Collard, Jean-Marc; Antonio, Martin


    Serotype 1 Streptococcus pneumoniae is a leading cause of invasive pneumococcal disease (IPD) worldwide, with the highest burden in developing countries. We report the whole-genome sequencing analysis of 448 serotype 1 isolates from 27 countries worldwide (including 11 in Africa). The global serotype 1 population shows a strong phylogeographic structure at the continental level, and within Africa there is further region-specific structure. Our results demonstrate that region-specific diversif...

  19. Staphylococcus aureus and Streptococcus pneumoniae interaction and response to pneumococcal vaccination: Myth or reality? (United States)

    Reiss-Mandel, Aylana; Regev-Yochay, Gili


    S. aureus and S. pneumoniae are both common pathogens that are also carried by a large proportion of healthy individuals in the nasal and nasopharyngeal spaces. A negative association between carriage of S. aureus and S. pneumoniae has been reported in children in various epidemiologic studies from different geographical regions. Most studies found that the negative association between S. pneumoniae and S. aureus was significant only for carriage of vaccine-type S. pneumoniae strains. In this review, we summarize the various suggested mechanisms of this suggested bacterial interference, and the clinical implications reported following PCV introduction to date in various geographical regions.

  20. Distinct effects on diversifying selection by two mechanisms of immunity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Yuan Li

    Full Text Available Antigenic variation to evade host immunity has long been assumed to be a driving force of diversifying selection in pathogens. Colonization by Streptococcus pneumoniae, which is central to the organism's transmission and therefore evolution, is limited by two arms of the immune system: antibody- and T cell- mediated immunity. In particular, the effector activity of CD4(+ T(H17 cell mediated immunity has been shown to act in trans, clearing co-colonizing pneumococci that do not bear the relevant antigen. It is thus unclear whether T(H17 cell immunity allows benefit of antigenic variation and contributes to diversifying selection. Here we show that antigen-specific CD4(+ T(H17 cell immunity almost equally reduces colonization by both an antigen-positive strain and a co-colonized, antigen-negative strain in a mouse model of pneumococcal carriage, thus potentially minimizing the advantage of escape from this type of immunity. Using a proteomic screening approach, we identified a list of candidate human CD4(+ T(H17 cell antigens. Using this list and a previously published list of pneumococcal Antibody antigens, we bioinformatically assessed the signals of diversifying selection among the identified antigens compared to non-antigens. We found that Antibody antigen genes were significantly more likely to be under diversifying selection than the T(H17 cell antigen genes, which were indistinguishable from non-antigens. Within the Antibody antigens, epitopes recognized by human antibodies showed stronger evidence of diversifying selection. Taken together, the data suggest that T(H17 cell-mediated immunity, one form of T cell immunity that is important to limit carriage of antigen-positive pneumococcus, favors little diversifying selection in the targeted antigen. The results could provide new insight into pneumococcal vaccine design.

  1. Erythromycin inhibits tumor necrosis factor alpha and interleukin 6 production induced by heat-killed Streptococcus pneumoniae in whole blood

    NARCIS (Netherlands)

    Schultz, M. J.; Speelman, P.; Zaat, S.; van Deventer, S. J.; van der Poll, T.


    To determine the effects of penicillin and erythromycin on cytokine production induced by heat-killed Streptococcus pneumoniae (HKSP), we studied the effects of those drugs on cytokine production induced by S. pneumoniae in human whole blood in vitro and ex vivo. In whole blood in vitro,

  2. The pavA gene of Streptococcus pneumoniae encodes a fibronectin-binding protein that is essential for virulence

    NARCIS (Netherlands)

    Holmes, AR; McNab, R; Millsap, KW; Rohde, M; Hammerschmidt, S; Mawdsley, JL; Jenkinson, HF

    Streptococcus pneumoniae colonizes the nasopharynx in up to 40% of healthy subjects, and is a leading cause of middle ear infections (otitis media), meningitis and pneumonia. Pneumococci adhere to glycosidic receptors on epithelial cells and to immobilized fibronectin, but the bacterial adhesins

  3. Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans (United States)

    Shanker, Erin; Federle, Michael J.


    The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

  4. Mechanism for transfer of transposon Tn2010 carrying macrolide resistance genes in Streptococcus pneumoniae and its effects on genome evolution. (United States)

    Zhou, Wenqing; Yao, Kaihu; Zhang, Gang; Yang, Yonghong; Li, Yun; Lv, Yuan; Feng, Jie


    The objective of this study was to identify the mechanism responsible for the horizontal transfer of transposon Tn2010 in Streptococcus pneumoniae, and the genomic alterations introduced by the transfer process. Tn2010 was identified using PCR in 15 clinical isolates of S. pneumoniae with erythromycin resistance. S. pneumoniae and Enterococcus faecalis isolates were used as recipient cells in mating and transformation experiments to test the conjugative transferability and transformability of Tn2010. Whole-genome sequencing was used to assess the effects of the Tn2010 transfer on recipient genomes. The biological cost of the horizontal acquisition of Tn2010 and additional genomic changes was investigated by growth competition experiments. Tn2010 was transformed at a frequency of 3 × 10(-7) transformants per cfu, whereas no transconjugants were detected using S. pneumoniae or E. faecalis as recipient cells. Genome analysis showed that many other recombinations were scattered throughout the genome of the transformants in addition to transposon Tn2010. The transformants demonstrated a negligible fitness cost compared with the wild-type strain. Tn2010 tended to be transferred by transformation rather than conjugation in S. pneumoniae, and the spread of Tn2010 could have a profound effect on the evolution of the genome. The acquisition of Tn2010 with negligible fitness cost may facilitate spread of the transposon. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail:

  5. Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

    Directory of Open Access Journals (Sweden)

    Sandra Figueiredo


    Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

  6. Evaluación antibacteriana de extracto de mosquera (Croton elegans.) frente a: (Staphylococcus aureus ATCC: 25923, Streptococcus pyogenes ATCC: 19615, Streptococcus pneumoniae ATCC: 49619 y Streptococcus mutans ATCC: 25175), patógenos de enfermedades respiratorias


    Ordóñez Rea, Omar Leonardo


    In our country there is a variety of medicinal plants some of them without scientific studies and little investigation that is the case of the species Croton elegans, the ethnobotanical use of it allows us to deduce some antimicrobial activity, this being the fundament that determined the essay on some respiratory disease causing bacteria such as: Staphylococcus aureus ATCC 25923 Streptococcus pneumoniae ATCC (49619), Streptococcus mutans ATCC (25175) y Streptococcus pyoge...

  7. The rnhB gene encoding RNase HII of Streptococcus pneumoniae and evidence of conserved motifs in eucaryotic genes. (United States)

    Zhang, Y B; Ayalew, S; Lacks, S A


    A single RNase H enzyme was detected in extracts of Streptococcus pneumoniae. The gene encoding this enzyme was cloned and expressed in Escherichia coli, as demonstrated by its ability to complement a double-mutant rnhA recC strain. Sequence analysis of the cloned DNA revealed an open reading frame of 290 codons that encodes a polypeptide of 31.9 kDa. The predicted protein exhibits a low level of homology (19% identity of amino acid residues) to RNase HII encoded by rnhB of E. coli. Identification of the S. pneumoniae RNase HII translation start site by amino-terminal sequencing of the protein and of mRNA start sites by primer extension with reverse transcriptase showed that the major transcript encoding rnhB begins at the protein start site. Comparison of the S. pneumoniae and E. coli RNase HII sequences and sequences of other, putative bacterial rnhB gene products surmised from sequencing data revealed three conserved motifs. Use of these motifs to search for homologous genes in eucaryotes demonstrated the presence of rnhB genes in a yeast and a roundworm. Partial rnhB gene sequences were detected among expressed sequences of mouse and human cells. From these data, it appears that RNase HII is universally present in living cells.

  8. Nebulized C1-Esterase Inhibitor does not Reduce Pulmonary Complement Activation in Rats with Severe Streptococcus Pneumoniae Pneumonia. (United States)

    de Beer, Friso; Lagrand, Wim; Glas, Gerie J; Beurskens, Charlotte J P; van Mierlo, Gerard; Wouters, Diana; Zeerleder, Sacha; Roelofs, Joris J T H; Juffermans, Nicole P; Horn, Janneke; Schultz, Marcus J


    Complement activation plays an important role in the pathogenesis of pneumonia. We hypothesized that inhibition of the complement system in the lungs by repeated treatment with nebulized plasma-derived human C1-esterase inhibitor reduces pulmonary complement activation and subsequently attenuates lung injury and lung inflammation. This was investigated in a rat model of severe Streptococcus pneumoniae pneumonia. Rats were intra-tracheally challenged with S. pneumoniae to induce pneumonia. Nebulized C1-esterase inhibitor or saline (control animals) was repeatedly administered to rats, 30 min before induction of pneumonia and every 6 h thereafter. Rats were sacrificed 20 or 40 h after inoculation with bacteria. Brochoalveolar lavage fluid and lung tissue were obtained for measuring levels of complement activation (C4b/c), lung injury and inflammation. Induction of pneumonia was associated with pulmonary complement activation (C4b/c at 20 h 1.24 % [0.56-2.59] and at 40 h 2.08 % [0.98-5.12], compared to 0.50 % [0.07-0.59] and 0.03 % [0.03-0.03] in the healthy control animals). The functional fraction of C1-INH was detectable in BALF, but no effect was found on pulmonary complement activation (C4b/c at 20 h 0.73 % [0.16-1.93] and at 40 h 2.38 % [0.54-4.19]). Twenty hours after inoculation, nebulized C1-esterase inhibitor treatment reduced total histology score, but this effect was no longer seen at 40 h. Nebulized C1-esterase inhibitor did not affect other markers of lung injury or lung inflammation. In this negative experimental animal study, severe S. pneumoniae pneumonia in rats is associated with pulmonary complement activation. Repeated treatment with nebulized C1-esterase inhibitor, although successfully delivered to the lungs, does not affect pulmonary complement activation, lung inflammation or lung injury.

  9. Evaluation of Biophotonic Imaging To Estimate Bacterial Burden in Mice Infected with Highly Virulent Compared to Less Virulent Streptococcus pneumoniae Serotypes▿ † (United States)

    Henken, Stefanie; Bohling, Jennifer; Ogunniyi, A. David; Paton, James C.; Salisbury, Vyvyan C.; Welte, Tobias; Maus, Ulrich A.


    Bioluminescence imaging is an innovative, noninvasive tool to analyze infectious disease progression under real-life conditions in small laboratory animals. However, the relevance of bioluminescence imaging to monitor invasive compared to noninvasive bacterial infections of the lung has not been examined so far. In the current study, we systematically evaluated the importance of bioluminescence imaging to monitor pneumococcal disease progression by correlating biophotonic signals with lung bacterial loads in two mouse strains (BALB/c, C57BL/6) infected with either self-glowing, bioluminescent serotype 19 Streptococcus pneumoniae causing focal pneumonia or serotype 2 S. pneumoniae causing invasive pneumococcal disease. The best correlations between bioluminescence signals and lung CFU counts were observed in BALB/c mice compared to C57BL/6 mice just on day 3 after infection with invasive serotype 2 S. pneumoniae, while excellent correlations between photon counts and bacterial loads were observed in isolated lungs of BALB/c and C57BL/6 mice, irrespective of the employed pneumococcal serotype. Moreover, good correlations between biophotonic signals and CFU counts were also observed in mice upon infection with serotype 19 S. pneumoniae causing focal pneumonia in mice, again with best correlation values obtained for BALB/c mice at day 3 postinfection. Collectively, we show that the relevance of biophotonic imaging to monitor S. pneumoniae-induced lung infections in mice is largely influenced by the disease model under investigation. The provided data may be important for studies of infectious diseases. PMID:20530224

  10. A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

    Directory of Open Access Journals (Sweden)

    Eduardo Walker Zettler


    Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

  11. Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

    NARCIS (Netherlands)

    León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.


    Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

  12. Increased rate of survival in Streptococcus pneumoniae-infected rats treated with the new immunomodulator Pidotimod. (United States)

    di Marco, R; Condorelli, F; Girardello, R; Uslenghi, C; Chisari, G; di Mauro, M; Speciale, A M; Meroni, P L; Nicoletti, F


    Wistar rats infected with Streptococcus pneumoniae (type III ATCC) rapidly develop an acute form of experimental lobar pneumonia (ELP) with death of 80-90% of the animals by 6 days after the infection. Prophylactic treatment of these animals with the novel immunomodulator Pidotimod, at the dose of 25 mg/kg bw, significantly increased their rate of survival as compared to the control group (50 vs. 90% respectively). Recovery from the infection appeared definitive since all the Pidotimod-treated survivors were alive and in good condition at the end of the observation period (45 days post infection). Prophylactic treatment with higher or lower doses of the drug was ineffective. Therapy with Pidotimod was not effective. This preliminary study suggests that Pidotimod may have contributed to activation of specific and non-specific immune effectors involved in the host response to S. pneumoniae infection.

  13. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Raphaël Laurenceau

    Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

  14. A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae. (United States)

    Laurenceau, Raphaël; Péhau-Arnaudet, Gérard; Baconnais, Sonia; Gault, Joseph; Malosse, Christian; Dujeancourt, Annick; Campo, Nathalie; Chamot-Rooke, Julia; Le Cam, Eric; Claverys, Jean-Pierre; Fronzes, Rémi


    Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

  15. Total synthesis of a Streptococcus pneumoniae serotype 12F CPS repeating unit hexasaccharide

    Directory of Open Access Journals (Sweden)

    Peter H. Seeberger


    Full Text Available The Gram-positive bacterium Streptococcus pneumoniae causes severe disease globally. Vaccines that prevent S. pneumoniae infections induce antibodies against epitopes within the bacterial capsular polysaccharide (CPS. A better immunological understanding of the epitopes that protect from bacterial infection requires defined oligosaccharides obtained by total synthesis. The key to the synthesis of the S. pneumoniae serotype 12F CPS hexasaccharide repeating unit that is not contained in currently used glycoconjugate vaccines is the assembly of the trisaccharide β-D-GalpNAc-(1→4-[α-D-Glcp-(1→3]-β-D-ManpNAcA, in which the branching points are equipped with orthogonal protecting groups. A linear approach relying on the sequential assembly of monosaccharide building blocks proved superior to a convergent [3 + 3] strategy that was not successful due to steric constraints. The synthetic hexasaccharide is the starting point for further immunological investigations.

  16. Características clínico-microbiológicas de la meningitis por Streptococcus pneumoniae resistente a la penicilina Streptococcus pneumoniae meningitis resistant to penicillin clinical and microbiological characteristics

    Directory of Open Access Journals (Sweden)

    Demóstenes Gómez-Barreto


    Full Text Available OBJETIVO: Evaluar la susceptibilidad antimicrobiana de Streptococcus pneumoniae aislado del líquido cefalorraquídeo de niños con meningitis, así como describir y comparar las características clínicas y microbiológicas, el tratamiento y la evolución del padecimiento entre niños infectados con cepas sensibles y resistentes a la penicilina y la cefalosporina. MATERIAL Y MÉTODOS: Treinta y ocho niños con meningitis neumocócica fueron incluidos prospectivamente en el Programa Institucional de Vigilancia de las Infecciones Neumocócicas, durante el lapso 1994-1998. Los datos clínicos y de laboratorio se colectaron de cada expediente. RESULTADOS: Del total de niños, 63% era menor de dos años de edad, 28.9% mostró cepas insensibles a la penicilina, 18.4% tenía resistencia intermedia, y 10.5% tenía resistencia elevada. El 2.6% mostró también resistencia a la cefotaxima. La única característica (por la prueba exacta de Fisher asociada con la resistencia fue: enfermedad de base previa al proceso (pOBJECTIVE: To evaluate the susceptibility to antibiotics of Streptococcus pneumoniae isolated from cerebrospinal fluid of children with meningitis. To describe and compare the clinical and microbiological characteristics, treatment and outcome among children infected with strains either susceptible or resistant to penicillin and cephalosporin. MATERIAL AND METHODS: A total of 38 children with pneumococcal meningitis were prospectively enrolled in the Institutional Surveillance Program for Pneumococcal Infections during 1994-1998. Clinical and laboratory data were collected by chart review. RESULTS: Of the 38 children, 24 (63% were less than 2 years of age, 11 (28.9% had drug-resistant S. pneumoniae, 18.4% had intermediate resistance, 10.5% high level resistance and 2.6% also showed high level resistance to cefotaxime. The only associated factors (by Fisher’s exact test associated to resistance were: previous use of antibiotics (p=0

  17. Serotipos prevalentes de Streptococcus pneumoniae colonizadores de nasofaringe, en niños del Distrito Federal Prevalence of Streptococcus pneumoniae serotypes on nasopharyngeal colonization in children of Mexico City

    Directory of Open Access Journals (Sweden)

    Fortino Solórzano-Santos


    Full Text Available OBJETIVO: Determinar frecuencia, serotipos y susceptibilidad a ocho antimicrobianos en Streptococcus pneumoniae aislados de la nasofaringe de una muestra representativa de niños menores de cinco años de edad residentes en el Distrito Federal. MATERIAL Y MÉTODOS: Estudio transversal, hecho de febrero de 2002 a enero de 2003. Se incluyeron niños de 2 meses a 5 años. A los seleccionados se les tomó una muestra de exudado faríngeo con hisopo de alginato de calcio. Bajo técnicas ya establecidas se realizó identificación, tipificación y susceptibilidad a ocho antimicrobianos de los aislamientos de S. pneumoniae. Se utilizó estadística descriptiva, prueba de Ji cuadrada y razón de momios (IC 95% para los factores de riesgo. RESULTADOS: Se estudiaron 573 niños. En 122/573 (21.4% niños se aisló S. pneumoniae. Los serotipos más frecuentes fueron el 23F, 35, 19F, 11A y 15A; 46% de los serotipos encontrados no son cubiertos con la vacuna heptavalente. Se encontró 12% de susceptibilidad reducida a la penicilina, con 3% de cepas con alta resistencia; la resistencia a eritromicina fue >30% y para trimetoprim-sulfametoxazol (TMP/SMX >40%. No hubo cepas resistentes a vancomicina, cefotaxima, amoxicilina-clavulanato, cloranfenicol o ampicilina. CONCLUSIONES: El porcentaje de serotipos de S. pneumoniae en portadores nasofaríngeos no cubiertos por la vacuna heptavalente es alto, y la resistencia a macrólidos y TMP/SMX es elevada, lo que debe alertar al grupo médico.OBJECTIVE: To determine the frequency, serotypes and susceptibility profiles to eight antimicrobials in Streptococcus pneumoniae nasopharyngeal isolates from a representative sample of children under 5 years of age, residents of Mexico City. PATIENTS AND METHODS: A cross-sectional survey was conducted in 573 children aged 2 months to 5 years. A nasopharyngeal sample was taken. S. pneumoniae identification, capsular serotyping and antimicrobial susceptibility to eight antimicrobials

  18. Multiple-locus variable-number tandem-repeat analysis of Streptococcus pneumoniae and comparison with multiple loci sequence typing

    Directory of Open Access Journals (Sweden)

    van Cuyck Hélène


    Full Text Available Abstract Background Streptococcus pneumoniae infections remain a major cause of morbidity and mortality worldwide. The diversity of pneumococci was first evidenced by serotyping of their capsular polysaccharides, responsible of virulence, resolving into more than 93 serotypes. Molecular tools have been developed to track the emergence and the spread of resistant, hyper virulent or non-vaccine type clones, particularly DNA-based methods using genetic polymorphism. Pulsed-Field Gel Electrophoresis analysis (PFGE and Multiple Loci Sequence Typing (MLST are the most frequently used genotyping techniques for S. pneumoniae. MLST is based on sequence comparison of housekeeping genes clustering isolates within sequence types. The availability of genome sequence data from different S. pneumoniae strains facilitated the search for other class of genetic markers as polymorphic DNA sequences for a Multiple-Locus Variable-Number Tandem-Repeat Analysis (MLVA. This study aims at confirming the relevance of MLVA of S. pneumoniae, comparing MLST and MLVA performances when discriminating subgroups of strains belonging to the same Sequence Type (ST, and defining a restricted but universal set of MLVA markers that has at least the same discriminatory power as MLST for S. pneumoniae by applying marker sets used by different authors on 331 isolates selected in UK. Results A minimum spanning tree was built including the serotypes distribution and comparing MLVA and MLST results. 220 MLVA types were determined grouped in 10 Sequence Types (ST. MLVA differentiated ST162 in two clonal complexes. A minimal set was defined: ms 25 and ms37, ms17, ms19, ms33, ms39, and ms40 including two universal markers. The selection was based on MLVA markers with a Diversity Index >0.8 and a selection of others depending of the population tested and the aim of the study. This set of 7 MLVA markers yields strain clusters similar to those obtained by MLST. Conclusions MLVA can discriminate

  19. [Sensitivity surveillance of Streptococcus pneumoniae isolates for several antibacterial agents in Gifu and Aichi prefecture (2010-2011)]. (United States)

    Eto, Maki; Mizunaga, Shingo; Fukuda, Yoshiko; Nomura, Nobuhiko; Matsukawa, Yoko; Mitsuyama, Junichi; Matsubara, Shigenori; Yamaoka, Kazukiyo; Watanabe, Kunitomo; Asano, Yuko; Suematsu, Hiroyuki; Sawamura, Haruki; Hashido, Hikonori; Yamagishi, Yuka; Mikamo, Hiroshige


    We investigated genotype of penicillin-binding protein (PBP) genes and macrolide resistant genes, the serotypes and the susceptibility to antibacterial agents against 258 strains of Streptococcus pneumoniae isolated from medical facilities in Gifu and Aichi prefectures between January 2010 and March 2011. These results were compared with those against 377 strains of S. pneumoniae isolated in 2008-2009. The number of genotype penicillin-susceptible S. pneumoniae (gPSSP) with 3 normal PBP genes, genotype penicillin-intermediate S. pneumoniae (gPISP) with 1 or 2 normal PBP genes and genotype penicillin-resistant S. pneumoniae (gPRSP) with 3 abnormal genes was 11 (4.3%), 135 (52.3%) and 112 (43.4%) strains, respectively. The isolates with no macrolide-resistant gene, only mefA, only ermB, and both mefA and ermB were 17 (6.6%), 65 (25.2%), 143 (55.4%) and 33 (12.8%). The prevalent pneumococcal serotypes isolated from children were type 19F (18.2%), following by type 6A and 15 (11.7%). The potential coverage of pneumococcal conjugate vaccine (PCV7) was 43.8%. The prevalent pneumococcal serotypes isolated from adults were high in order of type 19F (12.8%), type 6A, 3 and 11 (10.3%), excepting non-typable strains (17.9%), and from elderly persons were type 6B (23.2%) and type 3 (13.4%). The MIC90 of each antibacterial agents was as follows; 0.0625 microg/mL for garenoxacin, 0.125 microg/mL for panipenem, 0.25 microg/mL for imipenem, doripenem, tosufloxacin, 0.5 microg/mL for cefditoren, meropenem, moxifloxacin, 1 microg/mL for amoxicillin, clavulanic acid/amoxicillin, cefteram, cefcapene, ceftriaxone, 2 microg/mL for benzylpenicillin, piperacillin, tazobactam/ piperacillin, pazufloxacin, levofloxacin, 4 microg/mL for cefdinir, flomoxef, 16 microg/mL for minocycline, > 64 microg/mL for clarithromycin, azithromycin and these MIC90s were about the same as those in 2008-2009.

  20. Identification of Streptococcus pneumoniae: Development of a Standardized Protocol for Optochin Susceptibility Testing Using Total Lab Automation. (United States)

    Burckhardt, Irene; Panitz, Jessica; Burckhardt, Florian; Zimmermann, Stefan


    Purpose. Optochin susceptibility is one parameter used in the laboratory to identify Streptococcus pneumoniae. However, a single standardized procedure does not exist. Optochin is included neither in the current EUCAST breakpoint tables nor in the CLSI performance standards for antimicrobial susceptibility testing. We wanted to establish an evidence-based protocol for optochin testing for our Total Lab Automation. Methods. We tested seven different agars and four different reading time points (7 h, 12 h, 18 h, and 24 h). To accommodate for serotype diversity, all tests were done with 99 different strains covering 34 different serotypes of S. pneumoniae. We calculated a multivariable linear regression using data from 5544 inhibition zones. Results. Reading was possible for all strains at 12 h. Agar type and manufacturer influenced the size of the inhibition zones by up to 2 mm and they varied considerably depending on serotype (up to 3 mm for serotype 3). Depending on agar and reading time point, up to 38% of inhibition zones were smaller than the cut-off of 14 mm; that is, the result of the test was false-negative. Conclusions. Shortening incubation time from 24 h to 12 h for optochin susceptibility testing is feasible. Agar and incubation time have to be chosen carefully to avoid false-negative results.

  1. Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

    Directory of Open Access Journals (Sweden)

    Ana Paula Gomes de Oliveira Magalhães


    Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

  2. Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

    Directory of Open Access Journals (Sweden)

    Marta I. C. MEDEIROS


    Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

  3. Nebulized antithrombin limits bacterial outgrowth and lung injury in Streptococcus pneumoniae pneumonia in rats

    NARCIS (Netherlands)

    Hofstra, J.J.; Cornet, A.D.; de Rooy, B.F.; Vlaar, A.P.; van der Poll, T.; Levi, M.; Zaat, S.A.J.; Schultz, M.J.


    Introduction Disturbed alveolar fibrin turnover is a cardinal feature of severe pneumonia. Clinical studies suggest that natural inhibitors of coagulation exert lung-protective effects via anticoagulant and possibly also anti-inflammatory pathways. Intravenous infusion of the natural anticoagulants

  4. Evaluation of Streptococcus pneumoniae in bile samples: A case series review. (United States)

    Itoh, Naoya; Kawamura, Ichiro; Tsukahara, Mika; Mori, Keita; Kurai, Hanako


    Although Streptococcus pneumoniae is an important pathogen of humans, pneumococcal cholangitis is rare because of the rapid autolysis of S. pneumoniae. The aim of this case series was to review patients with bile cultures positive for S. pneumoniae. This study was a single center retrospective case series review of patients with S. pneumoniae in their bile at a tertiary-care cancer center between September 2002 and August 2015. Subjects consisted of all patients in whom S. pneumoniae was isolated in their bile during the study period. Bile specimens for culture were obtained from biliary drainage procedures such as endoscopic retrograde biliary drainage, endoscopic nasobiliary drainage, and percutaneous transhepatic biliary drainage. There were 20 patients with bile cultures positive for S. pneumoniae during the study period. All patients presented with extrahepatic obstructive jaundice due to hepatopancreatobiliary tumors. Nineteen of 20 patients underwent the placement of plastic intrabiliary tubes. The mean time between the first-time drainage and the positive culture was 26 days (range 0-313 days). Although 12 of 20 patients met our definition of cholangitis, 5 were clinically treated with antibiotics based on a physician's assessment of whether there was a true infection. The present study is the largest case series of patients with S. pneumoniae in their bile. Based on our findings, the isolation of S. pneumoniae from bile may be attributed to the placement of biliary drainage devices. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  5. Novel purification scheme and functions for a C3-binding protein from Streptococcus pneumoniae. (United States)

    Cheng, Q; Finkel, D; Hostetter, M K


    To isolate microbial proteins capable of binding the third component of complement (C3), we coupled the free sulfhydryl group of methylamine-inactivated C3 to a thiolSepharose matrix. This simple technique facilitated the purification of the first C3-binding protein isolated from a bacterium (Streptococcus pneumoniae). Both metastable (native) and thioester-disrupted C3 were recognized by this protein; binding of C3 was noncovalent, independent of thioester conformation, and preferential for the C3 alpha-chain. Sequencing of amino-terminal and internal peptides from the C3-binding protein disclosed a proline-rich region spanning approximately 20 amino acids and a signal peptide that had not been previously reported. The gene was isolated from a library of genomic DNA from laboratory strain CP1200 by screening with a 1200 bp PCR product amplified from degenerate oligonucleotides encoding the amino terminal sequence and the internal proline-rich sequence. The open reading frame spanned 1692 bp; all peptide sequences were identified in the translated gene product, which also contained at least three choline-binding repeats at the carboxy-terminus. The gene was conserved, and the translated protein was functionally active in pneumococcal clinical isolates of serotypes 1, 3, 4, 14, and 19F. Serum from a patient recovering from acute pneumococcal infection contained IgG antibodies specific for this protein by immunoblot. Wide conservation among clinical isolates, saturable binding of C3, and the ability to stimulate the human immune response have not previously been reported for this choline-binding protein. A similar biochemical approach should enable the identification of other C3-binding proteins in microorganisms able to elude complement-mediated host defense.

  6. Capsule Type and Amount Affect Shedding and Transmission of Streptococcus pneumoniae. (United States)

    Zafar, M Ammar; Hamaguchi, Shigeto; Zangari, Tonia; Cammer, Michael; Weiser, Jeffrey N


    The capsular polysaccharide (CPS) of Streptococcus pneumoniae is characterized by its diversity, as it has over 95 known serotypes, and the variation in its thickness as it surrounds an organism. While within-host effects of CPS have been studied in detail, there is no information about its contribution to host-to-host transmission. In this study, we used an infant mouse model of intralitter transmission, together with isogenic capsule switch and cps promoter switch constructs, to explore the effects of CPS type and amount. The determining factor in the transmission rate in this model is the number of pneumococci shed in nasal secretions by colonized hosts. Two of seven capsule switch constructs showed reduced shedding. These constructs were unimpaired in colonization and expressed capsules similar in size to those of the wild-type strain. A cps promoter switch mutant expressing ~50% of wild-type amounts of CPS also displayed reduced shedding without a defect in colonization. Since shedding from the mucosal surface may require escape from mucus entrapment, a mucin-binding assay was used to compare capsule switch and cps promoter switch mutants. The CPS type or amount constructs that shed poorly were bound more robustly by immobilized mucin. These capsule switch and cps promoter switch constructs with increased mucin-binding affinity and reduced shedding also had lower rates of pup-to-pup transmission. Our results demonstrate that CPS type and amount affect transmission dynamics and may contribute to the marked differences in prevalence among pneumococcal types.IMPORTANCEStreptococcus pneumoniae, a leading cause of morbidity and mortality, is readily transmitted, especially among young children. Its structurally and antigenically diverse capsular polysaccharide is the target of currently licensed pneumococcal vaccines. Epidemiology studies show that only a subset of the >95 distinct serotypes are prevalent in the human population, suggesting that certain capsular

  7. In silico assessment of virulence factors in strains of Streptococcus oralis and Streptococcus mitis isolated from patients with Infective Endocarditis

    DEFF Research Database (Denmark)

    Rasmussen, Louise H.; Iversen, Katrine Højholt; Dargis, Rimtas


    Streptococcus oralis and Streptococcus mitis belong to the Mitis group, which are mostly commensals in the human oral cavity. Even though S. oralis and S. mitis are oral commensals, they can be opportunistic pathogens causing infective endocarditis. A recent taxonomic re-evaluation of the Mitis...... group has embedded the species Streptococcus tigurinus and Streptococcus dentisani into the species S. oralis as subspecies. In this study, the distribution of virulence factors that contribute to bacterial immune evasion, colonization and adhesion was assessed in clinical strains of S. oralis (subsp...

  8. Respiratory Commensal Bacteria Corynebacterium pseudodiphtheriticum Improves Resistance of Infant Mice to Respiratory Syncytial Virus and Streptococcus pneumoniae Superinfection

    Directory of Open Access Journals (Sweden)

    Paulraj Kanmani


    Full Text Available Corynebacterium pseudodiphtheriticum is a Gram-positive bacterium found as a member of the normal microbiota of the upper respiratory tract. It was suggested that C. pseudodiphtheriticum may be potentially used as a next-generation probiotic for nasal application, although no deep studies were performed in this regard. We hypothesized that human isolate C. pseudodiphtheriticum strain 090104 is able to modulate the respiratory innate immune response and beneficially influence the resistance to viral and bacterial infections. Therefore, in the present study we investigated how the exposure of infant mice to nasal priming with viable or non-viable C. pseudodiphtheriticum 090104 influences the respiratory innate immune response triggered by Toll-like receptor (TLR-3 activation, the susceptibility to primary Respiratory Synsytial Virus (RSV infection, and the resistance to secondary Streptococcus pneumoniae pneumonia. We demonstrated that the nasal priming with viable C. pseudodiphtheriticum 090104 differentially modulated TLR3-mediated innate antiviral immune response in the respiratory tract of infant mice, improving their resistance to primary RSV infection, and secondary pneumococcal pneumonia. In association with the protection against RSV-pneumococcal superinfection, we found that viable C. pseudodiphtheriticum improved lung CD3+CD4+IFN-γ+, and CD3+CD4+IL-10+ T cells as well as CD11c+SiglecF+IFN-β+ alveolar macrophages. Of interest, non-viable bacteria did not have the same protective effect, suggesting that C. pseudodiphtheriticum colonization is needed for achieving its protective effect. In conclusion, we present evidence that nasal application of viable C. pseudodiphtheriticum could be thought as an alternative to boost defenses against RSV and secondary pneumococcal pneumonia, which should be further studied and validated in clinical trials. Due to the absence of a long-lasting immunity, re-infection with RSV throughout life is common

  9. Respiratory Commensal Bacteria Corynebacterium pseudodiphtheriticum Improves Resistance of Infant Mice to Respiratory Syncytial Virus and Streptococcus pneumoniae Superinfection. (United States)

    Kanmani, Paulraj; Clua, Patricia; Vizoso-Pinto, Maria G; Rodriguez, Cecilia; Alvarez, Susana; Melnikov, Vyacheslav; Takahashi, Hideki; Kitazawa, Haruki; Villena, Julio


    Corynebacterium pseudodiphtheriticum is a Gram-positive bacterium found as a member of the normal microbiota of the upper respiratory tract. It was suggested that C. pseudodiphtheriticum may be potentially used as a next-generation probiotic for nasal application, although no deep studies were performed in this regard. We hypothesized that human isolate C. pseudodiphtheriticum strain 090104 is able to modulate the respiratory innate immune response and beneficially influence the resistance to viral and bacterial infections. Therefore, in the present study we investigated how the exposure of infant mice to nasal priming with viable or non-viable C. pseudodiphtheriticum 090104 influences the respiratory innate immune response triggered by Toll-like receptor (TLR)-3 activation, the susceptibility to primary Respiratory Synsytial Virus (RSV) infection, and the resistance to secondary Streptococcus pneumoniae pneumonia. We demonstrated that the nasal priming with viable C. pseudodiphtheriticum 090104 differentially modulated TLR3-mediated innate antiviral immune response in the respiratory tract of infant mice, improving their resistance to primary RSV infection, and secondary pneumococcal pneumonia. In association with the protection against RSV-pneumococcal superinfection, we found that viable C. pseudodiphtheriticum improved lung CD3(+)CD4(+)IFN-γ(+), and CD3(+)CD4(+)IL-10(+) T cells as well as CD11c(+)SiglecF(+)IFN-β(+) alveolar macrophages. Of interest, non-viable bacteria did not have the same protective effect, suggesting that C. pseudodiphtheriticum colonization is needed for achieving its protective effect. In conclusion, we present evidence that nasal application of viable C. pseudodiphtheriticum could be thought as an alternative to boost defenses against RSV and secondary pneumococcal pneumonia, which should be further studied and validated in clinical trials. Due to the absence of a long-lasting immunity, re-infection with RSV throughout life is common

  10. Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System.

    Directory of Open Access Journals (Sweden)

    Morten Kjos


    Full Text Available Pneumococcal bacteriocins (pneumocins are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp of Streptococcus pneumoniae D39. Furthermore, by analogy with pneumococcal competence, we show that several antibiotics activate the blp-genes. Using real-time gene expression measurements we show that while the promoter driving expression of the two-component regulatory system blpR/H is constitutive, the remaining blp-promoters that control pneumocin expression, immunity and the inducer peptide BlpC, are pH-dependent and induced in the late exponential phase. Intriguingly, competence for genetic transformation, mediated by the paralogous ComD/E two-component quorum system, is induced by the same environmental cues. To test for interplay between these regulatory systems, we quantified the regulatory response to the addition of synthetic BlpC and competence-stimulating peptide (CSP. Supporting the idea of such interplay, we found that immediately upon addition of CSP, the blp-promoters were activated in a comD/E-dependent manner. After a delay, blp-expression was highly induced and was strictly dependent on blpRH and blpC. This raised the question of the mechanism of BlpC export, since bioinformatic analysis showed that the genes encoding the putative exporter for BlpC, blpAB, are not intact in strain D39 and most other strains. By contrast, all sequenced pneumococcal strains contain intact comAB genes, encoding the transport system for CSP. Consistent with the idea that comAB mediate BlpC export, we finally show that high-level expression of the blp-genes requires comAB. Together, our results demonstrate that regulation of pneumocin expression is intertwined with competence, explaining why certain antibiotics induce blp-expression. Antibiotic-induced pneumocin expression might

  11. Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

    Directory of Open Access Journals (Sweden)

    Casey L Pell

    Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

  12. Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

    Directory of Open Access Journals (Sweden)

    Gonzalo Angulo


    Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

  13. Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

    Directory of Open Access Journals (Sweden)

    Erdem I


    Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

  14. The place of endogenous antimicrobial peptides in the pathogenetic mechanisms of the development of community-acquired pneumonia caused by Streptococcus pneumoniae among infants

    Directory of Open Access Journals (Sweden)

    G.O. Lezhenko


    Full Text Available A comprehensive survey was carried out in 30 children with community-acquired pneumonia aged 2 months to 3 years old, among them in 18 children the disease was caused by Streptococcus pneumoniae, and in the remaining 12 patients — by Gram-negative flora. All children underwent the evaluation of the severity of the condition using the PRESS scale, according to which it was found that most patients had severe course of pneumococcal pneumonia. The analysis showed that the development of pneumococcal pneumonia in children occurred against the background of a decrease in the serum content of vitamin D metabolites and the activity of antimicrobial peptides, in contrast to pneumonia caused by Gram-negative pathogens. In the blood serum of children with pneumococcal pneumonia, there was detected a decrease in the content of β1-defensins by 2.6 times, LL-37 — by 3.7 times and human bactericidal permeability-increasing protein — by 2.8 times in comparison with the control group (p < 0.05. It has been proved that inadequate activation of antimicrobial peptides against the background of a deficiency of vitamin D metabolites in infants with pneumonia caused by Streptococcus pneumoniae is one of the pathogenetic links leading to a severe course of the disease.

  15. [Sensitivity surveillance of Streptococcus pneumoniae isolates for several antibacterial agents in Gifu and Aichi prefecture (2008-2009)]. (United States)

    Furuya, Yuri; Fukuda, Yoshiko; Nomura, Nobuhiko; Mitsuyama, Junichi; Yamaoka, Kazukiyo; Asano, Yuko; Sawamura, Haruki; Suematsu, Hiroyuki; Teraji, Mayumi; Kawahara, Yuuki; Matsukawa, Yoko; Matsubara, Shigenori; Miyabe, Takanori; Arai, Toru; Watanabe, Kunitomo; Mikamo, Hiroshige


    We investigated the susceptibility to antibacterials, genotype of penicillin-binding protein (PBP) genes and macrolide resistant genes, and the serotypes against 377 strains of Streptococcus pneumoniae isolated from medical facilities in Gifu and Aichi prefectures between June 2008 and April 2009. These results were compared with those against 160 strains of S. pneumoniae isolated in 2004. Referring to CLSI (M100-S17), the overall incidence of penicillin-susceptible (PSSP), penicillin-intermediate (PISP) and penicillin-resistant (PRSP) S. pneumoniae was 143 (38%), 185 (49%) and 49 (13%) strains, respectively. PISP and PRSP were isolated higher in the material of nasal cavity and throat, and PRSP was isolated higher in the area of Chuno district. The number of gPSSP with 3 normal PBP genes, gPISP with 1 or 2 normal PBP genes and gPRSP with 3 abnormal genes was 23 (6.1%), 173 (46%) and 181 (48%) strains, respectively. The isolates with no macrolide-resistant gene, only mefA, only ermB, and both mefA and ermB were 28 (7.4%), 138 (37%), 166 (44%) and 45 (12%). The prevalent pneumococcal serotypes were type 19 (92 strains; 24%), following by type 23 (60 strains; 16%) and type 6 (56 strains; 15%). The 80% of pneumococcal serotypes of PRSP were serotype 19 and 6. The MIC90 of each antibacterial was as follows; 0.1 microg/mL for imipenem, panipenem and garenoxacin, 0.2 microg/mL for moxifloxacin, 0.39 microg/mL for meropenem and tosufloxacin, 0.78 microg/ mL for amoxicillin, clavulanic acid/amoxicillin, cefditoren and cefcapene, 1.56 microg/mL for benzylpenicillin, piperacillin, cefteram and levofloxacin, 3.13 microg/mL for cefotiam, flomoxef and pazufloxacin, 6.25 microg/mL for cefdinir, 12.5 microg/mL for norfloxacin and minocycline, > 100 microg/mL for clarithromycin, and these MIC90s were about the same as those in 2004.

  16. Cidal activity of oral third-generation cephalosporins against Streptococcus pneumoniae in relation to cefotaxime intrinsic activity. (United States)

    Cafini, F; Aguilar, L; Alou, L; Giménez, M J; Sevillano, D; Torrico, M; González, N; Granizo, J J; Martín-Herrero, J E; Prieto, J


    This study explores the killing kinetics within 12 h of four oral third-generation cephalosporins against ten Streptococcus pneumoniae strains exhibiting cefotaxime minimum inhibitory concentrations (MICs) from 0.03 to 2 microg/ml. Killing curves were performed with concentrations achievable in serum after standard doses (0.015-4 microg/ml). Reductions of 90% were achieved with all compounds at serum-achievable concentrations for strains exhibiting cefotaxime MIC or = 1 microg/ml, only cefditoren reached a 90% reduction with concentrations of 0.5-1 microg/ml doses. At 4 microg/ml, cefditoren and cefotaxime reached 99.9% reduction in seven of the ten strains studied. At serum-achievable concentrations, cefdinir and cefixime were not bactericidal against strains exhibiting cefotaxime MIC > or = 0.25 microg/ml and > or = 0.5 microg/ml, respectively. Cefditoren showed the best killing kinetic profiles and this observation may be important when choosing an oral third-generation cephalosporin as initial or sequential therapy.

  17. Interaction between Streptococcus pneumoniae and Staphylococcus aureus in paediatric patients suffering from an underlying chronic disease. (United States)

    Esposito, Susanna; Marseglia, Gian Luigi; Colombo, Carla; Iughetti, Lorenzo; Terranova, Leonardo; Ierardi, Valentina; Gambino, Monia; Principi, Nicola


    Little is known about the interaction between Streptococcus pneumoniae and Staphylococcus aureus in school-age children and adolescents suffering from an underlying chronic disease. To increase our knowledge in this regard, an oropharyngeal swab was obtained from school-age children and adolescents suffering from asthma (n = 423), cystic fibrosis (CF) (n = 212) and type 1 diabetes mellitus (DM1) (n = 296). S. pneumoniae detection and serotyping were performed using a real-time polymerase chain reaction, and S. aureus detection was performed using the RIDAGENE MRSA system. Among asthmatic, CF and DM1 patients, both pathogens were identified in 65/423 (15.4%), 21/212 (9.9%) and 62/296 (20.9%) children, respectively; S. pneumoniae alone was identified in 127/434 (30.0%), 21/212 (9.9%) and 86/296 (29.1%), respectively; S. aureus alone was identified in 58/434 (13.7%), 78/212 (36.8%) and 49/296 (16.6%), respectively. S. pneumoniae colonisation rates were higher in younger children and declined with age, whereas the frequency of S. aureus colonisation was quite similar in the different age groups. Among asthmatic and CF patients aged 6-9 years, S. aureus carriage was significantly higher in children who were positive for S. pneumoniae (P <0.05). No significant association emerged between S. aureus carriage and carriage of S. pneumoniae serotypes included in the pneumococcal conjugate vaccines (PCVs). This study shows for the first time that school-age children and adolescents with asthma, CF and DM1 are frequently colonised by S. pneumoniae and S. aureus and that no negative relationship seems to exist between these pathogens. Moreover, the supposed protection offered by PCV administration against S. aureus colonisation was not demonstrated. © The Author(s) 2015.

  18. Draft Genome Sequences of Two Streptococcus pneumoniae Serotype 19A Sequence Type 226 Clinical Isolates from Hungary, Hu17 with High-Level Beta-Lactam Resistance and Hu15 of a Penicillin-Sensitive Phenotype. (United States)

    Rieger, Martin; Denapaite, Dalia; Brückner, Reinhold; Maurer, Patrick; Hakenbeck, Regine


    The draft genome sequences of two multiple-antibiotic-resistant Streptococcus pneumoniae isolates from Hungary, Hu15 and Hu17, are reported here. Strain Hu15 is penicillin susceptible, whereas Hu17 is a high-level-penicillin-resistant strain. Both isolates belong to the serotype 19A sequence type 226, a single-locus variant (in the ddl locus) of the Hungary(19A)-6 clone. Copyright © 2017 Rieger et al.

  19. Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

    Directory of Open Access Journals (Sweden)

    Cristina R. M. Yoshioka


    Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

  20. The ecology of nasal colonization of Streptococcus pneumoniae, Haemophilus influenzae and Staphylococcus aureus: the role of competition and interactions with host's immune response. (United States)

    Margolis, Elisa; Yates, Andrew; Levin, Bruce R


    The first step in invasive disease caused by the normally commensal bacteria Streptococcus pneumoniae, Staphylococcus aureus and Haemophilus influenzae is their colonization of the nasal passages. For any population to colonize a new habitat it is necessary for it to be able to compete with the existing organisms and evade predation. In the case of colonization of these species the competition is between strains of the same and different species of bacteria and the predation is mediated by the host's immune response. Here, we use a neonatal rat model to explore these elements of the ecology of nasal colonization by these occasionally invasive bacteria. When neonatal rats are colonized by any one of these species the density of bacteria in the nasal passage rapidly reaches a steady-state density that is species-specific but independent of inoculum size. When novel populations of H. influenzae and S. pneumoniae are introduced into the nasal passages of neonatal rats with established populations of the same species, residents and invaders coexisted. However, this was not the case for S. aureus - the established population inhibited invasion of new S. aureus populations. In mixed-species introductions, S. aureus or S. pneumoniae facilitated the invasion of another H. influenzae population; for other pairs the interaction was antagonistic and immune-mediated. For example, under some conditions H. influenzae promoted an immune response which limited the invasion of S. pneumoniae. Nasal colonization is a dynamic process with turnover of new strains and new species. These results suggest that multiple strains of either H. influenzae or S. pneumoniae can coexist; in contrast, S. aureus strains require a host to have no other S. aureus present to colonize. Levels of colonization (and hence the possible risk of invasive disease) by H. influenzae are increased in hosts pre-colonized with either S. aureus or S. pneumoniae.

  1. Streptococcus pneumoniae causing mycotic aneurysm in a pediatric patient with coarctation of the aorta. (United States)

    Haas, Brian; Wilt, Heath G; Carlson, Karina M; Lofland, Gary K


    Mycotic aneurysms are rare in patients with congenital heart disease, but may occur in those with aortic coarctation and abnormal aortic valve. Rapid diagnosis of mycotic aneurysm is of extreme importance given the significant reported incidence of morbidity and mortality across all age groups. Aortic aneurysm is uncommon before the second decade of life, and here we report a 10-year-old male patient with new diagnosis of aortic coarctation and bicuspid aortic valve, who developed a rapidly enlarging mycotic aneurysm from Streptococcus pneumoniae. Cardiac magnetic resonance imaging was crucial in making the diagnosis, as well as in follow-up. © 2011 Wiley Periodicals, Inc.

  2. Multidrug-resistant Streptococcus pneumoniae isolates from healthy Ghanaian preschool children

    DEFF Research Database (Denmark)

    Dayie, Nicholas Tete Kwaku Dzifa; Arhin, Reuben E.; Newman, Mercy J.


    Streptococcus pneumoniae is the cause of high mortality among children worldwide. Antimicrobial treatment and vaccination are used to control pneumococcal infections. In Ghana, data on antimicrobial resistance and the prevalence of multidrug-resistant pneumococcal clones are scarce; hence, the aim...... of this study was to determine the antibiogram of S. pneumoniae recovered from Ghanaian children younger than six years of age and to what extent resistances were due to the spread of certain sero- and multilocus sequence typing (MLST) types. The susceptibility of 115 pneumococcal isolates, recovered...... in a previous study, to six antimicrobials was determined by disk diffusion test. Overall, 90.4% of isolates were intermediate penicillin resistant, 99.1% were trimethoprim resistant, 73.0% were tetracycline resistant, and 33.9% were sulfamethoxazole resistant. Low resistance was recorded for erythromycin (2...

  3. Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

    DEFF Research Database (Denmark)

    Molzen, T E; Burghout, P; Bootsma, H J


    Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... of invasive pneumococcal disease is required in order to enable the development of new or adjunctive treatments and/or pneumococcal vaccines that are efficient across serotypes. We applied genomic array footprinting (GAF) in the search for S. pneumoniae genes that are essential during experimental meningitis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

  4. Endocarditis with ruptured sinus of Valsalva aneurysm caused by nonvaccine Streptococcus pneumoniae serotype 21. (United States)

    Patra, Kamakshya P; Vanchiere, John A; Bocchini, Joseph A; Wu, Amy C; Jackson, Robert D; Kiel, Ernest A; Mello, Dennis


    Sinus of Valsalva aneurysm is a rare, catastrophic complication of endocarditis. We report an unusual case of ruptured sinus of Valsalva aneurysm associated with endocarditis that was caused by Streptococcus pneumoniae serotype 21. The patient, a 12-year-old girl, underwent surgical repair of the aneurysm and was given intravenous antibiotics for 6 weeks. She was doing well at the 6-week follow-up visit. This case is unusual because of the patient's young age at presentation, the absence of predisposing factors, and the isolation of a nonvaccine serotype 21, which revealed the epidemiologic changes of invasive pneumococcal disease. To our knowledge, this is the first reported case of endocarditis caused by this S. pneumoniae serotype.

  5. Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types. (United States)

    Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu


    There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

  6. CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

    Directory of Open Access Journals (Sweden)

    Colette G. Ngo Ndjom


    Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

  7. Circulating Serotypes and Trends in Antibiotic Resistance of Invasive Streptococcus Pneumoniae from Children under Five in Bangalore. (United States)

    Kumar K L, Ravi; Ganaie, Feroze; Ashok, Vandana


    Globally, Streptococcus pneumoniae is estimated to be responsible for 1 to 2 million deaths annually, in extremes of age. Serotypic distribution of pneumococci varies with age, time, and geographical area. Limited data is available on serotypic prevalence and antimicrobial susceptibility patterns of pneumococci in India. To assess resistance trends to different groups of antimicrobials and serotypic prevalences of invasive pneumococci. A prospective, hospital based study was conducted for two years, at a tertiary care medical college hospital in south Bangalore. Forty invasive pneumococcal isolates from children who were ≤5 years, with a clinical and radiological diagnosis of invasive pneumococcal disease, (IPD) were evaluated. Qualitative typing/grouping was performed by doing the capsular reaction test (Neufeld test). Antimicrobial susceptibility was tested by Minimum Inhibitory Concentration method using automated microdilution procedure. The predominant invasive pneumococcal serotypes were serogroups/types (SGTs) 6 (25%) and 14 (17.5%). 35%, 77.5% and 15% of isolates were resistant to Penicillin, Trimethoprim/Sulfamethoxazole (TMP-SMX) and Ceftriaxone respectively. Intermediate and high level resistances to penicillin were seen in 22.5% and 12.5% of S. pneumoniae isolates correspondingly. Multidrug resistance was observed in 20% of strains. This study reported presence of high level drug resistance in invasive pneumococcal isolates which were obtained from children. The serogroup/type distribution in our study and those in other Indian studies were not even. This calls for monitoring of resistance and mapping of serotype distribution.

  8. Human Streptococcus agalactiae strains in aquatic mammals and fish

    Directory of Open Access Journals (Sweden)

    Delannoy Christian MJ


    Full Text Available Abstract Background In humans, Streptococcus agalactiae or group B streptococcus (GBS is a frequent coloniser of the rectovaginal tract, a major cause of neonatal infectious disease and an emerging cause of disease in non-pregnant adults. In addition, Streptococcus agalactiae causes invasive disease in fish, compromising food security and posing a zoonotic hazard. We studied the molecular epidemiology of S. agalactiae in fish and other aquatic species to assess potential for pathogen transmission between aquatic species and humans. Methods Isolates from fish (n = 26, seals (n = 6, a dolphin and a frog were characterized by pulsed-field gel electrophoresis, multilocus sequence typing and standardized 3-set genotyping, i.e. molecular serotyping and profiling of surface protein genes and mobile genetic elements. Results Four subpopulations of S. agalactiae were identified among aquatic isolates. Sequence type (ST 283 serotype III-4 and its novel single locus variant ST491 were detected in fish from Southeast Asia and shared a 3-set genotype identical to that of an emerging ST283 clone associated with invasive disease of adult humans in Asia. The human pathogenic strain ST7 serotype Ia was also detected in fish from Asia. ST23 serotype Ia, a subpopulation that is normally associated with human carriage, was found in all grey seals, suggesting that human effluent may contribute to microbial pollution of surface water and exposure of sea mammals to human pathogens. The final subpopulation consisted of non-haemolytic ST260 and ST261 serotype Ib isolates, which belong to a fish-associated clonal complex that has never been reported from humans. Conclusions The apparent association of the four subpopulations of S. agalactiae with specific groups of host species suggests that some strains of aquatic S. agalactiae may present a zoonotic or anthroponotic hazard. Furthermore, it provides a rational framework for exploration of pathogenesis and host

  9. Streptococcus pneumoniae and Staphylococcus aureus carriage in healthy school-age children and adolescents. (United States)

    Esposito, Susanna; Terranova, Leonardo; Ruggiero, Luca; Ascolese, Beatrice; Montinaro, Valentina; Rios, Walter Peves; Galeone, Carlotta; Principi, Nicola


    Streptococcus pneumoniae and Staphylococcus aureus are common commensals of the upper respiratory tract in children and adolescents. Understanding the relationship between these two pathogens, including their potential for mutual interference, is needed to evaluate the epidemiology of the diseases they cause, the factors that condition acquisition and carriage, and the impact of related preventative measures. We obtained oropharyngeal and nasal swabs from 497 healthy subjects aged 6-17 years. S. pneumoniae detection and serotyping were performed using a real-time PCR and S. aureus detection was performed using the RIDAGENE MRSA system. We found that 136 (27.3%) of the children were carriers of both species, 121 (24.3%) of the children carried S. pneumoniae alone and 128 (25.7%) of the children carried S. aureus alone. S. aureus carriage was similar between children who carried S. pneumoniae (136/257, 52.9 %, 95% confidence interval [CI]: 46.8-58.9%) vs those who did not (128/240, 53.3%, 95% CI: 47.0 -59.5%) and was independent of age and vaccination with 7-valent pneumococcal conjugate vaccine (PCV7). Vaccination with PCV7 did not affect S. aureus carriage [S. pneumoniae: 84/143 (58.7%, 95% CI: 50.5 -66.5%) vaccinated children vs 171/351 (48.7%, 95% CI: 43.5 -53.9%) unvaccinated children; S. aureus: 67/143 (46.9%, 95% CI: 38.9-55.0 %) vaccinated children vs 195/351 (55.6%, 95% CI: 50.3 -60.7%) unvaccinated children]. Pneumococcal serotype also did not appear to affect S. aureus carriage. These findings suggested that the carriage of S. pneumoniae did not affect that of S. aureus in older children and adolescents, regardless of age, PCV7 vaccination and pneumococcal serotype. © 2015 The Authors.

  10. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children. (United States)

    Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

  11. Detection of the efflux-mediated erythromycin resistance transposon in Streptococcus pneumoniae. (United States)

    Azadegan, Azadeh; Ahmadi, Ali; Lari, Abdolaziz Rastegar; Talebi, Malihe


    The present analysis focuses on phenotypic and genotypic characterizations of efflux-mediated erythromycin resistance in Streptococcus pneumoniae due to an increase in macrolide resistance in S. pneumoniae worldwide. We investigated the prevalence of efflux-mediated erythromycin resistance and its relevant genetic elements from 186 specimens of S. pneumonia isolated from clinical and normal flora from Tehran, Iran. The presence of erythromycin resistance genes was tested by PCR with two sets of primers, specific for erm(B) and mef(A/E), and their genetic elements with tetM, xis, and int genes. Isolates were typed with the BOX PCR method and tested for resistance to six antibiotics. Antibiotic susceptibility tests revealed that 100% and 47% isolates were resistant to tetracycline and erythromycin, respectively. The erythromycin and clindamycin double-disc diffusion test for macrolide-lincosamide-streptograminB (MLSB) resistance phenotype showed 74 (84%) isolates with the constitutive MLSB phenotype and the remaining with the M phenotype. BOX PCR demonstrated the presence of 7 types in pneumococci with the M phenotype. Fourteen (16%) isolates with the M phenotype harbored mef(A/E), tetM, xis, and int genes. The present results suggest dissemination of polyclonal groups of S. pneumoniae with the M phenotype carrying resistance genes attributed to transposon 2009.

  12. Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses. (United States)

    Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor


    The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

  13. Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae. (United States)

    Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem


    The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.

  14. Streptococcus intermedius Causing Necrotizing Pneumonia in an Immune Competent Female: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Faris Hannoodi


    Full Text Available We report a case of a 52-year-old immunocompetent Caucasian female treated for necrotizing Streptococcus intermedius pneumonia and review available literature of similar cases. Our patient presented with respiratory failure and required hospitalization and treatment in the intensive care unit. Moreover, she required surgical drainage of right lung empyema as well as decortication and resection. The review of literature revealed three cases of S. intermedius pneumonia, one of which was a mortality. Comparison of the published cases showed a highly varied prehospital course and radiological presentations, with a symptomatic phase ranging from 10 days to five months. Radiological findings varied from an isolated pleural effusion to systemic disease with the presence of brain abscesses. Immunocompetence appears to correlate well with the overall prognosis. In addition, smoking appears to be an important risk factor for S. intermedius pneumonia. In 2 (50% of cases, pleural fluid analysis identified S. intermedius. In contrast, no organism was found in our patient, necessitating the acquisition of lung tissue sample for the diagnosis. In conclusion, both medical and surgical management are necessary for effective treatment of S. intermedius pneumonia. The outcome of treatment is good in immunocompetent individuals.

  15. Systemic disease during Streptococcus pneumoniae acute lung infection requires 12-lipoxygenase-dependent inflammation. (United States)

    Bhowmick, Rudra; Maung, Nang; Hurley, Bryan P; Ghanem, Elsa Bou; Gronert, Karsten; McCormick, Beth A; Leong, John M


    Acute pulmonary infection by Streptococcus pneumoniae is characterized by high bacterial numbers in the lung, a robust alveolar influx of polymorphonuclear cells (PMNs), and a risk of systemic spread of the bacterium. We investigated host mediators of S. pneumoniae-induced PMN migration and the role of inflammation in septicemia following pneumococcal lung infection. Hepoxilin A3 (HXA3) is a PMN chemoattractant and a metabolite of the 12-lipoxygenase (12-LOX) pathway. We observed that S. pneumoniae infection induced the production of 12-LOX in cultured pulmonary epithelium and in the lungs of infected mice. Inhibition of the 12-LOX pathway prevented pathogen-induced PMN transepithelial migration in vitro and dramatically reduced lung inflammation upon high-dose pulmonary challenge with S. pneumoniae in vivo, thus implicating HXA3 in pneumococcus-induced pulmonary inflammation. PMN basolateral-to-apical transmigration in vitro significantly increased apical-to-basolateral transepithelial migration of bacteria. Mice suppressed in the expression of 12-LOX exhibited little or no bacteremia and survived an otherwise lethal pulmonary challenge. Our data suggest that pneumococcal pulmonary inflammation is required for high-level bacteremia and systemic infection, partly by disrupting lung epithelium through 12-LOX-dependent HXA3 production and subsequent PMN transepithelial migration.

  16. Antimicrobial activities of Eugenia caryophyllata extract and its major chemical constituent eugenol against Streptococcus pneumoniae. (United States)

    Yadav, Mukesh Kumar; Park, Seok-Won; Chae, Sung-Won; Song, Jae-Jun; Kim, Ho Chul


    In this study, we investigate the antimicrobial activities of both Eugenia caryophyllata (Ec) extract and its major component eugenol (4-allyl-2-methoxyphenol) against Streptococcus pneumoniae. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined by microdilution method. Pneumococcal biofilms were detected by crystal-violet microtiter plate assay, followed by colony-forming unit counts and visualized by scanning electron microscope (SEM). The synergistic effect of eugenol and penicillin was determined by checker-board method. Both the eugenol and the Ec extract inhibited pneumococcal growth in a concentration-dependent manner. The MIC and MBC of eugenol were 0.06% and 0.12%, respectively. Eugenol at a concentration of 0.12% completely killed S. pneumoniae within 60 min of exposure. The kill rate of planktonic cells was most rapid during the first 15 min of contact with eugenol. The addition of eugenol or Ec extract inhibited in vitro biofilm formation. In already established biofilms, the inhibitory effect of eugenol or Ec extract was more significant in terms of cell viability than in terms of disruption of the biofilm matrix. SEM analysis revealed non-viable and disruptive action of eugenol on the cell membrane of bacteria of biofilms. It was found that eugenol and penicillin produced a synergistic effect against S. pneumoniae. In conclusion, eugenol and Ec extract efficiently inhibited S. pneumoniae in planktonic growth and within biofilms. © 2013 APMIS. Published by John Wiley & Sons Ltd.

  17. Immunoglobulin deficiency in patients with Streptococcus pneumoniae or Haemophilus influenzae invasive infections. (United States)

    Martinot, Martin; Oswald, Laetitia; Parisi, Elisabeth; Etienne, Elodie; Argy, Nicolas; Grawey, Isabelle; De Briel, Dominique; Zadeh, Mahsa Mohseni; Federici, Laure; Blaison, Gilles; Koebel, Christelle; Jaulhac, Benoit; Hansmann, Yves; Christmann, Daniel


    Immunoglobulin (Ig) deficiency is a well-known risk factor for Streptococcus pneumoniae or Haemophilus influenzae infections and noteworthy invasive diseases. However, the proportion of these deficiencies in cases of invasive disease is unknown. The objective of this study was to evaluate the rate of Ig deficiency in cases of invasive disease. A prospective study was conducted from January 2008 to October 2010 in two French hospitals. Measurement of Ig levels was carried out in patients hospitalized for invasive diseases. A total of 119 patients were enrolled in the study, with nine cases of H. influenzae and 110 cases of S. pneumoniae invasive disease. There were 18 cases of meningitis, 79 of invasive pneumonia, and 22 other invasive diseases. Forty-five patients (37.8%) had an Ig abnormality, 37 of whom had an Ig deficiency (20 IgG deficiencies (three common variable immunodeficiencies and two complete IgA deficiencies) and 14 secondary deficiencies, mainly lymphoproliferative disorders. All these deficiencies were either not known or not substituted. Humoral deficiency is frequent in patients with S. pneumoniae or H. influenzae invasive disease and Ig dosage should be proposed systematically after such infections. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Amauri Lázaro Noda Albelo


    Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

  19. Influence of the beta-lactam resistance phenotype on the cefuroxime versus cefditoren susceptibility of Streptococcus pneumoniae and Haemophilus influenzae recovered from children with acute otitis media. (United States)

    Fenoll, Asunción; Aguilar, Lorenzo; Robledo, Olga; Giménez, María-José; Tarragó, David; Granizo, Juan-José; Gimeno, Mercedes; Coronel, Pilar


    To study the influence of resistance phenotypes (based on sentinel antibiotics: penicillin and amoxicillin with/without clavulanate) on the cefuroxime versus cefditoren susceptibility of Streptococcus pneumoniae and Haemophilus influenzae recovered from children with acute otitis media. Middle ear isolates (193 S. pneumoniae and 114 H. influenzae) received in the Spanish Reference Laboratory (Instituto de Salud Carlos III) were tested. Antimicrobial susceptibility to penicillin, amoxicillin with/without clavulanate, cefuroxime and cefditoren was determined by agar dilution using Mueller-Hinton agar supplemented with 5% sheep blood for S. pneumoniae and Haemophilus Test Medium for H. influenzae. Strains were classified according to penicillin susceptibility (S. pneumoniae) or beta-lactamase production (H. influenzae). The decrease in penicillin susceptibility of S. pneumoniae (from the susceptible to the resistant category) decreased amoxicillin and cefuroxime susceptibility rates from 100% to 34% and 0%, respectively. All pneumococcal strains were inhibited by 0.5 mg/L cefditoren, including those from penicillin-resistant serotypes 14, 23F, 6B and 9V with higher amoxicillin versus penicillin MICs. Susceptibility rates of beta-lactamase-positive H. influenzae strains were 93.8% and 85.4% to amoxicillin/clavulanate and cefuroxime, respectively. Resistance to amoxicillin/clavulanate (MIC>or=8/4 mg/L) was 12.1% (8 out of 66) and 6.3% (3 out of 48) in beta-lactamase-negative and -positive strains, respectively. All H. influenzae strains were inhibited by

  20. Exposure of a 23F Serotype Strain of Streptococcus pneumoniae to Cigarette Smoke Condensate Is Associated with Selective Upregulation of Genes Encoding the Two-Component Regulatory System 11 (TCS11

    Directory of Open Access Journals (Sweden)

    Riana Cockeran


    Full Text Available Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F to cigarette smoke condensate (160 μg/mL for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P<0.014–0.0006 upregulation of the genes encoding the two-component regulatory system 11 (TCS11, consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen.

  1. Contribución al estudio de los mecanismos moleculares de la resistencia a ciprofloxacina en "Streptococcus pneumoniae"


    Martínez Garriga, Blanca


    [spa] "Streptococcus pneumoniae", también llamado neumococo, es una bacteria Gram positiva caracterizada por la severidad de las infecciones que produce en la especie humana, siendo responsable de una elevada morbilidad y letalidad, especialmente en niños y ancianos, colectivos particularmente sensibles a sus consecuencias. La emergencia de cepas de S. pneumoniae resistentes a antibióticos como la penicilina y otros beta-lactámicos, comúnmente utilizados en el tratamiento de las infecciones n...

  2. Diversity of Streptococcus mutans strains in bacterial interspecies interactions. (United States)

    Li, Xiaolan; Hoogenkamp, Michel A; Ling, Junqi; Crielaard, Wim; Deng, Dong Mei


    Biofilms are matrix-enclosed microbial population adhere to each other and to surfaces. Compared to planktonic bacterial cells, biofilm cells show much higher levels of antimicrobial resistance. We aimed to investigate Streptococcus mutans strain diversity in biofilm formation and chlorhexidine (CHX) resistance of single S. mutans and dual S. mutans-Enterococcus faecalis biofilms. Four clinical S. mutans strains (C180-2, C67-1, HG723 and UA159) formed 24-h biofilms with or without an E. faecalis strain. These biofilms were treated for 10 min with 0.025% CHX. Biofilm formation, CHX resistance and S.mutans-E. faecalis interactions were evaluated by biomass staining, resazurin metabolism, viable count and competition agar assays. The main finding is that the presence of E. faecalis generally reduced all dual-species biofilm formation, but the proportions of S. mutans in the dual-species biofilms as well as CHX resistance displayed a clear S. mutans strain dependence. In particular, decreased resistance against CHX was observed in dual S. mutans C67-1 biofilms, while increased resistance was found in dual S. mutans UA159 biofilms. In conclusion, the interaction of S. mutans with E. faecalis in biofilms varies between strains, which underlines the importance of studying strain diversity in inter-species virulence modulation and biofilm antimicrobial resistance. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. The ParB-parS Chromosome Segregation System Modulates Competence Development in Streptococcus pneumoniae. (United States)

    Attaiech, Laetitia; Minnen, Anita; Kjos, Morten; Gruber, Stephan; Veening, Jan-Willem


    ParB proteins bind centromere-like DNA sequences called parS sites and are involved in plasmid and chromosome segregation in bacteria. We previously showed that the opportunistic human pathogen Streptococcus pneumoniae contains four parS sequences located close to the origin of replication which are bound by ParB. Using chromatin immunoprecipitation (ChIP), we found here that ParB spreads out from one of these parS sites, parS(-1.6°), for more than 5 kb and occupies the nearby comCDE operon, which drives competence development. Competence allows S. pneumoniae to take up DNA from its environment, thereby mediating horizontal gene transfer, and is also employed as a general stress response. Mutating parS(-1.6°) or deleting parB resulted in transcriptional up-regulation of comCDE and ssbB (a gene belonging to the competence regulon), demonstrating that ParB acts as a repressor of competence. However, genome-wide transcription analysis showed that ParB is not a global transcriptional regulator. Different factors, such as the composition of the growth medium and antibiotic-induced stress, can trigger the sensitive switch driving competence. This work shows that the ParB-parS chromosome segregation machinery also influences this developmental process. Streptococcus pneumoniae (pneumococcus) is an important human pathogen responsible for more than a million deaths each year. Like all other organisms, S. pneumoniae must be able to segregate its chromosomes properly. Not only is understanding the molecular mechanisms underlying chromosome segregation in S. pneumoniae therefore of fundamental importance, but also, this knowledge might offer new leads for ways to target this pathogen. Here, we identified a link between the pneumococcal chromosome segregation system and the competence-developmental system. Competence allows S. pneumoniae to take up and integrate exogenous DNA in its chromosome. This process plays a crucial role in successful adaptation to--and escape from

  4. [Economic cost of Streptococcus pneumoniae community-acquired pneumonia, meningitis and bacteremia in an adult population that required hospitalization in Bogotá, Colombia]. (United States)

    Calderón, Claudia; Dennis, Rodolfo


    Streptococcus pneumoniae infection in adults is related to pneumonia, meningitis and bacteremia. Its care costs in adults are not well documented in Colombia and it has a greater impact in people over 45 years old. The aims of this study were to analyze the associated costs of pneumonia, bacteremia and meningitis in invasive S. pneumoniae infection in Colombia among hospitalized adults and to estimate outpatient costs for community-acquired pneumonia. Additionally, we wanted to serve as a starting point for future economic evaluations. We performed a direct cost study associated with S. pneumoniae outpatient community-acquired pneumonia, bacteremia and meningitis costs confirmed by cultures. A cohort of hospitalized adults treated between January 2010 and June 2011 in three third level hospitals in Bogotá was analyzed. We evaluated 107 records and 60 bills charged to the payer. The data were classified according to care and treatment costs. We performed an estimate of direct costs for community-acquired pneumonia for outpatient cases through Delphi methodology using expert clinicians. The average direct costs associated with pneumococcal disease were US$ 6,283, US$ 3,886, and US$ 4,768 for pneumonia, meningitis and bacteremia, respectively (exchange rate 1 US$ = Col$ 1,938.34; average variation between 2010 and 2011). Pneumonia cases were 70% men and 30% women; the distribution for meningitis was the same for both genders (50%); and for bacteremia we had 67% men and 33% women. Outpatient cost of community-acquired pneumonia was estimated at US$ 82.2 ( Col $ 159,280 ) in adults. For special cases, direct cost increased to US$ 142 ( Col $ 274,427). The management of S. pneumoniae infection in people over 45 years old represents a high cost due to the use of drugs and hospitalization, which has a direct impact on health resources. Prevention and early treatment for pneumonia can reduce the cost and the burden of the disease.

  5. Role of polyamine transport in Streptococcus pneumoniae response to physiological stress and murine septicemia. (United States)

    Shah, Pratik; Romero, Damian G; Swiatlo, Edwin


    Streptococcus pneumoniae has a potential ABC-type transporter (Pot) for extracellular polyamines. Polyamine transport protein D (PotD) is a membrane-associated, surface protein that putatively binds polyamines such as putrescine and spermidine. In this study we used quantitative PCR (qPCR) to analyze potD mRNA expression under physiologically relevant stress conditions in vitro, during in vivo infection, and in the presence of polyamines and choline. Expression of potD mRNA was elevated 2- and 4-fold when cells were grown at either 34 or 42 degrees C, respectively, in a choline restricted environment. Expression increased by 5- and 11-fold in response to oxidative stress in either low or high choline environments, respectively. Putrescine led to an increase in potD mRNA transcription, while choline and spermidine resulted in decreased gene expression. Transcription of potD in pneumococci harvested from blood of systemically infected mice was 43-fold higher compared to in vitro transcription levels. Flow cytometry analysis using PotD antiserum confirmed increased PotD expression on the pneumococcal surface. These results indicate that polyamines and polyamine transport systems potentially play an important role in Streptococcus pneumoniae pathogenesis, and may be important for bacterial response to temperature shock, oxidative stress, choline limitation and in vivo growth.

  6. Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

    Directory of Open Access Journals (Sweden)

    Florry E van den Boogaard

    Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

  7. Influence of penicillin/amoxicillin non-susceptibility on the activity of third-generation cephalosporins against Streptococcus pneumoniae. (United States)

    Fenoll, A; Giménez, M J; Robledo, O; Aguilar, L; Tarragó, D; Granizo, J J; Martín-Herrero, J E


    To study the influence of penicillin/amoxicillin non-susceptibility on the activity of third-generation cephalosporins, 430 consecutive penicillin non-susceptible Streptococcus pneumoniae 2007 isolates received in the Spanish Reference Pneumococcal Laboratory were tested. For comparative purposes, 625 penicillin-susceptible 2007 isolates were also tested. Susceptibility was determined by agar dilution using Mueller-Hinton agar supplemented with 5% sheep blood. Penicillin-susceptible strains were susceptible to amoxicillin, cefotaxime and ceftriaxone, 99.8% to cefpodoxime and 99.5% to cefdinir, and were inhibited by 0.12 microg/ml of cefditoren and 4 microg/ml of cefixime. Penicillin-intermediate strains were susceptible to cefotaxime and ceftriaxone, with <50% susceptibility to cefdinir and cefpodoxime. The MIC(50) and MIC(90) values of cefditoren were 0.25 microg/ml and 0.5 microg/ml, respectively, whereas cefixime exhibited only marginal activity (MIC(90)=16 microg/ml). Penicillin-resistant strains were resistant to cefdinir and cefpodoxime, with 74.8% and 94.1% susceptibility to cefotaxime and ceftriaxone, respectively. Cefditoren MIC(50)/MIC(90) (0.5/1 microg/ml) were lower than cefotaxime and ceftriaxone. Among amoxicillin non-susceptible strains, susceptibility to cefdinir and cefpodoxime was <10%, and susceptibility to cefotaxime decreased from 87.9% in the intermediate category to 63.0% in the resistant group. Cefditoren MIC(50)/MIC(90) (0.5/1 microg/ml) were lower than cefotaxime. In conclusion, the activity of cefixime, cefdinir and cefpodoxime was highly affected by penicillin/amoxicillin non-susceptibility, while parenteral third-generation cephalosporins exhibited higher intrinsic activity (MIC(90)=1 microg/ml for penicillin-resistant and 2 microg/ml for amoxicillin-resistant strains). Cefditoren exhibited one-dilution lower MIC(90) values for these strains, even against those of the most troublesome serotypes.

  8. New Insights into Various Production Characteristics of Streptococcus thermophilus Strains. (United States)

    Cui, Yanhua; Xu, Tingting; Qu, Xiaojun; Hu, Tong; Jiang, Xu; Zhao, Chunyu


    Streptococcus thermophilus is one of the most valuable homo-fermentative lactic acid bacteria, which, for a long time, has been widely used as a starter for the production of fermented dairy products. The key production characteristics of S. thermophilus, for example the production of extracellular polysaccharide, proteolytic enzymes and flavor substances as well as acidifying capacity etc., have an important effect on the quality of dairy products. The acidification capacity of the strains determines the manufacturing time and quality of dairy products. It depends on the sugar utilization ability of strains. The production of extracellular polysaccharide is beneficial for improving the texture of dairy products. Flavor substances increase the acceptability of dairy products. The proteolytic activity of the strain influences not only the absorption of the nitrogen source, but also the formation of flavor substances. Different strains have obvious differences in production characteristics via long-time evolution and adaptation to environment. Gaining new strains with novel and desirable characteristics is an important long-term goal for researchers and the fermenting industry. The understanding of the potential molecular mechanisms behind important characteristics of different strains will promote the screening and breeding of excellent strains. In this paper, key technological and functional properties of different S. thermophilus strains are discussed, including sugar metabolism, proteolytic system and amino acid metabolism, and polysaccharide and flavor substance biosynthesis. At the same time, diversity of genomes and plasmids of S. thermophilus are presented. Advances in research on key production characteristics and molecular levels of S. thermophilus will increase understanding of molecular mechanisms of different strains with different important characteristics, and improve the industrialization control level for fermented foods.

  9. Detection and transmission of extracellular fac-tor producing Streptococcus suis serotype 2 strains in pigs

    NARCIS (Netherlands)

    Swildens, B.


    DETECTION AND TRANSMISSION OF EXTRACELLULAR FACTOR PRODUCING STREPTOCOCCUS SUIS SEROTYPE 2 STRAINS IN PIGS INTRODUCTION Streptococcus suis (S.suis) has been implicated in the etiology of many diseases among which meningitis in pigs. The virulent extracellular factor-positive strains of S.suis

  10. Antimicrobial and Antibiofilm Effects of Human Amniotic/Chorionic Membrane Extract on Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Mukesh K. Yadav


    Full Text Available Background:Streptococcus pneumoniae colonize the human nasopharynx in the form of biofilms. The biofilms act as bacterial reservoirs and planktonic bacteria from these biofilms can migrate to other sterile anatomical sites to cause pneumonia, otitis media (OM, bacteremia and meningitis. Human amniotic membrane contains numerous growth factors and antimicrobial activity; however, these have not been studied in detail. In this study, we prepared amniotic membrane extract and chorionic membrane extract (AME/CME and evaluated their antibacterial and antibiofilm activities against S. pneumoniae using an in vitro biofilm model and in vivo OM rat model.Materials and Methods: The AME/CME were prepared and protein was quantified using DCTM (detergent compatible method. The minimum inhibitory concentrations were determined using broth dilution method, and the synergistic effect of AME/CME with Penicillin-streptomycin was detected checkerboard. The in vitro biofilm and in vivo colonization of S. pneumoniae were studied using microtiter plate assay and OM rat model, respectively. The AME/CME-treated biofilms were examined using scanning electron microscope and confocal microscopy. To examine the constituents of AME/CME, we determined the proteins and peptides of AME/CME using tandem mass tag-based quantitative mass spectrometry.Results: AME/CME treatment significantly (p < 0.05 inhibited S. pneumoniae growth in planktonic form and in biofilms. Combined application of AME/CME and Penicillin-streptomycin solution had a synergistic effect against S. pneumoniae. Biofilms grown with AME/CME were thin, scattered, and unorganized. AME/CME effectively eradicated pre-established pneumococci biofilms and has a bactericidal effect. AME treatment significantly (p < 0.05 reduced bacterial colonization in the rat middle ear. The proteomics analysis revealed that the AME/CME contains hydrolase, ribonuclease, protease, and other antimicrobial proteins and peptides

  11. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. (United States)

    O'Brien, Katherine L; Wolfson, Lara J; Watt, James P; Henkle, Emily; Deloria-Knoll, Maria; McCall, Natalie; Lee, Ellen; Mulholland, Kim; Levine, Orin S; Cherian, Thomas


    Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. However, many countries lack national estimates of disease burden. Effective interventions are available, including pneumococcal conjugate vaccine and case management. To support local and global policy decisions on pneumococcal disease prevention and treatment, we estimated country-specific incidence of serious cases and deaths in children younger than 5 years. We measured the burden of pneumococcal pneumonia by applying the proportion of pneumonia cases caused by S pneumoniae derived from efficacy estimates from vaccine trials to WHO country-specific estimates of all-cause pneumonia cases and deaths. We also estimated burden of meningitis and non-pneumonia, non-meningitis invasive disease using disease incidence and case-fatality data from a systematic literature review. When high-quality data were available from a country, these were used for national estimates. Otherwise, estimates were based on data from neighbouring countries with similar child mortality. Estimates were adjusted for HIV prevalence and access to care and, when applicable, use of vaccine against Haemophilus influenzae type b. In 2000, about 14.5 million episodes of serious pneumococcal disease (uncertainty range 11.1-18.0 million) were estimated to occur. Pneumococcal disease caused about 826,000 deaths (582,000-926,000) in children aged 1-59 months, of which 91,000 (63,000-102,000) were in HIV-positive and 735,000 (519,000-825,000) in HIV-negative children. Of the deaths in HIV-negative children, over 61% (449,000 [316,000-501,000]) occurred in ten African and Asian countries. S pneumoniae causes around 11% (8-12%) of all deaths in children aged 1-59 months (excluding pneumococcal deaths in HIV-positive children). Achievement of the UN Millennium Development Goal 4 for child mortality reduction can be accelerated by prevention and treatment of pneumococcal disease, especially in

  12. Respiratory Syncytial Virus Increases the Virulence of Streptococcus pneumoniae by Binding to Penicillin Binding Protein 1a A New Paradigm in Respiratory Infection

    NARCIS (Netherlands)

    Smith, Claire M.; Sandrini, Sara; Datta, Sumit; Freestone, Primrose; Shafeeq, Sulman; Radhakrishnan, Priya; Williams, Gwyneth; Glenn, Sarah M.; Kuipers, Oscar P.; Hirst, Robert A.; Easton, Andrew J.; Andrew, Peter W.; O'Callaghan, Christopher


    Rationale: Respiratory syncytial virus (RSV) and Streptococcus pneumoniae are major respiratory pathogens. Coinfection with RSV and S. pneumoniae is associated with severe and often fatal pneumonia but the molecular basis for this remains unclear. ObjeOtives: Todetermine if interaction between RSV

  13. Genotyping and serotyping of macrolide and multidrug resistant Streptococcus pneumoniae isolated from carrier children

    Directory of Open Access Journals (Sweden)

    S F Swedan


    Full Text Available Aims: Streptococcus pneumoniae, an opportunistic pathogen commonly carried asymptomatically in the nasopharynx of children, is associated with increasing rates of treatment failures due to a worldwide increase in drug resistance. We investigated the carriage of S. pneumoniae in children 5 years or younger, the identity of prevalent serotypes, the rates of resistance to macrolides and other antimicrobial agents and the genotypes responsible for macrolide resistance. Materials and Methods: Nasopharyngeal swabs were collected from 157 children under 5 years for cultural isolation of S. pneumoniae. Antibiogram of isolates  was determined using the disk diffusion test, and the minimal inhibitory concentration to macrolides was determined using the E-test. Isolate serotypes and macrolide resistance genes, erm(B and mef(E, were identified using multiplex polymerase chain reactions. Results: S. pneumoniae was recovered from 33.8% of children; 41.9% among males and 21.9% among females (P = 0.009. The highest carriage rate occurred among age groups 7-12 months and 49-60 months. Most frequent serotypes were 19F, 6A/B, 11A, 19A, 14 and 15B/C.  Resistance to macrolides was 60.4%. Resistance to oxacillin, trimethoprim/sulfamethoxazole and clindamycin was present among 90.6%, 54.7% and 32.1% of isolates, respectively. All isolates were susceptible to chloramphenicol, levofloxacin and vancomycin. Isolates resistant to one or more macrolide drugs were more likely to be multidrug resistant. Resistance to clindamycin or oxacillin coexisted with macrolide resistance. Among the erythromycin-resistant isolates, erm(B, mef(E and erm(B and mef(E genes were present at rates of 43.8%, 37.5% and 6.3%, respectively. Erm(B and mef(E were associated with very high level and moderate-to-high level resistance to macrolides, respectively. Conclusion: A significant proportion of children harboured macrolide and multidrug-resistant S. pneumoniae.

  14. Mutant prevention concentration of tigecycline for clinical isolates of Streptococcus pneumoniae and Staphylococcus aureus. (United States)

    Hesje, C K; Drlica, K; Blondeau, J M


    The mutant prevention concentration (MPC) reflects the antimicrobial susceptibility of the resistant mutant subpopulations present in large bacterial populations. In principle, combining the MPC with pharmacokinetic measurements can guide treatment to restrict the enrichment of resistant subpopulations, just as the MIC is used with pharmacokinetics to restrict the growth of bulk, susceptible populations. Little is known about the MPC of tigecycline, one of the more recently approved antimicrobials. Tigecycline is particularly interesting because it shows good activity against Gram-positive pathogens. MPCs were determined using tigecycline-containing agar plates for clinical isolates of Streptococcus pneumoniae (n=47), MRSA (n=50) and MSSA (n=50). Trypticase soy agar containing sheep red blood cells, commonly used for the growth of S. pneumoniae, gave tigecycline MPC90 values that were two orders of magnitude higher than expected. The addition of agar to Todd-Hewitt broth (solidified Todd-Hewitt broth) allowed the high-density growth of S. pneumoniae in the absence of red blood cells and lowered the MPC90 of tigecycline by 100-fold to 0.5 mg/L. The addition of red blood cells to solidified Todd-Hewitt broth raised the MPC90 by 100-fold. Thus, red blood cells reduce the efficacy of tigecycline against S. pneumoniae. The growth of Staphylococcus aureus was not sensitive to red blood cells; values of MPC90 were 2 and 4 mg/L for MSSA and MRSA, respectively. Values of MPC constitute a concentration threshold for restricting the emergence of tigecycline resistance that can now be used in animal studies to determine pharmacodynamic thresholds. The off-label treatment of S. pneumoniae blood infections with tigecycline may require caution due to blood-cell-mediated interference with the antimicrobial. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e

  15. Streptococcus pneumoniae from Palestinian nasopharyngeal carriers: serotype distribution and antimicrobial resistance.

    Directory of Open Access Journals (Sweden)

    Abedelmajeed Nasereddin

    Full Text Available Infections of Streptococcus pneumoniae in children can be prevented by vaccination; left untreated, they cause high morbidity and fatalities. This study aimed at determining the nasopharyngeal carrier rates, serotype distribution and antimicrobial resistance patterns of S. pneumoniae in healthy Palestinian children under age two prior to the full introduction of the pneumococcal 7-valent conjugate vaccine (PCV7, which was originally introduced into Palestine in a pilot trial in September, 2010. In a cross sectional study, nasopharyngeal specimens were collected from 397 healthy children from different Palestinian districts between the beginning of November 2012 to the end of January 2013. Samples were inoculated into blood agar and suspected colonies were examined by amplifying the pneumococcal-specific autolysin gene using a real-time PCR. Serotypes were identified by a PCR that incorporated different sets of specific primers. Antimicrobial susceptibility was measured by disk diffusion and MIC methods. The resulting carrier rate of Streptococcus pneumoniae was 55.7% (221/397. The main serotypes were PCV7 serotypes 19F (12.2%, 23F (9.0%, 6B (8.6% and 14 (4% and PCV13 serotypes 6A (13.6% and 19A (4.1%. Notably, serotype 6A, not included in the pilot trial (PCV7 vaccine, was the most prevalent. Resistance to more than two drugs was observed for bacteria from 34.1% of the children (72/211 while 22.3% (47/211 carried bacteria were susceptible to all tested antibiotics. All the isolates were sensitive to cefotaxime and vancomycin. Any or all of these might impinge on the type and efficacy of the pneumococcal conjugate vaccines and antibiotics to be used for prevention and treatment of pneumococcal disease in the country.

  16. Generic and Specific Adaptive Responses of Streptococcus pneumoniae to Challenge with Three Distinct Antimicrobial Peptides, Bacitracin, LL-37, and Nisin

    NARCIS (Netherlands)

    Majchrzykiewicz, Joanna A.; Kuipers, Oscar P.; Bijlsma, Jetta J.E.

    To investigate the response of Streptococcus pneumoniae to three distinct antimicrobial peptides (AMPs), bacitracin, nisin, and LL-37, transcriptome analysis of challenged bacteria was performed. Only a limited number of genes were found to be up- or downregulated in all cases. Several of these

  17. Contributions of capsule, lipoproteins and duration of colonisation towards the protective immunity of prior Streptococcus pneumoniae nasopharyngeal colonisation


    Jonathan M Cohen; Chimalapati, Suneeta; Vogel, Corné; van Belkum, Alex; Baxendale, Helen E.; Brown, Jeremy S.


    Live attenuated vaccines have been proposed as a strategy to induce protective immunity against infectious diseases. Recent data have demonstrated that nasopharyngeal colonisation with Streptococcus pneumoniae induces protective immunity against subsequent invasive infection, suggesting nasal vaccination with live attenuated bacteria could be a preventative strategy. However the bacterial factors affecting the strength of this adaptive immune response remain unclear. In a direct comparison wi...

  18. Evaluation of CLSI agar dilution method and Trek Sensititre broth microdilution panel for determining antimicrobial susceptibility of Streptococcus pneumoniae. (United States)

    Zhang, Sean X; Rawte, Prasad; Brown, Shirley; Lo, Steven; Siebert, Heather; Pong-Porter, Sylvia; Low, Donald E; Jamieson, Frances B


    Both the CLSI agar dilution method and Trek Sensititre broth microdilution panel for Streptococcus pneumoniae antimicrobial susceptibility testing were evaluated against the reference CLSI broth microdilution method using the most recently published CLSI breakpoints. While agar dilution was not an optimal method, the commercial panel appeared to be an acceptable method, with minor errors encountered for ceftriaxone, penicillin, and meropenem.

  19. LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

    Czech Academy of Sciences Publication Activity Database

    Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel


    Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

  20. Pharmacodynamics of RWJ-54428 against Staphylococcus aureus, Streptococcus pneumoniae, and Enterococcus faecalis in a neutropenic mouse thigh infection model. (United States)

    Griffith, David C; Rodriguez, David; Corcoran, Erik; Dudley, Michael N


    RWJ-54428 (also known as MC-02,479) is a new cephalosporin with promising activity against gram-positive bacteria. The pharmacodynamics (PDs) of RWJ-54428 against Staphylococcus aureus, Streptococcus pneumoniae, and Enterococcus faecalis were studied in a neutropenic mouse thigh infection model. The RWJ-54428 MICs ranged from 0.25 to 1 mg/liter. Mice with ca. 10(6) CFU/thigh at the initiation of therapy were treated intraperitoneally with RWJ-54428 at doses that ranged from 3 to 1,200 mg/kg of body weight/day (in 2, 3, 4, 6, or 12 divided doses) for 24 h. The maximal reductions in bacterial counts in thigh tissues at 24 h for the methicillin-resistant S. aureus, penicillin-resistant S. pneumoniae, and E. faecalis strains were -2.8, -3.8, and -1.7 log10 CFU/thigh, respectively. The percentage of a 24-h dosing interval that the unbound serum RWJ-54428 concentrations exceeded the MIC (fT>MIC) was the pharmacokinetic (PK)-PD parameter that best described the efficacy of RWJ-54428. The fT>MICs for a bacteriostatic effect (no net change in the numbers of CFU/thigh over 24 h) ranged from 14 to 20% for staphylococci and streptococci; for maximal reductions in the numbers of CFU/thigh, the fT>MICs ranged from 22 to 36% for these strains. For E. faecalis, the ranges of fT>MICs for static and maximal effects were 30 to 46% and 55 to 60%, respectively. These data show that treatment with RWJ-54428 results in marked antibacterial effects in vivo, with the PK-PD parameters for efficacy being comparable to those for the efficacy of penicillins and carbapenems active against staphylococci and pneumococci.

  1. Identification of a human immunodominant B-cell epitope within the immunoglobulin A1 protease of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Felici Franco


    Full Text Available Abstract Background The IgA1 protease of Streptococcus pneumoniae is a proteolytic enzyme that specifically cleaves the hinge regions of human IgA1, which dominates most mucosal surfaces and is the major IgA isotype in serum. This protease is expressed in all of the known pneumococcal strains and plays a major role in pathogen's resistance to the host immune response. The present work was focused at identifying the immunodominant regions of pneumococcal IgA1 protease recognized by the human antibody response. Results An antigenic sequence corresponding to amino acids 420–457 (epiA of the iga gene product was identified by screening a pneumococcal phage display library with patients' sera. The epiA peptide is conserved in all pneumococci and in two out of three S. mitis strains, while it is not present in other oral streptococci so far sequenced. This epitope was specifically recognized by antibodies present in sera from 90% of healthy adults, thus representing an important target of the humoral response to S. pneumoniae and S. mitis infection. Moreover, sera from 68% of children less than 4 years old reacted with the epiA peptide, indicating that the human immune response against streptococcal antigens occurs during childhood. Conclusion The broad and specific recognition of the epiA polypeptide by human sera demonstrate that the pneumococcal IgA1 protease contains an immunodominant B-cell epitope. The use of phage display libraries to identify microbe or disease-specific antigens recognized by human sera is a valuable approach to epitope discovery.

  2. Characteristics and Outcome of Streptococcus pneumoniae Endocarditis in the XXI Century (United States)

    de Egea, Viviana; Muñoz, Patricia; Valerio, Maricela; de Alarcón, Arístides; Lepe, José Antonio; Miró, José M.; Gálvez-Acebal, Juan; García-Pavía, Pablo; Navas, Enrique; Goenaga, Miguel Angel; Fariñas, María Carmen; Vázquez, Elisa García; Marín, Mercedes; Bouza, Emilio


    Abstract Streptococcus pneumoniae is an infrequent cause of severe infectious endocarditis (IE). The aim of our study was to describe the epidemiology, clinical and microbiological characteristics, and outcome of a series of cases of S. pneumoniae IE diagnosed in Spain and in a series of cases published since 2000 in the medical literature. We prospectively collected all cases of IE diagnosed in a multicenter cohort of patients from 27 Spanish hospitals (n = 2539). We also performed a systematic review of the literature since 2000 and retrieved all cases with complete clinical data using a pre-established protocol. Predictors of mortality were identified using a logistic regression model. We collected 111 cases of pneumococcal IE: 24 patients from the Spanish cohort and 87 cases from the literature review. Median age was 51 years, and 23 patients (20.7%) were under 15 years. Men accounted for 64% of patients, and infection was community-acquired in 96.4% of cases. The most important underlying conditions were liver disease (27.9%) and immunosuppression (10.8%). A predisposing heart condition was present in only 18 patients (16.2%). Pneumococcal IE affected a native valve in 93.7% of patients. Left-sided endocarditis predominated (aortic valve 53.2% and mitral valve 40.5%). The microbiological diagnosis was obtained from blood cultures in 84.7% of cases. In the Spanish cohort, nonsusceptibility to penicillin was detected in 4.2%. The most common clinical manifestations included fever (71.2%), a new heart murmur (55%), pneumonia (45.9%), meningitis (40.5%), and Austrian syndrome (26.1%). Cardiac surgery was performed in 47.7% of patients. The in-hospital mortality rate was 20.7%. The multivariate analysis revealed the independent risk factors for mortality to be meningitis (OR, 4.3; 95% CI, 1.4–12.9; P < 0.01). Valve surgery was protective (OR, 0.1; 95% CI, 0.04–0.4; P < 0.01). Streptococcus pneumoniae IE is a community-acquired disease that mainly

  3. Induction of prophages by fluoroquinolones in Streptococcus pneumoniae: implications for emergence of resistance in genetically-related clones.

    Directory of Open Access Journals (Sweden)

    Elena López

    Full Text Available Antibiotic resistance in Streptococcus pneumoniae has increased worldwide by the spread of a few clones. Fluoroquinolone resistance occurs mainly by alteration of their intracellular targets, the type II DNA topoisomerases, which is acquired either by point mutation or by recombination. Increase in fluoroquinolone-resistance may depend on the balance between antibiotic consumption and the cost that resistance imposes to bacterial fitness. In addition, pneumococcal prophages could play an important role. Prophage induction by fluoroquinolones was confirmed in 4 clinical isolates by using Southern blot hybridization. Clinical isolates (105 fluoroquinolone-resistant and 160 fluoroquinolone-susceptible were tested for lysogeny by using a PCR assay and functional prophage carriage was studied by mitomycin C induction. Fluoroquinolone-resistant strains harbored fewer inducible prophages (17/43 than fluoroquinolone-susceptible strains (49/70 (P = 0.0018. In addition, isolates of clones associated with fluoroquinolone resistance [CC156 (3/25; CC63 (2/20, and CC81 (1/19], had lower frequency of functional prophages than isolates of clones with low incidence of fluoroquinolone resistance [CC30 (4/21, CC230 (5/20, CC62 (9/21, and CC180 (21/30]. Likewise, persistent strains from patients with chronic respiratory diseases subjected to fluoroquinolone treatment had a low frequency of inducible prophages (1/11. Development of ciprofloxacin resistance was tested with two isogenic strains, one lysogenic and the other non-lysogenic: emergence of resistance was only observed in the non-lysogenic strain. These results are compatible with the lysis of lysogenic isolates receiving fluoroquinolones before the development of resistance and explain the inverse relation between presence of inducible prophages and fluoroquinolone-resistance.

  4. Control of transcription elongation by GreA determines rate of gene expression in Streptococcus pneumoniae. (United States)

    Yuzenkova, Yulia; Gamba, Pamela; Herber, Martijn; Attaiech, Laetitia; Shafeeq, Sulman; Kuipers, Oscar P; Klumpp, Stefan; Zenkin, Nikolay; Veening, Jan-Willem


    Transcription by RNA polymerase may be interrupted by pauses caused by backtracking or misincorporation that can be resolved by the conserved bacterial Gre-factors. However, the consequences of such pausing in the living cell remain obscure. Here, we developed molecular biology and transcriptome sequencing tools in the human pathogen Streptococcus pneumoniae and provide evidence that transcription elongation is rate-limiting on highly expressed genes. Our results suggest that transcription elongation may be a highly regulated step of gene expression in S. pneumoniae. Regulation is accomplished via long-living elongation pauses and their resolution by elongation factor GreA. Interestingly, mathematical modeling indicates that long-living pauses cause queuing of RNA polymerases, which results in 'transcription traffic jams' on the gene and thus blocks its expression. Together, our results suggest that long-living pauses and RNA polymerase queues caused by them are a major problem on highly expressed genes and are detrimental for cell viability. The major and possibly sole function of GreA in S. pneumoniae is to prevent formation of backtracked elongation complexes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease. (United States)

    Pichavant, Muriel; Sharan, Riti; Le Rouzic, Olivier; Olivier, Cécile; Hennegrave, Florence; Rémy, Gaëlle; Pérez-Cruz, Magdiel; Koné, Bachirou; Gosset, Pierre; Just, Nicolas; Gosset, Philippe


    Progression of chronic obstructive pulmonary disease (COPD) is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS) and to stimulate peripheral blood mononuclear cells (PBMC) from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

  6. Efficacy of clarithromycin against Streptococcus pneumoniae expressing mef(A)-mediated resistance. (United States)

    Maglio, Dana; Capitano, Blair; Banevicius, Mary Anne; Tessier, Pamela R; Nightingale, Charles H; Nicolau, David P


    As a result of macrolide resistance rates of 25% for pneumococci in the US, the clinical use of this class as empirical therapy has been questioned. However, macrolides continue to be used with clinical success. Using an immunocompromised murine pneumonia model, this study evaluated in vivo efficacy of human simulated exposures of clarithromycin for 62 isolates of Streptococcus pneumoniae considered resistant by current methods of breakpoint determinations. Changes in bacterial density were compared between treated animals and untreated controls. Inhibition of bacterial growth was consistently observed for the majority of isolates tested with mean (S.D.) reductions in logCFU per lung of -0.88 (0.69), -1.02 (0.87), -0.47 (0.79), -0.84 (0.66), -0.25 (0.26), -0.80 (0.72) and -0.58 (0.47) for MICs of 1, 2, 4, 8, 16, 32 and 64 mg/l, respectively. A beneficial treatment effect was clearly noted for isolates with clarithromycin MICs <==8 mg/l. However, the sample size of isolates tested beyond the MIC of 8 mg/l was diminished due to mortality in both treated and untreated animals. Consistent suppression of bacterial growth observed in this neutropenic model provides support for the in vivo efficacy of clarithromycin with low-level macrolide-resistant S. pneumoniae.

  7. Characterization of Spbhp-37, a haemoglobin-binding protein of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    María Elena eRomero-Espejel


    Full Text Available Streptococcus pneumoniae is a Gram-positive microorganism that is the cause of bacterial pneumonia, sinusitis and otitis media. This human pathogen also can cause invasive diseases such as meningitis, bacteremia and septicemia. Haemoglobin (Hb and haem can support the growth and viability of S. pneumoniae as sole iron sources. Unfortunately, the acquisition mechanism of Hb and haem in this bacterium has been poorly studied. Previously we identified two proteins of 37 and 22 kDa as putative Hb- and haem-binding proteins (Spbhp-37 and Spbhp-22, respectively. The sequence of Spbhp-37 protein was database annotated as lipoprotein without any function or localization. Here it was immunolocalized in the surface cell by transmission electron microscopy using specific antibodies produced against the recombinant protein. The expression of Spbhp-37 was increased when bacteria were grown in media culture supplied with Hb. In addition, the affinity of Sphbp-37 for Hb was determined. Thus, in this work we are presenting new findings that attempt to explain the mechanism involved in iron acquisition of this pathogen. In the future these results could help to develop new therapy targets in order to avoid the secondary effects caused by the traditional therapies.

  8. Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Sandra M Carvalho

    Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

  9. Nasopharyngeal colonization with Streptococcus pneumoniae triggers dendritic cell dependent antibody responses against invasive disease in mice. (United States)

    Dommaschk, Anne; Ding, Nadine; Tort Tarres, Meritxell; Bittersohl, Lara F; Maus, Regina; Stolper, Jennifer; Jonigk, Danny; Braubach, Peter; Lippmann, Torsten; Welte, Tobias; Maus, Ulrich A


    Nasopharyngeal colonization with Streptococcus pneumoniae (Spn) is an important precondition for the development of pneumococcal pneumonia. At the same time, nasopharyngeal colonization with Spn has been shown to mount adaptive immune responses against Spn in mice and humans. Cellular responses of the nasopharyngeal compartment, including the nasal-associated lymphoid tissue, to pneumococcal colonization and their importance for developing adaptive immune responses are poorly defined. We show that nasopharyngeal colonization with S. pneumoniae led to substantial expansion of dendritic cells (DCs) both in nasopharyngeal tissue and nasal-associated lymphoid tissue of mice. Depletion of DCs achieved by either diphtheria toxin (DT) treatment of chimeric zDC+/DTR mice, or by use of FMS-like tyrosine kinase 3 ligand (Flt3L) KO mice exhibiting congenitally reduced DC pool sizes, significantly diminished antibody responses after colonization with Spn, along with impaired protective immunity against invasive pneumococcal disease. Collectively, the data show that classical DCs contribute to pneumococcal colonization induced adaptive immune responses against invasive pneumococcal disease in two different mouse models. These data may be useful for future nasopharyngeal vaccination strategies against pneumococcal diseases in humans. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. [Description of 3 cases of skin and soft tissue infections caused by Streptococcus pneumoniae]. (United States)

    Martínez, Mónica Elisabeth; Grenón, Sandra Liliana; López, Oscar Herminio; Leguizamón, Lorena Beatriz; Mollerach, Marta Eugenia; von Specht, Martha Helena

    The role of Streptococcus pneumoniae as a causative agent of skin and soft tissue infections (SSTI) is unusual and its clinical interpretation is difficult. We describe here three cases of SSTI due to S. pneumoniae in patients admitted to the Provincial Pediatric Hospital of Misiones, Argentina that were detected during 10 years of invasive disease (ID) surveillance documented in 2010, 2011 and 2015. These cases involved two girls aged 8 and 7 months old, and a two-year-old male child with diagnoses of gluteal abscess, preseptal cellulites and pyoderma respectively. All the patients were eutrophic and in good general condition on admission; one of them was seropositive for HIV. Antimicrobial susceptibility and serotypes were framed within the local epidemiology of invasive pneumococcal disease. Despite its low frequency, S. pneumoniae as an etiological agent of SSTI must be considered. Our findings revalue the role of the diagnostic laboratory and contribute to document the behavior of this pathogen. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Inhibition activity of wild berry juice fractions against Streptococcus pneumoniae binding to human bronchial cells. (United States)

    Huttunen, Sanna; Toivanen, Marko; Arkko, Satu; Ruponen, Marika; Tikkanen-Kaukanen, Carina


    Bacterial adhesion to the cell surface is a crucial step before infection can take place. Inhibition of bacterial binding offers a novel preventive approach against infections. Cranberry (Vaccinium macrocarpon Ait.) juice has been found to have antiadhesive activity against different bacteria. Streptococcus pneumoniae is an important pathogen and the most common cause for pneumonia, meningitis, and otitis media. In this study the inhibitory activity of cranberry (Vaccinium oxycoccos L.), bilberry (Vaccinium myrtillus L.) and crowberry (Empetrum nigrum and Empetrum hermaphroditum L.) juice fractions against pneumococcal binding was tested using human bronchial cells (Calu-3) as an adhesion model. In addition, the antimicrobial activity of the berry juice fractions was tested. It was found that the studied berry juice fractions had antiadhesion activity and cranberry juice was the most active. The adhesion inhibition activity of cranberry juice was nearly 90% at a concentration of 8.7 mg/g of soluble solids. The antimicrobial activity of the studied berry juice fractions was found to be remarkable; pneumococcal growth was inhibited totally at a concentration of ∼86 mg/g. Both antiadhesion and antimicrobial activities were reduced after solid-phase extraction of the berry juices, which may suggest molecular synergistic effects of the berry juice molecules against S. pneumoniae. The findings indicate that cranberry, bilberry and crowberry juices have potential against pneumococcal infections. Copyright © 2010 John Wiley & Sons, Ltd.

  12. Molecular analyses of glucosyltransferase genes among strains of Streptococcus mutans. (United States)

    Fujiwara, T; Terao, Y; Hoshino, T; Kawabata, S; Ooshima, T; Sobue, S; Kimura, S; Hamada, S


    Three glucosyltransferase (GTase) genes (gtfB, gtfC and gtfD) were cloned and sequenced from clinically isolated strains of Streptococcus mutans MT8148 (serotype c), MT4239 (c), MT4245 (e), MT4467 (e) and MT4251 (f), respectively. Comparison of the gtf genes revealed that interstrain difference of gtfB and gtfD was limited, while gtfC showed significant interstrain variations. Similar to gtfB and gtfD, gtfC possessed five direct repeats composed of homologous unit in the carboxyl-terminal portion. The repeating unit consisted of 63-65 amino acid residues and is responsible for glucan binding. The gtfC gene from S. mutans MT4245 lacked the fourth unit. Multiple alignment with the gtf sequence of strain GS-5 (c) revealed several changes in these gtf genes due to frameshift mutations. The peptides encoded by the gtfB, gtfC and gtfD genes of GS-5 were 1, 80, and 32 amino acid residues shorter than those of the test strains except strain MT4245.

  13. Decreased NLRP3 inflammasome expression in aged lung may contribute to increased susceptibility to secondary Streptococcus pneumoniae infection. (United States)

    Cho, Soo Jung; Plataki, Maria; Mitzel, Dana; Lowry, Gena; Rooney, Kristen; Stout-Delgado, Heather


    Post-viral pneumococcal pneumonia is a leading morbidity and mortality in older patients (≥65years of age). The goal of our current study is to understand the impact of chronological aging on innate immune responses to a secondary, post viral infection with Streptococcus pneumoniae, a causative agent of bacterial pneumonia. Using aged murine models of infection, our findings demonstrate increased morbidity and mortality in aged mice within 48h post-secondary S. pneumoniae infection. Increased susceptibility of aged mice was associated with decreased TLR1, TLR6, and TLR9 mRNA expression and diminished IL1β mRNA expression. Examination of NLRP3 inflammasome expression illustrated decreased NLRP3 mRNA expression and decreased IL1β production in aged lung in response to secondary S. pneumoniae infection. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Production of bacteriocins by Streptococcus bovis strains from Australian ruminants. (United States)

    Joachimsthal, E L; Reeves, R K H; Hung, J; Nielsen, L K; Ouwerkerk, D; Klieve, A V; Vickers, C E


    To examine the prevalence of bacteriocin production in Streptococcus bovis isolates from Australian ruminants and the feasibility of industrial production of bacteriocin. Streptococcus bovis strains were tested for production of bacteriocin-like inhibitory substances (BLIS) by antagonism assay against Lactococcus lactis. BLIS production was associated with source animal location (i.e. proximity of other bacteriocin-positive source animals) rather than ruminant species/breed or diet. One bacteriocin showing strong inhibitory activity (Sb15) was isolated and examined. Protein sequence, stability and activity spectrum of this bovicin were very similar to bovicin HC5. Production could be increased through serial culturing, and increased productivity could be partially maintained during cold storage of cultures. BLIS production is geographically widely distributed in Eastern Australia, and it appears that the bacteriocin(+) trait is maintained in animals at the same location. The HC5-like bacteriocin, originally identified in North America, is also found in Australia. Production of bacteriocin can be increased through serial culturing. The HC5-like bacteriocins appear to have a broad global distribution. Serial culturing may provide a route towards commercial manufacturing for use in industrial applications, and purified bacteriocin from S. bovis Sb15 could potentially be used to prevent food spoilage or as a feed additive to promote growth in ruminant species.

  15. Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

    Directory of Open Access Journals (Sweden)

    Lêda Lúcia M. Ferreira


    ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

  16. Aspectos Clínicos y neuroinmunológicos de la meningoencefalitis por Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Raisa Bu-Coifiu


    Full Text Available Después de exitosas campañas de vacunación contra Neisseria meningitidis y Haemophilus influenzae hubo un aumento de casos de meningoencefalitis por Streptococcus pneumoniae. Con el objetivo de describir las características clínicas, los hallazgos de laboratorio y las complicaciones encontradas a un grupo de pacientes que sufrieron de esta enfermedad entre 1993 y 2006, evaluar el estado de la barrera sangre-líquido cefalorraquídeo (LCR y el patrón de respuesta de síntesis intratecal de inmunoglobulinas a través del reibergrama, se estudiaron 12 niños con meningoencefalitis por Streptococcus pneumoniae que ingresaron en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana, en ese periodo. Se dosificaron albúmina IgA, IgM e IgG y sus subclases por inmunodifusión radial en suero y líquido cefalorraquídeo. La edad más frecuente resultó la menor de un año. Las mayores complicaciones fueron: shock séptico y edema cerebral. Hubo tres pacientes fallecidos. Los patrones de las tres clases mayores de inmunoglobulinas aparecieron en el 33% del total. Los dos patrones de subclases de IgG más IgM tuvieron en común la disfunción de la barrera sangre-líquido cefalorraquídeo. La respuesta inmune intratecal en los pacientes con meningoencefalitis por Streptococcus pneumoniae tiene características distintivas que lo diferencian de otras meningoencefalitis de origen bacteriano por lo que en su conjunto podrían ser elementos a ser tomados en cuenta para auxiliar al médico en su diagnóstico diferencial y en la táctica para una vacuna cubana.

  17. Streptococcus pneumoniae

    African Journals Online (AJOL)

    vaccine. There are at least 90 immunologically distinct capsular serotypes in 21 numbered serogroups, each containing 2 - 5 related serotypes, with a total of 65 such serotypes, and another .... active) drug concentration in plasma over time relative to the ... have been established at £2 pig / ml for parenteral penicillin G.

  18. [Detection and Serotyping of Streptococcus pneumoniae Carried in Healthy Adults with a Modified PCR Method]. (United States)

    Ishihara, Yuka; Okamoto, Akira; Ohta, Michio


    Detection of Streptococcus pneumoniae colonized in the pharynx of healthy carriers currently relies on conventional culture methods of direct plating with pharyngeal swab specimens. The accurate measurement of the carriage of pneumococci, however, has not been necessarily achieved with these methods due to low density colonization and contamination of numerous oral streptococci that express α-hemolysis. A PCR-based detection method of pneumococci-specific for lytA as well as PCR serotyping of S. pneumoniae was recently developed and their effectiveness was confirmed. We modified the reaction conditions of these methods to improve the detection rate and applied them to the measurement of S. pneumoniae carried in healthy adults. Pharyngeal swab specimens obtained from 110 healthy volunteers over 40 and living in Nagoya were enriched for 5 hours with broth medium supplemented with rabbit serum and the template DNA for PCR was extracted from the mixed enriched culture. Of 110 specimens 36 (32.7%) were lytA-positive, the rate of which was much higher than the results of previous culture-based studies. The DNA template preparations were then used for PCR-based serotyping with primers specific for each of the types included in pneumococcal 23 valent vaccine (PPV23). We found that 28 out of 36 lytA-positive carriers were identified as being positive for the serotypes belonging to PPV23, although serotypes 6A and 6B were indistinguishable with the PCR method. The most frequent serotype was serotype 14, and serotypes 4, 18C, and 6A/B were also frequently identified. Five lytA-positive carriers were previously vaccinated with PPV23, and among them, 4 were positive for serotypes contained in PPV23. We recommend PCR-based identification and serotyping of S. pneumoniae in broth enrichment culture of pharyngeal swab specimens as a reliable method for the surveillance of healthy carriers with low density colonization.

  19. Bacterial bronchitis caused by Streptococcus pneumoniae and nontypable Haemophilus influenzae in children: the impact of vaccination. (United States)

    Priftis, Kostas N; Litt, David; Manglani, Sapna; Anthracopoulos, Michael B; Thickett, Keith; Tzanakaki, Georgina; Fenton, Patricia; Syrogiannopoulos, George A; Vogiatzi, Aliki; Douros, Konstantinos; Slack, Mary; Everard, Mark L


    Protracted bacterial bronchitis is a major cause of persistent cough in childhood. The organisms most commonly isolated are nontypable Haemophilus influenzae and Streptococcus pneumoniae . There are no studies addressing typing of these organisms when recovered from the lower airways. Isolates of these two organisms (identified in BAL samples from children undergoing routine investigation of a chronic cough thought to be attributable to a protracted bacterial bronchitis) were subject to typing. Samples were collected in Sheffield, England, and Athens, Greece. The majority of the children from Sheffield had received pneumococcal-conjugate vaccines 7 or 13 (PCV-7 or PCV-13) conjugate vaccine but only a minority of Greek children had received PCV-7. All 18 S pneumoniae isolates from Greek BAL samples are serotypes contained in PCV-13 while 10 are contained in PCV-7. In contrast, 28 of the 39 samples from Sheffield contained serotypes that are not included in PCV-13. All 26 of the nontypable H influenzae samples obtained in Sheffield produced distinct multilocus variable-number tandem repeat analysis profiles. There was a significant difference between children from Athens and Sheffield in the distribution of serotypes contained or not contained in the pneumococcal vaccine ( P = .04). More specifically, immunization with pneumococcal vaccine was related with isolation of S pneumoniae serotypes not included in the vaccine (OR, 0.021; CI, 0.003-0.115; P < .001). The data suggest that both vaccine and nonvaccine S pneumoniae serotypes may play a role in protracted bacterial bronchitis and provide some hints that serotype replacement may occur in response to the introduction of conjugate vaccines.

  20. Mechanistic exploration of AhR-mediated host protection against Streptococcus pneumoniae infection. (United States)

    Wang, Tao; Wyrick, Katherine L; Pecka, Melanie R; Wills, Tamara B; Vorderstrasse, Beth A


    Streptococcus pneumoniae is a primary cause of invasive bacterial infection and pneumonia and is one of the leading causes of death worldwide. In prior studies we showed that pre-treating mice with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), a potent agonist of the aryl hydrocarbon receptor (AhR), protects against S. pneumoniae-induced mortality and reduces pulmonary bacterial burden. The current studies were conducted to help elucidate the mechanism for this protective effect, and to characterize the response in the lung during the first 10h following infection. C57Bl/6 mice were treated with TCDD one day prior to intranasal infection with serotype 3 S. pneumoniae. Monitoring of bacteria in the lung airways revealed that bacterial growth was inhibited in the TCDD-treated animals within 10h of infection. To address the mechanism of this rapid protective response, macrophages, neutrophils, and invariant Natural Killer T (iNKT) cells were quantified, and levels of natural antibodies produced by B-1 B cells were evaluated. Functional assays addressed whether AhR activation reduced the capacity of lung epithelial cells to bind bacteria, and whether TCDD treatment enhanced production of antimicrobial agents in the lung or blood. None of the hypothesized mechanisms was able to explain the protective effect. Finally, the exposure paradigm was manipulated to test whether administration of TCDD after instillation of the bacteria was also protective. Results showed that TCDD must be administered in advance of exposure to bacteria, suggesting that the lung environment is rendered inhospitable to the pathogens. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. In vitro activity of fluoroquinolones (gatifloxacin, levofloxacin and trovafloxacin and seven other antibiotics against Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Nicodemo A.C.


    Full Text Available In recent years, the level of resistance of S. pneumoniae to beta-lactam and/or macrolides has increased around the world including some countries in South America. Because of this resistance, it is necessary to test the therapeutic alternatives for treating this pathogen, including the newer quinolones. This study was carried out in order to compare the in vitro activity of fluoroquinolones gatifloxacin, levofloxacin and trovafloxacin, to penicillin G, amoxicillin, amoxicillin-clavulanate, cufuroxime sodium, ceftriaxone, azithromycin and clarithromycin, against 300 strains of S. pneumoniae. Of the 300 samples tested, 18.6% were not susceptible to penicillin (56 strains and 7% (21 strains were resistant to the second generation cephalosporin. Among the macrolides, resistance ranged from 6.7% for clarithromycin to 29.6% for azithromycin. Susceptibility to the newer quinolones was 100% including the 56 strains not susceptible to penicillin. Among the 10 antibiotics evaluated, the fluoroquinolones gatifloxacin, levofloxacin, and trovafloxacin displayed high levels of in vitro activity against S. pneumoniae.

  2. Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis. (United States)

    Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E


    Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

  3. Evaluation of PCR-based approach for serotype determination of Streptococcus pneumoniae. (United States)

    Shakrin, N N S M; Balasubramaniam, S D; Yusof, H A; Mastuki, M F; Masri, S N; Taib, N M; Nordin, S A; Jamal, F; Clarke, S C; Desa, M N M


    Determination of Streptococcus pneumoniae serotypes is essential for epidemiological surveillance. Therefore accurate, reliable and cost effective serotyping method is crucial. In this study, we determined the serotypes of 41 pneumococcal isolates recovered from human anterior nares by multiplex Polymerase Chain Reaction (PCR) utilizing published primers. The data was then compared with conventional serology using latex agglutination (LA) and the Quellung reaction. Based on the PCR-approach, 8 different serogroups/serotypes were detected with one isolate classified as non-typeable (cpsA-negative). In reference to the serology-based data, the results were in agreement except for one isolate. For the latter isolate, the LA and Quellung tests failed to show a reaction but the PCR-approach and sequencing identified the isolate as serogroup 15B/C. Based on this experimental setting, we found that the PCR-approach for pneumococcal serotypes determination is reliable to serve as the alternative for determining the pneumococcal serotyping.

  4. Impact of aspirin on the transcriptome of Streptococcus pneumoniae D39

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Aspirin or acetylsalicylic acid (ASA is a medicine used to treat pain, fever, and inflammation. Here, we for the very first time reported the genome-wide transcriptional profiling of aspirin-regulated genes in Streptococcus pneumoniae in the presence of 5 mM aspirin in chemically-defined medium (CDM using microarray analysis. Our results showed that expression of several genes was differentially expressed in the presence of aspirin. These genes were further grouped into COG (Clusters of Orthologous Groups functional categories based on the putative functions of the corresponding proteins. Most of affected genes belong to COG category E (Amino acid transport and metabolism, G (Carbohydrate transport and metabolism, J (Translation, ribosomal structure and biogenesis, and I (Lipid transport and metabolism. Transcriptional profiling data of aspirin-regulated genes was deposited to Gene Expression Omnibus (GEO database under accession number GSE94514.

  5. Regulation of naturally acquired mucosal immunity to Streptococcus pneumoniae in healthy Malawian adults and children.

    Directory of Open Access Journals (Sweden)

    Sarah J Glennie

    Full Text Available Worldwide, invasive pneumococcal disease caused by Streptococcus pneumoniae is most common in young children. In adults, disease rates decline following intermittent colonization and the acquisition of naturally acquired immunity. We characterized mucosal and systemic pneumococcal-specific T-cell responses in African children and adults who contend with intense rates of colonization, up to 100% and 60% respectively. We find most Malawian children have high pneumococcal-specific T-cell responses in tonsil tissue and peripheral blood. In addition, frequent commensalism generates CD25(hi (Tregs which modulate mucosal pneumococcal-specific T-cell responses in some children and ≥50% of adults. We propose that immune regulation may prolong pneumococcal colonization and predispose vulnerable individuals to disease.

  6. Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Mafalda X Henriques

    Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

  7. Antagonism between penicillin and erythromycin against Streptococcus pneumoniae in vitro and in vivo

    DEFF Research Database (Denmark)

    Johansen, H K; Jensen, T G; Dessau, Ram


    the effect of the bactericidal agent. In this study, the possible interaction between penicillin and erythromycin was investigated in vitro and in vivo against four clinical isolates of Streptococcus pneumoniae with MICs of penicillin ranging from 0.016 to 0.5 mg/L and of erythromycin from 0. 25 to >128 mg....../L. In vitro time-kill curves were generated with clinically relevant concentrations of penicillin (10 mg/L) and erythromycin (1 mg/L), either individually or in combination. Antagonism between penicillin and erythromycin was observed for the four isolates. In vivo interaction was investigated in the mouse...... peritonitis model. After intraperitoneal inoculation, penicillin and erythromycin were given either individually or in combination. For two of the four isolates, mortality was significantly higher in the groups treated with the combination of penicillin and erythromycin than in the groups treated...

  8. Three-dimensional structures of Lipoproteins from Streptococcus pneumoniae and Staphylococcus aureus. (United States)

    Bartual, Sergio G; Alcorlo, Martín; Martínez-Caballero, Siseth; Molina, Rafael; Hermoso, Juan A


    Bacterial lipoproteins (Lpp) compose a large family of surface-exposed proteins that are involved in diverse, but critical, cellular functions spanning from fitness to virulence. All of them present a common signature, a sequence motif, known as LipoBox, containing an invariant Cys residue that allows the protein to be covalently bound to the membrane through a thioether linkage. Despite the abundance and relevance of Lpp, there is a scarcity of structural and functional information for this family of proteins. In this review, the updated structural and functional data for Lpp from two Gram-positive pathogenic model organisms, Staphylococcus aureus and Streptococcus pneumoniae is presented. The available structural information offers a glimpse over the Lpp functional mechanisms. Their relevance in bacterial fitness, and also in virulence and host-pathogen interactions, reveals lipoproteins as very attractive targets for designing of novel antimicrobials, and interesting candidates as novel vaccine antigens. Copyright © 2017 Elsevier GmbH. All rights reserved.

  9. Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

    Directory of Open Access Journals (Sweden)

    Patrícia A. G. Velasquez


    Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

  10. Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Edwin J. Asturias


    Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

  11. Upper respiratory colonization by Streptococcus pneumoniae in healthy pre-school children in south-east Poland. (United States)

    Korona-Glowniak, Izabela; Niedzielski, Artur; Malm, Anna


    Carriage of Streptococcus pneumoniae in upper respiratory tract of healthy children is a major factor in the horizontal transmission of pneumococcal strains, especially between children attending day-care centers and may be also the source of infection in other individuals. During 8-month prospective study including 3 seasons (autumn, winter, spring), we determined risk factors for S. pneumoniae colonization in general and colonization at 2 or 3 time points in healthy pre-school children, including penicillin non-susceptible likewise multidrug resistant strains. Pneumococcal cultures were obtained from 311 children aged 3-5. Finally, a total of 342 isolates were identified. Resistance of pneumococcal isolates was determined and information about potential risk factors were obtained from questionnaires. A total of 72.4% children were colonized by pneumococci at least once, including 8.4% children colonized at 3 time points, 25.4% children - twice and 38.6% children - only once. Penicillin non-susceptible pneumococcal colonization was found in 36.3% children at least once while multidrug-resistant pneumococcal colonization in 34.1% children. Of the 10.9% and 10.6% children were colonized at 2 or 3 time points by penicillin non-sussceptible and multidrug-resistant isolates, respectively. Pneumococcal colonization (in general or by non-susceptible to penicillin isolates) was independently associated with day care attendance, having no siblings, frequent respiratory tract infections and higher number of antibiotic courses. Children attending day care center, with frequent respiratory tract infections, exposed to tobacco smoke were prone to colonization by multidrug-resistant isolates. Risk of colonization at 2 or 3 time points by pneumococcal isolates, including penicillin-nonsusceptible isolates, was associated with age and day care attendance while multidrug-resistant pneumococcal colonization was found to be significantly higher in children aged 3, with frequent

  12. The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro. (United States)

    Yadav, Mukesh Kumar; Go, Yoon Young; Chae, Sung-Won; Song, Jae-Jun


    Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam) alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC). In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell-clumps were scattered

  13. The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

    Directory of Open Access Journals (Sweden)

    Mukesh Kumar Yadav

    Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

  14. Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae. (United States)

    Santoro, Francesco; Oggioni, Marco R; Pozzi, Gianni; Iannelli, Francesco


    The Tn916-like genetic element Tn5251 is part of the composite conjugative transposon (CTn) Tn5253 of Streptococcus pneumoniae, a 64.5-kb chromosomal element originally called Omega(cat-tet) BM6001. DNA sequence analysis showed that Tn5251 is 18 033-bp long and contains 22 ORFs, 20 of which have the same direction of transcription. Annotation was possible for 11 out of 22 ORFs, including the tet(M) tetracycline resistance gene and int and xis involved in the integration/excision process. Autonomous copies of Tn5251 were generated during matings of Tn5253-containing donors with S. pneumoniae and Enterococcus faecalis. Tn5251 was shown to integrate at different sites in the bacterial chromosome. It behaves as a fully functional CTn capable of independent conjugal transfer to a variety of bacterial species including S. pneumoniae, Streptococcus gordonii, Streptococcus pyogenes, Streptococcus agalactiae, E. faecalis and Bacillus subtilis. The excision of Tn5251 produces a circular intermediate and a deletion in Tn5253 at a level of 1.2 copies per 10(5) chromosomes.

  15. Modulation of immune signaling, bacterial clearance, and corneal integrity by toll-like receptors during streptococcus pneumoniae keratitis. (United States)

    Tullos, Nathan A; Thompson, Hilary W; Taylor, Sidney D; Sanders, Melissa; Norcross, Erin W; Tolo, Isaiah; Moore, Quincy; Marquart, Mary E


    Bacterial keratitis, without effective antimicrobial treatment, leads to poor patient prognosis. Even after bacterial clearance, the host inflammatory response can contribute to corneal damage. Though Streptococcus pneumoniae (pneumococcus) is a common cause of bacterial keratitis, the role of host innate immunity during pneumococcal keratitis is not well characterized. This study investigated the role of Toll-like receptors (TLRs) during pneumococcal keratitis. C57BL/6, as well as TLR2(-/-) and TLR4(-/-) mice, were infected with S. pneumoniae, and infected corneas were examined for 21 days. Quantitative real-time reverse-transcriptase polymerase chain reaction was performed using primers for genes involved in the inflammatory response and TLR signaling. Bacterial survival and leukocyte invasion were examined over a 72-h period. The corneal expression of TLR2, TLR4, and other inflammatory genes was increased at 72 h post-infection (p.i.) compared to uninfected C57BL/6 scratch controls. TLR2(-/-) mice showed a significant increase in bacterial survival at 24 h p.i. likely due to decreased neutrophil infiltration; however, after Day 5 p.i. observed clinical scores of TLR2(-/-) and C57BL/6 mice were not significantly different. In contrast, permanent corneal damage was observed for TLR4(-/-) mice over 21 days. Initially, both TLR(-/-) mouse strains exhibited lower expression levels in many immune genes, but returned to similar or elevated levels compared to C57BL/6 mice by 72 h p.i. TLR2 and TLR4 are involved in the response to pneumococcal keratitis and TLR2 may aid in bacterial clearance by recruitment of neutrophils to the cornea, whereas TLR4 may be necessary to modulate the immune response to limit cellular damage.

  16. Streptococcus pneumoniae phosphotyrosine phosphatase CpsB and alterations in capsule production resulting from changes in oxygen availability. (United States)

    Geno, K Aaron; Hauser, Jocelyn R; Gupta, Kanupriya; Yother, Janet


    Streptococcus pneumoniae produces a protective capsular polysaccharide whose production must be modulated for bacterial survival within various host niches. Capsule production is affected in part by a phosphoregulatory system comprised of CpsB, CpsC, and CpsD. Here, we found that growth of serotype 2 strain D39 under conditions of increased oxygen availability resulted in decreased capsule levels concurrent with an ∼5-fold increase in Cps2B-mediated phosphatase activity. The change in Cps2B phosphatase activity did not result from alterations in the levels of either the cps2B transcript or the Cps2B protein. Recombinant Cps2B expressed in Escherichia coli similarly exhibited increased phosphatase activity under conditions of high-oxygen growth. S. pneumoniae D39 derivatives with defined deletion or point mutations in cps2B demonstrated reduced phosphatase activity with corresponding increases in levels of Cps2D tyrosine phosphorylation. There was, however, no correlation between these phenotypes and the level of capsule production. During growth under reduced-oxygen conditions, the Cps2B protein was essential for parental levels of capsule, but phosphatase activity alone could be eliminated without an effect on capsule. Under increased-oxygen conditions, deletion of cps2B did not affect capsule levels. These results indicate that neither Cps2B phosphatase activity nor Cps2D phosphorylation levels per se are determinants of capsule levels, whereas the Cps2B protein is important for capsule production during growth under conditions of reduced but not enhanced oxygen availability. Roles for factors outside the capsule locus, possible interactions between capsule regulatory proteins, and links to other cellular processes are also suggested by the results described in this study.

  17. [Sensitivity surveillance of Streptococcus pneumoniae isolates for several antibacterial agents in Gifu and Aichi prefectures (2011-2012)]. (United States)

    Funatsu, Tori; Mizunaga, Shingo; Fukuda, Yoshiko; Nomura, Nobuhiko; Hashido, Hikonori; Mitsuyama, Junichi; Hatano, Masakazu; Yamaoka, Kazukiyo; Watanabe, Kunitomo; Asano, Yuko; Suematsu, Hiroyuki; Sawamura, Haruki; Matsukawa, Yoko; Ohta, Hirotoshi; Yamagishi, Yuka; Mikamo, Hiroshige; Matsubara, Shigenori; Shibata, Naohiro


    We investigated the susceptibility to antibacterial agents, genotype of penicillin-binding protein (PBP) genes and macrolide resistant genes, and the serotypes against 270 strains of Streptococcus pneumoniae isolated from medical facilities in Gifu and Aichi prefectures between October 2011 and April 2012. These results were compared with those against S. pneumoniae isolated in 2008-2009 and 2010-2011. The number of gPSSP with 3 normal PBP genes, gPISP with 1 or 2 normal PBP genes and gPRSP with 3 abnormal genes isolated in 2011-2012 was 15 (5.6%), 162 (60.0%) and 93 (34.4%) strains, respectively. Compared with those isolated in 2008-2009 and 2010-2011, the numbers of gPRSP were decreasing. On the other hand, the isolates with no macrolide-resistant gene, only mefA, only ermB, and both mefA and ermB were 16 (5.9%), 75 (27.8%), 153 (56.7%) and 26 (9.6%). Compared with those isolated in 2008-2009 and 2010-2011, the numbers of isolates with ermB, which was usually associated with high-level resistance, were increasing. The prevalent pneumococcal serotypes in children were type 3 (14.4%), following by type 15 and 19F (9.3%). The coverages of 7-valent pneumococcal conjugate vaccine (PCV7) and 13-valent pneumococcal conjugate vaccine (PCV13) were calculated as 22.9% and 49.2%, respectively. The coverages of PCV7 and PCV13 in gPRSP isolated from children were 47.7% (21/44 strains) and 72.7% (32/44 strains). The MIC90 of each antibacterial agent was as follows; 0.125pg/mL for imipenem, panipenem and garenoxacin, 0.25 μg/mL for meropenem and doripenem, 0.5 μg/mL for cefditoren, moxifloxacin and tosufloxacin, 1 μg/mL for amoxicillin, clavulanic acid/amoxicillin, cefteram, cefcapene and ceftriaxone, 2 μg/mL for benzylpenicillin, ampicillin, sulbactam/ampicillin, piperacillin, tazobactam/piperacillin and levofloxacin, 4 μg/mL for cefdinir, flomoxef and pazufloxacin, 16 μg/mL for minocycline, > 64 μg/mL for clarithromycin and azithromycin, and these MIC90s were about the

  18. Rapid Assessment of Resistance to Antibiotic Inhibitors of Protein Synthesis in the Gram-Positive Pathogens, Enterococcus faecalis and Streptococcus pneumoniae, Based on Evaluation of the Lytic Response. (United States)

    Otero, Fátima; Tamayo, María; Santiso, Rebeca; Gosálvez, Jaime; Bou, Germán; Fernández, José Luis


    A novel assay for rapid determination of resistance to antibiotic inhibitors of protein synthesis was developed for the gram-positive pathogens, Enterococcus faecalis and Streptococcus pneumoniae. To this purpose, a lytic response was obtained by a brief incubation with lysozyme or a mixture of lysozyme, Triton X-100, and EDTA for E. faecalis (n = 82) and S. pneumoniae (n = 51), respectively. Lysis was quantified by visualizing the released nucleoids. Antibiotic-susceptible bacteria treated with Clinical and Laboratory Standards Institute (CLSI) breakpoint doses of erythromycin, azithromycin, or doxycycline that inhibited protein synthesis demonstrated a large reduction of lysed cells with respect to the control, that is, without antibiotics. However, cell lysis prevention was much lower in nonsusceptible strains, with unsuccessful inhibition of protein synthesis. ROC analysis showed that a reduction value of ≥35.6% and ≥40.4% discriminates susceptible and nonsusceptible strains for erythromycin and for doxycycline, respectively, in E. faecalis, whereas ≥20.0% is adequate for both macrolides and doxycycline in S. pneumoniae. Resistant stains were identified in 90-120 min with sensitivity and specificity between 91.7% and 100%. This is a proof of concept that evaluation of the lytic response may be a rapid and efficient test for determination of resistance to antibiotic inhibitors of protein synthesis.

  19. Interleukin-10 plays a key role in the modulation of neutrophils recruitment and lung inflammation during infection by Streptococcus pneumoniae. (United States)

    Peñaloza, Hernán F; Nieto, Pamela A; Muñoz-Durango, Natalia; Salazar-Echegarai, Francisco J; Torres, Javiera; Parga, María J; Alvarez-Lobos, Manuel; Riedel, Claudia A; Kalergis, Alexis M; Bueno, Susan M


    Streptococcus pneumoniae is a major aetiological agent of pneumonia worldwide, as well as otitis media, sinusitis, meningitis and sepsis. Recent reports have suggested that inflammation of lungs due to S. pneumoniae infection promotes bacterial dissemination and severe disease. However, the contribution of anti-inflammatory molecules to the pathogenesis of S. pneumoniae remains unknown. To elucidate whether the production of the anti-inflammatory cytokine interleukin-10 (IL-10) is beneficial or detrimental for the host during pneumococcal pneumonia, we performed S. pneumoniae infections in mice lacking IL-10 (IL-10(-/-) mice). The IL-10(-/-) mice showed increased mortality, higher expression of pro-inflammatory cytokines, and an exacerbated recruitment of neutrophils into the lungs after S. pneumoniae infection. However, IL-10(-/-) mice showed significantly lower bacterial loads in lungs, spleen, brain and blood, when compared with mice that produced this cytokine. Our results support the notion that production of IL-10 during S. pneumoniae infection modulates the expression of pro-inflammatory cytokines and the infiltration of neutrophils into the lungs. This feature of IL-10 is important to avoid excessive inflammation of tissues and to improve host survival, even though bacterial dissemination is less efficient in the absence of this cytokine. © 2015 John Wiley & Sons Ltd.

  20. Interleukin-10 plays a key role in the modulation of neutrophils recruitment and lung inflammation during infection by Streptococcus pneumoniae (United States)

    Peñaloza, Hernán F; Nieto, Pamela A; Muñoz-Durango, Natalia; Salazar-Echegarai, Francisco J; Torres, Javiera; Parga, María J; Alvarez-Lobos, Manuel; Riedel, Claudia A; Kalergis, Alexis M; Bueno, Susan M


    Streptococcus pneumoniae is a major aetiological agent of pneumonia worldwide, as well as otitis media, sinusitis, meningitis and sepsis. Recent reports have suggested that inflammation of lungs due to S. pneumoniae infection promotes bacterial dissemination and severe disease. However, the contribution of anti-inflammatory molecules to the pathogenesis of S. pneumoniae remains unknown. To elucidate whether the production of the anti-inflammatory cytokine interleukin-10 (IL-10) is beneficial or detrimental for the host during pneumococcal pneumonia, we performed S. pneumoniae infections in mice lacking IL-10 (IL-10−/− mice). The IL-10−/− mice showed increased mortality, higher expression of pro-inflammatory cytokines, and an exacerbated recruitment of neutrophils into the lungs after S. pneumoniae infection. However, IL-10−/− mice showed significantly lower bacterial loads in lungs, spleen, brain and blood, when compared with mice that produced this cytokine. Our results support the notion that production of IL-10 during S. pneumoniae infection modulates the expression of pro-inflammatory cytokines and the infiltration of neutrophils into the lungs. This feature of IL-10 is important to avoid excessive inflammation of tissues and to improve host survival, even though bacterial dissemination is less efficient in the absence of this cytokine. PMID:26032199

  1. The inverse correlation between Staphylococcus aureus and Streptococcus pneumoniae colonization in infants is not explained by differences in serum antibody levels in the generation R study

    NARCIS (Netherlands)

    A. Lebon (Ankie); N.J. Verkaik (Nelianne); C.P. de Vogel (Corné); H. Hooijkaas (Herbert); H.A. Verbrugh (Henri); W.J.B. van Wamel (Willem); V.W.V. Jaddoe (Vincent); A. Hofman (Albert); P.W.M. Hermans (Peter); T.J. Mitchell (Tim); H.A. Moll (Henriëtte); A.F. van Belkum (Alex)


    textabstractColonization rates of Streptococcus pneumoniae and Staphylococcus aureus are inversely correlated in infants. Several studies have searched for determinants of this negative association. We studied the association between antipneumococcal antibodies with Staphylococcus aureus

  2. The inverse correlation between Staphylococcus aureus and Streptococcus pneumoniae colonization in infants is not explained by differences in serum antibody levels in the Generation R Study

    NARCIS (Netherlands)

    Lebon, A.; Verkaik, N.J.; Vogel, C.P. de; Hooijkaas, H.; Verbrugh, H.A.; Wamel, W.J. van; Jaddoe, V.W.; Hofman, A.; Hermans, P.W.M.; Mitchell, T.J.; Moll, H.A.; Belkum, A. van


    Colonization rates of Streptococcus pneumoniae and Staphylococcus aureus are inversely correlated in infants. Several studies have searched for determinants of this negative association. We studied the association between antipneumococcal antibodies with Staphylococcus aureus colonization and the

  3. In vitro activity of oral cephalosporins against pediatric isolates of Streptococcus pneumoniae non-susceptible to penicillin, amoxicillin or erythromycin. (United States)

    Fenoll, A; Giménez, M J; Robledo, O; Aguilar, L; Tarragó, D; Granizo, J J; Gimeno, M; Coronel, P


    The aim of this study was to evaluate the effects of penicillin, amoxicillin or erythromycin resistance on the in vitro activity of oral cephalosporins against Streptococcus pneumoniae pediatric isolates. A total of 282 pediatric isolates received during 2005 in the Spanish Reference Pneumococcal Laboratory were tested by agar dilution: 104 strains were penicillin-susceptible, 72 intermediate, and 106 resistant. Serotypes 9 and 14 were the most troublesome with or= 32 microg/ml), with 0% susceptibility to cefaclor, cefuroxime and cefpodoxime. Cefditoren 0.5 microg/ml inhibited 95.3%, 95.5%, and 98.6% of penicillin-, amoxicillin-, and erythromycin-resistant isolates, respectively. Susceptibility to oral cephalosporins shifted from >90% in penicillin-susceptible isolates to approximately 38% for cefuroxime/cefpodoxime and approximately 7% for cefaclor in penicillin-intermediate, and to 0% in resistant isolates. Despite the different in vitro activity of oral cephalosporins, full resistance to penicillin or amoxicillin implied lack of susceptibility to all oral cephalosporins with defined CLSI breakpoints, rendering them inadequate as empirical treatment in countries with a high prevalence of penicillin resistance.

  4. The Streptococcus pneumoniae pezAT toxin-antitoxin system reduces β-lactam resistance and genetic competence

    Directory of Open Access Journals (Sweden)

    Wai Ting Chan


    Full Text Available Chromosomally-encoded Type II Toxin-Antitoxin operons are ubiquitous in bacteria and archaea. Antitoxins neutralize the toxic effect of cognate Toxins by protein-protein interactions and sequestering the active residues of the Toxin. Toxins target essential bacterial processes, mostly translation and replication. However, one class apart is constituted by the PezAT pair because the PezT toxin target cell wall biosynthesis. Here we have examined the role of the pezAT toxin-antitoxin genes in its natural host, the pathogenic bacterium Streptococcus pneumoniae. The pezAT operon on Pneumococcal Pathogenicity Island 1 was deleted from strain R6 and its phenotypic traits were compared with those of the wild type. The mutant cells formed shorter chains during exponential phase, leading to increased colony-forming units. At stationary phase, the mutant was more resilient to lysis. Importantly, the mutant exhibited higher resistance to antibiotics targeting cell walls (β-lactams, but not to antibiotics acting at other levels. In addition, the mutants also showed enhanced genetic competence. We suggest that PezAT participates in a subtle equilibrium between loss of functions (resistance to β-lactams and genetic competence and gain of other traits (virulence.

  5. Safety of a nasal vaccine against Streptococcus pneumoniae using heat-killed Lactobacillus casei as adjuvant. (United States)

    Almada, Guillermina; Haro, Cecilia; Vintiñi, Elisa; Medina, Marcela


    Streptococcus pneumoniae is a highly important respiratory pathogen that causes infections in children, elderly people and immunocompromised people around the world. Pneumococcal vaccines licensed did not reach to eradicate the pneumococcal infection. In a previous study was demonstrated the effectiveness of a nasal experimental vaccine that consisted in a pneumococcal protective protein A (PppA) co-administrated with heat-killed-Lactobacillus casei (LcM), in mice model of respiratory pneumococcal challenge. In the present work the safety of the experimental vaccine LcM+PppA and its components were evaluated through hematological, biochemical and immune parameters in a model infection with S. pneumoniae. Thus, alanine transaminase activity, creatinine levels, lactate dehydrogenase activity, C reactive protein levels, corticosterone levels in serum, total and differential leukocyte counts in blood and bronchoalveolar lavages (BAL) and IgE in BAL, were evaluated. Experimental vaccine: LcM+PppA nasally administered does not induce harmful effects in our vaccination-infection model. Studied parameters showed LcM+PppA's safety in liver, kidney, pulmonary and systemic levels. Although studies in experimental animals do not guarantee security for the application of the vaccine on humans, they are important evidence for the planning and subsequent clinical trials in humans. Copyright © 2014 Elsevier GmbH. All rights reserved.

  6. Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Neil G., E-mail:; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)


    The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

  7. Characterization of NAD salvage pathways and their role in virulence in Streptococcus pneumoniae (United States)

    Johnson, Michael D. L.; Echlin, Haley; Dao, Tina H.


    NAD is a necessary cofactor present in all living cells. Some bacteria cannot de novo synthesize NAD and must use the salvage pathway to import niacin or nicotinamide riboside via substrate importers NiaX and PnuC, respectively. Although homologues of these two importers and their substrates have been identified in other organisms, limited data exist in Streptococcus pneumoniae, specifically, on its effect on overall virulence. Here, we sought to characterize the substrate specificity of NiaX and PnuC in Str. pneumoniae TIGR4 and the contribution of these proteins to virulence of the pathogen. Although binding affinity of each importer for nicotinamide mononucleotide may overlap, we found NiaX to specifically import nicotinamide and nicotinic acid, and PnuC to be primarily responsible for nicotinamide riboside import. Furthermore, a pnuC mutant is completely attenuated during both intranasal and intratracheal infections in mice. Taken together, these findings underscore the importance of substrate salvage in pneumococcal pathogenesis and indicate that PnuC could potentially be a viable small-molecule therapeutic target to alleviate disease progression in the host. PMID:26311256

  8. Structure of the fucose mutarotase from Streptococcus pneumoniae in complex with L-fucose. (United States)

    Higgins, Melanie A; Boraston, Alisdair B


    Streptococcus pneumoniae relies on a variety of carbohydrate-utilization pathways for both colonization of its human host and full virulence during the development of invasive disease. One such pathway is the fucose-utilization pathway, a component of which is fucose mutarotase (SpFcsU), an enzyme that performs the interconversion between α-L-fucose and β-L-fucose. This protein was crystallized and its three-dimensional structure was solved in complex with L-fucose. The structure shows a complex decameric quaternary structure with a high overall degree of structural identity to Escherichia coli FcsU (EcFcsU). Furthermore, the active-site architecture of SpFcsU is highly similar to that of EcFcsU. When considered in the context of the fucose-utilization pathway found in S. pneumoniae, SpFcsU appears to link the two halves of the pathway by enhancing the rate of conversion of the product of the final glycoside hydrolysis step, β-fucose, into the substrate for the fucose isomerase, α-fucose.

  9. Structure of the fucose mutarotase from Streptococcus pneumoniae in complex with l-­fucose (United States)

    Higgins, Melanie A.; Boraston, Alisdair B.


    Streptococcus pneumoniae relies on a variety of carbohydrate-utilization pathways for both colonization of its human host and full virulence during the development of invasive disease. One such pathway is the fucose-utilization pathway, a component of which is fucose mutarotase (SpFcsU), an enzyme that performs the interconversion between α-l-fucose and β-l-fucose. This protein was crystallized and its three-dimensional structure was solved in complex with l-fucose. The structure shows a complex decameric quaternary structure with a high overall degree of structural identity to Escherichia coli FcsU (EcFcsU). Furthermore, the active-site architecture of SpFcsU is highly similar to that of EcFcsU. When considered in the context of the fucose-utilization pathway found in S. pneumoniae, SpFcsU appears to link the two halves of the pathway by enhancing the rate of conversion of the product of the final glycoside hydrolysis step, β-fucose, into the substrate for the fucose isomerase, α-fucose. PMID:22139157

  10. An outbreak of fatal hemorrhagic pneumonia caused by Streptococcus equi subsp. zooepidemicus in shelter dogs. (United States)

    Byun, Jae Won; Yoon, Soon Seek; Woo, Gye-Hyeong; Jung, Byeong Yeal; Joo, Yi-Seok


    An outbreak of fatal hemorrhagic pneumonia with 70-90% morbidity and 50% mortality occurred in an animal shelter in Yangju, Gyeonggi Province, Korea. Clinically, the affected dogs showed severe respiratory distress within 48 h after arriving in the shelter. The dead were found mainly with nasal bleeding and hematemesis. At necropsy, hemothorax and hemorrhagic pneumonia along with severe pulmonary consolidation was observed, though histopathological analysis showed mainly hemorrhagic bronchopneumonia. Lymphoid depletion was inconsistently seen in the spleen, tonsil and bronchial lymph node. Gram-positive colonies were shown in blood vessels or parenchyma of cerebrum, lung, liver, spleen, and kidney. Also, Streptococcus (S.) equi subsp. zooepidemicus was isolated from the various organs in which the bacterium was microscopically and histologically detected. In addition, approximately 0.9 Kb specific amplicon, antiphagocytic factor H binding protein, was amplified in the bacterial isolates. In this study, we reported an outbreak of canine hemorrhagic bronchopneumonia caused by S. equi subsp. zooepidemicus in an animal shelter in Yangju, Korea.

  11. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal


    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  12. Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Kathleen E Stevens


    Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

  13. Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient. (United States)

    Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J


    Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

  14. Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children (United States)

    Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.


    Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae–S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim–sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim–sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community. PMID:20803226

  15. Efficacy of single-dose ceftriaxone in experimental otitis media induced by penicillin- and cephalosporin-resistant Streptococcus pneumoniae. (United States)

    Barry, B; Muffat-Joly, M; Bauchet, J; Faurisson, F; Gehanno, P; Pocidalo, J J; Carbon, C


    We used a gerbil model of otitis media to assess the efficacy of single-dose ceftriaxone against three Streptococcus pneumoniae strains highly resistant to penicillin (MICs, 4 to 8 micrograms/ml) and with various susceptibilities to ceftriaxone (MICs, 0.5, 4, and 8 micrograms/ml). Middle ear infection was induced by bilateral transbullar challenge with 10(7) bacteria per ear. Antibiotic treatment was administered subcutaneously at 2 h postinfection. Infection status was checked 2 days later by counting the bacteria in middle ear and cerebrospinal fluid samples. With the cefriaxone-susceptible strain (MIC, 0.5 microgram/ml), we tested doses of 5 to 100 mg/kg of body weight. With a dose of 50 mg/kg, treatment outcome was equivalent to that with amoxicillin, which was used as a reference (25 mg/kg, two injections); no bacteria were recovered from 82% of the middle ear samples, and the rate of cerebrospinal fluid culture positivity was significantly reduced to 6%, relative to 59% for the untreated controls. Similar efficacy was obtained with a dose of 100 mg/kg against the two ceftriaxone-resistant strains. Pharmacokinetic study indicates that the values of the parameters in plasma after the administration of a dose of 100 mg/kg (peak level of total drug, 268 +/- 33 micrograms/ml; elimination half-life, 0.8 h; area under concentration-time curve, 488 were still suboptimal compared with the values of the parameters measured in pediatric patients after intravenous or intramuscular administration of a dose of 50 mg/kg. Our results indicate the efficacy of ceftriaxone against experimental cephalosporin-resistant pneumococcal otitis and provide a basis for the clinical use of single-dose ceftriaxone against pneumococcal otitis media.

  16. Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae. (United States)

    Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan


    Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  17. Proteomic variation and diversity in clinical Streptococcus pneumoniae isolates from invasive and non-invasive sites.

    Directory of Open Access Journals (Sweden)

    Mustapha Bittaye

    Full Text Available Streptococcus pneumoniae is responsible for a variety of invasive and non-invasive human infections. There are over 90 serotypes of S. pneumoniae differing in their ability to adapt to the different niches within the host. Two-dimensional gel electrophoresis was used to discriminate clinical S. pneumoniae isolates recovered from either blood cultures (invasive site isolates or other sites, including sputum, tracheal aspirate, ear, eye and skin swabs (non-invasive site isolates. Global protein expression profiles for five invasive site and six non-invasive site isolates representing five different serotypes (serotypes 4, 6, 9, 14 and 23 were obtained for each isolate and combined into a single data set using Progenesis SameSpots™ software. One-hundred and eighty six protein spots (39% of the protein spots in the dataset differed significantly (ANOVA, p<0.05 in abundance between the invasive site (101 upregulated protein spots and non-invasive site (85 upregulated protein spots isolates. Correlations between the bacterial proteomes and their sites of isolation were determined by Principal Component Analysis (PCA using the significantly different protein spots. Out of the 186 variable protein spots, 105 exhibited a serotype-associated pattern of variability. The expression of the remaining 81 protein spots was concluded to be uniquely linked to the site of bacterial isolation. Mass spectrometry was used to identify selected protein spots that showed either constant or differential abundance levels. The identified proteins had a diverse range of functions including, capsule biogenesis, DNA repair, protein deglycation, translation, stress response and virulence as well as amino acid, carbohydrate, lipid and nucleotide metabolism. These findings provide insight on the proteins that contribute towards the adaptation of the bacteria to different sites within the host.

  18. Phenotypic and genotypic characterization of Streptococcus pneumoniae resistant to macrolide in Casablanca, Morocco. (United States)

    Diawara, Idrissa; Zerouali, Khalid; Katfy, Khalid; Barguigua, Abouddihaj; Belabbes, Houria; Timinouni, Mohammed; Elmdaghri, Naima


    In Morocco, the 13-valent pneumococcal conjugate vaccine (PCV-13) was introduced in the national immunization program (NIP) in October 2010 and replaced by the PCV-10 in July 2012. The present study aimed to determine the prevalence of erythromycin-resistant Streptococcus pneumoniae (ERSP) and to analyze the phenotypic and genotypic characteristics of these isolates in Casablanca, Morocco from January 2007 to December 2014. Isolates were obtained from the Microbiology Laboratory of Ibn Rochd University Hospital Centre of Casablanca. Serogrouping was done using Pneumotest Kit and serotyping by the Quellung capsular swelling. Antibiotic susceptibility pattern was determined by disk diffusion and Etest methods. A total of 655S. pneumoniae isolates were collected from 2007 to 2014 from pediatric and adult patients. Fifty-five percent of these isolates were from invasive pneumococcal diseases. Of the 655 isolates, 92 (14%) were ERSP. Globally, the proportion of ERSP from 2007 to 2010 (before vaccination) and from 2011 to 2014 (after vaccination) were 11.6% and 17.2% (p=0.04), respectively. Of the 92 ERSP, 89%, 4% and 7% displayed constitutive MLSB (resistance to macrolide, lincosamide and streptogramin B), inducible MLSB, and M phenotype (resistance to macrolide only), respectively. ERSP genotypic analysis showed that 90.2% carried the ermB gene, 6.5% the mefE gene, and 3.3% both the genes (ermB+mefE). The most prevalent ERSP serotypes were 6B, 19F and 23F before vaccination and 19F, 6B, 6A and 23F after vaccination. Erythromycin resistance among S. pneumoniae is relatively high in Casablanca. The contribution of PCVs to the reduction in antibiotic use is encouraging but this should be accompanied by a rational use of antibiotic. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Reduction of Streptococcus pneumoniae Colonization and Dissemination by a Nonopsonic Capsular Polysaccharide Antibody

    Directory of Open Access Journals (Sweden)

    Christopher R. Doyle


    Full Text Available Streptococcus pneumoniae colonization of the nasopharynx (NP is a prerequisite for invasive pneumococcal disease (IPD. The marked reduction in IPD that followed the routine use of pneumococcal polysaccharide conjugate vaccines (PCVs has been linked to reduced NP colonization with vaccine-included serotypes (STs, with the caveat that PCVs are less effective against pneumonia than against IPD. Although PCV-elicited opsonic antibodies that enhance phagocytic killing of the homologous ST are considered a key correlate of PCV-mediated protection, recent studies question this relationship for some STs, including ST3. Studies with monoclonal antibodies (MAbs to the pneumococcal capsular polysaccharide (PPS of ST3 (PPS3 have shown that nonopsonic, as well as opsonic, antibodies can each protect mice against pneumonia and sepsis, but the effect of these types of MAbs on NP colonization is unknown. In this study, we determined the effects of protective opsonic and nonopsonic PPS3 MAbs on ST3 NP colonization in mice. Our results show that a nonopsonic MAb reduced early NP colonization and prevented ST3 dissemination to the lungs and blood, but an opsonic MAb did not. Moreover, the opsonic MAb induced a proinflammatory NP cytokine response, but the nonopsonic MAb had an antiinflammatory effect. The effect of the nonopsonic MAb on colonization did not require its Fc region, but its antiinflammatory effect did. Our findings challenge the paradigm that opsonic MAbs are required to prevent NP colonization and suggest that further studies of the activity of nonopsonic antibodies could advance our understanding of mechanisms of PCV efficacy and provide novel correlates of protection.

  20. Molecular characterization of increasing fluoroquinolone resistance in Streptococcus pneumoniae isolates in Canada, 1997 to 2005. (United States)

    Adam, Heather J; Schurek, Kristen N; Nichol, Kimberly A; Hoban, Chris J; Baudry, Trish J; Laing, Nancy M; Hoban, Daryl J; Zhanel, George G


    Molecular characterization of fluoroquinolone-resistant Streptococcus pneumoniae in Canada was conducted from 1997 to 2005. Over the course of the study, 205 ciprofloxacin-resistant isolates were evaluated for ParC and GyrA quinolone resistance-determining region (QRDR) substitutions, substitutions in the full genes of ParC, ParE, and GyrA, reserpine sensitivity, and serotype and by pulsed-field gel electrophoresis. Rates of ciprofloxacin resistance of S. pneumoniae increased significantly, from less than 1% in 1997 to 4.2% in 2005. Ciprofloxacin resistance was greatest in people >64 years of age and least in those <16 years of age. Significant increases were also noted in rates of resistance to gatifloxacin, gemifloxacin, levofloxacin, and moxifloxacin, to the current rates of 1.6%, 1.0%, 1.1%, and 1.0%, respectively. The most common genotype observed consisted of QRDR substitutions in GyrA (Ser81Phe) and ParC (Ser79Phe). Substitutions outside the QRDR of GyrA, ParC, and ParE were not associated with fluoroquinolone resistance in this study. Overall, 21% of isolates were reserpine-sensitive and were thus assumed to be efflux positive. The ciprofloxacin-resistant isolates belonged to 35 different serotypes, but 10 (19F, 11A, 23F, 6B, 22F, 12F, 6A, 14, 9V, and 19A) accounted for 72% of all isolates. The majority of the isolates were found to be genetically unrelated by pulsed-field gel electrophoresis. Within the observed clusters, there was considerable genetic heterogeneity with regard to fluoroquinolone resistance mechanisms and serotypes. Continued surveillance and molecular analysis of fluoroquinolone-resistant S. pneumoniae in Canada are essential for appropriate empirical treatment of infections and early detection of novel resistance mechanisms.

  1. Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014. (United States)

    Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi


    Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T371S in the STMK motif and TSQF574-577NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden15A-ST63 in northern Japan.

  2. Extracellular Adenosine Protects against Streptococcus pneumoniae Lung Infection by Regulating Pulmonary Neutrophil Recruitment. (United States)

    Bou Ghanem, Elsa N; Clark, Stacie; Roggensack, Sara E; McIver, Sally R; Alcaide, Pilar; Haydon, Philip G; Leong, John M


    An important determinant of disease following Streptococcus pneumoniae (pneumococcus) lung infection is pulmonary inflammation mediated by polymorphonuclear leukocytes (PMNs). We found that upon intratracheal challenge of mice, recruitment of PMNs into the lungs within the first 3 hours coincided with decreased pulmonary pneumococci, whereas large numbers of pulmonary PMNs beyond 12 hours correlated with a greater bacterial burden. Indeed, mice that survived infection largely resolved inflammation by 72 hours, and PMN depletion at peak infiltration, i.e. 18 hours post-infection, lowered bacterial numbers and enhanced survival. We investigated host signaling pathways that influence both pneumococcus clearance and pulmonary inflammation. Pharmacologic inhibition and/or genetic ablation of enzymes that generate extracellular adenosine (EAD) (e.g. the ectoenzyme CD73) or degrade EAD (e.g. adenosine deaminase) revealed that EAD dramatically increases murine resistance to S. pneumoniae lung infection. Moreover, adenosine diminished PMN movement across endothelial monolayers in vitro, and although inhibition or deficiency of CD73 had no discernible impact on PMN recruitment within the first 6 hours after intratracheal inoculation of mice, these measures enhanced PMN numbers in the pulmonary interstitium after 18 hours of infection, culminating in dramatically elevated numbers of pulmonary PMNs at three days post-infection. When assessed at this time point, CD73-/- mice displayed increased levels of cellular factors that promote leukocyte migration, such as CXCL2 chemokine in the murine lung, as well as CXCR2 and β-2 integrin on the surface of pulmonary PMNs. The enhanced pneumococcal susceptibility of CD73-/- mice was significantly reversed by PMN depletion following infection, suggesting that EAD-mediated resistance is largely mediated by its effects on PMNs. Finally, CD73-inhibition diminished the ability of PMNs to kill pneumococci in vitro, suggesting that EAD alters

  3. Bacteremia caused by a highly-resistant Streptococcus pneumoniae serotype 19A circulating in a daycare center. (United States)

    Shouval, Dror S; Porat, Nurith; Dagan, Ron; Keller, Nathan; Bilavsky, Efraim; Sivan, Yoram; Amir, Jacob


    We describe the clinical course of a previously healthy 20-month-old toddler admitted with high fever and leukocytosis. Blood culture grew Streptococcus pneumoniae serotype 19A, belonging to the ST663 clone, highly resistant to penicillin, ceftriaxone, and erythromycin. The same clone with identical antibiogram was isolated from the nasopharynx of another three of the other five healthy children attending the same daycare center as the patient. This case exemplifies the potential problems posed by highly-resistant S. pneumoniae serotype 19A, an emerging pathogen worldwide. Copyright © 2010 International Society for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  4. Mechanisms of dexamethasone-mediated inhibition of Toll-like receptor signaling induced by Neisseria meningitidis and Streptococcus pneumoniae

    DEFF Research Database (Denmark)

    Mogensen, Trine; Berg, Randi S; Paludan, Søren R


    Excessive inflammation contributes to the pathogenesis of bacterial meningitis, which remains a serious disease despite treatment with antibiotics. Therefore, anti-inflammatory drugs have important therapeutic potential, and clinical trials have revealed that early treatment with dexamethasone...... and S. pneumoniae, which may contribute to our understanding of the clinical effect and the importance of timing with respect to corticosteroid treatment during bacterial meningitis. Udgivelsesdato: 2008-Jan...... significantly reduces mortality and morbidity from bacterial meningitis. Here we investigate the molecular mechanisms behind the inhibitory effect of dexamethasone upon the inflammatory responses evoked by Neisseria meningitidis and Streptococcus pneumoniae, two of the major causes of bacterial meningitis...

  5. Complete Genome Sequence of Streptococcus pyogenes Strain JMUB1235 Isolated from an Acute Phlegmonous Gastritis Patient


    Watanabe, Shinya; Sasahara, Teppei; Arai, Naoshi; Sasaki, Kazumasa; Aiba, Yoshifumi; Sato?o, Yusuke; Cui, Longzhu


    Acute phlegmonous gastritis is an uncommon endogenous bacterial gastritis presenting with a high mortality rate. Here, we report the complete genome sequence of an emm89 Streptococcus pyogenes strain, JMUB1235, which is the causative agent of acute phlegmonous gastritis.

  6. Lactose-sensitive and -insensitive cell surface interactions of oral Streptococcus milleri strains and actinomyces. (United States)

    Eifuku, H; Kitada, K; Yakushiji, T; Inoue, M


    Of 158 oral Streptococcus milleri strains, 46 exhibited cellular coaggregation with the reagent strains of the actinomyces coaggregation groups A, B, and/or E. All but 1 of the 33 serotype b, e, f/F, and k/G strains belonged to streptococcus coaggregation group 2, and only 14 strains of limited seroclasses (g, i, Lancefield group F, or untypeable) appeared to be members of group 5, 3, or 4 (10, 3, and 1 strain, respectively). Thus, S. milleri infrequently exhibits lactose-inhibitable coaggregation with actinomyces. Images PMID:1987061

  7. Complete genome sequence of a Klebsiella pneumoniae strain isolated from a known cotton insect boll vector (United States)

    Klebsiella pneumoniae (associated with bacterial pneumonia) was previously isolated from Nezara viridula, a significant vector of cotton boll-rot pathogens. We provide the first annotated genome sequence of the cotton opportunistic strain K. pneumoniae 5-1. This data provides guidance to study the...

  8. Molecular characterization of penicillin non-susceptible Streptococcus pneumoniae isolated before and after pneumococcal conjugate vaccine implementation in Casablanca, Morocco. (United States)

    Diawara, Idrissa; Barguigua, Abouddihaj; Katfy, Khalid; Nayme, Kaotar; Belabbes, Houria; Timinouni, Mohammed; Zerouali, Khalid; Elmdaghri, Naima


    Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide, especially among children and the elderly. The ability to effectively treat pneumococcal infection has been compromised due to the acquisition of antibiotic resistance, particularly to β-lactam drugs. This study aimed to describe the prevalence and molecular evolution of penicillin non-susceptible S. pneumoniae (PNSP) isolated from invasive diseases before and after pneumococcal conjugate vaccine implementation in Casablanca, Morocco. Isolates were obtained from the Microbiology Laboratory of Ibn Rochd University Hospital Centre of Casablanca. Serogrouping was done by Pneumotest Kit and serotyping by the Quellung capsular swelling. Antibiotic susceptibility pattern was determined by disk diffusion and E-test methods. The PNSP were analyzed by pulsed-field gel electrophoresis (PFGE) and by genotyping of pbp1a, pbp2b, and pbp2x genes. A total of 361 S. pneumoniae isolates were collected from 2007 to 2014. Of these isolates, 58.7% were obtained before vaccination (2007-2010) and 41.3% after vaccination (2011-2014). Of the 361 isolates, 80 were PNSP (22.2%). Generally, the proportion of PNSP between pre- and post-vaccination periods were 31 and 13% (p = 0.009), respectively. The proportion of PNSP isolated from pediatric and adult (age > 14 years) patients decreased from 34.5 to 22.9% (p = 0.1) and from 17.7 to 10.2% (p = 0.1) before and after vaccine implementation, respectively. The leading serotypes of PNSP were 14 (33 vs. 57%) and 19A (18 vs. 14%) before and after vaccination among children. For adults, serotypes 19A (53%) and 23F (24%) were the dominant serotypes in the pre-vaccination period, while serotype 14 (22%) was the most prevalent after vaccination. There were 21 pbp genotypes in the pre-vaccination period vs. 12 for post-vaccination period. PFGE clustering showed six clusters of PNSP grouped into three clusters specific to pre-vaccination period (clusters I

  9. The interactome of Streptococcus pneumoniae and its bacteriophages show highly specific patterns of interactions among bacteria and their phages


    Rachelle Mariano; Stefan Wuchty; Vizoso-Pinto, Maria G.; Roman Häuser; Peter Uetz


    Although an abundance of bacteriophages exists, little is known about interactions between their proteins and those of their bacterial hosts. Here, we experimentally determined the phage-host interactomes of the phages Dp-1 and Cp-1 and their underlying protein interaction network in the host Streptococcus pneumoniae. We compared our results to the interaction patterns of E. coli phages lambda and T7. Dp-1 and Cp-1 target highly connected host proteins, occupy central network positions, and r...

  10. The capsule polysaccharide synthesis locus of streptococcus pneumoniae serotype 14: Identification of the glycosyl transferase gene cps14E.


    Kolkman, M A; Morrison, D. A.; van der Zeijst, B A; Nuijten, P J


    To identify a chromosomal region of Streptococcus pneumoniae serotype 14 involved in capsule polysaccharide synthesis, two strategies were used: (i) Tn916 mutagenesis, followed by the characterization of four unencapsulated mutants, and (ii) cross-hybridization with a capsule polysaccharide synthesis gene (cps) probe from S. agalactiae, which has a structurally similar capsule. The two approaches detected the same chromosomal region consisting of two adjacent EcoRI fragments. One of these Eco...

  11. Characterization and Dynamics of Middle Ear Fluid and Nasopharyngeal Isolates of Streptococcus pneumoniae from 12 Children Treated with Levofloxacin▿


    Davies, Todd A.; Leibovitz, Eugene; Noel, Gary J.; McNeeley, David F.; Bush, Karen; Dagan, Ron


    Children who had acute otitis media and were treated with levofloxacin were assessed for the emergence of fluoroquinolone-resistant Streptococcus pneumoniae. Nasopharynx cultures were obtained from patients at the entry to and during levofloxacin therapy. All nasopharynx isolates (n = 59) from 12 children were levofloxacin susceptible without parC/E or gyrA/B mutations. Pneumococcal nasopharynx persistence was not associated with levofloxacin resistance.

  12. Penicillin resistance and serotype distribution of Streptococcus pneumoniae in Ghanaian children less than six years of age

    DEFF Research Database (Denmark)

    Dayie, Nicholas T. K. D.; Arhin, Reuben E.; Newman, Mercy J.


    Background: The objective of this study was to determine the prevalence of nasopharyngeal carriage, serotype distribution, and penicillin resistance of Streptococcus pneumoniae in children 2 mu g/ml and were classified as fully penicillin resistant with 45% of the isolates having intermediate...... serotypes detected. The two penicillin resistant isolates (MIC 32 mu g/ml) were serotypes included in both PCV-13 and PPV-23. A nationwide monitoring system of penicillin susceptibility patterns and pneumococcal serotypes is recommended....

  13. Evaluation of a Medium (STGG) for Transport and Optimal Recovery of Streptococcus pneumoniae from Nasopharyngeal Secretions Collected during Field Studies


    O'Brien, Katherine L.; Bronsdon, Melinda A.; Dagan, Ron; Yagupsky, Pablo; Janco, Jacob; Elliott, John; Whitney, Cynthia G.; Yang, Yong-Hong; Robinson, Lisa-Gaye E.; Schwartz, Benjamin; Carlone, George M.


    Field studies of Streptococcus pneumoniae (pneumococci) nasopharyngeal (NP) colonization are hampered by the need to directly plate specimens in order to ensure isolate viability. A medium containing skim milk, tryptone, glucose, and glycerin (STGG) has been used to transport and store NP material, but its ability to preserve pneumococci has not been evaluated. Our objective was to qualitatively and semiquantitatively evaluate the ability of STGG to preserve pneumococci in NP secretions. Entw...

  14. Nasopharyngeal carriage, antibiogram & serotype distribution of Streptococcus pneumoniae among healthy under five children

    Directory of Open Access Journals (Sweden)

    K.L. Ravi Kumar


    Full Text Available Background & objectives: Information related to nasopharyngeal carriage of Streptococcus pneumoniae among healthy children is scanty in India. This prospective study was undertaken to determine the presence of asymptomatic nasopharyngeal colonization, assess serogroups/types (SGT and drug resistance of S. pneumoniae in children below five years of age. Methods: A total of 109 male and 81 female children in the age group of three months to five years belonging to different socio-economic classes were enrolled. They were recruited across all age groups from those attending paediatric OPD of a tertiary care and research centre for immunization program. Fifty three isolates identified as pneumococci were tested for their antimicrobial susceptibility pattern by Kirby-Bauer′s disc diffusion and E-Test methods. Serotyping was performed by detection of the quelling reaction with specific antiserum. Result: The pneumococcal carriage rate in the study population was 27.9 per cent. The isolation rate was associated with age being higher (49.2% in smaller children (3-12 months and among male (62.2%. The most prevalent SGTs were 19 followed by 10, 14 and 7; 21 per cent of isolates belonging to serotype 10 (n=7 were 11 (n=4 were not covered in any of the conjugate vaccines currently available in Indian market. Resistance to co-trimoxazole, tetracycline, penicillin and erythromycin was observed in 91 per cent (n=48, 36 per cent (n=19, 17 per cent (n=9 and 9 per cent (n=5 isolates, respectively. All the penicillin resistant isolates were found to be intermediately resistant by E-Test. Multidrug resistance was observed in 19 per cent (n=10 isolates. Interpretation & conclusions: High level of antibiotic resistance was present in S. pneumoniae isolated from healthy children below age five. A pneumococcal conjugate vaccine with the prevailing SGTs would help to reduce the pool of antibiotic resistant pneumococci. Continued surveillance of serotypes and tracking

  15. Draft genome sequences of Streptococcus bovis strains ATCC 33317 and JB1 (United States)

    We report the draft genome sequences of Streptococcus bovis type strain ATTC 33317 (CVM42251) isolated from cow dung and strain JB1 (CVM42252) isolated from a cow rumen in 1977. Strains were subjected to Next Generation sequencing and the genome sizes are approximately 2 MB and 2.2 MB, respectively....

  16. Biological and Epidemiological Features of Antibiotic-Resistant Streptococcus pneumoniae in Pre- and Post-Conjugate Vaccine Eras: a United States Perspective (United States)

    Kim, Lindsay; McGee, Lesley; Tomczyk, Sara


    SUMMARY Streptococcus pneumoniae inflicts a huge disease burden as the leading cause of community-acquired pneumonia and meningitis. Soon after mainstream antibiotic usage, multiresistant pneumococcal clones emerged and disseminated worldwide. Resistant clones are generated through adaptation to antibiotic pressures imposed while naturally residing within the human upper respiratory tract. Here, a huge array of related commensal streptococcal strains transfers core genomic and accessory resistance determinants to the highly transformable pneumococcus. β-Lactam resistance is the hallmark of pneumococcal adaptability, requiring multiple independent recombination events that are traceable to nonpneumococcal origins and stably perpetuated in multiresistant clonal complexes. Pneumococcal strains with elevated MICs of β-lactams are most often resistant to additional antibiotics. Basic underlying mechanisms of most pneumococcal resistances have been identified, although new insights that increase our understanding are continually provided. Although all pneumococcal infections can be successfully treated with antibiotics, the available choices are limited for some strains. Invasive pneumococcal disease data compiled during 1998 to 2013 through the population-based Active Bacterial Core surveillance program (U.S. population base of 30,600,000) demonstrate that targeting prevalent capsular serotypes with conjugate vaccines (7-valent and 13-valent vaccines implemented in 2000 and 2010, respectively) is extremely effective in reducing resistant infections. Nonetheless, resistant non-vaccine-serotype clones continue to emerge and expand. PMID:27076637

  17. Evolution of antimicrobial resistance and serotype distribution of Streptococcus pneumoniae isolated from children with invasive and noninvasive pneumococcal diseases in Algeria from 2005 to 2012 (United States)

    Ramdani-Bouguessa, N.; Ziane, H.; Bekhoucha, S.; Guechi, Z.; Azzam, A.; Touati, D.; Naim, M.; Azrou, S.; Hamidi, M.; Mertani, A.; Laraba, A.; Annane, T.; Kermani, S.; Tazir, M.


    Pneumococcal infections are a major cause of morbidity and mortality in developing countries. The introduction of pneumococcal conjugate vaccines (PCVs) has dramatically reduced the incidence of pneumococcal diseases. PCVs are not currently being used in Algeria. We conducted a prospective study from 2005 to 2012 in Algeria to determine antimicrobial drug resistance and serotype distribution of Streptococcus pneumoniae from children with pneumococcal disease. Among 270 isolated strains from children, 97 (36%) were invasive disease; of these, 48% were not susceptible to penicillin and 53% not susceptible to erythromycin. A high rate of antimicrobial nonsusceptibility was observed in strains isolated from children with meningitis. The serotype distribution from pneumococci isolated from children with invasive infections was (by order of prevalence): 14, 1, 19F, 19A, 6B, 5, 3, 6A and 23F. Multidrug resistance was observed in serotypes 14, 19F, 19A and 6B. The vaccine coverage of serotypes isolated from children aged Algeria and the increasing S. pneumoniae antibiotic resistance. The current pneumococcal vaccines cover a high percentage of the circulating strains. Therefore, vaccination would reduce the incidence of pneumococcal disease in Algeria. PMID:26106481

  18. [Antibiotic susceptibility of Staphylococcus aureus and Streptococcus pneumoniae in healthy carrier individuals in primary care in Barcelona area]. (United States)

    Llor, Carles; Boada, Albert; Pons-Vigués, Mariona; Grenzner, Elisabet; Juvé, Rosa; Almeda, Jesús


    The information available on antibiotic resistance patterns are generally based on specimens from hospitalised individuals. This study was aimed at evaluating the antibiotic resistance rate of nasal carriage strains of Staphylococcus aureus and Streptococcus pneumoniae in healthy individuals, in accordance with age and gender, attended in Primary Care Centres (PCC). Cross-sectional study. Seven PCC in the Barcelona area. Healthy nasal carriers aged 4years or more who did not present with any sign of infectious disease, and had not taken any antibiotic or had been hospitalised in the previous 3months. A total of 3,969 nasal swabs valid for identification were collected between 2010 and 2011 and were sent to one central microbiological laboratory for isolation of both pathogens. Resistance to common antibiotics was determined on the basis of the current European Committee on Antimicrobial Susceptibility Testing guidelines on cut-off points. The prevalence of methicillin-resistant S.aureus was 1.3% (95%CI: 0.5-2.1%), with resistance rates of 87.1% to phenoxymethylpenicillin and 11.6% to azithromycin, with no significant differences with age and gender. A total of 2.4% (95CI%: 0.1-4.7%) of the pneumococcal strains were highly resistant to both phenoxymethylpenicillin and macrolides, whereas the highest resistance rates were to cefaclor (53.3%), followed by tetracycline (20%) and cefuroxime (12.1%). These pathogens have lower resistance rates in the community than in the hospital setting. Primary Care physicians must be more aware of the current antimicrobial resistance, in order to ensure prudent use of antibiotics. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  19. Prevalence and clonal distribution of pcpA, psrP and Pilus-1 among pediatric isolates of Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Laura Selva

    Full Text Available Streptococcus pneumoniae is the leading cause of vaccine-preventable deaths globally. The objective of this study was to determine the distribution and clonal type variability of three potential vaccine antigens: Pneumococcal serine-rich repeat protein (PsrP, Pilus-1, and Pneumococcal choline binding protein A (PcpA among pneumococcal isolates from children with invasive pneumococcal disease and healthy nasopharyngeal carriers. We studied by Real-Time PCR a total of 458 invasive pneumococcal isolates and 89 nasopharyngeal pneumococcal isolates among children (total = 547 strains collected in Barcelona, Spain, from January 2004 to July 2010. pcpA, psrP and pilus-1 were detected in 92.8%, 51.7% and 14.4% of invasive isolates and in 92.1%, 48.3% and 18% of carrier isolates, respectively. Within individual serotypes the prevalence of psrP and pilus-1 was highly dependent on the clonal type. pcpA was highly prevalent in all strains with the exception of those belonging to serotype 3 (33.3% in serotype 3 isolates vs. 95.1% in other serotypes; P<.001. psrP was significantly more frequent in those serotypes that are less apt to be detected in carriage than in disease; 58.7% vs. 39.1% P<.001. Antibiotic resistance was associated with the presence of pilus-1 and showed a negative correlation with psrP. These results indicate that PcpA, and subsequently Psrp and Pilus-1 together might be good candidates to be used in a next-generation of multivalent pneumococcal protein vaccine.

  20. Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

    NARCIS (Netherlands)

    Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

    The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

  1. Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids.

    NARCIS (Netherlands)

    Jorens, P.G.; Parizel, P.M.; Demey, H.E.; Smets, K.; Jadoul, K.; Verbeek, M.M.; Wevers, R.A.; Cras, P.


    Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI

  2. The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae (United States)

    Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

  3. Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

    Directory of Open Access Journals (Sweden)

    Williams Thomas


    Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

  4. Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report (United States)


    Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap. PMID:22992300

  5. Sequence analysis of 96 genomic regions identifies distinct evolutionary lineages within CC156, the largest Streptococcus pneumoniae clonal complex in the MLST database.

    Directory of Open Access Journals (Sweden)

    Monica Moschioni

    Full Text Available Multi-Locus Sequence Typing (MLST of Streptococcus pneumoniae is based on the sequence of seven housekeeping gene fragments. The analysis of MLST allelic profiles by eBURST allows the grouping of genetically related strains into Clonal Complexes (CCs including those genotypes with a common descent from a predicted ancestor. However, the increasing use of MLST to characterize S. pneumoniae strains has led to the identification of a large number of new Sequence Types (STs causing the merger of formerly distinct lineages into larger CCs. An example of this is the CC156, displaying a high level of complexity and including strains with allelic profiles differing in all seven of the MLST loci, capsular type and the presence of the Pilus Islet-1 (PI-1. Detailed analysis of the CC156 indicates that the identification of new STs, such as ST4945, induced the merging of formerly distinct clonal complexes. In order to discriminate the strain diversity within CC156, a recently developed typing schema, 96-MLST, was used to analyse 66 strains representative of 41 different STs. Analysis of allelic profiles by hierarchical clustering and a minimum spanning tree identified ten genetically distinct evolutionary lineages. Similar results were obtained by phylogenetic analysis on the concatenated sequences with different methods. The identified lineages are homogenous in capsular type and PI-1 presence. ST4945 strains were unequivocally assigned to one of the lineages. In conclusion, the identification of new STs through an exhaustive analysis of pneumococcal strains from various laboratories has highlighted that potentially unrelated subgroups can be grouped into a single CC by eBURST. The analysis of additional loci, such as those included in the 96-MLST schema, will be necessary to accurately discriminate the clonal evolution of the pneumococcal population.

  6. The metalloregulatory zinc site in Streptococcus pneumoniae AdcR, a zinc-activated MarR family repressor. (United States)

    Reyes-Caballero, Hermes; Guerra, Alfredo J; Jacobsen, Faith E; Kazmierczak, Krystyna M; Cowart, Darin; Koppolu, Uma Mahendra Kumar; Scott, Robert A; Winkler, Malcolm E; Giedroc, David P


    Streptococcus pneumoniae D39 AdcR (adhesin competence repressor) is the first metal-sensing member of the MarR (multiple antibiotic resistance repressor) family to be characterized. Expression profiling with a ΔadcR strain grown in liquid culture (brain-heart infusion) under microaerobic conditions revealed upregulation of 13 genes, including adcR and adcCBA, encoding a high-affinity ABC uptake system for zinc, and genes encoding cell-surface zinc-binding pneumococcal histidine triad (Pht) proteins and AdcAII (Lmb, laminin binding). The ΔadcR, H108Q and H112Q adcR mutant allelic strains grown in 0.2 mM Zn(II) exhibit a slow-growth phenotype and an approximately twofold increase in cell-associated Zn(II). Apo- and Zn(II)-bound AdcR are homodimers in solution and binding to a 28-mer DNA containing an adc operator is strongly stimulated by Zn(II) with K(DNA-Zn)=2.4 × 10(8) M(-1) (pH 6.0, 0.2 M NaCl, 25 °C). AdcR binds two Zn(II) per dimer, with stepwise Zn(II) affinities K(Zn1) and K(Zn2) of ≥10(9) M(-1) at pH 6.0 and ≥10(12) M(-1) at pH 8.0, and one to three lower affinity Zn(II) depending on the pH. X-ray absorption spectroscopy of the high-affinity site reveals a pentacoordinate N/O complex and no cysteine coordination, the latter finding corroborated by wild type-like functional properties of C30A AdcR. Alanine substitution of conserved residues His42 in the DNA-binding domain, and His108 and His112 in the C-terminal regulatory domain, abolish high-affinity Zn(II) binding and greatly reduce Zn(II)-activated binding to DNA. NMR studies reveal that these mutants adopt the same folded conformation as dimeric wild type apo-AdcR, but fail to conformationally switch upon Zn(II) binding. These studies implicate His42, His108 and H112 as metalloregulatory zinc ligands in S. pneumoniae AdcR. Copyright © 2010 Elsevier Ltd. All rights reserved.

  7. Passive protection of mice against Streptococcus pneumoniae challenge by naturally occurring and vaccine-induced human anti-PhtD antibodies. (United States)

    Brookes, Roger H; Ming, Marin; Williams, Kimberley; Hopfer, Robert; Gurunathan, Sanjay; Gallichan, Scott; Tang, Mei; Ochs, Martina M


    Currently marketed Streptococcus pneumoniae vaccines are based on polysaccharide capsular antigens from the most common strains. Pneumococcal histidine triad protein D (PhtD) is a conserved surface protein that is being evaluated as a candidate for a vaccine with improved serotype coverage. Here, we measured the functional activity of human anti-PhtD antibodies in a passive protection model wherein mice were challenged with a lethal dose of S. pneumoniae by intravenous injection. This functional activity was compared with anti-PhtD antibody concentrations measured by enzyme-linked immunosorbent assay (ELISA) to estimate the 50% protective dose (ED50). Anti-PhtD antibodies affinity purified from pooled normal human sera passively protected mice with an ED50 of 1679 ELISA units/ml (95% confidence interval, 1420-1946). Sera from subjects injected with aluminum-adjuvanted PhtD in a phase I trial had similar activity per unit of antibody (ED50 = 1331 ELISA units/ml [95% confidence interval, 762-2038]). Vaccine-induced activity in the passive protection model was blocked by pre-incubation with recombinant PhtD but not by a control S. pneumoniae antigen (LytB). These results show that human anti-PhtD antibodies, whether naturally acquired or induced by the PhtD candidate vaccine, are functional. This supports the development of the PhtD candidate as part of a broadly protective pneumococcal vaccine.

  8. In vitro activity of ceftaroline against multidrug-resistant Staphylococcus aureus and Streptococcus pneumoniae: a review of published studies and the AWARE Surveillance Program (2008-2010). (United States)

    Farrell, David J; Castanheira, Mariana; Mendes, Rodrigo E; Sader, Helio S; Jones, Ronald N


    Ceftaroline is a new broad-spectrum parenteral cephalosporin with antibacterial activity against the prevalent pathogens causing both acute bacterial skin and skin structure infections (ABSSSIs) and community-acquired bacterial pneumonia (CABP). The Assessing Worldwide Antimicrobial Resistance Evaluation Surveillance Program was conducted in the United States between 2008 and 2010 to assess the in vitro activity of ceftaroline and comparator antibacterial agents against ABSSSI and CABP pathogens. A total of 8469 Staphylococcus aureus isolates and 3593 Streptococcus pneumoniae isolates collected from 72 medical centers representing all US Census regions were submitted to a central reference laboratory (JMI Laboratories, North Liberty, IA) for broth microdilution testing by reference methods. The overall prevalence of methicillin resistance among S. aureus isolates was 52.6%, and although ceftaroline showed more potent activity against methicillin-susceptible S. aureus (minimum inhibitory concentration for 50% [MIC(50)] and 90% [MIC(90)] of organisms, both 0.25 µg/mL) than against methicillin-resistant S. aureus (MIC(50) and MIC(90), both 1 µg/mL), it showed good activity against all 8469 S. aureus isolates (MIC(50) and MIC(90), 0.5 and 1 µg/mL, respectively), with 8296 isolates (98.0%) testing susceptible at the US Food and Drug Administration (FDA) break point of ≤ 1 µg/mL and no isolates having MICs of >2 µg/mL. Against S. pneumoniae, ceftaroline inhibited 98.7% of tested isolates at the FDA susceptible break point of ≤ 0.25 µg/mL (MIC(50) and MIC(90), 0.015 and 0.12 µg/mL, respectively) and was 16-fold more active than ceftriaxone (MIC(90), 2 µg/mL). The prevalence of multidrug resistance among S. pneumoniae isolates was 30.1% overall and remained stable over each of the 3 monitored years. Ceftaroline demonstrated high activity (MIC(50) and MIC(90), 0.12 and 0.25 µg/mL, respectively) against multidrug-resistant S. pneumoniae, with only 44 of 1001

  9. Streptococcus pneumoniae clonal complex 199: genetic diversity and tissue-specific virulence.

    Directory of Open Access Journals (Sweden)

    Jonathan C Thomas


    Full Text Available Streptococcus pneumoniae is an important cause of otitis media and invasive disease. Since introduction of the heptavalent pneumococcal conjugate vaccine, there has been an increase in replacement disease due to serotype 19A clonal complex (CC199 isolates. The goals of this study were to 1 describe genetic diversity among nineteen CC199 isolates from carriage, middle ear, blood, and cerebrospinal fluid, 2 compare CC199 19A (n = 3 and 15B/C (n = 2 isolates in the chinchilla model for pneumococcal disease, and 3 identify accessory genes associated with tissue-specific disease among a larger collection of S. pneumoniae isolates. CC199 isolates were analyzed by comparative genome hybridization. One hundred and twenty-seven genes were variably present. The CC199 phylogeny split into two main clades, one comprised predominantly of carriage isolates and another of disease isolates. Ability to colonize and cause disease did not differ by serotype in the chinchilla model. However, isolates from the disease clade were associated with faster time to bacteremia compared to carriage clade isolates. One 19A isolate exhibited hypervirulence. Twelve tissue-specific genes/regions were identified by correspondence analysis. After screening a diverse collection of 326 isolates, spr0282 was associated with carriage. Four genes/regions, SP0163, SP0463, SPN05002 and RD8a were associated with middle ear isolates. SPN05002 also associated with blood and CSF, while RD8a associated with blood isolates. The hypervirulent isolate's genome was sequenced using the Solexa paired-end sequencing platform and compared to that of a reference serotype 19A isolate, revealing the presence of a novel 20 kb region with sequence similarity to bacteriophage genes. Genetic factors other than serotype may modulate virulence potential in CC199. These studies have implications for the long-term effectiveness of conjugate vaccines. Ideally, future vaccines would target common

  10. Co-colonization by Streptococcus pneumoniae and Staphylococcus aureus in the throat during acute respiratory illnesses. (United States)

    DE Lastours, V; Malosh, R; Ramadugu, K; Srinivasan, U; Dawid, S; Ohmit, S; Foxman, B


    Pneumonia due to either Streptococcus pneumoniae (Sp) or Staphylococcus aureus (Sa) accounts for most mortality after influenza and acute respiratory illness (ARI). Because carriage precedes infection, we estimated Sp and Sa carriage to examine the co-colonization dynamics between Sp, Sa and respiratory viruses in the presence of ARI in the oropharynx. We tested oropharyngeal specimens of community subjects (aged ⩾2 years) with ARI for the presence of influenza A and B, 11 other common respiratory viruses, Sp and Sa, using real-time PCR. A total of 338 participants reported 519 ARI episodes of which 119 (35%) carried Sp, 52 (13%) carried Sa and 25 (7%) carried both. Thirty-five subjects tested positive for influenza, of which 14 (40%) carried Sp and six (17%) carried Sa, significantly more than in the influenza-negative group (P = 0·03 and P = 0·04, respectively). In subjects infected by any virus compared to those with no virus, Sp carriage (39·2% vs. 27·9%, P = 0·03) but not Sa carriage (11·6% vs. 14%, P = 0·6) was more frequent. For children, when Sa was present, Sp carriage tended to be less frequent than expected given the presence of viral infection, but not significantly [observed relative risk 1·14, 95% confidence interval (CI) 0·4-3·1; with a relative excess risk due to interaction of -0·11]. Independent of age, Sp carriers were more likely to return that season with subsequent ARI (odds ratio 2·14, 95% CI 1·1-4·3, P = 0·03). Both Sp and Sa carriage rates in the oropharynx increase during influenza infection in children. However, no negative interaction between Sp and Sa was observed. Sp carriers are more likely to suffer subsequent ARI episodes than non-carriers.

  11. Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae. (United States)

    Johnston, Calum; Caymaris, Stéphanie; Zomer, Aldert; Bootsma, Hester J; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W M; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre


    Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

  12. Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Calum Johnston

    Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

  13. Clinical presentation and prognostic factors of Streptococcus pneumoniae meningitis according to the focus of infection

    Directory of Open Access Journals (Sweden)

    Samuelsson Susanne


    Full Text Available Abstract Background We conducted a nationwide study in Denmark to identify clinical features and prognostic factors in patients with Streptococcus pneumoniae according to the focus of infection. Methods Based on a nationwide registration, clinical information's was prospectively collected from all reported cases of pneumococcal meningitis during a 2-year period (1999–2000. Clinical and laboratory findings at admission, clinical course and outcome of the disease including follow-up audiological examinations were collected retrospectively. The focus of infection was determined according to the clinical diagnosis made by the physicians and after review of the medical records. Results 187 consecutive cases with S. pneumoniae meningitis were included in the study. The most common focus was ear (30%, followed by lung (18%, sinus (8%, and other (2%. In 42% of cases a primary infection focus could not be determined. On admission, fever and an altered mental status were the most frequent findings (in 93% and 94% of cases, respectively, whereas back rigidity, headache and convulsion were found in 57%, 41% and 11% of cases, respectively. 21% of patients died during hospitalisation (adults: 27% vs. children: 2%, Fisher Exact Test, P P = 0.0005. Prognostic factors associated with fatal outcome in univariate logistic regression analysis were advanced age, presence of an underlying disease, history of headache, presence of a lung focus, absence of an otogenic focus, having a CT-scan prior to lumbar puncture, convulsions, requirement of assisted ventilation, and alterations in various CSF parameters (WBC P P = 0.005. Conclusion These results emphasize the prognostic importance of an early recognition of a predisposing focus to pneumococcal meningitis.

  14. Peptidoglycan Branched Stem Peptides Contribute to Streptococcus pneumoniae Virulence by Inhibiting Pneumolysin Release.

    Directory of Open Access Journals (Sweden)

    Neil G Greene


    Full Text Available Streptococcus pneumoniae (the pneumococcus colonizes the human nasopharynx and is a significant pathogen worldwide. Pneumolysin (Ply is a multi-functional, extracellular virulence factor produced by this organism that is critical for pathogenesis. Despite the absence of any apparent secretion or cell surface attachment motifs, Ply localizes to the cell envelope of actively growing cells. We sought to characterize the consequences of this surface localization. Through functional assays with whole cells and subcellular fractions, we determined that Ply activity and its release into the extracellular environment are inhibited by peptidoglycan (PG structure. The ability of PG to inhibit Ply release was dependent on the stem peptide composition of this macromolecule, which was manipulated by mutation of the murMN operon that encodes proteins responsible for branched stem peptide synthesis. Additionally, removal of choline-binding proteins from the cell surface significantly reduced Ply release to levels observed in a mutant with a high proportion of branched stem peptides suggesting a link between this structural feature and surface-associated choline-binding proteins involved in PG metabolism. Of clinical relevance, we also demonstrate that a hyperactive, mosaic murMN allele associated with penicillin resistance causes decreased Ply release with concomitant increases in the amount of branched stem peptides. Finally, using a murMN deletion mutant, we observed that increased Ply release is detrimental to virulence during a murine model of pneumonia. Taken together, our results reveal a novel role for branched stem peptides in pneumococcal pathogenesis and demonstrate the importance of controlled Ply release during infection. These results highlight the importance of PG composition in pathogenesis and may have broad implications for the diverse PG structures observed in other bacterial pathogens.

  15. A complex of equine lysozyme and oleic acid with bactericidal activity against Streptococcus pneumoniae.

    Directory of Open Access Journals (Sweden)

    Emily A Clementi

    Full Text Available HAMLET and ELOA are complexes consisting of oleic acid and two homologous, yet functionally different, proteins with cytotoxic activities against mammalian cells, with HAMLET showing higher tumor cells specificity, possibly due to the difference in propensity for oleic acid binding, as HAMLET binds 5-8 oleic acid molecules per protein molecule and ELOA binds 11-48 oleic acids. HAMLET has been shown to possess bactericidal activity against a number of bacterial species, particularly those with a respiratory tropism, with Streptococcus pneumoniae displaying the greatest degree of sensitivity. We show here that ELOA also displays bactericidal activity against pneumococci, which at lower concentrations shows mechanistic similarities to HAMLET's bactericidal activity. ELOA binds to S. pneumoniae and causes perturbations of the plasma membrane, including depolarization and subsequent rupture, and activates an influx of calcium into the cells. Selective inhibition of calcium channels and sodium/calcium exchange activity significantly diminished ELOA's bactericidal activity, similar to what we have observed with HAMLET. Finally, ELOA-induced death was also accompanied by DNA fragmentation into high molecular weight fragments - an apoptosis-like morphological phenotype that is seen during HAMLET-induced death. Thus, in contrast to different mechanisms of eukaryote cell death induced by ELOA and HAMLET, these complexes are characterized by rather similar activities towards bacteria. Although the majority of these events could be mimicked using oleic acid alone, the concentrations of oleic acid required were significantly higher than those present in the ELOA complex, and for some assays, the results were not identical between oleic acid alone and the ELOA complex. This indicates that the lipid, as a common denominator in both complexes, is an important component for the complexes' bactericidal activities, while the proteins are required both to solubilize

  16. Characterization of Streptococcus pneumoniae 5-enolpyruvylshikimate 3-phosphate synthase and its activation by univalent cations. (United States)

    Du, W; Wallis, N G; Mazzulla, M J; Chalker, A F; Zhang, L; Liu, W S; Kallender, H; Payne, D J


    The aroA gene (Escherichia coli nomenclature) encoding 5-enolpyruvylshikimate-3-phosphate (EPSP) synthase from the gram-positive pathogen Streptococcus pneumoniae has been identified, cloned and overexpressed in E. coli, and the enzyme purified to homogeneity. It was shown to catalyze a reversible conversion of shikimate 3-phosphate (S3P) and phosphoenolpyruvate (PEP) to EPSP and inorganic phosphate. Activation by univalent cations was observed in the forward reaction, with NH+4, Rb+ and K+ exerting the greatest effects. Km(PEP) was lowered by increasing [NH+4] and [K+], whereas Km(S3P) rose with increasing [K+], but fell with increasing [NH+4]. Increasing [NH+4] and [K+] resulted in an overall increase in kcat. Glyphosate (GLP) was found to be a competitive inhibitor with PEP, but the potency of inhibition was profoundly affected by [NH+4] and [K+]. For example, increasing [NH+4] and [K+] reduced Ki(GLP versus PEP) up to 600-fold. In the reverse reaction, the enzyme catalysis was less sensitive to univalent cations. Our analysis included univalent cation concentrations comparable with those found in bacterial cells. Therefore, the observed effects of these metal ions are more likely to reflect the physiological behavior of EPSP synthase and also add to our understanding of how to inhibit this enzyme in the host organism. As there is a much evidence to suggest that EPSP synthase is essential for bacterial survival, its discovery in the serious gram-positive pathogen S. pneumoniae and its inhibition by GLP indicate its potential as a broad-spectrum antibacterial target.

  17. Identification of high- and low-virulent strains of Chlamydia pneumoniae by their characterization in a mouse pneumonia model. (United States)

    Sommer, Kirsten; Njau, Florence; Wittkop, Ulrike; Thalmann, Jessica; Bartling, Gerda; Wagner, Annette; Klos, Andreas


    Contradicting reports exist about the pathogenicity of Chlamydia pneumoniae and the severity of the respiratory disease they cause. This study aimed to clarify, in mice, our hypothesis that marked differences in virulence of well-defined C. pneumoniae strains might exist for lung infections. C57BL/6J mice were intranasally infected with equal amounts of five different, identically prepared laboratory strains of C. pneumoniae. Based on the clinical score, weight, histopathological score, the granulocyte marker-enzyme myeloperoxidase, and the amount of Chlamydiae in the lung tissue, the C. pneumoniae isolates exhibited clear differences in overall growth characteristics or clearance, and pathological potential. Thus, we could identify chlamydial strains (Kajaani-K6 and CWL-029), where mice became seriously ill, as well as a relatively low-virulent isolate (TWAR-183). Cytokine profiles also varied drastically between the five strains in extent and kinetic. Our results indicate that C. pneumoniae isolates differ markedly with regard to their interaction with the host and their pathological potential. This might also be true for the infection in humans. Because the genomic diversity of C. pneumoniae is rather small, more subtle genomic deviations account most likely for the apparent functional differences. Our results will be useful to identify additional virulence factors in the future.

  18. In VitroStreptococcus pneumoniae Biofilm Formation and In Vivo Middle Ear Mucosal Biofilm in a Rat Model of Acute Otitis Induced by S. pneumoniae. (United States)

    Yadav, Mukesh Kumar; Chae, Sung-Won; Song, Jae-Jun


    Streptococcus pneumoniae is one of the most common pathogens of otitis media (OM) that exists in biofilm, which enhances the resistance of bacteria against antibiotic killing and diagnosis, compared to the free-floating (planktonic) form. This study evaluated biofilm formation by S. pneumoniae on an abiotic surface and in the middle ear cavity in a rat model of OM. In vitro biofilm formation was evaluated by inoculation of a 1:100 diluted S. pneumoniae cell suspension in a 96-well microplate. Adherent cells were quantified spectrophotometrically following staining with crystal violet by measurement of optical density at 570 nm. The ultrastructure of pneumococcal biofilm was assessed by scanning electron microscopy (SEM). For in vitro biofilm study, S. pneumoniae cell suspensions containing 1×10(7) colony forming units were injected through transtympanic membrane into the middle ear cavity of Sprague Dawley rats. The ultrastructure of middle ear mucus was observed by SEM 1 and 2 weeks post-inoculation. The in vitro study revealed robust biofilm formation by S. pneumoniae after 12-18 hours of incubation in high glucose medium, independent of exogenously supplied competence stimulating peptide and medium replacement. Adherent cells formed three-dimensional structures approximately 20-30 µm thick. The in vivo study revealed that ciliated epithelium was relatively resistant to biofilm formation and that biofilm formation occurred mainly on non-ciliated epithelium of the middle ear cavity. One week after inoculation, biofilm formation was high in 50% of the treated rats and low in 25% of the rats. After 2 weeks, biofilm formation was high and low in 25% and 37.5% of rats, respectively. The results imply that glucose level is important for the S. pneumoniae biofilm formation and S. pneumoniae biofilm formation may play important role in the pathophysiology of OM.

  19. Streptococcus anginosus (milleri) Group Strains Isolated in Poland (1996-2012) and their Antibiotic Resistance Patterns. (United States)

    Obszańska, Katarzyna; Kern-Zdanowicz, Izabella; Kozińska, Aleksandra; Machura, Katarzyna; Stefaniuk, Elzbieta; Hryniewicz, Waleria; Sitkiewicz, Izabela


    Streptococcus anginosus, Streptococcus intermedius and Streptococcus constellatus form a group of related streptococcal species, namely the Streptococcus Anginosus Group (SAG). The group, previously called "milleri" had been rarely described until 1980/1990 as source of infections. Nowadays SAG bacteria are often described as pathogens causing predominantly purulent infections. The number of infections is highly underestimated, as SAG strains are often classified in the microbiology laboratory as less virulent "viridans streptococci" Epidemiological situation regarding SAG infections in Poland has been unrecognized, therefore we performed a retrospective analysis of strains isolated between 1996 and 2012. Strains suspected of belonging to SAG were re-identified using an automated biochemical approach (Vitek2) and MALDI-TOF MS. We performed first analysis of antibiotic resistance among SAG strains isolated in Poland using automated methods (Vitek2), disk diffusion tests and E-Tests. We also performed PCR detection of resistance determinants in antibiotic resistant strains. Clonal structure of analyzed strains was evaluated with PFGE and MLVF methods. All three species are difficult to distinguish using automated diagnostic methods and the same is true for automated MIC evaluation. Our analysis revealed SAG strains are rarely isolated in Poland, predominantly from purulent infections. All isolates are very diverse on the genomic level as estimated by PFGE and MLVF analyses. All analyzed strains are sensitive to penicillin, a substantial group of strains is resistant to macrolides and the majority of strains are resistant to tetracycline.

  20. Self-assembled particulate PsaA as vaccine against Streptococcus pneumoniae infection

    Directory of Open Access Journals (Sweden)

    Majela González-Miro


    Full Text Available Streptococcus pneumoniae is a human pathogen responsible for the majority of childhood pneumonia and media otitis cases worldwide. The diversity of its capsular polysaccharides (CPS results in more than 91 serotypes of which at least 23 are virulent. Various CPS conjugated to immunogenic carrier proteins are currently licensed and provide protection against the infection caused by the respective serotypes but not against new and emerging virulent serotypes. In this study, we considered the conserved protein antigen PsaA, the pneumococcal surface adhesin A, in order to overcome the limitations of CPS antigens. The PsaA was translationally fused to a polyhydroxybutyrate (PHB synthase which mediated production of PsaA displayed on PHB inclusions in recombinant Escherichia coli. This suggested that the PsaA fusion to the PHB synthase did not interfere with PHB synthase activity and its ability to mediate formation of nano-sized inclusions composed of a PHB core surrounded by the PHB synthase fused to PsaA. Isolated PHB beads showed a negative surface charge. Transmission electron microscopy analysis suggested that the PsaA fusion to the PHB synthase reduced the size of PHB beads from about 500 nm to 100 nm. The integrity and antigenicity of the fusion protein attached to isolated PHB beads was confirmed by SDS-PAGE, tryptic peptide fingerprinting analysis using MALDI-TOF-MS/MS and immunoblotting using a monoclonal anti-PsaA antibody. Mice immunized with PsaA displaying PHB beads produced high and specific IgG levels dominated by IgG1 isotype. While IgG1 titer were similar between soluble and insoluble PsaA, the IgG2 titers were strongly increased upon vaccination with insoluble PsaA i.e. PsaA displayed on PHB beads. Particulate PsaA-PHB beads elicited IgG antibodies recognizing PsaA in whole cell lysates of seven different serotypes of S. pneumoniae. This study suggested that PHB beads are suitable carriers for PsaA in order to induce a significant

  1. [Morphology and immunotyping of AC-43 strain of Chlamydia pneumoniae isolated from a Japanese child]. (United States)

    Yamazaki, T


    A strain of Chlamydia pneumoniae (C. pneumoniae) which had been isolated from a Japanese child (AC-43) was examined morphologically and serologically using micro-immunofluorescent (micro-IF) test. Inclusions of AC-43 were stained by an indirect immunofluorescent method using C. pneumoniae specific monoclonal antibody. They were dense round inclusions which had been reported as a characteristic figure for C. pneumoniae. An elementary body (EB) of AC-43 was pear-shaped by electron micrograph, which was the same as previous reports for C. pneumoniae. We produced monoclonal antibodies using purified EB of AC-43 as antigen. Culture fluids of these clones reacted with C. pneumoniae antigens, but did not react with C. trachomatis or C. psittaci antigens by micro-IF tests. There was no difference in morphological and serological findings among standard strains and Japanese isolate of C. pneumoniae.

  2. Coordinated Bacteriocin Expression and Competence in Streptococcus pneumoniae Contributes to Genetic Adaptation through Neighbor Predation. (United States)

    Wholey, Wei-Yun; Kochan, Travis J; Storck, David N; Dawid, Suzanne


    Streptococcus pneumoniae (pneumococcus) has remained a persistent cause of invasive and mucosal disease in humans despite the widespread use of antibiotics and vaccines. The resilience of this organism is due to its capacity for adaptation through the uptake and incorporation of new genetic material from the surrounding microbial community. DNA uptake and recombination is controlled by a tightly regulated quorum sensing system that is triggered by the extracellular accumulation of competence stimulating peptide (CSP). In this study, we demonstrate that CSP can stimulate the production of a diverse array of blp bacteriocins. This cross stimulation occurs through increased production and secretion of the bacteriocin pheromone, BlpC, and requires a functional competence regulatory system. We show that a highly conserved motif in the promoter of the operon encoding BlpC and its transporter mediates the upregulation by CSP. The accumulation of BlpC following CSP stimulation results in augmented activation of the entire blp locus. Using biofilm-grown organisms as a model for competition and genetic exchange on the mucosal surface, we demonstrate that DNA exchange is enhanced by bacteriocin secretion suggesting that co-stimulation of bacteriocins with competence provides an adaptive advantage. The blp and com regulatory pathways are believed to have diverged and specialized in a remote ancestor of pneumococcus. Despite this, the two systems have maintained a regulatory connection that promotes competition and adaptation by targeting for lysis a wide array of potential competitors while simultaneously providing the means for incorporation of their DNA.

  3. Mutational and Biochemical Analysis of the DNA-entry Nuclease EndA from Streptococcus pneumoniae

    Energy Technology Data Exchange (ETDEWEB)

    M Midon; P Schafer; A Pingoud; M Ghosh; A Moon; M Cuneo; R London; G Meiss


    EndA is a membrane-attached surface-exposed DNA-entry nuclease previously known to be required for genetic transformation of Streptococcus pneumoniae. More recent studies have shown that the enzyme also plays an important role during the establishment of invasive infections by degrading extracellular chromatin in the form of neutrophil extracellular traps (NETs), enabling streptococci to overcome the innate immune system in mammals. As a virulence factor, EndA has become an interesting target for future drug design. Here we present the first mutational and biochemical analysis of recombinant forms of EndA produced either in a cell-free expression system or in Escherichia coli. We identify His160 and Asn191 to be essential for catalysis and Asn182 to be required for stability of EndA. The role of His160 as the putative general base in the catalytic mechanism is supported by chemical rescue of the H160A variant of EndA with imidazole added in excess. Our study paves the way for the identification and development of protein or low-molecular-weight inhibitors for EndA in future high-throughput screening assays.

  4. Mechanism of β-lactam action in Streptococcus pneumoniae: the piperacillin paradox. (United States)

    Philippe, Jules; Gallet, Benoit; Morlot, Cécile; Denapaite, Dalia; Hakenbeck, Regine; Chen, Yuxin; Vernet, Thierry; Zapun, André


    The human pathogen Streptococcus pneumoniae has been treated for decades with β-lactam antibiotics. Its resistance is now widespread, mediated by the expression of mosaic variants of the target enzymes, the penicillin-binding proteins (PBPs). Understanding the mode of action of β-lactams, not only in molecular detail but also in their physiological consequences, will be crucial to improving these drugs and any counterresistances. In this work, we investigate the piperacillin paradox, by which this β-lactam selects primarily variants of PBP2b, whereas its most reactive target is PBP2x. These PBPs are both essential monofunctional transpeptidases involved in peptidoglycan assembly. PBP2x participates in septal synthesis, while PBP2b functions in peripheral elongation. The formation of the "lemon"-shaped cells induced by piperacillin treatment is consistent with the inhibition of PBP2x. Following the examination of treated and untreated cells by electron microscopy, the localization of the PBPs by epifluorescence microscopy, and the determination of the inhibition time course of the different PBPs, we propose a model of peptidoglycan assembly that accounts for the piperacillin paradox. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  5. Coordinated Bacteriocin Expression and Competence in Streptococcus pneumoniae Contributes to Genetic Adaptation through Neighbor Predation.

    Directory of Open Access Journals (Sweden)

    Wei-Yun Wholey


    Full Text Available Streptococcus pneumoniae (pneumococcus has remained a persistent cause of invasive and mucosal disease in humans despite the widespread use of antibiotics and vaccines. The resilience of this organism is due to its capacity for adaptation through the uptake and incorporation of new genetic material from the surrounding microbial community. DNA uptake and recombination is controlled by a tightly regulated quorum sensing system that is triggered by the extracellular accumulation of competence stimulating peptide (CSP. In this study, we demonstrate that CSP can stimulate the production of a diverse array of blp bacteriocins. This cross stimulation occurs through increased production and secretion of the bacteriocin pheromone, BlpC, and requires a functional competence regulatory system. We show that a highly conserved motif in the promoter of the operon encoding BlpC and its transporter mediates the upregulation by CSP. The accumulation of BlpC following CSP stimulation results in augmented activation of the entire blp locus. Using biofilm-grown organisms as a model for competition and genetic exchange on the mucosal surface, we demonstrate that DNA exchange is enhanced by bacteriocin secretion suggesting that co-stimulation of bacteriocins with competence provides an adaptive advantage. The blp and com regulatory pathways are believed to have diverged and specialized in a remote ancestor of pneumococcus. Despite this, the two systems have maintained a regulatory connection that promotes competition and adaptation by targeting for lysis a wide array of potential competitors while simultaneously providing the means for incorporation of their DNA.

  6. Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

    Directory of Open Access Journals (Sweden)

    Tom Li Stephen


    Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

  7. A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic

    Directory of Open Access Journals (Sweden)

    Bogdan F. Ion


    Full Text Available Nicotinamidase (Nic is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic. In particular, density functional theory (DFT, molecular dynamics (MD and ONIOM quantum mechanics/molecular mechanics (QM/MM methods have been employed. The overall mechanism occurs in two stages: (i formation of a thioester enzyme-intermediate (IC2 and (ii hydrolysis of the thioester bond to give the products. The polar protein environment has a significant effect in stabilizing reaction intermediates and in particular transition states. As a result, both stages effectively occur in one step with Stage 1, formation of IC2, being rate limiting barrier with a cost of 53.5 kJ•mol−1 with respect to the reactant complex, RC. The effects of dispersion interactions on the overall mechanism were also considered but were generally calculated to have less significant effects with the overall mechanism being unchanged. In addition, the active site lysyl (Lys103 is concluded to likely play a role in stabilizing the thiolate of Cys136 during the reaction.

  8. Autolytic Activity and Plasma Binding Study of Aap, a Novel Minor Autolysin of Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Ramina Mahboobi


    Full Text Available Pneumococcal autolysins are enzymes involved in cell wall turnover and cellular division physiologically. They have been found to be involved in the pneumococcus pathogenesis. The aim of this study was to identify the autolytic activity of Spr1754 as a novel protein of Streptococcus pneumoniae. Moreover, the binding of the recombinant protein to plasma proteins was also determined. The spr1754 gene was amplified by PCR and cloned into the pET21a(+ prokaryotic expression vector. The constructed pET21a(+/spr1754 recombinant plasmid was transformed into E. coli Origami (DE3 and induced using IPTG. The recombinant protein of Spr1754 was purified by Ni-NTA affinity chromatography and confirmed by SDS-PAGE and Western blot analysis using anti-His tag monoclonal antibody. Autolytic activity and the ability of the recombinant protein in binding to plasma proteins were performed using zymogram analysis and western blot, respectively. The spr1754 with expected size was cloned and overexpressed in Escherichia coli Origami (DE3, successfully. After purification of the Spr1754 recombinant protein, the autolytic activity was observed by zymography. Of the four plasma proteins used in this study, binding of lactoferrin to Spr1754 recombinant protein was shown. The Spr1754 recombinant protein has a bifunctional activity, i.e., as being autolysin and lactoferrin binding and designated as Aap (autolytic/ adhesion/ pneumococcus. Nevertheless, characterization of the Aap needs to be followed using gene inactivation and cell wall localization.

  9. Inspecting the potential physiological and biomedical value of 44 conserved uncharacterised proteins of Streptococcus pneumoniae. (United States)

    Martín-Galiano, Antonio J; Yuste, José; Cercenado, María I; de la Campa, Adela G


    The major Gram-positive coccoid pathogens cause similar invasive diseases and show high rates of antimicrobial resistance. Uncharacterised proteins shared by these organisms may be involved in virulence or be targets for antimicrobial therapy. Forty four uncharacterised proteins from Streptococcus pneumoniae with homologues in Enterococcus faecalis and/or Staphylococcus aureus were selected for analysis. These proteins showed differences in terms of sequence conservation and number of interacting partners. Twenty eight of these proteins were monodomain proteins and 16 were modular, involving domain combinations and, in many cases, predicted unstructured regions. The genes coding for four of these 44 proteins were essential. Genomic and structural studies showed one of the four essential genes to code for a promising antibacterial target. The strongest impact of gene removal was on monodomain proteins showing high sequence conservation and/or interactions with many other proteins. Eleven out of 40 knockouts (one for each gene) showed growth delay and 10 knockouts presented a chaining phenotype. Five of these chaining mutants showed a lack of putative DNA-binding proteins. This suggest this phenotype results from a loss of overall transcription regulation. Five knockouts showed defective autolysis in response to penicillin and vancomycin, and attenuated virulence in an animal model of sepsis. Uncharacterised proteins make up a reservoir of polypeptides of different physiological importance and biomedical potential. A promising antibacterial target was identified. Five of the 44 examined proteins seemed to be virulence factors.

  10. Does dysregulated complement activation contribute to haemolytic uraemic syndrome secondary to Streptococcus pneumoniae? (United States)

    Gilbert, Rodney D; Nagra, Arvind; Haq, Mushfequr R


    We describe two patients with haemolytic uraemic syndrome (HUS) associated with invasive Streptococcus pneumoniae infection. Both patients had transiently reduced serum concentrations of complement C3. One had reduced expression of CD46 and never recovered renal function. No constitutive defect in regulation of the alternative pathway of complement activation was demonstrated in the second patient but there was an apparent improvement in her condition after administration of eculizumab. The most widely accepted mechanism for pneumococcal HUS is endothelial cell damage by pre-formed antibodies against the Thomsen-Friedenreich antigen. This explanation does not bear rigorous scrutiny. We postulate that transiently dysregulated complement activation may play a role in the pathogenesis of pneumococcal disease. We further postulate that the mechanism could be enhanced binding of factor H to the neuraminidase-altered surface of endothelial cells or reduced binding of factor H to the endothelial cell surface mediated by competitive binding of factor H by pneumococcal surface protein C (pspC). Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Evaluation of a rapid antigen test for detection of Streptococcus pneumoniae in cerebrospinal fluid. (United States)

    Boulos, Angel; Fairley, Derek; McKenna, James; Coyle, Peter


    Detection of Streptococcus pneumoniae antigen in cerebrospinal fluid (CSF) using lateral flow immunochromatography tests (ICTs) is an effective, rapid and low-cost method to diagnose pneumococcal meningitis. This study evaluated the diagnostic accuracy of the Uni-Gold ICT to detect pneumococcal antigen in CSF specimens, compared with gold standard bacteriology and quantitative real-time PCR (qPCR) testing. CSF specimens (n=69) from patients with suspected bacterial meningitis were included in the study. 13/69 (19%) were positive and 56/69 (81%) were negative for pneumococcus by the gold standard tests. The ICT had sensitivity of 85% (55%-98%), specificity of 96% (88%-100%), positive likelihood ratio of 23.7 (6-94) and negative likelihood ratio of 0.16 (0.04-0.57). Overall, a strong correlation between the ICT and qPCR results was seen (κ=0.81). In contrast, CSF microscopy and culture were exceptionally insensitive. The ICT method is sufficiently robust and accurate for use in algorithms to diagnose bacterial meningitis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to

  12. Identifying transmission routes of Streptococcus pneumoniae and sources of acquisitions in high transmission communities. (United States)

    Althouse, B M; Hammitt, L L; Grant, L; Wagner, B G; Reid, R; Larzelere-Hinton, F; Weatherholtz, R; Klugman, K P; Rodgers, G L; O'Brien, K L; Hu, H


    Identifying the transmission sources and reservoirs of Streptococcus pneumoniae (SP) is a long-standing question for pneumococcal epidemiology, transmission dynamics, and vaccine policy. Here we use serotype to identify SP transmission and examine acquisitions (in the same household, local community, and county, or of unidentified origin) in a longitudinal cohort of children and adults from the Navajo Nation and the White Mountain Apache American Indian Tribes. We found that adults acquire SP relatively more in the household than other age groups, and children 2-8 years old typically acquire in their own or surrounding communities. Age-specific transmission probability matrices show that transmissions within household were mostly seen from older to younger siblings. Outside the household, children most often transmit to other children in the same age group, showing age-assortative mixing behavior. We find toddlers and older children to be most involved in SP transmission and acquisition, indicating their role as key drivers of SP epidemiology. Although infants have high carriage prevalence, they do not play a central role in transmission of SP compared with toddlers and older children. Our results are relevant to inform alternative pneumococcal conjugate vaccine dosing strategies and analytic efforts to inform optimization of vaccine programs, as well as assessing the transmission dynamics of pathogens transmitted by close contact in general.

  13. Arginase 1 activity worsens lung-protective immunity against Streptococcus pneumoniae infection. (United States)

    Knippenberg, Sarah; Brumshagen, Christina; Aschenbrenner, Franziska; Welte, Tobias; Maus, Ulrich A


    Type 2 helper cell (Th2) dominated chronic lung diseases such as asthma are characterized by an increased risk for bacterial lung infections. However, the underlying mechanisms are poorly defined. Arginase 1 (Arg1) has been suggested to play an important role in the pathophysiology of asthma, and is rapidly induced in lung macrophages by Th2 cytokines, thereby limiting macrophage-derived antimicrobial nitric oxide (NO) production. Here we examined the effect of Th2 cytokine induced upregulation or lung myeloid cell specific conditional knockdown of Arg1 on lung resistance against Streptococcus pneumoniae (Spn) in mice. Lung macrophages responded with a profound induction of Arg1 mRNA and protein to treatment with IL-13 both in vitro and in vivo. IL-13-induced Arg1 activity in the lungs of mice led to significantly attenuated lung-protective immunity against Spn, while conditional Arg1 knockdown had no effect on lung-protective immunity against Spn. Collectively, the data show that Th2 cytokine induced increased Arg1 activity worsens lung-protective immunity against Spn, and interventions to block Th2 cytokine induced lung Arg1 activity may thus be a novel immunomodulatory strategy to lower the risk of bacterial infections in asthmatic patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Serotypes and antimicrobial resistance of meningeal isolates of Streptococcus pneumonia. Cuba, 2007-2012

    Directory of Open Access Journals (Sweden)

    Gilda Toraño-Peraza


    Full Text Available An observational study was conducted to know the serotypes and antimicrobial susceptibility of isolates of Streptococcus pneumoniae responsible for meningitis in Cuba, where there is no vaccine yet to prevent invasive pneumococcal disease. The study included the total number of isolates submitted to the "Pedro Kourí" Institute between 2007 and 2012 (N=237. Serotypes identification was performed using capsular swelling test and antimicrobial susceptibility was studied by determining the minimum inhibitory concentration using the broth microdilution method. Predominant serotypes were 6A, 6B, 14, 19F and 23F and other non-vaccinal 18 serogroups/serotypes were identified in 29.1% of the isolates. A tendency to an increased resistance to penicillin (44.3 % was observed; the most common resistance patterns were: penicillin-trimethoprim/sulfamethoxazole and penicillin-erythromycin (21.1% and 10.5%, respectively. The largest number of isolates resistant to penicillin was in serotypes 6B, 14, 19F and 23F and the possibility of resistant non-vaccine serotypes emergence should be considered. The results show that 70.4 % of the isolates studied corresponds to the serotypes included in 13-valent conjugated pneumococcal vaccine, but with 10-valent it would achieve a lower vaccination potential coverage (56.1%. This information must be considered when evaluating the decision to use in Cuba any commercially available vaccine or the proposal of another strategy of vaccination from autochthonous vaccine c