Distribución de serotipos de Streptococcus pneumoniae aislados de infecciones invasoras en el Hospital de Niños de Santa Fe Serotype distribution of Streptococcus pneumoniae isolated from invasive infections at the Hospital de Niños of Santa Fe.

Directory of Open Access Journals (Sweden)

C. Mayoral

2008-03-01

Full Text Available Con la introducción de vacunas conjugadas antineumocócicas se observó, en muchos países, disminución de aislamientos de Streptococcus pneumoniae del serotipo 14 y aumento de aislamientos correspondientes a serotipos no incluidos en esas vacunas. En 1993, el Hospital de Niños de Santa Fe comenzó la vigilancia de la distribución de serotipos de Streptococcus pneumoniae invasores. En este trabajo se estudió la correlación entre serotipo y a patología (neumonía/meningitis, b edad (menor o mayor de dos años, y c CIM de penicilina, para los serotipos aislados en el período 2003-2005. El serotipo predominante fue el 14, seguido del 1, 6B, 18C, 7F, 19F y 5. El serotipo 14 mostró asociación estadísticamente significativa con valores de CIM de penicilina entre 0,5 y 2 mg/l, no así con alguna patología, aunque se lo halló con mayor frecuencia en neumonías que en meningitis. Los serotipos 14 y 1 prevalecieron en niños menores y mayores de 2 años, respectivamente. La CIM de penicilina = 2 mg/l se observó más en neumonías que en meningitis. La frecuencia relativa de los diferentes serotipos hallados fue semejante a la observada en el período 1993-99; no obstante, los serotipos 18C, 4, 12F y 22F no se habían encontrado antes. La aparición de nuevos serotipos convierte en importante la vigilancia, dada la necesidad de formular vacunas que los incluyan y que efectivamente prevengan las infecciones neumocócicas más comunes.The serotype distribution of Streptococcus pneumoniae varies through time. The introduction of pneumococcal conjugate vaccines showed a decreased prevalence of pneumococcal invasive isolates belonging to serotype 14 and an increase of serotypes not therein included. In 1993, the Hospital de Niños of Santa Fe began surveillance of the serotype distribution of invasive S. pneumoniae disease. In the period 2003 - 2005, 76 isolates were analysed by studying the correlation between serotype and pathology, age and MIC

Multiplex PCR to determine Streptococcus pneumoniae serotypes causing otitis media in the Republic of Ireland with further characterisation of antimicrobial susceptibilities and genotypes.

LENUS (Irish Health Repository)

Vickers, I

2011-03-01

The purpose of this study was to determine the serotypes, genotypes and antimicrobial susceptibilities of Streptococcus pneumoniae causing otitis media (OM) in children in Dublin, Ireland. S. pneumoniae isolates (n = 28) from spontaneously discharging OM were studied. Serotyping was performed using a previously undescribed multiplex polymerase chain reaction (PCR) scheme in combination with serological methods. Multilocus sequence typing (MLST) was performed using standard procedures. Antimicrobial susceptibility testing was performed using the Etest method. Fourteen different S. pneumoniae serotypes were identified. The five most common serotypes were 3, 19F, 19A, 14 and 6A, which accounted for 68% of all infections. The 7-valent pneumococcal conjugate vaccine (PCV7), 10-valent pneumococcal conjugate vaccine (PHiD-CV) and 13-valent pneumococcal conjugate vaccine (PCV13) provided potential coverages of 43%, 46% and 86%, respectively. Reduced susceptibility to penicillin was evident for 25% of isolates and was associated with serotypes 14, 19A, 19F and 9V. A total of 21 different sequence types (STs) were identified. Pneumococcal Molecular Epidemiology Network (PMEN) clones or their variants represented 54% (15\\/28) of all isolates. Continued monitoring and characterisation of S. pneumoniae causing OM in Ireland is warranted in order to guide future vaccine and treatment policies.

Multidrug Resistance in Non-PCV13 Serotypes of Streptococcus pneumoniae in Northern Japan, 2014.

Science.gov (United States)

Kawaguchiya, Mitsuyo; Urushibara, Noriko; Kobayashi, Nobumichi

2017-03-01

Since the implementation of routine PCV13 immunization in Japan, nonvaccine serotypes (NVTs) have been increasing among clinical isolates of Streptococcus pneumoniae. In this study, susceptibility to 18 antibiotics was tested for all the 231 isolates with NVTs, which were collected from children Japan in 2014 (July-November). High resistance rates were observed for macrolides (>90.9%), tetracycline (91.3%), and clindamycin (75.3%), while penicillin (PEN) nonsusceptibility (PNSP; MIC ≥0.12 μg/ml) was detected in 42.9% of the pneumococci [39.4%; PEN-intermediate S. pneumoniae (PISP), 3.5%; PEN-resistant S. pneumoniae (PRSP)]. All serotype 15A isolates were PRSP (MIC, ≥2 μg/ml) or PISP, and PNSP was prevalent in also serotypes 23A (96.9%), 6C (41%), and 35B (33.3%). Overall, 42.0% of the isolates showed multidrug resistance (MDR). Sequence types (STs) determined for 20 PNSP isolates with NVTs were ST63 (15A), STs 242 or 5832 (6C), STs 338 or 5242 (23A), and ST558 (35B). All the PNSP isolates possessed tet(M), and erm(B) or mefA(A/E), and 70% of them were gPRSP having three altered genes pbp1a, pbp2x, and pbp2b. Among alterations in transpeptidase-coding region of penicillin-binding proteins (PBPs), two substitutions of T 371 S in the STMK motif and TSQF 574-577 NTGY in PBP1a were common to all PRSP isolates. The present study showed the spread of PNSP in NVTs 15A, 23A, 6C, and 35B, and the emergence of the MDR international clone Sweden 15A -ST63 in northern Japan.

The post-vaccine microevolution of invasive Streptococcus pneumoniae

NARCIS (Netherlands)

Cremers, Amelieke J H; Mobegi, Fredrick M; de Jonge, Marien I; van Hijum, Sacha A F T; Meis, Jacques F; Hermans, Peter W M; Ferwerda, Gerben; Bentley, Stephen D; Zomer, Aldert L

2015-01-01

The 7-valent pneumococcal conjugated vaccine (PCV7) has affected the genetic population of Streptococcus pneumoniae in pediatric carriage. Little is known however about pneumococcal population genomics in adult invasive pneumococcal disease (IPD) under vaccine pressure. We sequenced and serotyped

Population biology of Streptococcus pneumoniae in West Africa: multilocus sequence typing of serotypes that exhibit different predisposition to invasive disease and carriage.

Directory of Open Access Journals (Sweden)

Eric S Donkor

Full Text Available Little is known about the population biology of Streptococcus pneumoniae in developing countries, although the majority of pneumococcal infections occur in this setting. The aim of the study was to apply MLST to investigate the population biology of S. pneumoniae in West Africa.Seventy three invasive and carriage S. pneumoniae isolates from three West African countries including The Gambia, Nigeria and Ghana were investigated. The isolates covered seven serotypes (1, 3, 5, 6A, 11, 14, 23F and were subjected to multilocus sequence typing and antibiotic susceptibility testing.Overall, 50 different sequence types (STs were identified, of which 38% (29 were novel. The most common ST was a novel clone-ST 4012 (6.5%, and some clones including STs 913, 925, 1737, 2160 and 3310 appeared to be specific to the study region. Two STs including ST 63 and ST 4012 were associated with multiple serotypes indicating a history of serotype switching. ST 63 was associated with serotypes 3 and 23F, while ST 4012 was associated with serotypes 6A and 23. eBURST analyses using the stringent 6/7 identical loci definition grouped the 50 STs into 5 clonal complexes and 65 singletons, expressing a high level of genetic diversity among the isolates. Compared to the other serotypes, serotypes 1 and 5 isolates appeared to be more clonal. Internationally recognized antibiotic resistant clones of S. pneumoniae were generally absent in the population investigated and the only multidrug resistant isolate identified (1/66 belong to the Pneumocococcal Epidemiology Network clone ST 63.The pneumococcal population in West Africa is quite divergent, and serotypes that are common in invasive disease (such as serotypes 1 and 5 are more likely to be clonal than serotypes that are common in carriage.

Streptococcus pneumoniae aislados de infecciones invasivas: serotipos y resistencia antimicrobiana Streptococcus pneumoniae isolated from invasive infections: serotypes and antimicrobial resistance

Directory of Open Access Journals (Sweden)

Gladys Antonia Cueto Montoya

2007-03-01

Full Text Available Las meningoencefalitis bacterianas constituyen una enfermedad invasiva importante, quizás no tanto por su frecuencia, como por la gravedad de su cuadro. Los cambios en la epidemiología de los síndromes neurológicos infecciosos en Cuba a partir de la vacunación contra meningococo BC y Haemophilus influenzae b han hecho que el Streptococcus pneumoniae constituya el agente causal más frecuente. Debido al incremento de la resistencia de este microorganismo a los antibióticos habituales, se realizaron modificaciones al régimen terapéutico convencional, fundamentalmente en las meningitis pediátricas. Es necesario lograr el aislamiento en cultivo de este agente para conocer los serotipos más frecuentes en el país, y lograr una vacuna neumocócica conjugada, así como para la vigilancia de las cepas frente a los antimicrobianos.The bacterial meningoencephalitis is an important invasive disease, not only because of its frequency, but also because of the severity of its picture. The changes in the epidemiology of the neurological infectious syndromes in Cuba starting from the vaccination against meningococcus BC and Haemophilus infuenzae b have made that Streptococcus pneumoniae be the most frequent causal agent. Due to the increase of the resistance of this microorganism to habitual antibiotics, modifications were made in the conventional therapeutic regimen, mainly in the pediatric meningitis. It is necessary to achieve the isolation in culture of this agent to know the most common serotypes in the country, to attain a conjugated pneumococcal vaccine, and to keep the surveillance of the strains against the antimicrobials.

Emerging, Non-PCV13 Serotypes 11A and 35B of Streptococcus pneumoniae Show High Potential for Biofilm Formation In Vitro.

Directory of Open Access Journals (Sweden)

Mirian Domenech

Full Text Available Since the use of pneumococcal conjugate vaccines PCV7 and PCV13 in children became widespread, invasive pneumococcal disease (IPD has dramatically decreased. Nevertheless, there has been a rise in incidence of Streptococcus pneumoniae non-vaccine serotypes (NVT colonising the human nasopharynx. Nasopharyngeal colonisation, an essential step in the development of S. pneumoniae-induced IPD, is associated with biofilm formation. Although the capsule is the main pneumococcal virulence factor, the formation of pneumococcal biofilms might, in fact, be limited by the presence of capsular polysaccharide (CPS.We used clinical isolates of 16 emerging, non-PCV13 serotypes as well as isogenic transformants of the same serotypes. The biofilm formation capacity of isogenic transformants expressing CPSs from NVT was evaluated in vitro to ascertain whether this trait can be used to predict the emergence of NVT. Fourteen out of 16 NVT analysed were not good biofilm formers, presumably because of the presence of CPS. In contrast, serotypes 11A and 35B formed ≥45% of the biofilm produced by the non-encapsulated M11 strain.This study suggest that emerging, NVT serotypes 11A and 35B deserve a close surveillance.

Serotype distribution and antibiotic susceptibility of Streptococcus pneumoniae strains in the south of Tunisia: A five-year study (2012–2016 of pediatric and adult populations

Directory of Open Access Journals (Sweden)

Sonia Ktari

2017-12-01

Full Text Available Objectives: To analyze the serotype distribution of Streptococcus pneumoniae clinical isolates collected in the south of Tunisia over a 5-year period in different age groups and to assess their antimicrobial susceptibility patterns. Methods: A total of 305 non-duplicate S. pneumoniae isolates were collected between January 2012 and December 2016 at the university hospital in Sfax, Tunisia. All isolates were serotyped by multiplex PCR. The antibiotic susceptibility of all isolates was determined using the disk diffusion test or Etest assay. Results: Among the 305 pneumococcal isolates, 76 (24.9% were invasive and 229 (75.1% were non-invasive. The most common serotypes were 19F (20%, 14 (16.7%, 3 (9.2%, 23F (7.5%, 19A (5.9%, and 6B (5.9%. Potential immunization coverage rates for pneumococcal conjugate vaccines PCV7, PCV10, and PCV13 were 58%, 59.3%, and 78.7%, respectively. Three-quarters (75.3% of pneumococcal isolates were non-susceptible to penicillin. The resistance rate to erythromycin was 71.4%. Only two isolates were resistant to levofloxacin. Conclusions: 19F and 14 were the most prevalent serotypes in the south of Tunisia. The inclusion of a PCV in the immunization program could be useful for reducing the burden of pneumococcal diseases. The high resistance rate to penicillin and macrolides is alarming. Prudent use of antibiotics is crucial to prevent the selection of multidrug-resistant pneumococci. Keywords: Streptococcus pneumoniae, Antibiotic, Serotype, PCV, Tunisia

Lung abscess due to Streptococcus pneumoniae: a case series and brief review of the literature.

Science.gov (United States)

Nicolini, Antonello; Cilloniz, Catia; Senarega, Renata; Ferraioli, Gianluca; Barlascini, Cornelius

2014-01-01

Anaerobes used to be the most common cause of community-acquired lung abscess, and Streptococcus species used to be the second most common cause. In recent years, this has been changing. Klebsiella pneumoniae is now an increasing cause of community- acquired lung abscess, but Streptococcus species continue to be major pathogens. Necrotizing pneumonia has generally been regarded as a rare complication of pneumococcal infection in adults. Type 3 Streptococcus pneumoniae was the single most common type implicated in necrosis; however, many other serotypes were implicated. This entity predominately infects children, but is present also in adults. Lung abscess in adults due to Streptococcus pneumoniae is not common. In this regard we present a case series of pulmonary cavitation due to Streptococcus pneumoniae and discuss the possible pathogenic mechanism of the disease.

Molecular epidemiology of penicillin-nonsusceptible Streptococcus pneumoniae among children in Greece

NARCIS (Netherlands)

D. Bogaert (Debby); G.A. Syrogiannopoulos; I.N. Grivea; R. de Groot (Ronald); N.G. Beratis; P.W.M. Hermans (Peter)

2000-01-01

textabstractA total of 145 penicillin-nonsusceptible Streptococcus pneumoniae strains were isolated from young carriers in Greece and analyzed by antibiotic susceptibility testing, serotyping, restriction fragment end labeling (RFEL), and penicillin-binding protein

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

OpenAIRE

Quintero, B.; Araque, M.; van der Gaast-de Jongh, C.; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P. W. M.

2010-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5?years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae?S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6...

Demographic profile of healthy children with nasopharyngeal colonisation of Streptococcus pneumoniae: A research paper

Directory of Open Access Journals (Sweden)

Radhika Raman

2017-01-01

Full Text Available Background: Pneumonia is a preventable cause of mortality in children. Streptococcus pneumoniae colonising the nasopharynx of healthy children can cause invasive diseases and the serotype distribution of colonisation isolates should be an indicator of invasive disease, antibiotic resistance profiles, and potential vaccine coverage. Identifying factors influencing nasopharyngeal colonisation, the serotypes and antimicrobial resistance pattern can improve rational preventive strategies. Objectives: Identify risk factors associated with nasopharyngeal colonisation of S.pneumoniae in healthy children between 6 months to 5 years of age. Determine the serotype and antibiotic sensitivity of S. pneumoniae isolated from nasopharynx of healthy children. Methods: This prospective observational included 500 healthy children, 6months to 5 years of age. Demographic features of the study population, the serotypes and antimicrobial sensitivity pattern of S.Pneumoniae isolated from cultures of nasopharyngeal swabs were subjected to statistical analysis. Results: S. pneumoniae was isolated in 9% of 450 children. Increased nasopharyngeal carriage rate was associated with overcrowding 48.8% and poor ventilation 35.5%. 6B (n=16 was the most common serotype isolated. 69% were serogroups known to cause invasive disease All S. pneumoniae isolates were susceptible to vancomycin and linezolid. Antimicrobial susceptibility of PCV 7 serotypes were greater than non PCV 7 serotypes for almost all antimicrobials tested. Penicillin resistance was 11 % and MDR 51%

Antimicrobial resistance and serotyping of Streptococcus pneumoniae isolated from pediatric patients in Belo Horizonte, MG, Brazil Resistência antimicrobiana e sorotipagem de Streptococcus pneumoniae isolado de pacientes pediátricos em Belo Horizonte, MG

Directory of Open Access Journals (Sweden)

Ana Paula Gomes de Oliveira Magalhães

2003-07-01

Full Text Available Thirty one Streptococcus pneumoniae invasive strains were isolated from a pediatric population in Belo Horizonte from June, 1999 to May, 2001. Penicillin, trimethoprim-sulfamethoxazole, tetracycline and chloramphenicol resistance rates for the isolates were 41.9, 58.1, 25.8 and 3.2%, respectively. Intermediate penicillin resistant (MICs between 0.1 and 1.0 µg/ml and resistant (MICs > 2.0 µg/ml isolates occured at rates of 38.7 and 3.2%, respectively. Resistance to erythromycin, ofloxacin, rifampin or vancomicyn was not detected. Ten S. pneumoniae serotypes (14, 5, 10 A, 6B, 15B, 18C, 6 A, 18 A, 19 A and 19 F were identified. Serotype 14 (12 out of 31 was predominant among the isolates. Penicillin and trimethoprim-sulfamethoxazole resistance was more common in 14 and 6B serotypes.Trinta e três linhagens invasivas do S. pneumoniae foram isoladas a partir de pacientes pediátricos em Belo Horizonte, MG, Brasil, de junho de 1999 a maio de 2001. As taxas de resistência à penicilina, ao trimetoprim-sultametoxazol, tetraciclina e cloranfenicol foram respectivamente, 41, 9; 58,1 e 3,2%. A resistência intermediária à penicilina (MICs entre 0,1 e 1,0 µg/ml e resistência total (MICs>2.0 µg/ml ocorreram, respectivamente, nas porcentagens de 38,7 e 3,2%. Não foi detectada resistência à eritromicina, ofloxacin, rifampina e vancomicina. Foram identificados 9 sorotipos do S. pneumoniae (14, 5, 10 , 6B, 15B, 18C, 6 A, 18 19 A e 19F entre os isolados. O sorotipo 14 (12 de 31 foi predominate entre os isolados. A resistência à penicilina e ao trimetoprim-sulfametoxazol estava sempre associada aos sorotipos 14 e 6B.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Science.gov (United States)

Moore, Catrin E; Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P J; Parry, Christopher M

2016-01-01

The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9-6.2). The case fatality was 15.6% (95% CI 8-23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 - 2012.

Directory of Open Access Journals (Sweden)

Catrin E Moore

Full Text Available The 13-valent pneumococcal vaccine (PCV13 was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD. Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation.All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing.There were 90 Cambodian children hospitalized with IPD with a median (IQR age of 2.3 years (0.9-6.2. The case fatality was 15.6% (95% CI 8-23. Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%, 23F (8/50; 16%, 14 (6/50; 12%, 5 (5/50; 10% and 19A (3/50; 6%. Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing.This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel sequence types and resistotypes.

Serotype distribution in non-bacteremic pneumococcal pneumonia

DEFF Research Database (Denmark)

Benfield, Thomas Lars Vibe; Skovgaard, Marlene; Schønheyder, Henrik Carl

2013-01-01

There is limited knowledge of serotypes that cause non-bacteremic pneumococcal pneumonia (NBP). Here we report serotypes, their associated disease potential and coverage of pneumococcal conjugate vaccines (PCV) in adults with NBP and compare these to bacteremic pneumonia (BP).......There is limited knowledge of serotypes that cause non-bacteremic pneumococcal pneumonia (NBP). Here we report serotypes, their associated disease potential and coverage of pneumococcal conjugate vaccines (PCV) in adults with NBP and compare these to bacteremic pneumonia (BP)....

Carriage of Streptococcus pneumoniae 3 Years after Start of Vaccination Program, the Netherlands

NARCIS (Netherlands)

Spijkerman, J.; van Gils, E.J.M.; Veenhoven, R.H.; Hak, E.; Yzerman, E.P.F.; van den Ende, A.; Wijmenga-Monsuur, A.J.; van den Dobbelsteen, G.P.J.M.; Sanders, E.A.M.

2011-01-01

To evaluate the effectiveness of the 7-valent pneumococcal conjugate vaccine (PCV7) program, we conducted a cross-sectional observational study on nasopharyngeal carriage of Streptococcus pneumoniae 3 years after implementation of the program in the Netherlands. We compared pneumococcal serotypes in

Serotype distribution of Streptococcus pneumoniae causing invasive disease in the Republic of Ireland.

LENUS (Irish Health Repository)

Vickers, I

2011-05-01

The 7-valent pneumococcal conjugate vaccine (PCV7) was included in the routine infant immunization schedule in Ireland in September 2008. We determined the serotype of 977 S. pneumoniae isolates causing invasive disease between 2000-2002 and 2007-2008, assessed for the presence of the recently described serotype 6C and determined the susceptibility of isolates during 2007-2008 to penicillin and cefotaxime. Serotype 14 was the most common serotype during both periods and 7·7% of isolates previously typed as serotype 6A were serotype 6C. During 2000-2002 and 2007-2008, PCV7 could potentially have prevented 85% and 74% of invasive pneumococcal disease in the target population (i.e. children aged <2 years), respectively. The level of penicillin non-susceptibility was 17% in 2007-2008. Ongoing surveillance of serotypes is required to determine the impact of PCV7 in the Irish population and to assess the potential of new vaccines with expanded valency.

Recent epidemiology of Streptococcus pneumoniae in nasopharynxes of Korean children with acute otitis media.

Science.gov (United States)

Han, Seung Beom; Kim, Jong-Hyun; Kang, Jin Han; Ma, Sang Hyuk; Kim, Chun Soo; Kim, Kyung-Hyo; Kim, Hwang Min; Choi, Young Youn

2017-03-01

This prospective study was performed to evaluate serotype distribution, multilocus sequence typing, and antibiotic susceptibility of Streptococcus pneumoniae identified in Korean children with acute otitis media (AOM) after the introduction of a 7-valent pneumococcal conjugate vaccine (PCV7). Nasopharyngeal aspirates were collected from children diagnosed with AOM in seven hospitals in Korea. The bacteria identified in these samples and the serotypes, sequence types (STs), and antibiotic susceptibilities of S. pneumoniae isolates were evaluated. A total of 390 children were enrolled, and bacteria were identified in 376 (96.4%) children. S. pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were identified in 155 (39.7%), 127 (32.6%) and 86 (22.1%) children, respectively. Serotype 19A (22.4%) was the most common S. pneumoniae serotype, with serogroups 11 (14.7%) and 15 (13.5%) following. ST320 (23.5%) was the most common ST; ST166 (17.0%) and ST83 (8.5%) followed. The overall susceptibility rates of S. pneumoniae to oral penicillin V and amoxicillin/clavulanate were 2.6% and 53.2%, respectively. The susceptibility rate to cefditoren was 91.0%; however, the rates for other cephalosporins were less than 10.0%. Compared with other serogroups, S. pneumoniae serogroups 19, 11, and 15 showed significantly lower susceptibility rates to all the antibiotics tested. S. pneumoniae serotype 19A, serogroups 11 and 15 were the major nasopharyngeal-colonizing bacteria in Korean children with AOM after the introduction of PCV7. These relatively prevalent serotype/serogroups showed lower antibiotic susceptibility rates. Copyright © 2016. Published by Elsevier Ltd.

Genome-wide identification of Streptococcus pneumoniae genes essential for bacterial replication during experimental meningitis

DEFF Research Database (Denmark)

Molzen, T E; Burghout, P; Bootsma, H J

2010-01-01

Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... as targets for future therapy and prevention of pneumococcal meningitis, since their mutants were attenuated in both models of infection as well as in competitive growth in human cerebrospinal fluid in vitro.......Meningitis is the most serious of invasive infections caused by the Gram-positive bacterium Streptococcus pneumoniae. Vaccines protect only against a limited number of serotypes, and evolving bacterial resistance to antimicrobials impedes treatment. Further insight into the molecular pathogenesis...... genes mutants of which had become attenuated or enriched, respectively, during infection. The results point to essential roles for capsular polysaccharides, nutrient uptake, and amino acid biosynthesis in bacterial replication during experimental meningitis. The GAF phenotype of a subset of identified...

A Cross-sectional Survey Assessing Carriage of Streptococcus pneumoniae in a Healthy Population in Xinjiang Uygur Autonomous Region of China.

Science.gov (United States)

Xie, Na; Chen, Zhao Yun; Chen, Tao; Zhu, Bing Qing; Xu, Li; Gao, Yuan; Zhang, Ai Yu; Zhao, Pan; Liu, Ji Wen; Shao, Zhu Jun

2018-03-01

The carriage rate and serotype distribution of Streptococcus pneumoniae (S. pneumoniae) in a healthy population in China remains unclear. In this study, we collected the oropharyngeal swabs from 513 individuals in Xinjiang, China. Real-time PCR targeting the lytA gene and 12 serotypes were assessed to identify S. pneumoniae carriage. The total carriage rate of S. pneumoniae was 70.4% (361/513). The most prevalent serotypes were 19B/F, 18B/C, 5, and 6A/B. The highest carriage rate of S. pneumoniae was noted in children aged 6-10 years (88.6%), which merits further attention. The co-colonization rate of two or more S. pneumoniae serotypes was 79.8% (264/331). This study aimed to investigate the baseline pneumococcal carriage rate among healthy individuals in China to improve our understanding of the epidemiology of S. pneumoniae. Copyright © 2018 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

CRH Affects the Phenotypic Expression of Sepsis-Associated Virulence Factors by Streptococcus pneumoniae Serotype 1 In vitro

Directory of Open Access Journals (Sweden)

Colette G. Ngo Ndjom

2017-06-01

Full Text Available Sepsis is a life-threatening health condition caused by infectious pathogens of the respiratory tract, and accounts for 28–50% of annual deaths in the US alone. Current treatment regimen advocates the use of corticosteroids as adjunct treatment with antibiotics, for their broad inhibitory effect on the activity and production of pro-inflammatory mediators. However, despite their use, corticosteroids have not proven to be able to reverse the death incidence among septic patients. We have previously demonstrated the potential for neuroendocrine factors to directly influence Streptococcus pneumoniae virulence, which may in turn mediate disease outcome leading to sepsis and septic shock. The current study investigated the role of Corticotropin-releasing hormone (CRH in mediating key markers of pneumococcal virulence as important phenotypic determinants of sepsis and septic shock risks. In vitro cultures of serotype 1 pneumococcal strain with CRH promoted growth rate, increased capsule thickness and penicillin resistance, as well as induced pneumolysin gene expression. These results thus provide significant insights of CRH–pathogen interactions useful in understanding the underlying mechanisms of neuroendocrine factor's role in the onset of community acquired pneumonias (CAP, sepsis and septic shock.

Streptococcus pneumoniae Drugs Resistance in Acute Rhinosinusitis

Directory of Open Access Journals (Sweden)

Chong Jie Hao

2016-03-01

Full Text Available Background: Acute rhinosinusitis that usually caused by Streptococcus pneumoniae becomes the reason why patients seek for medical care. Drugs resistance in Streptococcus pneumoniae is increasing worldwide. This study was conducted to determine drugs resistance of Streptococcus pneumonia from acute rhinosinusitis in Dr. Hasan Sadikin General Hospital. Methods: A descriptive laboratory study was conducted in June–October 2014 at the Laboratory of Microbiology Faculty of Medicine Universitas Padjadjaran. The sample was taken using nasopharyngeal swabbing from 100 acute rhinosinusitis patients in Dr. Hasan Sadikin General Hospital and planted on tryptic soy agar containing 5% sheep blood and 5 μg/ml of gentamicin sulphate and then incubated in 5% CO2 incubator at 37°C for 24 hours. The identification of Streptococcus pneumonia was performed by optochin test. The susceptibility test against Streptococcus pneumoniae was done using disk diffusion method.The antibiotic disks were trimethoprim-sulfamethoxazole, oxacillin, levofloxacin, azithromycin, and doxycycline. Results: Out of 100 samples, 8 of them were tested positive for Streptococcus pneumoniae. Three of Streptococcus pneumoniae isolates died with unknown reason after it were stored at -80 .The drugs resistance test showed the resistance of Streptococcus pneumonia to oxacillin, azithromycin and trimethoprim were 6, whereas levofloxacin and doxycycline are 4. Conclusions: Streptococcus pneumonia drugs resistance in acute rhinosinusitis shows the resistance of Streptococcus pneumoniae to oxacillin, azithromycin and trimethoprim are 6, whereas the resistance to levofloxacin and doxycycline are 4.

Characterisation of Invasive Streptococcus pneumoniae Isolated from Cambodian Children between 2007 – 2012

Science.gov (United States)

Giess, Adam; Soeng, Sona; Sar, Poda; Kumar, Varun; Nhoung, Pheakdey; Bousfield, Rachel; Turner, Paul; Stoesser, Nicole; Day, Nicholas P. J.; Parry, Christopher M.

2016-01-01

Background The 13-valent pneumococcal vaccine (PCV13) was introduced in Cambodia in January 2015. There are limited data concerning the common serotypes causing invasive pneumococcal disease (IPD). Knowledge of the circulating pneumococcal serotypes is important to monitor epidemiological changes before and after vaccine implementation. Methods All episodes of IPD defined by the isolation of Streptococcus pneumoniae from blood, cerebrospinal fluid or other sterile site in Cambodian children admitted to the Angkor Hospital for Children in Siem Reap, Northwestern Cambodia, between 1st January 2007 and 1st July 2012 were retrospectively studied. Streptococcus pneumoniae isolates that could be retrieved underwent phenotypic typing and whole genome sequencing. Results There were 90 Cambodian children hospitalized with IPD with a median (IQR) age of 2.3 years (0.9–6.2). The case fatality was 15.6% (95% CI 8–23). Of 50 Streptococcus pneumoniae isolates available for further testing, 46% were penicillin non-susceptible and 8% were ceftriaxone non-susceptible, 78% were cotrimoxazole resistant, 30% were erythromycin resistant and 30% chloramphenicol resistant. There were no significant changes in resistance levels over the five-year period. The most common serotypes were 1 (11/50; 22%), 23F (8/50; 16%), 14 (6/50; 12%), 5 (5/50; 10%) and 19A (3/50; 6%). Coverage by PCV7, PCV10 and PCV13 was 44%, 76% and 92% respectively. We identified novel multilocus sequence types and resistotypes using whole genome sequencing. Conclusions This study suggests IPD is an important disease in Cambodian children and can have a significant mortality. PCV13 coverage of the serotypes determined in studied strains was high and consistent with another recent study. The phenotypic resistance patterns observed were similar to other regional studies. The use of whole genome sequencing in the present study provides additional typing and resistance information together with the description of novel

Identification of the smallest structure capable of evoking opsonophagocytic antibodies against Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.; Dekker, H.A.T.; Joosten, J.A.; Michalik, D.; de Souza, A.C.; Adamo, R.; Lahmann, M.; Oscarson, S.; Kamerling, J.P.|info:eu-repo/dai/nl/070433941; Snippe, H.

2008-01-01

Synthetic overlapping oligosaccharide fragments of Streptococcus pneumoniae serotype 14 capsular polysaccharide (Pn14PS), {6)-[β-D-Galp-(14)-]β-D-GlcpNAc-(13)-β-D-Galp-(14)-β-D-Glcp-(1}n, were conjugated to CRM197 protein and injected into mice to determine the smallest immunogenic structure. The

Nasopharyngeal carriage of Streptococcus pneumoniae and other bacteria in the 7th year after implementation of the pneumococcal conjugate vaccine in the Netherlands

NARCIS (Netherlands)

Bosch, Astrid A T M; van Houten, Marlies A.; Bruin, Jacob P.; Wijmenga-Monsuur, Alienke J.; Trzciński, Krzysztof; Bogaert, Debby; Rots, Nynke Y.; Sanders, Elisabeth A M

2016-01-01

After introduction of the 7-valent pneumococcal conjugate vaccine (PCV7) in the infant national immunization program (NIP) in the Netherlands in 2006, Streptococcus pneumoniae strains of the non-vaccine serotype 19A emerged and became the dominant serotype in carriage in children and their parents.

Incidence and serotype characterisation of Streptococcus agalactiae in a Portuguese hospital.

Science.gov (United States)

Pinto, Ana Mafalda; Pereira, Tamegão Aires; Alves, Valquíria; Araújo, António; Lage, Olga Maria

2018-06-01

Streptococcus agalactiae, commonly known as group B Streptococcus (GBS), has been recognised as a worldwide causative pathogenic agent of neonatal sepsis, meningitis and pneumonia. To better understand the behaviour of S. agalactiae in pregnant women from a hospital from the North of Portugal, retrospective analyses were performed to describe epidemiological, clinical and microbiological characteristics of the isolates obtained. Based on laboratorial records and the hospital's patient files, a 6-year retrospective study was performed to analyse S. agalactiae isolates from screened pregnant women between 35 and 37 weeks of gestation and hospitalised neonates from pregnant women between 24 and 41 weeks of gestation admitted in Hospital Pedro Hispano. Serotype characterisation was also performed in 67 GBS strains. In 6692 pregnant women between 35 and 37 weeks of gestation screened between 2011 and 2016, a total of 1377 S. agalactiae isolates (21%) were found. A high percentage (40%) of unknown colonisation status among hospitalised neonates from pregnant women between 24 and 41 weeks of gestations was also found. The incidence of neonatal sepsis was 8.7 (95% CI 7.0 to 10.8) cases per 1000 live births. Regarding serotype characterisation, serotype III (22.4%) was the most frequent, followed by serotype Ia (19.4%) and serotypes Ib and V (both with 17.9%). High epidemiological values of GBS colonisation and incidence were found in this study. In Portugal studies on the epidemiology and behaviour of S. agalactiae remain limited, reinforcing the importance and need for S. agalactiae screening across the country. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Circulation of Streptococcus pneumoniae clone Colombia5 ST289 in nine Latin American countries Circulación de Streptococcus pneumoniae clon Colombia5 ST289 en nueve países de América Latina

Directory of Open Access Journals (Sweden)

Carolina Firacative

2009-04-01

Full Text Available OBJECTIVE: To determine genetic relatedness of clone Colombia5 ST289 with invasive Streptococcus pneumoniae serotype 5 isolates recovered in nine Latin American countries. METHODS: Forty-four invasive S. pneumoniae serotype 5 isolates recovered from children under 5 years of age in Bolivia, Chile, Dominican Republic, Ecuador, Nicaragua, Panama, Paraguay, Peru, and Venezuela were studied. Pulsed-field gel electrophoresis patterns of DNA treated with SmaI restriction enzyme were classified using Tenover's criteria and analyzed with the Fingerprinting II program to determine their genetic relatedness with the Colombian clone. RESULTS: All isolates had a genetic similarity of 78.5% or more with the Colombian clone. Thirteen electrophoretic subtypes derived of pattern A were identified, and five of them (A5, A6, A8, A13, A27 comprised 61.4% of the isolates. CONCLUSIONS: Clone Colombia5 ST289 is disseminated in Latin America. This is important because S. pneumoniae serotype 5 frequently causes invasive disease in the region and is associated with trimethoprim-sulfamethoxazole resistance.OBJETIVO: Determinar la relación genética del clon Colombia5 ST289 con los aislamientos invasores de Streptococcus pneumoniae serotipo 5 provenientes de nueve países latinoamericanos. MÉTODOS: Se estudiaron 45 aislamientos invasores de Streptococcus pneumoniae serotipo 5 procedentes de niños menores de 5 años de Bolivia, Chile, Ecuador, Nicaragua, Panamá, Paraguay, Perú, República Dominicana y Venezuela. Los patrones en electroforesis en gel de campo pulsante del ADN tratado con la enzima de restricción SmaI se clasificaron mediante el criterio de Tenover y se analizaron con el programa Fingerprinting II para determinar su relación genética con el clon colombiano. RESULTADOS: Todos los aislamientos tuvieron una similitud genética de 78,5% o mayor con el clon colombiano. Se identificaron 13 subtipos electroforéticos derivados del patrón A y cinco de ellos

Dominance of multidrug-resistant Denmark(14)-32 (ST230) clone among Streptococcus pneumoniae serotype 19A isolates causing pneumococcal disease in Bulgaria from 1992 to 2013.

Science.gov (United States)

Setchanova, Lena Petrova; Alexandrova, Alexandra; Dacheva, Daniela; Mitov, Ivan; Kaneva, Radka; Mitev, Vanio

2015-02-01

A pneumococcal conjugate vaccine (PCV10) was introduced in Bulgarian national immunization program since April 2010. Clonal composition based on pulsed-field gel electrophoresis and multilocus sequence typing genotyping of 52 serotype 19A Streptococcus pneumoniae isolates was analyzed. These were invasive and respiratory isolates collected between 1992 and 2013 from both children (78.8% clone. The most frequent sequence type (ST) was ST230 (48.1%) and together with four other closely related STs (15.4%), belonging to ST1611, ST276, ST7466, and ST2013, which were single- and double-locus variants; they were included in the main CC230. The disappearance of highly drug-resistant ST663 clone and emergence of new clones as CC320 and CC199 was also observed among the rest 19A isolates. A comparison of clonal composition between invasive and noninvasive isolates did not show a great genetic diversity among both kinds of isolates. Continuous surveillance of serotype 19A population following the introduction of PCV10 is essential to evaluate the impact of the vaccine on the epidemiology of this serotype.

Fallos vacunales a vacunas conjugadas de Streptococcus pneumoniae y Haemophilus influenzae tipo b

Directory of Open Access Journals (Sweden)

Gonzalo Angulo

2016-11-01

Full Text Available Haemophilus influenzae type b and Streptococcus pneumoniae are the main cause agents of otitis, pneumonia, sepsis and meningitis, affecting mainly children under 5 years. Conjugate vaccines for encapsulated germs have dramatically decreased, the various diseases caused by these germs. Despite the decrease in morbidity and mortality, vaccine failures were observed. Children who experienced vaccine failures to Haemophilus influenzae type b had associated comorbidities more frequently than the general population (prematurity, HIV, Down syndrome, tumors, etc.. Nevertheless, most of these children have no medical history or immunological disorders. There is no consensus on whether all patients with vaccine failures should be assessed immunologically and how. There are recommendations to indicate a booster dose to patients with certain comorbidities and patients experiencing vaccine failure even in the absence of theses. Of the vaccine preparations available for Haemophilus influenzae type b association with acellular Bordetella pertussis proved to be less immunogenic and is currently being discouraged. Streptococcus pneumoniae serotypes 6B and 19F are less immunogenics and explain most of the vaccine failures in some series.

Serotype distribution of Streptococcus pneumoniae isolated from patients with invasive pneumococcal disease in Brazil before and after ten-pneumococcal conjugate vaccine implementation.

Science.gov (United States)

dos Santos, Silvia R; Passadore, Lilian F; Takagi, Elizabeth H; Fujii, Cristiane M; Yoshioka, Cristina R M; Gilio, Alfredo E; Martinez, Marina B

2013-12-09

The ten-pneumococcal conjugate vaccine (PCV10) was introduced into the national immunization program for childhood vaccination schedules by the Brazilian Health Public Service in March 2010. The aim of this study was to compare Streptococcus pneumoniae serotype distribution, antibiotic resistance patterns, and potential coverage before (January 2006-June 2010) and after (July 2010-September 2012) PCV10 introduction. The incidence of invasive pneumococcal disease (IPD), patient demographics, and disease characteristics were recorded. This study was conducted at the University Hospital of Sao Paulo University in Brazil from January 2006 to September 2012. Serotyping was performed using multiplex PCR typing, and antimicrobial sensitivity by Clinical and Laboratory Standards Institute (CLSI). A total of 259 S. pneumoniae strains were isolated from patients with IPD. The ages of the patients ranged from 3 months to 95 years old. The strains were isolated from cerebrospinal fluid, pleural fluid, and blood. The incidence of IPD among patients at HU-USP changed after the introduction of PCV10. The overall incidence of IPD was 3.42 cases per 1000 admissions in the vaccine pre- implementation period and of 2.99 cases per 1000 admissions in the vaccine post-implementation period. The incidence of IPD among children<2 y.o. attended at HU-USP changed significantly after the introduction of PCV10, from 20.30 to 3.97 of incidence. The incidence of PCV10- serotypes decrease from 16.47 to 0.44 in the same age, before and after PC10 implementation, respectively. Moreover, it was possible to realize the sensitivity to penicillin among isolates increased significantly in the post-vaccine period. Data from this study suggest that PCV10 contributed to decrease with PID rate among children less than 2 y.o. The resistance rate among pneumococcal isolates also could be observed since serotypes with greater resistance to beta lactam antibiotics were not easily isolated after vaccination

Characterization of Streptococcus pneumoniae isolates from Austrian companion animals and horses.

Science.gov (United States)

Ginders, Maximilian; Leschnik, Michael; Künzel, Frank; Kampner, Doris; Mikula, Claudia; Steindl, Georg; Eichhorn, Inga; Feßler, Andrea T; Schwarz, Stefan; Spergser, Joachim; Loncaric, Igor

2017-11-14

The aim of the present study was to investigate the genetic relatedness and the antimicrobial resistance profiles of a collection of Austrian Streptococcus pneumoniae isolates from companion animals and horses. A total of 12 non-repetitive isolates presumptively identified as S. pneumoniae were obtained during routinely diagnostic activities between March 2009 and January 2017. Isolates were confirmed as S. pneumoniae by bile solubility and optochin susceptibility testing, matrix-assisted laser desorption-ionization-time of flight (MALDI-TOF) mass spectrometry and sequence analysis of a part recA and the 16S rRNA genes. Isolates were further characterized by pneumolysin polymerase chain reaction (PCR) and genotyped by multilocus sequence typing (MLST). Antimicrobial susceptibility testing was performed and resistance genes were detected by specific PCR assays. All isolates were serotyped. Four sequence types (ST) (ST36, ST3546, ST6934 and ST6937) and four serotypes (3, 19A, 19F and 23F) were detected. Two isolates from twelve displayed a multidrug-resistance pheno- and genotype. This study represents the first comprehensive investigation on characteristics of S. pneumoniae isolates recovered from Austrian companion animals and horses. The obtained results indicate that common human sero- (23F) and sequence type (ST36) implicated in causing invasive pneumococcal disease (IPD) may circulate in dogs. Isolates obtained from other examined animals seem to be host-adapted.

Streptococcus pneumoniae urinary tract infection in pedeatrics.

Science.gov (United States)

Pougnet, Richard; Sapin, Jeanne; De Parscau, Loïc; Pougnet, Laurence

2017-06-01

Streptococcus pneumoniae infections in children are most often lung infections or meningitis. Urinary tract infections are much rarer. We present the case of a urinary tract infection with Streptococcus pneumoniae. The clinical picture was classical. The urine culture showed the presence of Streptococcus pneumoniae in urine (10 4 UFC/mL; with 2 × 10 4 leucocytes/mL). The literature mentions a few cases of such infections. In some studies, the prevalence of Streptococcus pneumoniae in urine of children is less than 1%. Those children mostly present abnormalities of urinary tract. In our case, urinary ultrasound scan have shown the presence of an ectopic kidney in this child. The discussion between the clinician and the biologist has contributed to the discovery of this renal anomaly.

Epidemiology of Streptococcus pneumoniae causing acute otitis media among children in Southern Catalonia throughout 2007-2013: Incidence, serotype distribution and vaccine's effectiveness.

Science.gov (United States)

Ochoa-Gondar, O; Figuerola-Massana, E; Vila-Corcoles, A; Aguirre, C A; de Diego, C; Satue, E; Gomez, F; Raga, X

2015-12-01

This study investigated incidence and serotype distribution of Streptococcus pneumoniae causing acute otitis media (AOM) in Catalonian children, evaluating vaccination effectiveness in the current era of extended valency pneumococcal conjugate vaccines (PCVs). Population-based surveillance study that included all AOM cases with isolation of pneumococcus (from otic fluids/otorrea) identified among children ≤14 years in the region of Tarragona (Southern Catalonia, Spain) from 01/01/2007 to 31/12/2013. Prevalence of infections caused by serotypes covered by the different PCVs formulations were calculated for the periods before and after 30/06/2010 (date of PCV7/PCV13 replacement). The indirect cohort method was used to estimate PCV7/13 effectiveness against vaccine-type infections. A total of 78 children with a pneumococcal AOM were identified across study period, which meant an incidence rate of 23 cases per 100,000 population-year. Thirty-six cases (46.2%) occurred within the late PCV7 era and 42 cases (53.8%) during the early PCV13 era. Overall, the most common serotypes were type 19A (21.7%), type 3 (13.3%) and type 15B (6.7%). Prevalence of cases caused by serotypes included in PCV7 did not substantially change between the first and the second study period (from 10.3% to 12.9%), whereas prevalence of cases caused by PCV13 serotypes showed a decreasing trend between both periods (from 65.5% to 48.4%). The aggregate PCV7/13 effectiveness against vaccine-type infections was 72% (95% confidence interval: -26 to 94). Pneumococcal conjugate vaccination appears an acceptable preventive option to prevent pneumococcal AOM in infants. However, its serotype coverage and clinical effectiveness are not optimal. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children.

Science.gov (United States)

Quintero, B; Araque, M; van der Gaast-de Jongh, C; Escalona, F; Correa, M; Morillo-Puente, S; Vielma, S; Hermans, P W M

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of S. pneumoniae colonization, S. aureus colonization, and S. pneumoniae-S. aureus co-colonization was 28%, 56%, and 16%, respectively. Pneumococcal serotypes 6B (14%), 19F (12%), 23F (12%), 15 (9%), 6A (8%), 11 (8%), 23A (6%), and 34 (6%) were the most prevalent. Non-respiratory atopy was a risk factor for S. aureus colonization (p = 0.017). Vaccine serotypes were negatively associated with preceding respiratory infection (p = 0.02) and with S. aureus colonization (p = 0.03). We observed a high prevalence of pneumococcal resistance against trimethoprim-sulfamethoxazole (40%), erythromycin (38%), and penicillin (14%). Semi-quantitative measurement of pneumococcal colonization density showed that children with young siblings and low socioeconomic status were more densely colonized (p = 0.02 and p = 0.02, respectively). In contrast, trimethoprim-sulfamethoxazole- and multidrug-resistant-pneumococci colonized children sparsely (p = 0.03 and p = 0.01, respectively). Our data form an important basis to monitor the future impact of pneumococcal vaccination on bacterial colonization, as well as to recommend a rationalized and restrictive antimicrobial use in our community.

streptococcus pneumoniae , klebsiella pneumoniae proteus vulgaris

African Journals Online (AJOL)

DR. AMINU

2-20mm) on Streptococcus pneumoniae and Proteus vulgaris when compared to the ... The result from this preliminary study suggests that the plant contains active compounds that .... Veterinary and Medical Laboratory Technology, Vom,. Jos.

Reappraisal of the taxonomy of Streptococcus suis serotypes 20, 22 and 26: Streptococcus parasuis sp. nov.

Science.gov (United States)

Nomoto, R; Maruyama, F; Ishida, S; Tohya, M; Sekizaki, T; Osawa, Ro

2015-02-01

In order to clarify the taxonomic position of serotypes 20, 22 and 26 of Streptococcus suis, biochemical and molecular genetic studies were performed on isolates (SUT-7, SUT-286(T), SUT-319, SUT-328 and SUT-380) reacted with specific antisera of serotypes 20, 22 or 26 from the saliva of healthy pigs as well as reference strains of serotypes 20, 22 and 26. Comparative recN gene sequencing showed high genetic relatedness among our isolates, but marked differences from the type strain S. suis NCTC 10234(T), i.e. 74.8-75.7 % sequence similarity. The genomic relatedness between the isolates and other strains of species of the genus Streptococcus, including S. suis, was calculated using the average nucleotide identity values of whole genome sequences, which indicated that serotypes 20, 22 and 26 should be removed taxonomically from S. suis and treated as a novel genomic species. Comparative sequence analysis revealed 99.0-100 % sequence similarities for the 16S rRNA genes between the reference strains of serotypes 20, 22 and 26, and our isolates. Isolate STU-286(T) had relatively high 16S rRNA gene sequence similarity with S. suis NCTC 10234(T) (98.8 %). SUT-286(T) could be distinguished from S. suis and other closely related species of the genus Streptococcus using biochemical tests. Due to its phylogenetic and phenotypic similarities to S. suis we propose naming the novel species Streptococcus parasuis sp. nov., with SUT-286(T) ( = JCM 30273(T) = DSM 29126(T)) as the type strain. © 2015 IUMS.

Identification of proteins in Streptococcus pneumoniae by reverse vaccinology and genetic diversity of these proteins in clinical isolates.

Science.gov (United States)

Argondizzo, Ana Paula Corrêa; da Mota, Fabio Faria; Pestana, Cristiane Pinheiro; Reis, Joice Neves; de Miranda, Antonio Basílio; Galler, Ricardo; Medeiros, Marco Alberto

2015-02-01

Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Virulence-associated proteins common and conserved among all capsular types now represent the best strategy to combat pneumococcal infections. Our aim was to identify conserved targets in pneumococci that showed positive prediction for lipoprotein and extracellular subcellular location using bioinformatics programs and verify the distribution and the degree of conservation of these targets in pneumococci. These targets can be considered potential vaccine candidate to be evaluated in the future. A set of 13 targets were analyzed and confirmed the presence in all pneumococci tested. These 13 genes were highly conserved showing around >96 % of amino acid and nucleotide identity, but they were also present and show high identity in the closely related species Streptococcus mitis, Streptococcus oralis, and Streptococcus pseudopneumoniae. S. oralis clusters away from S. pneumoniae, while S. pseudopneumoniae and S. mitis cluster closer. The divergence between the selected targets was too small to be observed consistently in phylogenetic groups between the analyzed genomes of S. pneumoniae. The proteins analyzed fulfill two of the initial criteria of a vaccine candidate: targets are present in a variety of different pneumococci strains including different serotypes and are conserved among the samples evaluated.

Clinical behavior of Streptococcus pneumoniae meningoencephalitis Comportamiento clinico y terapéutico de la meningoencefalitis por Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Raisa Bu-Coifiu Fanego

2009-12-01

Full Text Available OBJECTIVE: There was an increased number of cases of meningoencephalitis caused by Streptococcus pneumoniae, after the successful vaccination campaigns against Neisseria meningitidis and Haemophilus influenzae. This paper aims at describing the clinical characteristics, the laboratory findings, the complications, and the therapeutic management of these patients, who have been suffering from this disease since 1993 to 2006. METHOD: Twelve children with Streptococcus pneumoniae meningoencephalitis admitted to the pediatric hospital of San Miguel del Padron, City of Havana in this period were assessed. RESULTS: Children under one year are the most frequently affected. Septic shock and brain edema were the most severe complications. Three patients died, implying that this disease has a serious course. Early treatment of brain edema is very important to reduce mortality. The elective drugs for treatment of these cases of Streptococcus pneumoniae meningoencephalitis were vancomycin combined with cephalosporin, cefotaxime or ceftriaxone type. CONCLUSION: Patients with Streptococcus pneumoniae meningoencephalitis show clinical characteristics, complications, and sequels that are different to other bacterial meningoencephalitis, meaning that they could be helpful for physicians considering the differential diagnosis of meningoencephalitis.OBJETIVO: Existe un incremento de la meningoencefalitis producida por Streptococcus pneumoniae, después de las campañas exitosas de vacunación contra Neisseria meningitidis y Haemophilus influenzae. El objetivo de este trabajo es describir las caracteristicas clinicas, los hallazgos de laboratorio, las complicaciones y el manejo terapéutico de los pacientes que sufrieron esta enfermedad desde 1993 a 2006. MÉTODO: Se estudiaron doce niños con meningoencefalitis por Streptococcus pneumoniae ingresados en el Hospital Pediátrico de San Miguel del Padrón, Ciudad de La Habana en este periodo. RESULTADOS: Los ni

Association between nasopharyngeal load of Streptococcus pneumoniae, viral coinfection, and radiologically confirmed pneumonia in Vietnamese children.

Science.gov (United States)

Vu, Huong Thi Thu; Yoshida, Lay Myint; Suzuki, Motoi; Nguyen, Hien Anh Thi; Nguyen, Cat Dinh Lien; Nguyen, Ai Thi Thuy; Oishi, Kengo; Yamamoto, Takeshi; Watanabe, Kiwao; Vu, Thiem Dinh

2011-01-01

The interplay between nasopharyngeal bacterial carriage, viral coinfection, and lower respiratory tract infections (LRTIs) is poorly understood. We explored this association in Vietnamese children aged less than 5 years. A hospital-based case-control study of pediatric LRTIs was conducted in Nha Trang, Vietnam. A total of 550 hospitalized children (274 radiologically confirmed pneumonia [RCP] and 276 other LRTIs) were enrolled and 350 healthy controls were randomly selected from the community. Polymerase chain reaction-based methods were used to measure bacterial loads of Streptococcus pneumoniae (SP), Haemophilus influenzae, and Moraxella catarrhalis and to detect 13 respiratory viruses and bacterial serotypes in nasopharyngeal samples of study participants. The median nasopharyngeal bacterial load of SP was substantially higher in children with RCP compared with healthy controls or children with other LRTIs (P RCP or other LRTIs groups. An increased load of SP in the nasopharynx was associated with RCP, viral coinfection, and presence of pneumococcal capsule.

Silica desiccant packets for storage and transport of Streptococcus pneumoniae and other clinically relevant species.

Directory of Open Access Journals (Sweden)

Casey L Pell

Full Text Available Bacterial isolates are often transported between laboratories for research and diagnostic purposes. Silica desiccant packets (SDPs, which are inexpensive and do not require freezing, were evaluated for storage and recovery of bacterial isolates. Conditions such as inoculum size, swab type and temperature of storage were investigated using ten Streptococcus pneumoniae isolates. The optimized protocol was then tested using 49 additional S. pneumoniae isolates representing 40 serogroups. Overall, S. pneumoniae growth was considered satisfactory (>100 colony forming units for 98/109 (89.9% and 20/20 (100% swabs after 14 days at room temperature or 28 days at 4° C, respectively. Storage in SDPs did not impact on the ability of S. pneumoniae isolates to be subsequently serotyped. When the survival of nine other clinically relevant bacterial species was tested, seven were viable after 28 days at room temperature, the exceptions being Neisseria gonorrhoeae and Haemophilus influenzae. SDPs are suitable for transport and short-term storage of bacterial species including S. pneumoniae.

Case Report of Necrotizing Fasciitis Associated with Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Lei Jiao

2016-01-01

Full Text Available Necrotizing fasciitis, caused by Streptococcus pneumoniae, is an extremely rare and life-threatening bacterial soft tissue infection. We report a case of early necrotizing fasciitis associated with Streptococcus pneumoniae infection in a 26-year-old man who was immunocompromised with mixed connective tissue disease. The patient presented with acute, painful, erythematous, and edematous skin lesions of his right lower back, which rapidly progressed to the right knee. The patient underwent surgical exploration, and a diagnosis of necrotizing fasciitis was confirmed by pathological evidence of necrosis of the fascia and neutrophil infiltration in tissue biopsies. Cultures of fascial tissue biopsies and blood samples were positive for Streptococcus pneumoniae. To our knowledge, this is the first report of necrotizing fasciitis resulting from Streptococcus pneumoniae diagnosed at early phase; the patient recovered well without surgical debridement.

ROLE OF STREPTOCOCCUS PNEUMONIAE IN THE STRUCTURE OF BACTERIAL INFECTIONS IN THE CHILDREN HOSPITALIZED TO INPATIENT HOSPITALS IN MOSCOW IN 2011–2012

Directory of Open Access Journals (Sweden)

A. A. Baranov

2013-01-01

Full Text Available Data on the spread of Streptococcus pneumoniae serotypes in the RF are extremely limited. 3 pneumococcal conjugated vaccines are approved inRussia; however, neither has yet been employed in the framework of the national population immunization program. At the same time, it is the dataon the serotype range of pneumococcal infections that may be considered the prognostic efficacy criterion for the national vaccination programs.The objective of this research is identification of the circulating S. pneumoniae serotypes and spread of pneumococcal etiology infections in the structure of bacterial infections in the infants hospitalized to 5 inpatient hospital of Moscow in 2011–2012. The trial involved 864 patients in tote. Vast majority of patients (86% had acute purulent otitis media and sinusitis. Community-acquired pneumonia was diagnosed in 9% of patients, sepsis and bacteremia — in 3.6%; purulent meningitis — 1.2% of patients. It has been revealed that S. pneumoniae is the primary pathogen in the structure of nasopharyngeal carriage in the children under 5 years of age hospitalized with acute bacterial infections, and the primary bacterial causative agent of acute otitis media at this age. Nasopharyngeal pneumococcal carriage analysis revealed the prevalent serotypes — 19F, 14, 23F, 3, 6A and B; they were present in 3/4 of all cases; 19F was the most frequent (> 20%. Diversity of the S. pneumoniae serotypes detected in middle ear liquid was less significant — 17 serotypes (in comparison with 24 serotypes in nasopharynx. The 5 prevalent serotypes were 19F, 3, 14, 23F, 6B and 19A (> 75% in tote. Detection rate of serotypes 3 and 19A in middle ear liquid significantly exceeded the detection rate of these serotypes in case of nasopharyngeal carriage. The study of invasive infections revealed serotypes 14, 23F, 3 and 15C. These data may be used as a benchmark for future monitoring and evaluation of effect of PCV vaccines on epidemiology of

Streptococcus pneumoniae necrotizing fasciitis in systemic lupus erythematosus.

Science.gov (United States)

Sánchez, A; Robaina, R; Pérez, G; Cairoli, E

2016-04-01

Necrotizing fasciitis is a rapidly progressive destructive soft tissue infection with high mortality. Streptococcus pneumoniae as etiologic agent of necrotizing fasciitis is extremely unusual. The increased susceptibility to Streptococcus pneumoniae infection in patients with systemic lupus erythematosus is probably a multifactorial phenomenon. We report a case of a patient, a 36-year-old Caucasian female with 8-year history of systemic lupus erythematosus who presented a fatal Streptococcus pneumoniae necrotizing fasciitis. The role of computed tomography and the high performance of blood cultures for isolation of the causative microorganism are emphasized. Once diagnosis is suspected, empiric antibiotic treatment must be prescribed and prompt surgical exploration is mandatory. © The Author(s) 2015.

Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms.

Science.gov (United States)

Shak, Joshua R; Ludewick, Herbert P; Howery, Kristen E; Sakai, Fuminori; Yi, Hong; Harvey, Richard M; Paton, James C; Klugman, Keith P; Vidal, Jorge E

2013-09-10

Streptococcus pneumoniae is an important commensal and pathogen responsible for almost a million deaths annually in children under five. The formation of biofilms by S. pneumoniae is important in nasopharyngeal colonization, pneumonia, and otitis media. Pneumolysin (Ply) is a toxin that contributes significantly to the virulence of S. pneumoniae and is an important candidate as a serotype-independent vaccine target. Having previously demonstrated that a luxS knockout mutant was unable to form early biofilms and expressed less ply mRNA than the wild type, we conducted a study to investigate the role of Ply in biofilm formation. We found that Ply was expressed in early phases of biofilm development and localized to cellular aggregates as early as 4 h postinoculation. S. pneumoniae ply knockout mutants in D39 and TIGR4 backgrounds produced significantly less biofilm biomass than wild-type strains at early time points, both on polystyrene and on human respiratory epithelial cells, cultured under static or continuous-flow conditions. Ply's role in biofilm formation appears to be independent of its hemolytic activity, as S. pneumoniae serotype 1 strains, which produce a nonhemolytic variant of Ply, were still able to form biofilms. Transmission electron microscopy of biofilms grown on A549 lung cells using immunogold demonstrated that Ply was located both on the surfaces of pneumococcal cells and in the extracellular biofilm matrix. Altogether, our studies demonstrate a novel role for pneumolysin in the assembly of S. pneumoniae biofilms that is likely important during both carriage and disease and therefore significant for pneumolysin-targeting vaccines under development. The bacterium Streptococcus pneumoniae (commonly known as the pneumococcus) is commonly carried in the human nasopharynx and can spread to other body sites to cause disease. In the nasopharynx, middle ear, and lungs, the pneumococcus forms multicellular surface-associated structures called biofilms

Epidemiology of culture-confirmed infections of Streptococcus pneumoniae (2012-2015) and nasopharyngeal carriage in children and households in Taiwan (2014-2015).

Science.gov (United States)

Janapatla, Rajendra Prasad; Su, Lin-Hui; Chen, Hsin-Hang; Chang, Hsin-Ju; Tsai, Tian-Chi; Chen, Po-Yen; Chen, Chyi-Liang; Chiu, Cheng-Hsun

2017-06-01

An observational study was performed to investigate the carriage rate and serotypes of Streptococcus pneumoniae in the 13-valent pneumococcal conjugate vaccine (PCV13) era in Taiwan. From March 2014 to March 2015 a total of 500 healthy children and their households (631 adults) were enrolled from two large medical centres for nasopharyngeal carriage survey. Clinical isolates were prospectively collected from June 2012 to May 2015 at Chang Gung Memorial Hospital. We applied a multiplex polymerase chain reaction in addition to culture to detect S. pneumoniae. S. pneumoniae was isolated from 12.0 % of the children and 3.6 % of the households. In the children's cohort only 23.3 % of the isolates could be assigned to PCV13 serotypes; non-vaccine serotypes were predominant (76.6 %) and the most frequently detected non-vaccine serotypes were 15A/F and 15B/C (both 13.3 %), followed by 23A (6.7 %). In the household cohort, 21.7 % belonged to PCV13 serotypes, and 78.3 % to non-vaccine serotypes. Clinical analysis of culture-confirmed pneumococcal infection showed that infection caused by PCV13 serotypes decreased by 47 % from 83 % in 2012-2013 to 44 % in 2014-2015, while infection caused by non-PCV13 serotypes increased from 17 to 56 %. Among the carriage isolates a significantly higher percentage belonged to serogroup 15 compared to serogroup 19 (26.6 vs 6.66 %, 2014-2015; P=0.003). Therefore, clinical isolates belonging to serogroup 15 were more prevalent than those belonging to serogroup 19 (44.1 vs 32.3 %, 2014-2015; P=0.318). The isolation of non-vaccine serotypes and unknown serotypes after the introduction of PCV13 in children highlights the importance of continued surveillance for emerging serotypes.

Streptococcus pneumoniae carriage among healthy and sick pediatric patients before the generalized implementation of the 13-valent pneumococcal vaccine in Morocco from 2010 to 2011.

Science.gov (United States)

Jroundi, Imane; Mahraoui, Chafik; Benmessaoud, Rachid; Moraleda, Cinta; Munoz Almagro, Carmen; Seffar, Meryem; Tligui, Houssain; Kettani, Selma C; Benjelloun, Badr S; Alonso, Pedro L; Bassat, Quique

Nasopharyngeal carriage studies provide insights into the local prevalence of circulating pneumococcal serotypes. These data are critical to vaccination monitoring, as they allow for the prediction and assessment of impact. Very little data are available on the carriage of pneumococcal serotypes in Morocco. Here, we describe the prevalence of Streptococcus pneumoniae carriage and serotype distribution among 697 pediatric patients with ages ranging from 2 to 59 months who were admitted to a Moroccan hospital with severe pneumonia, as well as 195 healthy infants and young children who were recruited at a vaccination clinic. Carriage rates were 40.5% (79/195) for healthy children and 22.8% (159/697) for sick children. The most commonly observed circulating serotypes included 6A, 6B and 19F, all of which are included in the current 13-valent anti-pneumococcal conjugate vaccine that was recently introduced in Morocco. Monitoring of circulating serotypes remains necessary after vaccine introduction to assess whether serotype replacement is occurring. Copyright © 2016 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

MALDI-TOF mass spectrometry for differentiation between Streptococcus pneumoniae and Streptococcus pseudopneumoniae.

Science.gov (United States)

van Prehn, Joffrey; van Veen, Suzanne Q; Schelfaut, Jacqueline J G; Wessels, Els

2016-05-01

We compared the Vitek MS and Microflex MALDI-TOF mass spectrometry platform for species differentiation within the Streptococcus mitis group with PCR assays targeted at lytA, Spn9802, and recA as reference standard. The Vitek MS correctly identified 10/11 Streptococcus pneumoniae, 13/13 Streptococcus pseudopneumoniae, and 12/13 S. mitis/oralis. The Microflex correctly identified 9/11 S. pneumoniae, 0/13 S. pseudopneumoniae, and 13/13 S. mitis/oralis. MALDI-TOF is a powerful tool for species determination within the mitis group. Diagnostic accuracy varies depending on platform and database used. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Impacto de Streptococcus pneumoniae en las neumonías del niño latinoamericano Impact of Streptococcus pneumoniae in pneumonias of Latin American children

Directory of Open Access Journals (Sweden)

María Hortal

2000-09-01

Full Text Available La neumonía adquirida en la comunidad es una de las principales causas de morbilidad y mortalidad en la infancia. Estudios realizados en países en desarrollo indican que los cuadros de neumonía más graves se asocian a causas bacterianas, con predominio de Streptococcus pneumoniae, seguido por Haemophilus influenzae tipo b. El manejo de esas infecciones en los menores de 2 años se ve dificultado por la carencia de vacunas apropiadas y por la disminución de la susceptibilidad de S. pneumoniae a la penicilina y a otros antibióticos. En 1993, por iniciativa del Sistema Regional de Vacunas (SIREVA de la Organización Panamericana de la Salud y con la financiación de la Agencia Canadiense para el Desarrollo Internacional (Canadian International Development Agency: CIDA, se diseñó un estudio para identificar los tipos capsulares de S. pneumoniae que causan enfermedad invasora en los niños latinoamericanos menores de 5 años, con el propósito de determinar tanto la composición ideal de una vacuna conjugada que pudiera emplearse en la Región como la susceptibilidad a la penicilina de los aislados de S. pneumoniae. La iniciativa fue aceptada por Argentina, Brasil, Colombia, Chile, México y Uruguay. En este informe se analiza la información sobre la neumonía por S. pneumoniae generada en los países participantes. Se captaron 3 393 niños con infecciones sistémicas por S. pneumoniae, de las cuales 1 578 correspondían a neumonías. El análisis se concentró en los 1 409 casos de neumonía de Argentina, Brasil, Colombia, México y Uruguay. La distribución por edades evidenció un franco predominio de los menores de 2 años (63,8%. Se identificaron 12 tipos capsulares prevalentes, de los cuales los serotipos 14, 5 y 1 ocuparon los tres primeros lugares en la mayoría de los países. En el período 1993-1998, la resistencia a la penicilina aumentó en los cinco países; al comienzo del estudio, los mayores porcentajes correspondieron a M�

Bacteremia with Streptococcus pneumoniae

DEFF Research Database (Denmark)

Christensen, J S; Jensen, T G; Kolmos, H J

2012-01-01

We conducted a hospital-based cohort study among adult patients with first-time Streptococcus pneumoniae bacteremia (SPB) from 2000 through 2008. Patients were identified in a population-based bacteremia database and followed up for mortality through the Danish Civil Registration System (CRS...

Gene Regulation in Streptococcus pneumoniae: interplay between nutrition and virulence

NARCIS (Netherlands)

W.T. Hendriksen (Wouter)

2010-01-01

textabstractStreptococcus pneumoniae (the pneumococcus) is a Gram-positive bacterium, which belongs to the species of streptococci. Other pathogenic bacteria belonging to this class include Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus suis, Streptococcus uberis, Streptococcus

MLVA Typing of Streptococcus pneumoniae Isolates with Emphasis on Serotypes 14, 9N and 9V: Comparison of Previously Described Panels and Proposal of a Novel 7 VNTR Loci-Based Simplified Scheme.

Science.gov (United States)

Costa, Natália S; Pinto, Tatiana C A; Merquior, Vânia L C; Castro, Luciana F S; da Rocha, Filomena S P; Morais, Jaqueline M; Peralta, José M; Teixeira, Lúcia M

2016-01-01

Streptococcus pneumoniae remains as an important cause of community-acquired bacterial infections, and the nasopharynx of asymptomatic carriers is the major reservoir of this microorganism. Pneumococcal strains of serotype 14 and serogroup 9 are among the most frequently isolated from both asymptomatic carriers and patients with invasive disease living in Brazil. Internationally disseminated clones belonging to such serotypes have been associated with the emergence and spread of antimicrobial resistance in our setting, highlighting the need for epidemiological tracking of these isolates. In this scenario, Multiple Loci VNTR Analysis (MLVA) has emerged as an alternative tool for the molecular characterization of pneumococci, in addition to more traditional techniques such as Multi-Locus Sequence Typing (MLST) and Pulsed-Field Gel Electrophoresis (PFGE). In the present study, 18 VNTR loci, as well as other previously described reduced MLVA panels (7 VNTR loci), were evaluated as tools to characterize pneumococcal strains of serotypes 14, 9N and 9V belonging to international and regional clones isolated in Brazil. The 18 VNTR loci panel was highly congruent with MLST and PFGE, being also useful for indicating the genetic relationship with international clones and for discriminating among strains with indistinguishable STs and PFGE profiles. Analysis of the results also allowed deducing a novel shorter 7 VNTR loci panel, keeping a high discriminatory power for isolates of the serotypes investigated and a high congruence level with MLST and PFGE. The newly proposed simplified panel was then evaluated for typing pneumococcal strains of other commonly isolated serotypes. The results indicate that MLVA is a faster and easier to perform, reliable approach for the molecular characterization of S. pneumoniae isolates, with potential for cost-effective application, especially in resource-limited countries.

MOLECULAR TYPING OF STREPTOCOCCUS PNEUMONIAE BY THE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY IN ACCORDANCE TO THE PREVALENCE OF SEROTYPES IN THE RUSSIAN FEDERATION

Directory of Open Access Journals (Sweden)

N. M. Alyab'eva

2013-01-01

Full Text Available Aim: to compare two methods of S. pneumoniae molecular typing: classic serological method and the multiplex polymerase chain reaction (M-PCR assay modified in accordance to the date on the serotypes circulating in Russian Federation. Patients and methods: 420 pneumococcal isolates mainly from non-sterile loci were analyzed. After microbiological identification pneumococci were serologically typed with the means of specific antiserum produced by Staten Serum Institute (Denmark in latex agglutination test and/or capsular swelling method. At the same time we performed series of the M-PCR, which consisted of 7 consecutive reactions at the most. Results: serotype was identified by the means of serological method in all 420 strains of S. pneumoniae; in total we determined 24 different serotypes. By the means of the M-PCR we succeeded in identification of 95% (399/420 examined strains, and 90% of them were typed during the first 3 reactions. All isolates failed to be typed by M-PCR (n =21 have serotypes not included into the composition of the M-PCR. The results of serological and molecular typing were identical in 99,2% (396/399 of the isolates; 3 strains showed contradictory results: serotype 19A was found on serological assay and serotype 19F — on PCR assay. Conclusions: the introduced modification of M-PCR allows correct identification of pneumococcal serotype more than in 90% of strains circulating in the Russian Federation, including all serotypes of pneumococcal polysaccharide conjugate vaccine.

Dominance of multidrug resistant CC271 clones in macrolide-resistant streptococcus pneumoniae in Arizona

Directory of Open Access Journals (Sweden)

Bowers Jolene R

2012-01-01

Full Text Available Abstract Background Rates of resistance to macrolide antibiotics in Streptococcus pneumoniae are rising around the world due to the spread of mobile genetic elements harboring mef(E and erm(B genes and post-vaccine clonal expansion of strains that carry them. Results Characterization of 592 clinical isolates collected in Arizona over a 10 year period shows 23.6% are macrolide resistant. The largest portion of the macrolide-resistant population, 52%, is dual mef(E/erm(B-positive. All dual-positive isolates are multidrug-resistant clonal lineages of Taiwan19F-14, mostly multilocus sequence type 320, carrying the recently described transposon Tn2010. The remainder of the macrolide resistant S. pneumoniae collection includes 31% mef(E-positive, and 9% erm(B-positive strains. Conclusions The dual-positive, multidrug-resistant S. pneumoniae clones have likely expanded by switching to non-vaccine serotypes after the heptavalent pneumococcal conjugate vaccine release, and their success limits therapy options. This upsurge could have a considerable clinical impact in Arizona.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia Susceptibility to antimicrobial agents in isolates of invasive Streptococcus pneumoniae in Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P A study was done to determine the patterns of susceptibility to antimicrobial agents in isolates of Streptococcus

Monoclonal Idiotope Vaccine against Streptococcus pneumoniae Infection

Science.gov (United States)

McNamara, Mary K.; Ward, Ronald E.; Kohler, Heinz

1984-12-01

A monoclonal anti-idiotope antibody coupled to a carrier protein was used to immunize BALB/c mice against a lethal Streptococcus pneumoniae infection. Vaccinated mice developed a high titer of antibody to phosphorylcholine, which is known to protect against infection with Streptococcus pneumoniae. Measurement of the median lethal dose of the bacteria indicated that anti-idiotope immunization significantly increased the resistance of BALB/c mice to the bacterial challenge. Antibody to an idiotope can thus be used as an antigen substitute for the induction of protective immunity.

Polyamine transporter potABCD is required for virulence of encapsulated but not nonencapsulated Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Haley R Pipkins

Full Text Available Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causative agent of multiple diseases. Since invasive pneumococcal infections are associated with encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumococcal vaccines. However, there is an increasing distribution of non-vaccine serotypes, as well as nonencapsulated S. pneumoniae (NESp. Both encapsulated and nonencapsulated pneumococci possess the polyamine oligo-transport operon (potABCD. Previous research has shown inactivation of the pot operon in encapsulated pneumococci alters protein expression and leads to a significant reduction in pneumococcal murine colonization, but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumolysin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla model of otitis media (OM, the absence of potD does not significantly affect MNZ67 virulence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain TIGR4 (serotype 4. Deletion of potD also significantly reduced persistence of TIGR4 in the lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is important for the regulation of protein expression and biofilm formation in both encapsulated and NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67 murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore, NESp virulence regulation needs to be further established to identify potential NESp therapeutic targets.

Individual risk factors associated with nasopharyngeal colonization with Streptococcus pneumoniae and Haemophilus influenzae: a Japanese birth cohort study.

Science.gov (United States)

Otsuka, Taketo; Chang, Bin; Shirai, Takatoshi; Iwaya, Atsushi; Wada, Akihito; Yamanaka, Noboru; Okazaki, Minoru

2013-07-01

The first step in a bacterial disease is the establishment of nasopharyngeal carriage. We conducted a birth cohort study to identify factors associated with colonization in healthy children and evaluate the serotype distributions and resistances of Streptococcus pneumoniae/Haemophilus influenzae. Nasopharyngeal cultures were obtained from 349 subjects at 5 time points coinciding with health checkups (4, 7, 10, 18 and 36 months). A total of 551 S. pneumoniae (penicillin resistance rate: 46.3%) and 301 H. influenzae (ampicillin resistance rate: 44.5%) isolates were obtained from 1654 samples. In this study, 47.5% and 60.9% of S. pneumoniae isolates were included in the serotypes of 7- and 13-valent pneumococcal conjugate vaccines, respectively. Analyzing by Cox proportional hazards models, cohabiting older sibling(s) attending day-care (hazard ratios: 2.064-3.518, P rates. This data indicated that introduction of appropriate antimicrobial usage in areas of overuse of antimicrobials could contribute to lower colonization of S. pneumoniae/H. influenzae, resulting in a decrease in the absolute number of resistant isolates. Strategies to control transmission at day-care centers or from older sibling(s) as well as appropriate use of antimicrobials are essential for reducing colonization and the absolute number of resistant isolates.

Factors associated with colonization of Streptococcus pneumoniae ...

African Journals Online (AJOL)

with schooling and presence chronic diseases. ... Streptococcus pneumoniae is a leading cause of serious community-acquired infections such as ... large number of individuals are still suffering from infections caused by these bacteria, especially ... samples of children with severe pneumonia (Nantanda et al., 2008).

Detection and quantification of Streptococcus pneumoniae from ...

African Journals Online (AJOL)

The aim of this study was to develop a real time polymerase chain reaction (PCR) for quantitative detection of Streptococcus pneumoniae from clinical respiratory specimens. Initially, 184 respiratory specimens from patients with community acquired pneumonia (CAP) (n = 129) and 55 cases with hospital associated ...

Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-10-01

Full Text Available Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolates (17%, with 12 (11% having an intermediate level of sensitivity and 7 (6% showing outright resistance. Only 1 of the 19 isolates resistant to penicillin also showed resistance to ceftriaxone. There was diminished sensitivity to erythromycin in 3 isolates (3%, to chloramphenicol in 6 (5%, and to co-trimoxazole (trimethoprim + sulfamethoxazole in 46 (40%. Resistance to multiple drugs was found in 7 isolates (6%. The most commonly encountered penicillin-resistant serotype was 23F (68.4%. An association was observed between age, prior use of antibiotics, and colonization by S. pneumoniae with reduced penicillin sensitivity or multiple-drug resistance. This study confirmed the presence of antibiotic-resistant S. pneumoniae in Colombia and highlights the importance of the rational use of antibiotics and of the implementation of epidemiologic surveillance for this agent.Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia

Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía Antibiotic susceptibility of Streptococcus pneumoniae colonizing the nasopharynx of Colombian children with pneumonia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-04-01

Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.Streptococcus pneumoniae is one of the principal causal agents of acute respiratory infection (ARI in children, and its resistance to antibiotics has increased worldwide. This study examined the patterns of susceptibility to antibiotics of S. pneumoniae that had colonized the upper respiratory tract of 272 children hospitalized for pneumonia in two hospitals in Santafé de Bogotá. S. pneumoniae was isolated from 114 patients (42%. Diminished susceptibility to penicillin was noted in 19 isolations (17%, with 12 (11

Effect of decreased BCAA synthesis through disruption of ilvC gene on the virulence of Streptococcus pneumoniae.

Science.gov (United States)

Kim, Gyu-Lee; Lee, Seungyeop; Luong, Truc Thanh; Nguyen, Cuong Thach; Park, Sang-Sang; Pyo, Suhkneung; Rhee, Dong-Kwon

2017-08-01

Streptococcus pneumoniae (pneumococcus) is responsible for significant morbidity and mortality worldwide. It causes a variety of life-threatening infections such as pneumonia, bacteremia, and meningitis. In bacterial physiology, the metabolic pathway of branched-chain amino acids (BCAAs) plays an important role in virulence. Nonetheless, the function of IlvC, one of the enzymes involved in the biosynthesis of BCAAs, in S. pneumoniae remains unclear. Here, we demonstrated that downregulation of BCAA biosynthesis by ilvC ablation can diminish BCAA concentration and expression of pneumolysin (Ply) and LytA, and subsequently attenuate virulence. Infection with an ilvC mutant showed significantly reduced mortality and colonization in comparison with strain D39 (serotype 2, wild type), suggesting that ilvC can potentiate S. pneumoniae virulence due to adequate BCAA synthesis. Taken together, these results suggest that the function of ilvC in BCAA synthesis is essential for virulence factor and could play an important role in the pathogenesis of respiratory infections.

Capsular Polysaccharide Expression in Commensal Streptococcus Species

DEFF Research Database (Denmark)

Skov Sørensen, Uffe B; Yao, Kaihu; Yang, Yonghong

2016-01-01

Expression of a capsular polysaccharide is considered a hallmark of most invasive species of bacteria, including Streptococcus pneumoniae, in which the capsule is among the principal virulence factors and is the basis for successful vaccines. Consequently, it was previously assumed that capsule....... pneumoniae evolved by import of cps fragments from commensal Streptococcus species, resulting in a mosaic of genes of different origins. The demonstrated antigenic identity of at least eight of the numerous capsular polysaccharide structures expressed by commensal streptococci with recognized serotypes of S...... of Streptococcus pneumoniae and is the basis for successful vaccines against infections caused by this important pathogen. Contrasting with previous assumptions, this study showed that expression of capsular polysaccharides by the same genetic mechanisms is a general property of closely related species...

Associations of Streptococcus suis serotype 2 ribotype profiles with clinical disease and antimicrobial resistance

DEFF Research Database (Denmark)

Rasmussen, S. R.; Aarestrup, Frank Møller; Jensen, N. E.

1999-01-01

A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting in the identificat......A total of 122 Streptococcus suis serotype 2 strains were characterized thoroughly by comparing clinical and pathological observations, ribotype profiles, and antimicrobial resistance. Twenty-one different ribotype profiles were found and compared by cluster analysis, resulting...

Familias de la proteína de superficie PspA de Streptococcus pneumoniae: Relación con serotipos y localización Pneumococcal surface protein A (PspA families: Relation with serotypes and clinical site of infection

Directory of Open Access Journals (Sweden)

Clara Mayoral

2010-10-01

Full Text Available PspA, proteína de superficie de Streptococcus pneumoniae es un factor de virulencia, fuertemente inmunogénica y común a todos los serotipos. Aunque el gen que codifica para esta proteína presenta una marcada heterogeneidad en la región correspondiente al N-terminal, la PspA contiene epitopes conservados de manera tal que la inmunización genera protección contra neumococos pertenecientes a diversos tipos capsulares y con distintas PspA. A pesar del marcado polimorfismo del gen pspA es posible agrupar las distintas variantes en 3 familias mayoritarias. Estas propiedades las convierten en candidatas ideales para elaborar vacunas. Debido a que la mayoría de los trabajos sobre identificación de familias fueron realizados sobre serotipos frecuentes en otros países, el objetivo fue identificar las familias de PspA de aislamientos de pacientes de nuestra región y relacionarlas con los serotipos prevalentes y patologías. Se estudiaron 70 aislamientos, provenientes de niños con infecciones invasoras. Se aplicó una PCR utilizando cebadores específicos de cada familia. El 60% fueron familia 1 y 34% familia 2. En un 6% no se identificó ninguna de las familias de PspA. Los serotipos 1 y 5 presentaron familia 1 únicamente; los serotipos 14, 6B, 19F y 18C mostraron genes de ambas familias. La familia 1 se observó en 60% de las neumonías y 50% de las meningitis. La familia 2 en 33% de neumonías y 50% de meningitis. Esta información podría ser un valioso aporte para la formulación de una vacuna regional efectiva utilizando PspA recombinante como inmunógeno.PspA, a pneumococcal surface protein, is highly immunogenic and common to all serotypes. Although pspA gene shows a great heterogeneity at the N-terminal region, PspA protein has conserved epytopes which are able to elicit protective cross-reaction against various serotypes presenting different PspA. In spite of the high polimorfism of the PspA, three majority families can be identified

Serotype Distribution and Antimicrobial Sensitivity Profile of Streptococcus pneumoniae Carried in Healthy Toddlers before PCV13 Introduction in Niamey, Niger.

Directory of Open Access Journals (Sweden)

Sani Ousmane

Full Text Available To mitigate the burden of pneumococcal infections in Niger, a 13-valent pneumococcal vaccine, PCV13, was introduced for routine child vaccination in July 2014. In order to provide pre-vaccine baseline data and allow appreciation of changes on carriage due to vaccination, we analyzed retrospectively pneumococcal isolates obtained from healthy, 0 to 2 year old children prior to the vaccine introduction.From June 5, 2007, to May 26, 2008, 1200 nasopharyngeal swabs were collected from healthy 0 to 2 year old children and analyzed by standard microbiological methods. Serotyping was done by SM-PCR and the data were analyzed with R version 2.15.0 (2012-03-30.Streptococcus pneumoniae was detected in 654/1200 children (54.5% among whom 339 (51.8% were males. The ages of the study subjects varied from few days to 26 months (mean = 7.1, median = 6, 95% CI [6.8-7.4]. Out of 654 frozen isolates, 377 (54.8% were able to be re-grown and analyzed. In total, 32 different serogroups/serotypes were detected of which, the most prevalent were 6/(6A/6B/6C/6D (15.6%, 23F (10.6%, 19F (9.3%, 14 (9%, 19A (5.6%, 23B (4.0%, 25F/38 (3.7%, 18/(18A/18B/18C/18F (2.9% and PCR non-typeable (16.4%. Eleven serogroups/serotypes accounting for 57.3% (216/377 were of PCV13 types. Of the 211/377 (56% isolates tested for drug sensitivity, 23/211 (10.9%, 24/211 (11.4%, 9/211(4.3% and 148/210 (70.5% were respectively resistance to oxacillin, chloramphenicol, erythromycin and tetracycline. Thirteen of the oxacillin resistant isolates were additionally multidrug-resistant. No resistance was however detected to gentamycin500μg and to fluoroquinolones (ø Norfloxacin5μg 3 months and presence in family of more than one sibling aged 3 months and presence in family of children aged < 6 years were significant factors for pneumococcal carriage. The present data should help understanding post vaccine introduction changes in pneumococcal carriage and infections for better action.

Detection of Streptococcus pneumoniae in whole blood by PCR.

Science.gov (United States)

Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D

1995-03-01

Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple

Seeing Streptococcus pneumoniae, a Common Killer Bacteria

DEFF Research Database (Denmark)

Kjærgaard, Rikke Schmidt; Andersen, Ebbe Sloth

2014-01-01

Look around you. The diversity and complexity of life on earth is overwhelming and data continues to grow. In our desire to understand and explain everything scientifically from molecular evolution to supernovas we depend on visual representations. This paper investigates visual representations...... of the bacteria Streptococcus pneumoniae by use of ink, watercolours and computer graphics. We propose a novel artistic visual rendering of Streptococcus pneumoniae and ask what the value of these kind of representations are compared to traditional scientific data. We ask if drawings and computer......-assisted representations can add to our scientific knowledge about this dangerous bacteria. Is there still a role for the scientific illustrator in the scientific process and synthesis of scientific knowledge?...

Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia induce distinct host responses.

Science.gov (United States)

McConnell, Kevin W; McDunn, Jonathan E; Clark, Andrew T; Dunne, W Michael; Dixon, David J; Turnbull, Isaiah R; Dipasco, Peter J; Osberghaus, William F; Sherman, Benjamin; Martin, James R; Walter, Michael J; Cobb, J Perren; Buchman, Timothy G; Hotchkiss, Richard S; Coopersmith, Craig M

2010-01-01

Pathogens that cause pneumonia may be treated in a targeted fashion by antibiotics, but if this therapy fails, then treatment involves only nonspecific supportive measures, independent of the inciting infection. The purpose of this study was to determine whether host response is similar after disparate infections with similar mortalities. Prospective, randomized controlled study. Animal laboratory in a university medical center. Pneumonia was induced in FVB/N mice by either Streptococcus pneumoniae or two different concentrations of Pseudomonas aeruginosa. Plasma and bronchoalveolar lavage fluid from septic animals was assayed by a microarray immunoassay measuring 18 inflammatory mediators at multiple time points. The host response was dependent on the causative organism as well as kinetics of mortality, but the pro-inflammatory and anti-inflammatory responses were independent of inoculum concentration or degree of bacteremia. Pneumonia caused by different concentrations of the same bacteria, Pseudomonas aeruginosa, also yielded distinct inflammatory responses; however, inflammatory mediator expression did not directly track the severity of infection. For all infections, the host response was compartmentalized, with markedly different concentrations of inflammatory mediators in the systemic circulation and the lungs. Hierarchical clustering analysis resulted in the identification of five distinct clusters of the host response to bacterial infection. Principal components analysis correlated pulmonary macrophage inflammatory peptide-2 and interleukin-10 with progression of infection, whereas elevated plasma tumor necrosis factor sr2 and macrophage chemotactic peptide-1 were indicative of fulminant disease with >90% mortality within 48 hrs. Septic mice have distinct local and systemic responses to Streptococcus pneumoniae and Pseudomonas aeruginosa pneumonia. Targeting specific host inflammatory responses induced by distinct bacterial infections could represent a

NEW VIRULENCE FACTORS OF STREPTOCOCCUS PNEUMONIAE

NARCIS (Netherlands)

Hermans, Peter Wilhelmus Maria; Bootsma, Jeanette Hester; Burghout, Pieter Jan; Kuipers, Oscar; Bijlsma, Johanna Jacoba Elisabeth; Kloosterman, Tomas Gerrit; Andersen, Christian O.

2011-01-01

The present invention provides proteins/genes, which are essential for survival, and consequently, for virulence of Streptococcus pneumoniae in vivo, and thus are ideal vaccine candidates for a vaccine preparation against pneumococcal infection. Further, also antibodies against said protein(s) are

Surveillance of invasive diseases caused by Streptococcus pneumoniae in Italy: evolution of serotypes and antibiotic resistance in different age groups before and after implementation of PCV7

Directory of Open Access Journals (Sweden)

Fabio D’Ambrosio

2013-04-01

Full Text Available Background: PCV7 has been available in Italy since 2001, however only in 2005 national recommendations were issued and vaccination was implemented with different modalities by the Regions. Objectives: Aim of this study was to describe changes in serotype distribution and antibiotic susceptibility of S. pneumoniae from invasive pneumococcal diseases (IPD in the last decade. Study Design: S. pneumoniae isolates from IPD, collected through a national surveillance system, were serotyped and antibiotic susceptibility was determined by E-test. Data were analyzed according to age groups (5 years, >5-64 years, 65 years and to 3 time periods: prior, during and after PCV7 implementation (2001- 2003, 2006-2008 and 2009-2011. Results: The percentage of PCV7 serotypes (vaccine serotypes, VS decreased over the years not only in children (from 60% to 26% but also in the other age groups. Penicillin resistance was rather low in 2001-2003 (7-12%, but peaked in children in 2006-2008 (24%, and decreased in 2009-2011, while erythromycin resistance slightly decreased over the 3 periods. Conclusions: PCV7 use has largely impacted the epidemiology of S. pneumoniae in Italy, with a decrease in VS in all age groups.The impact of PCV 13, available in Italy since the end of 2010, requires future evaluations.

Automated glycan assembly of a S. pneumoniae serotype 3 CPS antigen

Directory of Open Access Journals (Sweden)

Markus W. Weishaupt

2016-07-01

Full Text Available Vaccines against S. pneumoniae, one of the most prevalent bacterial infections causing severe disease, rely on isolated capsular polysaccharide (CPS that are conjugated to proteins. Such isolates contain a heterogeneous oligosaccharide mixture of different chain lengths and frame shifts. Access to defined synthetic S. pneumoniae CPS structures is desirable. Known syntheses of S. pneumoniae serotype 3 CPS rely on a time-consuming and low-yielding late-stage oxidation step, or use disaccharide building blocks which limits variability. Herein, we report the first iterative automated glycan assembly (AGA of a conjugation-ready S. pneumoniae serotype 3 CPS trisaccharide. This oligosaccharide was assembled using a novel glucuronic acid building block to circumvent the need for a late-stage oxidation. The introduction of a washing step with the activator prior to each glycosylation cycle greatly increased the yields by neutralizing any residual base from deprotection steps in the synthetic cycle. This process improvement is applicable to AGA of many other oligosaccharides.

Different metabolic profiles of K1 serotype and non-serotype K1 and K2 Klebsiella pneumoniae isolates in oral infection mice model.

Science.gov (United States)

Chen, Nan; Wang, Lin-Lin; Xue, Juan; Ma, Xiang-Bo; Zhao, Sheng; Rong, Rui-Xue; Li, Hong-Quan; Ding, Liang; Zheng, Ming-Zhi; Chen, Ying-Ying; Duan, Fei; Shen, Yue-Liang

2014-10-01

K1 or K2 serotype Klebsiella pneumoniae isolate caused clinical pyogenic liver abscess (KLA) infection is prevalent in many areas. It has been identified that K1 or K2 serotype K. pneumoniae isolates caused KLA infection in mice by oral inoculation. In our study, K1 serotype K. pneumoniae isolate Kp1002 with hypermucoviscosity (HV)-positive phenotype caused KLA infection in C57BL/6 mice by oral inoculation. Simultaneously, non-serotype K1 and K2 isolate Kp1014 with HV-negative phenotype failed to cause KLA infection in the same manner. It seems that gastrointestinal tract translocation is the pathway by which K1 or K2 serotype K. pneumoniae caused KLA infection. Liquid chromatography-tandem mass spectrometry was used to further analyze metabolic profile changes in mice with KLA infection. Data showed that after Kp1002 or Kp1014 oral inoculation, serum Phosphatidylcholine (PC) and Lysophosphatidylcholine (LPC) levels significantly changed in mice. Some PC and LPC molecules showed changes both in the Kp1002 KLA group and the Kp1014 no-KLA group compared with the control group. The level of 18:1/18:2-PC significantly changed in the Kp1002 KLA group compared with the control group, but showed no change between the Kp1014 no-KLA group and the control group. The level of 18:1/18:2-PC might have been particularly affected by KLA infection caused by K1 serotype K. pneumoniae Kp1002. It may be a potential biomarker for KLA infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

Host-pathogen interaction during Streptococcus pneumoniae colonization and infection

NARCIS (Netherlands)

D. Bogaert (Debby)

2004-01-01

markdownabstract__Abstract__ Streptococcus pneumoniae was discovered by Sternberg and Pasteur in 1880. It took another six years to discover that this microorganism, called the pneumococcus, was the actual cause of bacterial pneumonia . Subsequently, this bacterium has been shown to provoke an

A Visual Review of the Human Pathogen Streptococcus pneumoniae

DEFF Research Database (Denmark)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David

2017-01-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life...

Antibiotic Susceptibilities and Serotyping of Clinical Streptococcus Agalactiae Isolates

Directory of Open Access Journals (Sweden)

Altay Atalay

2011-11-01

Full Text Available Objective: Streptococcus agalactiae (Group B streptococci, GBS are frequently responsible for sepsis and meningitis seen in the early weeks of life. GBS may cause perinatal infection and premature birth in pregnant women. The aim of this study was to serotype GBS strains isolated from clinical samples and evaluate their serotype distribution according to their susceptibilities to antibiotics and isolation sites. Material and Methods: One hundred thirty one S. agalactiae strains isolated from the clinical samples were included in the study. Of the strains, 99 were isolated from urine, 20 from soft tissue, 10 from blood and 2 from vaginal swab. Penicillin G and ceftriaxone susceptibilities of GBS were determined by the agar dilution method. Susceptibilities to erythromycin, clindamycin, vancomycin and tetracycline were determined by the Kirby-Bauer method according to CLSI criteria. Serotyping was performed using the latex aglutination method using specific antisera (Ia, Ib, II-VIII. Results: While in 131 GBS strains, serotypes VII and VIII were not detected, the most frequently isolated serotypes were types Ia (36%, III (30.5% and II (13% respectively. Serotype Ia was the most frequently seen serotype in all samples. All GBS isolates were susceptible to penicilin G, ceftriaxone and vancomycin. Among the strains, tetracycline, erythromycin and clindamycin resistance rates were determined as 90%, 14.5%, and 13% respectively. Conclusion: Penicillin is still the first choice of treatment for the infections with all serotypes of S. agalactiae in Turkey.

A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae Polymerase chain reaction used to detect Streptococcus pneumoniae resistance to penicillin

Directory of Open Access Journals (Sweden)

Eduardo Walker Zettler

2004-12-01

Full Text Available INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM. A reação em cadeia da polimerase (PCR detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca de 8 horas. OBJETIVO: Comparar a PCR com o método da CIM no diagnóstico da resistência da Streptococcus pneumoniae a penicilina. MÉTODO: Foram estudadas 153 amostras de Streptococcus pneumoniae, isoladas de diferentes sítios anatômicos, usando-se para detecção de mutações nos genes que codificam as proteínas ligadoras de penicilina 1a, 2b e 2x, responsáveis pela resistência à penicilina. A ocorrência das mutações foi correlacionada com a CIM de penicilina, determinada pelo teste de difusão em ágar. RESULTADOS: A resistência global à penicilina do Streptococcus pneumoniae foi de 22,8% (16,3% de resistência intermediária e 6,5% de resistência alta. Em proporções estatisticamente significativas, as amostras sensíveis à penicilina não tinham mutações, as intermediárias apenas uma, geralmente na proteína ligadora de penicilina 2x, e as altamente resistentes tinham mutações nas três proteínas investigadas. CONCLUSÃO: A PCR é um método rápido para a detecção da resistência à penicilina do Streptococcus pneumoniae, que poderá vir a ser utilizado na prática clínica.BACKGROUND: Streptococcus pneumoniae is the most common etiologic agent of community-acquired respiratory infections. In recent years, S. pneumoniae resistance to antimicrobial agents has increased. Minimum inhibitory concentration (MIC is routinely used to determine resistance. Polymerase chain reaction (PCR detects the genes

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...

Structure of a conjugative element in Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Vijayakumar, M.N.; Priebe, S.D.; Guild, W.R.

1986-06-01

The authors have cloned and mapped a 69-kilobase (kb) region of the chromosome of Streptococcus pneumoniae DP1322, which carries the conjugative Omega(cat-tet) insertion from S. pneumoniae BM6001. This element proved to be 65.5 kb in size. Location of the junctions was facilitated by cloning a preferred target region from the wild-type strain Rx1 recipient genome. This target site was preferred by both the BM6001 element and the cat-erm-tet element from Streptococcus agalactiae B109. Within the BM6001 element cat and tet were separated by 30 kb, and cat was flanked by two copies of a sequence that was also present in the recipient strain Rx1 DNA. Another sequence at least 2.4 kb in size was found inside the BM6001 element and at two places in the Rx1 genome. Its role is unknown. The ends of the BM6001 element appear to be the same as those of the B109 element, both as seen after transfer to S. pneumoniae and as mapped by others in pDP5 after transposition in Streptococcus faecalis. No homology is seen between the ends of the BM6001 element and no evidence found suggesting that it ever circularizes.

Detection and transmission of extracellular fac-tor producing Streptococcus suis serotype 2 strains in pigs

NARCIS (Netherlands)

Swildens, B.

2009-01-01

DETECTION AND TRANSMISSION OF EXTRACELLULAR FACTOR PRODUCING STREPTOCOCCUS SUIS SEROTYPE 2 STRAINS IN PIGS INTRODUCTION Streptococcus suis (S.suis) has been implicated in the etiology of many diseases among which meningitis in pigs. The virulent extracellular factor-positive strains of S.suis

Uji Daya Hambat Ekstrak Buah Belimbing Manis (Averrhoa carambola terhadap Pertumbuhan Bakteri Streptococcus pneumoniae secara In Vitro

Directory of Open Access Journals (Sweden)

Rita Risandi

2016-09-01

Full Text Available AbstrakBuah belimbing manis (Averrhoa carambola merupakan salah satu tanaman Indonesia yang diyakini memiliki khasiat obat. Salah satu manfaat yang dapat diambil dari sari buah belimbing manis (Averrhoa carambola adalah dapat mengobati radang tenggorokan. Radang tenggorokan merupakan salah satu infeksi yang disebabkan oleh bakteri Streptococcus pneumoniae. Tujuan penelitian ini adalah menentukan daya hambat ekstrak buah belimbing manis (Averrhoa carambola terhadap pertumbuhan bakteri Streptococcus pneumoniae  secara in vitro. Metode studi ini ialah eksperimental dengan desain postest only control group design yang dilakukan di Laboratorium Biota Sumatera Universitas Andalas dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Andalas dari Agustus sampai Oktober 2014. Hasil penelitian menunjukkan bahwa ekstrak buah belimbing manis (Averrhoa carambola dengan konsentrasi yaitu 5%, 10%, 15% dan 20% tidak memiliki daya hambat terhadap pertumbuhan bakteri Streptococcus pneumoniae.  Hal ini terbukti karena tidak terbentuk zona hambat pada agar darah dan tidak terdapat pengaruh lama kontak ekstrak buah belimbing manis (Averrhoa carambola  terhadap pertumbuhan bakteri Streptococcus pneumoniae secara in vitro. Ekstrak buah belimbing manis tidak memiliki efek antibakteri terhadap pertumbuhan bakteri Streptococcus pneumoniae.Kata kunci: ekstrak buah belimbing manis, Streptococcus pneumoniae, daya hambat Abstract             Star fruit (Averrhoa carambola is a Indonesian plant that is believed to have medicinal properties. One of the benefits that can be drawn from the juice of star fruit (Averrhoa carambola is the ability to treat strep throat. Strep throat is a bacterial infection caused by Streptococcus pneumoniae. The objective of this study was to determine the inhibitory extract of star fruit (Averrhoa carambola on the growth of the bacterium Streptococcus pneumoniae in vitro. This was an experimental  research  with design

Meningitis caused by streptococci other than Streptococcus pneumoniae: a retrospective clinical study

DEFF Research Database (Denmark)

Møller, Kirsten; Harder, Eva; Wandall, Johan

1999-01-01

We reviewed the medical records of 26 patients (median age 62 years, range 5-76 years) admitted to our institution during 1978-98 with acute bacterial meningitis (ABM) caused by streptococci other than Streptococcus pneumoniae (comprising 1.9% of all patients with ABM). 19 cases were community......-acquired and 7 were nosocomial. 73% had comorbid or predisposing conditions and 73% had an identifiable extracerebral focus; only in 2 patients no comorbid disease, primary focus or predisposing condition was present. Five patients had cerebral abscesses, and 5 had endocarditis. Beta-haemolytic streptococci were...... grown in 14 cases (serotype A: 4, B: 5, C: 1, G: 4) and were predominant among patients with endocarditis, whereas alpha- or non-haemolytic strains grew in 12 cases (S. mitis: 4, S. constellatus: 2, E. faecalis: 2, S. bovis: 1, unspecified: 3) and were predominant in patients with a brain abscess...

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

Energy Technology Data Exchange (ETDEWEB)

Cilloniz, Catia; Torres, Antoni [Servicio de Neumologia, Hospital Clinic de Barcelona, Ciber de Enfermedades Respiratorias (CIBERES), Instituto de Investigacion Biomedica Agusti Pi i Sunyer, Universidad de Barcelona (Spain); Rangel, Ernesto [Facultad de Medicina, Universidad Autonoma de Nayarit, Tepic (Mexico); Barlascini, Cornelius [Servizio di Igiene e Sanita Pubblica, Ospedale Generale di Sestri Levante, Sestri Levante (Italy); Piroddi, Ines Maria Grazia; Nicolini, Antonello, E-mail: antonellonicolini@gmail.com [Servizio di Pneumologia, Ospedale Generale di Sestri Levante, Sestri Levante (Italy)

2015-07-15

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Streptococcus pneumoniae-associated pneumonia complicated by purulent pericarditis: case series

International Nuclear Information System (INIS)

Cilloniz, Catia; Torres, Antoni; Rangel, Ernesto; Barlascini, Cornelius; Piroddi, Ines Maria Grazia; Nicolini, Antonello

2015-01-01

Objective: In the antibiotic era, purulent pericarditis is a rare entity. However, there are still reports of cases of the disease, which is associated with high mortality, and most such cases are attributed to delayed diagnosis. Approximately 40-50% of all cases of purulent pericarditis are caused by Gram-positive bacteria, Streptococcus pneumoniae in particular. Methods: We report four cases of pneumococcal pneumonia complicated by pericarditis, with different clinical features and levels of severity. Results: In three of the four cases, the main complication was cardiac tamponade. Microbiological screening (urinary antigen testing and pleural fluid culture) confirmed the diagnosis of severe pneumococcal pneumonia complicated by purulent pericarditis. Conclusions: In cases of pneumococcal pneumonia complicated by pericarditis, early diagnosis is of paramount importance to avoid severe hemodynamic compromise. The complications of acute pericarditis appear early in the clinical course of the infection. The most serious complications are cardiac tamponade and its consequences. Antibiotic therapy combined with pericardiocentesis drastically reduces the mortality associated with purulent pericarditis. (author)

Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

Science.gov (United States)

Andam, Cheryl P.; Harris, Simon R.; Cornick, Jennifer E.; Yang, Marie; Bricio-Moreno, Laura; Kamng’ona, Arox W.; French, Neil; Heyderman, Robert S.; Kadioglu, Aras; Everett, Dean B.; Bentley, Stephen D.

2016-01-01

ABSTRACT Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD) globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs). Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate) and how many individual recombination events occur per isolate (the frequency). Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions. PMID:27677790

Recombination in Streptococcus pneumoniae Lineages Increase with Carriage Duration and Size of the Polysaccharide Capsule

Directory of Open Access Journals (Sweden)

Chrispin Chaguza

2016-09-01

Full Text Available Streptococcus pneumoniae causes a high burden of invasive pneumococcal disease (IPD globally, especially in children from resource-poor settings. Like many bacteria, the pneumococcus can import DNA from other strains or even species by transformation and homologous recombination, which has allowed the pneumococcus to evade clinical interventions such as antibiotics and pneumococcal conjugate vaccines (PCVs. Pneumococci are enclosed in a complex polysaccharide capsule that determines the serotype; the capsule varies in size and is associated with properties including carriage prevalence and virulence. We determined and quantified the association between capsule and recombination events using genomic data from a diverse collection of serotypes sampled in Malawi. We determined both the amount of variation introduced by recombination relative to mutation (the relative rate and how many individual recombination events occur per isolate (the frequency. Using univariate analyses, we found an association between both recombination measures and multiple factors associated with the capsule, including duration and prevalence of carriage. Because many capsular factors are correlated, we used multivariate analysis to correct for collinearity. Capsule size and carriage duration remained positively associated with recombination, although with a reduced P value, and this effect may be mediated through some unassayed additional property associated with larger capsules. This work describes an important impact of serotype on recombination that has been previously overlooked. While the details of how this effect is achieved remain to be determined, it may have important consequences for the serotype-specific response to vaccines and other interventions.

Drug-resistance in Streptococcus pneumoniae isolates among Spanish middle aged and older adults with community-acquired pneumonia

Directory of Open Access Journals (Sweden)

Raga-Luria Xavier

2009-03-01

Full Text Available Abstract Background Pneumococcal diseases remain a major cause of morbidity and mortality worldwide. Updated data on drug-resistance from different populations may be important to recognize changes in disease patterns. This study assessed current levels of penicilin resistance among Streptococcus Pneumoniae causing pneumonia in Spanish middle age and older adults. Methods Antimicrobial susceptibility was tested for 104 consecutive isolates of Streptococcus pneumoniae recovered from patients 50 years or older with radiographically confirmed pneumonia in the region of Tarragona (Spain between 2002 and 2007. According to the minimum inhibitory concentration of tested antimicrobials (penicillin, erythromycin, cefotaxime and levofloxacin strains were classified as susceptible or resistant. Antimicrobial resistance was determined for early cases (2002–2004 and contemporary cases (2005–2007. Results Twenty-seven (25.9% were penicillin-resistant strains (19 strains with intermediate resistance and 8 strains with high resistance. Penicillin-resistance was higher in 2002–2004 than in 2005–2007 (39.5% vs 18.2%, p = 0.017. Of 27 penicillin-resistant strains, 10 (37% were resistant to erythromycin, 8 (29.6% to cefotaxime, 2 (7.4% to levofloxacin, and 4 (14.8% were identified as multidrug resistant. Case-fatality rate was higher among those patients who had an infection caused by any penicillin susceptible strain (16.9% than in those with infections due to penicillin-resistant strains. Conclusion Resistance to penicillin among Streptococcus pneumoniae remains high, but such resistance does not result in increased mortality in patients with pneumococcal pneumonia.

Emergence of group B Streptococcus serotype IV in women of child-bearing age in Ireland.

LENUS (Irish Health Repository)

Kiely, R A

2011-02-01

This study determined the carriage rate and serotype distribution of group B Streptococcus (GBS) in women of child-bearing age in the southern region of Ireland. A total of 2000 vaginal swabs collected in two periods in 2004 and 2006 were examined and revealed a GBS carriage rate of 16·1%. Serotyping of isolates showed that serotypes Ia, II, III, IV, and V were the most prevalent. A high prevalence of serotype IV was found, increasing from 7·6% to 15·2% between 2004 and 2006. Random amplified polymorphic DNA analysis demonstrated considerable genetic heterogeneity in the serotype IV isolates. This serotype should be considered for inclusion in potential vaccines for use in Ireland.

Streptococcus pneumoniae, mecanismos de resistencia antimicrobiana

Directory of Open Access Journals (Sweden)

Amauri Noda Albelo

2011-09-01

Full Text Available El Streptococcus pneumoniae, principal agente causal de la neumonía comunitaria, líder en la etiología de la otitis media y la meningitis, en las últimas 3 décadas ha incrementado, de manera importante, su resistencia a los agentes terapéuticos más utilizados, como los betalactámicos, macrólidos, azálidos y fluroquinolonas. La versatilidad adaptativa del microorganismo le ha permitido crear mecanismos capaces de sobreponerse a cualquiera de estas agresiones terapéuticas con un grado variable de eficacia. Se realiza una revisión de los mecanismos más importantes implicados en la adquisición de resistencia antimicrobiana por S. pneumoniae, y se precisan algunos de los factores de riesgo implicados en infección por S. pneumoniae resistente.

Trivalent pneumococcal protein recombinant vaccine protects against lethal Streptococcus pneumoniae pneumonia and correlates with phagocytosis by neutrophils during early pathogenesis.

Science.gov (United States)

Xu, Qingfu; Surendran, Naveen; Verhoeven, David; Klapa, Jessica; Ochs, Martina; Pichichero, Michael E

2015-02-18

Due to the fact that current polysaccharide-based pneumococcal vaccines have limited serotype coverage, protein-based vaccine candidates have been sought for over a decade to replace or complement current vaccines. We previously reported that a trivalent Pneumococcal Protein recombinant Vaccine (PPrV), showed protection against pneumonia and sepsis in an infant murine model. Here we investigated immunological correlates of protection of PPrV in the same model. C57BL/6J infant mice were intramuscularly vaccinated at age 1-3 weeks with 3 doses of PPrV, containing pneumococcal histidine triad protein D (PhtD), pneumococcal choline binding protein A (PcpA), and detoxified pneumolysin mutant PlyD1. 3-4 weeks after last vaccination, serum and lung antibody levels to PPrV components were measured, and mice were intranasally challenged with a lethal dose of Streptococcus pneumoniae (Spn) serotype 6A. Lung Spn bacterial burden, number of neutrophils and alveolar macrophages, phagocytosed Spn by granulocytes, and levels of cytokines and chemokines were determined at 6, 12, 24, and 48h after challenge. PPrV vaccination conferred 83% protection against Spn challenge. Vaccinated mice had significantly elevated serum and lung antibody levels to three PPrV components. In the first stage of pathogenesis of Spn induced pneumonia (6-24h after challenge), vaccinated mice had lower Spn bacterial lung burdens and more phagocytosed Spn in the granulocytes. PPrV vaccination led to lower levels of pro-inflammatory cytokines IL-6, IL-1β, and TFN-α, and other cytokines and chemokines (IL-12, IL-17, IFN-γ, MIP-1b, MIP-2 and KC, and G-CSF), presumably due to a lower lung bacterial burden. Trivalent PPrV vaccination results in increased serum and lung antibody levels to the vaccine components, a reduction in Spn induced lethality, enhanced early clearance of Spn in lungs due to more rapid and thorough phagocytosis of Spn by neutrophils, and correspondingly a reduction in lung inflammation

Correlations between computed tomography findings and clinical manifestations of Streptococcus pneumoniae pneumonia

International Nuclear Information System (INIS)

Yagihashi, Kunihiro; Kurihara, Yasuyuki; Fujikawa, Atsuko; Matsuoka, Shin; Nakajima, Yasuo

2011-01-01

The aim of this study was to characterize the imaging features and compare computed tomography (CT) findings with clinical features of patients with Streptococcus pneumoniae pneumonia. We retrospectively reviewed 75 patients (44 men, 31 women; mean age 67 years) diagnosed with S. pneumoniae pneumonia who underwent chest CT scanning at our institution between January 2007 and August 2008. Diagnoses were based on detection of the S. pneumoniae antigen in urine. Chest CT scans revealed abnormalities in all patients. The predominant opacity patterns were an airspace pneumonia pattern (48%) and a bronchopneumonia pattern (48%), followed by an interstitial pneumonia pattern (4%). Consolidation was observed most frequently (84%) followed by ground glass opacity (82.7%), bronchial wall thickening (61.3%), and centrilobular nodules (49.3%). Airway dilatation (21.6%), pleural effusion (33.3%), lymphadenopathy (34.8%), and pulmonary emphysema (21.3%) were also observed. Pulmonary emphysema was significantly less frequent in patients with the bronchopneumonia pattern than in those without (p=0.007). The clinical features and CT findings did not differ significantly. CT image analysis showed that patients with S. pneumoniae pneumonia exhibited the bronchopneumonia and airspace pneumonia patterns with equal frequency. Bronchopneumonia pattern was less common in patients with preexisting emphysema. (author)

Carrier state of Haemophilus influenzae type b (Hib, Streptococcus pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children in Pokhara, Nepal

Directory of Open Access Journals (Sweden)

Dharm Raj Bhatta

2014-02-01

Full Text Available Objective: To determine the incidence of carrier state of Haemophilus influenzae type b, Streptococcus pneumoniae (S. pneumoniae, Streptococcus pyogenes, Neisseria meningitidis and Corynebacterium diphtheriae among school children. Methods: Specimen from posterior pharyngeal wall and tonsils were collected on calcium alginate coated swabs from 1 02 participants. Processing of specimen and antimicrobial susceptibility testing was done by standard procedures. Results: Potential pathogens isolated in our study were S. pneumoniae (14.7%, Staphylococcus aureus (12.7%, Corynebacterium diphtheriae (3.9%, Streptococcus pyogenes (3.9% and Haemophilus influenzae (1.9%. Important findings in antibiogram include high resistance of S. pneumoniae to penicillin (73% and resistance of Staphylococcus aureus to oxacillin (23%. Conclusions: Pharyngeal colonization by S. pneumoniae among school children was found high and there is need of introduction of pneumococcal vaccines among children. Despite expected universal vaccination, pharyngeal colonization by Corynebacterium diphtheriae is possible and there is possibility of transmission.

Evolution of Streptococcus pneumoniae and its close commensal relatives

DEFF Research Database (Denmark)

Kilian, Mogens; Poulsen, Knud; Blomqvist, Trinelise

2008-01-01

Streptococcus pneumoniae is a member of the Mitis group of streptococci which, according to 16S rRNA-sequence based phylogenetic reconstruction, includes 12 species. While other species of this group are considered prototypes of commensal bacteria, S. pneumoniae is among the most frequent microbial...... of unique genes and their origin support the model that the entire cluster of S. pneumoniae, S. pseudopneumoniae, and S. mitis lineages evolved from pneumococcus-like bacteria presumably pathogenic to the common immediate ancestor of hominoids. During their adaptation to a commensal life style, most...

Dyrkningsnegativ Streptococcus pneumoniae endokarditis diagnosticeret med polymerasekaedereaktion

DEFF Research Database (Denmark)

Rasmussen, Rasmus Vedby; Kemp, Michael; Bangsborg, Jette Marie

2008-01-01

A 60-year old man was admitted with sepsis and meningitis of unknown aetiology. Underlying aortic valve endocarditis was diagnosed by echocardiography and severe insufficiency led to aortic valve replacement. Application of broad-range PCR to cusp tissue revealed a DNA product, and a diagnosis of...... of Streptococcus pneumoniae endocarditis was obtained by DNA sequencing....

First human case report of sepsis due to infection with Streptococcus suis serotype 31 in Thailand.

Science.gov (United States)

Hatrongjit, Rujirat; Kerdsin, Anusak; Gottschalk, Marcelo; Takeuchi, Dan; Hamada, Shigeyuki; Oishi, Kazunori; Akeda, Yukihiro

2015-09-30

Streptococcus suis is a zoonotic pathogen that causes invasive infections in humans and pigs. It has been reported that S. suis infection in humans is mostly caused by serotype 2. However, human cases caused by other serotypes have rarely been reported. This is the first report of a human case of infection with S. suis serotype 31 in Thailand. A 55-year-old male alcohol misuser with liver cirrhosis was admitted with sepsis to a hospital in the Central Region of Thailand. He had consumed a homemade, raw pork product prior to the onset of illness. He was alive after treatment with ceftriaxone and no complication occurred. An isolate from blood culture at the hospital was suspected as viridans group Streptococcus. It was confirmed at a reference laboratory as S. suis serotype 31 by biochemical tests, 16S rDNA sequencing, and multiplex polymerase chain reaction for serotyping, but it was untypable by the co-agglutination test with antisera against recognized S. suis serotypes, suggesting loss of capsular material. The absence of a capsule was confirmed by transmission electron microscopy. The isolate was confirmed to be sequence type 221, with 13 putative virulence genes that are usually found in serotype 2 strains. We should be aware of the emergence of S. suis infections caused by uncommon serotypes in patients with predisposing conditions. Laboratory capacity to identify S. suis in the hospital is needed in developing countries, which can contribute to enhanced surveillance, epidemiological control, and prevention strategies in the prevalent area.

Molecular serotyping, virulence gene profiling and pathogenicity of Streptococcus agalactiae isolated from tilapia farms in Thailand by multiplex PCR.

Science.gov (United States)

Kannika, K; Pisuttharachai, D; Srisapoome, P; Wongtavatchai, J; Kondo, H; Hirono, I; Unajak, S; Areechon, N

2017-06-01

This study aimed to biotype Streptococcus agalactiae isolated from tilapia farms in Thailand based on molecular biotyping methods and to determine the correlation between the serotype and virulence of bacteria. In addition to a biotyping (serotyping) technique based on multiplex PCR of cps genes, in this study, we developed multiplex PCR typing of Group B streptococcus (GBS) virulence genes to examine three clusters of virulence genes and their correlation with the pathogenicity of S. agalactiae. The epidemiology of S. agalactiae in Thailand was analysed to provide bacterial genetic information towards a future rational vaccine strategy for tilapia culture systems. Streptococcus agalactiae were isolated from diseased tilapia from different areas of Thailand. A total of 124 S. agalactiae isolates were identified by phenotypic analysis and confirmed by 16S rRNA PCR. Bacterial genotyping was conducted based on (i) molecular serotyping of the capsular polysaccharide (cps) gene cluster and (ii) virulence gene profiling using multiplex PCR analysis of 14 virulence genes (lmb, scpB, pavA, cspA, spb1, cyl, bca, rib, fbsA, fbsB, cfb, hylB, bac and pbp1A/ponA). Only serotypes Ia and III were found in this study; serotype Ia lacks the lmb, scpB and spb1 genes, whereas serotype III lacks only the bac gene. Virulence tests in juvenile Nile tilapia demonstrated a correlation between the pathogenicity of the bacteria and their virulence gene profile, with serotype III showing higher virulence than serotype Ia. Epidemiological analysis showed an almost equal distribution in all regions of Thailand, except serotype III was found predominantly in the southern areas. Only two serotypes of S. agalactiae were isolated from diseased tilapia in Thailand. Serotype Ia showed fewer virulence genes and lower virulence than serotype III. Both serotypes showed a similar distribution throughout Thailand. We identified two major serotypes of S. agalactiae isolates associated with the outbreak in

Mutations Blocking Side Chain Assembly, Polymerization, or Transport of a Wzy-Dependent Streptococcus pneumoniae Capsule Are Lethal in the Absence of Suppressor Mutations and Can Affect Polymer Transfer to the Cell Wall▿

OpenAIRE

Xayarath, Bobbi; Yother, Janet

2007-01-01

Extracellular polysaccharides of many bacteria are synthesized by the Wzy polymerase-dependent mechanism, where long-chain polymers are assembled from undecaprenyl-phosphate-linked repeat units on the outer face of the cytoplasmic membrane. In gram-positive bacteria, Wzy-dependent capsules remain largely cell associated via membrane and peptidoglycan linkages. Like many Wzy-dependent capsules, the Streptococcus pneumoniae serotype 2 capsule is branched. In this study, we found that deletions ...

Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes.

Directory of Open Access Journals (Sweden)

Stephen D Bentley

2006-03-01

Full Text Available Several major invasive bacterial pathogens are encapsulated. Expression of a polysaccharide capsule is essential for survival in the blood, and thus for virulence, but also is a target for host antibodies and the basis for effective vaccines. Encapsulated species typically exhibit antigenic variation and express one of a number of immunochemically distinct capsular polysaccharides that define serotypes. We provide the sequences of the capsular biosynthetic genes of all 90 serotypes of Streptococcus pneumoniae and relate these to the known polysaccharide structures and patterns of immunological reactivity of typing sera, thereby providing the most complete understanding of the genetics and origins of bacterial polysaccharide diversity, laying the foundations for molecular serotyping. This is the first time, to our knowledge, that a complete repertoire of capsular biosynthetic genes has been available, enabling a holistic analysis of a bacterial polysaccharide biosynthesis system. Remarkably, the total size of alternative coding DNA at this one locus exceeds 1.8 Mbp, almost equivalent to the entire S. pneumoniae chromosomal complement.

Vaccination for the control of childhood bacterial pneumonia - Haemophilus influenzae type b and pneumococcal vaccines

Directory of Open Access Journals (Sweden)

Diana C Otczyk

2013-01-01

Full Text Available Pneumonia in childhood is endemic in large parts of the world and in particular, in developing countries, as well as in many indigenous communities within developed nations. Haemophilus influenzae type b and Streptococcus pneumoniae conjugate vaccines are currently available against the leading bacterial causes of pneumonia.  The use of the vaccines in both industrialised and developing countries have shown a dramatic reduction in the burden of pneumonia and invasive disease in children.  However, the greatest threat facing pneumococcal conjugate vaccine effectiveness is serotype replacement.  The current vaccines provide serotype-specific, antibody–mediated protection against only a few of the 90+ capsule serotypes.  Therefore, there has been a focus in recent years to rapidly advance technologies that will result in broader disease coverage and more affordable vaccines that can be used in developing countries.  The next generation of pneumococcal vaccines have advanced to clinical trials.

JST Thesaurus Headwords and Synonyms: Streptococcus pneumoniae [MeCab user dictionary for science technology term[Archive

Lifescience Database Archive (English)

Full Text Available MeCab user dictionary for science technology term Streptococcus pneumoniae 名詞 一般 * ...* * * 肺炎球菌 ハイエンキュウキン ハイエンキューキン Thesaurus2015 200906003627228649 C LS07 UNKNOWN_2 Streptococcus pneumoniae

Characterization of Streptococcus suis through serotyping, SE-AFLP and virulence profile

Directory of Open Access Journals (Sweden)

Franco F. Calderaro

Full Text Available Abstract: Streptococcus suis is one of most important pathogens in the swine industry worldwide. Despite its importance, studies of S. suis characterization in South America are still rare. This study evaluates S. suis isolates from distinct Brazilian states, from 1999 to 2004, and its molecular and serological characterization. A total of 174 isolates were studied. S. suis identification was confirmed by PCR and isolates were further serotyped and genotyped by SE-AFLP and amplification of virulence markers. Serotype 1, 2, 3, 4, 7, 18, 22 and 32 were identified among the studied isolates, and only 4% were characterized as non-typeable. The mrp+/epf+/sly+ genotype was the most frequent. The SE-AFLP analysis resulted in 29 patterns distributed in three main clusters with over 65% of genetic similarity. Isolates presented a slight tendency to cluster according to serotype and origin; however, no further correlation with virulence genotypes was observed.

Septicaemia models using Streptococcus pneumoniae and Listeria monocytogenes: understanding the role of complement properdin.

Science.gov (United States)

Dupont, Aline; Mohamed, Fatima; Salehen, Nur'Ain; Glenn, Sarah; Francescut, Lorenza; Adib, Rozita; Byrne, Simon; Brewin, Hannah; Elliott, Irina; Richards, Luke; Dimitrova, Petya; Schwaeble, Wilhelm; Ivanovska, Nina; Kadioglu, Aras; Machado, Lee R; Andrew, Peter W; Stover, Cordula

2014-08-01

Streptococcus pneumoniae and Listeria monocytogenes, pathogens which can cause severe infectious disease in human, were used to infect properdin-deficient and wildtype mice. The aim was to deduce a role for properdin, positive regulator of the alternative pathway of complement activation, by comparing and contrasting the immune response of the two genotypes in vivo. We show that properdin-deficient and wildtype mice mounted antipneumococcal serotype-specific IgM antibodies, which were protective. Properdin-deficient mice, however, had increased survival in the model of streptococcal pneumonia and sepsis. Low activity of the classical pathway of complement and modulation of FcγR2b expression appear to be pathogenically involved. In listeriosis, however, properdin-deficient mice had reduced survival and a dendritic cell population that was impaired in maturation and activity. In vitro analyses of splenocytes and bone marrow-derived myeloid cells support the view that the opposing outcomes of properdin-deficient and wildtype mice in these two infection models is likely to be due to a skewing of macrophage activity to an M2 phenotype in the properdin-deficient mice. The phenotypes observed thus appear to reflect the extent to which M2- or M1-polarised macrophages are involved in the immune responses to S. pneumoniae and L. monocytogenes. We conclude that properdin controls the strength of immune responses by affecting humoral as well as cellular phenotypes during acute bacterial infection and ensuing inflammation.

Group B streptococcus serotype prevalence in reproductive-age women at a tertiary care military medical center relative to global serotype distribution

Directory of Open Access Journals (Sweden)

Williams Julie

2010-11-01

Full Text Available Abstract Background Group B Streptococcus (GBS serotype (Ia, Ib, II-IX correlates with pathogen virulence and clinical prognosis. Epidemiological studies of seroprevalence are an important metric for determining the proportion of serotypes in a given population. The purpose of this study was to evaluate the prevalence of individual GBS serotypes at Madigan Healthcare System (Madigan, the largest military tertiary healthcare facility in the Pacific Northwestern United States, and to compare seroprevalences with international locations. Methods To determine serotype distribution at Madigan, we obtained GBS isolates from standard-of-care anogenital swabs from 207 women of indeterminate gravidity between ages 18-40 during a five month interval. Serotype was determined using a recently described molecular method of polymerase chain reaction by capsular polysaccharide synthesis (cps genes associated with pathogen virulence. Results Serotypes Ia, III, and V were the most prevalent (28%, 27%, and 17%, respectively. A systematic review of global GBS seroprevalence, meta-analysis, and statistical comparison revealed strikingly similar serodistibution at Madigan relative to civilian-sector populations in Canada and the United States. Serotype Ia was the only serotype consistently higher in North American populations relative to other geographic regions (p Conclusion This study establishes PCR-based serotyping as a viable strategy for GBS epidemiological surveillance. Our results suggest that GBS seroprevalence remains stable in North America over the past two decades.

Lung abscess due to Streptococcus pneumoniae simulating pulmonary tuberculosis: presentation of two cases

Directory of Open Access Journals (Sweden)

Alessandro Perazzo

2014-03-01

Full Text Available In the past, anaerobes were the most common cause of community-acquired lung abscess; Streptococcus species were the second most common cause. In recent years, this has changed. Klebsiella pneumoniae is now most common cause of community- acquired lung abscess, although Streptococcus species remain pathogen of major importance. We present two cases of pulmonary cavitation due to Streptococcus pneumoniae which resembled pulmonary tuberculosis with regards to their history and radiological findings. These are examples of a common diagnosis presenting in an uncommon way. Our cases had some peculiarities: they had a clinical picture strongly suggestive of pulmonary tuberculosis or lung cancer rather than necrotizing infectious pneumonia in patients with no comorbidities or underlying diseases (including oral or dental pathologies. Radiological findings did not help the clinicians: pulmonary tuberculosis was the first diagnostic hypothesis in both cases. An underlying lung cancer was excluded in the first case only after invasive pulmonary procedures.

Outbreak of Streptococcus pneumoniae in a Psychiatric Unit

Centers for Disease Control (CDC) Podcasts

2012-11-02

Dr. Katherine Fleming-Dutra, an epidemiologist at CDC, discusses her investigation of a Streptococcus pneumoniae outbreak in a pediatric psychiatric unit.  Created: 11/2/2012 by National Center for Emerging and Zoonotic Infectious Diseases (NCEZID); National Center for Immunization and Respiratory Diseases (NCIRD).   Date Released: 11/5/2012.

Bright fluorescent Streptococcus pneumoniae for live cell imaging of host-pathogen interactions

NARCIS (Netherlands)

Kjos, M.; Aprianto, R.; Fernandes, V.E.; Andrew, P.W.; Strijp, van J.A.G.; Nijland, R.; Veening, J.W.

2015-01-01

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people, but at the same time one of the major causes of infectious diseases such as pneumonia, meningitis and sepsis. The shift from commensal to pathogen and its interaction with host cells is poorly understood. One of the

Bright Fluorescent Streptococcus pneumoniae for Live-Cell Imaging of Host-Pathogen Interactions

NARCIS (Netherlands)

Kjos, Morten; Aprianto, Rieza; Fernandes, Vitor E.; Andrew, Peter W.; van Strijp, Jos A. G.; Nijland, Reindert; Veening, Jan-Willem

Streptococcus pneumoniae is a common nasopharyngeal resident in healthy people but, at the same time, one of the major causes of infectious diseases such as pneumonia, meningitis, and sepsis. The shift from commensal to pathogen and its interaction with host cells are poorly understood. One of the

Transport of Streptococcus pneumoniae capsular polysaccharide in MHC Class II tubules.

Directory of Open Access Journals (Sweden)

Tom Li Stephen

2007-03-01

Full Text Available Bacterial capsular polysaccharides are virulence factors and are considered T cell-independent antigens. However, the capsular polysaccharide Sp1 from Streptococcus pneumoniae serotype 1 has been shown to activate CD4(+ T cells in a major histocompatibility complex (MHC class II-dependent manner. The mechanism of carbohydrate presentation to CD4(+ T cells is unknown. We show in live murine dendritic cells (DCs that Sp1 translocates from lysosomal compartments to the plasma membrane in MHCII-positive tubules. Sp1 cell surface presentation results in reduction of self-peptide presentation without alteration of the MHCII self peptide repertoire. In DM-deficient mice, retrograde transport of Sp1/MHCII complexes resulting in T cell-dependent immune responses to the polysaccharide in vitro and in vivo is significantly reduced. The results demonstrate the capacity of a bacterial capsular polysaccharide antigen to use DC tubules as a vehicle for its transport as an MHCII/saccharide complex to the cell surface for the induction of T cell activation. Furthermore, retrograde transport requires the functional role of DM in self peptide-carbohydrate exchange. These observations open new opportunities for the design of vaccines against microbial encapsulated pathogens.

Characterization and transfer studies of macrolide resistance genes in Streptococcus pneumoniae from Denmark

DEFF Research Database (Denmark)

Nielsen, Karen L; Hammerum, Anette M; Lambertsen, Lotte M

2010-01-01

Over the last decade, erythromycin resistance has been increasing in frequency in Streptococcus pneumoniae in Denmark. In the present study, 49 non-related erythromycin-resistant S. pneumoniae isolates from invasive sites and 20 isolates from non-invasive sites were collected; antimicrobial...

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae Use of penicillin in the extrameningeal infection from Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.The beta-lactamase resistance of Strepcoccus pneumoniae is relative and may to be overcome if the dose of this type of drugs is increased. The definition of oversensitivity and of resistance of above mentioned bacteria was originally created to predict the infection response of central nervous system (CNS to treatment. The infection outside of the CNS by most of strains of S. pneumoniae responds to habitual dose of betalactamic antibiotics. A review of the new cut points of Laboratory Standards Institute for the sensitivity to pathogen penicillin and its implication in current therapy of extrameningeal disease by S. pneumoniae is analyzed.

Identification of PblB mediating galactose-specific adhesion in a successful Streptococcus pneumoniae clone.

Science.gov (United States)

Hsieh, Yu-Chia; Lin, Tzu-Lung; Lin, Che-Ming; Wang, Jin-Town

2015-07-21

The pneumococcal genome is variable and there are minimal data on the influence of the accessory genome on phenotype. Pneumococcal serotype 14 sequence type (ST) 46 had been the most prevalent clone causing pneumonia in children in Taiwan. A microarray was constructed using the genomic DNA of a clinical strain (NTUH-P15) of serotype 14 ST46. Using DNA hybridization, genomic variations in NTUH-P15 were compared to those of 3 control strains. Microarray analysis identified 7 genomic regions that had significant increases in hybridization signals in the NTUH-P15 strain compared to control strains. One of these regions encoded PblB, a phage-encoded virulence factor implicated (in Streptococcus mitis) in infective endocarditis. The isogenic pblB mutant decreased adherence to A549 human lung epithelial cell compared to wild-type NTUH-P15 strain (P = 0.01). Complementation with pblB restored the adherence. PblB is predicted to contain a galactose-binding domain-like region. Preincubation of NTUH-P15 with D-galactose resulted in decreases of adherence to A549 cell in a dose-dependent manner. Challenge of mice with NTUH-P15, isogenic pblB mutant and pblB complementation strains determined that PblB was required for bacterial persistence in the nasopharynx and lung. PblB, as an adhesin mediating the galactose-specific adhesion activity of pneumococci, promote pneumococcal clonal success.

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

OpenAIRE

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom h...

Neutrophil evasion strategies by Streptococcus pneumoniae and Staphylococcus aureus.

Science.gov (United States)

Lewis, Megan L; Surewaard, Bas G J

2018-03-01

Humans are well equipped to defend themselves against bacteria. The innate immune system employs diverse mechanisms to recognize, control and initiate a response that can destroy millions of different microbes. Microbes that evade the sophisticated innate immune system are able to escape detection and could become pathogens. The pathogens Streptococcus pneumoniae and Staphylococcus aureus are particularly successful due to the development of a wide variety of virulence strategies for bacterial pathogenesis and they invest significant efforts towards mechanisms that allow for neutrophil evasion. Neutrophils are a primary cellular defense and can rapidly kill invading microbes, which is an indispensable function for maintaining host health. This review compares the key features of Streptococcus pneumoniae and Staphylococcus aureus in epidemiology, with a specific focus on virulence mechanisms utilized to evade neutrophils in bacterial pathogenesis. It is important to understand the complex interactions between pathogenic bacteria and neutrophils so that we can disrupt the ability of pathogens to cause disease.

Streptococcus pneumoniae – caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society (BTS CURB-65 scoring tools were evaluated. The statistical treatment was performed using the SPSS 14.0 program. We included 104 patients, 67.3% male, median age 63 years old, mortality 13.4%. There was a significant association between the PSI and CURB-65 score and mortality. Despite advances, CAP is still an important health problem with a high atten - dant morbi-mortality. This study confirms the value of PSI and CURB-65 in the prediction of severe pneumonia. Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67

Antibiotic resistance of Streptococcus pneumoniae in children with acute otitis media treatment failure.

Science.gov (United States)

Zielnik-Jurkiewicz, Beata; Bielicka, Anna

2015-12-01

The emergence of antibiotic-resistant bacteria is a major cause of treatment failure in children with acute otitis media (AOM). This study aimed to analyze the types of bacterial strains in fluid isolated from the middle ear of children with AOM who did not respond to oral antibiotic treatment. We also determined the antibiotic resistance of the most frequently isolated bacterial strain (Streptococcus pneumoniae) found in these children. This was a prospective study of 157 children with AOM aged from 6 months to 7 years admitted due to unsuccessful oral antibiotic treatment. All children underwent a myringotomy, and samples of the middle ear fluid were collected for bacteriological examination. Positive bacterial cultures were obtained in 104 patients (66.2%), with Streptococcus pneumoniae (39.69%), Haemophilus influenzae (16.03%) Staphylococcus aureus (16.03%), Staphylococcus haemolyticus (6.9%) and Streptococcus pyogenes (5.34%) found most frequently. The majority (65.4%) of S. pneumoniae strains were penicillin-intermediate-resistant or penicillin-resistant, and 67.2% strains of S. pneumoniae were multidrug-resistant. We identified S. pneumoniae as the most frequently isolated pathogen from the middle ear in children with AOM treatment failure and determined that the majority of strains were antibiotic-resistant. We propose that the microbiological identification of bacterial strains and their degree of antibiotic resistance should be performed prior to therapy in order to choose the most appropriate antibiotic therapy for children with AOM treatment failure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Pneumococcal Serotype 15C Capsule Is Partially O-Acetylated and Allows for Limited Evasion of 23-Valent Pneumococcal Polysaccharide Vaccine-Elicited Anti-Serotype 15B Antibodies

OpenAIRE

Spencer, Brady L.; Shenoy, Anukul T.; Orihuela, Carlos J.; Nahm, Moon H.

2017-01-01

As a species, Streptococcus pneumoniae (the pneumococcus) utilizes a diverse array of capsular polysaccharides to evade the host. In contrast to large variations in sugar composition and linkage formation, O-acetylation is a subtle capsular modification that nonetheless has a large impact on capsular shielding and recognition of the capsule by vaccine-elicited antibodies. Serotype 15B, which is included in the 23-valent pneumococcal polysaccharide vaccine (PPV23), carries the putative O-acety...

The Streptococcus pneumoniae Competence Regulatory System Influences Respiratory Tract Colonization ▿

OpenAIRE

Kowalko, J. E.; Sebert, M. E.

2008-01-01

The Streptococcus pneumoniae ComDE two-component signaling system controls the development of genetic competence in the bacterium and affects virulence in models of pneumonia and bacteremia. We have investigated the impact of the competence pathway during colonization of the nasopharynx, the principal ecological niche of the pneumococcus. Previous work showed that deletion of the pneumococcal CiaRH signaling system inhibited colonization and increased expression of genes required for competen...

Quorum Sensing Regulation of Competence and Bacteriocins in Streptococcus pneumoniae and mutans

Science.gov (United States)

Shanker, Erin; Federle, Michael J.

2017-01-01

The human pathogens Streptococcus pneumoniae and Streptococcus mutans have both evolved complex quorum sensing (QS) systems that regulate the production of bacteriocins and the entry into the competent state, a requirement for natural transformation. Natural transformation provides bacteria with a mechanism to repair damaged genes or as a source of new advantageous traits. In S. pneumoniae, the competence pathway is controlled by the two-component signal transduction pathway ComCDE, which directly regulates SigX, the alternative sigma factor required for the initiation into competence. Over the past two decades, effectors of cellular killing (i.e., fratricides) have been recognized as important targets of the pneumococcal competence QS pathway. Recently, direct interactions between the ComCDE and the paralogous BlpRH pathway, regulating bacteriocin production, were identified, further strengthening the interconnections between these two QS systems. Interestingly, a similar theme is being revealed in S. mutans, the primary etiological agent of dental caries. This review compares the relationship between the bacteriocin and the competence QS pathways in both S. pneumoniae and S. mutans, and hopes to provide clues to regulatory pathways across the genus Streptococcus as a potential tool to efficiently investigate putative competence pathways in nontransformable streptococci. PMID:28067778

Translation quality control is maintained by the penicillin resistance factor MurM in Streptococcus pneumoniae

DEFF Research Database (Denmark)

Shepherd, Jennifer; Ibba, Michael

2013-01-01

Streptococcus pneumoniae is a causative agent of nosocomial infections such as pneumonia, meningitis and septicaemia. Penicillin resistance in S. pneumoniae depends in part upon MurM, an aminoacyl-tRNA-ligase that attaches L-serine or L-alanine to the stem peptide lysine of Lipid II in cell wall...

N-acetylglucosamine-Mediated Expression of nagA and nagB in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Henriques-Normark, Birgitta; Kuipers, Oscar P

2016-01-01

In this study, we have explored the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylglucosamine (NAG). Transcriptome comparison of S. pneumoniae D39 wild-type grown in chemically defined medium (CDM) in the presence of 0.5% NAG to that grown in the presence of 0.5% glucose

Carriage of Streptococcus pneumoniae and other respiratory bacterial pathogens in low and lower-middle income countries: a systematic review and meta-analysis.

Directory of Open Access Journals (Sweden)

Richard A Adegbola

Full Text Available Infection with Streptococcus pneumoniae is a major cause of childhood morbidity and mortality worldwide, especially in low income countries where pneumococcal conjugate vaccines (PCVs are still underused. In countries where PCVs have been introduced, much of their efficacy has resulted from their impact on nasopharyngeal carriage in vaccinated children. Understanding the epidemiology of carriage for S. pneumoniae and other common respiratory bacteria in developing countries is crucial for implementing appropriate vaccination strategies and evaluating their impact.We have systematically reviewed published studies reporting nasopharyngeal or oropharyngeal carriage of S. pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Staphylococcus aureus, and Neisseria meningitidis in children and adults in low and lower-middle income countries. Studies reporting pneumococcal carriage for healthy children <5 years of age were selected for a meta-analysis. The prevalences of carriage for S. pneumoniae, H. influenzae, and M. catarrhalis were generally higher in low income than in lower-middle income countries and were higher in young children than in adults. The prevalence of S. aureus was high in neonates. Meta-analysis of data from young children before the introduction of PCVs showed a pooled prevalence estimate of 64.8% (95% confidence interval, 49.8%-76.1% in low income countries and 47.8% (95% confidence interval, 44.7%-50.8% in lower-middle income countries. The most frequent serotypes were 6A, 6B, 19A, 19F, and 23F.In low and lower-middle income countries, pneumococcal carriage is frequent, especially in children, and the spectrum of serotypes is wide. However, because data are limited, additional studies are needed to adequately assess the impact of PCV introduction on carriage of respiratory bacteria in these countries.

[Ability of procalcitonin to predict bacteremia in patients with community acquired pneumonia].

Science.gov (United States)

Julián-Jiménez, Agustín; Timón Zapata, Jesús; Laserna Mendieta, Emilio José; Parejo Miguez, Raquel; Flores Chacartegui, Manuel; Gallardo Schall, Pablo

2014-04-07

To analyze the usefulness and ability of procalcitonin (PCT) to predict the presence of bacteremia in patients with community-acquired pneumonia (CAP) caused by Streptococcus pneumoniae (S. pneumoniae) or other bacteria. This is an observational, prospective and descriptive study involving patients who were diagnosed with CAP in our Emergency Department. Data collected included socio-demographic and comorbidity variables, Charlson index, stage in the Pneumonia Severity Index and criteria of severe NAC, microbiologic studies and biomarker determinations (PCT and C reactive protein). The follow-up was carried out during 30 days to calculate the predictive power and the diagnostic performance for bacteremia caused or not by S. pneumoniae. Four hundred and seventy-four patients were finally included in the study. Blood cultures were positive in 85 individuals (17.9%) and S. pneumoniae was identified as the responsible pathogen in 75 of them (88.4%) (in 5 cases together with another agent). The area under the Receiver Operating Characteristic curve for PCT to predict bacteremia (caused by S. pneumoniae or not) was 0.988 (95% confidence interval 0.908-0.995; P98% and>10, respectively. The most frequently isolated serotypes of S. pneumoniae were 19A, 7F, 1 and 3. The highest mean levels of PCT were found in serotypes 7F, 19A, 3 and 1, which showed statistically significant differences with regard to the others serotypes considered (P=.008). Serotypes associated with the highest percentage of severe sepsis-septic shock, 30-days mortality and multi-lobe or bilateral affection were 3, 1 and 19A; 1, 3 and 19A; and 3, 19A and 6A, respectively. PCT had a remarkable diagnostic ability to discard or suspect bacteremia and to guide the etiology of CAP caused by S. pneumoniae. Serotypes 1, 3, 19A and 7F showed greater frequency, systemic inflammatory response and clinical severity. Copyright © 2013 Elsevier España, S.L. All rights reserved.

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

Science.gov (United States)

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

OpenAIRE

Amauri Lázaro Noda Albelo; Lázaro Arturo Vidal Tallet; Joan Iavier Vidal Casal; Leanet Hernández Álvarez

2011-01-01

La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos beta...

Clonal distribution of pneumococcal serotype 19F isolates from Ghana

DEFF Research Database (Denmark)

Sparding, Nadja; Dayie, Nicholas Tete Kwaku Dzifa; Mills, Richael O.

2015-01-01

Streptococcus pneumoniae is a major cause of morbidity and mortality worldwide. Pneumococcal strains are classified according to their capsular polysaccharide and more than 90 different serotypes are currently known. In this project, three distinct groups of pneumococcal carriage isolates from Gh...... in Ghana in that many new clones were identified. This supports the importance of continued monitoring of pneumococcal carriage in Ghana and elsewhere when vaccines, e.g., PCV-13, have been introduced to monitor the possible future spread of antimicrobial resistant clones....

Development of a Colloidal Gold-Based Immunochromatographic Strip for Rapid Detection of Klebsiella pneumoniae Serotypes K1 and K2.

Science.gov (United States)

Siu, L Kristopher; Tsai, Yu-Kuo; Lin, Jung-Chung; Chen, Te-Li; Fung, Chang-Phone; Chang, Feng-Yee

2016-12-01

In this study, a novel colloidal gold-based immunochromatographic strip (ICS) containing anti-Klebsiella pneumoniae capsular polysaccharide polyclonal antibodies was developed to specifically detect K. pneumoniae serotypes K1 and K2. Capsular polysaccharide K1 and K2 antigens were first used to produce polyclonal anti-K1 and anti-K2 antibodies. Reference strains with different serotypes, nontypeable K. pneumoniae strains, and other bacterial species were then used to assess the sensitivity and specificity of these test strips. The detection limit was found to be 10 5 CFU, and the ICSs were stable for 6 months when stored at room temperature. No false-positive or false-negative results were observed, and equivalent results were obtained compared to those of more conventional test methods, such as PCR or serum agglutination. In conclusion, the ICS developed here requires no technical expertise and allows for the specific, rapid, and simultaneous detection of K. pneumoniae serotypes K1 and K2. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Effect of Serotype on Pneumococcal Competition in a Mouse Colonization Model.

Science.gov (United States)

Trzciński, Krzysztof; Li, Yuan; Weinberger, Daniel M; Thompson, Claudette M; Cordy, Derrick; Bessolo, Andrew; Malley, Richard; Lipsitch, Marc

2015-09-15

Competitive interactions between Streptococcus pneumoniae strains during host colonization could influence the serotype distribution in nasopharyngeal carriage and pneumococcal disease. We evaluated the competitive fitness of strains of serotypes 6B, 14, 19A, 19F, 23F, and 35B in a mouse model of multiserotype carriage. Isogenic variants were constructed using clinical strains as the capsule gene donors. Animals were intranasally inoculated with a mixture of up to six pneumococcal strains of different serotypes, with separate experiments involving either clinical isolates or isogenic capsule-switch variants of clinical strain TIGR4. Upper-respiratory-tract samples were repeatedly collected from animals in order to monitor changes in the serotype ratios using quantitative PCR. A reproducible hierarchy of capsular types developed in the airways of mice inoculated with multiple strains. Serotype ranks in this hierarchy were similar among pneumococcal strains of different genetic backgrounds in different strains of mice and were not altered when tested under a range of host conditions. This rank correlated with the measure of the metabolic cost of capsule synthesis and in vitro measure of pneumococcal cell surface charge, both parameters considered to be predictors of serotype-specific fitness in carriage. This study demonstrates the presence of a robust competitive hierarchy of pneumococcal serotypes in vivo that is driven mainly, but not exclusively, by the capsule itself. Streptococcus pneumoniae (pneumococcus) is the leading cause of death due to respiratory bacterial infections but also a commensal frequently carried in upper airways. Available vaccines induce immune responses against polysaccharides coating pneumococcal cells, but with over 90 different capsular types (serotypes) identified, they can only target strains of the selected few serotypes most prevalent in disease. Vaccines not only protect vaccinated individuals against disease but also protect by

The Proteasome-Ubiquitin System Is Required for Efficient Killing of Intracellular Streptococcus pneumoniae by Brain Endothelial Cells

NARCIS (Netherlands)

Iovino, Federico; Gradstedt, Henrik; Bijlsma, Jetta J.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is a Gram-positive bacterium that causes serious invasive diseases, such as pneumonia, bacteremia, and meningitis, with high morbidity and mortality throughout the world. Before causing invasive disease, S. pneumoniae encounters cellular barriers, which are

The comparative development of elevated resistance to macrolides in community-acquired pneumonia caused by Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yayan J

2014-10-01

Full Text Available Josef Yayan Department of Internal Medicine, Division of Pulmonary, Allergy and Sleep Medicine, Saarland University Medical Center, Homburg/Saar, Germany Background: Community-acquired pneumonia (CAP is an acute inflammation of the lungs, which is often caused by Streptococcus pneumoniae. CAP is the leading cause of death by infectious disease in industrialized countries. Therefore, an immediate and effective antibiotic therapy is of great importance for the nonfatal outcome of the disease. The literature contains increasing data about the development of resistance to antibiotics that are used for the treatment of CAP caused by S. pneumoniae; this article also examines the possible development of resistance to antibiotics in S. pneumoniae in recent years.Methods: Within the study period of 2004–2014, all hospital charts from patients with CAP caused by S. pneumoniae were collected from the Department of Internal Medicine, Saarland University Medical Center, Homburg/Saar, Germany. The tracheal secretions of S. pneumoniae in CAP patients were obtained by bronchoalveolar lavage; bronchial aspirates were obtained through flexible bronchoscopy and directly from sputum, and blood cultures were examined microbiologically for microorganisms.Results: From a total of 100 patients with CAP caused by S. pneumoniae, 23 (53.49% [34.78% female], 95% confidence interval, 38.58–68.4 patients with a mean age of 59.78±15.77 years met the inclusion criteria of this investigation. These patients were compared to a total of 20 (46.51% [35% female], 95% confidence interval, 31.6–61.42 patients with a mean age of 58.9±13.36 years with CAP who were infested with S. pneumoniae. In the latter group, the streptococcal antigen was detected in pulmonary aspirations by bronchoscopy or in urine using polymerase chain reaction and a rapid pneumococcal test. Penicillin G and vancomycin had a high rate of sensitivity on the antibiogram for S. pneumoniae, which was

Streptococcus pneumoniae aislados durante 2002-2006: serotipos y resistencia antibiótica. Correlación con las vacunas existentes

Directory of Open Access Journals (Sweden)

José María Guevara-Duncan

2008-03-01

Full Text Available Objetivos: Identificar los serotipos de S. pneumoniae aislados, correlacionándolos con los incluidos en las vacunas existentes y su resistencia antimicrobiana. Diseño: Estudio descriptivo, observacional y longitudinal. Lugar: Instituto de Medicina Tropical Daniel A. Carrión, Facultad de Medicina, UNMSM. Material biológico: Cepas de Streptococcus pneumoniae. Intervenciones: Cuarenta Streptococcus pneumoniae de nuestro cepario, aislados entre el 2002 y 2006, fueron serotipificados en el Instituto de Salud Carlos III en Madrid -España; 15 fueron invasivos, 11 aislados de infecciones localizadas, 6 de portadores y 8 eran multiresistentes. Principales medidas de resultados: Protección de las vacunas existentes en nuestro medio a las infecciones causadas por Streptococcus pneumoniae. Resultados: Hubo 14 serotipos diferentes y los serogrupos más identificados fueron 23, 19 y 6. El 28,6% estaba contenido en la vacuna 7-valente, 42,9% en la 9-valente, 50% en la 11-valente y el 71,4% en la 23-valente; 57,5% fue resistente a la penicilina y 30% a eritromicina. El grupo de Streptococcus invasivo resultó más sensible a los antibióticos que los otros grupos. Los serotipos asociados a multirresistencia fueron 19F y 23F. Conclusiones: Ninguna de las vacunas protege a todas las infecciones causadas por Streptococcus pneumoniae, en nuestro medio.

Streptococcus pneumoniae PspC Subgroup Prevalence in Invasive Disease and Differences in Contribution to Complement Evasion.

Science.gov (United States)

van der Maten, Erika; van den Broek, Bryan; de Jonge, Marien I; Rensen, Kim J W; Eleveld, Marc J; Zomer, Aldert L; Cremers, Amelieke J H; Ferwerda, Gerben; de Groot, Ronald; Langereis, Jeroen D; van der Flier, Michiel

2018-04-01

The pneumococcal capsular serotype is an important determinant of complement resistance and invasive disease potential, but other virulence factors have also been found to contribute. Pneumococcal surface protein C (PspC), a highly variable virulence protein that binds complement factor H to evade C3 opsonization, is divided into two subgroups: choline-bound subgroup I and LPxTG-anchored subgroup II. The prevalence of different PspC subgroups in invasive pneumococcal disease (IPD) and functional differences in complement evasion are unknown. The prevalence of PspC subgroups in IPD isolates was determined in a collection of 349 sequenced strains of Streptococcus pneumoniae isolated from adult patients. pspC deletion mutants and isogenic pspC switch mutants were constructed to study differences in factor H binding and complement evasion in relation to capsule thickness. Subgroup I pspC was far more prevalent in IPD isolates than subgroup II pspC The presence of capsule was associated with a greater ability of bound factor H to reduce complement opsonization. Pneumococcal subgroup I PspC bound significantly more factor H and showed more effective complement evasion than subgroup II PspC in isogenic encapsulated pneumococci. We conclude that variation in the PspC subgroups, independent of capsule serotypes, affects pneumococcal factor H binding and its ability to evade complement deposition. Copyright © 2018 American Society for Microbiology.

Invasive liver abscess syndrome caused by Klebsiella pneumoniae with definite K2 serotyping in Japan: a case report.

Science.gov (United States)

Seo, Ryota; Kudo, Daisuke; Gu, Yoshiaki; Yano, Hisakazu; Aoyagi, Tetsuji; Omura, Taku; Irino, Shigemi; Kaku, Mitsuo; Kushimoto, Shigeki

2016-12-01

Klebsiella pneumonia is a well-known human pathogen, and recently, a distinct invasive syndrome caused by K. pneumoniae serotypes K1 and K2 has been recognized in Southeast Asia. This syndrome is characterized by primary liver abscess and extrahepatic complications resulting from bacteremic dissemination. We report the first adult case of primary liver abscess caused by the definite K2 serotyped pathogen, with endogenous endophthalmitis in Japan. A 64-year-old woman was admitted to a nearby hospital for a high fever and diarrhea. She had visual loss of her right eye, renal dysfunction, and thrombocytopenia within 24 h from admission. She was transferred to our institution. On admission, she had no alteration of mental status and normal vital signs; however, she had almost complete ablepsia of the right eye. Laboratory data showed severe inflammation, liver dysfunction, thrombocytopenia, an increased serum creatinine level, and coagulopathy. Computed tomography showed a low density area in the right lobe of the liver. Invasive liver abscess syndrome probably caused by K. pneumonia was highly suspected and immediately administered broad-spectrum antibiotics for severe sepsis. Concurrently, endogenous endophthalmitis was diagnosed, and we performed vitrectomy on the day of admission. The blood culture showed K. pneumoniae infection. Percutaneous drainage of the liver abscess was also performed. Although she was discharged in a good general condition on day 22, she had complete ablepsia of the right eye. The K2A gene was detected by polymerase chain reaction (PCR), which is consistent with the K2 serotype. PCR was also positive for the virulence-associated gene rmpA. Final diagnosis was invasive liver abscess syndrome caused by K2 serotype K. pneumonia. Although the primary liver abscess caused by K. pneumoniae with a hypermucoviscous phenotype is infrequently reported outside Southeast Asia, physicians should recognize this syndrome, and appropriate diagnosis and

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

N-acetylgalatosamine-Mediated Regulation of the aga Operon by AgaR in Streptococcus pneumoniae

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Ahmed, Hifza; Kuipers, Oscar P

2016-01-01

Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa). Transcriptome comparison of S. pneumoniae D39 grown in NAGaM17 (0.5% NAGa + M17) to that grown in GM17 (0.5% Glucose + M17) revealed the elevated expression of various carbon metabolic

Streptococcus pneumoniae Supragenome Hybridization Arrays for Profiling of Genetic Content and Gene Expression.

Science.gov (United States)

Kadam, Anagha; Janto, Benjamin; Eutsey, Rory; Earl, Joshua P; Powell, Evan; Dahlgren, Margaret E; Hu, Fen Z; Ehrlich, Garth D; Hiller, N Luisa

2015-02-02

There is extensive genomic diversity among Streptococcus pneumoniae isolates. Approximately half of the comprehensive set of genes in the species (the supragenome or pangenome) is present in all the isolates (core set), and the remaining is unevenly distributed among strains (distributed set). The Streptococcus pneumoniae Supragenome Hybridization (SpSGH) array provides coverage for an extensive set of genes and polymorphisms encountered within this species, capturing this genomic diversity. Further, the capture is quantitative. In this manner, the SpSGH array allows for both genomic and transcriptomic analyses of diverse S. pneumoniae isolates on a single platform. In this unit, we present the SpSGH array, and describe in detail its design and implementation for both genomic and transcriptomic analyses. The methodology can be applied to construction and modification of SpSGH array platforms, as well to other bacterial species as long as multiple whole-genome sequences are available that collectively capture the vast majority of the species supragenome. Copyright © 2015 John Wiley & Sons, Inc.

Strain-specific virulence phenotypes of Streptococcus pneumoniae assessed using the Chinchilla laniger model of otitis media.

Directory of Open Access Journals (Sweden)

Michael L Forbes

2008-04-01

Full Text Available Streptococcus pneumoniae [Sp] infection is associated with local and systemic disease. Our current understanding of the differential contributions of genetic strain variation, serotype, and host response to disease phenotype is incomplete. Using the chinchilla model of otitis media [OM] we investigated the disease phenotype generated by the laboratory strain TIGR4 and each of thirteen clinical strains (BS68-75, BS290, BS291, BS293, BS436 and BS437; eleven of the thirteen strains have been genomically sequenced.For each strain 100 colony forming units were injected bilaterally into the tympanic bullae of 6 young adult chinchillas under general anesthesia. All animals were examined daily for local and systemic disease by a blinded observer. Pneumatic otoscopy was used to evaluate local disease, and behavioral assessments served as the measure of systemic disease. Virulence scoring was performed using a 4-point scale to assess four clinical parameters [severity and rapidity of local disease onset; and severity and rapidity of systemic disease onset] during a 10-day evaluation period. Highly significant variation was observed among the strains in their ability to cause disease and moribundity.As expected, there was a significant correlation between the rapidity of systemic disease onset and severity of systemic disease; however, there was little correlation between the severity of otoscopic changes and severity of systemic disease. Importantly, it was observed that different strains of the same serotype produced as broad an array of disease phenotypes as did strains of different serotypes. We attribute these phenotypic differences among the strains to the high degree of genomic plasticity that we have previously documented.

Streptococcus pneumoniae: A Cause of Primary Lung Abscess in a Child

OpenAIRE

MacDonald, Kelly S; de Carvalho, Volia M; Liebert, Lawrence; Embree, Joanne E

1993-01-01

A case of primary pneumococcal lung abscess in a five-year-old child is described. Secondary anaerobic infection as a cause of cavitation was excluded by bronchoscopic culture of the cavity. Streptococcus pneumoniae is a rare but recognized cause of lung abscess in healthy children.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

NARCIS (Netherlands)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose

Streptococcus pneumoniae-induced ototoxicity in organ of Corti explant cultures.

Science.gov (United States)

Perny, Michael; Solyga, Magdalena; Grandgirard, Denis; Roccio, Marta; Leib, Stephen L; Senn, Pascal

2017-07-01

Hearing loss remains the most common long-term complication of pneumococcal meningitis (PM) reported in up to 30% of survivors. Streptococcus pneumoniae have been shown to possess different ototoxic properties. Here we present a novel ex vivo experimental setup to examine in detail the pattern of hair cell loss upon exposure to different S. pneumoniae strains, therefore recapitulating pathogen derived aspects of PM-induced hearing loss. Our results show a higher susceptibility towards S. pneumoniae-induced cochlear damage for outer hair cells (OHC) compared to inner hair cells (IHC), which is consistent with in vivo data. S. pneumoniae-induced hair cell loss was both time and dose-dependent. Moreover, we have found significant differences in the level of cell damage between tissue from the basal and the apical turns. This shows that the higher vulnerability of hair cells located at high frequency regions observed in vivo cannot be explained solely by the spatial organisation and bacterial infiltration from the basal portion of the cochlea. Using a wild type D39 strain and a mutant defective for the pneumolysin (PLY) gene, we also have shown that the toxin PLY is an important factor involved in ototoxic damages. The obtained results indicate that PLY can cause both IHC and OHC loss. Finally, we are reporting here for the first time a higher vulnerability of HC located at the basal and middle cochlear region to pneumolysin-induced damage. The detailed description of the susceptibility of hair cells to Streptococcus pneumoniae provided in this report can in the future determine the choice and the development of novel otoprotective therapies during pneumococcal meningitis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

OpenAIRE

Aura Lucía Leal; Castañeda Elizabeth

1999-01-01

Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medell...

The enhanced pneumococcal LAMP assay: a clinical tool for the diagnosis of meningitis due to Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Dong Wook Kim

Full Text Available BACKGROUND: Streptococcus pneumoniae is a leading cause of invasive bacterial disease in developed and developing countries. We studied the loop-mediated isothermal amplification (LAMP technique to assess its suitability for detecting S. pneumoniae nucleic acid in cerebrospinal fluid (CSF. METHODOLOGY/PRINCIPAL FINDINGS: We established an improved LAMP assay targeting the lytA gene (Streptococcus pneumoniae [Sp] LAMP. The analytical specificity of the primers was validated by using 32 reference strains (10 Streptococcus and seven non-Streptococcus species plus 25 clinical alpha-hemolytic streptococcal strains, including four S. pneumoniae strains and 21 other strains (3 S. oralis, 17 S. mitis, and one Streptococcus species harboring virulence factor-encoding genes (lytA or ply. Within 30 minutes, the assay could detect as few as 10 copies of both purified DNA and spiked CSF specimens with greater sensitivity than conventional polymerase chain reaction (PCR. The linear determination range for this assay is 10 to 1,000,000 microorganisms per reaction mixture using real-time turbidimetry. We evaluated the clinical sensitivity and specificity of the Sp LAMP assay using 106 randomly selected CSF specimens from children with suspected meningitis in Korea, China and Vietnam. For comparison, CSF specimens were also tested against conventional PCR and culture tests. The detection rate of the LAMP method was substantially higher than the rates of PCR and culture tests. In this small sample, relative to the LAMP assay, the clinical sensitivity of PCR and culture tests was 54.5% and 33.3%, respectively, while clinical specificity of the two tests was 100%. CONCLUSIONS/SIGNIFICANCE: Compared to PCR, Sp LAMP detected S. pneumoniae with higher analytical and clinical sensitivity. This specific and sensitive LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

Prenatal and neonatal Group B Streptococcus screening and serotyping in Lebanon: incidence and implications.

Science.gov (United States)

Seoud, Muheiddine; Nassar, Anwar H; Zalloua, Pierre; Boghossian, Nansi; Ezeddine, Jihad; Fakhoury, Hassan; Abboud, Joseph; Melki, Imad; Araj, George; Nacouzi, Ghinwa; Sanyoura, May; Yunis, Khalid

2010-03-01

The study aimed at determining the prevalence, risk factors, perinatal transmission, and serotypes of Group B Streptococcus (GBS) among pregnant women and their newborns in Beirut, Lebanon. This was a cross-sectional study of all pregnant women admitted from February to September 2006 to three major hospitals. Overall, 137 of 775 (17.7%) mothers and 50 of 682 newborns (7.3%) tested positive for GBS. Maternal colonization was not associated with maternal age, household income, gravidity, intrapartum fever, preterm labor, or premature rupture of membrane. Transmission rate was 40/120 (30%). Serotype 5 (24.1%) was the most common followed by serotype 1a (15.0%), 3 (14.4%), 2 (11.8%) and 1b (7.5%). Pregnant women in Lebanon appear to have a relatively high prevalence of GBS colonization with no identifiable risk factors for its acquisition. These results could provide basis for the institution of a national policy for universal maternal GBS screening to reduce neonatal morbidity and mortality.

Internamento devido a PAC por Streptococcus pneumoniae - Avaliação de factores de mortalidade Streptococcus pneumoniae - caused CAP in hospitalised patients: mortality predictors

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-10-01

Full Text Available A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS - CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0. Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade. Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for microbiological testing using standard culture techniques and urine antigen detection. Pneumonia Severity Index (PSI and British Thoracic Society

Involvement of T6 pili in biofilm formation by serotype M6 Streptococcus pyogenes.

Science.gov (United States)

Kimura, Keiji Richard; Nakata, Masanobu; Sumitomo, Tomoko; Kreikemeyer, Bernd; Podbielski, Andreas; Terao, Yutaka; Kawabata, Shigetada

2012-02-01

The group A streptococcus (GAS) Streptococcus pyogenes is known to cause self-limiting purulent infections in humans. The role of GAS pili in host cell adhesion and biofilm formation is likely fundamental in early colonization. Pilus genes are found in the FCT (fibronectin-binding protein, collagen-binding protein, and trypsin-resistant antigen) genomic region, which has been classified into nine subtypes based on the diversity of gene content and nucleotide sequence. Several epidemiological studies have indicated that FCT type 1 strains, including serotype M6, produce large amounts of monospecies biofilm in vitro. We examined the direct involvement of pili in biofilm formation by serotype M6 clinical isolates. In the majority of tested strains, deletion of the tee6 gene encoding pilus shaft protein T6 compromised the ability to form biofilm on an abiotic surface. Deletion of the fctX and srtB genes, which encode pilus ancillary protein and class C pilus-associated sortase, respectively, also decreased biofilm formation by a representative strain. Unexpectedly, these mutant strains showed increased bacterial aggregation compared with that of the wild-type strain. When the entire FCT type 1 pilus region was ectopically expressed in serotype M1 strain SF370, biofilm formation was promoted and autoaggregation was inhibited. These findings indicate that assembled FCT type 1 pili contribute to biofilm formation and also function as attenuators of bacterial aggregation. Taken together, our results show the potential role of FCT type 1 pili in the pathogenesis of GAS infections.

Outbreaks of Streptococcus pneumoniae carriage in day care cohorts in Finland – implications for elimination of transmission

Directory of Open Access Journals (Sweden)

Auranen Kari

2009-06-01

Full Text Available Abstract Background Day care centre (DCC attendees play a central role in maintaining the circulation of Streptococcus pneumoniae (pneumococcus in the population. Exposure within families and within DCCs are the main risk factors for colonisation with pneumococcal serotypes in DCC attendees. Methods Transmission of serotype specific carriage was analysed with a continuous time event history model, based on longitudinal data from day care attendees and their family members. Rates of acquisition, conditional on exposure, were estimated in a Bayesian framework utilising latent processes of carriage. To ensure a correct level of exposure, non-participating day care attendees and their family members were included in the analysis. Posterior predictive simulations were used to quantify transmission patterns within day care cohorts, to estimate the basic reproduction number for pneumococcal carriage in a population of day care cohorts, and to assess the critical vaccine efficacy against carriage to eliminate pneumococcal transmission. Results The model, validated by posterior predictive sampling, was successful in capturing the strong temporal clustering of pneumococcal serotypes in the day care cohorts. In average 2.7 new outbreaks of pneumococcal carriage initiate in a day care cohort each month. While 39% of outbreaks were of size one, the mean outbreak size was 7.6 individuals and the mean length of an outbreak was 2.8 months. The role of families in creating and maintaining transmission was minimal, as only 10% of acquisitions in day care attendees were from family members. Considering a population of day care cohorts, a child-to-child basic reproduction number was estimated as 1.4 and the critical vaccine efficacy against acquisition of carriage as 0.3. Conclusion Pneumococcal transmission occurs in serotype specific outbreaks of carriage, driven by within-day-care transmission and between-serotype competition. An amplifying effect of the day

Streptococcus pneumoniae sepsis as the initial presentation of systemic lupus erythematosus

Directory of Open Access Journals (Sweden)

Erdem I

2016-09-01

Full Text Available Ilknur Erdem,1 Senay Elbasan Omar,1 Ridvan Kara Ali,1 Hayati Gunes,2 Aynur Eren Topkaya2 1Department of Infectious Diseases, 2Department of Medical Microbiology, Faculty of Medicine, Namik Kemal University, Tekirdag, Turkey Objective: Infections are among the most important causes of morbidity and mortality in patients with systemic lupus erythematosus (SLE but are rare initial presentation of the disease. Therefore, in this study, we describe a case of Streptococcus pneumoniae sepsis in a young woman with previously undiagnosed SLE. Case report: A 23-year-old female patient was admitted to our outpatient clinic complaining of high fever (40°C, chills, fatigue, generalized myalgia, and cough with brown sputum for 5 days. Blood cultures grew gram-positive coccus defined as S. pneumoniae using standard procedures. Antinuclear antibody was positive at a titer of 1/1,000, and anti-double-stranded DNA was positive at 984 IU/mL. She was diagnosed with SLE. Her respiratory symptoms and pleural effusion were considered to be due to pulmonary manifestation of SLE. Conclusion: The underlying immunosuppression caused by SLE could have predisposed the patient to invasive pneumococcal disease. It may also occur as a primary presenting feature, although a rare condition. Keywords: Streptococcus pneumoniae, sepsis, systemic lupus erythematosus

Selective and genetic constraints on pneumococcal serotype switching.

Directory of Open Access Journals (Sweden)

Nicholas J Croucher

2015-03-01

Full Text Available Streptococcus pneumoniae isolates typically express one of over 90 immunologically distinguishable polysaccharide capsules (serotypes, which can be classified into "serogroups" based on cross-reactivity with certain antibodies. Pneumococci can alter their serotype through recombinations affecting the capsule polysaccharide synthesis (cps locus. Twenty such "serotype switching" events were fully characterised using a collection of 616 whole genome sequences from systematic surveys of pneumococcal carriage. Eleven of these were within-serogroup switches, representing a highly significant (p < 0.0001 enrichment based on the observed serotype distribution. Whereas the recombinations resulting in between-serogroup switches all spanned the entire cps locus, some of those that caused within-serogroup switches did not. However, higher rates of within-serogroup switching could not be fully explained by either more frequent, shorter recombinations, nor by genetic linkage to genes involved in β-lactam resistance. This suggested the observed pattern was a consequence of selection for preserving serogroup. Phenotyping of strains constructed to express different serotypes in common genetic backgrounds was used to test whether genotypes were physiologically adapted to particular serogroups. These data were consistent with epistatic interactions between the cps locus and the rest of the genome that were specific to serotype, but not serogroup, meaning they were unlikely to account for the observed distribution of capsule types. Exclusion of these genetic and physiological hypotheses suggested future work should focus on alternative mechanisms, such as host immunity spanning multiple serotypes within the same serogroup, which might explain the observed pattern.

Epidemiology of Streptococcus pneumoniae and Staphylococcus aureus colonization in healthy Venezuelan children

NARCIS (Netherlands)

Quintero, B.; Araque, M.; Gaast-de Jongh, C.E. van der; Escalona, F.; Correa, M.; Morillo-Puente, S.; Vielma, S.; Hermans, P.W.M.

2011-01-01

Streptococcus pneumoniae and Staphylococcus aureus cause significant morbidity and mortality worldwide. We investigated both the colonization and co-colonization characteristics for these pathogens among 250 healthy children from 2 to 5 years of age in Merida, Venezuela, in 2007. The prevalence of

Acute suppurative parotitis caused by Streptococcus pneumoniae in an HIV-infected man.

Science.gov (United States)

Guzman Vinasco, Luis; Bares, Sara; Sandkovsky, Uriel

2015-03-02

We report a case of a 32-year-old man who presented with progressive unilateral parotid gland enlargement and subsequently tested positive for HIV. A CT scan of the neck performed with contrast showed a phlegmon in the region of the right parotid tail measuring approximately 2.5×2.4 cm. Cultures of the aspirated fluid grew Streptococcus pneumoniae and the S. pneumoniae urinary antigen test was also positive. The patient underwent surgical debridement and received antimicrobial therapy with complete resolution of the parotitis. Parotitis caused by S. pneumoniae is rare, and HIV infection should be suspected in any case of invasive pneumococcal disease. 2015 BMJ Publishing Group Ltd.

Serotype- and virulence-associated gene profile of Streptococcus suis isolates from pig carcasses in Chiang Mai Province, Northern Thailand.

Science.gov (United States)

Wongsawan, Kanruethai; Gottschalk, Marcelo; Tharavichitkul, Prasit

2015-02-01

In this present study, the serotype of 40 Streptococcus suis isolates from submaxillary glands of pig carcasses sold in wet markets in Chiang Mai Province, northern Thailand, was investigated. Eleven serotypes, including types 2, 3, 4, 5, 7, 8, 9, 17, 21, 22 and 31, were found in the isolates by a Multiplex PCR combined with serum agglutination. Of the eleven serotypes present, type 3 was the most prevalent, while types 2, 4, 5 and 21 were of primary interest due to their human isolate serotype. The mrp+/epf - /sly - genotype was found to be the most prevalent genotype. This study indicates the importance of effective control of human S. suis infection due to raw pork or pig carcass handling in northern Thailand.

A necrotic lung ball caused by co-infection with Candida and Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Yokoyama T

2011-12-01

Full Text Available Toshinobu Yokoyama, Jun Sasaki, Keita Matsumoto, Chie Koga, Yusuke Ito, Yoichiro Kaku, Morihiro Tajiri, Hiroki Natori, Masashi HirokawaDivision of Respirology, Neurology and Rheumatology, Department of Internal Medicine, Kurume University School of Medicine, Kurume, JapanIntroduction: A necrotic lung ball is a rare radiological feature that is sometimes seen in cases of pulmonary aspergillosis. This paper reports a rare occurrence of a necrotic lung ball in a young male caused by Candida and Streptococcus pneumoniae.Case report: A 28-year-old male with pulmonary candidiasis was found to have a lung ball on computed tomography (CT of the chest. The patient was treated with ß-lactams and itraconazole and then fluconazole, which improved his condition (as found on a following chest CT scan and serum ß-D-glucan level. The necrotic lung ball was suspected to have been caused by co-infection with Candida and S. pneumoniae.Conclusion: A necrotic lung ball can result from infection by Candida and/or S. pneumoniae, indicating that physicians should be aware that patients may still have a fungal infection of the lungs that could result in a lung ball, even when they do not have either Aspergillus antibodies or antigens.Keywords: lung ball, necrotic lung ball, Candida, Streptococcus pneumoniae

Utilización de la penicilina en la infección extrameníngea por Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Amauri Lázaro Noda Albelo

2011-12-01

Full Text Available La resistencia del Streptococcus pneumoniae a los antibióticos betalactámicos es relativa, y puede ser superada si se incrementa la dosis de esta clase de medicamentos. La definición de susceptibilidad y resistencia del Streptococcus pneumoniae se creó originalmente para predecir respuesta al tratamiento de la infección del sistema nervioso central. La infección fuera del sistema nervioso central por la mayoría de las cepas de S. pneumoniae responde a las dosis habituales de antibióticos betalactámicos. Se realiza una revisión de los nuevos puntos de corte del Laboratory Standars Institute para sensibilidad a penicilina del patógeno, y se analiza su implicación en la terapéutica actual de la enfermedad extrameníngea por S. pneumoniae.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae

NARCIS (Netherlands)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-01-01

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires

Streptococcus pneumoniae enhances human respiratory syncytial virus infection in vitro and in vivo

NARCIS (Netherlands)

D.T. Nguyen (Tien); R.P.L. Louwen (Rogier); Elberse, K. (Karin); G. van Amerongen (Geert); S. Yüksel (Selma); A. Luijendijk (Ad); A.D.M.E. Osterhaus (Albert); W.P. Duprex (William Paul); R.L. de Swart (Rik)

2015-01-01

textabstractHuman respiratory syncytial virus (HRSV) and Streptococcus pneumoniae are important causative agents of respiratory tract infections. Both pathogens are associated with seasonal disease outbreaks in the pediatric population, and can often be detected simultaneously in infants

Characterization of virulence of the Streptococcus suis serotype 2 reference strain Henrichsen S 735 in newborn gnotobiotic pigs

NARCIS (Netherlands)

Vecht, U.; Wisselink, H.J.; Stockhofe-Zurwieden, N.; Smith, H.E.

1996-01-01

Strain Henrichsen S 735 (NCTC 10234) of Streptococcus suis serotype 2 reference and three other such strains (strains S 4005, S 3921 and T 141) were tested for virulence by inoculating pigs intranasally and intravenously. The taxonomical properties of each strain were determined. Phenotypes were

Epidemiological Studies of Potent Environmental Pathogen: Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Nazir A. Brohi

2016-12-01

Full Text Available A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton’s agar after 24 hours incubation

Epidemiological studies of potent environment pathogen streptococcus pneumoniae

International Nuclear Information System (INIS)

Brohi, N.A.; Tunio, S.A.

2016-01-01

A general survey for six months was undertaken for the prevalence of environmental bacterium Streptococcus pneumoniae among the different age groups (3-65 years) including both sexes from various hospitals of Hyderabad city. Laboratory examinations revealed S. pneumoniae as most potent environmental pathogen from the sputum and throat swabs of old aged patients and children respectively. During observations, 39 specimens were growth positive; the biochemistry of isolates revealed that they were coagulase, catalase and oxidase negative, TSI, gel hydrolysis positive and were able to ferment glucose, lactose, maltose, galactose, fructose, sucrose, starch and raffinose. The results of antimicrobial activity showed that pneumococci were resistant to the cefspan, septran, cravit, pipemetic acid, azomax, bacitracin, and penicillin and a clear zone of inhibition was observed on clithromycin, optochin, cefizox, genatamycin, minocyclin, levoflaxacin, and vancomycin. There were intermediate zone of inhibition found on claforan, nalidixic acid, amoxycillin, fosfomycin, fortum, and erythromycin on Mueller Hinton's agar after 24 hours incubation. (author)

AdcAII of Streptococcus pneumoniae Affects Pneumococcal Invasiveness.

Directory of Open Access Journals (Sweden)

Lindsey R Brown

Full Text Available Across bacterial species, metal binding proteins can serve functions in pathogenesis in addition to regulating metal homeostasis. We have compared and contrasted the activities of zinc (Zn2+-binding lipoproteins AdcA and AdcAII in the Streptococcus pneumoniae TIGR4 background. Exposure to Zn2+-limiting conditions resulted in delayed growth in a strain lacking AdcAII (ΔAdcAII when compared to wild type bacteria or a mutant lacking AdcA (ΔAdcA. AdcAII failed to interact with the extracellular matrix protein laminin despite homology to laminin-binding proteins of related streptococci. Deletion of AdcA or AdcAII led to significantly increased invasion of A549 human lung epithelial cells and a trend toward increased invasion in vivo. Loss of AdcAII, but not AdcA, was shown to negatively impact early colonization of the nasopharynx. Our findings suggest that expression of AdcAII affects invasiveness of S. pneumoniae in response to available Zn2+ concentrations.

Mechanisms of genome evolution of Streptococcus.

Science.gov (United States)

Andam, Cheryl P; Hanage, William P

2015-07-01

The genus Streptococcus contains 104 recognized species, many of which are associated with human or animal hosts. A globally prevalent human pathogen in this group is Streptococcus pneumoniae (the pneumococcus). While being a common resident of the upper respiratory tract, it is also a major cause of otitis media, pneumonia, bacteremia and meningitis, accounting for a high burden of morbidity and mortality worldwide. Recent findings demonstrate the importance of recombination and selection in driving the population dynamics and evolution of different pneumococcal lineages, allowing them to successfully evade the impacts of selective pressures such as vaccination and antibiotic treatment. We highlight the ability of pneumococci to respond to these pressures through processes including serotype replacement, capsular switching and horizontal gene transfer (HGT) of antibiotic resistance genes. The challenge in controlling this pathogen also lies in the exceptional genetic and phenotypic variation among different pneumococcal lineages, particularly in terms of their pathogenicity and resistance to current therapeutic strategies. The widespread use of pneumococcal conjugate vaccines, which target only a small subset of the more than 90 pneumococcal serotypes, provides us with a unique opportunity to elucidate how the processes of selection and recombination interact to generate a remarkable level of plasticity and heterogeneity in the pneumococcal genome. These processes also play an important role in the emergence and spread of multi-resistant strains, which continues to pose a challenge in disease control and/or eradication. The application of population of genomic approaches at different spatial and temporal scales will help improve strategies to control this global pathogen, and potentially other pathogenic streptococci. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Serotypes, antibiotic susceptibilities, and multi-locus sequence type profiles of Streptococcus agalactiae isolates circulating in Beijing, China.

Science.gov (United States)

Wang, Ping; Tong, Jing-jing; Ma, Xiu-hua; Song, Feng-li; Fan, Ling; Guo, Cui-mei; Shi, Wei; Yu, Sang-jie; Yao, Kai-hu; Yang, Yong-hong

2015-01-01

To investigate the serotypes, antibiotic susceptibilities, and multi-locus sequence type (MLST) profiles of Streptococcus agalactiae (S. agalactiae) in Beijing to provide references for the prevention and treatment of S. agalactiae infections. All isolates were identified using the CAMP test and the latex-agglutination assay and serotyped using a Strep-B-Latex kit, after which they were assessed for antibiotic susceptibility, macrolide-resistance genes, and MLST profiles. In total, 56 S. agalactiae isolates were identified in 863 pregnant women (6.5%). Serotypes Ia, Ib, II, III, and V were identified, among which types III (32.1%), Ia (17.9%), Ib (16.1%), and V (14.3%) were the predominant serotypes. All isolates were susceptible to penicillin and ceftriaxone. The nonsusceptiblity rates measured for erythromycin, clarithromycin, azithromycin, telithromycin, clindamycin, tetracycline, and levofloxacin were 85.7%, 92.9%, 98.2%, 30.4%, 73.2%, 91%, and 39.3%, respectively. We identified 14 sequence types (STs) for the 56 isolates, among which ST19 (30.4%) was predominant. The rate of fluoroquinolone resistance was higher in serotype III than in the other serotypes. Among the 44 erythromycin-resistant isolates, 32 (72.7%) carried ermB. S. agalactiae isolates of the serotypes Ia, Ib, III, and V are common in Beijing. Among the S. agalactiae isolates, the macrolide and clindamycin resistance rates are extremely high. Most of the erythromycin-resistant isolates carry ermB.

[Bacteremic pneumococcal pneumonia].

Science.gov (United States)

Pineda Solas, V; Pérez Benito, A; Domingo Puiggros, M; Larramona Carrera, H; Segura Porta, F; Fontanals Aymerich, D

2002-11-01

Streptococcus pneumonia is the most common bacterial cause of community-acquired pneumonia in children. The reference standard for etiological diagnosis is isolation of S. pneumoniae from blood Since the advent of conjugate vaccines, disease caused by this organism can now be prevented. Many studies have been performed of the global incidence of invasive pneumococcal infections and of pneumococcal meningitis but few studies investigated bacteremic pneumococcal pneumonia and its complications in children. To determine the incidence, patient characteristics, clinical signs, laboratory data, percentage and days of hospitalization, response to antibiotic treatment, antibiotic resistance, complications and causal serogroups of bacteremic pneumococcal pneumonia in our environment in order to estimate requirements for systematic vaccination programs. From January 1990 to May 2001, data on all pediatric cases of invasive pneumococcal infections diagnosed in our hospital were collected. Several characteristics of patients with bacteremic pneumococcal pneumonia were analyzed. Bacteremic pneumococcal pneumonia was diagnosed in patients with positive blood or pleural fluid cultures for S. pneumoniae and radiographically evident pulmonary infiltrate. The incidence of both types of pneumonia were determined according to population census data. All S. pneumonia strains were sent to the Pneumococci Reference Laboratory of the Instituto Carlos III in Madrid for serotyping. We estimated the serotype coverage of the pneumococcal 7-valent conjugate vaccine according to the serotypes included in this vaccine and their distribution. Forty cases of bacteremic pneumococcal pneumonia were diagnosed, yielding an incidence of 17,10 and 5 cases per 10(5) children aged less than 2, 4 and 15 years old respectively. The mean age was 50 months and 43% were aged less than 4 years. Peaks occurred in January, March, April and May. A total of 77.5% of the patients were admitted to hospital and the

Bilateral Acromioclavicular Septic Arthritis as an Initial Presentation of Streptococcus pneumoniae Endocarditis

Directory of Open Access Journals (Sweden)

Neda Hashemi-Sadraei

2014-01-01

Full Text Available Infective endocarditis (IE is infrequently associated with septic arthritis. Moreover, septic arthritis of the acromioclavicular (AC joint is rarely reported in the literature. We report a case of Streptococcus pneumoniae IE in a patient who presented with bilateral AC joint septic arthritis and we review the literature on the topic.

PCR deduction of invasive and colonizing pneumococcal serotypes from Venezuela: a critical appraisal.

Science.gov (United States)

Bello Gonzalez, Teresita; Rivera-Olivero, Ismar Alejandra; Sisco, María Carolina; Spadola, Enza; Hermans, Peter W; de Waard, Jacobus H

2014-04-15

Serotype surveillance of Streptococcus pneumoniae is indispensable for evaluating the potential impact of pneumococcal conjugate vaccines. Serotyping by the standard Quellung reaction is technically demanding, time consuming, and expensive. A simple and economical strategy is multiplex PCR-based serotyping. We evaluated the cost effectiveness of a modified serial multiplex PCR (mPCR), resolving 24 serotypes in four PCR reactions and optimally targeting the most prevalent invasive and colonizing pneumococcal serotypes found in Venezuela. A total of 223 pneumococcal isolates, 140 invasive and 83 carriage isolates, previously serotyped by the Quellung reaction and representing the 18 most common serotypes/groups identified in Venezuela, were serotyped with the adapted mPCR. The mPCR serotyped 76% of all the strains in the first two PCR reactions and 91% after four reactions, correctly identifying 17 serotypes/groups. An isolate could be serotyped with mPCR in less than 2 minutes versus 15 minutes for the Quellung reaction, considerably lowering labor costs. A restrictive weakness of mPCR was found for the detection of 19F strains. Most Venezuelan 19F strains were not typeable using the mPCR, and two 19F cps serotype variants were identified. The mPCR assay is an accurate, rapid, and economical method for the identification of the vast majority of the serotypes from Venezuela and can be used in place of the standard Quellung reaction. An exception is the identification of serotype 19F. In this setting, most 19F strains were not detectable with mPCR, demonstrating a need of serology-based quality control for PCR-based serotyping.

An evaluation of emerging vaccines for childhood pneumococcal pneumonia

Directory of Open Access Journals (Sweden)

Zhang Jian Shayne F

2011-04-01

Full Text Available Abstract Background Pneumonia is the leading cause of child mortality worldwide. Streptococcus pneumoniae (SP or pneumococcus is estimated to cause 821,000 child deaths each year. It has over 90 serotypes, of which 7 to 13 serotypes are included in current formulations of pneumococcal conjugate vaccines that are efficacious in young children. To further reduce the burden from SP pneumonia, a vaccine is required that could protect children from a greater diversity of serotypes. Two different types of vaccines against pneumococcal pneumonia are currently at varying stages of development: a multivalent pneumococcal conjugate vaccine covering additional SP serotypes; and a conserved common pneumococcal protein antigen (PPA vaccine offering protection for all serotypes. Methods We used a modified CHNRI methodology for setting priorities in health research investments. This was done in two stages. In Stage I, we systematically reviewed the literature related to emerging SP vaccines relevant to several criteria of interest: answerability; efficacy and effectiveness; cost of development, production and implementation; deliverability, affordability and sustainability; maximum potential for disease burden reduction; acceptability to the end users and health workers; and effect on equity. In Stage II, we conducted an expert opinion exercise by inviting 20 experts (leading basic scientists, international public health researchers, international policy makers and representatives of pharmaceutical companies. The policy makers and industry representatives accepted our invitation on the condition of anonymity, due to sensitive nature of their involvement in such exercises. They answered questions from CHNRI framework and their “collective optimism” towards each criterion was documented on a scale from 0 to 100%. Results The experts expressed very high level of optimism (over 80% that low-cost polysaccharide conjugate SP vaccines would satisfy each of the 9

Pyruvate Oxidase Influences the Sugar Utilization Pattern and Capsule Production in Streptococcus pneumoniae

NARCIS (Netherlands)

Carvalho, Sandra M.; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P.; Neves, Ana R.; Bijlsma, Jetta J. E.

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence,

Meropenem susceptibility of Neisseria meningitidis and Streptococcus pneumoniae from meningitis patients in The Netherlands

NARCIS (Netherlands)

van de Beek, D.; Hensen, E. F.; Spanjaard, L.; de Gans, J.; Enting, R. H.; Dankert, J.

1997-01-01

In-vitro susceptibility of 299 Neisseria meningitidis and 157 Streptococcus pneumoniae strains from meningitis patients in The Netherlands in 1993 and 1994 to meropenem was determined using the Etest. Susceptibility to penicillin, ceftriaxone, and chloramphenicol was also determined. Rifampicin

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae.

Science.gov (United States)

Maricic, Natalie; Anderson, Erica S; Opipari, AnneMarie E; Yu, Emily A; Dawid, Suzanne

2016-01-26

Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus) in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials. Successful colonization of a polymicrobial host surface is a prerequisite for the subsequent development of disease for many bacterial pathogens. Bacterial factors that directly inhibit the growth of neighbors

The Importance of TLR2 and Macrophages in Modulating a Humoral Response after Encountering Streptococcus pneumoniae

Science.gov (United States)

2008-03-26

Chapter 3 Submited as: Sam Vasilevsky, Jesus Colino, Roman Puliaev, David H. Canaday, and Clifford M...general microbiology 138:249- 259. 7. Musher , D. M. 1992. Infections caused by Streptococcus pneumoniae: clinical spectrum, pathogenesis, immunity, and...Pneumonia and Its Implications for Antimicrobial Resistance Chest 115:1-2. 230. Musher , D. M., I. Alexandraki, E. A. Graviss, N. Yanbeiy, A. Eid, L

[Examination about utility of a Streptococcus pneumoniae capsular antigen swiftness search kit urine in a pneumonia patient].

Science.gov (United States)

Hashikita, Giichi; Yamaguti, Toshiyuki; Tachi, Yoshimi; Kishi, Etsuko; Kawamura, Toru; Takahashi, Shun; Arai, Yukie; Koyama, Sachie; Huruhata, Toshihumi; Itabashi, Akira; Oka, Yoko; Yamazaki, Tsutomu; Maesaki, Sigefumi

2005-01-01

We investigated the usefullness of Binax NOW urine antigen test, an immunochromatographic assay that binds any soluble Streptococcus pneumoniae antigen (C polysaccharide) for the diagnosis of penumoniae form September 2003 to March 2005. We used 372 samples form the patinets with pneumoniae diagnosed for blood or sputum cultuter or gram-stained sputum smear. Out of 24 culture positive specimens, Binax NOW urine antigen test, showed positive in 18 (75%) specimens. The sensitivity of sputum and blood culture was 71.7% and 83.3%, respectively. Binax NOW urine antigen test was seemed false positives in 55 samples, false negatives in 6 samples. The specificity of Binax NOW urine antigen test was evaluated 84.1%. Overall agreement among tests was 83.6%. When compared to culture, false negative urine antigen may be the result of colonizing S. pneumoniae in sputum or pneumonia caused by an agent other than S. pneumoniae. CRP values for cases were both urine antigen and culture were positive ranged from 40 mg/dl to 10 mg/dl while urine antigen and culture negative cases were predominantly less than 10 mg/dl. Positive blood and pleural fluid culture cases were consistently associated with strongly positive urine antigen tests. Non-agreement between urine antigen, culture, and microscopy may be the result of specimen quality, labile nature of S. pneumoniae and antimicrobial therapy.

Maternal Colonization With Group B Streptococcus and Serotype Distribution Worldwide: Systematic Review and Meta-analyses.

Science.gov (United States)

Russell, Neal J; Seale, Anna C; O'Driscoll, Megan; O'Sullivan, Catherine; Bianchi-Jassir, Fiorella; Gonzalez-Guarin, Juan; Lawn, Joy E; Baker, Carol J; Bartlett, Linda; Cutland, Clare; Gravett, Michael G; Heath, Paul T; Le Doare, Kirsty; Madhi, Shabir A; Rubens, Craig E; Schrag, Stephanie; Sobanjo-Ter Meulen, Ajoke; Vekemans, Johan; Saha, Samir K; Ip, Margaret

2017-11-06

Maternal rectovaginal colonization with group B Streptococcus (GBS) is the most common pathway for GBS disease in mother, fetus, and newborn. This article, the second in a series estimating the burden of GBS, aims to determine the prevalence and serotype distribution of GBS colonizing pregnant women worldwide. We conducted systematic literature reviews (PubMed/Medline, Embase, Latin American and Caribbean Health Sciences Literature [LILACS], World Health Organization Library Information System [WHOLIS], and Scopus), organized Chinese language searches, and sought unpublished data from investigator groups. We applied broad inclusion criteria to maximize data inputs, particularly from low- and middle-income contexts, and then applied new meta-analyses to adjust for studies with less-sensitive sampling and laboratory techniques. We undertook meta-analyses to derive pooled estimates of maternal GBS colonization prevalence at national and regional levels. The dataset regarding colonization included 390 articles, 85 countries, and a total of 299924 pregnant women. Our adjusted estimate for maternal GBS colonization worldwide was 18% (95% confidence interval [CI], 17%-19%), with regional variation (11%-35%), and lower prevalence in Southern Asia (12.5% [95% CI, 10%-15%]) and Eastern Asia (11% [95% CI, 10%-12%]). Bacterial serotypes I-V account for 98% of identified colonizing GBS isolates worldwide. Serotype III, associated with invasive disease, accounts for 25% (95% CI, 23%-28%), but is less frequent in some South American and Asian countries. Serotypes VI-IX are more common in Asia. GBS colonizes pregnant women worldwide, but prevalence and serotype distribution vary, even after adjusting for laboratory methods. Lower GBS maternal colonization prevalence, with less serotype III, may help to explain lower GBS disease incidence in regions such as Asia. High prevalence worldwide, and more serotype data, are relevant to prevention efforts. © The Author 2017. Published by

Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

Directory of Open Access Journals (Sweden)

Tijmen J Hommes

Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

Surface antigens contribute differently to the pathophysiological features in serotype K1 and K2 Klebsiella pneumoniae strains isolated from liver abscesses.

Science.gov (United States)

Yeh, Kuo-Ming; Chiu, Sheng-Kung; Lin, Chii-Lan; Huang, Li-Yueh; Tsai, Yu-Kuo; Chang, Jen-Chang; Lin, Jung-Chung; Chang, Feng-Yee; Siu, Leung-Kei

2016-01-01

The virulence role of surface antigens in a single serotype of Klebsiella pneumoniae strain have been studied, but little is known about whether their contribution will vary with serotype. To investigate the role of K and O antigen in hyper-virulent strains, we constructed O and K antigen deficient mutants from serotype K1 STL43 and K2 TSGH strains from patients with liver abscess, and characterized their virulence in according to the abscess formation and resistance to neutrophil phagocytosis, serum, and bacterial clearance in liver. Both of K1 and K2-antigen mutants lost their wildtype resistance to neutrophil phagocytosis and hepatic clearance, and failed to cause abscess formation. K2-antigen mutant became serum susceptible while K1-antigen mutant maintained its resistance to serum killing. The amount of glucuronic acid, indicating the amount of capsular polysaccharide (CPS, K antigen), was inversed proportional to the rate of phagocytosis. O-antigen mutant of serotype K1 strains had significantly more amount of CPS, and more resistant to neutrophil phagocytosis than its wildtype counterpart. O-antigen mutants of serotype K1 and K2 strains lost their wildtype serum resistance, and kept resistant to neutrophil phagocytosis. While both mutants lacked the same O1 antigen, O-antigen mutant of serotype K1 became susceptible to liver clearance and cause mild abscess formation, but its serotype K2 counterpart maintained these wildtype virulence. We conclude that the contribution of surface antigens to virulence of K. pneumoniae strains varies with serotypes.

Molecular typing and virulence analysis of serotype K1 Klebsiella pneumoniae strains isolated from liver abscess patients and stool samples from noninfectious subjects in Hong Kong, Singapore, and Taiwan.

Science.gov (United States)

Siu, L Kristopher; Fung, Chang-Phone; Chang, Feng-Yee; Lee, Nelson; Yeh, Kuo-Ming; Koh, Tse Hsien; Ip, Margaret

2011-11-01

Serotype K1 Klebsiella pneumoniae with multilocus sequence type 23 (ST23) has been strongly associated with liver abscess in Taiwan. Few data regarding the strain types and virulence of this serotype from other Asian countries are available. Serotype K1 K. pneumoniae strains isolated from liver abscess and stool samples from subjects hospitalized in Hong Kong, Singapore, and Taiwan hospitals were examined. Forty-seven serotype K1 isolates were identified: 26 from liver abscess samples and 21 from stool samples. MLST revealed 7 sequence types: 85.1% (40 of 47 isolates) belonged to ST23, 1 isolate belonged to ST163 (a single-locus variant of ST23), and 2 isolates were ST249 (a 3-locus variant of ST23). New STs, namely, ST367, ST425, and ST426, were allocated to 3 of 4 isolates from stool samples. The virulence of these strains was determined by neutrophil phagocytosis and mouse infection models. Except for two ST23 isolates, all Klebsiella pneumoniae isolates were resistant to phagocytosis. Resistance to serum killing varied in isolates of ST23, while all non-ST23 strains were susceptible to serum killing except one with ST249 from a liver abscess. All hypervirulent isolates with a 50% lethal dose of serum killing, and also carried both virulence-associated genes, rmpA and aerobactin. Multilocus sequence typing genotype 23 was the most prevalent sequence type among serotype K1 K. pneumoniae isolates from both liver abscess and stool samples in the Asia Pacific region. Serotype K1 K. pneumoniae isolates with capsule expression leading to phagocytic resistance and with the aerobactin gene were associated with hypervirulence.

Growth, immune responses and protection of Nile tilapia Oreochromis niloticus immunized with formalin-killed Streptococcus agalactiae serotype Ia and III vaccines

Directory of Open Access Journals (Sweden)

Atchariya Suwannasang

2017-08-01

Full Text Available The protective efficacy of formalin-killed Streptococcus agalactiae (Group B Streptococcus, GBS serotype Ia (GBS-Ia and III (GBS-III vaccines were assessed in Nile tilapia (Oreochromis niloticus. The fish with an average weight of 34.45± 0.08 g were immunized by intraperitoneal (i.p. injection with 4 different formalin-killed vaccines prepared from GBS-Ia (1x1010 CFU/mL, GBS-III (1x1010 CFU/mL, and combined GBS-Ia and GBS-III in an equal volume at final concentrations 1x1010 CFU/mL and 2x1010 CFU/mL in comparison with the non-immunized control group. At 2 and 4 weeks post vaccination, no significant differences were observed (p>0.05 among treatments in growth performance or haemato-immunological parameters, except the increased red blood cell at 2 weeks. Significantly increased antibody titers (p<0.05 against GBS-Ia and GBS-III antigens were noted in the groups immunized with homologous GBS vaccines, whereas the group reacted with heterologous GBS antigen showed less antibody titer as compared with the control group. The vaccination experiment indicated that i.p. injection of Nile tilapia with formalin-killed cells prepared from GBS-Ia or GBS-III provides significant protection, with relative percent survival (RPS value of 52.17 to 71.42%, against a challenge with the homologous serotype isolate, whereas the RPS in fish challenged with a heterologous serotype isolate varied from 20.00 to 53.57%. These results suggested that vaccines from either GBS-Ia or GBS-III have insufficient cross-protective efficacy against the other serotypes. However, a mixed vaccine produced from both GBS serotypes Ia and III provided significant protection with 65.00 to 95.66% RPS which could be an excellent vaccine to protect fish against streptococcosis caused by both GBS serotypes Ia and III.

Concurrent Infection with Hepatitis C Virus and Streptococcus pneumoniae.

Science.gov (United States)

Marrie, Thomas J; Tyrrell, Gregory J; Majumdar, Sumit R; Eurich, Dean T

2017-07-01

Little is known about concurrent infection with hepatitis C virus (HCV) and Streptococcus pneumoniae, which causes invasive pneumococcal disease (IPD). We hypothesized that co-infection with HCV and S. pneumoniae would increase risk for death and complications. We captured sociodemographic and serologic data for adults with IPD in a population-based cohort study in northern Alberta, Canada, during 2000-2014. IPD patients infected with HCV were compared with IPD patients not infected with HCV for risk of in-hospital deaths and complications by using multivariable logistic regression. A total of 355 of 3,251 patients with IPD were co-infected with HCV. The in-hospital mortality rate was higher for IPD patients infected with HCV. Prevalence of most IPD-related complications (e.g., cellulitis, acute kidney injury, mechanical ventilation) was also higher in HCV-infected patients. Infection with HCV is common in patients with IPD, and HCV is independently associated with an increased risk for serious illness and death.

The impact of pneumolysin on the macrophage response to Streptococcus pneumoniae is strain-dependent.

Directory of Open Access Journals (Sweden)

Richard M Harvey

Full Text Available Streptococcus pneumoniae is the world's leading cause of pneumonia, bacteremia, meningitis and otitis media. A major pneumococcal virulence factor is the cholesterol-dependent cytolysin, which has the defining property of forming pores in cholesterol-containing membranes. In recent times a clinically significant and internationally successful serotype 1 ST306 clone has been found to express a non-cytolytic variant of Ply (Ply306. However, while the pneumococcus is a naturally transformable organism, strains of the ST306 clonal group have to date been virtually impossible to transform, severely restricting efforts to understand the role of non-cytolytic Ply in the success of this clone. In this study isogenic Ply mutants were constructed in the D39 background and for the first time in the ST306 background (A0229467 to enable direct comparisons between Ply variants for their impact on the immune response in a macrophage-like cell line. Strains that expressed cytolytic Ply were found to induce a significant increase in IL-1β release from macrophage-like cells compared to the non-cytolytic and Ply-deficient strains in a background-independent manner, confirming the requirement for pore formation in the Ply-dependent activation of the NLRP3 inflammasome. However, cytolytic activity in the D39 background was found to induce increased expression of the genes encoding GM-CSF (CSF2, p19 subunit of IL-23 (IL23A and IFNβ (IFNB1 compared to non-cytolytic and Ply-deficient D39 mutants, but had no effect in the A0229467 background. The impact of Ply on the immune response to the pneumococcus is highly dependent on the strain background, thus emphasising the importance of the interaction between specific virulence factors and other components of the genetic background of this organism.

Feasibility and Safety of Local Treatment with Recombinant Human Tissue Factor Pathway Inhibitor in a Rat Model of Streptococcus pneumoniae Pneumonia.

Directory of Open Access Journals (Sweden)

Florry E van den Boogaard

Full Text Available Pulmonary coagulopathy is intrinsic to pulmonary injury including pneumonia. Anticoagulant strategies could benefit patients with pneumonia, but systemic administration of anticoagulant agents may lead to suboptimal local levels and may cause systemic hemorrhage. We hypothesized nebulization to provide a safer and more effective route for local administration of anticoagulants. Therefore, we aimed to examine feasibility and safety of nebulization of recombinant human tissue factor pathway inhibitor (rh-TFPI in a well-established rat model of Streptococcus (S. pneumoniae pneumonia. Thirty minutes before and every 6 hours after intratracheal instillation of S. pneumonia causing pneumonia, rats were subjected to local treatment with rh-TFPI or placebo, and sacrificed after 42 hours. Pneumonia was associated with local as well as systemic activation of coagulation. Nebulization of rh-TFPI resulted in high levels of rh-TFPI in bronchoalveolar lavage fluid, which was accompanied by an attenuation of pulmonary coagulation. Systemic rh-TFPI levels remained undetectable, and systemic TFPI activity and systemic coagulation were not affected. Histopathology revealed no bleeding in the lungs. We conclude that nebulization of rh-TFPI seems feasible and safe; local anticoagulant treatment with rh-TFPI attenuates pulmonary coagulation, while not affecting systemic coagulation in a rat model of S. pneumoniae pneumonia.

The alpha-tocopherol form of vitamin E boosts elastase activity of human PMNs and their ability to kill Streptococcus pneumoniae

Science.gov (United States)

Despite the availability of vaccines, Streptococcus pneumoniae remains a leading cause of life-threatening infections such as pneumonia, bacteremia and meningitis. Polymorphonuclear leukocytes (PMNs) are a key determinant of disease course, because optimal host defense requires an initial robust pul...

Crystallization and preliminary X-ray crystallographic studies of DnaJ from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhao, Shasha; Jin, Li; Niu, Siqiang; Yang, Wei; Zhang, Shaocheng; Guo, Zhen; Zhang, Hongpeng; Huang, Ailong; Yin, Yibing; Wang, Deqiang

2013-01-01

DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. DnaJ, cooperating with DnaK and GrpE, promotes the folding of unfolded hydrophobic polypeptides, dissociates protein complexes and translocates protein across membranes. Additionally, DnaJ from Streptococcus pneumoniae (SpDnaJ) is involved in the infectious disease process and is being developed as a potential vaccine to prevent bacterial infection. Here the expression, purification, crystallization and preliminary crystallographic analysis of SpDnaJ are reported. The crystals belong to space groups I222 or I2 1 2 1 2 1 and the diffraction resolution is 3.0 Å with unit-cell parameters a = 47.68, b = 104.45, c = 234.57 Å. The crystal most likely contains one molecule in the asymmetric unit, with a V M value of 3.24 Å 3 Da −1 and a solvent content of 62.1%

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

Protection of pigs against challenge with virulent Streptococcus suis serotype 2 strains by a muramidase-released protein and extracellular factor vaccine

NARCIS (Netherlands)

Wisselink, H.J.; Vecht, U.; Stockhofe Zurwieden, N.; Smith, H.E.

2001-01-01

The efficacy of a muramidase-released protein (MRP) and extracellular factor (EF) vaccine in preventing infection and disease in pigs challenged either with a homologous or a heterologous Streptococcus suis serotype 2 strain (MRP EF ) was compared with the efficacy of a vaccine containing

The Pneumococcal Serotype 15C Capsule Is Partially O-Acetylated and Allows for Limited Evasion of 23-Valent Pneumococcal Polysaccharide Vaccine-Elicited Anti-Serotype 15B Antibodies.

Science.gov (United States)

Spencer, Brady L; Shenoy, Anukul T; Orihuela, Carlos J; Nahm, Moon H

2017-08-01

As a species, Streptococcus pneumoniae (the pneumococcus) utilizes a diverse array of capsular polysaccharides to evade the host. In contrast to large variations in sugar composition and linkage formation, O-acetylation is a subtle capsular modification that nonetheless has a large impact on capsular shielding and recognition of the capsule by vaccine-elicited antibodies. Serotype 15B, which is included in the 23-valent pneumococcal polysaccharide vaccine (PPV23), carries the putative O-acetyltransferase gene wciZ The coding sequence of wciZ contains eight consecutive TA repeats [(TA) 8 ]. Replication slippage is thought to result in the addition or loss of TA repeats, subsequently causing frameshift and truncation of WciZ to yield a nonacetylated serotype, 15C. Using sensitive serological tools, we show that serotype 15C isolates whose wciZ contains seven or nine TA repeats retain partial O-acetylation, while serotype 15C isolates whose wciZ contains six TA repeats have barely detectable O-acetylation. We confirmed by inhibition enzyme-linked immunosorbent assay that (TA) 7 serotype 15C is ∼0.1% as acetylated as serotype 15B, while serotype 15X is nonacetylated. To eliminate the impact of genetic background, we created isogenic serotype 15B, (TA) 7 serotype 15C, and 15BΔ wciZ (15X) strains and found that reduction or absence of WciZ-mediated O-acetylation did not affect capsular shielding from phagocytes, biofilm formation, adhesion to nasopharyngeal cells, desiccation tolerance, or murine colonization. Sera from PPV23-immunized persons opsonized serotype 15B significantly but only slightly better than serotypes 15C and 15X; thus, PPV23 may not result in expansion of serotype 15C. Copyright © 2017 American Society for Microbiology.

A novel one-step real-time multiplex PCR assay to detect Streptococcus agalactiae presence and serotypes Ia, Ib, and III.

Science.gov (United States)

Furfaro, Lucy L; Chang, Barbara J; Payne, Matthew S

2017-09-01

Streptococcus agalactiae is the leading cause of early-onset neonatal sepsis. Culture-based screening methods lack the sensitivity of molecular assays and do not indicate serotype; a potentially important virulence marker. We aimed to develop a multiplex PCR to detect S. agalactiae while simultaneously identifying serotypes Ia, Ib, and III; commonly associated with infant disease. Primers were designed to target S. agalactiae serotype-specific cps genes and the dltS gene. The assay was validated with 512 vaginal specimens from pregnant women. 112 (21.9%) were dltS positive, with 14.3%, 0.9%, and 6.3% of these identified as cps Ia, Ib, and III, respectively. Our assay is a specific and sensitive method to simultaneously detect S. agalactiae and serotypes Ia, Ib, and III in a single step. It is of high significance for clinical diagnostic applications and also provides epidemiological data on serotype, information that may be important for vaccine development and other targeted non-antibiotic therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

Infective Endocarditis Complicated by Intraventricular Abscesses, Pericarditis, and Mycotic Aneurysm Due to an Emerging Strain of Serotype VI Streptococcus agalactiae.

Science.gov (United States)

Hirai, Nobuyasu; Kasahara, Kei; Uno, Kenji; Ogawa, Yoshihiko; Ogawa, Taku; Yonekawa, Shinsuke; Nakano, Ryuichi; Yano, Hisakazu; Sakagami, Azusa; Uemura, Takayuki; Okura, Hiroyuki; Saito, Yoshihiko; Yoshikawa, Masahide; Mikasa, Keiichi

2017-11-22

An increasing number of invasive infections due to Streptococcus agalactiae in non-pregnant adults have been reported. We report a case of infective endocarditis complicated by intraventricular abscesses, pericarditis, and mycotic aneurysm due to S. agalactiae belonging to ST681 with a capsular serotype VI in a woman with diabetes. The patient also had a myocardial infarction and was treated with percutaneous coronary intervention, pericardiocentesis, and 6 weeks of antibiotic treatment. Invasive infections due to serotype VI S. agalactiae are common in Asian countries such as Taiwan and Japan, so continuous monitoring of invasive S. agalactiae strains is warranted.

Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

Science.gov (United States)

Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

2003-01-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

A comparison of machine learning and Bayesian modelling for molecular serotyping.

Science.gov (United States)

Newton, Richard; Wernisch, Lorenz

2017-08-11

Streptococcus pneumoniae is a human pathogen that is a major cause of infant mortality. Identifying the pneumococcal serotype is an important step in monitoring the impact of vaccines used to protect against disease. Genomic microarrays provide an effective method for molecular serotyping. Previously we developed an empirical Bayesian model for the classification of serotypes from a molecular serotyping array. With only few samples available, a model driven approach was the only option. In the meanwhile, several thousand samples have been made available to us, providing an opportunity to investigate serotype classification by machine learning methods, which could complement the Bayesian model. We compare the performance of the original Bayesian model with two machine learning algorithms: Gradient Boosting Machines and Random Forests. We present our results as an example of a generic strategy whereby a preliminary probabilistic model is complemented or replaced by a machine learning classifier once enough data are available. Despite the availability of thousands of serotyping arrays, a problem encountered when applying machine learning methods is the lack of training data containing mixtures of serotypes; due to the large number of possible combinations. Most of the available training data comprises samples with only a single serotype. To overcome the lack of training data we implemented an iterative analysis, creating artificial training data of serotype mixtures by combining raw data from single serotype arrays. With the enhanced training set the machine learning algorithms out perform the original Bayesian model. However, for serotypes currently lacking sufficient training data the best performing implementation was a combination of the results of the Bayesian Model and the Gradient Boosting Machine. As well as being an effective method for classifying biological data, machine learning can also be used as an efficient method for revealing subtle biological

No diagnostic utility of antibody patterns against Klebsiella pneumoniae capsular serotypes in patients with axial spondyloarthritis vs. patients with non-specific low back pain

DEFF Research Database (Denmark)

Hermansen, L T; Loft, A G; Christiansen, A A

2017-01-01

OBJECTIVES: To investigate whether antibody response patterns against Klebsiella pneumoniae capsular serotypes can discriminate patients with axial spondyloarthritis (axSpA) from patients with non-specific low back pain (LBP). METHOD: Immunoglobulin (Ig)G and IgA antibodies against K. pneumoniae...... capsular serotypes K2, K26, K36, and K50 were measured, and antibody seropositivity compared between groups and analysed for patient correlation in five different groups: (a) 96 patients fulfilling the Assessment of SpondyloArthritis International Society (ASAS) classification criteria for axSpA; (b) 38...... ankylosing spondylitis (AS) served as the negative and positive control groups. RESULTS: There was no difference in IgG and IgA seropositivity against all serotypes between the axSpA, non-axSpA, and LBP groups. No significant correlations were found between anti-Klebsiella antibodies and age, gender, HLA-B27...

Post-infective transverse myelitis following Streptococcus pneumoniae meningitis with radiological features of acute disseminated encephalomyelitis: a case report

Directory of Open Access Journals (Sweden)

Williams Thomas

2012-09-01

Full Text Available Abstract Introduction Post-infectious autoimmune demyelination of the central nervous system is a rare neurological disorder typically associated with exanthematous viral infections. We report an unusual presentation of the condition and a previously undocumented association with Streptococcus pneumonia meningitis. Case presentation A 50-year-old Caucasian woman presented to our facility with an acute myelopathy three days after discharge following acute Streptococcus pneumoniae meningitis. Imaging studies of the spine ruled out an infective focus and no other lesions were seen within the cord. Diffuse, bilateral white matter lesions were seen within the cerebral hemispheres, and our patient was diagnosed as having a post-infective demyelination syndrome that met the diagnostic criteria for an acute transverse myelitis. Our patient clinically and radiologically improved following treatment with steroids. Conclusions The novel association of a Streptococcus pneumoniae infection with post-infectious autoimmune central nervous system demyelination should alert the reader to the potentially causative role of this common organism, and gives insights into the pathogenesis. The unusual dissociation between the clinical presentation and the location of the radiological lesions should also highlight the potential for the condition to mimic the presentation of others, and stimulates debate on the definitions of acute transverse myelitis and acute disseminated encephalomyelitis, and their potential overlap.

C3b/iC3b deposition on Streptococcus pneumoniae is not affected by HIV infection.

Directory of Open Access Journals (Sweden)

Catherine Hyams

2010-01-01

Full Text Available Streptococcus pneumoniae is a common cause of infection in both HIV positive patients and those with complement deficiencies. We hypothesised that HIV positive individuals might exhibit reduced opsonisation of pneumococcus with complement due to reduced levels of S. pneumoniae specific IgG. We discovered no difference in C3 deposition on S. pneumoniae between HIV positive or negative individuals, and furthermore C3 deposition remained unchanged as HIV progressed towards AIDS. We found no correlation between C3 deposition on S. pneumoniae and CD4 cell count in HIV infected individuals. Hence we have demonstrated no failure of complement immunity in HIV positive patients.

Genotypes and virulence in serotype K2 Klebsiella pneumoniae from liver abscess and non-infectious carriers in Hong Kong, Singapore and Taiwan.

Science.gov (United States)

Lin, Jung-Chung; Koh, Tse Hsien; Lee, Nelson; Fung, Chang-Phone; Chang, Feng-Yee; Tsai, Yu-Kuo; Ip, Margaret; Siu, L Kristopher

2014-01-01

In Klebsiella pneumoniae liver abscess (KP-LA), K. pneumoniae K2 is the most frequently isolated serotype after K1, but this serotype has been much less studied. In the present study, the molecular types sequences type (MLST) of serotype K2 isolates from three different regions in Asia were identified and the virulence of these isolates was investigated. Eight different MLSTs were found among 26 isolates (ST 65, 66, 86, 373, 374, 375, 380, and 434). There were two major MLST groups, ST-65-like (42%) and ST86-like (46%). No isolates contained allS while all isolates contained rmpA. The prevalence of aerobactin gene and kfu were 25/26 (96%) and 3/26 (11.5%) respectively. Although liver abscess isolates were generally more resistant (11/15 isolates) to serum killing, there was no specific distribution of serum killing resistant or susceptible ST types between stool carriage and liver abscess isolates. Neutrophil phagocytosis showed that the liver abscess and carriage isolates varied in their susceptibility to phagocytosis. Strains with resistance to both neutrophil phagocytosis and serum killing were generally hypervirulent with lethality at LD50 K2 isolates. Unlike serotype K1 KP-LA that mainly belong to ST-23, ST-65-like and -86-like are the two major MLST types among serotype K2 isolates from Singapore, Hong Kong and Taiwan.

Expression of Streptococcus pneumoniae Bacteriocins Is Induced by Antibiotics via Regulatory Interplay with the Competence System

NARCIS (Netherlands)

Kjos, Morten; Miller, Eric; Slager, Jelle; Lake, Frank B; Gericke, Oliver; Roberts, Ian S; Rozen, Daniel E; Veening, Jan-Willem

2016-01-01

Pneumococcal bacteriocins (pneumocins) are antibacterial toxins that mediate intra-species competition within the human host. However, the triggers of pneumocin expression are poorly understood. Using RNA-sequencing, we mapped the regulon of the pneumocin cluster (blp) of Streptococcus pneumoniae

Multiple colonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal polysaccharide vaccine.

Directory of Open Access Journals (Sweden)

Silvio D Brugger

2010-07-01

Full Text Available Simultaneous carriage of more than one strain of Streptococcus pneumoniae promotes horizontal gene transfer events and may lead to capsule switch and acquisition of antibiotic resistance. We studied the epidemiology of cocolonization with S. pneumoniae before and after introduction of the seven-valent conjugated pneumococcal vaccine (PCV7.Nasopharyngeal swabs (n 1120 were collected from outpatients between 2004 and 2009 within an ongoing nationwide surveillance program. Cocolonization was detected directly from swabs by restriction fragment length polymorphism (RFLP analysis. Serotypes were identified by agglutination, multiplex PCR and microarray.Rate of multiple colonization remained stable up to three years after PCV7 introduction. Cocolonization was associated with serotypes of low carriage prevalence in the prevaccine era. Pneumococcal colonization density was higher in cocolonized samples and cocolonizing strains were present in a balanced ratio (median 1.38. Other characteristics of cocolonization were a higher frequency at young age, but no association with recurrent acute otitis media, recent antibiotic exposure, day care usage and PCV7 vaccination status.Pneumococcal cocolonization is dominated by serotypes of low carriage prevalence in the prevaccine era, which coexist in the nasopharynx. Emergence of such previously rare serotypes under vaccine selection pressure may promote cocolonization in the future.

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence.

NARCIS (Netherlands)

Hendriksen, W.T.; Bootsma, H.J.; Diepen, A. van; Estevao, S.; Kuipers, O.P.; Groot, R. de; Hermans, P.W.M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray

Structure of the Streptococcus pneumoniae Surface Protein and Adhesin PfbA

OpenAIRE

Suits, Michael D.; Boraston, Alisdair B.

2013-01-01

PfbA (plasmin- and fibronectin-binding protein A) is an extracellular Streptococcus pneumoniae cell-wall attached surface protein that binds to fibronectin, plasmin, and plasminogen. Here we present a structural analysis of the surface exposed domains of PfbA using a combined approach of X-ray crystallography and small-angle X-ray scattering (SAXS). The crystal structure of the PfbA core domain, here called PfbAβ, determined to 2.28 Å resolution revealed an elongated 12-stranded parallel β-he...

The influence of Streptococcus pneumoniae nasopharyngeal colonization on the clinical outcome of the respiratory tract infections in preschool children.

Science.gov (United States)

Petraitiene, Sigita; Alasevicius, Tomas; Staceviciene, Indre; Vaiciuniene, Daiva; Kacergius, Tomas; Usonis, Vytautas

2015-09-30

Streptococcus pneumoniae (SPn) is an important pathogen causing a variety of clinical manifestations. The effects of SPn nasopharyngeal colonization on respiratory tract infections are poorly studied. We evaluated the association of SPn colonization with features of respiratory tract infections. Children under the age of 6 years who visited a primary care physician because of respiratory tract infections were enrolled in the study. History was taken, children were clinically assessed by the physician, and nasopharyngeal swabs were obtained and cultured for SPn. Positive samples were serotyped. Associations of SPn colonization with clinical signs and symptoms, recovery duration, absence from day care centre, frequencies of specific diagnoses, and treatment with antimicrobials were evaluated. In total 900 children were enrolled. The prevalence of SPn colonization was 40.8 % (n = 367). There were minor differences between male and female subjects (199 of 492, 40.4 % vs 168 of 408, 41.2 %, p = 0.825). Children with and without siblings had similar colonization rates (145 of 334, 43.4 % vs 219 of 562, 39.0 %, p = 0.187). Clinical signs and symptoms were not associated with SPn colonization. Children colonized with SPn had longer recovery duration compared to non-colonized children (114 of 367, 31.1 % vs 98 of 533, 18.4 %, p vs 94 of 284, 33.1 %, p = 0.001). Pneumonia, sinusitis, and acute otitis media were more frequently diagnosed in children colonized with SPn. Children attending day care centres had significantly higher prevalence of SPn colonization (270 of 367, 44.4 % vs 338 of 533, 33.1 %, p = 0.001). Children with pneumonia, sinusitis and acute otitis media were more frequently treated with antimicrobials than children with other diagnoses. SPn nasopharyngeal colonization has a negative impact on the course of respiratory tract infection, likely because of SPn being the cause of the disease or a complicating factor. It is also associated

Streptococcal toxic shock syndrome caused by Streptococcus suis serotype 2.

Directory of Open Access Journals (Sweden)

Jiaqi Tang

2006-05-01

Full Text Available BACKGROUND: Streptococcus suis serotype 2 (S. suis 2, SS2 is a major zoonotic pathogen that causes only sporadic cases of meningitis and sepsis in humans. Most if not all cases of Streptococcal toxic shock syndrome (STSS that have been well-documented to date were associated with the non-SS2 group A streptococcus (GAS. However, a recent large-scale outbreak of SS2 in Sichuan Province, China, appeared to be caused by more invasive deep-tissue infection with STSS, characterized by acute high fever, vascular collapse, hypotension, shock, and multiple organ failure. METHODS AND FINDINGS: We investigated this outbreak of SS2 infections in both human and pigs, which took place from July to August, 2005, through clinical observation and laboratory experiments. Clinical and pathological characterization of the human patients revealed the hallmarks of typical STSS, which to date had only been associated with GAS infection. Retrospectively, we found that this outbreak was very similar to an earlier outbreak in Jiangsu Province, China, in 1998. We isolated and analyzed 37 bacterial strains from human specimens and eight from pig specimens of the recent outbreak, as well as three human isolates and two pig isolates from the 1998 outbreak we had kept in our laboratory. The bacterial isolates were examined using light microscopy observation, pig infection experiments, multiplex-PCR assay, as well as restriction fragment length polymorphisms (RFLP and multiple sequence alignment analyses. Multiple lines of evidence confirmed that highly virulent strains of SS2 were the causative agents of both outbreaks. CONCLUSIONS: We report, to our knowledge for the first time, two outbreaks of STSS caused by SS2, a non-GAS streptococcus. The 2005 outbreak was associated with 38 deaths out of 204 documented human cases; the 1998 outbreak with 14 deaths out of 25 reported human cases. Most of the fatal cases were characterized by STSS; some of them by meningitis or severe

Pediatric Invasive Pneumococcal Disease in Guatemala City: Importance of Serotype 2.

Science.gov (United States)

Gaensbauer, James T; Asturias, Edwin J; Soto, Monica; Holt, Elizabeth; Olson, Daniel; Halsey, Neal A

2016-05-01

To inform estimations of the potential impact of recently introduced pneumococcal conjugate vaccine (PCV), we report results of 11 years of pre-PCV surveillance for invasive pneumococcal disease (IPD) among children in Guatemala City. Cases of IPD in children younger than 5 years were identified by active surveillance at 3 referral hospitals in Guatemala City from October 1996 through 2007. Clinical and demographic data were obtained, and isolates of Streptococcus pneumoniae from normally sterile sites were serotyped using latex agglutination and confirmed by Quellung reaction. Four hundred fifty-two cases of IPD were identified with a case fatality rate of 21%. Meningitis was the most common cause of death (77% of all deaths) and occurred more often in infancy (median age 5 months) than other clinical syndromes. Of the 137 isolates serotyped, type 1 (26 cases, 17%), type 2 (25 cases, 16%) and type 5 (18 cases, 12%) were the most common. Serotype 2 was associated with a higher case fatality rate (28%), higher rate of meningitis (68%) and occurred in younger infants (median age, 3.5 months) than other common serotypes. Recently introduced PCV13 includes 73% of observed serotypes in the study. Infants with IPD presented at a young age. Serotype 2, rarely reported as a significant cause of IPD and not included in available PCVs, was a common cause of disease in this population. PCV13 introduction in Guatemala, begun in 2013, may not have as great an impact in disease reduction as has been observed in other countries.

Streptococcus agalactiae isolates of serotypes Ia, III and V from human and cow are able to infect tilapia.

Science.gov (United States)

Chen, Ming; Wang, Rui; Luo, Fu-Guang; Huang, Yan; Liang, Wan-Wen; Huang, Ting; Lei, Ai-Ying; Gan, Xi; Li, Li-Ping

2015-10-22

Recent studies have shown that group B streptococcus (GBS) may be infectious across hosts. The purpose of this study is to investigate the pathogenicity of clinical GBS isolates with serotypes Ia, III and V from human and cow to tilapia and the evolutionary relationship among these GBS strains of different sources. A total of 27 clinical GBS isolates from human (n=10), cow (n=2) and tilapia (n=15) were analyzed using serotyping, multi-locus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). Among them, 15 isolates were tested for their pathogenicity to tilapia. The results showed that five human GBS strains (2 serotype III, 2 serotype Ia and 1 serotype V) infected tilapia with mortality rate ranging from 56.67% to 100%, while the other five human GBS strains tested were unable to infect tilapia. In addition, two cow GBS strains C001 and C003 of serotype III infected tilapia. However, they had significantly lower pathogenicity than the five human strains. Furthermore, human GBS strains H005 and H008, which had very strong ability to infect tilapia, had the same PFGE pattern. MLST analysis showed that the five human and the two cow GBS strains that were able to infect tilapia belonged to clonal complexes CC19, CC23 and CC103. The study for the first time confirmed that human or cow GBS clonal complexes CC19, CC23 and CC103 containing strains with serotypes Ia, III and V could infect tilapia and induce clinical signs under experimental conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Live Attenuated Influenza Vaccine Enhances Colonization of Streptococcus pneumoniae and Staphylococcus aureus in Mice

Science.gov (United States)

Mina, Michael J.; McCullers, Jonathan A.; Klugman, Keith P.

2014-01-01

ABSTRACT Community interactions at mucosal surfaces between viruses, like influenza virus, and respiratory bacterial pathogens are important contributors toward pathogenesis of bacterial disease. What has not been considered is the natural extension of these interactions to live attenuated immunizations, and in particular, live attenuated influenza vaccines (LAIVs). Using a mouse-adapted LAIV against influenza A (H3N2) virus carrying the same mutations as the human FluMist vaccine, we find that LAIV vaccination reverses normal bacterial clearance from the nasopharynx and significantly increases bacterial carriage densities of the clinically important bacterial pathogens Streptococcus pneumoniae (serotypes 19F and 7F) and Staphylococcus aureus (strains Newman and Wright) within the upper respiratory tract of mice. Vaccination with LAIV also resulted in 2- to 5-fold increases in mean durations of bacterial carriage. Furthermore, we show that the increases in carriage density and duration were nearly identical in all aspects to changes in bacterial colonizing dynamics following infection with wild-type (WT) influenza virus. Importantly, LAIV, unlike WT influenza viruses, had no effect on severe bacterial disease or mortality within the lower respiratory tract. Our findings are, to the best of our knowledge, the first to demonstrate that vaccination with a live attenuated viral vaccine can directly modulate colonizing dynamics of important and unrelated human bacterial pathogens, and does so in a manner highly analogous to that seen following wild-type virus infection. PMID:24549845

Whole-Genome-Sequencing characterization of bloodstream infection-causing hypervirulent Klebsiella pneumoniae of capsular serotype K2 and ST374.

Science.gov (United States)

Wang, Xiaoli; Xie, Yingzhou; Li, Gang; Liu, Jialin; Li, Xiaobin; Tian, Lijun; Sun, Jingyong; Ou, Hong-Yu; Qu, Hongping

2018-01-01

Hypervirulent K. pneumoniae variants (hvKP) have been increasingly reported worldwide, causing metastasis of severe infections such as liver abscesses and bacteremia. The capsular serotype K2 hvKP strains show diverse multi-locus sequence types (MLSTs), but with limited genetics and virulence information. In this study, we report a hypermucoviscous K. pneumoniae strain, RJF293, isolated from a human bloodstream sample in a Chinese hospital. It caused a metastatic infection and fatal septic shock in a critical patient. The microbiological features and genetic background were investigated with multiple approaches. The Strain RJF293 was determined to be multilocis sequence type (ST) 374 and serotype K2, displayed a median lethal dose (LD50) of 1.5 × 10 2 CFU in BALB/c mice and was as virulent as the ST23 K1 serotype hvKP strain NTUH-K2044 in a mouse lethality assay. Whole genome sequencing revealed that the RJF293 genome codes for 32 putative virulence factors and exhibits a unique presence/absence pattern in comparison to the other 105 completely sequenced K. pneumoniae genomes. Whole genome SNP-based phylogenetic analysis revealed that strain RJF293 formed a single clade, distant from those containing either ST66 or ST86 hvKP. Compared to the other sequenced hvKP chromosomes, RJF293 contains several strain-variable regions, including one prophage, one ICEKp1 family integrative and conjugative element and six large genomic islands. The sequencing of the first complete genome of an ST374 K2 hvKP clinical strain should reinforce our understanding of the epidemiology and virulence mechanisms of this bloodstream infection-causing hvKP with clinical significance.

Estado de portador nasofaríngeo de Streptococcus pneumoniae en madres e hijos de la población indígena Panare del estado Bolívar, Venezuela Pneumococcal carriage in mothers and children of the Panare Amerindians from the State of Bolivar, Venezuela

Directory of Open Access Journals (Sweden)

T Bello González

2010-02-01

carriage and serotype distribution of Streptococcus pneumoniae in mothers and children of the Panare people from Venezuela. In May 2008, in 8 distinct geographically isolated communities, 148 nasopharyngeal samples were obtained from 64 healthy mothers and 84 healthy Panare children under 5 years of age. S. pneumoniae was isolated and identified by standard techniques. Strains were typified by multiplex PCR and resistance patterns were determined by the disk diffusion method. A total of 65 strains were isolated; 11% of the mothers and 69% of the children carried S. pneumoniae. Serotypes 6B (48%, 33F (21,5%, 6A (6%, 19A (3,1% and 23F (1,5% were the most predominant. Of the 6 colonized mother-child pairs, 3 pairs (2 with 6B, were colonized with the same serotype. All strains were sensitive to penicillin and 13,7% were resistant to macrolides. The high colonization rates in the Panare people suggest that the children are at increased risk of pneumococcal invasive disease and could benefit from vaccination. Four conjugate vaccine serotypes (6B, 6A, 19A and 23F representing 58 % of all strains were present in the population at the moment of sampling. Resistance to antibiotics is (still not a problem.

Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin

NARCIS (Netherlands)

León-Sicairos, N.; Angulo-Zamudio, U.A.; Vidal, J.E.; López-Torres, C.A.; Bolscher, J.G.M.; Nazmi, K.; Reyes-Cortes, R.; Reyes-López, M.; de la Garza, M.; Canizalez-Román, A.

2014-01-01

Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity

A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Raphaël Laurenceau

Full Text Available Natural genetic transformation is widely distributed in bacteria and generally occurs during a genetically programmed differentiated state called competence. This process promotes genome plasticity and adaptability in Gram-negative and Gram-positive bacteria. Transformation requires the binding and internalization of exogenous DNA, the mechanisms of which are unclear. Here, we report the discovery of a transformation pilus at the surface of competent Streptococcus pneumoniae cells. This Type IV-like pilus, which is primarily composed of the ComGC pilin, is required for transformation. We provide evidence that it directly binds DNA and propose that the transformation pilus is the primary DNA receptor on the bacterial cell during transformation in S. pneumoniae. Being a central component of the transformation apparatus, the transformation pilus enables S. pneumoniae, a major Gram-positive human pathogen, to acquire resistance to antibiotics and to escape vaccines through the binding and incorporation of new genetic material.

A visual review of the human pathogen Streptococcus pneumoniae.

Science.gov (United States)

Engholm, Ditte Høyer; Kilian, Mogens; Goodsell, David S; Andersen, Ebbe Sloth; Kjærgaard, Rikke Schmidt

2017-11-01

Being the principal causative agent of bacterial pneumonia, otitis media, meningitis and septicemia, the bacterium Streptococcus pneumoniae is a major global health problem. To highlight the molecular basis of this problem, we have portrayed essential biological processes of the pneumococcal life cycle in eight watercolor paintings. The paintings are done to a consistent nanometer scale based on currently available data from structural biology and proteomics. In this review article, the paintings are used to provide a visual review of protein synthesis, carbohydrate metabolism, cell wall synthesis, cell division, teichoic acid synthesis, virulence, transformation and pilus synthesis based on the available scientific literature within the field of pneumococcal biology. Visualization of the molecular details of these processes reveals several scientific questions about how molecular components of the pneumococcal cell are organized to allow biological function to take place. By the presentation of this visual review, we intend to stimulate scientific discussion, aid in the generation of scientific hypotheses and increase public awareness. A narrated video describing the biological processes in the context of a whole-cell illustration accompany this article. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Análise das cepas de Streptococcus pneumoniae causadores de pneumonia invasiva: sorotipos e sensibilidade aos antimicrobianos

Directory of Open Access Journals (Sweden)

Cristina R. M. Yoshioka

2011-02-01

Full Text Available OBJETIVOS: Identificar os sorotipos de pneumococo mais frequentemente isolados de crianças internadas com pneumonia invasiva, comparar os sorotipos com os incluídos em vacinas conjugadas e analisar sua sensibilidade aos antimicrobianos mais utilizados na faixa etária pediátrica. MÉTODOS: Estudo descritivo, retrospectivo das pneumonias pneumocócicas identificadas em crianças internadas no hospital universitário da Universidade de São Paulo, no período de janeiro de 2003 a outubro de 2008. Os critérios de inclusão foram: faixa etária de 29 dias até 15 anos incompletos com diagnóstico clínico e radiológico de pneumonia e com cultura de sangue e/ou líquido pleural com crescimento de Streptococcus pneumoniae. RESULTADOS: Foram incluídas no estudo 107 crianças. Os sorotipos mais frequentes foram: 14 (36,5%, 1 (16,7%, 5 (14,6%, 6B (6,3% e 3 (4,2%. A proporção de sorotipos contidos na vacina conjugada heptavalente seria de 53,1%, na vacina 10-valente de 86,5% e na 13-valente seria de 96,9%. De acordo com os padrões do Clinical and Laboratory Standards Institute 2008, 100 cepas (93,5% de pneumococos foram sensíveis à penicilina (concentração inibitória mínima, CIM 8 µg/mL. Verificamos alta taxa de sensibilidade para as cepas testadas para vancomicina, rifampicina, ceftriaxone, clindamicina, cloranfenicol e eritromicina. CONCLUSÕES: Nossos resultados confirmam um expressivo impacto potencial das vacinas conjugadas, principalmente pela 10-valente e 13-valente, sobre os casos de pneumonias invasivas. Os resultados de sensibilidade à penicilina evidenciam que a opção terapêutica de escolha para o tratamento das pneumonias invasivas continua sendo a penicilina.

The Host Immune Response to Streptococcus pneumoniae: Bridging Innate and Adaptive Immunity

Science.gov (United States)

2006-07-06

P.J. (1989) Effect of Streptococcus pneumoniae on human respiratory epithelium in vitro. Infect. Immun. 57: 2006-2013. Stoop, J.N., van der Molen ...antibiotics. Clin. Microbiol. Rev. 3: 171-196. Knapp, S., Wieland, C.W., van ’t Veer, C., Takeuchi, O., Akira, S., Florquin, S., and van der Poll...R.G., Baan, C.C., van der Laan, L.J., Kuipers, E.J., Kusters, J.G., and Janssen, H.L. (2005) Regulatory T cells contribute to the impaired immune

Internamento devido a PAC por Streptococcus pneumoniae – Avaliação de factores de mortalidade

Directory of Open Access Journals (Sweden)

Sandra Figueiredo

2008-09-01

Full Text Available Resumo: A avaliação da gravidade perante qualquer caso de pneumonia adquirida na comunidade (PAC é de suma importância, pois dela decorrem decisões como a necessidade de internamento e o tratamento empírico inicial. Os autores apresentam um estudo retrospectivo, que incluiu doentes internados devido a pneumonia por Streptococcus pneumoniae durante o ano de 2006, no Hospital de São João. A confirmação etiológica de infecção foi feita por isolamentos no sangue, líquido pleural, secreções traqueobrônquicas, lavado brônquico, lavado broncoalveolar e pesquisa de antigenúria. Foram analisados os factores de risco e avaliados, com base nas normas PSI (Pneumonia Severity Index e da British Thoracic Society (BTS -CURB-65. A análise estatística foi efectuada utilizando teste T para amostras independentes e ANOVA, usando o programa de análise estatística SPSS 14.0.Foram incluídos 104 doentes com idade mediana de 63 anos, sendo 67,3% do sexo masculino. O estudo revelou existir uma associação com significado estatístico entre os resultados de PSI e CURB-65 e a evolução para a mortalidade.Apesar da melhoria dos meios diagnósticos e profilácticos, e da terapêutica antibiótica, a pneumonia pneumocócica permanece uma entidade de grande morbilidade e mortalidade. O valor preditivo das normas PSI e CURB-65 foi confirmado nesta população de doentes, documentando uma correlação entre o número de factores de risco e a evolução da doença.Rev Port Pneumol 2008; XIV (5: 601-615 Abstract: Probably the most important decision in the management of Community-Acquired Pneumonia (CAP is patient site of care. Patients with Streptococcus pneumoniae-caused CAP admitted to our hospital between 1st January and 31st December 2006 were retrospectively analysed. Samples of blood, sputum, bronchial and bronchoalveolar lavage and urine were collected for

A reação em cadeia da polimerase na detecção da resistência à penicilina em Streptococcus pneumoniae

OpenAIRE

Zettler,Eduardo Walker; Scheibe,Rosane M.; Dias,Cícero A. G.; Santafé,Patrícia; Moreira,José da Silva; Santos,Diógenes S.; Fritscher,Carlos Cezar

2004-01-01

INTRODUÇÃO: O Streptococcus pneumoniae é o mais freqüente agente etiológico de infecções respiratórias adquiridas na comunidade e sua resistência aos antimicrobianos tem aumentado nos últimos anos. A determinação da resistência é feita rotineiramente por método lento que depende do crescimento em cultura e determinação da concentração inibitória mínima (CIM). A reação em cadeia da polimerase (PCR) detecta os genes responsáveis pela resistência do Streptococcus pneumoniae a penicilina em cerca...

The Small Molecule DAM Inhibitor, Pyrimidinedione, Disrupts Streptococcus pneumoniae Biofilm Growth In Vitro.

Directory of Open Access Journals (Sweden)

Mukesh Kumar Yadav

Full Text Available Streptococcus pneumoniae persist in the human nasopharynx within organized biofilms. However, expansion to other tissues may cause severe infections such as pneumonia, otitis media, bacteremia, and meningitis, especially in children and the elderly. Bacteria within biofilms possess increased tolerance to antibiotics and are able to resist host defense systems. Bacteria within biofilms exhibit different physiology, metabolism, and gene expression profiles than planktonic cells. These differences underscore the need to identify alternative therapeutic targets and novel antimicrobial compounds that are effective against pneumococcal biofilms. In bacteria, DNA adenine methyltransferase (Dam alters pathogenic gene expression and catalyzes the methylation of adenine in the DNA duplex and of macromolecules during the activated methyl cycle (AMC. In pneumococci, AMC is involved in the biosynthesis of quorum sensing molecules that regulate competence and biofilm formation. In this study, we examine the effect of a small molecule Dam inhibitor, pyrimidinedione, on Streptococcus pneumoniae biofilm formation and evaluate the changes in global gene expression within biofilms via microarray analysis. The effects of pyrimidinedione on in vitro biofilms were studied using a static microtiter plate assay, and the architecture of the biofilms was viewed using confocal and scanning electron microscopy. The cytotoxicity of pyrimidinedione was tested on a human middle ear epithelium cell line by CCK-8. In situ oligonucleotide microarray was used to compare the global gene expression of Streptococcus pneumoniae D39 within biofilms grown in the presence and absence of pyrimidinedione. Real-time RT-PCR was used to study gene expression. Pyrimidinedione inhibits pneumococcal biofilm growth in vitro in a concentration-dependent manner, but it does not inhibit planktonic cell growth. Confocal microscopy analysis revealed the absence of organized biofilms, where cell

Roles of the Essential Protein FtsA in Cell Growth and Division in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Mura, Andrea; Fadda, D.; Perez, A.J.; Danforth, M.L.; Musu, D.; Rico, A.I.; Krupka, M.; Denapaite, D.; Tsui, H-Ch.T.; Winkler, M.E.; Branny, Pavel; Vicente, M.; Margolin, W.; Massidda, O.

2017-01-01

Roč. 199, č. 3 (2017), č. článku UNSP e00608. ISSN 0021-9193 R&D Projects: GA ČR GAP302/12/0256; GA MŠk LH12055 Institutional support: RVO:61388971 Keywords : FtsA * Gram-positive cocci * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 3.143, year: 2016

Time and dose-dependent risk of pneumococcal pneumonia following influenza: a model for within-host interaction between influenza and Streptococcus pneumoniae

OpenAIRE

Shrestha, Sourya; Foxman, Betsy; Dawid, Suzanne; Aiello, Allison E.; Davis, Brian M.; Berus, Joshua; Rohani, Pejman

2013-01-01

A significant fraction of seasonal and in particular pandemic influenza deaths are attributed to secondary bacterial infections. In animal models, influenza virus predisposes hosts to severe infection with both Streptococcus pneumoniae and Staphylococcus aureus. Despite its importance, the mechanistic nature of the interaction between influenza and pneumococci, its dependence on the timing and sequence of infections as well as the clinical and epidemiological consequences remain unclear. We e...

LocZ is a new cell division protein involved in proper septum placement in Streptococcus pneumoniae

Czech Academy of Sciences Publication Activity Database

Holečková, Nela; Doubravová, Linda; Massidda, Orietta; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

2015-01-01

Roč. 6, č. 1 (2015), s. 1-13 ISSN 2150-7511 R&D Projects: GA ČR GAP207/12/1568; GA ČR GAP302/12/0256 Institutional support: RVO:61388971 Keywords : cell division * septum placement * Streptococcus pneumoniae Subject RIV: EE - Microbiology, Virology Impact factor: 6.975, year: 2015

UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

NARCIS (Netherlands)

Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

Comparative genomic analysis of multidrug-resistant Streptococcus pneumoniae isolates

Directory of Open Access Journals (Sweden)

Pan F

2018-05-01

Full Text Available Fen Pan,1 Hong Zhang,1 Xiaoyan Dong,2 Weixing Ye,3 Ping He,4 Shulin Zhang,4 Jeff Xianchao Zhu,5 Nanbert Zhong1,2,6 1Department of Clinical Laboratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 2Department of Respiratory, Shanghai Children’s Hospital, Shanghai Jiaotong University, Shanghai, China; 3Shanghai Personal Biotechnology Co., Ltd, Shanghai, China; 4Department of Medical Microbiology and Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China; 5Zhejiang Bioruida Biotechnology co. Ltd, Zhejiang, China; 6New York State Institute for Basic Research in Developmental Disabilities, Staten Island, NY, USA Introduction: Multidrug resistance in Streptococcus pneumoniae has emerged as a serious problem to public health. A further understanding of the genetic diversity in antibiotic-resistant S. pneumoniae isolates is needed. Methods: We conducted whole-genome resequencing for 25 pneumococcal strains isolated from children with different antimicrobial resistance profiles. Comparative analysis focus on detection of single-nucleotide polymorphisms (SNPs and insertions and deletions (indels was conducted. Moreover, phylogenetic analysis was applied to investigate the genetic relationship among these strains. Results: The genome size of the isolates was ~2.1 Mbp, covering >90% of the total estimated size of the reference genome. The overall G+C% content was ~39.5%, and there were 2,200–2,400 open reading frames. All isolates with different drug resistance profiles harbored many indels (range 131–171 and SNPs (range 16,103–28,128. Genetic diversity analysis showed that the variation of different genes were associated with specific antibiotic resistance. Known antibiotic resistance genes (pbps, murMN, ciaH, rplD, sulA, and dpr were identified, and new genes (regR, argH, trkH, and PTS-EII closely related with antibiotic resistance were found, although these genes were primarily annotated

Sorotipagem de amostras de Streptococcus suis isoladas de suínos em granjas dos Estados de São Paulo, Minas Gerais e Paraná Serotyping of Streptococcus suis strains isolated from pigs in the States of São Paulo, Minas Gerais e Paraná, Brazil

Directory of Open Access Journals (Sweden)

Keila J.R. Pagnani

2002-01-01

Full Text Available Infecções causadas por Streptococcus suis são muito comuns em países onde a indústria de carne suína é desenvolvida. Estas infecções estão relacionadas a casos clínicos de broncopneumonia, meningite, artrite, pericardite, miocardite, endocardite, poliserosite fibrinosa, septicemia, rinite e aborto. Esta bactéria também foi descrita como patógeno de ruminantes e humanos. No Brasil há evidências clínicas da existência de processos infecciosos causados por S. suis afetando mais de 50% das granjas em Estados como São Paulo, Minas Gerais e Paraná. No presente estudo foram isoladas 51 amostras de S. suis de granjas do Estados acima referidos, coletadas de diferentes casos clínicos como septicemia, meningite, artrite e pneumonia, tendo sido obtidas ou em cultura pura ou como patógeno de maior predominância nos tecidos de suínos. Este material foi semeado em Columbia ágar sangue adicionado de 5% de sangue bovino e incubado a 37°C por 24 horas. Para a identificação bioquímica as colônias que apresentavam a-hemólise, bem como as amostras padrão, foram submetidas a testes convencionais para a confirmação da espécie S. suis, tais como: hidrólise de arginina, teste de Voges-Proskauer, e produção de ácido a partir de vários carboidratos (inulina, salicina, trealose, lactose, sacarose, sorbitol, manitol e glicerol. As amostras também foram testadas para habilidade de crescimento em meio de TSA com 6,5% de NaCl e para a produção de amilase. Todas as amostras que fizeram parte desta pesquisa foram testadas pelo sistema Api 20 Strep para confirmação dos resultados obtidos nos testes convencionais. Para a sorotipagem foram produzidos antissoros de 1 a 8. Outras amostras não pertencentes a estes sorotipos também foram sorotipadas. O antissoro produzido em coelhos foi titulado pelo teste de aglutinação em tubo com 2-mercaptoetanol e pelo teste de reação capsular e, quando adequados, foram usados no teste de co

Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

DEFF Research Database (Denmark)

Jensen, Anders; Kilian, Mogens

2011-01-01

The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

Correlation between PFGE Groups and mrp/epf/sly Genotypes of Human Streptococcus suis Serotype 2 in Northern Thailand

Directory of Open Access Journals (Sweden)

Prasit Tharavichitkul

2014-01-01

Full Text Available Streptococcus suis infection is a severe zoonotic disease commonly found in Northern Thailand where people often consume raw pork and/or pig’s blood. The most frequent clinical presentations are meningitis, sepsis, and endocarditis with higher rate of mortality and hearing loss sequelae. To clarify the correlation between pulsed-field gel electrophoresis (PFGE groups and mrp/epf/sly genotypes of S. suis serotype 2, 62 patient and 4 healthy pig isolates from Northern Thailand were studied. By PFGE analysis, at 66% homology, most human isolates (69.4% and 1 pig isolate were in group A, whereas 14.5% of human isolates and 3 out of 4 pig isolates were in group D. According to mrp/epf/sly genotypes, 80.6% of human isolates were identified in mrp+epf−sly− and only 12.9% were in mrp−epf−sly+ genotypes; in contrast, 1 and 3 pig isolates were detected in these two genotypes, respectively. Interestingly, all isolates of S. suis serotype 2 classified in PFGE groups A, B, and E were set in mrp+epf−sly− genotypes. These data show a close correlation between PFGE groups and mrp/epf/sly genotypes of human S. suis serotype 2.

Correlation between PFGE Groups and mrp/epf/sly Genotypes of Human Streptococcus suis Serotype 2 in Northern Thailand.

Science.gov (United States)

Tharavichitkul, Prasit; Wongsawan, Kanreuthai; Takenami, Naoki; Pruksakorn, Sumalee; Fongcom, Achara; Gottschalk, Marcelo; Khanthawa, Banyong; Supajatura, Volaluk; Takai, Shinji

2014-01-01

Streptococcus suis infection is a severe zoonotic disease commonly found in Northern Thailand where people often consume raw pork and/or pig's blood. The most frequent clinical presentations are meningitis, sepsis, and endocarditis with higher rate of mortality and hearing loss sequelae. To clarify the correlation between pulsed-field gel electrophoresis (PFGE) groups and mrp/epf/sly genotypes of S. suis serotype 2, 62 patient and 4 healthy pig isolates from Northern Thailand were studied. By PFGE analysis, at 66% homology, most human isolates (69.4%) and 1 pig isolate were in group A, whereas 14.5% of human isolates and 3 out of 4 pig isolates were in group D. According to mrp/epf/sly genotypes, 80.6% of human isolates were identified in mrp (+) epf (-) sly (-) and only 12.9% were in mrp (-) epf (-) sly (+) genotypes; in contrast, 1 and 3 pig isolates were detected in these two genotypes, respectively. Interestingly, all isolates of S. suis serotype 2 classified in PFGE groups A, B, and E were set in mrp (+) epf (-) sly (-) genotypes. These data show a close correlation between PFGE groups and mrp/epf/sly genotypes of human S. suis serotype 2.

Slaughterhouse pigs are a major reservoir of Streptococcus suis serotype 2 capable of causing human infection in southern Vietnam.

Directory of Open Access Journals (Sweden)

Thi Hoa Ngo

2011-03-01

Full Text Available Streptococcus suis is a pathogen of major economic significance to the swine industry and is increasingly recognized as an emerging zoonotic agent in Asia. In Vietnam, S. suis is the leading cause of bacterial meningitis in adult humans. Zoonotic transmission is most frequently associated with serotype 2 strains and occupational exposure to pigs or consumption of infected pork. To gain insight into the role of pigs for human consumption as a reservoir for zoonotic infection in southern Vietnam, we determined the prevalence and diversity of S. suis carriage in healthy slaughterhouse pigs. Nasopharyngeal tonsils were sampled from pigs at slaughterhouses serving six provinces in southern Vietnam and Ho Chi Minh City area from September 2006 to November 2007. Samples were screened by bacterial culture. Isolates of S. suis were serotyped and characterized by multi locus sequence typing (MLST and pulse field gel electrophoresis (PFGE. Antibiotic susceptibility profiles and associated genetic resistance determinants, and the presence of putative virulence factors were determined. 41% (222/542 of pigs carried S. suis of one or multiple serotypes. 8% (45/542 carried S. suis serotype 2 which was the most common serotype found (45/317 strains, 14%. 80% of serotype 2 strains belonged to the MLST clonal complex 1,which was previously associated with meningitis cases in Vietnam and outbreaks of severe disease in China in 1998 and 2005. These strains clustered with representative strains isolated from patients with meningitis in PFGE analysis, and showed similar antimicrobial resistance and virulence factor profiles. Slaughterhouse pigs are a major reservoir of S. suis serotype 2 capable of causing human infection in southern Vietnam. Strict hygiene at processing facilities, and health education programs addressing food safety and proper handling of pork should be encouraged.

Radiolabeling of gemifloxacin with technetium-99m and biological evaluation in artificially Streptococcus pneumoniae infected rats

International Nuclear Information System (INIS)

Syed Qaiser Shah; Muhammad Rafiullah Khan

2011-01-01

In the current investigation complexation of the gemifloxacin (GIN) with technetium-99 m ( 99m Tc) and its biological evaluation in artificially Streptococcus pneumoniae (S. pneumoniae) infected rats was assessed as potential S. pneumoniae infection radiotracer. Radiochemically the 99m Tc-GIN complex was further analyzed in terms of stability in saline, in vitro stability in serum at 37 deg C, in vitro binding with S. pneumoniae and biodistribution in artificially S. pneumoniae (living and heat killed) infected rats. The complex was found 97.25 ± 0.25% radiochemically stable in saline at 30 min after reconstitution. The stability of the 99m Tc-GIN complex was decreased to 90.50 ± 0.20% within 240 min after reconstitution. In serum the 99m Tc-GIN complex showed stable profile with the appearance of 18.85% free tracer within 16 h of incubation. The 99m Tc-GIN complex showed saturated in vitro binding with S. pneumoniae after different intervals. Almost five fold uptake was observed in living S. pneumoniae infected muscle of the rats as compared to the inflamed and normal muscle. No significant difference in the uptake of heat killed S. pneumoniae infected, inflamed and normal muscles of the rats. The high RCP yield in saline, in vitro permanence in serum, in vitro binding with living S. pneumoniae and biodistribution in artificially S. pneumoniae infected rats we recommend the 99m Tc-GIN as potential S. pneumoniae infection radiotracer. (author)

Development of new synthetic oligosaccharide vaccines : the immunogenicity of oligosaccharide-CRM197 neoconjugates and oligosaccharide/peptide hybrid gold nanoparticles based on the capsular polysaccharide structure of Streptococcus pneumoniae type 14

NARCIS (Netherlands)

Safari, D.

2010-01-01

Streptococcus pneumoniae is a leading cause of bacterial pneumonia, meningitis, and sepsis in children worldwide. Nowadays, the antibiotic resistance of S. pneumoniae bacteria has increased worldwide. This makes treatment of S. pneumoniae infections more difficult and stresses the importance of the

Changed Expression of Cytoskeleton Proteins During Lung Injury in a Mouse Model of Streptococcus pneumoniae Infection

Directory of Open Access Journals (Sweden)

Mario Ferrer-Navarro

2018-05-01

Full Text Available Infections by Streptococcus pneumoniae are a major cause of morbidity and mortality worldwide, often causing community-acquired pneumonia, otitis media and also bacteremia and meningitis. Studies on S. pneumoniae are mainly focused on its virulence or capacity to evade the host immune system, but little is known about the injury caused in lungs during a pneumococcal infection. Herein we investigated this issue comparing the proteome profile of lungs from S. pneumoniae-infected mice with control mice by means of difference gel electrophoresis (DIGE technology. In order to obtain reliable results three biological replicas were used, and four technical replicas were carried out in each biological replica. Proteomic comparison was performed at two time points: 24 and 48 h post infection. A total of 91 proteins were identified with different abundance. We found important changes in the protein profiles during pneumococcal infection mainly associated with regulation of vesicle-mediated transport, wound healing, and cytoskeleton organization. In conclusion, the results obtained show that the cytoskeleton of the host cell is modified in S. pneumoniae infection.

Platelet Endothelial Cell Adhesion Molecule-1, a Putative Receptor for the Adhesion of Streptococcus pneumoniae to the Vascular Endothelium of the Blood-Brain Barrier

NARCIS (Netherlands)

Iovino, Federico; Molema, Grietje; Bijlsma, Jetta J. E.

The Gram-positive bacterium Streptococcus pneumoniae is the main causative agent of bacterial meningitis. S. pneumoniae is thought to invade the central nervous system via the bloodstream by crossing the vascular endothelium of the blood-brain barrier. The exact mechanism by which pneumococci cross

Predicting pneumococcal community-acquired pneumonia in the emergency department: evaluation of clinical parameters.

Science.gov (United States)

Huijts, S M; Boersma, W G; Grobbee, D E; Gruber, W C; Jansen, K U; Kluytmans, J A J W; Kuipers, B A F; Palmen, F; Pride, M W; Webber, C; Bonten, M J M

2014-12-01

The aim of this study was to quantify the value of clinical predictors available in the emergency department (ED) in predicting Streptococcus pneumoniae as the cause of community-acquired pneumonia (CAP). A prospective, observational, cohort study of patients with CAP presenting in the ED was performed. Pneumococcal aetiology of CAP was based on either bacteraemia, or S. pneumoniae being cultured from sputum, or urinary immunochromatographic assay positivity, or positivity of a novel serotype-specific urinary antigen detection test. Multivariate logistic regression was used to identify independent predictors and various cut-off values of probability scores were used to evaluate the usefulness of the model. Three hundred and twenty-eight (31.0%) of 1057 patients with CAP had pneumococcal CAP. Nine independent predictors for pneumococcal pneumonia were identified, but the clinical utility of this prediction model was disappointing, because of low positive predictive values or a small yield. Clinical criteria have insufficient diagnostic capacity to predict pneumococcal CAP. Rapid antigen detection tests are needed to diagnose S. pneumoniae at the time of hospital admission. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

A Multi-Scale Computational Study on the Mechanism of Streptococcus pneumoniae Nicotinamidase (SpNic)

OpenAIRE

Ion, Bogdan; Kazim, Erum; Gauld, James

2014-01-01

Nicotinamidase (Nic) is a key zinc-dependent enzyme in NAD metabolism that catalyzes the hydrolysis of nicotinamide to give nicotinic acid. A multi-scale computational approach has been used to investigate the catalytic mechanism, substrate binding and roles of active site residues of Nic from Streptococcus pneumoniae (SpNic). In particular, density functional theory (DFT), molecular dynamics (MD) and ONIOM quantum mechanics/molecular mechanics (QM/MM) methods have been employed. The o...

The diversity of Klebsiella pneumoniae surface polysaccharides.

Science.gov (United States)

Follador, Rainer; Heinz, Eva; Wyres, Kelly L; Ellington, Matthew J; Kowarik, Michael; Holt, Kathryn E; Thomson, Nicholas R

2016-08-01

Klebsiella pneumoniae is considered an urgent health concern due to the emergence of multi-drug-resistant strains for which vaccination offers a potential remedy. Vaccines based on surface polysaccharides are highly promising but need to address the high diversity of surface-exposed polysaccharides, synthesized as O-antigens (lipopolysaccharide, LPS) and K-antigens (capsule polysaccharide, CPS), present in K. pneumoniae . We present a comprehensive and clinically relevant study of the diversity of O- and K-antigen biosynthesis gene clusters across a global collection of over 500 K. pneumoniae whole-genome sequences and the seroepidemiology of human isolates from different infection types. Our study defines the genetic diversity of O- and K-antigen biosynthesis cluster sequences across this collection, identifying sequences for known serotypes as well as identifying novel LPS and CPS gene clusters found in circulating contemporary isolates. Serotypes O1, O2 and O3 were most prevalent in our sample set, accounting for approximately 80 % of all infections. In contrast, K serotypes showed an order of magnitude higher diversity and differ among infection types. In addition we investigated a potential association of O or K serotypes with phylogenetic lineage, infection type and the presence of known virulence genes. K1 and K2 serotypes, which are associated with hypervirulent K. pneumoniae , were associated with a higher abundance of virulence genes and more diverse O serotypes compared to other common K serotypes.

[Isolation of a carbapenem-resistant K1 serotype Klebsiella pneumonia strain and the study of resistance mechanism].

Science.gov (United States)

Zhang, Rong; Wang, Xuan; Lü, Jianxin

2014-12-16

To study the virulence and mechanism of carbapenem resistance of a clinical isolate of carbapenem-resistant K1 serotype Klebsiella pneumonia strain. Identification of isolate was carried out with VITEK-2 compact system. Antimicrobial susceptibility was determined by E-test; Metallo β-lactamases and carbapenemases screening were conducted by imipenem-EDTA double disc synergy test and modified Hodge test, respectively.Specific polymerehse chain reaction (PCR) and DNA sequencing were preformed to detect the virulence genes including K1, K2, K5, K20, K54, K57, magA, rmpA, wcaG and a series of β-lactamase resistence genes. Conjunction experiment was also performed. The plasmids of transconjugants were submitted to PCR-based replicon typing (PBRT) method. Molecular typing was performed by multilocus sequence typing (MLST). Antimicrobial susceptibility testing revealed that the Klebsiella pneumonia strain was resistant to most of the antibiotics used in clinic. Phynotype confirmary rest revealed the production of carbapanemases, while Metallo β-lactamases were negative; PCR and DNA sequencing confirmed the isolate was positive for blaKPC-2, blaCTX-M-15, blaTEM-1, blaSHV-1 and virulence genes K1, magA, rmpA, wcaG simultaneously; blaKPC-2 was transferred from donor to Escherichia EC600 by conjunction experiment, while no virulence genes were found in the transconjugants. PBRT revealed that Frep plasmid was found in transconjugants. MLST analysis revealed that this strain belonged to ST23. K1 serotype Klebsiella pneumonia strain carries virulence genes and carbapenem resistance gene blaKPC-2, noteworthily the carbapenem resistance genes can be transferred through horizontal transmission on plasmids.

[Antibiotic resistance analysis of Streptococcus pneumoniae isolates from the hospitalized children in Shanxi Children's Hospital from 2012 to 2014].

Science.gov (United States)

Ge, L L; Han, Z Y; Liu, A H; Zhu, L; Meng, J H

2017-02-02

Objective: To investigate the antibiotic resistance status of Streptococcus pneumoniae isolates from hospitalized children in Shanxi Children's Hospital. Method: E-test and Kirby-Bauer methods were applied to determine drug sensitivity of the isolates collected from the body fluid specimens of hospitalized children in Shanxi Children's Hospital from January 2012 to December 2014. The antimicrobial sensitivity and minimum inhibitory concentration (MIC) of Streptococcus pneumoniae to the conventional antibiotics were analyzed, in order to compare the annual trends of non-invasive isolates, while the differentiation of sensitivity from specimens. The comparison of rates was performed by Chi-squared test and Fisher's exact test. Result: A total of 671 isolates of streptococcus pneumoniae were obtained, which could be divided as non-invasive isolates(607), invasive isolates from non-cerebrospinal fluid(non-CSF)(40) and invasive isolates from cerebrospinal fluid(CSF)(24). The antimicrobial sensitivity(isolates(%)) of the 671 isolates were respectively vancomycin 671(100.0%), linezolid 671(100.0%), levofloxacin 665(99.1%), penicillin 595(88.7%), ceftriaxone 516(76.9%), cefotaxime 512(76.3%), sulfamethoxazole-trimethoprin(SMZ-TMP) 103(15.4%), clindamycin 28(4.2%), tetracycline 26(3.9%), erythromycin 12(1.8%). From 2012 to 2014, the susceptibility rates of non-invasive isolates to penicillin every year were 95.0%(96/101), 97.3%(110/113), 87.3%(343/393), respectively, and there was significant difference among the three years(χ(2)=13.266, P penicillin were 0.064, 2.000, 6.000 in 2012, which grew up to 1.000, 3.000, 16.000 in 2014. There was no significant difference in the susceptibility rate of non-invasive isolates to ceftriaxone and cefotaxime during these three years, (χ(2)=1.172, 1.198, both P >0.05). On the other hand, the values of MIC(50, )MIC(90) and the maximum value of MIC(mg/L) of ceftriaxone and cefotaxime both increased from 0.500, 2.000, 8.000 in 2012 to 0

Streptococcus suis meningitis, a poacher's risk

NARCIS (Netherlands)

Halaby, T.; Hoitsma, E.; Hupperts, R.; Spanjaard, L.; Luirink, M.; Jacobs, J.

2000-01-01

Streptococcus suis infection is a zoonosis that has been mainly reported in pig-rearing and pork-consuming countries. The most common disease manifestation is meningitis, often associated with cochleovestibular signs. The causative agent is Streptococcus suis serotype 2, found as a commensal in the

Purpura fulminans associated with Streptococcus pneumoniae septicemia in an asplenic pediatric patient.

Science.gov (United States)

Konda, S; Zell, D; Milikowski, C; Alonso-Llamazares, J

2013-09-01

Purpura fulminans is a rapidly progressive syndrome of small-vessel thrombosis and hemorrhagic necrosis of the skin accompanied by disseminated intravascular coagulation. We describe a case of Streptococcus pneumoniae septicemia in an asplenic 5-year-old boy on oral tacrolimus, with a past medical history of multivisceral organ transplantation and subsequent development of purpura fulminans on his chest and distal extremities. The acute infectious form of purpura fulminans is usually caused by gram-negative bacteria. Cases secondary to gram-positive encapsulated bacteria usually occur when individuals are immuno-suppressed or have anatomic or functional asplenia. Our patient had both, which likely increased his susceptibility, and he responded well to antimicrobial therapy in addition to prophylactic coverage in the setting of his immunosuppression. We review the literature for similar cases due to S. pneumoniae in the pediatric population and discuss the etiology and treatment of purpura fulminans. Copyright © 2011 Elsevier España, S.L. and AEDV. All rights reserved.

Community-based outbreaks in vulnerable populations of invasive infections caused by Streptococcus pneumoniae serotypes 5 and 8 in Calgary, Canada.

Directory of Open Access Journals (Sweden)

Otto G Vanderkooi

Full Text Available BACKGROUND: Outbreaks of invasive pneumococcal disease (IPD typically occur within institutions. Beginning in 2005, we detected an increase in serotype (ST 5 and ST8 IPD cases, predominantly in homeless persons living in an open community. METHODOLOGY/PRINCIPAL FINDINGS: CASPER (Calgary Area S. pneumoniae Epidemiology Research surveillance study of all IPD (sterile site isolates in our region (pop ~1,100,000. Interviews and chart reviews of all cases and all isolates phenotypically analyzed and selected isolated tested by multi-locus sequence typing (MLST. CONCLUSIONS/SIGNIFICANCE: During 2005-2007, 162 cases of ST5 IPD and 45 cases of ST8 IPD were identified. The isolates demonstrated phenotypic and genotypic clonality. The ST5 isolates were sequence type (ST 289 and demonstrated intermediate susceptibility to TMP-SMX. The ST8 isolates were predominantly ST1268, with a susceptible antimicrobial susceptibility profile. Individuals with ST5 IPD were more likely to be middle aged (OR 2.6, homeless (OR 4.4, using illicit drugs(OR 4.8, and asthmatic(OR 2.6. Those with ST8 were more likely to be male (OR 4.4, homeless (OR 2.6, aboriginal (OR7.3, and a current smoker (OR 2.5. Overlapping outbreaks of ST5 and ST8 IPD occurred in an open community in Calgary, Canada and homelessness was a predominant risk factor. Homelessness represents a unique community in which pneumococcal outbreaks can occur.

Streptococcus pneumonia YlxR at 1.35 Å shows a putative new fold

OpenAIRE

Osipiuk, Jerzy; Górnicki, Piotr; Maj, Luke; Dementieva, Irina; Laskowski, Roman; Joachimiak, Andrzej

2001-01-01

The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Å. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Å from orthorhombic crystals using synchrotron radiation and the structure was determined ...

A Community-acquired Lung Abscess Attributable to Streptococcus pneumoniae which Extended Directly into the Chest Wall.

Science.gov (United States)

Ko, Yuki; Tobino, Kazunori; Yasuda, Yuichiro; Sueyasu, Takuto; Nishizawa, Saori; Yoshimine, Kouhei; Munechika, Miyuki; Asaji, Mina; Yamaji, Yoshikazu; Tsuruno, Kosuke; Miyajima, Hiroyuki; Mukasa, Yosuke; Ebi, Noriyuki

We herein report the case of 75-year-old Japanese female with a community-acquired lung abscess attributable to Streptococcus pneumoniae (S. penumoniae) which extended into the chest wall. The patient was admitted to our hospital with a painful mass on the left anterior chest wall. A contrast-enhanced chest computed tomography scan showed a lung abscess in the left upper lobe which extended into the chest wall. Surgical debridement of the chest wall abscess and percutaneous transthoracic tube drainage of the lung abscess were performed. A culture of the drainage specimen yielded S. pneumoniae. The patient showed a remarkable improvement after the initiation of intravenous antibiotic therapy.

Interaction of SIGNR1 expressed by marginal zone macrophages with marginal zone B cells is essential to early IgM responses against Streptococcus pneumoniae

NARCIS (Netherlands)

Koppel, Estella A.; Litjens, Manja; van den Berg, Venice C.; van Kooyk, Yvette; Geijtenbeek, Teunis B. H.

2008-01-01

The spleen plays a pivotal role in the immune defense against encapsulated bacteria such as Streptococcus pneumoniae. Murine splenic marginal zone macrophages express the C-type lectin SIGNR1, which is crucial for the capture of S. pneumoniae from blood. In this study, we demonstrate that SIGNR1 is

The effect of immunization with pneumococcal conjugated vaccines on Streptococcus pneumoniae resistance patterns in acute otitis media

Directory of Open Access Journals (Sweden)

Tal Marom

2017-10-01

Full Text Available Following the introduction of 7- and 13-pneumococcal conjugate vaccines (PCVs in Israel, we demonstrated that within Streptococcus pneumoniae (Sp positive middle ear cultures, obtained from young children with severe acute otitis media (AOM episodes, there were more penicillin-susceptible and less multi-drug resistant Sp isolates in PCV immunized children.

Etiology of childhood community acquired pneumonia and its implications for vaccination

Directory of Open Access Journals (Sweden)

Nascimento-Carvalho Cristiana M.C.

2001-01-01

Full Text Available Pneumonia is an important cause of morbidity and mortality among children throughout the world. Vaccines are available for some organisms, but they are underutilized and/or still in development. To evaluate the potential impact of vaccines, we review studies in which the etiology of childhood community-acquired pneumonia was recorded. In North America and Europe (9 studies, the etiology of pneumonia was established in 62% of studied children (range 43%-88% by use of noninvasive specific methods for microbiologic diagnosis. The most often identified agents were S. pneumoniae (22%, respiratory syncytial virus (RSV (20%, Haemophilus influenzae (7%, and Mycoplasma pneumoniae (15%. In Africa and South America (8 studies, bacteria were recovered from 56% (range 32%-68% of severely ill children studied by lung aspirate. The most often isolated bacteria were Streptococcus pneumoniae (33% and Haemophilus influenzae (21%. A high percentage of H. influenzae strains were not serotype b. Throughout the world, children requiring hospitalization were most likely to have infection caused by pneumococcus H. influenzae or RSV. Out patients also had Mycoplasma pneumoniae. Countries in Africa and Asia recorded 2 to 10 times more children with pneumonia (7 to 40/100 annually than in the USA. Widespread use of pneumococcal and H. influenzae type b conjugate vaccines could reduce the frequency of childhood pneumonia by one-third. Further reduction will require development of non-type b H. influenzae, RSV and M. pneumoniae vaccines. This could result in a > 50% reduction of pneumonia in children. This goal should be sought and achieved as soon as possible.

S-carboxymethylcysteine inhibits adherence of Streptococcus pneumoniae to human alveolar epithelial cells.

Science.gov (United States)

Sumitomo, Tomoko; Nakata, Masanobu; Yamaguchi, Masaya; Terao, Yutaka; Kawabata, Shigetada

2012-01-01

Streptococcus pneumoniae is a major pathogen of respiratory infections that utilizes platelet-activating factor receptor (PAFR) for firm adherence to host cells. The mucolytic agent S-carboxymethylcysteine (S-CMC) has been shown to exert inhibitory effects against infection by several respiratory pathogens including S. pneumoniae in vitro and in vivo. Moreover, clinical studies have implicated the benefits of S-CMC in preventing exacerbation of chronic obstructive pulmonary disease, which is considered to be related to respiratory infections. In this study, to assess whether the potency of S-CMC is attributable to inhibition of pneumococcal adherence to host cells, an alveolar epithelial cell line stimulated with interleukin-1α was used as a model of inflamed epithelial cells. Despite upregulation of PAFR by inflammatory activation, treatment with S-CMC efficiently inhibited pneumococcal adherence to host epithelial cells. In order to gain insight into the inhibitory mechanism, the effects of S-CMC on PAFR expression were also investigated. Following treatment with S-CMC, PAFR expression was reduced at both mRNA and post-transcriptional levels. Interestingly, S-CMC was also effective in inhibiting pneumococcal adherence to cells transfected with PAFR small interfering RNAs. These results indicate S-CMC as a probable inhibitor targeting numerous epithelial receptors that interact with S. pneumoniae.

Unusual Manifestation of Severe Conjugated Hyperbilirubinemia in an Infant with Streptococcus pneumoniae-associated Hemolytic Uremic Syndrome

Directory of Open Access Journals (Sweden)

Jung-Pin Chen

2007-01-01

Full Text Available Streptococcus pneumoniae is an uncommon etiologic organism in children with hemolytic uremic syndrome (HUS. Historically, severe S. pneumoniae-associated HUS usually has a poor clinical outcome. The clinical manifestations of marked jaundice and hepatic dysfunction in this form of HUS are extremely rare. We report a 10-month-old female infant with S. pneumoniae-associated HUS who had the unusual manifestation of severely elevated conjugated bilirubin and hepatic transaminases. Screening for viral hepatitis was negative, and evidence of biliary obstruction and hepatotoxic drug exposure was also absent. The patient was treated with antihypertensive agents for 2.5 months and required peritoneal dialysis for a period of 26 days. Hepatic function returned to normal on the 8th day of hospitalization. Renal function was mildly impaired at 1-year follow-up. Our report suggests that severe conjugated hyperbilirubinemia is a rare manifestation of S. pneumoniae-associated HUS in children. It is important for pediatricians that pneumococcal infection with severe hematologic and renal disorders should be investigated for evidence of S. pneumoniae-associated HUS. [J Formos Med Assoc 2007;106(2 Suppl:S17-S22

Genetic Transformation of Streptococcus mutans

OpenAIRE

Perry, Dennis; Kuramitsu, Howard K.

1981-01-01

Three strains of Streptococcus mutans belonging to serotypes a, c, and f were transformed to streptomycin resistance by deoxyribonucleic acids derived from homologous and heterologous streptomycin-resistant strains of S. mutans and Streptococcus sanguis strain Challis. Homologous transformation of S. mutans was less efficient than heterologous transformation by deoxyribonucleic acids from other strains of S. mutans.

The putative proteinase maturation protein A of Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective immune responses

NARCIS (Netherlands)

K. Overweg (Karin); A. Kerr; M. Sluijter (Marcel); M.H. Jackson; T.J. Mitchell; A.P. de Jong; R. de Groot (Ronald); P.W.M. Hermans (Peter)

2000-01-01

textabstractSurface-exposed proteins often play an important role in the interaction between pathogenic bacteria and their host. We isolated a pool of hydrophobic, surface-associated proteins of Streptococcus pneumoniae. The opsonophagocytic activity of hyperimmune

Streptococcus pneumoniae and Haemophilus influenzae as etiological agents of conjunctivitis outbreaks in the region of Ribeirão Preto, SP, Brazil

Directory of Open Access Journals (Sweden)

Marta I. C. MEDEIROS

1998-01-01

Full Text Available In the study of conjunctivitis outbreaks occurring from September 1994 to September 1996 in the region of Ribeirão Preto, conjunctival exudates of 92 patients were cultivated in Instituto Adolfo Lutz Laboratory I, Ribeirão Preto. Most cases occurred in the age range 2-7 years. The etiological agents which were most frequently isolated from the analyzed cases were: Streptococcus pneumoniae and Haemophilus influenzae, in 40.22% and 21.74%, respectively. 51.35% of the S. pneumoniae isolated strains were not typable. The oxacillin-resistant S. pneumoniae strains were submitted to the minimum inhibitory concentration test (MIC and three of them presented intermediate resistance, whereas only one was highly resistant to penicillin.No estudo de surtos de conjuntivite ocorridos no período de setembro de 1994 a setembro de 1996, na região de Ribeirão Preto, foram semeadas no Instituto Adolfo Lutz Laboratório I, Ribeirão Preto, exsudatos conjuntivais de 92 pacientes, sendo que a maioria dos casos estava na faixa etária de 2-7 anos. Os agentes etiológicos mais freqüentemente isolados dos casos analisados foram: Streptococcus pneumoniae e Haemophilus influenzae em 40,22% e 21,74% respectivamente. 51,35% das cepas de S. pneumoniae isoladas foram não tipáveis. As cepas de S. pneumoniae oxacilina resistente foram submetidas ao teste de concentração inibitória mínima (CIM, sendo que três apresentaram resistência intermediária e apenas uma foi altamente resistente à penicilina.

Meningitis and pneumonia in Guatemalan children: the importance of Haemophilus influenzae type b and Streptococcus pneumoniae Meningitis y neumonía en niños guatemaltecos: importancia de Haemophilus influenzae tipo b y de Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Edwin J. Asturias

2003-12-01

Full Text Available OBJECTIVE: To determine the epidemiology of Haemophilus influenzae type b (Hib and Streptococcus pneumoniae invasive infections in hospitalized Guatemalan children. This is an important issue since Hib vaccine has not been incorporated into the routine immunization program in Guatemala and information from hospital records in 1995 indicated a low incidence of Hib and S. pneumoniae as causes of meningitis and invasive infections. METHODS: Children who were hospitalized in Guatemala City with clinical signs compatible with bacterial infections were evaluated for evidence of Hib or S. pneumoniae infection. Normally sterile body fluids were cultured, and antigen detection was performed on cerebrospinal fluid (CSF and pleural fluid. RESULTS: Of 1 203 children 1-59 months of age hospitalized over a 28-month period, 725 of them (60.3% had a primary diagnosis of pneumonia, 357 (29.7% of meningitis, 60 (5.0% of cellulitis, and 61 (5.1% of sepsis and other conditions. Hib was identified in 20.0% of children with meningitis and S. pneumoniae in 12.9%. The average annual incidence of Hib meningitis was 13.8 cases per 100 000 children under 5 years of age, and 32.4% of meningitides caused by Hib and 58.7% of S. pneumoniae meningitides occurred prior to 6 months of age. Case fatality rates were 14.1%, 37.0%, and 18.0%, respectively, for children with Hib, S. pneumoniae, and culture-negative and antigen-negative meningitis. Prior antibiotic therapy was common and was associated with significant reductions in CSF-culture-positive results for children with other evidence of Hib or S. pneumoniae meningitis. CONCLUSIONS: Improvements in case detection, culture methods, and latex agglutination for antigen detection in CSF resulted in identification of Hib and S. pneumoniae as important causes of severe disease in Guatemalan children. Using a cutoff of > 10 white blood cells per cubic millimeter in CSF would improve the sensitivity for detection of bacterial

Uptake of extracellular DNA: Competence induced pili in natural transformation of Streptococcus pneumoniae

Science.gov (United States)

Muschiol, Sandra; Balaban, Murat; Normark, Staffan; Henriques-Normark, Birgitta

2015-01-01

Transport of DNA across bacterial membranes involves complex DNA uptake systems. In Gram-positive bacteria, the DNA uptake machinery shares fundamental similarities with type IV pili and type II secretion systems. Although dedicated pilus structures, such as type IV pili in Gram-negative bacteria, are necessary for efficient DNA uptake, the role of similar structures in Gram-positive bacteria is just beginning to emerge. Recently two essentially very different pilus structures composed of the same major pilin protein ComGC were proposed to be involved in transformation of the Gram-positive bacterium Streptococcus pneumoniae – one is a long, thin, type IV pilus-like fiber with DNA binding capacity and the other one is a pilus structure that was thicker, much shorter and not able to bind DNA. Here we discuss how competence induced pili, either by pilus retraction or by a transient pilus-related opening in the cell wall, may mediate DNA uptake in S. pneumoniae. PMID:25640084

Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

International Nuclear Information System (INIS)

Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

2010-01-01

3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

[Isolation and identification of the temperate bacteriophage from isolated strains of Streptococcus suis serotype 2].

Science.gov (United States)

Ma, Yuling; Lu, Chengping; Fan, Hongjie

2008-04-01

A PCR assay was developed to study the distributional characteristics of phage integrase gene in Streptococcus suis serotype 2 (SS2). A 323bp distinct DNA target can be amplified in 25 strains of virulent SS2, while can not be amplified in avirulent strain T15, 5 strains of other serotypes (SS1, SS7, SS9) and strains of group C Streptococcus strains from pigs, which suggested that the phage integrase gene may be related to the pathogenicity of SS2 and can be consider as a detection factor of the virulent gene of SS2. The sequencing and restriction endonuclease analysis of the PCR products were also done. Comparisons between the sequences of phage integrase gene with that of SS2 strain, showed a high homology with SS2 China strains 98HAH33, 05ZYH33 and North American strain 89-1591. Complete cell lysis was observed with SS2 virulent strains but not with avirulent strain T15 after the induction by mitomycin C. Electron microscopy analysis of the lysate from SS2 virulent strains HA9801 and ZY05719 revealed the presence of phage particles. The induced phage, named SS2-HA and SS2-ZY, both have a small isometric nucleocapsid approximately 50 nm in diameter and have no tail and is therefore a member of the Tectiviridae family. The phage integrase gene sequence of phage SS2-HA and SS2-ZY shared high homologue identities with virulent SS2 strains, which suggested that the phage integrase gene of SS2 has high specify. The temperate phage and phage integrase gene can only detected from SS2 virulent strains but not from avirulent strain, and the detection of phage integrase gene was related to the virulence-associate factors of SS2, such as the muramidase-released protein gene (mrp), which suggested that the temperate phage of SS2 may be related to the pathogenicity of SS2.

Effect of pneumococcal conjugate vaccination on serotype-specific carriage and invasive disease in England: a cross-sectional study.

Directory of Open Access Journals (Sweden)

Stefan Flasche

2011-04-01

Full Text Available BACKGROUND: We investigated the effect of the 7-valent pneumococcal conjugate vaccine (PCV7 programme in England on serotype-specific carriage and invasive disease to help understand its role in serotype replacement and predict the impact of higher valency vaccines. METHODS AND FINDINGS: Nasopharyngeal swabs were taken from children <5 y old and family members (n=400 2 y after introduction of PCV7 into routine immunization programs. Proportions carrying Streptococcus pneumoniae and serotype distribution among carried isolates were compared with a similar population prior to PCV7 introduction. Serotype-specific case carrier ratios (CCRs were estimated using national data on invasive disease. In vaccinated children and their contacts vaccine-type (VT carriage decreased, but was offset by an increase in non-VT carriage, with no significant overall change in carriage prevalence, odds ratio 1.06 (95% confidence interval 0.76-1.49. The lower CCRs of the replacing serotypes resulted in a net reduction in invasive disease in children. The additional serotypes covered by higher valency vaccines had low carriage but high disease prevalence. Serotype 11C emerged as predominant in carriage but caused no invasive disease whereas 8, 12F, and 22F emerged in disease but had very low carriage prevalence. CONCLUSION: Because the additional serotypes included in PCV10/13 have high CCRs but low carriage prevalence, vaccinating against them is likely to significantly reduce invasive disease with less risk of serotype replacement. However, a few serotypes with high CCRs could mitigate the benefits of higher valency vaccines. Assessment of the effect of PCV on carriage as well as invasive disease should be part of enhanced surveillance activities for PCVs. Please see later in the article for the Editors' Summary.

Salmonella enterica serovar Choleraesuis vector delivering SaoA antigen confers protection against Streptococcus suis serotypes 2 and 7 in mice and pigs.

Science.gov (United States)

Li, Yu-An; Ji, Zhenying; Wang, Xiaobo; Wang, Shifeng; Shi, Huoying

2017-12-21

Streptococcus suis is one of the major pathogens that cause economic losses in the swine industry worldwide. However, current bacterins only provide limited prophylactic protection in the field. An ideal vaccine against S. suis should protect pigs against the clinical diseases caused by multiple serotypes, or at least protect against the dominant serotype in a given geographic region. A new recombinant Salmonella enterica serotype Choleraesuis vaccine vector, rSC0011, that is based on the regulated delayed attenuation system and regulated delayed antigen synthesis system, was developed recently. In this study, an improved recombinant attenuated Salmonella Choleraesuis vector, rSC0016, was developed by incorporating a sopB mutation to ensure adequate safety and maximal immunogenicity. In the spleens of mice, rSC0016 colonized less than rSC0011. rSC0016 and rSC0011 colonized similarly in Peyer's patches of mice. The recombinant vaccine rSC0016(pS-SaoA) induced stronger cellular, humoral, and mucosal immune responses in mice and swine against SaoA, a conserved surface protein that is present in many S. suis serotypes, than did rSC0011(pS-SaoA) without sopB or rSC0018(pS-SaoA), which is an avirulent, chemically attenuated vaccine strain. rSC0016(pS-SaoA) provided 100% protection against S. suis serotype 2 in mice and pigs, and full cross-protection against SS7 in pigs. This new vaccine vector provides a foundation for the development of a universal vaccine against multiple serotypes of S. suis in pigs.

The response regulator YycF inhibits expression of the fatty acid biosynthesis repressor FabT in Streptococcus pneumoniae

NARCIS (Netherlands)

Mohedano, Maria L.; Amblar, Mónica; La Fuente, De Alicia; Wells, Jerry M.; López, Paloma

2016-01-01

The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression.

The alpha-tocopherol form of vitamin E reverses age-associated susceptibility to Streptococcus pneumoniae lung infection by modulating pulmonary neutrophil recruitment

Science.gov (United States)

Streptococcus pneumonia infections are an important cause of morbidity and mortality in older patients. Uncontrolled neutrophil-driven pulmonary inflammation exacerbates this disease. To test whether the alpha-tocopherol (alpha-Toc) form of vitamin E, a regulator of immunity, can modulate neutrophil...

The cGAS/STING Pathway Detects Streptococcus pneumoniae but Appears Dispensable for Antipneumococcal Defense in Mice and Humans.

Science.gov (United States)

Ruiz-Moreno, Juan Sebastian; Hamann, Lutz; Jin, Lei; Sander, Leif E; Puzianowska-Kuznicka, Monika; Cambier, John; Witzenrath, Martin; Schumann, Ralf R; Suttorp, Norbert; Opitz, Bastian

2018-03-01

Streptococcus pneumoniae is a frequent colonizer of the upper respiratory tract and a leading cause of bacterial pneumonia. The innate immune system senses pneumococcal cell wall components, toxin, and nucleic acids, which leads to production of inflammatory mediators to initiate and control antibacterial defense. Here, we show that the cGAS (cyclic GMP-AMP [cGAMP] synthase)-STING pathway mediates detection of pneumococcal DNA in mouse macrophages to primarily stimulate type I interferon (IFN) responses. Cells of human individuals carrying HAQ TMEM173 , which encodes a common hypomorphic variant of STING, were largely or partly defective in inducing type I IFNs and proinflammatory cytokines upon infection. Subsequent analyses, however, revealed that STING was dispensable for restricting S. pneumoniae during acute pneumonia in mice. Moreover, explorative analyses did not find differences in the allele frequency of HAQ TMEM173 in nonvaccinated pneumococcal pneumonia patients and healthy controls or an association of HAQ TMEM173 carriage with disease severity. Together, our results indicate that the cGAS/STING pathway senses S. pneumoniae but plays no major role in antipneumococcal immunity in mice and humans. Copyright © 2018 American Society for Microbiology.

TLR-mediated inflammatory responses to Streptococcus pneumoniae are highly dependent on surface expression of bacterial lipoproteins.

Science.gov (United States)

Tomlinson, Gillian; Chimalapati, Suneeta; Pollard, Tracey; Lapp, Thabo; Cohen, Jonathan; Camberlein, Emilie; Stafford, Sian; Periselneris, Jimstan; Aldridge, Christine; Vollmer, Waldemar; Picard, Capucine; Casanova, Jean-Laurent; Noursadeghi, Mahdad; Brown, Jeremy

2014-10-01

Streptococcus pneumoniae infections induce inflammatory responses that contribute toward both disease pathogenesis and immunity, but the host-pathogen interactions that mediate these effects are poorly defined. We used the surface lipoprotein-deficient ∆lgt pneumococcal mutant strain to test the hypothesis that lipoproteins are key determinants of TLR-mediated immune responses to S. pneumoniae. We show using reporter assays that TLR2 signaling is dependent on pneumococcal lipoproteins, and that macrophage NF-κB activation and TNF-α release were reduced in response to the ∆lgt strain. Differences in TNF-α responses between Δlgt and wild-type bacteria were abrogated for macrophages from TLR2- but not TLR4-deficient mice. Transcriptional profiling of human macrophages revealed attenuated TLR2-associated responses to ∆lgt S. pneumoniae, comprising many NF-κB-regulated proinflammatory cytokine and chemokine genes. Importantly, non-TLR2-associated responses were preserved. Experiments using leukocytes from IL-1R-associated kinase-4-deficient patients and a mouse pneumonia model confirmed that proinflammatory responses were lipoprotein dependent. Our data suggest that leukocyte responses to bacterial lipoproteins are required for TLR2- and IL-1R-associated kinase-4-mediated inflammatory responses to S. pneumoniae. Copyright © 2014 The Authors.

Differential B-cell memory around the 11-month booster in children vaccinated with a 10- or 13-valent pneumococcal conjugate vaccine

NARCIS (Netherlands)

van Westen, Els; Wijmenga-Monsuur, Alienke J; van Dijken, Harry H; van Gaans-van den Brink, Jacqueline A M; Kuipers, Betsy; Knol, Mirjam J; Berbers, Guy A M; Sanders, Elisabeth A M; Rots, Nynke Y; van Els, Cécile A C M

2015-01-01

BACKGROUND: Both the 10- and 13-valent pneumococcal conjugate vaccines (PCV10 and PCV13) induce immunological memory against Streptococcus pneumoniae infections caused by vaccine serotypes. In addition to comparing serum antibody levels, we investigated frequencies of serotype-specific plasma cells

LuxS impacts on LytA-dependent autolysis and on competence in Streptococcus pneumoniae.

Science.gov (United States)

Romao, Susana; Memmi, Guido; Oggioni, Marco R; Trombe, Marie-Claude

2006-02-01

The ubiquitous protein LuxS with S-ribosylhomocysteinase activity is involved in S-adenosyl methionine detoxification, C-1 unit recycling and the production of autoinducers that allow the cell to sense and respond to cell density. Independent reports describe the impact of LuxS deficiency on Streptococcus pneumoniae virulence in the mouse. In vitro, LuxS deficiency confers discrete phenotypes. A combined approach using genetic dissection and mixed-culture experiments allowed the involvement of LuxS in the developmental physiology of S. pneumoniae to be investigated. Functional LuxS was found to be related on the one hand to down-regulation of competence, and on the other hand to attenuation of autolysis in cultures entering stationary phase. The competence phenotype of luxS mutant bacteria was complemented by media conditioned by competence-defective ComAB0 bacteria, but not by BSA. The autolytic phenotype was complemented by BSA, but not by conditioned supernatants. It is suggested that the impact of LuxS on competence, but not on autolysis, involves cell-cell communication. The phenotype of luxS mutant strains reveals a hierarchy in the competence regulatory networks of S. pneumoniae.

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V M = 2.77 Å 3 Da −1 ) and shows a diffraction limit of 3.5 Å

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γ = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.

Multicentre in-vitro evaluation of the susceptibility of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin

NARCIS (Netherlands)

HoogkampKorstanje, JAA; DirksGo, SIS; Kabel, P; Manson, WL; Stobberingh, EE; Vreede, RW; Davies, BI

Seven laboratories, including a reference laboratory, tested the susceptibility of Moraxella catarrhalis, Streptococcus pneumoniae and Haemophilus influenzae strains to ciprofloxacin, clarithromycin, co-amoxiclav and sparfloxacin with the Etest. A total of 976 strains were collected. The results

Characterization of a Multipeptide Lantibiotic Locus in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Natalie Maricic

2016-01-01

Full Text Available Bacterial communities are established through a combination of cooperative and antagonistic interactions between the inhabitants. Competitive interactions often involve the production of antimicrobial substances, including bacteriocins, which are small antimicrobial peptides that target other community members. Despite the nearly ubiquitous presence of bacteriocin-encoding loci, inhibitory activity has been attributed to only a small fraction of gene clusters. In this study, we characterized a novel locus (the pld locus in the pathogen Streptococcus pneumoniae that drives the production of a bacteriocin called pneumolancidin, which has broad antimicrobial activity. The locus encodes an unusual tandem array of four inhibitory peptides, three of which are absolutely required for antibacterial activity. The three peptide sequences are similar but appear to play distinct roles in regulation and inhibition. A modification enzyme typically found in loci encoding a class of highly modified bacteriocins called lantibiotics was required for inhibitory activity. The production of pneumolancidin is controlled by a two-component regulatory system that is activated by the accumulation of modified peptides. The locus is located on a mobile element that has been found in many pneumococcal lineages, although not all elements carry the pld genes. Intriguingly, a minimal region containing only the genes required for pneumolancidin immunity was found in several Streptococcus mitis strains. The pneumolancidin-producing strain can inhibit nearly all pneumococci tested to date and provided a competitive advantage in vivo. These peptides not only represent a unique strategy for bacterial competition but also are an important resource to guide the development of new antimicrobials.

Virulence Studies of Different Sequence Types and Geographical Origins of Streptococcus suis Serotype 2 in a Mouse Model of Infection

Directory of Open Access Journals (Sweden)

Jean-Philippe Auger

2016-07-01

Full Text Available Multilocus sequence typing previously identified three predominant sequence types (STs of Streptococcus suis serotype 2: ST1 strains predominate in Eurasia while North American (NA strains are generally ST25 and ST28. However, ST25/ST28 and ST1 strains have also been isolated in Asia and NA, respectively. Using a well-standardized mouse model of infection, the virulence of strains belonging to different STs and different geographical origins was evaluated. Results demonstrated that although a certain tendency may be observed, S. suis serotype 2 virulence is difficult to predict based on ST and geographical origin alone; strains belonging to the same ST presented important differences of virulence and did not always correlate with origin. The only exception appears to be NA ST28 strains, which were generally less virulent in both systemic and central nervous system (CNS infection models. Persistent and high levels of bacteremia accompanied by elevated CNS inflammation are required to cause meningitis. Although widely used, in vitro tests such as phagocytosis and killing assays require further standardization in order to be used as predictive tests for evaluating virulence of strains. The use of strains other than archetypal strains has increased our knowledge and understanding of the S. suis serotype 2 population dynamics.

Strain-specific impact of PsaR of Streptococcus pneumoniae on global gene expression and virulence

OpenAIRE

Hendriksen, Wouter T.; Bootsma, Hester J.; van Diepen, Angela; Estevao, Silvia; Kuipers, Oscar P.; de Groot, Ronald; Hermans, Peter W. M.

2009-01-01

Previous studies have indicated that PsaR of Streptococcus pneumoniae is a manganese-dependent regulator, negatively affecting the expression of at least seven genes. Here, we extended these observations by transcriptome and proteome analysis of psaR mutants in strains D39 and TIGR4. The microarray analysis identified three shared PsaR targets: the psa operon, pcpA and prtA. In addition, we found 31 genes to be regulated by PsaR in D39 only, most strikingly a cellobiose-specific phosphotrains...

Identification and characterization of a novel protective antigen, Enolase of Streptococcus suis serotype 2.

Science.gov (United States)

Zhang, Anding; Chen, Bo; Mu, Xiaofeng; Li, Ran; Zheng, Pei; Zhao, Yaxin; Chen, Huanchun; Jin, Meilin

2009-02-25

Streptococcus suis serotype 2 (SS2) is a porcine and human pathogen with adhesive and invasive properties. The absence of suitable vaccine or virulent marker can be the bottleneck to control SS2 infection. In the present study, a novel immunogenic Enolase identified in the previous study was inducibly overexpressed in Escherichia coli, and the purified recombinant protein could elicit a significant humoral antibody response and confer efficient immunity against challenge with lethal dose of SS2 or SS7 infection in mouse model. The roles Enolase plays in pathogenicity of SS2 were also explored as reasons for which Enolase could be a protective antigen. The Enolase was an in vivo-induced antigen confirmed by the real-time PCR and could adhere to the Hep-2 cells by the indirect immunofluorescent assay and the inhibition assay. These suggested that Enolase could play important roles in pathogenicity and may serve as a novel vaccine candidate against SS2 infection.

PENICILLIN-BINDING PROTEIN 2X OF STREPTOCOCCUS-PNEUMONIAE - EXPRESSION IN ESCHERICHIA-COLI AND PURIFICATION OF A SOLUBLE ENZYMATICALLY ACTIVE DERIVATIVE

NARCIS (Netherlands)

LAIBLE, G; KECK, W; LURZ, R; MOTTL, H; FRERE, JM; JAMIN, M; HAKENBECK, R

1992-01-01

A 2.5-kb DNA fragment including the structural gene coding for the penicillin-binding protein 2x (PBP 2x) of Streptococcus pneumoniae has been cloned into the vector pJDC9 and expressed in Escherichia coli. Mapping of RNA polymerase binding sites by electron microscopy indicated that the pbpX

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Sandra M Carvalho

Full Text Available Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

Pyruvate oxidase influences the sugar utilization pattern and capsule production in Streptococcus pneumoniae.

Science.gov (United States)

Carvalho, Sandra M; Farshchi Andisi, Vahid; Gradstedt, Henrik; Neef, Jolanda; Kuipers, Oscar P; Neves, Ana R; Bijlsma, Jetta J E

2013-01-01

Pyruvate oxidase is a key function in the metabolism and lifestyle of many lactic acid bacteria and its activity depends on the presence of environmental oxygen. In Streptococcus pneumoniae the protein has been suggested to play a major role in metabolism and has been implicated in virulence, oxidative stress survival and death in stationary phase. Under semi-aerobic conditions, transcriptomic and metabolite profiling analysis of a spxB mutant grown on glucose showed minor changes compared to the wild type, apart from the significant induction of two operons involved in carbohydrate uptake and processing. This induction leads to a change in the sugar utilization capabilities of the bacterium, as indicated by the analysis of the growth profiles of the D39 parent and spxB mutant on alternative carbohydrates. Metabolic analysis and growth experiments showed that inactivation of SpxB has no effect on the glucose fermentation pattern, except under aerobic conditions. More importantly, we show that mutation of spxB results in the production of increased amounts of capsule, the major virulence factor of S. pneumoniae. Part of this increase can be attributed to induction of capsule operon (cps) transcription. Therefore, we propose that S. pneumoniae utilizes pyruvate oxidase as an indirect sensor of the oxygenation of the environment, resulting in the adaption of its nutritional capability and the amount of capsule to survive in the host.

Virulence genes and genetic diversity of Streptococcus suis serotype 2 isolates from Thailand.

Science.gov (United States)

Maneerat, K; Yongkiettrakul, S; Kramomtong, I; Tongtawe, P; Tapchaisri, P; Luangsuk, P; Chaicumpa, W; Gottschalk, M; Srimanote, P

2013-11-01

Isolates of Streptococcus suis from different Western countries as well as those from China and Vietnam have been previously well characterized. So far, the genetic characteristics and relationship between S. suis strains isolated from both humans and pigs in Thailand are unknown. In this study, a total of 245 S. suis isolates were collected from both human cases (epidemic and sporadic) and pigs (diseased and asymptomatic) in Thailand. Bacterial strains were identified by biochemical tests and PCR targeting both, the 16S rRNA and gdh genes. Thirty-six isolates were identified as serotype 2 based on serotyping and the cps2-PCR. These isolates were tested for the presence of six virulence-associated genes: an arginine deiminase (arcA), a 38-kDa protein and protective antigen (bay046), an extracellular factor (epf), an hyaluronidase (hyl), a muramidase-released protein (mrp) and a suilysin (sly). In addition, the genetic diversities of these isolates were studied by RAPD PCR and multilocus sequence typing (MLST) analysis. Four virulence-associated gene patterns (VAGP 1 to 4) were obtained, and the majority of isolates (32/36) carried all genes tested (VAGP1). Each of the three OPB primers used provided 4 patterns designated RAPD-A to RAPD-D. Furthermore, MLST analysis could also distinguish the 36 isolates into four sequence types (STs): ST1 (n = 32), ST104 (n = 2), ST233 (n = 1) and a newly identified ST, ST336 (n = 1). Dendrogram constructions based on RAPD patterns indicated that S. suis serotype 2 isolates from Thailand could be divided into four groups and that the characteristics of the individual groups were in complete agreement with the virulence gene profiles and STs. The majority (32/36) of isolates recovered from diseased pigs, slaughterhouse pigs or human patients could be classified into a single group (VAGP1, RAPD-A and ST1). This genetic information strongly suggests the transmission of S. suis isolates from pigs to humans in Thailand. Our findings are

Streptococcus suis, an important pig pathogen and emerging zoonotic agent—an update on the worldwide distribution based on serotyping and sequence typing

Science.gov (United States)

Goyette-Desjardins, Guillaume; Auger, Jean-Philippe; Xu, Jianguo; Segura, Mariela; Gottschalk, Marcelo

2014-01-01

Streptococcus suis is an important pathogen causing economic problems in the pig industry. Moreover, it is a zoonotic agent causing severe infections to people in close contact with infected pigs or pork-derived products. Although considered sporadic in the past, human S. suis infections have been reported during the last 45 years, with two large outbreaks recorded in China. In fact, the number of reported human cases has significantly increased in recent years. In this review, we present the worldwide distribution of serotypes and sequence types (STs), as determined by multilocus sequence typing, for pigs (between 2002 and 2013) and humans (between 1968 and 2013). The methods employed for S. suis identification and typing, the current epidemiological knowledge regarding serotypes and STs and the zoonotic potential of S. suis are discussed. Increased awareness of S. suis in both human and veterinary diagnostic laboratories and further establishment of typing methods will contribute to our knowledge of this pathogen, especially in regions where complete and/or recent data is lacking. More research is required to understand differences in virulence that occur among S. suis strains and if these differences can be associated with specific serotypes or STs. PMID:26038745

[Emergence of invasive pneumococcal disease caused by non-vaccine serotypes in the era of the 7-valent conjugate vaccine].

Science.gov (United States)

González Martínez, F; Navarro Gómez, M L; Saavedra Lozano, J; Santos Sebastián, M M; Rodríguez Fernández, R; González Sanchéz, M; Cercenado Mansilla, E; Hernández-Sampelayo Matos, T

2014-03-01

There has been an increased incidence in invasive pneumococcal disease (IPD) produced by non-vaccine serotype (NVS) of Streptococcus pneumoniae after the introduction of PCV7. Our objective was to describe the epidemiological, clinical and microbiological characteristics of IPD caused by NVS in a tertiary hospital in Madrid. Retrospective (1998-2004) and prospective (2005-2009) study evaluating IPD caused by NVS in children. The study was divided into three periods: P1 (1998-2001) when PCV7 was not commercialized; P2 (2002-2005) with 40% vaccine coverage among children; and P3 (2006-2009) when the vaccine was added to the Childhood Immunization Schedule in Madrid. We analyzed 155 cases of IPD. One hundred and fifty of these isolates were serotyped (100 were NVS). There was an increase in the prevalence of IPD from P1 (31%) to P2 (54%) and P3 (91%). The most relevant emerging serotypes were 19A, 7F, 1, 5, 3 and 15C. The most significant clinical syndromes produced by some specific serotypes were as follows: lower respiratory tract infection (LRTI) by serotypes 1, 3, 5 and 15C; LRTI, primary bacteremia and meningitis by serotype 19A; and primary bacteremia by serotype 7F (66%). The large majority (83.8%) of NVS were sensitive to penicillin. There has been an increased prevalence of IPD caused by NVS since the introduction of PCV7. These changes should prompt the introduction of new pneumococcal vaccines, which include most of the NVS, in the childhood immunization calendar to prevent IPD in children. Copyright © 2012 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Resistencia a antibióticos no betalactámicos de aislamientos invasores de Streptococcus pneumoniae en niños latinoamericanos: SIREVA II, 2000-2005 Resistance to non-beta-lactam antibiotics in the clinical isolates of Streptococcus pneumoniae of children in Latin America: SIREVA II, 2000-2005

Directory of Open Access Journals (Sweden)

Clara Inés Agudelo

2009-04-01

Full Text Available OBJETIVO:Determinar la evolución de la resistencia a la eritromicina, el cloranfenicol, el trimetoprim-sulfametozaxol (SXT y la vancomicina de aislamientos invasores de Streptococcus pneumoniae obtenidos de niños de 10 países de América Latina y del Caribe en seis años de vigilancia. MÉTODOS: Se analizaron 8 993 aislamientos de S. pneumoniae recuperados entre 2000 y 2005 de niños menores de 6 años con infecciones invasoras, procedentes de Argentina, Brasil, Chile, Colombia, Cuba, México, Paraguay, República Dominicana, Uruguay y Venezuela. La sensibilidad a los antibióticos se determinó mediante los métodos establecidos y estandarizados en el proyecto SIREVA. La resistencia a múltiples antibióticos se definió como la resistencia a tres o más familias de antibióticos, de los no betalactámicos analizados en este estudio o de los betalactámicos evaluados en un estudio previo en el que 37,8% de estos aislamientos presentaron sensibilidad disminuida a la penicilina. RESULTADOS: Se encontró algún grado de resistencia al SXT y la eritromicina (56,4% y 15,4% de los aislamientos estudiados, respectivamente y 4,6% presentó alta resistencia al cloranfenicol. Todos los aislamientos fueron sensibles a la vancomicina. Se observó la mayor frecuencia de resistencia al SXT en los aislamientos de neumonía y a la eritromicina en los casos de sepsis (61,6% y 25,5%, respectivamente; P OBJECTIVE: To examine the development of resistance to erythromycin, chloramphenicol, trimethoprim-sulfamethoxazole (TMP-SMZ, and vancomycin of the invasive isolates of Streptococcus pneumoniae obtained from children in 10 Latin American/Caribbean countries during six years of surveillance. METHODS: Analysis of 8 993 isolates of S. pneumoniae recovered in 2000-2005 from children with invasive infections, who were less than 6 years of age, and from Argentina, Brazil, Chile, Colombia, Cuba, Dominican Republic, Mexico, Paraguay, Uruguay, or Venezuela. Antibiotic

Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

Directory of Open Access Journals (Sweden)

Helen Hencida Thangamony

2018-01-01

Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

Phosphorylation of the Streptococcus pneumoniae cell wall biosynthesis enzyme MurC by a eukaryotic-like Ser/Thr kinase.

Science.gov (United States)

Falk, Shaun P; Weisblum, Bernard

2013-03-01

Streptococcus pneumoniae contains a single Ser/Thr kinase-phosphatase pair known as StkP-PhpP. Here, we report the interaction of StkP-PhpP with S. pneumoniae UDP-N-acetylmuramoyl:L-alanine ligase, MurC, an enzyme that synthesizes an essential intermediate of the cell wall peptidoglycan pathway. Combinatorial phage display using StkP as target selected the peptide sequence YEVCGSDTVGC as an interacting partner and subsequently confirmed by ELISA. The phage peptide sequence YEVCGSDTVGC aligns closely with the MurC motif spanning S. pneumoniae amino acid coordinates 31-37. We show that MurC is phosphorylated by StkP and that phosphoMurC is dephosphorylated by PhpP. These data suggest a link between StkP-PhpP with the coordinated regulation of cell wall biosynthesis via MurC. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of SAICAR synthase from Streptococcus suis serotype 2

International Nuclear Information System (INIS)

Cheng, Xia; Lu, Guangwen; Qi, Jianxun; Cheng, Hao; Gao, Feng; Wang, Jundong; Yan, Jinghua

2010-01-01

Crystals of SAICAR synthase from S. suis serotype 2 were obtained in the presence of 40 mM aspartic acid substrate; they belonged to space group P2 and diffracted to 2.8 Å resolution. Phosphoribosylaminoimidazole-succinocarboxamide synthase (SAICAR synthase) plays an essential role in the de novo biosynthesis of purine nucleotides. In this study, the SAICAR synthase from Streptococcus suis was cloned and overexpressed in Escherichia coli. The subsequent product was purified and crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.8 Å resolution and belonged to space group P2, with unit-cell parameters a = 70.2, b = 52.2, c = 153.9 Å, β = 102.8°

The Streptococcus pyogenes serotype M49 Nra-Ralp3 transcriptional regulatory network and its control of virulence factor expression from the novel eno ralp3 epf sagA pathogenicity region.

Science.gov (United States)

Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O; Podbielski, Andreas

2007-12-01

Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known

Streptococcus pneumoniae(Spn) Nasopharyngeal Carriage in Children Under 3 Years Old, Attending Day Care Centers in Argentina

Science.gov (United States)

Gentile, Angela; Rearte, Analía; Von Spetch, Martha; Laban, Celia; Papucci, Santiago Lopez; Badano, Andrea; Ferrario, Claudia; Pereda, Rosana; Flores, Devora; Berry, Diana; Aguilera, Alejandra; Sponton, Norma; Sorhouet, Cecilia; Napoli, Daniela; Devoto, Susana; Vizzotti, Carla

2017-01-01

Abstract Background In 2012 the 13-valent conjugated pneumococcal vaccine (PCV-13) was introduced in the National Immunization Program. We performed an epidemiological study to describe SPN nasopharyngeal carriage prevalence. Methods Between June to September 2015 it was performed a cross-sectional study among children Salta (North West), Trelew (South), Rosario (Centre), Buenos Aires (Capital city) and Posadas (North East)). Samples were analyzed at references hospitals of each city and isolates were submitted to the INEI “Dr. Carlos G. Malbrán “, for confirming and serotyping. We considered completed schedule 3 doses of PCV13, administrated14 days prior to enrollment. Results We included 359 toddlers, 61,6% (IC95% 56,3–66,6) were SPN carriers. Median age was 24 months, without significative difference in carriage status. Multivariate analysis showed that independently of age, sex and socioeconomic level, variables associated with carriage were: · City: Taking Salta as reference (less carriage prevalence), Rosario and Posadas were statistically associated with higher prevalence rates: OR: 3,1 (IC95% 1,3–7,1) y OR: 2,8 (IC96% 1,2–6,3) respectively · Children attending to public day care centers had higher carriage rates than those attending private ones: OR: 1,9 (IC95% 1,06–3,4) · Children sharing bedroom with 3 or more persons, were associated to mayor risk or carriage: OR: 1,7 (IC95% 1,03–2,7) We found 46 serotypes in the 221 isolates. (2 couldn’t be serotyped), 90,9% (IC95% 86,3–94,3) were non PCV 13 serotypes (most frequent were 15B, 23B and 11A). Only 7 of 46 were PCV13 serotypes. (Graphic 1) Of the 20 toddlers with PCV13 serotypes, 16 were completely vaccinated Graphic 1: S pneumoniae serotype distribution. N = 221 Conclusion Nasopharyngeal carriage of SPN was high in children < 3 years old attending day care centers. Most isolates were Non PCV13 serotypes. The independent predictors for higher prevalence rates were: 1- Children living

Construction of improved tools for protein localization studies in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Mafalda X Henriques

Full Text Available We have constructed a set of plasmids that allow efficient expression of both N- and C-terminal fusions of proteins of interest to fluorescent proteins mCherry, Citrine, CFP and GFP in the Gram-positive pathogen Streptococcus pneumoniae. In order to improve expression of the fluorescent fusions to levels that allow their detection by fluorescence microscopy, we have introduced a 10 amino acid tag, named i-tag, at the N-terminal end of the fluorescent proteins. This caused increased expression due to improved translation efficiency and did not interfere with the protein localization in pneumococcal bacteria. Localizing fluorescent derivatives of FtsZ, Wzd and Wze in dividing bacteria validated the developed tools. The availability of the new plasmids described in this work should greatly facilitate studies of protein localization in an important clinical pathogen.

Frequent beneficial mutations during single-colony serial transfer of Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Kathleen E Stevens

2011-08-01

Full Text Available The appearance of new mutations within a population provides the raw material for evolution. The consistent decline in fitness observed in classical mutation accumulation studies has provided support for the long-held view that deleterious mutations are more common than beneficial mutations. Here we present results of a study using a mutation accumulation design with the bacterium Streptococcus pneumoniae in which the fitness of the derived populations increased. This rise in fitness was associated specifically with adaptation to survival during brief stationary phase periods between single-colony population bottlenecks. To understand better the population dynamics behind this unanticipated adaptation, we developed a maximum likelihood model describing the processes of mutation and stationary-phase selection in the context of frequent population bottlenecks. Using this model, we estimate that the rate of beneficial mutations may be as high as 4.8×10(-4 events per genome for each time interval corresponding to the pneumococcal generation time. This rate is several orders of magnitude higher than earlier estimates of beneficial mutation rates in bacteria but supports recent results obtained through the propagation of small populations of Escherichia coli. Our findings indicate that beneficial mutations may be relatively frequent in bacteria and suggest that in S. pneumoniae, which develops natural competence for transformation, a steady supply of such mutations may be available for sampling by recombination.

Progress toward characterization of the group A Streptococcus metagenome: complete genome sequence of a macrolide-resistant serotype M6 strain.

Science.gov (United States)

Banks, David J; Porcella, Stephen F; Barbian, Kent D; Beres, Stephen B; Philips, Lauren E; Voyich, Jovanka M; DeLeo, Frank R; Martin, Judith M; Somerville, Greg A; Musser, James M

2004-08-15

We describe the genome sequence of a macrolide-resistant strain (MGAS10394) of serotype M6 group A Streptococcus (GAS). The genome is 1,900,156 bp in length, and 8 prophage-like elements or remnants compose 12.4% of the chromosome. A 8.3-kb prophage remnant encodes the SpeA4 variant of streptococcal pyrogenic exotoxin A. The genome of strain MGAS10394 contains a chimeric genetic element composed of prophage genes and a transposon encoding the mefA gene conferring macrolide resistance. This chimeric element also has a gene encoding a novel surface-exposed protein (designated "R6 protein"), with an LPKTG cell-anchor motif located at the carboxyterminus. Surface expression of this protein was confirmed by flow cytometry. Humans with GAS pharyngitis caused by serotype M6 strains had antibody against the R6 protein present in convalescent, but not acute, serum samples. Our studies add to the theme that GAS prophage-encoded extracellular proteins contribute to host-pathogen interactions in a strain-specific fashion.

Nonencapsulated Streptococcus pneumoniae causes otitis media during single-species infection and during polymicrobial infection with nontypeable Haemophilus influenzae.

Science.gov (United States)

Murrah, Kyle A; Pang, Bing; Richardson, Stephen; Perez, Antonia; Reimche, Jennifer; King, Lauren; Wren, John; Swords, W Edward

2015-07-01

Streptococcus pneumoniae strains lacking capsular polysaccharide have been increasingly reported in carriage and disease contexts. Since most cases of otitis media involve more than one bacterial species, we aimed to determine the capacity of a nonencapsulated S. pneumoniae clinical isolate to induce disease in the context of a single-species infection and as a polymicrobial infection with nontypeable Haemophilus influenzae. Using the chinchilla model of otitis media, we found that nonencapsulated S. pneumoniae colonizes the nasopharynx following intranasal inoculation, but does not readily ascend into the middle ear. However, when we inoculated nonencapsulated S. pneumoniae directly into the middle ear, the bacteria persisted for two weeks post-inoculation and induced symptoms consistent with chronic otitis media. During coinfection with nontypeable H. influenzae, both species persisted for one week and induced polymicrobial otitis media. We also observed that nontypeable H. influenzae conferred passive protection from killing by amoxicillin upon S. pneumoniae from within polymicrobial biofilms in vitro. Therefore, based on these results, we conclude that nonencapsulated pneumococci are a potential causative agent of chronic/recurrent otitis media, and can also cause mutualistic infection with other opportunists, which could complicate treatment outcomes. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The Streptococcus pyogenes Serotype M49 Nra-Ralp3 Transcriptional Regulatory Network and Its Control of Virulence Factor Expression from the Novel eno ralp3 epf sagA Pathogenicity Region▿ †

Science.gov (United States)

Kreikemeyer, Bernd; Nakata, Masanobu; Köller, Thomas; Hildisch, Hendrikje; Kourakos, Vassilios; Standar, Kerstin; Kawabata, Shigetada; Glocker, Michael O.; Podbielski, Andreas

2007-01-01

Many Streptococcus pyogenes (group A streptococcus [GAS]) virulence factor- and transcriptional regulator-encoding genes cluster together in discrete genomic regions. Nra is a central regulator of the FCT region. Previous studies exclusively described Nra as a transcriptional repressor of adhesin and toxin genes. Here transcriptome and proteome analysis of a serotype M49 GAS strain and an isogenic Nra mutant of this strain revealed the complete Nra regulon profile. Nra is active in all growth phases tested, with the largest regulon in the transition phase. Almost exclusively, virulence factor-encoding genes are repressed by Nra; these genes include the GAS pilus operon, the capsule synthesis operon, the cytolysin-mediated translocation system genes, all Mga region core virulence genes, and genes encoding other regulators, like the Ihk/Irr system, Rgg, and two additional RofA-like protein family regulators. Surprisingly, our experiments revealed that Nra additionally acts as a positive regulator, mostly for genes encoding proteins and enzymes with metabolic functions. Epidemiological investigations revealed strong genetic linkage of one particular Nra-repressed regulator, Ralp3 (SPy0735), with a gene encoding Epf (extracellular protein factor from Streptococcus suis). In a serotype-specific fashion, this ralp3 epf gene block is integrated, most likely via transposition, into the eno sagA virulence gene block, which is present in all GAS serotypes. In GAS serotypes M1, M4, M12, M28, and M49 this novel discrete genetic region is therefore designated the eno ralp3 epf sagA (ERES) pathogenicity region. Functional experiments showed that Epf is a novel GAS plasminogen-binding protein and revealed that Ralp3 activity counteracts Nra and MsmR regulatory activity. In addition to the Mga and FCT regions, the ERES region is the third discrete chromosomal pathogenicity region. All of these regions are transcriptionally linked, adding another level of complexity to the known

Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction

OpenAIRE

Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E.; Lau, Gee W.

2015-01-01

The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 “late” competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically...

Seroepidemiology of Klebsiella pneumoniae colonizing the intestinal tract of healthy chinese and overseas chinese adults in Asian countries

Directory of Open Access Journals (Sweden)

Lin Yi-Tsung

2012-01-01

Full Text Available Abstract Background Capsular serotypes K1 and K2 of Klebsiella pneumoniae are thought to the major virulence determinants responsible for liver abscess. The intestine is one of the major reservoirs of K. pneumoniae, and epidemiological studies have suggested that the majority of K. pneumoniae infections are preceded by colonization of the gastrointestinal tract. The possibility of fecal-oral transmission in liver abscess has been raised on the basis of molecular typing of isolates. Data on the serotype distribution of K. pneumoniae in stool samples from healthy individuals has not been previously reported. This study investigated the seroepidemiology of K. pneumoniae isolates from the intestinal tract of healthy Chinese in Asian countries. Stool specimens from healthy adult Chinese residents of Taiwan, Japan, Hong Kong, China, Thailand, Malaysia, Singapore, and Vietnam were collected from August 2004 to August 2010 for analysis. Results Serotypes K1/K2 accounted for 9.8% of all K. pneumoniae isolates from stools in all countries. There was no significant difference in the prevalence of K1/K2 isolates among the countries excluding Thailand and Vietnam. The antimicrobial susceptibility pattern was nearly the same in K. pneumoniae isolates. The result of pulsed-field gel electrophoresis revealed no major clonal cluster of serotype K1 isolates. Conclusions The result showed that Chinese ethnicity itself might be a major factor predisposing to intestinal colonization by serotype K1/K2 K. pneumoniae isolates. The prevalent serotype K1/K2 isolates may partially correspond to the prevalence of K. pneumoniae liver abscess in Asian countries.

Influence of impaired lipoprotein biogenesis on surface and exoproteome of Streptococcus pneumoniae.

Science.gov (United States)

Pribyl, Thomas; Moche, Martin; Dreisbach, Annette; Bijlsma, Jetta J E; Saleh, Malek; Abdullah, Mohammed R; Hecker, Michael; van Dijl, Jan Maarten; Becher, Dörte; Hammerschmidt, Sven

2014-02-07

Surface proteins are important for the fitness and virulence of the Gram-positive pathogen Streptococcus pneumoniae. They are crucial for interaction of the pathogen with its human host during infection. Therefore, the analysis of the pneumococcal surface proteome is an important task that requires powerful tools. In this study, two different methods, an optimized biotinylation approach and shaving with trypsin beads, were applied to study the pneumococcal surface proteome and to identify surface-exposed protein domains, respectively. The identification of nearly 95% of the predicted lipoproteins and 75% of the predicted sortase substrates reflects the high coverage of the two classical surface protein classes accomplished in this study. Furthermore, the biotinylation approach was applied to study the impact of an impaired lipoprotein maturation pathway on the cell envelope proteome and exoproteome. Loss of the lipoprotein diacylglyceryl transferase Lgt leads to striking changes in the lipoprotein distribution. Many lipoproteins disappear from the surface proteome and accumulate in the exoproteome. Further insights into lipoprotein processing in pneumococci are provided by immunoblot analyses of bacterial lysates and corresponding supernatant fractions. Taken together, the first comprehensive overview of the pneumococcal surface and exoproteome is presented, and a model for lipoprotein processing in S. pneumoniae is proposed.

Exposure to welding fumes and lower airway infection with Streptococcus pneumoniae.

Science.gov (United States)

Suri, Reetika; Periselneris, Jimstan; Lanone, Sophie; Zeidler-Erdely, Patti C; Melton, Geoffrey; Palmer, Keith T; Andujar, Pascal; Antonini, James M; Cohignac, Vanessa; Erdely, Aaron; Jose, Ricardo J; Mudway, Ian; Brown, Jeremy; Grigg, Jonathan

2016-02-01

Welders are at increased risk of pneumococcal pneumonia. The mechanism for this association is not known. The capacity of pneumococci to adhere to and infect lower airway cells is mediated by host-expressed platelet-activating factor receptor (PAFR). We sought to assess the effect of mild steel welding fumes (MS-WF) on PAFR-dependent pneumococcal adhesion and infection to human airway cells in vitro and on pneumococcal airway infection in a mouse model. The oxidative potential of MS-WF was assessed by their capacity to reduce antioxidants in vitro. Pneumococcal adhesion and infection of A549, BEAS-2B, and primary human bronchial airway cells were assessed by means of quantitative bacterial culture and expressed as colony-forming units (CFU). After intranasal instillation of MS-WF, mice were infected with Streptococcus pneumoniae, and bronchoalveolar lavage fluid (BALF) and lung CFU values were determined. PAFR protein levels were assessed by using immunofluorescence and immunohistochemistry, and PAFR mRNA expression was assessed by using quantitative PCR. PAFR was blocked by CV-3988, and oxidative stress was attenuated by N-acetylcysteine. MS-WF exhibited high oxidative potential. In A549 and BEAS-2B cells MS-WF increased pneumococcal adhesion and infection and PAFR protein expression. Both CV-3988 and N-acetylcysteine reduced MS-WF-stimulated pneumococcal adhesion and infection of airway cells. MS-WF increased mouse lung PAFR mRNA expression and increased BALF and lung pneumococcal CFU values. In MS-WF-exposed mice CV-3988 reduced BALF CFU values. Hypersusceptibility of welders to pneumococcal pneumonia is in part mediated by the capacity of welding fumes to increase PAFR-dependent pneumococcal adhesion and infection of lower airway cells. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. All rights reserved.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism

Directory of Open Access Journals (Sweden)

Laura ePaixão

2015-10-01

Full Text Available Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonised by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonisation to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc on this response at the transcriptional, physiological and metabolic levels. Galactose (Gal, N-acetylglucosamine (GlcNAc and mannose (Man affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo 13C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s was readily consumed and elicited a metabolic shift towards a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome. In central carbon metabolism (most represented category, Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Transcriptional and metabolic effects of glucose on Streptococcus pneumoniae sugar metabolism.

Science.gov (United States)

Paixão, Laura; Caldas, José; Kloosterman, Tomas G; Kuipers, Oscar P; Vinga, Susana; Neves, Ana R

2015-01-01

Streptococcus pneumoniae is a strictly fermentative human pathogen that relies on carbohydrate metabolism to generate energy for growth. The nasopharynx colonized by the bacterium is poor in free sugars, but mucosa lining glycans can provide a source of sugar. In blood and inflamed tissues glucose is the prevailing sugar. As a result during progression from colonization to disease S. pneumoniae has to cope with a pronounced shift in carbohydrate nature and availability. Thus, we set out to assess the pneumococcal response to sugars found in glycans and the influence of glucose (Glc) on this response at the transcriptional, physiological, and metabolic levels. Galactose (Gal), N-acetylglucosamine (GlcNAc), and mannose (Man) affected the expression of 8 to 14% of the genes covering cellular functions including central carbon metabolism and virulence. The pattern of end-products as monitored by in vivo (13)C-NMR is in good agreement with the fermentation profiles during growth, while the pools of phosphorylated metabolites are consistent with the type of fermentation observed (homolactic vs. mixed) and regulation at the metabolic level. Furthermore, the accumulation of α-Gal6P and Man6P indicate metabolic bottlenecks in the metabolism of Gal and Man, respectively. Glc added to cells actively metabolizing other sugar(s) was readily consumed and elicited a metabolic shift toward a homolactic profile. The transcriptional response to Glc was large (over 5% of the genome). In central carbon metabolism (most represented category), Glc exerted mostly negative regulation. The smallest response to Glc was observed on a sugar mix, suggesting that exposure to varied sugars improves the fitness of S. pneumoniae. The expression of virulence factors was negatively controlled by Glc in a sugar-dependent manner. Overall, our results shed new light on the link between carbohydrate metabolism, adaptation to host niches and virulence.

Meningitis neonatal e infección puerperal por Streptococcus pneumoniae: Presentación de un caso

Directory of Open Access Journals (Sweden)

Cecilia Ortiz Rodríguez

2003-06-01

Full Text Available Las infecciones neonatales causadas por Streptococcus pneumoniae constituyen un fenómeno raro, poco reportado en la literatura médica; en el presente trabajo se describe el caso de una meningoencefalitis purulenta de aparición precoz, en un neonato nacido por parto eutócico, a termino y de buen peso. Se aisló el microorganismo en la sangre y en el líquido cefalorraquídeo del recién nacido, así como en los loquios de la madre. Las 3 antibiotipias fueron idénticas. La evolución del niño fue desfavorable, el cual falleció a las 81 horas de vida, en un cuadro de fallo multiorgánico. La necropsia corroboró el diagnóstico. La madre desarrolló una endometritis puerperal a los 4 días, con buena evolución.Neonatal infections caused by Streptococcus pneumoniae are a rare phenomenon that is barely reported in the medical literature. The present paper describes a case of early purulent meningoencephalitis occurred in an adequate birthweight neonate born to term eutocic delivery. The microorganism was isolated in the newborn's blood and cerebrospinal fluid as well as in his mother's lochia. The three antibiotypes were identical. The newborn did not recover and died after 81 hours due to a multiple organ failure. Necropsy confirmed the diagnosis. The mother developed puerperal endometritis after 4 days but did recover.

SUSCEPTIBILITY OF RESPIRATORY ISOLATES OF STREPTOCOCCUS PNEUMONIAE ISOLATED FROM CHILDREN HOSPITALIZED IN THE CLINICAL CENTER NIS.

Science.gov (United States)

Dinić, Marina M; Mladenović Antić, Snezana; Kocić, Branislava; Stanković Dordević, Dobrila; Vrbić, Miodrag; Bogdanović, Milena

2016-01-01

Streptococcus pneumoniae is one of the most common causes of respiratory infections. The aim was to study the susceptibility to antimicrobial agents of respiratory isolates ofStreptococcus pneumoniae obtained from hospitalized children. A total of 190 respiratory pneumococcal isolates obtained from children aged from 0 to 14 years were isolated and identified by using standard microbiological methods. Susceptibility to oxacillin, erythromycin, clindamycin, tetracycline, cotrimoxazole, ofloxacin and rifampicin was tested by disc diffusion method. Minimal inhibitory concentrations for amoxicillin and ceftriaxone were determined by means of E test. The macrolide-resistant phenotype was detected by double disc diffusion test. All tested isolates were susceptible to amoxicillin and ceftriaxone. The minimal amoxicillin concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.50 microg/ml and 1.0 microg/ml, respectively and the minimal ceftriaxone concentration inhibiting the growth of 50% of isolates and of 90% of isolates was 0.25 microg/ml and 0.50 microg/ml, respectively. Susceptibility to erythromycin and clindamycin was observed in 21.6% and 29.47% of isolates, respectively. The resistence to macrolides-M phenotype was detected in 10.07% of isolates and constitutive macrolide-lincosamide-streptogramin phenotype (constitutive MLS phenotype) was found in 89.93% of isolates. All tested isolates were susceptible to ofloxacin and rifampicin. Amoxicillin could be the therapy of choice in pediatric practice. The macrolides should not be recommended for the empirical therapy of pneumococcal respiratory tract infection in our local area.

Caracterización de aislamientos invasivos de S. pneumoniae, H. influenzae y N. meningitidis en América Latina y el Caribe: SIREVA II, 2000-2005 Characterization of invasive isolates of S. pneumoniae, H. influenzae, and N. meningitidis in Latin America and the Caribbean: SIREVA II, 2000-2005

Directory of Open Access Journals (Sweden)

Jean-Marc Gabastou

2008-07-01

cobertura de las vacunas aplicadas. Se recomienda realizar un análisis específico por país para ajustar la introducción de nuevas vacunas conjugadas y decidir el esquema de vacunación más adecuado.OBJECTIVES: To analyze the phenotypical characteristics and the susceptibility to antibiotics of the circulating strains of Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis circulating in Latin America and the Caribbean from 2000-2005. Potential coverage by conjugate vaccines was evaluated. METHODS: Conventional methods were used to study the distribution of the serotypes or serogroups of 17 303 strains of S. pneumoniae, 2 782 strains of H. influenzae, and 6 955 strains of N. meningitidis isolated from cases of pneumonia, meningitis, sepsis, bacteriemias, and other invasive processes. The antimicrobial susceptibilities of the study strains were evaluated. The isolates came from 453 sentinel surveillance sites in 19 countries in Latin America and four in the Caribbean, as part of the SIREVA II (Network Surveillance System for the Bacterial Agents Responsible for Pneumonia and Meningitis project. RESULTS: S. pneumoniae serotype 14 was the most frequently isolated (21.1%, especially in children under 6 years of age (29.1%. The potential coverages by hepta-, nona-, deca-, and trideca-valent antipneumonia conjugate vaccines were 59.0%, 73.4%, 76.5%, and 85.9%, respectively. Of the isolates, 63.3% were sensitive to penicillin. H. influenzae serotype b was present in 72.2% of the isolations from children under 2 years of age, whereas 8.6% produced serotypes a, c, d, e, and f, and 19.2% could not be serotyped. The rate of H. influenzae beta-lactamase-producing strains isolated from children under 2 years of age was 16.3%. The most frequent N. meningitidis serogroups were B (69.0% and C (25.7%; 65.8% and 99.2% of the strains were susceptible to penicillin and rifampicin, respectively. CONCLUSIONS: These results highlight the importance of comprehensive

Mannheimia haemolytica serotype A1 exhibits differential pathogenicity in two related species, Ovis canadensis and Ovis aries.

Science.gov (United States)

Dassanayake, Rohana P; Shanthalingam, Sudarvili; Herndon, Caroline N; Lawrence, Paulraj K; Frances Cassirer, E; Potter, Kathleen A; Foreyt, William J; Clinkenbeard, Kenneth D; Srikumaran, Subramaniam

2009-02-02

Mannheimia haemolytica causes pneumonia in both bighorn sheep (BHS, Ovis canadensis) and domestic sheep (DS, Ovis aries). Under experimental conditions, co-pasturing of BHS and DS results in fatal pneumonia in BHS. It is conceivable that certain serotypes of M. haemolytica carried by DS are non-pathogenic to them, but lethal for BHS. M. haemolytica serotypes A1 and A2 are carried by DS in the nasopharynx. However, it is the serotype A2 that predominantly causes pneumonia in DS. The objectives of this study were to determine whether serotype A1 exhibits differential pathogenicity to BHS and DS, and to determine whether leukotoxin (Lkt) secreted by this organism is its primary virulence factor. Three groups each of BHS and DS were intra-tracheally administered either 1 x 10(9)cfu of serotype A1 wild-type (lktA-Wt group), Lkt-deletion mutant of serotype A1-(lktA-Mt group), or saline (control group), respectively. In the lktA-Wt groups, all four BHS died within 48h while none of the DS died during the 2-week study period. In the lktA-Mt groups, none of the BHS or DS died. In the control groups, one DS died due to an unrelated cause. Necropsy and histopathological findings revealed that death of BHS in the lktA-Wt group was due to bilateral, fibrinohemorrhagic pneumonia. Although the A1-Mt-inoculated BHS were clinically normal, on necropsy, lungs of two BHS showed varying degrees of mild chronic pneumonia. These results indicate that M. haemolytica serotype A1 is non-pathogenic to DS, but highly lethal to BHS, and that Lkt is the primary virulence factor of M. haemolytica.

Validation of the Infectious Diseases Society of America/American Thoracic Society criteria to predict severe community-acquired pneumonia caused by Streptococcus pneumoniae.

Science.gov (United States)

Kontou, Paschalina; Kuti, Joseph L; Nicolau, David P

2009-10-01

Severe community-acquired pneumonia (CAP) is usually defined as pneumonia that requires intensive care unit (ICU) admission; the primary pathogen responsible for ICU admission is Streptococcus pneumoniae. In this study, the 2007 Infectious Diseases Society of America/American Thoracic Society (IDSA/ATS) consensus criteria for ICU admission were compared with other severity scores in predicting ICU admission and mortality. We retrospectively studied 158 patients with pneumococcal CAP (1999-2003). Clinical and laboratory features at the emergency department were recorded and used to calculate the 2007 IDSA/ATS rule, the 2001 ATS rule, 2 modified 2007 IDSA/ATS rules, the Pneumonia Severity Index (PSI), and the CURB (confusion, urea, respiratory rate, blood pressure) score. The sensitivity, specificity, positive predictive value, and negative predictive value (NPV) were assessed for the various indices. We also determined the criteria that were independently predictive of ICU admission and of mortality in our population. The 2007 IDSA/ATS criteria performed as well as the 2001 ATS rule in predicting ICU admission both demonstrated high sensitivity (90%) and NPV (97%). For the prediction of mortality, the best tool proved to be the PSI score (sensitivity, 95%; NPV, 99%). The variables associated with ICU admission in this patient population included tachypnea, confusion, Pao(2)/Fio(2) ratio of 250 or lower, and hypotension requiring fluid resuscitation. Mechanical ventilation and PSI class V were independently associated with mortality. This study confirms the usefulness of the new criteria in predicting severe CAP. The 2001 ATS criteria seem an attractive alternative because they are simple and as effective as the 2007 IDSA/ATS criteria.

Penicillin-resistant viridans streptococci have obtained altered penicillin-binding protein genes from penicillin-resistant strains of Streptococcus pneumoniae.

OpenAIRE

Dowson, C G; Hutchison, A; Woodford, N; Johnson, A P; George, R C; Spratt, B G

1990-01-01

Penicillin-resistant strains of Streptococcus pneumoniae possess altered forms of penicillin-binding proteins (PBPs) with decreased affinity for penicillin. The PBP2B genes of these strains have a mosaic structure, consisting of regions that are very similar to those in penicillin-sensitive strains, alternating with regions that are highly diverged. Penicillin-resistant strains of viridans groups streptococci (e.g., S. sanguis and S. oralis) that produce altered PBPs have also been reported. ...

Genetic diversity of penicillin-binding protein 2B and 2X genes from Streptococcus pneumoniae in South Africa.

OpenAIRE

Smith, A M; Klugman, K P; Coffey, T J; Spratt, B G

1993-01-01

Streptococcus pneumoniae (the pneumococcus) is believed to have developed resistance to penicillin by the production of altered forms of penicillin-binding proteins (PBPs) that have decreased affinity for penicillin. Sixty-eight clinical isolates of serogroup 6 and 19 pneumococci (MICs, < 0.015 to 8 micrograms/ml) were randomly selected from hospitals across South Africa which are at substantial geographic distance from each other. The polymerase chain reaction was used to isolate the penicil...

Dual infection by streptococcus and atypical mycobacteria following Ahmed glaucoma valve surgery.

Science.gov (United States)

Rao, Aparna; Wallang, Batriti; Padhy, Tapas Ranjan; Mittal, Ruchi; Sharma, Savitri

2013-07-01

To report a case of late postoperative endophthalmitis caused by Streptococcus pneumoniae and conjunctival necrosis by Streptococcus pneumoniae and Mycobacterium fortuitum following Ahmed glaucoma valve (AGV) surgery in a young patient. Case report of a 13-year-old boy with purulent exudates and extensive conjunctival necrosis two months following amniotic membrane graft and conjunctival closure (for conjunctival retraction post AGV for secondary glaucoma). The conjunctiva showed extensive necrosis causing exposure of the tube and plate associated with frank exudates in the area adjoining the plate and anterior chamber mandating explantation of the plate along with intravitreal antibiotics. The vitreous aspirate grew Streptococcus pneumoniae while Streptococcus pneumoniae with Mycobacterium fortuitum was isolated from the explanted plate. Despite adequate control of infection following surgery, the final visual outcome was poor owing to disc pallor. Conjunctival necrosis and retraction post-AGV can cause late postoperative co-infections by fulminant and slow-growing organisms. A close follow-up is therefore essential in these cases to prevent sight-threatening complications.

IL-22 Defect During Streptococcus pneumoniae Infection Triggers Exacerbation of Chronic Obstructive Pulmonary Disease

Directory of Open Access Journals (Sweden)

Muriel Pichavant

2015-11-01

Full Text Available Progression of chronic obstructive pulmonary disease (COPD is linked to episodes of exacerbations caused by bacterial infections due to Streptococcus pneumoniae. Our objective was to identify during COPD, factors of susceptibility to bacterial infections among cytokine network and their role in COPD exacerbations. S. pneumoniae was used to sub-lethally challenge mice chronically exposed to air or cigarette smoke (CS and to stimulate peripheral blood mononuclear cells (PBMC from non-smokers, smokers and COPD patients. The immune response and the cytokine production were evaluated. Delayed clearance of the bacteria and stronger lung inflammation observed in infected CS-exposed mice were associated with an altered production of IL-17 and IL-22 by innate immune cells. This defect was related to a reduced production of IL-1β and IL-23 by antigen presenting cells. Importantly, supplementation with recombinant IL-22 restored bacterial clearance in CS-exposed mice and limited lung alteration. In contrast with non-smokers, blood NK and NKT cells from COPD patients failed to increase IL-17 and IL-22 levels in response to S. pneumoniae, in association with a defect in IL-1β and IL-23 secretion. This study identified IL-17 and IL-22 as susceptibility factors in COPD exacerbation. Therefore targeting such cytokines could represent a potent strategy to control COPD exacerbation.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Fluorescence Imaging of Streptococcus pneumoniae with the Helix pomatia agglutinin (HPA As a Potential, Rapid Diagnostic Tool

Directory of Open Access Journals (Sweden)

Mirian Domenech

2017-07-01

Full Text Available Streptococcus pneumoniae is a common human pathogen and a major causal agent of life-threatening infections that can either be respiratory or non-respiratory. It is well known that the Helix pomatia (edible snail agglutinin (HPA lectin shows specificity for terminal αGalNAc residues present, among other locations, in the Forssman pentasaccharide (αGalNAc1→3βGalNAc1→3αGal1→4βGal1→4βGlc. Based on experiments involving choline-independent mutants and different growth conditions, we propose here that HPA recognizes the αGalNAc terminal residues of the cell wall teichoic and lipoteichoic acids of S. pneumoniae. In addition, experimental evidence showing that pneumococci can be specifically labeled with HPA when growing as planktonic cultures as well as in mixed biofilms of S. pneumoniae and Haemophilus influenzae has been obtained. It should be underlined that pneumococci were HPA-labeled despite of the presence of a capsule. Although some non-pneumococcal species also bind the agglutinin, HPA-binding combined with fluorescence microscopy constitutes a suitable tool for identifying S. pneumoniae and, if used in conjunction with Gram staining and/or other suitable technique like antigen detection, it may potentially facilitate a fast and accurate diagnosis of pneumococcal infections.

Nasal immunization of mice with Lactobacillus casei expressing the Pneumococcal Surface Protein A: induction of antibodies, complement deposition and partial protection against Streptococcus pneumoniae challenge.

Science.gov (United States)

Campos, Ivana B; Darrieux, Michelle; Ferreira, Daniela M; Miyaji, Eliane N; Silva, Débora A; Arêas, Ana Paula M; Aires, Karina A; Leite, Luciana C C; Ho, Paulo L; Oliveira, Maria Leonor S

2008-04-01

Strategies for the development of new vaccines against Streptococcus pneumoniae infections try to overcome problems such as serotype coverage and high costs, present in currently available vaccines. Formulations based on protein candidates that can induce protection in animal models have been pointed as good alternatives. Among them, the Pneumococcal Surface Protein A (PspA) plays an important role during systemic infection at least in part through the inhibition of complement deposition on the pneumococcal surface, a mechanism of evasion from the immune system. Antigen delivery systems based on live recombinant lactic acid bacteria (LAB) represents a promising strategy for mucosal vaccination, since they are generally regarded as safe bacteria able to elicit both systemic and mucosal immune responses. In this work, the N-terminal region of clade 1 PspA was constitutively expressed in Lactobacillus casei and the recombinant bacteria was tested as a mucosal vaccine in mice. Nasal immunization with L. casei-PspA 1 induced anti-PspA antibodies that were able to bind to pneumococcal strains carrying both clade 1 and clade 2 PspAs and to induce complement deposition on the surface of the bacteria. In addition, an increase in survival of immunized mice after a systemic challenge with a virulent pneumococcal strain was observed.

Diagnosis Infeksi Streptococcus suis serotipe-2 pada Babi Secara Serologi dengan Muramidase Released Protein (SEROLOGICALLY DIAGNOSE OF STREPTOCOCCUS SUIS SEROTYPE-2 INFECTION IN PIGS BASED ON MURAMIDASE RELEASED PROTEIN

Directory of Open Access Journals (Sweden)

Siti Isrina Oktavia Salasia

2016-01-01

Full Text Available Streptococcus suis is a bacterial pathogen causing disease of pigs that characterized by meningitis,bronchopneumonia, arthritis, pericarditis, polyserositis and septicaemia. S. suis especially serotype 2 caninfect human (zoonotic with a special symptom of meningitis. The aim of this research was to detect S.suis infection based on muramidase released protein (MRP, as an important virulence marker of S. suis.S. suis serotype 2 strain P171 with phenotype of MRP+EF+ was used in this research. The MRP antigen wasextracted using lysozyme and separated by using sodium dodecyl sulphate-polyacrylamide gel electrophoresis(SDS-PAGE. Balb/c mice were imunized with 136 kDa MRP to produce antibody against MRP. Theantibody was evaluated by using enzyme linkage immunosorbent assay (ELISA. The results of the researchshowed that the antibody against MRP with molecular weight of 136 kDa could be produced on Balb/Cmice with the highest absorbance of 3,889 and could be used to detect field sera from infected pigs with200x dilution using ELISA antigen capture. Antibody against MRP could detect serologically of S. suisinfection in pigs in Papua with 50% seropositivy by using ELISA antigen capture and 40% by using dot blot.

Infection by Streptococcus pneumoniae in children with or without radiologically confirmed pneumonia

Directory of Open Access Journals (Sweden)

Dafne C. Andrade

2018-01-01

Conclusions: Among children with clinical diagnosis of community‐acquired pneumonia submitted to chest radiograph, those with radiologically confirmed pneumonia present a higher rate of infection by S. pneumoniae when compared with those with a normal chest radiograph.

Use of Tetravalent Galabiose for Inhibition of Streptococcus Suis Serotype 2 Infection in a Mouse Model

Directory of Open Access Journals (Sweden)

Karen A. Krogfelt

2013-04-01

Full Text Available Streptococcus suis is an important swine pathogen associated with a variety of infections such as meningitis, arthritis and septicemia. The bacterium is zoonotic and has been found to cause meningitis especially in humans occupationally exposed to infected pigs. Since adhesion is a prerequisite for colonization and subsequent infection, anti-adhesion treatment seems a natural alternative to traditional treatment with antibiotics. In order to optimize the inhibitory potency a multivalency approach was taken in the inhibitor design. A synthetic tetravalent galabiose compound was chosen which had previously shown promising anti-adhesion effects with S. suis in vitro. The aim of this study was to evaluate the in vivo effects of the compound using an infection peritonitis mouse model. As such S. suis serotype 2 infection and treatment were tested in vivo and the effects were compared to the effect of treatment with penicillin.

Three Decades of Follow-up of Adults After Recovery From Invasive Pneumococcal Pneumonia.

Science.gov (United States)

Ajayi, Oluwadamilare O; Norton, Nancy B; Gress, Todd W; Stanek, Ronald J; Mufson, Maurice A

2017-05-01

Streptococcus pneumoniae infection is the most common cause of community-acquired pneumonia in adults. Invasive pneumococcal disease (IPD) carries a high case fatality rate. We investigated the lifespan of adults who recovered from IPD during a 32-year follow-up. We determined whether adults discharged after an episode of IPD from hospitals affiliated with the Marshall University Joan C. Edwards School of Medicine in Huntington, West Virginia from 1983-2003 were alive on June 30, 2014. Lifespan was assessed by Kaplan-Meier methodology, Cox proportional hazards multivariate analysis, life expectancy using life tables for West Virginia, years of potential life lost and serotype occurrence. The study group comprised 155 adults who survived IPD. They had a mean age at discharge of 64.6 years, mean lifespan after IPD of 7.1 years, mean expected lifespan after IPD of 17.0 years, mean age at death of 71.6 years and a mean life expectancy of 81.6 years. Only 14 (9.0%) patients lived longer than their life expectancy. Of the 13 comorbid diseases analyzed, cancer and neurologic diseases and the number of comorbid diseases suffered by each patient were the significant variables associated with survival. The mean years of potential life lost was 9.936 years. Only serotype 12 of 31 serotypes recovered occurred more often in patients who survived for 11 or more years after discharge (relative risk = 3.44, 95% CI: 1.19-9.95). The fact that most adult patients who recovered from IPD died before their documented life expectancy argues for the pernicious severity of IPD and the importance of immunization of adults with pneumococcal vaccines. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Identification of Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid by multiplex real-time PCR.

Science.gov (United States)

Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia

2017-08-14

The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

Probing genomic diversity and evolution of Streptococcus suis serotype 2 by NimbleGen tiling arrays

Directory of Open Access Journals (Sweden)

Liao Hui

2011-05-01

Full Text Available Abstract Background Our previous studies revealed that a new disease form of streptococcal toxic shock syndrome (STSS is associated with specific Streptococcus suis serotype 2 (SS2 strains. To achieve a better understanding of the pathogenicity and evolution of SS2 at the whole-genome level, comparative genomic analysis of 18 SS2 strains, selected on the basis of virulence and geographic origin, was performed using NimbleGen tiling arrays. Results Our results demonstrate that SS2 isolates have highly divergent genomes. The 89K pathogenicity island (PAI, which has been previously recognized as unique to the Chinese epidemic strains causing STSS, was partially included in some other virulent and avirulent strains. The ABC-type transport systems, encoded by 89K, were hypothesized to greatly contribute to the catastrophic features of STSS. Moreover, we identified many polymorphisms in genes encoding candidate or known virulence factors, such as PlcR, lipase, sortases, the pilus-associated proteins, and the response regulator RevS and CtsR. On the basis of analysis of regions of differences (RDs across the entire genome for the 18 selected SS2 strains, a model of microevolution for these strains is proposed, which provides clues into Streptococcus pathogenicity and evolution. Conclusions Our deep comparative genomic analysis of the 89K PAI present in the genome of SS2 strains revealed details into how some virulent strains acquired genes that may contribute to STSS, which may lead to better environmental monitoring of epidemic SS2 strains.

Epidemiology and population structure of serotypes 1, 5 and 7f carried by children in Portugal from 1996-2010 before introduction of the 10-valent and 13-valent pneumococcal conjugate vaccines.

Directory of Open Access Journals (Sweden)

Sónia T Almeida

Full Text Available Among the over 90 serotypes of Streptococcus pneumoniae described, serotypes 1, 5, and 7F account for a significant proportion of invasive disease worldwide and are now covered by the most recent 10- and 13-valent pneumococcal conjugate vaccines (PCVs. The epidemiology of these serotypes in carriage remains poorly studied because they are rarely detected. We aimed to gain insights into the epidemiology and population structure of serotypes 1, 5 and 7F carried by children in Portugal before PCV10 and PCV13 became widely used. Isolates obtained in cross-sectional studies carried out over a 15-year period (1996-2010 were retrospectively pooled and characterized. Of 5,123 pneumococci obtained, 70 were associated with serotypes 1 (n = 21, 5 (n = 7, and 7F (n = 42. The highest prevalence detected was 3.3% for serotype 1 in 2006, 1% for serotype 5 in 2009, and 3.3% for serotype 7F in 2006; Serotype 1 was associated with PMEN international clones Sweden(1-28(ST306 and Sweden(1-40(ST304; serotype 5 was associated with Colombia(5-19(ST289; and serotype 7F was associated with Netherlands(7F-39(ST191. All these isolates were fully susceptible. Most carriers of serotypes 1 (86%, 5 (86%, and 7F (91% were older than two years but a significant association with older age was only observed for serotype 7F (p = 0.006. Evidence for cross-transmission was obtained. In conclusion, we were able to detect and characterize the rarely carried serotypes 1, 5, and 7F among healthy children in Portugal. These data will constitute an important baseline for upcoming surveillance studies aimed to establish the impact of novel PCVs targeting these serotypes in carriage.

The impact of serotype-specific vaccination on phylodynamic parameters of Streptococcus pneumoniae and the pneumococcal pan-genome.

Science.gov (United States)

Azarian, Taj; Grant, Lindsay R; Arnold, Brian J; Hammitt, Laura L; Reid, Raymond; Santosham, Mathuram; Weatherholtz, Robert; Goklish, Novalene; Thompson, Claudette M; Bentley, Stephen D; O'Brien, Katherine L; Hanage, William P; Lipsitch, Marc

2018-04-01

In the United States, the introduction of the heptavalent pneumococcal conjugate vaccine (PCV) largely eliminated vaccine serotypes (VT); non-vaccine serotypes (NVT) subsequently increased in carriage and disease. Vaccination also disrupts the composition of the pneumococcal pangenome, which includes mobile genetic elements and polymorphic non-capsular antigens important for virulence, transmission, and pneumococcal ecology. Antigenic proteins are of interest for future vaccines; yet, little is known about how the they are affected by PCV use. To investigate the evolutionary impact of vaccination, we assessed recombination, evolution, and pathogen demographic history of 937 pneumococci collected from 1998-2012 among Navajo and White Mountain Apache Native American communities. We analyzed changes in the pneumococcal pangenome, focusing on metabolic loci and 19 polymorphic protein antigens. We found the impact of PCV on the pneumococcal population could be observed in reduced diversity, a smaller pangenome, and changing frequencies of accessory clusters of orthologous groups (COGs). Post-PCV7, diversity rebounded through clonal expansion of NVT lineages and inferred in-migration of two previously unobserved lineages. Accessory COGs frequencies trended toward pre-PCV7 values with increasing time since vaccine introduction. Contemporary frequencies of protein antigen variants are better predicted by pre-PCV7 values (1998-2000) than the preceding period (2006-2008), suggesting balancing selection may have acted in maintaining variant frequencies in this population. Overall, we present the largest genomic analysis of pneumococcal carriage in the United States to date, which includes a snapshot of a true vaccine-naïve community prior to the introduction of PCV7. These data improve our understanding of pneumococcal evolution and emphasize the need to consider pangenome composition when inferring the impact of vaccination and developing future protein-based pneumococcal

The impact of serotype-specific vaccination on phylodynamic parameters of Streptococcus pneumoniae and the pneumococcal pan-genome

Science.gov (United States)

Hammitt, Laura L.; Santosham, Mathuram; Goklish, Novalene; Thompson, Claudette M.; Bentley, Stephen D.; O’Brien, Katherine L.

2018-01-01

In the United States, the introduction of the heptavalent pneumococcal conjugate vaccine (PCV) largely eliminated vaccine serotypes (VT); non-vaccine serotypes (NVT) subsequently increased in carriage and disease. Vaccination also disrupts the composition of the pneumococcal pangenome, which includes mobile genetic elements and polymorphic non-capsular antigens important for virulence, transmission, and pneumococcal ecology. Antigenic proteins are of interest for future vaccines; yet, little is known about how the they are affected by PCV use. To investigate the evolutionary impact of vaccination, we assessed recombination, evolution, and pathogen demographic history of 937 pneumococci collected from 1998–2012 among Navajo and White Mountain Apache Native American communities. We analyzed changes in the pneumococcal pangenome, focusing on metabolic loci and 19 polymorphic protein antigens. We found the impact of PCV on the pneumococcal population could be observed in reduced diversity, a smaller pangenome, and changing frequencies of accessory clusters of orthologous groups (COGs). Post-PCV7, diversity rebounded through clonal expansion of NVT lineages and inferred in-migration of two previously unobserved lineages. Accessory COGs frequencies trended toward pre-PCV7 values with increasing time since vaccine introduction. Contemporary frequencies of protein antigen variants are better predicted by pre-PCV7 values (1998–2000) than the preceding period (2006–2008), suggesting balancing selection may have acted in maintaining variant frequencies in this population. Overall, we present the largest genomic analysis of pneumococcal carriage in the United States to date, which includes a snapshot of a true vaccine-naïve community prior to the introduction of PCV7. These data improve our understanding of pneumococcal evolution and emphasize the need to consider pangenome composition when inferring the impact of vaccination and developing future protein

A novel computational method identifies intra- and inter-species recombination events in Staphylococcus aureus and Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Lisa Sanguinetti

Full Text Available Advances in high-throughput DNA sequencing technologies have determined an explosion in the number of sequenced bacterial genomes. Comparative sequence analysis frequently reveals evidences of homologous recombination occurring with different mechanisms and rates in different species, but the large-scale use of computational methods to identify recombination events is hampered by their high computational costs. Here, we propose a new method to identify recombination events in large datasets of whole genome sequences. Using a filtering procedure of the gene conservation profiles of a test genome against a panel of strains, this algorithm identifies sets of contiguous genes acquired by homologous recombination. The locations of the recombination breakpoints are determined using a statistical test that is able to account for the differences in the natural rate of evolution between different genes. The algorithm was tested on a dataset of 75 genomes of Staphylococcus aureus and 50 genomes comprising different streptococcal species, and was able to detect intra-species recombination events in S. aureus and in Streptococcus pneumoniae. Furthermore, we found evidences of an inter-species exchange of genetic material between S. pneumoniae and Streptococcus mitis, a closely related commensal species that colonizes the same ecological niche. The method has been implemented in an R package, Reco, which is freely available from supplementary material, and provides a rapid screening tool to investigate recombination on a genome-wide scale from sequence data.

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Directory of Open Access Journals (Sweden)

Pui-Ying Iroh Tam

Full Text Available Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture.Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples.A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%. One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1% and 62.5% (95% CI 24.5-91.5%, respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%. Among these, six were positive for a non-S. pneumoniae pathogen on culture.Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite

Molecular Detection of Streptococcus pneumoniae on Dried Blood Spots from Febrile Nigerian Children Compared to Culture.

Science.gov (United States)

Iroh Tam, Pui-Ying; Hernandez-Alvarado, Nelmary; Schleiss, Mark R; Hassan-Hanga, Fatimah; Onuchukwu, Chuma; Umoru, Dominic; Obaro, Stephen K

2016-01-01

Nigeria has one of the highest burdens of pneumococcal disease in the world, but accurate surveillance is lacking. Molecular detection of infectious pathogens in dried blood spots (DBS) is an ideal method for surveillance of infections in resource-limited settings because of its low cost, minimal blood volumes involved, and ease of storage at ambient temperature. Our study aim was to evaluate a Streptococcus pneumoniae real-time polymerase chain reaction (rt-PCR) assay on DBS from febrile Nigerian children on Whatman 903 and FTA filter papers, compared to the gold standard of culture. Between September 2011 to May 2015, blood was collected from children 5 years of age or under who presented to six hospital study sites throughout northern and central Nigeria with febrile illness, and inoculated into blood culture bottles or spotted onto Whatman 903 or FTA filter paper. Culture and rt-PCR were performed on all samples. A total of 537 DBS specimens from 535 children were included in the study, of which 15 were culture-positive for S. pneumoniae. The rt-PCR assay detected S. pneumoniae in 12 DBS specimens (2.2%). One positive rt-PCR result was identified in a culture-negative specimen from a high-risk subject, and two positive rt-PCR results were negative on repeat testing. Six culture-confirmed cases of S. pneumoniae bacteremia were missed. Compared to culture, the overall sensitivities of Whatman 903 and FTA DBS for detection of S. pneumoniae were 57.1% (95% CI 18.4-90.1%) and 62.5% (95% CI 24.5-91.5%), respectively. Nonspecific amplification was noted in an additional 22 DBS (4.1%). Among these, six were positive for a non-S. pneumoniae pathogen on culture. Rt-PCR was able to detect S. pneumoniae from clinical DBS specimens, including from a culture-negative specimen. Our findings show promise of this approach as a surveillance diagnostic, but also raise important cautionary questions. Several DBS specimens were detected as S. pneumoniae by rt-PCR despite growth of

Etiology of community-acquired pneumonia in hospitalized patients in Jordan

International Nuclear Information System (INIS)

Al-Ali, Musa K.; Batchoun, R. G.; Al-Nour, Tariq M.

2006-01-01

To ascertain the causative organisms of community acquired pneumonia (Cap) in Jordanian patients requiring hospital admission. A prospective study of both adults and children admitted to Princess Basma and Princess Rahma Teaching Hospitals in Irbid, Jordan with a diagnosis of CAP over a 6-month period from April to October 2002. A total of 35 adult patients were admitted with a mean age of 47 years, and 63 children with a mean age of 3 years. A pathogen was isolated from 25 (71%) adults, and from 17 (27%) children, and sputum cultures gave the best diagnostic yield. In adults Streptococcus pneumoniae was the most common isolate (26%), followed by Chlamydia pneumoniae (23%), Haemophilus influenzae (17%), Mycoplasma pneumoniae (9%), and Legionella pneumophila and Klebsiella pneumoniae (6%) each. Seven of the 9 gram negative isolates were from patients with some co morbid illness. While in children, Chlamydia pneumoniae was the most common (14%), followed by Mycoplasma pneumoniae (6%), and Streptococcus pneumoniae, Haemophilus influenzae, and Pseudomonas aeruginosa (3%) each. Streptococcus pneumoniae and atypical microorganisms are the most common cause of CAP in previously healthy adults; while in those with associated co morbid illness, gram negative organisms are the likely cause. In children, the overall detection rate of causative organisms was low with atypical microorganisms being the most common. (author)

Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

Science.gov (United States)

Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

2015-01-01

Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

Assembly mechanism of FCT region type 1 pili in serotype M6 Streptococcus pyogenes.

Science.gov (United States)

Nakata, Masanobu; Kimura, Keiji Richard; Sumitomo, Tomoko; Wada, Satoshi; Sugauchi, Akinari; Oiki, Eiji; Higashino, Miharu; Kreikemeyer, Bernd; Podbielski, Andreas; Okahashi, Nobuo; Hamada, Shigeyuki; Isoda, Ryutaro; Terao, Yutaka; Kawabata, Shigetada

2011-10-28

The human pathogen Streptococcus pyogenes produces diverse pili depending on the serotype. We investigated the assembly mechanism of FCT type 1 pili in a serotype M6 strain. The pili were found to be assembled from two precursor proteins, the backbone protein T6 and ancillary protein FctX, and anchored to the cell wall in a manner that requires both a housekeeping sortase enzyme (SrtA) and pilus-associated sortase enzyme (SrtB). SrtB is primarily required for efficient formation of the T6 and FctX complex and subsequent polymerization of T6, whereas proper anchoring of the pili to the cell wall is mainly mediated by SrtA. Because motifs essential for polymerization of pilus backbone proteins in other Gram-positive bacteria are not present in T6, we sought to identify the functional residues involved in this process. Our results showed that T6 encompasses the novel VAKS pilin motif conserved in streptococcal T6 homologues and that the lysine residue (Lys-175) within the motif and cell wall sorting signal of T6 are prerequisites for isopeptide linkage of T6 molecules. Because Lys-175 and the cell wall sorting signal of FctX are indispensable for substantial incorporation of FctX into the T6 pilus shaft, FctX is suggested to be located at the pilus tip, which was also implied by immunogold electron microscopy findings. Thus, the elaborate assembly of FCT type 1 pili is potentially organized by sortase-mediated cross-linking between sorting signals and the amino group of Lys-175 positioned in the VAKS motif of T6, thereby displaying T6 and FctX in a temporospatial manner.

N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Muhammad Afzal

2016-09-01

Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

Polarity of recombination in transformation of Streptococcus pneumoniae.

Science.gov (United States)

Pasta, F; Sicard, M A

1999-03-16

In transformation of Streptococcus pneumoniae DNA enters the cell as single-strand fragments and integrates into the chromosome by homologous recombination. Deletions and insertions of a few hundred base pairs frequently stop the recombination process of a donor strand. In this work we took advantage of such interruptions of recombination to compare the transformation efficiencies of the segments 5'- and 3'-ward from a deletion. The deletion was created in the center of a fragment of the ami locus, and sites around the deletion were labeled by a frameshift generating a restriction site. Heteroduplexes were constructed containing two restriction sites on one strand and two different ones on the complementary strand. ami+ bacteria were transformed with such heteroduplexes. ami- transformants were isolated and individually underwent amplification of the transformed ami region. We have obtained two kinds of amplification products: short when the deletion was integrated, long when recombination stops at the deletion. Each long fragment was tested by the four restriction enzymes to detect which strand and which side of the deletion had recombined. We found that 80% of the cuts were located 5' to the deletion, showing that, in vivo, the 5' side is strongly favored by recombination. Further results suggest that exchanges occurring from 5' to 3' relative to the donor strand are more efficient than in the opposite direction, thus accounting for the 5' preference.

Susceptibilidad antimicrobiana de Streptococcus pneumoniae colonizante de nasofaringe en niños colombianos con neumonía

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1997-04-01

Full Text Available Streptococcus pneumoniae es uno de los principales agentes causales de infección respiratoria aguda (IRA en niños y su resistencia a antibióticos se ha incrementado en todo el mundo. En este estudio se determinaron los patrones de susceptibilidad a antimicrobianos de S. pneumoniae colonizante de las vías respiratorias altas en 272 niños hospitalizados por neumonía en dos hospitales de Santafé de Bogotá. Se aisló S. pneumoniae en 114 pacientes (42%. Se observó susceptibilidad disminuida a la penicilina en 19 aislamientos (17%, con sensibilidad intermedia en 12 (11% y franca resistencia en 7 (6%. Solo 1 de los 19 aislamientos resistentes a penicilina mostró también resistencia a la ceftriaxona. Se observó sensibilidad disminuida a la eritromicina en 3 aislamientos (3%, al cloranfenicol en 6 (5% y al cotrimoxazol (trimetoprima + sulfametoxazol en 46 (40%. Se encontró multirresistencia en 7 aislamientos (6%. El serotipo con sensibilidad disminuida a la penicilina que se halló con mayor frecuencia fue el 23F (68,4%. Se observó una asociación entre la edad, el uso previo de antibióticos y la colonización con S. pneumoniae con susceptibilidad disminuida a la penicilina o multirresistencia. Este estudio confirma la presencia de resistencia antimicrobiana de S. pneumoniae en Colombia y resalta la importancia del uso racional de los antibióticos y de la implementación de la vigilancia epidemiológica sobre este agente.

Antibacterial activity of Euphorbia hirta against Streptococcus ...

African Journals Online (AJOL)

This investigation was conducted to determine the in-vitro effect of aqueous, ethanol and methanol crude extracts of Euphorbia hirta at concentrations ranging from 10mg/ml – 100mg/ml against three pathogenic bacteria (Streptococcus pneumoniae, Klebsiella pneumoniae and Proteus vulgaris) using cup plate method.

Streptococcus suis Serotype 2 Biofilms Inhibit the Formation of Neutrophil Extracellular Traps.

Science.gov (United States)

Ma, Fang; Yi, Li; Yu, Ningwei; Wang, Guangyu; Ma, Zhe; Lin, Huixing; Fan, Hongjie

2017-01-01

Invasive infections caused by Streptococcus suis serotype 2 (SS2) has emerged as a clinical problem in recent years. Neutrophil extracellular traps (NETs) are an important mechanism for the trapping and killing of pathogens that are resistant to phagocytosis. Biofilm formation can protect bacteria from being killed by phagocytes. Until now, there have only been a few studies that focused on the interactions between bacterial biofilms and NETs. SS2 in both a biofilm state and a planktonic cell state were incubated with phagocytes and NETs, and bacterial survival was assessed. DNase I and cytochalasin B were used to degrade NET DNA or suppress phagocytosis, respectively. Extracellular DNA was stained with impermeable fluorescent dye to quantify NET formation. Biofilm formation increased up to 6-fold in the presence of neutrophils, and biofilms were identified in murine tissue. Both planktonic and biofilm cells induced neutrophils chemotaxis to the infection site, with neutrophils increasing by 85.1 and 73.8%, respectively. The bacteria in biofilms were not phagocytized. The bactericidal efficacy of NETs on the biofilms and planktonic cells were equal; however, the biofilm extracellular matrix can inhibit NET release. Although biofilms inhibit NETs release, NETs appear to be an important mechanism to eliminate SS2 biofilms. This knowledge advances the understanding of biofilms and may aid in the development of treatments for persistent infections with a biofilm component.

Effect of spatial separation of pigs on spread of Streptococcus suis serotype 9.

Directory of Open Access Journals (Sweden)

Niels Dekker

Full Text Available The spread of an infectious agent in a population can be reduced by interfering in the infectiousness or susceptibility of individuals, and/or in their contact structure. The aim of this study was to quantify the effect of prevention of direct contact between infectious and susceptible pigs on the transmission of Streptococcus suis (S. suis. In three replicate experiments, S. suis-free pigs were housed in boxes either in pairs (25 pairs or alone (15 pigs. The distance between the boxes was ±1 m. At 7 weeks of age, one pig of each pair was inoculated intranasally with S. suis serotype 9; the other pigs were exposed to S. suis by either direct (pairs or indirect contact (individually housed pigs. Tonsillar brush and saliva swab samples from all pigs were collected regularly for 4 weeks post inoculation to monitor colonization with S. suis. All inoculated pigs became infected, and their pen mates became colonized within 2 days. Thirteen indirectly exposed pigs became positive within 7-25 days after exposure. The rate of direct transmission βdir was estimated to be 3.58 per pig per day (95% CI: 2.29-5.60. The rate of indirect transmission increased in time, depending on the cumulative number of days pigs tested positive for the presence of S. suis. The estimate β'ind was 0.001 (95% CI: 0.0006-0.0017 new infections per pig per day for each day that an infected pig was tested positive for S. suis. We conclude that prevention of direct contact reduces the rate at which susceptible pigs become colonized. Simulation studies using these parameters showed, however, that such intervention measure would not limit S. suis serotype 9 spread in a commercial pig farm to a relevant extent, implying that spatial separation of groups op pigs within a compartment would not be effective on a farm.

Standardisation and evaluation of a quantitative multiplex real-time PCR assay for the rapid identification of Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Feroze Ahmed Ganaie

2015-01-01

Full Text Available Rapid diagnosis of Streptococcus pneumoniae can play a significant role in decreasing morbidity and mortality of infection. The accurate diagnosis of pneumococcal disease is hampered by the difficulties in growing the isolates from clinical specimens and also by misidentification. Molecular methods have gained popularity as they offer improvement in the detection of causative pathogens with speed and ease. The present study aims at validating and standardising the use of 4 oligonucleotide primer-probe sets (pneumolysin [ply], autolysin [lytA], pneumococcal surface adhesion A [psaA] and Spn9802 [DNA fragment] in a single-reaction mixture for the detection and discrimination of S. pneumoniae. Here, we validate a quantitative multiplex real-time PCR (qmPCR assay with a panel consisting of 43 S. pneumoniae and 29 non-pneumococcal isolates, 20 culture positive, 26 culture negative and 30 spiked serum samples. A standard curve was obtained using S. pneumoniae ATCC 49619 strain and glyceraldehyde 3-phosphate dehydrogenase (GAPDH gene was used as an endogenous internal control. The experiment showed high sensitivity with lower limit of detection equivalent to 4 genome copies/µl. The efficiency of the reaction was 100% for ply, lytA, Spn9802 and 97% for psaA. The test showed sensitivity and specificity of 100% with culture isolates and serum specimens. This study demonstrates that qmPCR analysis of sera using 4 oligonucleotide primers appears to be an appropriate method for the genotypic identification of S. pneumoniae infection.

[Increase in the incidence of invasive pneumococcal disease caused by serotype 19A prior to the implementation of the expanded pneumococcal vaccines].

Science.gov (United States)

González Martínez, F; Saavedra Lozano, J; Navarro Gómez, M L; Santos Sebastián, M M; Rodríguez Fernández, R; González Sánchez, M; Hernández-Sampelayo Matos, T

2013-11-01

To describe the epidemiology, clinical syndromes and microbiological characteristics of serotype 19A as the main cause of invasive pneumococcal disease (IPD) in children admitted to a tertiary hospital in Spain. A retrospective (1998-2004) and prospective (2005-2009) study was conducted on children with IPD produced by serotype 19A. The study was divided into three periods (P): P1 (1998-2001) when PCV7 had not been commercialized; P2 (2002-2005) with 40% vaccine coverage among children; and P3 (2006-2009) when the vaccine was added to the Childhood Immunization Schedule in Madrid. A total of 155 isolates of Streptococcus pneumoniae (SP) producing IPD were analysed, with 21 of them being serotype 19A (14%). An increased prevalence of serotype 19A was found: 2/45 cases (4.4%) in P1, 3/41 cases (7.3%) in P2 and 16/69 cases (23.2%) in P3. It occurred mostly in children younger than 2 years (16/21; 76%). This serotype was the main cause of meningitis (5/20; 25%), pleural empyema (3/22; 14%) and bacteraemic mastoiditis (2/4; 50%). Thirteen isolates (61.5%) had an MIC ≥ 0.12μ/ml for penicillin in extra-meningeal infections, and 3 of the 5 isolates causing meningitis (60%) had an MIC ≥ 1μ/ml for cefotaxime. Serotype 19A was the main causal agent of IPD in the PCV7 era (P3), with high antibiotic resistance rates. This serotype was responsible for all types of IPD, being the main cause of meningitis. Copyright © 2012 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Alta prevalência de crianças portadoras de Streptococcus pneumoniae resistentes à penicilina em creches públicas High prevalence of children colonized with penicillin-resistant Streptococcus pneumoniae in public day-care centers

Directory of Open Access Journals (Sweden)

Patrícia A. G. Velasquez

2009-12-01

Full Text Available OBJETIVOS: Investigar a prevalência de Streptococcus pneumoniae (pneumococos na nasofaringe de crianças sadias atendidas em creches municipais da cidade de Umuarama (PR. Avaliar a susceptibilidade aos antimicrobianos dos pneumococos isolados. MÉTODOS: Secreção da nasofaringe de 212 crianças foi coletada no período de abril a outubro de 2008. Após semeadura dos espécimes em ágar sangue e incubação a 37 °C por 24-48 horas, as colônias suspeitas de pertencerem a S. pneumoniae foram identificadas pela α-hemólise, sensibilidade à optoquina e bile solubilidade. A susceptibilidade à penicilina foi investigada pelos testes de disco-difusão e de diluição. A susceptibilidade aos demais antimicrobianos indicados no tratamento das infecções pneumocócicas foi realizada por disco-difusão RESULTADOS: A prevalência de pneumococos na nasofaringe foi de 43,4% (92/212, sendo maior em crianças com idade entre 2 e 5 anos (p = 0,0005. Não houve diferença significativa entre os sexos. Resistência intermediária e resistência plena à penicilina foram encontradas respectivamente em 34,8 (32/92 e 22,8% (21/92 dos isolados. Sessenta e sete amostras (72,8% foram resistentes ao sulfametoxazol-trimetoprim, oito (8,7% à eritromicina e seis (6,5% à tetraciclina. Uma amostra apresentou resistência à clindamicina (1,1%, e outra ao cloranfenicol (1,1%. Todas as amostras foram sensíveis a levofloxacina, ofloxacina, rifampicina, telitromicina, linezolide e vancomicina. Nove amostras foram consideradas multirresistentes, por apresentarem resistência a três ou mais classes de antimicrobianos. CONCLUSÕES: O presente estudo registrou uma alta prevalência de crianças portadoras sadias de amostras de S. pneumoniae resistentes à penicilina que podem constituir importantes reservatórios desse patógeno na comunidade.OBJECTIVES: To investigate the prevalence of Streptococcus pneumoniae (pneumococci in the nasopharynx of healthy children enrolled

Molecular Characterization of Streptococcus agalactiae Isolates From Pregnant and Non-Pregnant Women at Yazd University Hospital, Iran

OpenAIRE

Sadeh, Maryam; Firouzi, Roya; Derakhshandeh, Abdollah; Bagher Khalili, Mohammad; Kong, Fanrong; Kudinha, Timothy

2016-01-01

Background: Streptococcus agalactiae (Group B streptococcus, GBS) that colonize the vaginas of pregnant women may occasionally cause neonatal infections. It is one of the most common causes of sepsis and meningitis in neonates and of invasive diseases in pregnant women. It can also cause infectious disease among immunocompromised individuals. The distribution of capsular serotypes and genotypes varies over time and by geographic era. The serotyping and genotyping data of GBS in Iranian pregna...

Efficacy of some synthetic antibiotics on Streptococcus pneumoniae ...

African Journals Online (AJOL)

Effects of some synthetic antibiotics on Streptococcus pnemoniae and Proteus mirabilis isolated from cultured Clarias gariepinus, an important food fish raised in a concrete tank was carried out to ascertain their remedies on mortalities of the Clarias gariepinus adult fish. Streptococcus pnemoniae and Proteus mirabilis were ...

Effect of Xylitol on Growth of Streptococcus pneumoniae in the Presence of Fructose and Sorbitol

Science.gov (United States)

Tapiainen, Terhi; Kontiokari, Tero; Sammalkivi, Laura; Ikäheimo, Irma; Koskela, Markku; Uhari, Matti

2001-01-01

Xylitol is effective in preventing acute otitis media by inhibiting the growth of Streptococcus pneumoniae. To clarify this inhibition we used fructose, which is known to block similar growth inhibition observed in Streptococcus mutans. In addition, we evaluated the efficacy of sorbitol in inhibiting the growth of pneumococci, as sorbitol is widely used for indications similar to those for which xylitol is used. The addition of 5% xylitol to the growth medium resulted in marked growth inhibition, an effect which was totally eliminated in the presence of 1, 2.5, or 5% fructose but not in the presence of 1 or 5% glucose, 1% galactose, or 1% sucrose. This finding implies that xylitol-induced inhibition of pneumococcal growth is mediated via the fructose phosphotransferase system in a way similar to that in which mutans group streptococcal growth is inhibited. The addition of sorbitol at concentrations of 1, 2.5, or 5% to the growth medium did not affect the growth of pneumococci and neither inhibited nor enhanced the xylitol-induced growth impairment. Thus, it seems that xylitol is the only commercially used sugar substitute proven to have an antimicrobial effect on pneumococci. PMID:11120960

Streptococcus pneumoniae-Induced Oxidative Stress in Lung Epithelial Cells Depends on Pneumococcal Autolysis and Is Reversible by Resveratrol.

Science.gov (United States)

Zahlten, Janine; Kim, Ye-Ji; Doehn, Jan-Moritz; Pribyl, Thomas; Hocke, Andreas C; García, Pedro; Hammerschmidt, Sven; Suttorp, Norbert; Hippenstiel, Stefan; Hübner, Ralf-Harto

2015-06-01

Streptococcus pneumoniae is the most common cause of community-acquired pneumonia worldwide. During pneumococcal pneumonia, the human airway epithelium is exposed to large amounts of H2O2 as a product of host and pathogen oxidative metabolism. Airway cells are known to be highly vulnerable to oxidant damage, but the pathophysiology of oxidative stress induced by S. pneumoniae and the role of nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated antioxidant systems of the host are not well characterized. For gluthation/gluthathion disulfide analysis BEAS-2B cells, primary broncho-epithelial cells (pBEC), explanted human lung tissue and mouse lungs were infected with different S. pneumoniae strains (D39, A66, R6x, H2O2/pneumolysin/LytA- deficient mutants of R6x). Cell death was proven by LDH assay and cell viability by IL-8 ELISA. The translocation of Nrf2 and the expression of catalase were shown via Western blot. The binding of Nrf2 at the catalase promoter was analyzed by ChIP. We observed a significant induction of oxidative stress induced by S. pneumoniae in vivo, ex vivo, and in vitro. Upon stimulation, the oxidant-responsive transcription factor Nrf2 was activated, and catalase was upregulated via Nrf2. The pneumococci-induced oxidative stress was independent of S. pneumoniae-derived H2O2 and pneumolysin but depended on the pneumococcal autolysin LytA. The Nrf2 inducer resveratrol, as opposed to catalase, reversed oxidative stress in lung epithelial cells. These observations indicate a H2O2-independent induction of oxidative stress in lung epithelial cells via the release of bacterial factors of S. pneumoniae. Resveratrol might be an option for prevention of acute lung injury and inflammatory responses observed in pneumococcal pneumonia. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Stress-triggered signaling affecting survival or suicide of Streptococcus pneumoniae.

Science.gov (United States)

Cortes, Paulo R; Piñas, Germán E; Cian, Melina B; Yandar, Nubia; Echenique, Jose

2015-01-01

Streptococcus pneumoniae is a major human pathogen that can survive to stress conditions, such as the acidic environment of inflammatory foci, and tolerates lethal pH through a mechanism known as the acid tolerance response. We previously described that S. pneumoniae activates acidic-stress induced lysis in response to acidified environments, favoring the release of cell wall compounds, DNA and virulence factors. Here, we demonstrate that F(0)F(1)-ATPase is involved in the response to acidic stress. Chemical inhibitors (DCCD, optochin) of this proton pump repressed the ATR induction, but caused an increased ASIL. Confirming these findings, mutants of the subunit c of this enzyme showed the same phenotypes as inhibitors. Importantly, we demonstrated that F(0)F(1)-ATPase and ATR are necessary for the intracellular survival of the pneumococcus in macrophages. Alternatively, a screening of two-component system (TCS) mutants showed that ATR and survival in pneumocytes were controlled in contrasting ways by ComDE and CiaRH, which had been involved in the ASIL mechanism. Briefly, CiaRH was essential for ATR (ComE represses activation) whereas ComE was necessary for ASIL (CiaRH protects against induction). They did not regulate F0F1-ATPase expression, but control LytA expression on the pneumococcal surface. These results suggest that both TCSs and F(0)F(1)-ATPase control a stress response and decide between a survival or a suicide mechanism by independent pathways, either in vitro or in pneumocyte cultures. This biological model contributes to the current knowledge about bacterial response under stress conditions in host tissues, where pathogens need to survive in order to establish infections. Copyright © 2014 Elsevier GmbH. All rights reserved.

Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza

Science.gov (United States)

Cisterna, Daniel; Savji, Nazir; Bussetti, Ana Valeria; Kapoor, Vishal; Hui, Jeffrey; Tokarz, Rafal; Briese, Thomas; Baumeister, Elsa; Lipkin, W. Ian

2009-01-01

Background Initial reports in May 2009 of the novel influenza strain H1N1pdm estimated a case fatality rate (CFR) of 0.6%, similar to that of seasonal influenza. In July 2009, however, Argentina reported 3056 cases with 137 deaths, representing a CFR of 4.5%. Potential explanations for increased CFR included virus reassortment or genetic drift, or infection of a more vulnerable population. Virus genomic sequencing of 26 Argentinian samples representing both severe and mild disease indicated no evidence of reassortment, mutations associated with resistance to antiviral drugs, or genetic drift that might contribute to virulence. Furthermore, no evidence was found for increased frequency of risk factors for H1N1pdm disease. Methods/Principal Findings We examined nasopharyngeal swab samples (NPS) from 199 cases of H1N1pdm infection from Argentina with MassTag PCR, testing for 33 additional microbial agents. The study population consisted of 199 H1N1pdm-infected subjects sampled between 23 June and 4 July 2009. Thirty-nine had severe disease defined as death (n = 20) or hospitalization (n = 19); 160 had mild disease. At least one additional agent of potential pathogenic importance was identified in 152 samples (76%), including Streptococcus pneumoniae (n = 62); Haemophilus influenzae (n = 104); human respiratory syncytial virus A (n = 11) and B (n = 1); human rhinovirus A (n = 1) and B (n = 4); human coronaviruses 229E (n = 1) and OC43 (n = 2); Klebsiella pneumoniae (n = 2); Acinetobacter baumannii (n = 2); Serratia marcescens (n = 1); and Staphylococcus aureus (n = 35) and methicillin-resistant S. aureus (MRSA, n = 6). The presence of S. pneumoniae was strongly correlated with severe disease. S. pneumoniae was present in 56.4% of severe cases versus 25% of mild cases; more than one-third of H1N1pdm NPS with S. pneumoniae were from subjects with severe disease (22 of 62 S. pneumoniae-positive NPS, p = 0

Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Margarida Carrolo

Full Text Available Streptococcus pneumoniae (pneumococcus is able to form biofilms in vivo and previous studies propose that pneumococcal biofilms play a relevant role both in colonization and infection. Additionally, pneumococci recovered from human infections are characterized by a high prevalence of lysogenic bacteriophages (phages residing quiescently in their host chromosome. We investigated a possible link between lysogeny and biofilm formation. Considering that extracellular DNA (eDNA is a key factor in the biofilm matrix, we reasoned that prophage spontaneous activation with the consequent bacterial host lysis could provide a source of eDNA, enhancing pneumococcal biofilm development. Monitoring biofilm growth of lysogenic and non-lysogenic pneumococcal strains indicated that phage-infected bacteria are more proficient at forming biofilms, that is their biofilms are characterized by a higher biomass and cell viability. The presence of phage particles throughout the lysogenic strains biofilm development implicated prophage spontaneous induction in this effect. Analysis of lysogens deficient for phage lysin and the bacterial major autolysin revealed that the absence of either lytic activity impaired biofilm development and the addition of DNA restored the ability of mutant strains to form robust biofilms. These findings establish that limited phage-mediated host lysis of a fraction of the bacterial population, due to spontaneous phage induction, constitutes an important source of eDNA for the S. pneumoniae biofilm matrix and that this localized release of eDNA favors biofilm formation by the remaining bacterial population.

Meningitis caused by Neisseria Meningitidis, Hemophilus Influenzae Type B and Streptococcus Pneumoniae during 2005–2012 in Turkey

Science.gov (United States)

Ceyhan, Mehmet; Gürler, Nezahat; Ozsurekci, Yasemin; Keser, Melike; Aycan, Ahmet Emre; Gurbuz, Venhar; Salman, Nuran; Camcioglu, Yildiz; Dinleyici, Ener Cagri; Ozkan, Sengul; Sensoy, Gulnar; Belet, Nursen; Alhan, Emre; Hacimustafaoglu, Mustafa; Celebi, Solmaz; Uzun, Hakan; Faik Oner, Ahmet; Kurugol, Zafer; Ali Tas, Mehmet; Aygun, Denizmen; Oncel, Eda Karadag; Celik, Melda; Yasa, Olcay; Akin, Fatih; Coşkun, Yavuz

2014-01-01

Successful vaccination policies for protection from bacterial meningitis are dependent on determination of the etiology of bacterial meningitis. Cerebrospinal fluid (CSF) samples were obtained prospectively from children from 1 month to ≤ 18 years of age hospitalized with suspected meningitis, in order to determine the etiology of meningitis in Turkey. DNA evidence of Neisseria meningitidis (N. meningitidis), Streptococcus pneumoniae (S. pneumoniae), and Hemophilus influenzae type b (Hib) was detected using multiplex polymerase chain reaction (PCR). In total, 1452 CSF samples were evaluated and bacterial etiology was determined in 645 (44.4%) cases between 2005 and 2012; N. meningitidis was detected in 333 (51.6%), S. pneumoniae in 195 (30.2%), and Hib in 117 (18.1%) of the PCR positive samples. Of the 333 N. meningitidis positive samples 127 (38.1%) were identified as serogroup W-135, 87 (26.1%) serogroup B, 28 (8.4%) serogroup A and 3 (0.9%) serogroup Y; 88 (26.4%) were non-groupable. As vaccines against the most frequent bacterial isolates in this study are available and licensed, these results highlight the need for broad based protection against meningococcal disease in Turkey. PMID:25483487

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Paterson, Neil G.; Riboldi-Tunnicliffe, Alan; Mitchell, Timothy J.; Isaacs, Neil W.

2006-01-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6 1 22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo [Pharmaceutical Research Center, Meiji Seika Kaisha Ltd, 760 Morooka-cho, Kohoku-ku, Yokohama 222-8567 (Japan)

2008-04-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Yamada, Mototsugu; Watanabe, Takashi; Baba, Nobuyoshi; Miyara, Takako; Saito, Jun; Takeuchi, Yasuo

2008-01-01

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4 3 2 1 2, with unit-cell parameters a = b = 86.39, c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent

Purification, crystallization and preliminary X-ray diffraction analysis of RafE, a sugar-binding lipoprotein from Streptococcus pneumoniae

Energy Technology Data Exchange (ETDEWEB)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunnicliffe, Alan [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Mitchell, Timothy J. [Division of Infection and Immunity (IBLS), Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom); Isaacs, Neil W. [Department of Chemistry and WestCHEM, Glasgow Biomedical Research Centre (GBRC), University of Glasgow, 120 University Place, Glasgow G12 8TA,Scotland (United Kingdom)

2006-07-01

The mature form of RafE has been expressed, purified and crystallized. X-ray diffraction data have been collected to 3.65 and 2.90 Å resolution from native and selenomethionine-derivative crystals, respectively. Streptococcus pneumoniae contains a large number of sugar-transport systems and the system responsible for raffinose uptake has recently been identified. The substrate-binding protein component of this system shares strong sequence homology with the multiple sugar metabolism substrate-binding protein MsmE from S. mutans and contains a lipoprotein-attachment site at cysteine residue 23. A truncated form (residues 24–419) of RafE from S. pneumoniae was cloned and overexpressed in Escherichia coli. Native and selenomethionine-labelled protein have been crystallized in the hexagonal space group P6{sub 1}22. Diffraction data have been successfully phased to 2.90 Å using Se SAD data and model building is in progress.

Differential recognition and hydrolysis of host carbohydrate antigens by Streptococcus pneumoniae family 98 glycoside hydrolases.

Science.gov (United States)

Higgins, Melanie A; Whitworth, Garrett E; El Warry, Nahida; Randriantsoa, Mialy; Samain, Eric; Burke, Robert D; Vocadlo, David J; Boraston, Alisdair B

2009-09-18

The presence of a fucose utilization operon in the Streptococcus pneumoniae genome and its established importance in virulence indicates a reliance of this bacterium on the harvesting of host fucose-containing glycans. The identities of these glycans, however, and how they are harvested is presently unknown. The biochemical and high resolution x-ray crystallographic analysis of two family 98 glycoside hydrolases (GH98s) from distinctive forms of the fucose utilization operon that originate from different S. pneumoniae strains reveal that one enzyme, the predominant type among pneumococcal isolates, has a unique endo-beta-galactosidase activity on the LewisY antigen. Altered active site topography in the other species of GH98 enzyme tune its endo-beta-galactosidase activity to the blood group A and B antigens. Despite their different specificities, these enzymes, and by extension all family 98 glycoside hydrolases, use an inverting catalytic mechanism. Many bacterial and viral pathogens exploit host carbohydrate antigens for adherence as a precursor to colonization or infection. However, this is the first evidence of bacterial endoglycosidase enzymes that are known to play a role in virulence and are specific for distinct host carbohydrate antigens. The strain-specific distribution of two distinct types of GH98 enzymes further suggests that S. pneumoniae strains may specialize to exploit host-specific antigens that vary from host to host, a factor that may feature in whether a strain is capable of colonizing a host or establishing an invasive infection.

Mechanisms and impact of genetic recombination in the evolution of Streptococcus pneumoniae.

Science.gov (United States)

Chaguza, Chrispin; Cornick, Jennifer E; Everett, Dean B

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a highly recombinogenic bacterium responsible for a high burden of human disease globally. Genetic recombination, a process in which exogenous DNA is acquired and incorporated into its genome, is a key evolutionary mechanism employed by the pneumococcus to rapidly adapt to selective pressures. The rate at which the pneumococcus acquires genetic variation through recombination is much higher than the rate at which the organism acquires variation through spontaneous mutations. This higher rate of variation allows the pneumococcus to circumvent the host innate and adaptive immune responses, escape clinical interventions, including antibiotic therapy and vaccine introduction. The rapid influx of whole genome sequence (WGS) data and the advent of novel analysis methods and powerful computational tools for population genetics and evolution studies has transformed our understanding of how genetic recombination drives pneumococcal adaptation and evolution. Here we discuss how genetic recombination has impacted upon the evolution of the pneumococcus.

Penicillin-Resistant trend of Streptococcus pneumoniae in Asia: A systematic review.

Science.gov (United States)

Mamishi, Setareh; Moradkhani, Sepideh; Mahmoudi, Shima; Hosseinpour-Sadeghi, Reihaneh; Pourakbari, Babak

2014-08-01

The high prevalence of resistance to penicillin by Streptococcus pneumoniaeis considered as a great concern, particularly in Asian countries. The aim of this study was to investigate the changing trend of penicillin-resistant S. pneumoniae (PRSP) in Asia over a 20 years period. A review of the literature was conducted using the PubMed database, Google Scholar, Scopus, two Persian scientific search engines "Scientific Information Database" (www.sid.ir), and "Mag Iran" (www.magiran.com) through 1993 to 2013. Our study provides a unique chance to investigate the changing trend in PSSP in Asia over a 20 years period. Susceptibility rates among different centers in each country varied widely. In Malaysia, the PSSP rate decreased from 97.2% in 1995-1996 to 69% in 2000. In Singapore, PSSP levels decreased from 72.6% in 1997 to 30.5% in 2007-2008. In Iran, PSSP ranged from 0% to 100%. In Taiwan, the rate of PSSP was 60.3% in 1995 and countries such as Vietnam, Singapore, Philippines, Pakistan, Nepal, Kuwait, Korea and Indonesia.

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

International Nuclear Information System (INIS)

Jorens, Philippe G.; Demey, Hendrik E.; Parizel, Paul M.; Smets, Katrien; Jadoul, Kris; Verbeek, M.M.; Wevers, R.A.; Cras, Patrick

2005-01-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

Meningoencephalitis caused by Streptococcus pneumoniae: a diagnostic and therapeutic challenge. Diagnosis with diffusion-weighted MRI leading to treatment with corticosteroids

Energy Technology Data Exchange (ETDEWEB)

Jorens, Philippe G.; Demey, Hendrik E. [University Hospital of Antwerp, UZA, Department of Intensive Care Medicine, Edegem (Belgium); Parizel, Paul M. [University of Antwerp, Department of Radiology, Edegem (Belgium); Smets, Katrien [University of Antwerp, Department of Neurology, Edegem (Belgium); General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Jadoul, Kris [General Hospital AZ Middelares, Department of Neurology, Sint-Niklaas (Belgium); Verbeek, M.M.; Wevers, R.A. [University Hospital of Nijmegen, Laboratory of Paediatrics and Neurology, Nijmegen (Netherlands); Cras, Patrick [University of Antwerp, Department of Neurology, Edegem (Belgium)

2005-10-01

Streptococcus pneumoniae is a common cause of bacterial meningitis but only rarely causes other infections such as brain abscess, encephalitis, encephalomyelitis or meningoencephalitis. We report on three adult patients with meningoencephalitis caused by S. pneumoniae. In all three, CT and MRI revealed widespread brain lesions, suggesting extensive parenchymal injury. Diffusion-weighted MRI showed lesions with restricted diffusion, reflecting local areas of ischaemia with cytotoxic oedema secondary to an immunologically mediated necrotising vasculitis and thrombosis. High levels of markers of neuronal, glial and myelin damage were found in the cerebrospinal fluid. According to the literature, brain parenchyma lesions in adults with pneumococcal meningoencephalitis are often associated with death or severe neurological deficit. Our patients were treated with pulse doses of glucocorticoids: this resulted in dramatic clinical improvement and an excellent final neurological recovery. (orig.)

Frequency of Streptococcus pneumonia and Haemophilus influenza in acute exacerbation of chronic obstructive airway disease and their sensitivity to levofloxacin

International Nuclear Information System (INIS)

Furqan, S.; Paracha, S.A.U.

2014-01-01

Objective: To determine the frequency of Streptococcus pneumoniae and Haemophilus influenzae in acute exacerbation of chronic obstructive pulmonary disease and their sensitivity to levofloxacin. Methods: The cross-sectional study was conducted at the Department of Medicine, AbbasiShaheed Hospital, Karachi, between July 2009 and January 2010. Patients already diagnosed with chronic obstructive pulmonary disease and admitted with symptoms of acute exacerbation were included in the study and their sputum samples were sent for microbiological evaluation. SPSS 16 was used for statistical analysis. Results: Of the total 105 patients in the study, 90 (85.17%) were males. Overall mean age at presentation was 62+-10.2 years. S. pneumoniae was isolated from sputum culture of 33 (31.4%) patients, while 13 (12.4%) patients showed growth of H. influenzae. Out of the 33 sputum specimens of S. pneumoniae, 32 (97.0%) were sensitive to levofloxacin, while 1 (3.0%) was resistant. All the 13 isolates of H. influenzae were sensitive to levofloxacin. Conclusion: S. pneumoniae and H. influenzae are still the most prevalent organisms isolated in acute exacerbation of chronic obstructive pulmonary disease in our population. Levofloxacin is still considered a highly sensitive antibiotic against these common micro-organisms in our population, but S. pneumoniae has started developing resistance against levofloxacin. Therefore, intermittent surveillance regarding development of resistance pattern of common micro-organisms against commonly prescribed antibiotics is required. (author)

CT features of legionella pneumonia, compared with streptococcal pneumonia. A collaborative study

International Nuclear Information System (INIS)

Tokuda, Hitoshi; Sakai, Fumikazu; Goto, Hajime

2007-01-01

Legionella pneumophila pneumonia (LPP) is of serious concern for chest physicians for its potential lethality and difficulty of diagnosis. In spite of widespread use of urine antigen detection method, it remains one of the most difficult-to-treat disease among community acquired pneumonia. We investigated CT images of 38 cases of LPP, comparing them with wide spread Streptococcus pneumoniae pneumonia (SPP). We find that sharply demarcated consolidation scattered in ground-glass opacity is the most striking and pathognomonic feature of LPP, which is rarely found in SPP. Bronchiolitis was not found in LPP, while it is a relatively common finding in SPP, which could be the second clue of differentiation of these two diseases. (author)

Swine infection by Streptococcus suis: a retrospective study Infecção em suínos por Streptococcus suis: estudo retrospectivo

Directory of Open Access Journals (Sweden)

A.E. Del'Arco

2008-08-01

Full Text Available The epidemic aspects of swine infections caused by Streptococcus suis were studied, focusing mainly on the occurrence of several serotypes. A total of 323 samples of S. suis were isolated from clinically ill animals, serotyped according to the co-agglutination procedure, and analyzed. The serotyping revealed that S. suis was present in several Brazilian states. The largest number was isolated from the states of Minas Gerais (62.5%, São Paulo (10.8%, and Paraná (9.3%. Serotype 2 was the most frequent (61.0%, followed by the serotypes 1, 3, 4, 7, and 8. The largest number of isolations was obtained from the brain (60.1%, followed by the lungs (10.4%. About 9.4% of the cases were due to septicemia.Estudaram-se os aspectos epidêmicos das infecções de suínos causadas por Streptococcus suis, enfocando, principalmente, a ocorrência de diferentes sorotipos. Foram analisadas 323 amostras isoladas de animais clinicamente doentes, as quais foram sorotipadas de acordo com o procedimento de co-aglutinação. Foi verificado que S. suis está presente em vários estados brasileiros e o maior número de isolados originou-se dos estados de Minas Gerais (62,5%, São Paulo (10,8% e Paraná (9,3%. O sorotipo 2 foi o mais freqüente (61.0%, seguido pelos sorotipos 1, 3, 4, 7 e 8. Os isolamentos foram obtidos principalmente de cérebro (60,1% e pulmões (10,4%. Os casos de septicemia representaram 9,4%.

Antibiotic treatment and the diagnosis of Streptococcus pneumoniae in lower respiratory tract infections in adults

DEFF Research Database (Denmark)

Korsgaard, Jens; Møller, Jens Kjølseth; Kilian, Mogens

2005-01-01

OBJECTIVE: To analyze the possible influence of antibiotic treatment on the results of different diagnostic tests for the diagnosis of lower respiratory tract infections with Streptococcus pneumoniae. MATERIAL AND METHODS: A prospective cohort of 159 unselected adult immunocompetent patients...... admitted to Silkeborg County Hospital in Denmark with community-acquired lower respiratory tract infections underwent microbiological investigations with fiber-optic bronchoscopy with bronchoalveolar lavage, blood and sputum culture and urine antigen test for type-specific polysaccharide capsular antigens...... was positive in both systems, making a total of 22 patients with documented pneumococcal infection. As a positive culture test was dependent on the absence of antibiotic treatment, whereas a positive urine antigen test depended on antibiotic treatment within 48 hours, the two tests were complementary...

Cloning, expression, purification, crystallization and preliminary X-ray analysis of the pilus-associated sortase C from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Neiers, F.; Madhurantakam, C.; Fälker, S.; Normark, S.; Henriques-Normark, B.; Achour, A.

2008-01-01

Crystallization conditions and preliminary X-ray diffraction analysis of the S. pneumoniae-derived pilus-associated protein sortase C are reported. The pilus-associated sortase C from Streptococcus pneumoniae (SrtC or Srt-2) acts as a polymerase for the pilus subunit proteins RrgA and RrgB. Here, the crystallization and preliminary X-ray diffraction analysis of three crystal forms of SrtC are reported. One crystal form belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 48.9, b = 96.9, c = 98.9 Å, α = β = γ = 90°. The other two crystal forms belong to space group P222, with unit-cell parameters a = 48.8, b = 97.2, c = 99.2 Å, α = β = γ = 90° and a = 48.6, b = 96.5, c = 98.8 Å, α = β = γ = 90°, respectively. Preliminary analysis indicates the presence of two molecules in the asymmetric unit of the crystal for all three forms

Extended Spectrum β-Lactamase (ESBL) in Klebsiella Pneumoniae ...

African Journals Online (AJOL)

Pseudomonas aeruginosa, Streptococcus Pneumoniae and Serratia spp. Two of the children died in spite of early use of appropriate antibiotics as determined by antibiotic susceptibility testing. Phenotypic and molecualr investigation showed extended-spectrum β-lactamase (ESBL) producing K. pneumoniae to be ...

Components of Streptococcus pneumoniae suppress allergic airways disease and NKT cells by inducing regulatory T cells.

Science.gov (United States)

Thorburn, Alison N; Foster, Paul S; Gibson, Peter G; Hansbro, Philip M

2012-05-01

Asthma is an allergic airways disease (AAD) caused by dysregulated immune responses and characterized by eosinophilic inflammation, mucus hypersecretion, and airway hyperresponsiveness (AHR). NKT cells have been shown to contribute to AHR in some mouse models. Conversely, regulatory T cells (Tregs) control aberrant immune responses and maintain homeostasis. Recent evidence suggests that Streptococcus pneumoniae induces Tregs that have potential to be harnessed therapeutically for asthma. In this study, mouse models of AAD were used to identify the S. pneumoniae components that have suppressive properties, and the mechanisms underlying suppression were investigated. We tested the suppressive capacity of type-3-polysaccharide (T3P), isolated cell walls, pneumolysoid (Ply) and CpG. When coadministered, T3P + Ply suppressed the development of: eosinophilic inflammation, Th2 cytokine release, mucus hypersecretion, and AHR. Importantly, T3P + Ply also attenuated features of AAD when administered during established disease. We show that NKT cells contributed to the development of AAD and also were suppressed by T3P + Ply treatment. Furthermore, adoptive transfer of NKT cells induced AHR, which also could be reversed by T3P + Ply. T3P + Ply-induced Tregs were essential for the suppression of NKT cells and AAD, which was demonstrated by Treg depletion. Collectively, our results show that the S. pneumoniae components T3P + Ply suppress AAD through the induction of Tregs that blocked the activity of NKT cells. These data suggest that S. pneumoniae components may have potential as a therapeutic strategy for the suppression of allergic asthma through the induction of Tregs and suppression of NKT cells.

Epidemiology of Otitis Media with Spontaneous Perforation of the Tympanic Membrane in Young Children and Association with Bacterial Nasopharyngeal Carriage, Recurrences and Pneumococcal Vaccination in Catalonia, Spain - The Prospective HERMES Study.

Science.gov (United States)

Cilveti, Robert; Olmo, Montserrat; Pérez-Jove, Josefa; Picazo, Juan-José; Arimany, Josep-Lluis; Mora, Emiliano; Pérez-Porcuna, Tomás M; Aguilar, Ignacio; Alonso, Aurora; Molina, Francesc; Del Amo, María; Mendez, Cristina

2017-01-01

The Epidemiology of otitis media with spontaneous perforation of the tympanic membrane and associated nasopharyngeal carriage of bacterial otopathogens was analysed in a county in Catalonia (Spain) with pneumococcal conjugate vaccines (PCVs) not included in the immunization programme at study time. A prospective, multicentre study was performed in 10 primary care centres and 2 hospitals (June 2011-June 2014), including all otherwise healthy children ≥2 months ≤8 years with otitis media presenting spontaneous tympanic perforation within 48h. Up to 521 otitis episodes in 487 children were included, showing by culture/PCR in middle ear fluid (MEF): Haemophilus influenzae [24.2%], both Streptococcus pneumoniae and H. influenzae [24.0%], S. pneumoniae [15.9%], Streptococcus pyogenes [13.6%], and Staphylococcus aureus [6.7%]. Culture-negative/PCR-positive otitis accounted for 31.3% (S. pneumoniae), 30.2% (H. influenzae) and 89.6% (mixed S. pneumoniae/H. influenzae infections). Overall, incidence decreased over the 3-year study period, with significant decreases in otitis by S. pneumoniae and by H. influenzae, but no decreases for mixed S. pneumoniae/H. influenzae infections. Concordance between species in nasopharynx and MEF was found in 58.3% of cases, with maximal rates for S. pyogenes (71.8%), and with identical pneumococcal serotype in 40.5% of cases. Most patients (66.6%) had past episodes. PCV13 serotypes were significantly more frequent in first episodes, in otitis by S. pneumoniae as single agent, and among MEF than nasopharyngeal isolates. All non-PCV13 serotypes separately accounted for <5% in MEF. Up to 73.9% children had received ≥1 dose of PCV, with lower carriage of PCV13 serotypes than among non-vaccinated children. Pooling pneumococcal isolates from MEF and nasopharynx, 30% were multidrug resistant, primarily belonging to serotypes 19A [29.8%], 24A [14.3%], 19F [8.3%] and 15A [6.0%]. Our results suggest that increasing PCV13 vaccination would

Epidemiology of Otitis Media with Spontaneous Perforation of the Tympanic Membrane in Young Children and Association with Bacterial Nasopharyngeal Carriage, Recurrences and Pneumococcal Vaccination in Catalonia, Spain - The Prospective HERMES Study.

Directory of Open Access Journals (Sweden)

Robert Cilveti

Full Text Available The Epidemiology of otitis media with spontaneous perforation of the tympanic membrane and associated nasopharyngeal carriage of bacterial otopathogens was analysed in a county in Catalonia (Spain with pneumococcal conjugate vaccines (PCVs not included in the immunization programme at study time. A prospective, multicentre study was performed in 10 primary care centres and 2 hospitals (June 2011-June 2014, including all otherwise healthy children ≥2 months ≤8 years with otitis media presenting spontaneous tympanic perforation within 48h. Up to 521 otitis episodes in 487 children were included, showing by culture/PCR in middle ear fluid (MEF: Haemophilus influenzae [24.2%], both Streptococcus pneumoniae and H. influenzae [24.0%], S. pneumoniae [15.9%], Streptococcus pyogenes [13.6%], and Staphylococcus aureus [6.7%]. Culture-negative/PCR-positive otitis accounted for 31.3% (S. pneumoniae, 30.2% (H. influenzae and 89.6% (mixed S. pneumoniae/H. influenzae infections. Overall, incidence decreased over the 3-year study period, with significant decreases in otitis by S. pneumoniae and by H. influenzae, but no decreases for mixed S. pneumoniae/H. influenzae infections. Concordance between species in nasopharynx and MEF was found in 58.3% of cases, with maximal rates for S. pyogenes (71.8%, and with identical pneumococcal serotype in 40.5% of cases. Most patients (66.6% had past episodes. PCV13 serotypes were significantly more frequent in first episodes, in otitis by S. pneumoniae as single agent, and among MEF than nasopharyngeal isolates. All non-PCV13 serotypes separately accounted for <5% in MEF. Up to 73.9% children had received ≥1 dose of PCV, with lower carriage of PCV13 serotypes than among non-vaccinated children. Pooling pneumococcal isolates from MEF and nasopharynx, 30% were multidrug resistant, primarily belonging to serotypes 19A [29.8%], 24A [14.3%], 19F [8.3%] and 15A [6.0%]. Our results suggest that increasing PCV13 vaccination

Human Streptococcus agalactiae strains in aquatic mammals and fish

Science.gov (United States)

2013-01-01

Background In humans, Streptococcus agalactiae or group B streptococcus (GBS) is a frequent coloniser of the rectovaginal tract, a major cause of neonatal infectious disease and an emerging cause of disease in non-pregnant adults. In addition, Streptococcus agalactiae causes invasive disease in fish, compromising food security and posing a zoonotic hazard. We studied the molecular epidemiology of S. agalactiae in fish and other aquatic species to assess potential for pathogen transmission between aquatic species and humans. Methods Isolates from fish (n = 26), seals (n = 6), a dolphin and a frog were characterized by pulsed-field gel electrophoresis, multilocus sequence typing and standardized 3-set genotyping, i.e. molecular serotyping and profiling of surface protein genes and mobile genetic elements. Results Four subpopulations of S. agalactiae were identified among aquatic isolates. Sequence type (ST) 283 serotype III-4 and its novel single locus variant ST491 were detected in fish from Southeast Asia and shared a 3-set genotype identical to that of an emerging ST283 clone associated with invasive disease of adult humans in Asia. The human pathogenic strain ST7 serotype Ia was also detected in fish from Asia. ST23 serotype Ia, a subpopulation that is normally associated with human carriage, was found in all grey seals, suggesting that human effluent may contribute to microbial pollution of surface water and exposure of sea mammals to human pathogens. The final subpopulation consisted of non-haemolytic ST260 and ST261 serotype Ib isolates, which belong to a fish-associated clonal complex that has never been reported from humans. Conclusions The apparent association of the four subpopulations of S. agalactiae with specific groups of host species suggests that some strains of aquatic S. agalactiae may present a zoonotic or anthroponotic hazard. Furthermore, it provides a rational framework for exploration of pathogenesis and host-associated genome content of S

[Legionella pneumonia after the use of CPAP equipment].

Science.gov (United States)

Stolk, Jaap M; Russcher, Anne; van Elzakker, Erika P M; Schippers, Emile F

2016-01-01

Continuous positive airway pressure (CPAP) equipment can be colonised by Legionellae and might cause Legionella pneumonia in the user. However, there is no reported case of Legionella pneumonia related to CPAP equipment in which an identical Legionella was found in both the patient and the CPAP equipment. A 51-year-old man came to the Emergency Department with fever, confusion and dyspnoea that had been present for 3 days. His medical history included obstructive sleep apnoea, for which he had been using CPAP therapy at home for 10 weeks. The CPAP equipment showed signs of poor maintenance. Chest X-ray revealed a pulmonary consolidation. Laboratory investigation resulted in a positive urine antigen test for Legionella. Water from the CPAP equipment and sputum from the patient revealed Legionella pneumophila. Serotyping and sequence-based typing showed an identical L. pneumophila serotype 1 ST37. It is important to be aware that CPAP equipment can be colonised with Legionellae and might cause Legionella pneumonia. It is therefore necessary to ask about CPAP therapy in a patient with community-acquired pneumonia.

Structural conservation, variability, and immunogenicity of the T6 backbone pilin of serotype M6 Streptococcus pyogenes.

Science.gov (United States)

Young, Paul G; Moreland, Nicole J; Loh, Jacelyn M; Bell, Anita; Atatoa Carr, Polly; Proft, Thomas; Baker, Edward N

2014-07-01

Group A streptococcus (GAS; Streptococcus pyogenes) is a Gram-positive human pathogen that causes a broad range of diseases ranging from acute pharyngitis to the poststreptococcal sequelae of acute rheumatic fever. GAS pili are highly diverse, long protein polymers that extend from the cell surface. They have multiple roles in infection and are promising candidates for vaccine development. This study describes the structure of the T6 backbone pilin (BP; Lancefield T-antigen) from the important M6 serotype. The structure reveals a modular arrangement of three tandem immunoglobulin-like domains, two with internal isopeptide bonds. The T6 pilin lysine, essential for polymerization, is located in a novel VAKS motif that is structurally homologous to the canonical YPKN pilin lysine in other three- and four-domain Gram-positive pilins. The T6 structure also highlights a conserved pilin core whose surface is decorated with highly variable loops and extensions. Comparison to other Gram-positive BPs shows that many of the largest variable extensions are found in conserved locations. Studies with sera from patients diagnosed with GAS-associated acute rheumatic fever showed that each of the three T6 domains, and the largest of the variable extensions (V8), are targeted by IgG during infection in vivo. Although the GAS BP show large variations in size and sequence, the modular nature of the pilus proteins revealed by the T6 structure may aid the future design of a pilus-based vaccine. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Carriage and serotype distribution of Streptococcus agalactiae in third trimester pregnancy in southern Ghana

DEFF Research Database (Denmark)

Slotved, Hans-Christian; Dayie, Nicholas T K D; Banini, Josephine A N

2017-01-01

was performed on a single subcultured colony. Gram staining was performed, and isolates were evaluated for beta-haemolytic reactions. Furthermore, the isolates were serotyped using the GBS latex serotyping kit. RESULTS: The carriage rates were found to be 25.5% (95% CI: 19.6-32.1) to 28.0% (95% CI: 21...... of this study revealed that prevalence of GBS colonization in pregnant women in Greater Accra region is high and comparable to rates observed in South Africa and Western countries. The most prevalent serotypes were serotypes VII and IX, which have not been observed before in West Africa....

Effect of vaccines on bacterial meningitis worldwide

NARCIS (Netherlands)

McIntyre, Peter B.; O'Brien, Katherine L.; Greenwood, Brian; van de Beek, Diederik

2012-01-01

Three bacteria-Haemophilus influenzae, Streptococcus pneumoniae, and Neisseria meningitidis-account for most acute bacterial meningitis. Measurement of the effect of protein-polysaccharide conjugate vaccines is most reliable for H influenzae meningitis because one serotype and one age group account

Dynamics of Streptococcus pneumoniae serotypes causing acute otitis media isolated from children with spontaneous middle-ear drainage over a 12-year period (1999-2010 in a region of northern Spain.

Directory of Open Access Journals (Sweden)

Marta Alonso

Full Text Available The aim of this study was to determine the serotype and clonal distribution of pneumococci causing acute otitis media (AOM and their relationship with recurrences and mixed infections with other microorganisms under the influence of the 7-valent pneumococcal conjugate vaccine (PCV7. To do this, all pneumococcal isolates collected from the spontaneous middle-ear drainage of children <5 years old diagnosed of AOM by their pediatrician or their general practitioner from 1999 to 2010 were phenotypically characterized and the most frequent serotypes were genotyped. In the 12-year study, 818 episodes of pneumococcal AOM were detected, mostly (70.5% in children younger than 2 years old. In 262 episodes (32%, the pneumococci were isolated with another bacterium, mainly (n=214 Haemophilus influenzae. Mixed infections were similar in children under or over 2 years old. The most frequent serotypes were 19A (n=227, 27.8%, 3 (n=92, 11.2% and 19F (n=74, 9%. Serotypes included in the PCV7 sharply decreased from 62.4% in the pre-vaccination (1999-2001 to 2.2% in the late post-vaccination period (2008-2010. Serotype diversity steadily increased after the introduction of the PCV7 but decreased from 2008-2010 due to the predominant role of serotype 19A isolates, mostly ST276 and ST320. The prevalence of serotype 3 doubled from 6.1% (20/326 in 1999-2004 to 14.6% (72/492 in 2005-2010. Relapses mainly occurred in male infants infected with isolates with diminished antimicrobial susceptibility. Reinfections caused by isolates with the same serotype but different genotype were frequent, highlighting the need for genetic studies to differentiate among similar strains. In conclusion, the main change in pneumococcal AOM observed after the introduction of the PCV7 was the sharp decrease in vaccine serotypes. Also notable was the high burden of serotype 19A in total pneumococcal AOM before and especially after the introduction of the PCV7, as well as in relapses and

Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response trhough Toll-like receptors 2, 4, and 9 in species-specific patterns

DEFF Research Database (Denmark)

Mogensen, T.H.; Paludan, Søren Riis; Kilian, Mogens

2006-01-01

activation by live bacteria. Here, we demonstrate that live Streptococcus pneumoniae, Haemophilus influenzae type b, and Neisseria meningitidis, the three principal causes of bacterial meningitis, use distinct sets of TLRs to trigger the inflammatory response. Using human embryonic kidney 293 cell lines......, each overexpressing one type of TLR, we found that S. pneumoniae triggered activation of the transcription factor nuclear factor-kappaB and expression of interleukin-8, only in cells expressing TLR2 or -9. The same response was evoked by H. influenzae in cells expressing TLR2 or -4 and by N...... and confirmed the essential role of these TLRs and also identified differential functions of TLRs in activation of the inflammatory response. Collectively, we here demonstrate that S. pneumoniae, H. influenzae, and N. meningitidis each activate several TLRs in species-specific patterns and show that infection...

Risk for Death among Children with Pneumonia, Afghanistan.

Science.gov (United States)

Zabihullah, Rahmani; Dhoubhadel, Bhim G; Rauf, Ferogh A; Shafiq, Sahab A; Suzuki, Motoi; Watanabe, Kiwao; Yoshida, Lay M; Yasunami, Michio; Zabihullah, Salihi; Parry, Christopher M; Mirwais, Rabi; Ariyoshi, Koya

2017-08-01

In Afghanistan, childhood deaths from pneumonia are high. Among 639 children at 1 hospital, the case-fatality rate was 12.1%, and 46.8% of pneumococcal serotypes detected were covered by the 13-valent vaccine. Most deaths occurred within 2 days of hospitalization; newborns and malnourished children were at risk. Vaccination could reduce pneumonia and deaths.

Natural Genetic Transformation Generates a Population of Merodiploids in Streptococcus pneumoniae

Science.gov (United States)

Zomer, Aldert; Bootsma, Hester J.; Prudhomme, Marc; Granadel, Chantal; Hermans, Peter W. M.; Polard, Patrice; Martin, Bernard; Claverys, Jean-Pierre

2013-01-01

Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R) corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ∼3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD) formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ∼100 to ∼900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA). We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of merodiploids by

Natural genetic transformation generates a population of merodiploids in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Calum Johnston

Full Text Available Partial duplication of genetic material is prevalent in eukaryotes and provides potential for evolution of new traits. Prokaryotes, which are generally haploid in nature, can evolve new genes by partial chromosome duplication, known as merodiploidy. Little is known about merodiploid formation during genetic exchange processes, although merodiploids have been serendipitously observed in early studies of bacterial transformation. Natural bacterial transformation involves internalization of exogenous donor DNA and its subsequent integration into the recipient genome by homology. It contributes to the remarkable plasticity of the human pathogen Streptococcus pneumoniae through intra and interspecies genetic exchange. We report that lethal cassette transformation produced merodiploids possessing both intact and cassette-inactivated copies of the essential target gene, bordered by repeats (R corresponding to incomplete copies of IS861. We show that merodiploidy is transiently stimulated by transformation, and only requires uptake of a ~3-kb DNA fragment partly repeated in the chromosome. We propose and validate a model for merodiploid formation, providing evidence that tandem-duplication (TD formation involves unequal crossing-over resulting from alternative pairing and interchromatid integration of R. This unequal crossing-over produces a chromosome dimer, resolution of which generates a chromosome with the TD and an abortive chromosome lacking the duplicated region. We document occurrence of TDs ranging from ~100 to ~900 kb in size at various chromosomal locations, including by self-transformation (transformation with recipient chromosomal DNA. We show that self-transformation produces a population containing many different merodiploid cells. Merodiploidy provides opportunities for evolution of new genetic traits via alteration of duplicated genes, unrestricted by functional selective pressure. Transient stimulation of a varied population of

Streptococcus pneumoniae biofilm formation and dispersion during colonization and disease

Science.gov (United States)

Chao, Yashuan; Marks, Laura R.; Pettigrew, Melinda M.; Hakansson, Anders P.

2015-01-01

Streptococcus pneumoniae (the pneumococcus) is a common colonizer of the human nasopharynx. Despite a low rate of invasive disease, the high prevalence of colonization results in millions of infections and over one million deaths per year, mostly in individuals under the age of 5 and the elderly. Colonizing pneumococci form well-organized biofilm communities in the nasopharyngeal environment, but the specific role of biofilms and their interaction with the host during colonization and disease is not yet clear. Pneumococci in biofilms are highly resistant to antimicrobial agents and this phenotype can be recapitulated when pneumococci are grown on respiratory epithelial cells under conditions found in the nasopharyngeal environment. Pneumococcal biofilms display lower levels of virulence in vivo and provide an optimal environment for increased genetic exchange both in vitro and in vivo, with increased natural transformation seen during co-colonization with multiple strains. Biofilms have also been detected on mucosal surfaces during pneumonia and middle ear infection, although the role of these biofilms in the disease process is debated. Recent studies have shown that changes in the nasopharyngeal environment caused by concomitant virus infection, changes in the microflora, inflammation, or other host assaults trigger active release of pneumococci from biofilms. These dispersed bacteria have distinct phenotypic properties and transcriptional profiles different from both biofilm and broth-grown, planktonic bacteria, resulting in a significantly increased virulence in vivo. In this review we discuss the properties of pneumococcal biofilms, the role of biofilm formation during pneumococcal colonization, including their propensity for increased ability to exchange genetic material, as well as mechanisms involved in transition from asymptomatic biofilm colonization to dissemination and disease of otherwise sterile sites. Greater understanding of pneumococcal biofilm

Virulence-associated gene profiling of Streptococcus suis isolates by PCR

NARCIS (Netherlands)

Silva, L.M.G.; Baums, C.G.; Rehm, T.; Wisselink, H.J.; Goethe, R.; Valentin-Weigand, P.

2006-01-01

Definition of virulent Streptococcus suis strains is controversial. One successful approach for identification of virulent European strains is differentiation of capsular serotypes (or the corresponding cps types) and subsequent detection of virulence-associated factors, namely the extracellular

Nasopharyngeal Carriage of Streptococcus Pneumoniae and Serotypes Indentified among Nursing Home Residents in Comparison to the Elderly and Patients Younger than 65 Years Living in Domestic Environment.

Science.gov (United States)

Kolšek-Šušteršič, Maja; Beg Krasnič, Andreja; Mioč, Verica; Paragi, Metka; Rifel, Janez

2017-09-01

In Slovenia, there is little data available on pneumococcal vaccination rates and no data on asymptomatic NPCR and serotypes in the population of nursing home residents in comparison to the elderly living in domestic environment, therefore the goal was to gain these data. A cross sectional epidemiological study was performed. Nasopharyngeal swabs from 151 nursing home residents, 150 elderly living in domestic environment, and 38 adults less than 65 years old were collected twice (in two consecutive years). The swabs were analysed for pneumococcal identification and serotyping. Patient data were collected from medical files and medical history. No statistically significant differences in NPCR were seen between compared groups in two consecutive years. An average NPCR in two consecutive years in nursing home residents was 1.45%, in the elderly living in domestic environment 0.85%, and in adults less than 65 years old 7.05%. Serotypes identified among nursing home residents were 6B and 9N, among the group of elderly living in domestic environment, 6A and among adults less than 65 years old, 35F, 18C and 3. Pneumococcal vaccination rates were low (3.3% in nursing home residents, 6% in the elderly from domestic environment and 0% in the group of adults less than 65 years old). Our data suggests that NPCR and the proportion of people vaccinated with pneumococcal vaccine among the elderly are low. We identified different serotypes in all groups, only one person was a chronic carrier (serotype 35F).

Age-dependent prevalence of nasopharyngeal carriage of streptococcus pneumoniae before conjugate vaccine introduction: a prediction model based on a meta-analysis.

Science.gov (United States)

Le Polain de Waroux, Olivier; Flasche, Stefan; Prieto-Merino, David; Edmunds, W John

2014-01-01

Data on the prevalence of nasopharyngeal carriage of S.pneumoniae in all age groups are important to help predict the impact of introducing pneumococcal conjugate vaccines (PCV) into routine infant immunization, given the important indirect effect of the vaccine. Yet most carriage studies are limited to children under five years of age. We here explore the association between carriage prevalence and serotype distribution in children aged ≥5 years and in adults compared to children. We conducted a systematic review of studies providing carriage estimates across age groups in healthy populations not previously exposed to PCV, using MEDLINE and Embase. We used Bayesian linear meta-regression models to predict the overall carriage prevalence as well as the prevalence and distribution of vaccine and nonvaccine type (VT and NVT) serotypes in older age groups as a function of that in linear association between the carriage prevalence in pre-school childen (<5 y) and both that in school aged children (5-17 y olds) and in adults. The proportion of VT serotypes isolated from carriers was consistently lower in older age groups and on average about 73% that of children <5 y among 5-17 y olds and adults respectively. We provide a prediction model to infer the carriage prevalence and serotype distribution in 5-17 y olds and adults as a function of that in children <5 years of age. Such predictions are helpful for assessing the potential population-wide effects of vaccination programmes, e.g. via transmission models, and thus assist in the design of future pneumococcal conjugate vaccination strategies.

Colonização e resistência antimicrobiana de Streptococcus pneumoniae isolado em nasofaringe de crianças com rinofaringite aguda Nasopharyngeal colonization and antimicrobial resistance of Streptococcus pneumoniae isolated in children with acute rinofaringitis

Directory of Open Access Journals (Sweden)

Lêda Lúcia M. Ferreira

2001-06-01

ças com infecção respiratória alta podem ser usados na vigilância da resistência antimicrobiana numa determinada comunidade.OBJECTIVE: to determine the prevalence and risk factors for nasopharyngeal colonization by, and to evaluate antimicrobial susceptibility of Streptococcus pneumoniae strains in children with acute rhinopharyngitis. METHODS: we collected nasopharyngeal swab specimens from 400 children aged 3 months to 5 years and with clinical status of acute rhinopharyngitis from June 16, 1997 to May 20, 1998 at the outpatient clinics of two hospitals in the city of São Paulo. Nasopharyngeal specimens were collected pernasally using a calcium alginate swab and plated immediately after collection onto trypticose soy agar with 5% sheep blood and garamicin 5 mcg/ml. Penicillin susceptibility was determined by oxacillin 1 mcg disk screening test and the minimal inhibitory concentration by the E-test. RESULTS: Pneumococci were recovered from 139 children, indicating a colonization prevalence of 35%. The risk factors analyzed indicated that the colonization was more prevalent in children attending day-care centers, children with siblings younger than 5 years, and children with recent use of antimicrobial agents. The prevalence of penicillin non-susceptible strains was of 16 % (20 strains. All strains were intermediately resistant (0.1mcg/ ml < MIC < 1.0 mcg/ ml. Out of the penicillin intermediately resistant strains, 7 (37% showed intermediate resistance to cotrimoxazol and 2 (11% full resistance to trimethoprim-sulfamethoxazole. No strains were resistant to ceftriaxone, amoxicillin, clarithromicin, or chloramphenicol. CONCLUSIONS: our findings indicate that the prevalence of nasopharyngeal colonization by Streptococcus pneumoniae in children with upper respiratory infections was of 34.8%. Children attending day-care centers and children with younger siblings showed higher levels of colonization The results of prevalence of bacterial resistance were similar to those

Antimicrobial resistance in Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis and group A beta-haemolytic streptococci in 2002-2003. Results of the multinational GRASP Surveillance Program

DEFF Research Database (Denmark)

Beekmann, Susan E; Heilmann, Kris P; Richter, Sandra S

2005-01-01

A multinational surveillance study, GRASP, was conducted between November 2002 and April 2003 with the aim of assessing rates of antimicrobial resistance among 2656 isolates of Streptococcus pneumoniae, 2486 isolates of group A beta-haemolytic streptococci, 1358 isolates of Haemophilus influenzae...... and 1047 of Moraxella catarrhalis from 20 countries in Europe, eastern Asia and southern Africa. Conspicuous differences between various countries were noted in the S. pneumoniae resistance rates observed for penicillin (0-79.2%) and erythromycin (4-66%), along with other antimicrobials. The percentage...... of MDR strains was above 25% in 8 of the 20 countries studied. Group A streptococcal macrolide resistance rates ranged from 0% to 35% by country, while rates of beta-lactamase production ranged from 0% to 39% for H. influenzae and 80-100% for M. catarrhalis. Antibiotic resistance in S. pneumoniae remains...

Streptococcus pneumoniae bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome.

Science.gov (United States)

Yii, Irene Yuen Lin; Tan, Jamie Bee Xian; Fong, Warren Weng Seng

2016-10-01

Invasive pneumococcal disease is an uncommon and notifiable disease in Singapore. It is often associated with significant morbidity and mortality. We report a rare case of invasive pneumococcal bacteraemia due to parotitis in a patient with systemic sclerosis and secondary Sjögren's syndrome. We also present a retrospective review of Streptococcus pneumoniae bacteraemia cases in Singapore General Hospital from January 2011 to April 2016. A 59-year-old Malay lady with a history of systemic sclerosis with secondary Sjögren's syndrome presented with fever and left parotid gland swelling. Clinical examination revealed poor salivary pooling and left parotid swelling without fluctuance. Ultrasound of the left parotid gland confirmed acute parotitis without evidence of abscess or sialolithiasis. Blood cultures were positive for S. pneumoniae . She was diagnosed to have invasive pneumococcal bacteraemia secondary to acute parotitis, and treated with intravenous benzylpenicillin with clearance of bacteraemia after 3 days. Upon discharge, her antibiotics were changed to intravenous ceftriaxone to facilitate outpatient parenteral antibiotic therapy for another 2 weeks. She responded favourably to antibiotics at follow-up, with no complications from the bacteraemia. A review of the microbiological records of the Singapore General Hospital revealed 116 cases of pneumococcal bacteraemia, most (80.3 %) of which were due to pneumonia. None were due to parotitis. S. pneumoniae parotitis and subsequent bacteraemia is rare. Prompt recognition of the disease and appropriate use of antibiotics are important. This case highlights that close communication between healthcare workers (microbiologist, rheumatologist and infectious disease specialist) is essential in ensuring good clinical outcomes in patients with a potentially fatal disease.

Methylation of 23S rRNA nucleotide G748 by RlmAII methyltransferase renders Streptococcus pneumoniae telithromycin susceptible.

Science.gov (United States)

Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko

2013-08-01

Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.

Capsular Sialyltransferase Specificity Mediates Different Phenotypes in Streptococcus suis and Group B Streptococcus

Directory of Open Access Journals (Sweden)

David Roy

2018-04-01

Full Text Available The capsular polysaccharide (CPS represents a key virulence factor for most encapsulated streptococci. Streptococcus suis and Group B Streptococcus (GBS are both well-encapsulated pathogens of clinical importance in veterinary and/or human medicine and responsible for invasive systemic diseases. S. suis and GBS are the only Gram-positive bacteria which express a sialylated CPS at their surface. An important difference between these two sialylated CPSs is the linkage between the side-chain terminal galactose and sialic acid, being α-2,6 for S. suis but α-2,3 for GBS. It is still unclear how sialic acid may affect CPS production and, consequently, the pathogenesis of the disease caused by these two bacterial pathogens. Here, we investigated the role of sialic acid and the putative effect of sialic acid linkage modification in CPS synthesis using inter-species allelic exchange mutagenesis. To this aim, a new molecular biogenetic approach to express CPS with modified sialic acid linkage was developed. We showed that sialic acid (and its α-2,6 linkage is crucial for S. suis CPS synthesis, whereas for GBS, CPS synthesis may occur in presence of an α-2,6 sialyltransferase or in absence of sialic acid moiety. To evaluate the effect of the CPS composition/structure on sialyltransferase activity, two distinct capsular serotypes within each bacterial species were compared (S. suis serotypes 2 and 14 and GBS serotypes III and V. It was demonstrated that the observed differences in sialyltransferase activity and specificity between S. suis and GBS were serotype unrestricted. This is the first time that a study investigates the interspecies exchange of capsular sialyltransferase genes in Gram-positive bacteria. The obtained mutants represent novel tools that could be used to further investigate the immunomodulatory properties of sialylated CPSs. Finally, in spite of common CPS structural characteristics and similarities in the cps loci, sialic acid exerts

Isolation of Streptococcus tigurinus - a novel member of Streptococcus mitis group from a case of periodontitis.

Science.gov (United States)

Dhotre, Shree V; Mehetre, Gajanan T; Dharne, Mahesh S; Suryawanshi, Namdev M; Nagoba, Basavraj S

2014-08-01

Streptococcus tigurinus is a new member of the Streptococcus viridians group and is closely related to Streptococcus mitis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae, Streptococcus oralis, and Streptococcus infantis. The type strain AZ_3a(T) of S. tigurinus was originally isolated from a patient with infective endocarditis. Accurate identification of S. tigurinus is facilitated only by newer molecular methods like 16S rRNA gene analysis. During the course of study on bacteraemia and infective endocarditis with reference to periodontitis and viridians group of streptococci, a strain of S. tigurinus isolated from subgingival plaque of a patient with periodontitis identified by 16S rRNA gene analysis, which was originally identified as Streptococcus pluranimalium by Vitek 2. Confirmation by 16S rRNA gene analysis showed 99.39% similarity (1476/1485 bp) with S. tigurinus AZ_3a(T) (AORU01000002). To the best of our knowledge, this is the first report of isolation of S. tigurinus from the oral cavity of a periodontitis patient. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Características laboratoriais das ceratites e conjuntivites causadas por Streptococcus sp Laboratorial findings of Streptococcus keratitis and conjunctivitis

Directory of Open Access Journals (Sweden)

Helena Parente Solari

2004-10-01

Full Text Available OBJETIVOS: Analisar os resultados laboratoriais de conjuntivites e ceratites com cultura positiva para Streptococcus sp, avaliando a incidência das diferentes espécies e os dados dos antibiogramas. MÉTODOS: Estudo retrospectivo de revisão de prontuários de pacientes encaminhados ao laboratório de Doenças Externas do Departamento de Oftalmologia da UNIFESP com resultado de cultivo bacteriano positivo de córnea ou conjuntiva e com identificação de alguma cepa do gênero Streptococcus sp, no período de janeiro de 1995 a dezembro de 2001. Analisou-se idade do paciente, espécie de Streptococcus e os testes de sensibilidade aos seguintes antibióticos: cefalotina, amicacina, gentamicina, tobramicina, ciprofloxacina, lomefloxacina, ofloxacina, norfloxacina e vancomicina. RESULTADOS: As espécies mais encontradas foram Streptococcus pneumoniae e Streptococcus viridans. Com relação aos antibióticos, a sensibilidade foi maior à cefalotina, às quinolonas e à vancomicina. CONCLUSÕES: Considerando-se os antibióticos tópicos comercialmente disponíveis, as quinolonas apresentam melhor espectro de ação quando comparadas aos aminoglicosídios.PURPOSE: To evaluate laboratorial findings of Streptococcus keratitis and conjunctivitis, analyzing the different species and the results of bacterial susceptibility to an antibiotics. METHODS: Retrospective study of the records from the External Disease Laboratory of the Ophthalmology Department of the Federal University of São Paulo, with conjunctival or corneal positive bacterial culture for Streptococcus sp, between January 1995 and December 2001. The collected data were age, Streptococcus species and the bacterial susceptibility to the following antibiotics: cephalotin, amikacin, gentamicin, tobramicin, ciprofloxacin, lomefloxacin, ofloxacin, norfloxacin and vancomicin. RESULTS: The most frequent species were Streptococcus pneumoniae and Streptococcus viridans. Regarding bacterial

Competence in Streptococcus pneumoniae is regulated by the rate of ribosomal decoding errors.

Science.gov (United States)

Stevens, Kathleen E; Chang, Diana; Zwack, Erin E; Sebert, Michael E

2011-01-01

Competence for genetic transformation in Streptococcus pneumoniae develops in response to accumulation of a secreted peptide pheromone and was one of the initial examples of bacterial quorum sensing. Activation of this signaling system induces not only expression of the proteins required for transformation but also the production of cellular chaperones and proteases. We have shown here that activity of this pathway is sensitively responsive to changes in the accuracy of protein synthesis that are triggered by either mutations in ribosomal proteins or exposure to antibiotics. Increasing the error rate during ribosomal decoding promoted competence, while reducing the error rate below the baseline level repressed the development of both spontaneous and antibiotic-induced competence. This pattern of regulation was promoted by the bacterial HtrA serine protease. Analysis of strains with the htrA (S234A) catalytic site mutation showed that the proteolytic activity of HtrA selectively repressed competence when translational fidelity was high but not when accuracy was low. These findings redefine the pneumococcal competence pathway as a response to errors during protein synthesis. This response has the capacity to address the immediate challenge of misfolded proteins through production of chaperones and proteases and may also be able to address, through genetic exchange, upstream coding errors that cause intrinsic protein folding defects. The competence pathway may thereby represent a strategy for dealing with lesions that impair proper protein coding and for maintaining the coding integrity of the genome. The signaling pathway that governs competence in the human respiratory tract pathogen Streptococcus pneumoniae regulates both genetic transformation and the production of cellular chaperones and proteases. The current study shows that this pathway is sensitively controlled in response to changes in the accuracy of protein synthesis. Increasing the error rate during

Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of a family 101 glycoside hydrolase from Streptococcus pneumoniae

International Nuclear Information System (INIS)

Gregg, Katie J.; Boraston, Alisdair B.

2009-01-01

The catalytic module of a family 101 glycoside hydrolase from S. pneumoniae was cloned, recombinantly produced and crystallized. Streptococcus pneumoniae is a serious human pathogen that is responsible for a wide range of diseases including pneumonia, meningitis, septicaemia and otitis media. The full virulence of this bacterium is reliant on carbohydrate processing and metabolism, as revealed by biochemical and genetic studies. One carbohydrate-processing enzyme is a family 101 glycoside hydrolase (SpGH101) that is responsible for catalyzing the liberation of galactosyl β1,3-N-acetyl-d-galactosamine (Galβ1,3GalNAc) α-linked to serine or threonine residues of mucin-type glycoproteins. The 124 kDa catalytic module of this enzyme (SpGH101CM) was cloned and overproduced in Escherichia coli and purified. Crystals were obtained in space group P2 1 and diffracted to 2.0 Å resolution, with unit-cell parameters a = 81.86, b = 88.91, c = 88.77 Å, β = 112.46°. SpGH101CM also qualitatively displayed good activity towards the synthetic substrate p-nitrophenyl-2-acetamido-2-deoxy-3-O-(β-d-galactopyranosyl) -α-d-galactopyranoside, which is consistent with the classification of this enzyme as an endo-α-N-acetylgalactosaminidase

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

2010-12-03

Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased

Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

Directory of Open Access Journals (Sweden)

Welinder-Olsson Christina

2010-12-01

Full Text Available Abstract Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR for detection of S. pneumoniae (9802 gene fragment, H. influenzae (omp P6 gene and N. meningitidis (ctrA gene. The method was evaluated on bronchoalveolar lavage (BAL samples from 156 adults with lower respiratory tract infection (LRTI and 31 controls, and on 87 cerebrospinal fluid (CSF samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both

Evaluación de un medio para la conservación de Streptococcus pneumoniae a partir de muestras nasofaríngeas

Directory of Open Access Journals (Sweden)

Nacxiry Fonseca

2000-09-01

Full Text Available La Organización Mundial de la Salud (OMS llegó a un consenso. en 1998, acerca de la metodologia general para el estudio de portadores de Streptococcus pneumoniae Esta metodología incluía un nuevo medio para el transporte y el almacenamiento de muestras nasofaringeas, compuesto portriptona, glucosa, glicerol y leche descremada, denominado STGG. Este medio fue evaluado oor nuestro laboratorio, en marzo de 1999. en un grupo de 15 niños menores de 5 años asistentes a una guarderia de Bogotá. Se les tomó una muestia nasofaringea que se colocó en el medio STGG y, posteriormente, se valoró el crecimiento de S. pneumoniae en cuatro momentos diferentes: 0, 5 , 10 y 30 días después de la toma de la muestra. La recuperación inicial de S. pneumoniae fue de 73% (11/15. En todas las 11 muestras de las que se obtuvo un crecimiento inicial, fue posible recuperar S. pneumoniae en los diferentes tiempos de observación, aún en las muestras con crecimiento en un solo cuadrante. En el tiempo 0 y a los 30 días, 7 de las 11 muestras presentaron un crecimiento de abundante a moderado. Con los datos obtenidos, se logró demostrar que el medio STGG es capaz de mantener, a largo plazo, la viabilidad de S. pneumoniae en muestras nasofaringeas de niños portadores de este microorganismo.

Susceptibilidad a antimicrobianos en aislamientos de Streptococcus pneumoniae invasor en Colombia

Directory of Open Access Journals (Sweden)

Aura Lucía Leal

1999-03-01

Full Text Available Se realizó un estudio para determinar los patrones de susceptibilidad a los antimicrobianos de los aislamientos de Streptococcus pneumoniae causante de enfermedad invasora diagnosticada en Colombia en niños menores de 5 años entre 1994 y 1996 y para establecer la distribución de los tipos capsulares de los aislamientos resistentes. Se analizaron 324 aislamientos recuperados durante la ejecución del Protocolo Nacional de Serotipificación de S. pneumoniae realizado en Santa Fe de Bogotá, Medellín y Cali, Colombia, entre julio de 1994 y marzo de 1996. Se observó que 119 de todos los aislamientos (36,7% presentaban susceptibilidad disminuida por lo menos a un antimicrobiano, que 39 (12% presentaban susceptibilidad disminuida a la penicilina y que de estos últimos aislamientos, 29 presentaban resistencia intermedia y 10 resistencia alta. Nueve aislamientos (2,8% presentaban resistencia a la ceftriaxona, 80 (24,7% a la combinación de trimetoprima y sulfametoxazol (TMS, 49 (15,1% al cloranfenicol y 31 (9,6% a la eritromicina. Se observó resistencia a dos antimicrobianos en 31 aislamientos (9,6% y multirresistencia en 22 (6,7%. Estos 22 aislamientos mostraron resistencia al TMS. Las asociaciones más frecuentes fueron penicilina, TMS y eritromicina en 5 casos; penicilina, cloranfenicol, TMS y eritromicina en 4; penicilina, ceftriaxona, cloranfenicol y TMS en 3; y penicilina, ceftriaxona, cloranfenicol, TMS y eritromicina en 3 casos. Los serotipos más frecuentes en los aislamientos resistentes a la penicilina fueron: 23F (53,8%, 14 (25,6%, 6B (7,7%, 9V (5,1%, 19F (5,1% y 34 (2,6%. Los serotipos más frecuentes en los aislamientos resistentes a antimicrobianos distintos de la penicilina fueron: 5 (37,5%, 23F (7,5%, 14 (18,8% y 6B (13,8%. Esta diferencia en la distribución de los serotipos fue estadísticamente significativa (P < 0,0001. Los resultados de este estudio indican la necesidad de mantener una vigilancia activa de los patrones de

Radiographic features of Mycoplasma pneumoniae pneumonia: differential diagnosis and performance timing

International Nuclear Information System (INIS)

Miyashita, Naoyuki; Sugiu, Tadaaki; Kawai, Yasuhiro; Oda, Keiko; Yamaguchi, Tetsuya; Ouchi, Kazunobu; Kobashi, Yoshihiro; Oka, Mikio

2009-01-01

The Japanese Respiratory Society guidelines propose a differential diagnosis for atypical pneumonia and bacterial pneumonia using a scoring system for the selection of appropriate antibiotic. In order to improve this scoring system, the guidelines are seeking new specific parameter. The purpose of this study was to clarify the pattern of abnormalities with Mycoplasma pneumoniae pneumonia on chest computed tomography (CT) and whether the radiographic findings could distinguish M. pneumoniae pneumonia from Streptococcus pneumoniae pneumonia. A retrospective review was performed of the CT findings of 64 cases and 68 cases where M. pneumoniae and S. pneumoniae, respectively, were the only pathogen identified by the panel of diagnostic tests used. Of the 64 patients with M. pneumoniae pneumonia, bronchial wall thickening was observed most frequently (81%), followed by centrilobular nodules (78%), ground-glass attenuation (78%), and consolidation (61%). Bronchial wall thickening and centrilobular nodules were observed more often in M. pneumoniae patients than in S. pneumoniae patients (p < 0.0001). The presence of bilateral bronchial wall thickening or centrilobular nodules was only seen in patients with M. pneumoniae pneumonia. Using the scoring system of the Japanese Respiratory Society guidelines and chest CT findings, 97% of M. pneumoniae patients were suspected to be M. pneumoniae pneumonia without serology. When comparing the CT findings between early stage and progressed stage in the same patients with severe pneumonia, the radiographic features of early stage M. pneumoniae pneumonia were not observed clearly in the progressed stage. The present results indicate that the diagnosis of M. pneumoniae pneumonia would appear to be reliable when found with a combination of bronchial wall thickening and centrilobular nodules in the CT findings. However, these CT findings are not observed in progressed severe M. pneumoniae pneumonia patients

Conservative sex and the benefits of transformation in Streptococcus pneumoniae.

Directory of Open Access Journals (Sweden)

Daniel J P Engelmoer

Full Text Available Natural transformation has significant effects on bacterial genome evolution, but the evolutionary factors maintaining this mode of bacterial sex remain uncertain. Transformation is hypothesized to have both positive and negative evolutionary effects on bacteria. It can facilitate adaptation by combining beneficial mutations into a single individual, or reduce the mutational load by exposing deleterious alleles to natural selection. Alternatively, it may expose transformed cells to damaged or otherwise mutated environmental DNA and is energetically expensive. Here, we examine the long-term effects of transformation in the naturally competent species Streptococcus pneumoniae by evolving populations of wild-type and competence-deficient strains in chemostats for 1000 generations. Half of these populations were exposed to periodic mild stress to examine context-dependent benefits of transformation. We find that competence reduces fitness gain under benign conditions; however, these costs are reduced in the presence of periodic stress. Using whole genome re-sequencing, we show that competent populations fix fewer new mutations and that competence prevents the emergence of mutators. Our results show that during evolution in benign conditions competence helps maintain genome stability but is evolutionary costly; however, during periods of stress this same conservativism enables cells to retain fitness in the face of new mutations, showing for the first time that the benefits of transformation are context dependent.

Epidemiological study on the penicillin resistance of clinical Streptococcus pneumoniae isolates identified as the common sequence types.

Science.gov (United States)

Gao, Wei; Shi, Wei; Chen, Chang-hui; Wen, De-nian; Tian, Jin; Yao, Kai-hu

2016-10-20

There were some limitation in the current interpretation about the penicillin resistance mechanism of clinical Streptococcus pneumoniae isolates at the strain level. To explore the possibilities of studying the mechanism based on the sequence types (ST) of this bacteria, 488 isolates collected in Beijing from 1997-2014 and 88 isolates collected in Youyang County, Chongqing and Zhongjiang County, Sichuan in 2015 were analyzed by penicillin minimum inhibitory concentration (MIC) distribution and annual distribution. The results showed that the penicillin MICs of the all isolates covering by the given ST in Beijing have a defined range, either penicillin MIC penicillin MICs in the first few years after it was identified. The penicillin MIC of isolates identified as common STs and collected in Youyang County, Chongqing and Sichuan Zhongjiang County, including the ST271, ST320 and ST81, was around 0.25~2 mg/L (≥0.25 mg/L). Our study revealed the epidemiological distribution of penicillin MICs of the given STs determined in clinical S. pneumoniae isolates, suggesting that it is reasonable to research the penicillin resistance mechanism based on the STs of this bacteria.

Monomicrobial necrotizing fasciitis in a white male caused by hypermucoviscous Klebsiella pneumoniae

DEFF Research Database (Denmark)

Gunnarsson, Gudjon L; Brandt, Pernille B; Gad, Dorte

2009-01-01

We report a case of monomicrobial necrotizing fasciitis caused by hypermucoviscous Klebsiella pneumoniae in an immunocompromised white male after travel to China. The K. pneumoniae isolate belonged to the K2 serotype, and carried the virulence factors RmpA and aerobactin. To the best of our...... knowledge this is the first report of necrotizing fasciitis caused by hypermucoviscous K. pneumoniae resembling the highly virulent K. pneumoniae isolates associated with liver abscess syndrome in Asia....

Survey of immunological features of the alpha-like proteins of Streptococcus agalactiae.

Science.gov (United States)

Maeland, Johan A; Afset, Jan E; Lyng, Randi V; Radtke, Andreas

2015-02-01

Nearly all Streptococcus agalactiae (group B streptococcus [GBS]) strains express a protein which belongs to the so-called alpha-like proteins (Alps), of which Cα, Alp1, Alp2, Alp3, Rib, and Alp4 are known to occur in GBS. The Alps are chimeras which form mosaic structures on the GBS surface. Both N- and C-terminal stretches of the Alps possess immunogenic sites of dissimilar immunological specificity. In this review, we have compiled data dealing with the specificity of the N- and C-terminal immunogenic sites of the Alps. The majority of N-terminal sites show protein specificity while the C-terminal sites show broader cross-reactivity. Molecular serotyping has revealed that antibody-based serotyping has often resulted in erroneous Alp identification, due to persistence of cross-reacting antibodies in antisera for serotyping. Retrospectively, this could be expected on the basis of sequence analysis results. Some of the historical R proteins are in fact Alps. The data included in the review may provide a basis for decisions regarding techniques for the preparation of specific antisera for serotyping of GBS, for use in other approaches in GBS research, and for decision making in the context of GBS vaccine developments. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Other age groups than children need to be considered as carriers of Streptococcal pneumoniae serotypes.

Science.gov (United States)

Slotved, Hans-Christian

2016-10-02

We need to raise the issue that focus on children as the only carriage group for pneumococci is not optimal; we need to consider that other age groups might also be carriers of pneumococcal serotypes causing invasive pneumococcal diseases (IPD) in unvaccinated age groups. The pneumococcal conjugate vaccines (PCV) have successfully removed IPD from vaccinated children. Studies have shown an effect of PCV reducing the pneumococcal carriage of PCV serotypes in children. The status for several countries having used PCV for many years is that they do not see PCV serotypes neither carried nor as a cause of IPD in children. PCV vaccination of children has shown a herd protection effect in unvaccinated groups as a reduction in IPD cases caused by PCV serotypes. However, not all PCV serotypes have disappeared as the cause of IPD in the unvaccinated age groups. The author therefore believes that if we are to see PCV serotypes disappear as a cause of IPD in unvaccinated age groups, we need to perform further carriage studies to examine carriage in other age groups. Alternatively, all age groups should be vaccinated against pneumococci to eliminate IPD caused by PCV serotypes from possible hidden carriers.

A Novel Function for the Streptococcus pneumoniae Aminopeptidase N: Inhibition of T Cell Effector Function through Regulation of TCR Signaling

Directory of Open Access Journals (Sweden)

Lance K. Blevins

2017-11-01

Full Text Available Streptococcus pneumoniae (Spn causes a variety of disease states including fatal bacterial pneumonia. Our previous finding that introduction of Spn into an animal with ongoing influenza virus infection resulted in a CD8+ T cell population with reduced effector function gave rise to the possibility of direct regulation by pneumococcal components. Here, we show that treatment of effector T cells with lysate derived from Spn resulted in inhibition of IFNγ and tumor necrosis factor α production as well as of cytolytic granule release. Spn aminopeptidase N (PepN was identified as the inhibitory bacterial component and surprisingly, this property was independent of the peptidase activity found in this family of proteins. Inhibitory activity was associated with reduced activation of ZAP-70, ERK1/2, c-Jun N-terminal kinase, and p38, demonstrating the ability of PepN to negatively regulate TCR signaling at multiple points in the cascade. These results reveal a novel immune regulatory function for a bacterial aminopeptidase.

Dalbavancin Activity When Tested against Streptococcus pneumoniae Isolated in Medical Centers on Six Continents (2011 to 2014).

Science.gov (United States)

Jones, Ronald N; Schuchert, Jason E; Mendes, Rodrigo E

2016-06-01

Dalbavancin, a novel lipoglycopeptide, was approved for use in 2014 by regulatory agencies in the United States and Europe for the treatment of skin and skin structure infections. The activity of dalbavancin was also widely assessed by determination of its activity against Streptococcus pneumoniae clinical isolates collected from patients on six continents monitored during two time intervals (2011 to 2013 and 2014). A total of 18,186 pneumococcal isolates were obtained from 49 nations and submitted to a monitoring laboratory as part of the SENTRY Antimicrobial Surveillance Program for reference susceptibility testing. The potency of dalbavancin against S. pneumoniae was consistent across the years that it was monitored, with the MIC50 and MIC90 being 0.015 and 0.03 μg/ml, respectively, and all isolates were inhibited by ≤0.12 μg/ml. The activity of dalbavancin was not adversely influenced by nonsusceptibility to β-lactams (ceftriaxone or penicillin), macrolides, clindamycin, fluoroquinolones, or tetracyclines or multidrug resistance (MDR). Regional variations in dalbavancin activity were not detected, but S. pneumoniae strains isolated in the Asia-Pacific region were more likely to be nonsusceptible to penicillin and ceftriaxone as well as to be MDR than strains isolated in North or South America and Europe. Direct comparisons of potency illustrated that dalbavancin (MIC50 and MIC90, 0.015 and 0.03 μg/ml, respectively) was 16-fold or more active than vancomycin (MIC50, 0.25 μg/ml), linezolid (MIC50, 1 μg/ml), levofloxacin (MIC50, 1 μg/ml), ceftriaxone (MIC90, 1 μg/ml), and penicillin (MIC90, 2 μg/ml). In conclusion, dalbavancin had potent and consistent activity against this contemporary (2011 to 2014) collection of S. pneumoniae isolates. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Chlamydia trachomatis serotype A infections in the Amazon region of Brazil: prevalence, entry and dissemination

Directory of Open Access Journals (Sweden)

Marluísa de Oliveira Guimarães Ishak

2015-04-01

Full Text Available INTRODUCTION: Chlamydia infection is associated with debilitating human diseases including trachoma, pneumonia, coronary heart disease and urogenital diseases. Serotypes of C. trachomatis show a fair correlation with the group of diseases they cause, and their distribution follows a well-described geographic pattern. Serotype A, a trachoma-associated strain, is known for its limited dissemination in the Middle East and Northern Africa. However, knowledge on the spread of bacteria from the genus Chlamydia as well as the distribution of serotypes in Brazil is quite limited. METHODS: Blood samples of 1,710 individuals from ten human population groups in the Amazon region of Brazil were examined for antibodies to Chlamydia using indirect immunofluorescence and microimmunofluorescence assays. RESULTS: The prevalence of antibodies to Chlamydia ranged from 23.9% (Wayana-Apalai to 90.7% (Awa-Guaja with a mean prevalence of 50.2%. Seroreactivity was detected to C. pneumoniae and to all serotypes of C. trachomatis tested; furthermore, we report clear evidence of the as-yet-undescribed occurrence of serotype A of C. trachomatis. CONCLUSIONS: Specific seroreactivity not only accounts for the large extent of dissemination of C. trachomatis in the Amazon region of Brazil but also shows an expanded area of occurrence of serotype A outside the epidemiological settings previously described. Furthermore, these data suggest possible routes of Chlamydia introduction into the Amazon region from the massive human migration that occurred during the 1,700s.

CD4+ T-cell Responses Among Adults and Young Children In Response to Streptococcus pneumoniae and Haemophilus influenzae Vaccine Candidate Protein Antigens

OpenAIRE

Sharma, Sharad K.; Roumanes, David; Almudevar, Anthony; Mosmann, Tim R.; Pichichero, Michael E.

2013-01-01

We characterized cytokine profiles of CD4+ T-helper (h) cells in adults and young children to ascertain if responses occur to next-generation candidate vaccine antigens PspA, PcpA, PhtD, PhtE, Ply, LytB of Streptococcus pneumonia (Spn) and Protein D and OMP26 of non-typeable Haemophilus influenzae (NTHi). Adults had vaccine antigen-specific Th1 - and Th2 cells responsive to all antigens evaluated whereas young children had significant numbers of vaccine antigen-specific CD4+ T cells producing...

Streptococcus agalactiae Serotype IV in Humans and Cattle, Northern Europe

DEFF Research Database (Denmark)

Lyhs, Ulrike; Kulkas, Laura; Katholm, Jorgen

2016-01-01

not differentiate between populations isolated from different host species. Isolates from humans and cattle differed in lactose fermentation, which is encoded on the accessory genome and represents an adaptation to the bovine mammary gland. Serotype IV-ST196 isolates were obtained from multiple dairy herds in both...

Evidence for Rare Capsular Switching in Streptococcus agalactiae▿

Science.gov (United States)

Martins, Elisabete Raquel; Melo-Cristino, José; Ramirez, Mário

2010-01-01

The polysaccharide capsule is a major antigenic factor in Streptococcus agalactiae (Lancefield group B streptococcus [GBS]). Previous observations suggest that exchange of capsular loci is likely to occur rather frequently in GBS, even though GBS is not known to be naturally transformable. We sought to identify and characterize putative capsular switching events, by means of a combination of phenotypic and genotypic methods, including pulsed-field gel electrophoretic profiling, multilocus sequence typing, and surface protein and pilus gene profiling. We show that capsular switching by horizontal gene transfer is not as frequent as previously suggested. Serotyping errors may be the main reason behind the overestimation of capsule switching, since phenotypic techniques are prone to errors of interpretation. The identified putative capsular transformants involved the acquisition of the entire capsular locus and were not restricted to the serotype-specific central genes, the previously suggested main mechanism underlying capsular switching. Our data, while questioning the frequency of capsular switching, provide clear evidence for in vivo capsular transformation in S. agalactiae, which may be of critical importance in planning future vaccination strategies against this pathogen. PMID:20023016

Plasmid transferability of KPC into a virulent K2 serotype Klebsiella pneumoniae.

Science.gov (United States)

Siu, Leung-Kei Kristopher; Huang, David B; Chiang, Tom

2014-03-31

KPC-producing carbapenem-resistant Klebsiella pneumoniae (CRKP) infections are associated with high mortality; however, their virulence determinants are not well defined. We investigated the virulence and plasmid transferability among KPC-containing K. pneumoniae isolates. KPC-2 and -3 were successfully conjugated and retained by a virulent K2 K. pneumoniae recipient isolate. Antimicrobial susceptibility testing showed KPC-2 and -3 donor strains were resistant to more than four classes of antibiotics while the K2 isolate was only initially resistant to ampicillin. After conjugation of KPC-2 and -3, the K2 K. pneumoniae transconjugants became resistant to all beta-lactams. Additionally, the KPC K2 K. pneumoniae transconjugants continued to retain its high serum resistance and murine lethality. Conjugation and retainment of KPC by virulent K2 K. pneumoniae and the ability of the tranconjugants to maintain its high serum resistance and murine lethality after conjugation was demonstrated in this study. These findings are concerning for the potential of KPC-like genes to disseminate among virulent K. pneumoniae isolates.

[Increasing incidence of community-acquired pneumonia caused by atypical microorganisms].

Science.gov (United States)

Tazón-Varela, M A; Alonso-Valle, H; Muñoz-Cacho, P; Gallo-Terán, J; Piris-García, X; Pérez-Mier, L A

2017-09-01

Knowing the most common microorganisms in our environment can help us to make proper empirical treatment decisions. The aim is to identify those microorganisms causing community-acquired pneumonia. An observational, descriptive and prospective study was conducted, including patients over 14 years with a clinical and radiographic diagnosis of community-acquired pneumonia during a 383 consecutive day period. A record was made of sociodemographic variables, personal history, prognostic severity scales, progress, and pathogenic agents. The aetiological diagnosis was made using blood cultures, detection of Streptococcus pneumoniae and Legionella pneumophila urinary antigens, sputum culture, influenza virus and Streptococcus pyogenes detection. Categorical variables are presented as absolute values and percentages, and continuous variables as their means and standard deviations. Of the 287 patients included in the study (42% women, mean age 66±22 years), 10.45% died and 70% required hospital admission. An aetiological diagnosis was achieved in 43 patients (14.98%), with 16 microorganisms found in 59 positive samples. The most frequently isolated pathogen was Streptococcus pneumonia (24/59, 41%), followed by gram-negative enteric bacilli, Klebsiella pneumonia, Escherichia coli, Serratia marcescens and Enterobacter cloacae isolated in 20% of the samples (12/59), influenza virus (5/59, 9%), methicillin-resistant Staphylococcus aureus (3/59, 5%), Pseudomonas aeruginosa (2/59, 3%), Moraxella catarrhalis (2/59, 3%), Legionella pneumophila (2/59, 3%), and Haemophilus influenza (2/59, 3%). Polymicrobial infections accounted for 14% (8/59). A high percentage of atypical microorganisms causing community-acquired pneumonia were found. Copyright © 2016 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España, S.L.U. All rights reserved.

Quantitative determination of pneumococcal capsular polysaccharide serotype 14 using a modification of phenol-sulfuric acid method.

Science.gov (United States)

Cuesta, Gabriela; Suarez, Norma; Bessio, Maria I; Ferreira, Fernando; Massaldi, Hugo

2003-01-01

The capsular polysaccharide of Streptococcus pneumoniae, serotype 14, is part of every pneumococcal vaccine presently in the market or under development. A strategy for the quantitative determination of this polysaccharide by the phenol-sulfuric acid method is described. The modality of acid addition is shown to be the critical step for obtaining reproducible test results between different technicians. Raising the incubation temperature above 80 degrees C increased the consistency of the method by more than 60% regardless of the acid addition modality, but at the expense of some loss of sensitivity. Incubation at 110 degrees C was found necessary to obtain reproducible results within 3% for this technique, which was used to follow the enrichment of the polysaccharide during the last steps of purification. A model mixture of the component polysaccharide sugars provided an adequate and economic standard to construct the calibration curve for this assay, with absorbance reading either in the reaction tubes or in a microplate. A similar procedure may be applied to the determination of other bacterial polysaccharides as well.

Prevalence of mef and ermB genes in invasive pediatric erythromycin-resistant Streptococcus pneumoniae isolates from Argentina Prevalencia de los genes mef y ermB en aislamientos invasivos de Streptococcus pneumoniae resistentes a eritromicina recuperados de pacientes pediátricos en Argentina

Directory of Open Access Journals (Sweden)

A. Corso

2009-03-01

Full Text Available During the period 1993-2001, a total of 1,499 pneumococci isolates were recovered through the Argentinean surveillance of Streptococcus pneumoniae causing invasive disease in children under 6 years of age, 3.5% of which were erythromycin resistant. Among the 50 erythromycin-resistant strains available, 58% (n=29 harbored mefA/E genes (15 mefA, 30%; and 14 mefE, 28%, 34% (n=17 ermB, and 6% (n=3 both mefA/E plus ermB genes, while one isolate was negative for all the acquired genes studied. The England14-9 (42%, Poland6B-20 (20% and Spain9v-3 (16% clones were responsible for the emergence of pneumococcal macrolide resistance in pediatric population from Argentina.En el marco del programa de vigilancia regional SIREVA, se analizaron 1499 aislamientos de Streptococcus pneumoniae causantes de enfermedad invasiva en menores de 6 años, recuperados entre 1993 y 2001. Se detectó un 3,5% de resistencia a eritromicina. De los 50 aislamientos resistentes a eritromicina que pudieron ser estudiados, el 58% (n=29 tenían los genes mefA/E (15 mefA, 30% y 14 mefE, 28%, el 34% (n=17 el gen ermB y el 6% (n=3 la combinación de genes mefA/E y ermB. Sólo un aislamiento fue negativo para todos los genes analizados. Los clones internacionales England14-9, Poland6B-20 y Spain9v-3 representaron el 78% del total de aislamientos resistentes (42, 20 y 16%, respectivamente y se consideraron los responsables de la emergencia de la resistencia a macrólidos entre los neumococos que afectan a la población pediátrica de Argentina.

Prevalência de sorotipos e resistência antimicrobiana de cepas invasivas do Streptococcus pneumoniae

Directory of Open Access Journals (Sweden)

Mantese Orlando C.

2003-01-01

Full Text Available OBJETIVO: Avaliar o perfil de sorotipos e a susceptibilidade aos antimicrobianos de cepas de Streptococcus pneumoniae obtidas em espécimes clínicos de pacientes com doença invasiva, bem como suas implicações na formulação de vacinas pneumocócicas. MÉTODOS: Cepas de pneumococo isoladas no Laboratório de Análises Clínicas do Hospital de Clínicas da Universidade Federal de Uberlândia a partir de amostras clínicas de pacientes com doença invasiva foram identificadas e enviadas ao Instituto Adolfo Lutz em São Paulo para confirmação da identificação, sorotipagem e determinação da susceptibilidade aos antimicrobianos. RESULTADOS: De abril de 1999 a março de 2003, foram isoladas 148 cepas invasivas de pneumococo, sendo 84 (56,7% provenientes de pacientes do sexo masculino. A idade variou de um dia a 88,83 anos, com média de 21,33+25,82 anos e mediana de 4,42 anos. Os diagnósticos clínicos mais comuns foram pneumonia (91 casos; 61,4%, meningite (32 casos; 21,6% e bacteremia sem foco evidente (15 casos; 10,1%. As principais fontes de recuperação foram sangue (76 amostras; 51,3%, líquido pleural (39; 26,3% e liquor (30; 20,2%. No total, foram identificados 23 diferentes sorotipos entre 143 amostras testadas, sendo os mais comuns os seguintes: 14, 3, 1, 5, 6A, 6B e 18C. Dentre 30 (20,2% cepas oxacilina-resistentes, 23 (15,5% confirmaram a resistência à penicilina (12,8% com nível intermediário e 2,7%, com nível pleno, que esteve restrita aos sorotipos 14, 23F, 19A e 6B, predominando em indivíduos com até dois anos de idade (p = 0,0008. Foi detectada susceptibilidade diminuída ao cotrimoxazol (63,4%, à eritromicina (8,3%, à clindamicina (8,7% e à ofloxacina (0,8%. A resistência à cefotaxima foi detectada em três das 30 cepas testadas (2% das 148, todas elas com resistência confirmada à penicilina. Não foi observada resistência a cloranfenicol, rifampicina ou vancomicina. CONCLUSÕES: A resistência �

Age-dependent prevalence of nasopharyngeal carriage of streptococcus pneumoniae before conjugate vaccine introduction: a prediction model based on a meta-analysis.

Directory of Open Access Journals (Sweden)

Olivier Le Polain de Waroux

Full Text Available INTRODUCTION: Data on the prevalence of nasopharyngeal carriage of S.pneumoniae in all age groups are important to help predict the impact of introducing pneumococcal conjugate vaccines (PCV into routine infant immunization, given the important indirect effect of the vaccine. Yet most carriage studies are limited to children under five years of age. We here explore the association between carriage prevalence and serotype distribution in children aged ≥5 years and in adults compared to children. METHODS: We conducted a systematic review of studies providing carriage estimates across age groups in healthy populations not previously exposed to PCV, using MEDLINE and Embase. We used Bayesian linear meta-regression models to predict the overall carriage prevalence as well as the prevalence and distribution of vaccine and nonvaccine type (VT and NVT serotypes in older age groups as a function of that in <5 y olds. RESULTS: Twenty-nine studies compromising of 20,391 individuals were included in the analysis. In all studies nasopharyngeal carriage decreased with increasing age. We found a strong positive linear association between the carriage prevalence in pre-school childen (<5 y and both that in school aged children (5-17 y olds and in adults. The proportion of VT serotypes isolated from carriers was consistently lower in older age groups and on average about 73% that of children <5 y among 5-17 y olds and adults respectively. We provide a prediction model to infer the carriage prevalence and serotype distribution in 5-17 y olds and adults as a function of that in children <5 years of age. CONCLUSION: Such predictions are helpful for assessing the potential population-wide effects of vaccination programmes, e.g. via transmission models, and thus assist in the design of future pneumococcal conjugate vaccination strategies.

Telithromycin resistance in Streptococcus pneumoniae is conferred by a deletion in the leader sequence of erm(B) that increases rRNA methylation

DEFF Research Database (Denmark)

Wolter, Nicole; Smith, Anthony M; Farrell, David J

2008-01-01

A telithromycin-resistant clinical isolate of Streptococcus pneumoniae (strain P1501016) has been found to contain a version of erm(B) that is altered by a 136-bp deletion in the leader sequence. By allele replacement mutagenesis, a second strain of S. pneumoniae (PC13) with a wild-type erm(B) gene...... was transformed to the telithromycin-resistant phenotype by introduction of the mutant erm(B) gene. Whereas the wild-type PC13 strain showed slight telithromycin resistance only after induction by erythromycin (telithromycin MIC increased from 0.06 to 0.5 microg/ml), the transformed PC13 strain is constitutively...... resistant (MIC of 16 mug/ml). Expression of erm(B) was quantified by real-time reverse transcription-PCR in the presence of erythromycin or telithromycin; erm(B) expression was significantly higher in the transformed PC13 strain than the wild-type strain. Furthermore, the transformed strain had...

Antimicrobial activity of innate immune molecules against Streptococcus pneumoniae, Moraxella catarrhalis and nontypeable Haemophilus influenzae

Directory of Open Access Journals (Sweden)

Teufert Karen

2004-05-01

Full Text Available Abstract Background Despite its direct connection to the nasopharynx which harbors otitis media pathogens as part of its normal flora, the middle ear cavity is kept free of these bacteria by as yet unknown mechanisms. Respiratory mucosal epithelia, including those of the middle ear and eustachian tube, secrete antimicrobial effectors including lysozyme, lactoferrin and β defensins-1 and -2. To elucidate the role of these innate immune molecules in the normal defense and maintenance of sterility of respiratory mucosa such as that of the middle ear, we assessed their effect on the respiratory pathogens nontypeable Haemophilus influenzae (NTHi 12, Moraxella catarrhalis 035E, and Streptococcus pneumoniae 3, and 6B. Methods Two assay methods, the radial assay and the liquid broth assay, were employed for testing the antimicrobial activity of the molecules. This was done in order to minimize the possibility that the observed effects were artifacts of any single assay system employed. Also, transmission electron microscopy (TEM was employed to evaluate the effect of antimicrobial innate immune molecules on OM pathogens. For the statistical analysis of the data, Student's t-test was performed. Results Results of the radial diffusion assay showed that β defensin-2 was active against all four OM pathogens tested, while treatment with β defensin-1 appeared to only affect M. catarrhalis. The radial assay results also showed that lysozyme was quite effective against S. pneumoniae 3 and 6B and was partially bacteriostatic/bactericidal against M. catarrhalis. Lysozyme however, appeared not to affect the growth of NTHi. Thus, lysozyme seems to have a more pronounced impact on the growth of the Gram-positive S. pneumoniae as compared to that of Gram-negative pathogens. Lactoferrin on the other hand, enhanced the growth of the bacteria tested. The results of the radial assays were confirmed using liquid broth assays for antimicrobial activity, and showed that

Streptococcus iniae cpsG alters capsular carbohydrate composition and is a cause of serotype switching in vaccinated fish.

Science.gov (United States)

Heath, Candice; Gillen, Christine M; Chrysanthopoulos, Panagiotis; Walker, Mark J; Barnes, Andrew C

2016-09-25

Streptococcus iniae causes septicaemia and meningitis in marine and freshwater fish wherever they are farmed in warm-temperate and tropical regions. Although serotype specific, vaccination with bacterins (killed bacterial cultures) is largely successful and vaccine failure occurs only occasionally through emergence of new capsular serotypes. Previously we showed that mutations in vaccine escapes are restricted to a limited repertoire of genes within the 20-gene capsular polysaccharide (cps) operon. cpsG, a putative UDP-galactose 4-epimerase, has three sequence types based on the insertion or deletion of the three amino acids leucine, serine and lysine in the substrate binding site of the protein. To elucidate the role of cpsG in capsular polysaccharide (CPS) biosynthesis and capsular composition, we first prepared isogenic knockout and complemented mutants of cpsG by allelic exchange mutagenesis. Deletion of cpsG resulted in changes to colony morphology and cell buoyant density, and also significantly decreased galactose content relative to glucose in the capsular polysaccharide as determined by GC-MS, consistent with epimerase activity of CpsG. There was also a metabolic penalty of cpsG knockout revealed by slower growth in complex media, and reduced proliferation in whole fish blood. Moreover, whilst antibodies raised in fish against the wild type cross-reacted in whole cell and cps ELISA, they did not cross-opsonise the mutant in a peripheral blood neutrophil opsonisation assay, consistent with reported vaccine escape. We have shown here that mutation in cpsG results in altered CPS composition and this in turn results in poor cross-opsonisation that explains some of the historic vaccination failure on fish farms in Australia. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Differentiation of highly virulent strains of Streptococcus suis serotype 2 according to glutamate dehydrogenase electrophoretic and sequence type.

Science.gov (United States)

Kutz, Russell; Okwumabua, Ogi

2008-10-01

The glutamate dehydrogenase (GDH) enzymes of 19 Streptococcus suis serotype 2 strains, consisting of 18 swine isolates and 1 human clinical isolate from a geographically varied collection, were analyzed by activity staining on a nondenaturing gel. All seven (100%) of the highly virulent strains tested produced an electrophoretic type (ET) distinct from those of moderately virulent and nonvirulent strains. By PCR and nucleotide sequence determination, the gdh genes of the 19 strains and of 2 highly virulent strains involved in recent Chinese outbreaks yielded a 1,820-bp fragment containing an open reading frame of 1,344 nucleotides, which encodes a protein of 448 amino acid residues with a calculated molecular mass of approximately 49 kDa. The nucleotide sequences contained base pair differences, but most were silent. Cluster analysis of the deduced amino acid sequences separated the isolates into three groups. Group I (ETI) consisted of the seven highly virulent isolates and the two Chinese outbreak strains, containing Ala(299)-to-Ser, Glu(305)-to-Lys, and Glu(330)-to-Lys amino acid substitutions compared with groups II and III (ETII). Groups II and III consisted of moderately virulent and nonvirulent strains, which are separated from each other by Tyr(72)-to-Asp and Thr(296)-to-Ala substitutions. Gene exchange studies resulted in the change of ETI to ETII and vice versa. A spectrophotometric activity assay for GDH did not show significant differences between the groups. These results suggest that the GDH ETs and sequence types may serve as useful markers in predicting the pathogenic behavior of strains of this serotype and that the molecular basis for the observed differences in the ETs was amino acid substitutions and not deletion, insertion, or processing uniqueness.

LocZ Is a New Cell Division Protein Involved in Proper Septum Placement in Streptococcus pneumoniae

Science.gov (United States)

Holečková, Nela; Molle, Virginie; Buriánková, Karolína; Benada, Oldřich; Kofroňová, Olga; Ulrych, Aleš; Branny, Pavel

2014-01-01

ABSTRACT How bacteria control proper septum placement at midcell, to guarantee the generation of identical daughter cells, is still largely unknown. Although different systems involved in the selection of the division site have been described in selected species, these do not appear to be widely conserved. Here, we report that LocZ (Spr0334), a newly identified cell division protein, is involved in proper septum placement in Streptococcus pneumoniae. We show that locZ is not essential but that its deletion results in cell division defects and shape deformation, causing cells to divide asymmetrically and generate unequally sized, occasionally anucleated, daughter cells. LocZ has a unique localization profile. It arrives early at midcell, before FtsZ and FtsA, and leaves the septum early, apparently moving along with the equatorial rings that mark the future division sites. Consistently, cells lacking LocZ also show misplacement of the Z-ring, suggesting that it could act as a positive regulator to determine septum placement. LocZ was identified as a substrate of the Ser/Thr protein kinase StkP, which regulates cell division in S. pneumoniae. Interestingly, homologues of LocZ are found only in streptococci, lactococci, and enterococci, indicating that this close phylogenetically related group of bacteria evolved a specific solution to spatially regulate cell division. PMID:25550321

The novel species Streptococcus tigurinus and its association with oral infection.

Science.gov (United States)

Zbinden, Andrea; Bostanci, Nagihan; Belibasakis, Georgios N

2015-01-01

Streptococcus tigurinus is a novel species of viridans streptococci, shown to cause severe invasive infections such as infective endocarditis, spondylodiscitis and meningitis. S. tigurinus belongs to the Streptococcus mitis group and is most closely related to Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus pseudopneumoniae and Streptococcus infantis. The presence of S. tigurinus in the human oral cavity has been documented, including in patients with periodontal disease. This review addresses the available scientific knowledge on S. tigurinus and its association with closely related streptococci, and discusses its putative involvement in common oral infections. While there is as yet no strong evidence on the involvement of S. tigurinus with oral infections, its presence in the oral cavity and its association with endocarditis warrants special attention for a link between oral and systemic infection.

Host-pathogen Interaction at the Intestinal Mucosa Correlates With Zoonotic Potential of Streptococcus suis

DEFF Research Database (Denmark)

Ferrando, Maria Laura; de Greeff, Astrid; van Rooijen, Willemien J. M.

2015-01-01

Background. Streptococcus suis has emerged as an important cause of bacterial meningitis in adults. The ingestion of undercooked pork is a risk factor for human S. suis serotype 2 (SS2) infection. Here we provide experimental evidence indicating that the gastrointestinal tract is an entry site of...... be considered a food-borne pathogen. S. suis interaction with human and pig IEC correlates with S. suis serotype and genotype, which can explain the zoonotic potential of SS2....... of SS2 infection. Methods. We developed a noninvasive in vivo model to study oral SS2 infection in piglets. We compared in vitro interaction of S. suis with human and porcine intestinal epithelial cells (IEC). Results. Two out of 15 piglets showed clinical symptoms compatible with S. suis infection 24......Background. Streptococcus suis has emerged as an important cause of bacterial meningitis in adults. The ingestion of undercooked pork is a risk factor for human S. suis serotype 2 (SS2) infection. Here we provide experimental evidence indicating that the gastrointestinal tract is an entry site...

Prevalence of penicillin and erythromycin resistance among invasive Streptococcus pneumoniae isolates reported by laboratories in the southern and eastern Mediterranean region.

Science.gov (United States)

Borg, M A; Tiemersma, E; Scicluna, E; van de Sande-Bruinsma, N; de Kraker, M; Monen, J; Grundmann, H

2009-03-01

Information about the epidemiology of resistance in Streptococcus pneumoniae within southern and eastern countries of the Mediterranean region is incomplete, as reports have been sporadic and difficult to compare. Over a 36-month period, from 2003 to 2005, the ARMed project collected 1298 susceptibility test results of invasive isolates of S. pneumoniae from blood and spinal fluid cultures routinely processed within 59 participating laboratories situated in Algeria, Cyprus, Egypt, Jordan, Lebanon, Malta, Morocco, Tunisia and Turkey. Overall, 26% (335) of isolates were reported as non-susceptible to penicillin, with the highest proportions being reported from Algeria (44%) and Lebanon (40%). During the same time period, the highest proportions of pneumococci that were not susceptible to erythromycin were reported from Malta (46%) and Tunisia (39%). Proportions of dual non-susceptibility in excess of 5% were found in laboratories in Algeria, Tunisia, Lebanon, Jordan and Turkey. ARMed data on the antimicrobial resistance epidemiology of S. pneumoniae in the southern and eastern Mediterranean region provided evidence of high rates of resistance, especially to penicillin. This evidence calls for a greater focus on the identification of relevant drivers of resistance and on the implemention of effective practices in order to address the problem of resistence.